WO2022045366A1 - Method for treating facioscapulohumeral muscular dystrophy (fshd) by targeting dux4 gene - Google Patents

Method for treating facioscapulohumeral muscular dystrophy (fshd) by targeting dux4 gene Download PDF

Info

Publication number
WO2022045366A1
WO2022045366A1 PCT/JP2021/031973 JP2021031973W WO2022045366A1 WO 2022045366 A1 WO2022045366 A1 WO 2022045366A1 JP 2021031973 W JP2021031973 W JP 2021031973W WO 2022045366 A1 WO2022045366 A1 WO 2022045366A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
vector
base sequence
polynucleotide
sequence encoding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/JP2021/031973
Other languages
English (en)
French (fr)
Inventor
Tetsuya Yamagata
Yuanbo QIN
Rebecca WINDMUELLER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Modalis Therapeutics Corp
Original Assignee
Modalis Therapeutics Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Modalis Therapeutics Corp filed Critical Modalis Therapeutics Corp
Priority to US18/043,124 priority Critical patent/US20230323456A1/en
Priority to JP2023513722A priority patent/JP7736329B2/ja
Priority to EP21861786.8A priority patent/EP4204556A4/en
Priority to CN202180050873.1A priority patent/CN116194578A/zh
Publication of WO2022045366A1 publication Critical patent/WO2022045366A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4705Regulators; Modulating activity stimulating, promoting or activating activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • C12N15/861Adenoviral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/43Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16041Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present invention relates to methods for treating facioscapulohumeral muscular dystrophy (FSHD) by targeting the human Double homeobox, 4 (DUX4) gene, and the like. More particularly, the present invention relates to methods and agents for treating or preventing FSHD by suppressing expression of human DUX4 gene by using a guide RNA targeting a particular sequence of human DUX4 gene and a fusion protein of a transcription inhibitor and a CRISPR effector protein, and the like.
  • FSHD facioscapulohumeral muscular dystrophy
  • Facioscapulohumeral muscular dystrophy is one of the most prevalent myopathies, affecting males and females of all ages.
  • FSHD1 is attributed to the shortened repeats (10 repeats or less) of the genomic sequence (D4Z4) of telomere (4q35) on chromosome 4
  • FSHD2 is attributed to a complex factor other than FSHD1.
  • DNA is highly methylated in the normal D4Z4 repeat sequence.
  • FSHD1 and FSHD2 the chromatin structure changes accompanying DNA hypomethylation due to the respective genomic abnormalities, and a gene (DUX4 transcription factor) that is not originally expressed in muscle (progenitor) cells is activated. While DUX4 protein is important in the developmental stage, it is not generally present in mature cells, and DUX4 activation in FSHD skeletal muscle is known to cause cell death.
  • Prevention of the activation of DUX4 is expected to lead to the treatment of FSHD, and as a part thereof, attempts have been made to reduce the amount of DUX4 mRNA by using the gene editing technology (non-patent document 1).
  • NPL 1 Mol Ther. 2016 Mar; 24(3): 527-535
  • NPL 2 Dominguez A. et al., Nat Rev Mol Cell Biol. 2016 Jan; 17(1): 5-15
  • NPL 3 Liao H. et al., Cell. 2017 Dec 14; 171(7): 1495-507
  • FSHD Facioscapulohumeral muscular dystrophy
  • human DUX4 gene (Gene ID: 100288687) can be strongly suppressed by using a guide RNA targeting a particular sequence of human DUX4 gene and a fusion protein of a transcription repressor and a nuclease-deficient CRISPR effector protein.
  • the present inventors have found that the expression of human DUX4 gene can be strongly suppressed by a single AAV vector carrying a base sequence encoding the fusion protein and a base sequence encoding the guide RNA, using a compact nuclease-deficient CRISPR effector protein and a compact transcription repressor.
  • a polynucleotide comprising the following base sequences: (a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription repressor, and (b) a base sequence encoding a guide RNA targeting a continuous region set forth in SEQ ID NO: 2, 3, 4, 20, 51, 68, 138, 142, 146, 156, 158, or 161 in the expression regulatory region of human DUX4 gene.
  • the polynucleotide of [1], wherein the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 2, 3, 4, 20, 51, 68, 138, 142, 146, 156, 158, or 161, or the base sequence set forth in SEQ ID NO: 2, 3, 4, 20, 51, 68, 138, 142, 146, 156, 158, or 161 in which 1 to 3 bases are deleted, substituted, inserted, and/or added.
  • [4] The polynucleotide of any of [1] to [3], wherein the transcriptional repressor is selected from the group KRAB, MeCP2, SIN3A, HDT1, MBD2B, NIPP1, and HP1A.
  • the polynucleotide of [9] wherein the promoter sequence for the base sequence encoding the guide RNA is U6 promoter.
  • a vector comprising a polynucleotide of any of [1] to [12].
  • AAV adeno-associated virus
  • a pharmaceutical composition comprising a polynucleotide of any of [1] to [12] or a vector of any of [13] to [17].
  • the expression of the human DUX4 gene can be suppressed and, consequently, the present invention is expected to be able to treat FSHD.
  • FIG. 1 shows the location of the targeted genome regions relative to human DUX4 gene.
  • FIG. 2 shows the evaluation results of an expression suppressing action on human DUX4 gene in two lymphoblast cell lines (LCLs; GM16343 LCL and GM16414 LCL) derived from FSHD patients by using sgRNA containing crRNA encoded by the targeting sequence shown in SEQ ID NOs: 1 to 76.
  • the horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence, and the vertical axis shows the ratio of the expression level of DUX4 gene when using each sgRNA to that when using control sgRNA as 1.
  • FIG. 3A Fig.
  • FIG. 3A shows the evaluation results of an expression suppressing action on human DUX4 gene in GM16343 LCL by using sgRNA containing crRNA encoded by the selected 27 targeting sequences.
  • the horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence, and the vertical axis shows the ratio of the expression level of DUX4 gene when using each sgRNA to that when using control sgRNA as 1.
  • Fig. 3B shows the evaluation results of an expression suppressing action on human DUX4 gene in GM16414 LCL by using sgRNA containing crRNA encoded by the selected 27 targeting sequences.
  • the horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence, and the vertical axis shows the ratio of the expression level of DUX4 gene when using each sgRNA to that when using control sgRNA as 1.
  • Fig. 4 shows the evaluation results of quantification of DUX4 and FSHD biomarkers TRIM43, MBD3L2 and ZSCAN4 from the best 6 sgRNAs identified in validation experiment using FSHD patient derived LCLs.
  • the horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence, and the vertical axis shows the ratio of the expression level of DUX4 gene when using each sgRNA to that when using control sgRNA as 1.
  • FIG. 5 Fig.
  • FIG. 5 shows the location of the targeted genome regions relative to human DUX4 gene.
  • Fig. 6 shows the evaluation results of an expression suppressing action on human DUX4 gene in one lymphoblast cell line (LCLs; GM16343 LCL) derived from FSHD patients by using sgRNA containing crRNA encoded by the targeting sequence shown in SEQ ID NOs: 104 to 188.
  • the horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence
  • the vertical axis shows the ratio of the expression level of DUX4 gene when using each sgRNA to that when using control sgRNA as 1.
  • FIG. 7 Fig.
  • the horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence, and the vertical axis shows the ratio of the expression level of DUX4 gene when using each sgRNA to that when using control sgRNA as 1.
  • the present invention provides a polynucleotide comprising the following base sequences (hereinafter sometimes to be also referred to as “the polynucleotide of the present invention”): (a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription repressor, and (b) a base sequence encoding a guide RNA targeting a continuous region set forth in SEQ ID NO: 2, 3, 4, 20, 51, 68, 138, 142, 146, 156, 158, or 161 in the expression regulatory region of human DUX4 gene.
  • the polynucleotide of the present invention is introduced into a desired cell and transcribed to produce a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription repressor, and a guide RNA targeting a particular region of the expression regulatory region of the human DUX4 gene.
  • fusion protein and guide RNA form a complex (hereinafter the complex is sometimes referred to as “ribonucleoprotein; RNP”) and cooperatively act on the aforementioned particular region, thus suppressing transcription of the human DUX4 gene.
  • the expression of the human DUX4 gene can be suppressed by, for example, not less than about 40%, not less than about 50%, not less than about 60%, not less than about 70%, not less than about 75%, not less than about 80%, not less than about 85%, not less than about 90%, not less than about 95%, or about 100%.
  • the expression regulatory region of human Double homeobox, 4 (DUX4) gene means any region in which the expression of human DUX4 gene can be suppressed by binding RNP to that region. That is, the expression regulatory region of human DUX4 gene may exist in any region such as the promoter region, enhancer region, intron, and exon of the human DUX4 gene, as long as the expression of the human DUX4 gene is suppressed by the binding of RNP. In the present specification, when the expression regulatory region is shown by the particular sequence, the expression regulatory region includes both the sense strand sequence and the antisense strand sequence conceptually.
  • a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription repressor is recruited by a guide RNA into a particular region in the expression regulatory region of the human DUX4 gene.
  • the “guide RNA targeting ...” means a “guide RNA recruiting a fusion protein into ...”.
  • the “guide RNA (to be also referred to as ‘gRNA’)” is an RNA comprising a genome specific CRISPR-RNA (to be referred to as “crRNA”).
  • crRNA is an RNA that binds to a complementary sequence of a targeting sequence (described later).
  • the “guide RNA” refers to an RNA comprising an RNA consisting of crRNA and a specific sequence attached to its 5’-terminal (for example, an RNA sequence set forth in SEQ ID NO: 80 in the case of FnCpf 1).
  • the “guide RNA” refers to chimera RNA (to be referred to as “single guide RNA (sgRNA)”) comprising crRNA and trans-activating crRNA attached to its 3’-terminal (to be referred to as “tracrRNA”) (see, for example, Zhang F. et al., Hum Mol Genet. 2014 Sep 15; 23(R1): R40-6 and Zetsche B. et al., Cell. 2015 Oct 22; 163(3): 759-71, which are incorporated herein by reference in their entireties).
  • sgRNA single guide RNA
  • a sequence complementary to the sequence to which crRNA is bound in the expression regulatory region of the human DUX4 gene is referred to as a “targeting sequence”. That is, in the present specification, the “targeting sequence” is a DNA sequence present in the expression regulatory region of the human DUX4 gene and adjacent to PAM (protospacer adjacent motif). PAM is adjacent to the 5’-side of the targeting sequence when Cpf1 is used as the CRISPR effector protein. PAM is adjacent to the 3’-side of the targeting sequence when Cas9 is used as the CRISPR effector protein.
  • the targeting sequence may be present on either the sense strand sequence side or the antisense strand sequence side of the expression regulatory region of the human DUX4 gene (see, for example, the aforementioned Zhang F. et al., Hum Mol Genet. 2014 Sep 15; 23(R1): R40-6 and Zetsche B. et al., Cell. 2015 Oct 22; 163(3): 759-71, which are incorporated herein by reference in their entireties).
  • CRISPR effector protein In the present invention, using a nuclease-deficient CRISPR effector protein, a transcriptional repressor fused thereto is recruited to the expression regulatory region of the human DUX4 gene.
  • the nuclease-deficient CRISPR effector protein (hereinafter to be simply referred to as “CRISPR effector protein”) to be used in the present invention is not particularly limited as long as it forms a complex with gRNA and is recruited to the expression regulatory region of the human DUX4 gene.
  • nuclease-deficient Cas9 (hereinafter sometimes to be also referred to as “dCas9”) or nuclease-deficient Cpf1 (hereinafter sometimes to be also referred to as “dCpf1”) can be included.
  • dCas9 nuclease-deficient Cas9
  • dCpf1 nuclease-deficient Cpf1
  • dCas9 examples include, but are not limited to, a nuclease-deficient variant of Streptococcus pyogenes-derived Cas9 (SpCas9; PAM sequence: NGG (N is A, G, T or C. hereinafter the same)), Streptococcus thermophilus-derived Cas9 (StCas9; PAM sequence: NNAGAAW (W is A or T.
  • Neisseria meningitidis-derived Cas9 Neisseria meningitidis-derived Cas9 (NmCas9; PAM sequence: NNNNGATT), or Staphylococcus aureus-derived Cas9 (SaCas9; PAM sequence: NNGRRT (R is A or G. hereinafter the same)) and the like (see, for example, Nishimasu et al., Cell. 2014 Feb 27; 156(5): 935-49, Esvelt KM et al., Nat Methods. 2013 Nov; 10(11):1116-21, Zhang Y. Mol Cell. 2015 Oct 15; 60(2):242-55, and Friedland AE et al., Genome Biol.
  • dSaCas9 a double mutant in which the 10th Asp residue is converted to Ala residue and the 580th Asn residue is converted to Ala residue (SEQ ID NO: 81), or a double mutant in which the 10th Asp residue is converted to Ala residue and the 557th His residue is converted to Ala residue (SEQ ID NO: 82) (hereinafter any of these double mutants is sometimes to be referred to as “dSaCas9”) can be used (see, for example, the aforementioned Friedland AE et al., Genome Biol. 2015, which is incorporated herein by reference in its entirety).
  • dCas9 a variant obtained by modifying a part of the amino acid sequence of the aforementioned dCas9, which forms a complex with gRNA and is recruited to the expression regulatory region of the human DUX4 gene, may also be used.
  • examples of such variants include a truncated variant with a partly deleted amino acid sequence.
  • variants disclosed in WO2019/235627 and WO2020/085441, which are incorporated herein by reference in their entireties can be used.
  • dSaCas9 obtained by deleting the 721st to 745th amino acids from dSaCas9 that is a double mutant in which the 10th Asp residue is converted to Ala residue and the 580th Asn residue is converted to Ala residue (SEQ ID NO: 83), or dSaCas9 in which the deleted part is substituted by a peptide linker (e.g., one in which the deleted part is substituted by GGSGGS linker (SEQ ID NO: 84) is set forth in SEQ ID NO: 85, and one in which the deleted part is substituted by SGGGS linker (SEQ ID NO: 86) is set forth in SEQ ID NO: 87, etc.) (hereinafter any of these double mutants is sometimes to be referred to as “dSaCas9[-25]”), or dSaCas9 obtained by deleting the 482nd to 648th amino acids from dSaCas9 that is the aforementioned double
  • dCpf1 examples include, but are not limited to, a nuclease-deficient variant of Francisella novicida-derived Cpf1 (FnCpf1; PAM sequence: NTT), Acidaminococcus sp.-derived Cpf1 (AsCpf1; PAM sequence: NTTT), or Lachnospiraceae bacterium-derived Cpf1 (LbCpf1; PAM sequence: NTTT) and the like (see, for example, Zetsche B. et al., Cell. 2015 Oct 22; 163(3):759-71, Yamano T et al., Cell.
  • FnCpf1 Francisella novicida-derived Cpf1
  • AsCpf1 Acidaminococcus sp.-derived Cpf1
  • LbCpf1 Lachnospiraceae bacterium-derived Cpf1
  • dCpf1 a variant obtained by modifying a part of the amino acid sequence of the aforementioned dCpf1, which forms a complex with gRNA and is recruited to the expression regulatory region of the human DUX4 gene, may also be used.
  • dCas9 is used as the nuclease-deficient CRISPR effector protein.
  • the dCas9 is dSaCas9, and, in a particular embodiment, the dSaCas9 is dSaCas9[-25].
  • a polynucleotide comprising a base sequence encoding a CRISPR effector protein can be cloned by, for example, synthesizing an oligoDNA primer covering a region encoding a desired part of the protein based on the cDNA sequence information thereof, and amplifying the polynucleotide by PCR method using total RNA or mRNA fraction prepared from the cells producing the protein as a template.
  • a polynucleotide comprising a base sequence encoding a nuclease-deficient CRISPR effector protein can be obtained by introducing a mutation into a nucleotide sequence encoding a cloned CRISPR effector protein by a known site-directed mutagenesis method to convert the amino acid residues (e.g., 10th Asp residue, 557th His residue, and 580th Asn residue in the case of SaCas9; 917th Asp residue and 1006th Glu residue in the case of FnCpf1, and the like can be included, but are not limited to these) at a site important for DNA cleavage activity to other amino acids.
  • amino acid residues e.g., 10th Asp residue, 557th His residue, and 580th Asn residue in the case of SaCas9; 917th Asp residue and 1006th Glu residue in the case of FnCpf1, and the like can be included, but are not limited to these
  • a polynucleotide comprising a base sequence encoding nuclease-deficient CRISPR effector protein can be obtained by chemical synthesis or a combination of chemical synthesis and PCR method or Gibson Assembly method, based on the cDNA sequence information thereof, and can also be further constructed as a base sequence that underwent codon optimization to give codons suitable for expression in human.
  • transcriptional repressor means a protein having the ability to repress gene transcription of human DUX4 gene or a peptide fragment retaining the function thereof.
  • the transcriptional repressor to be used in the present invention is not particularly limited as long as it can repress expression of human DUX4 gene.
  • KRAB Kruppel-associated box
  • MBD2B v-ErbA
  • SID chain state of SID (SID4X)
  • MBD2, MBD3, DNMT family e.g., DNMT1, DNMT3A, DNMT3B
  • Rb MeCP2, ROM2, LSD1, AtHD2A, SET1, HDAC11, SETD8, EZH2, SUV39H1, PHF19, SALI, NUE, SUVR4, KYP, DIM5, HDAC8, SIRT3, SIRT6, MESOLO4, SET8, HST2, COBB, SET-TAF1B, NCOR, SIN3A, HDT1, NIPP1, HP1A, ERF repressor domain (ERD), and variants thereof having transcriptional repression ability, fusions thereof and the like.
  • KRAB is used as the transcriptional repressor.
  • a polynucleotide comprising a base sequence encoding a transcriptional repressor can be constructed by chemical synthesis or a combination of chemical synthesis and PCR method or Gibson Assembly method. Furthermore, a polynucleotide comprising a base sequence encoding a transcriptional repressor can also be constructed as a codon-optimized DNA sequence to be codons suitable for expression in human.
  • a polynucleotide comprising a base sequence encoding a fusion protein of a transcriptional repressor and a nuclease-deficient CRISPR effector protein can be prepared by ligating a base sequence encoding the CRISPR effector protein to a base sequence encoding the transcriptional repressor directly or after adding a base sequence encoding a linker, NLS (nuclear localization signal)(for example, a base sequence set forth in SEQ ID NO: 90 or SEQ ID NO: 91), a tag and/or others.
  • NLS nuclear localization signal
  • the transcriptional repressor may be fused with either N-terminal or C-terminal of the nuclease-deficient CRISPR effector protein.
  • a linker with an amino acid number of about 2 to 50 can be used, and specific examples thereof include, but are not limited to, a G-S-G-S linker in which glycine (G) and serine (S) are alternately linked and the like.
  • the linker as the polynucleotide comprising a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, the base sequence set forth in SEQ ID NO: 92, which encodes SV40 NLS, dSaCas9 (e.g., D10A and N580A mutant), NLS and KRAB as a fused protein, can be used.
  • other base sequence see “(6) other base sequences” below
  • selection marker e.g., Puro
  • a fusion protein of nuclease-deficient CRISPR effector protein and transcription repressor can be recruited to the expression regulatory region of the human DUX4 gene by guide RNA.
  • guide RNA comprises crRNA, and the crRNA binds to a complementary sequence of the targeting sequence.
  • crRNA may not be completely complementary to the complementary sequence of the targeting sequence as long as the guide RNA can recruit the fusion protein to the target region, and may comprise a base sequence of the targeting sequence in which at least 1 to 3 bases are deleted, substituted, inserted and/or added.
  • the targeting sequence can be determined using a published gRNA design web site (CRISPR Design Tool, CRISPR direct, etc.).
  • CRISPR Design Tool CRISPR direct, etc.
  • candidate targeting sequences of about 20 nucleotides in length for which PAM (e.g., NNGRRT in the case of SaCas9) is adjacent to the 3’-side thereof are listed, and one having a small number of off-target sites in human genome from among these candidate targeting sequences can be used as the targeting sequence.
  • the base length of the targeting sequence is 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length.
  • bioinformatic tools such as Benchling (https://benchling.com), and COSMID (CRISPR Off-target Sites with Mismatches, Insertions, and Deletions) (Available on https://crispr.bme.gatech.edu on the internet). Using these, the similarity to the base sequence targeted by gRNA can be summarized.
  • the off-target site can be searched for by subjecting the target genome to Blast search with respect to 8 to 12 nucleotides on the 3’-side of the candidate targeting sequence (seed sequence with high discrimination ability of targeted nucleotide sequence).
  • the region of ”190,065,500-190,068,500” and the region of ”190,047,000-190,052,000” can be the expression regulatory region of the human DUX4 gene. Therefore, in one embodiment of the present invention, the targeting sequence can be 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length, in the regions of ”190,065,500-190,068,500” and ”190,047,000-190,052,000” existing in the GRCh38/hg38 of human chromosome 4 (Chr 4).
  • the targeting sequence can be 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length, in the regions of ”190,065,000-190,093,000” (D4Z4 repeat region) and ”190,173,000-190,176,000” (DUX4 gene) existing in the GRCh38/hg38 of human chromosome 4 (Chr 4).
  • a base sequence encoding crRNA may be the same base sequence as the targeting sequence.
  • the targeting sequence set forth in SEQ ID NO: 4 CCCTCCACCGGGCTGACCGGCC
  • crRNA transcribed from the sequence is CCCUCCACCGGGCUGACCGGCC (SEQ ID NO: 93) and is bound to GGCCGGTCAGCCCGGTGGAGGG (SEQ ID NO: 94), which is a sequence complementary to the base sequence set forth in SEQ ID NO: 4 and is present in the expression regulatory region of the human DUX4 gene.
  • a base sequence which is a targeting sequence in which at least 1 to 3 bases are deleted, substituted, inserted and/or added can be used as the base sequence encoding crRNA as long as guide RNA can recruit a fusion protein to the target region.
  • the base sequence set forth in SEQ ID NO: 2, 3, 4, 20, 51, 68, 138, 142, 146, 156, 158, or 161, or the base sequence set forth in SEQ ID NO: 2, 3, 4, 20, 51, 68, 138, 142, 146, 156, 158, or 161 in which 1 to 3 bases are deleted, substituted, inserted and/or added can be used.
  • a base sequence encoding gRNA can be designed as a DNA sequence encoding crRNA with particular RNA attached to the 5’-terminal.
  • RNA attached to the 5’-terminal of crRNA and a DNA sequence encoding said RNA can be appropriately selected by those of ordinary skill in the art according to the dCpf1 to be used.
  • a base sequence in which SEQ ID NO: 95; AATT TCTAC TGTT GTAGA T is attached to the 5’-side of the targeting sequence can be used as a base sequence encoding gRNA (when transcribed to RNA, the sequences of the underlined parts form base pairs to form a stem-loop structure).
  • the sequence to be added to the 5’-terminal may be a sequence generally used for various Cpf1 proteins in which at least 1 to 6 bases are deleted, substituted, inserted and/or added, as long as gRNA can recruit a fusion protein to the expression regulatory region after transcription.
  • a base sequence encoding gRNA can be designed as a DNA sequence in which a DNA sequence encoding known tracrRNA is linked to the 3’-terminal of a DNA sequence encoding crRNA.
  • tracrRNA and a DNA sequence encoding the tracrRNA can be appropriately selected by those of ordinary skill in the art according to the dCas9 to be used.
  • the base sequence set forth in SEQ ID NO: 96 is used as the DNA sequence encoding tracrRNA.
  • the DNA sequence encoding tracrRNA may be a base sequence encoding tracrRNA generally used for various Cas9 proteins in which at least 1 to 6 bases are deleted, substituted, inserted and/or added, as long as gRNA can recruit a fusion protein to the expression regulatory region after transcription.
  • a polynucleotide comprising a base sequence encoding gRNA designed in this way can be chemically synthesized using a known DNA synthesis method.
  • the polynucleotide of the present invention may comprise at least two different base sequences encoding a gRNA.
  • the polynucleotide can comprise at least two different base sequences encoding the guide RNA, wherein the at least two different base sequences are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 2, 3, 4, 8, 15, 17, 18, 20, 25, 31, 32, 33, 35, 39, 40, 42, 44, 50, 51, 52, 55, 57, 58, 59, 65, 67, 68, 113, 116, 135, 138, 142, 144, 146, 156, 158, 161, or 171, preferably are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 2, 3, 4, 20, 51, 68, 138, 142, 146, 156, 158, or 161.
  • a promoter sequence may be operably linked to the upstream of each of a base sequence encoding fusion protein of nuclease-deficient CRISPR effector protein and transcriptional repressor and/or a base sequence encoding gRNA.
  • the promoter to be possibly linked is not particularly limited as long as it shows a promoter activity in the target cell.
  • Examples of the promoter sequence possibly linked to the upstream of the base sequence encoding gRNA include, but are not limited to, U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, H1 promoter, and tRNA promoter, which are pol III promoters, and the like.
  • U6 promoter can be used as the promoter sequence for the base sequence encoding the guide RNA.
  • a single promoter sequence may be operably linked to the upstream of the two or more base sequences.
  • a promoter sequence may be operably linked to the upstream of each of the two or more base sequences, wherein the promoter sequence operably linked to each base sequence may be the same or different.
  • a ubiquitous promoter or neuron-specific promoter may be used.
  • the ubiquitous promoter include, but are not limited to, EF-1 ⁇ promoter, EFS promoter, CMV (cytomegalovirus) promoter, hTERT promoter, SR ⁇ promoter, SV40 promoter, LTR promoter, CAG promoter, RSV (Rous sarcoma virus) promoter, and the like.
  • EFS promoter, CMV promoter or CAG promoter can be used as the ubiquitous promoter.
  • neuron-specific promoter examples include, but are not limited to, neuron-specific enolase (NSE) promoter, human neurofilament light chain (NEFL) promoter.
  • NSE neuron-specific enolase
  • NEFL human neurofilament light chain
  • the aforementioned promoter may have any modification and/or alteration as long as it has promoter activity in the target cell.
  • U6 is used as a promoter for a base sequence encoding the guide RNA
  • CMV promoter can be used as the promoter sequence for the base sequence encoding the fusion protein.
  • polynucleotide of the present invention may further comprise known sequences such as Polyadenylation (polyA) signal, Kozak consensus sequence and the like besides those mentioned above for the purpose of improving the translation efficiency of mRNA produced by transcription of a base sequence encoding a fusion protein of nuclease-deficient CRISPR effector protein and transcription repressor.
  • Polyadenylation signal in the present invention may include hGH polyA, bGH polyA, 2x sNRP-1 polyA (see US7557197B2, which is incorporated herein by reference in its entirety), and so on.
  • the polynucleotide of the present invention may comprise a base sequence encoding a linker sequence, a base sequence encoding NLS and/or a base sequence encoding a tag.
  • the polynucleotide of the present invention may comprise an intervening sequence.
  • a preferred example of the intervening sequence is a sequence encoding IRES (Internal ribosome entry site), 2A peptide.
  • the 2A peptide is a peptide sequence of around 20 amino acid residues derived from virus, is recognized by a protease present in the cell (2A peptidase), and is cleaved at the position of 1 residue from the C terminal.
  • 2A peptidase Multiple genes linked as one unit by 2A peptide are transcribed and translated as one unit, and then cleaved by 2A peptidase.
  • Examples of the 2A peptidase include F2A (derived from foot-and-mouth disease virus), E2A (derived from equine rhinitis A virus), T2A (derived from Thosea asigna virus), and P2A (derived from porcine teschovirus-1).
  • a polynucleotide comprising: a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, a promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcriptional repressor, one or two base sequences respectively encoding a guide RNA, wherein the one or two base sequences are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 2, 3, 4, 8, 15, 17, 18, 20, 25, 31, 32, 33, 35, 39, 40, 42, 44, 50, 51, 52, 55, 57, 58, 59, 65, 67, 68, 113, 116, 135, 138, 142, 144, 146, 156, 158, 161, or 171, preferably are selected from a base sequence comprising a sequence set
  • a polynucleotide comprising: a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, CMV promoter for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcriptional repressor, one or two base sequences respectively encoding a guide RNA, wherein the one or two base sequences are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 2, 3, 4, 8, 15, 17, 18, 20, 25, 31, 32, 33, 35, 39, 40, 42, 44, 50, 51, 52, 55, 57, 58, 59, 65, 67, 68, 113, 116, 135, 138, 142, 144, 146, 156, 158, 161, or 171, preferably are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 2, 3, 4, 20, 51,
  • the present invention provides a vector comprising the polynucleotide of the present invention (hereinafter sometimes referred to as “the vector of the present invention”).
  • the vector of the present invention may be a plasmid vector or a viral vector.
  • the plasmid vector to be used is not particularly limited and may be any plasmid vector such as cloning plasmid vector and expression plasmid vector.
  • the plasmid vector is prepared by inserting the polynucleotide of the present invention into a plasmid vector by a known method.
  • the viral vector to be used is not particularly limited and examples thereof include, but are not limited to, adenovirus vector, adeno-associated virus (AAV) vector, lentivirus vector, retrovirus vector, Sendaivirus vector and the like.
  • AAV vector adeno-associated virus
  • lentivirus vector lentivirus vector
  • retrovirus vector Sendaivirus vector
  • Sendaivirus vector Sendaivirus vector
  • the “virus vector” or “viral vector” also includes derivatives thereof.
  • AAV vector is preferably used for the reasons such that it can express transgene for a long time, and it is derived from a non-pathogenic virus and has high safety.
  • a viral vector comprising the polynucleotide of the present invention can be prepared by a known method.
  • a plasmid vector for virus expression into which the polynucleotide of the present invention has been inserted is prepared, the vector is transfected into an appropriate host cell to allow for transient production of a viral vector comprising the polynucleotide of the present invention, and the viral vector is collected.
  • the serotype of the AAV vector is not particularly limited as long as expression of the human DUX4 gene in the target can be activated, and any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh.10 and the like may be used (for the various serotypes of AAV, see, for example, WO 2005/033321 and EP2341068 (A1), which are incorporated herein by reference in their entireties).
  • variants of AAV include, but are not limited to, new serotype with a modified capsid (e.g., WO 2012/057363, which is incorporated herein by reference in its entirety) and the like.
  • a new serotype with a modified capsid improving infectivity for muscle cells can be used, such as AAV 587 MTP, AAV 588 MTP, AAV-B1, AAVM41, AAVS1_P1, and AAVS10_P1, and the like (see Yu et al., Gene Ther. 2009 Aug;16(8):953-62, Choudhury et al., Mol Ther.
  • a known method such as (1) a method using a plasmid, (2) a method using a baculovirus, (3) a method using a herpes simplex virus, (4) a method using an adenovirus, or (5) a method using yeast can be used (e.g., Appl Microbiol Biotechnol. 2018; 102(3): 1045-1054, etc., which is incorporated herein by reference in its entirety).
  • an AAV vector is prepared by a method using a plasmid
  • a vector plasmid comprising inverted terminal repeat (ITR) at both ends of wild-type AAV genomic sequence and the polynucleotide of the present invention inserted in place of the DNA encoding Rep protein and capsid protein is prepared.
  • the DNA encoding Rep protein and capsid protein necessary for forming virus particles are inserted into other plasmids.
  • a plasmid comprising genes (E1A, E1B, E2A, VA and E4orf6) responsible for the helper action of adenovirus necessary for proliferation of AAV is prepared as an adenovirus helper plasmid.
  • AAV vector recombinant AAV
  • a cell capable of supplying a part of the gene products (proteins) of the genes responsible for the aforementioned helper action e.g., 293 cell, etc.
  • the produced AAV vector is present in the nucleus.
  • a desired AAV vector is prepared by destroying the host cell with freeze-thawing, collecting the virus and then subjecting the virus fraction to separation and purification by density gradient ultracentrifugation method using cesium chloride, column method or the like.
  • AAV vector has great advantages in terms of safety, gene transduction efficiency and the like, and is used for gene therapy.
  • the size of a polynucleotide that can be packaged in AAV vector is limited.
  • the entire length including the base length of a polynucleotide comprising a base sequence encoding a fusion protein of dSaCas9 and miniVR or microVR, a base sequence encoding gRNA targeting the expression regulatory region of the human DUX4 gene, and EFS promoter sequence or CK8 promoter sequence and U6 promoter sequence as the promoter sequences, and ITR parts is about 4.85 kb, and they can be packaged in a single AAV vector.
  • composition of the present invention also provides a pharmaceutical composition comprising the polynucleotide of the present invention or the vector of the present invention (hereinafter sometimes referred to as “the pharmaceutical composition of the present invention”).
  • the pharmaceutical composition of the present invention can be used for treating or preventing FSHD.
  • the pharmaceutical composition of the present invention comprises the polynucleotide of the present invention or the vector of the present invention as an active ingredient, and may be prepared as a formulation comprising such active ingredient (i.e., the polynucleotide of the present invention or the vector of the present invention) and, generally, a pharmaceutically acceptable carrier.
  • the pharmaceutical composition of the present invention is administered parenterally, and may be administered topically or systemically.
  • the pharmaceutical composition of the present invention can be administered by, but are not limited to, for example, intravenous administration, intraarterial administration, subcutaneous administration, intraperitoneal administration, or intramuscular administration.
  • the dose of the pharmaceutical composition of the present invention to a subject is not particularly limited as long as it is an effective amount for the treatment and/or prevention. It may be appropriately optimized according to the active ingredient, dosage form, age and body weight of the subject, administration schedule, administration method and the like.
  • the pharmaceutical composition of the present invention can be not only administered to the subject affected with FSHD but also prophylactically administered to subjects who may develop FSHD in the future based on the genetic background analysis and the like.
  • treatment in the present specification also includes remission of disease, in addition to the cure of diseases.
  • prevention may also include delaying the onset of disease, in addition to prophylaxis of the onset of disease.
  • the pharmaceutical composition of the present invention can also be referred to as “the agent of the present invention” or the like.
  • the present invention also provides a method for treating or preventing FSHD, comprising administering the polynucleotide of the present invention or the vector of the present invention to a subject in need thereof (hereinafter sometimes referred to as “the method of the present invention”).
  • the present invention includes the polynucleotide of the present invention or the vector of the present invention for use in the treatment or prevention FSHD.
  • the present invention includes use of the polynucleotide of the present invention or the vector of the present invention in the manufacture of a pharmaceutical composition for the treatment or prevention of FSHD.
  • the method of the present invention can be practiced by administering the aforementioned pharmaceutical composition of the present invention to a subject affected with FSHD, and the dose, administration route, subject and the like are the same as those mentioned above.
  • Measurement of the symptoms may be performed before the start of the treatment using the method of the present invention and at any timing after the treatment to determine the response of the subject to the treatment.
  • Ribonucleoprotein comprising the following (hereinafter sometimes referred to as “RNP of the present invention”): (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription repressor, and (d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 2, 3, 4, 8, 15, 17, 18, 20, 25, 31, 32, 33, 35, 39, 40, 42, 44, 50, 51, 52, 55, 57, 58, 59, 65, 67, 68, 113, 116, 135, 138, 142, 144, 146, 156, 158, 161, or 171, preferably are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 2, 3, 4, 20, 51, 68, 138, 142, 146, 156, 158, or 161 in the expression regulatory region of human DUX4 gene.
  • RNP of the present invention a ribonucleoprotein comprising the following (hereinafter sometimes referred
  • nuclease-deficient CRISPR effector protein, transcription repressor, and guide RNA comprised in the RNP of the present invention
  • the nuclease-deficient CRISPR effector protein, transcription repressor, and guide RNA explained in detail in the above-mentioned section of “1.
  • Polynucleotide can be used.
  • the fusion protein of nuclease-deficient CRISPR effector protein and transcription repressor to be comprised in the RNP of the present invention can be produced by, for example, introducing a polynucleotide encoding the fusion protein into the cell, bacterium, or other organism to allow for the expression, or an in vitro translation system by using the polynucleotide.
  • guide RNA comprised in the RNP of the present invention can be produced by, for example, chemical synthesis or an in vitro transcription system by using a polynucleotide encoding the guide RNA.
  • the thus-prepared fusion protein and guide RNA are mixed to prepare the RNP of the present invention.
  • other substances such as gold particles may be mixed.
  • the RNP may be encapsulated in a lipid nanoparticle (LNP) by a known method.
  • LNP lipid nanoparticle
  • the RNP of the present invention can be introduced into the target cell, tissue and the like by a known method.
  • Lee K., et al., Nat Biomed Eng. 2017; 1:889-901, WO 2016/153012 which are incorporated herein by reference in their entireties, and the like can be referred to for encapsulation in LNP and introduction method.
  • the guide RNA comprised in RNP of the present invention targets continuous 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length, in the regions of ”190,065,500-190,068,500” and ”190,047,000-190,052,000” existing in the GRCh38/hg38 of human chromosome 4 (Chr 4).
  • the guide RNA comprised in RNP of the present invention targets continuous 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length, in the regions of ”190,065,000-190,093,000” and ”190,173,000-190,176,000” existing in the GRCh38/hg38 of human chromosome 4 (Chr 4).
  • the present invention also provides a composition or kit comprising the following for suppression of the expression of the human DUX4 gene: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription repressor, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 2, 3, 4, 8, 15, 17, 18, 20, 25, 31, 32, 33, 35, 39, 40, 42, 44, 50, 51, 52, 55, 57, 58, 59, 65, 67, 68, 113, 116, 135, 138, 142, 144, 146, 156, 158, 161, or 171, preferably are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 2, 3, 4, 20, 51, 68, 113, 116, 135, 138, 142, 144, 146, 156, 158, 161, or 171 in the expression regulatory region of human DUX
  • the present invention also provides a method for treating or preventing FSHD, comprising administering the following (e) and (f): (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription repressor, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 2, 3, 4, 8, 15, 17, 18, 20, 25, 31, 32, 33, 35, 39, 40, 42, 44, 50, 51, 52, 55, 57, 58, 59, 65, 67, 68, 113, 116, 135, 138, 142, 144, 146, 156, 158, 161, or 171, preferably are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 2, 3, 4, 20, 51, 68, 113, 116, 135, 138, 142, 144, 146, 156, 158, 161, or 171 in the expression regulatory region of human
  • the present invention also provides use of the following (e) and (f): (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription repressor, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 2, 3, 4, 8, 15, 17, 18, 20, 25, 31, 32, 33, 35, 39, 40, 42, 44, 50, 51, 52, 55, 57, 58, 59, 65, 67, 68, 113, 116, 135, 138, 142, 144, 146, 156, 158, 161, or 171, preferably are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 2, 3, 4, 20, 51, 68, 113, 116, 135, 138, 142, 144, 146, 156, 158, 161, or 171 in the expression regulatory region of human DUX4 gene, or a polynucleo
  • nuclease-deficient CRISPR effector protein transcription repressor, guide RNA, as well as polynucleotides encoding them and vectors in which they are carried in these inventions, those explained in detail in the above-mentioned sections of “1. Polynucleotide”, “2. Vector” and “5. Ribonucleoprotein” can be used.
  • the dose, administration route, subject, formulation and the like of the above-mentioned (e) and (f) are the same as those explained in the section of “3. Pharmaceutical composition”.
  • the examples describe the use of a fusion protein of dCas9 with a transcriptional repressor to suppress gene expression, in the defined expression regulatory region of human DUX4 gene that leads to the selective suppression of human DUX4 gene expression.
  • the example also describes the definition of a specific genomic region that confers selective suppression of the human DUX4 gene without minimally affecting the expression of other genes.
  • the method of the present invention to suppress human DUX4 gene expression represents a novel therapeutic or preventive strategy for the FSHD as described and illustrated herein.
  • Targeting sequences were specified by the 21-nucleotide segment adjacent to a protospacer adjacent motif (PAM) having the sequence NNGRRT (5’-21nt targeting sequence-NNGRRT-3’) (Tables 1-1 to 1-3).
  • PAM protospacer adjacent motif
  • DUX4 Targeting Sequences-2 In a previous selection (Selection of DUX4 Targeting Sequences-1) we tested targeting sequences in roughly 8 kb of sequence around the putative promoter regions of the human DUX4 gene, based on the H3K4me3, H3K27Ac pattern of genome in human skeletal muscle cells. We now expanded our focus on a larger area that included the entirely of the D4Z4 repeat region and the DUX4 coding gene. The regions were scanned for sequences that can be targeted by a catalytically-inactive SaCas9 (D10A and N580A mutant; dSaCas9) complexed with gRNA, defined herein as a targeting sequence. Locations of the targeted genome regions relative to the DUX4 gene are depicted in Figure 5, and their coordinates are noted below:
  • Chr4 GRCh38/hg38; 190,065,000-190,093,000 ⁇ ⁇ 28kb (D4Z4 repeat region) 2. Chr4: GRCh38/hg38; chr4:190,173,000-190,176,000 ⁇ ⁇ 3kb (DUX4 gene)
  • Targeting sequences were specified by the 21-nucleotide segment adjacent to a protospacer adjacent motif (PAM) having the sequence NNGRRT (5’-21nt targeting sequence-NNGRRT-3’) (Tables 2-1 to 2-4).
  • PAM protospacer adjacent motif
  • pLentiCRISPR v2 Lentiviral transfer plasmid (pED316) pLentiCRISPR v2 was purchased from Genscript (https://www.genscript.com) and the following modifications were made: the SpCas9 gRNA scaffold sequence was replaced by SaCas9 gRNA scaffold sequence; SpCas9-FLAG was replaced with dSaCas9 (D10A and N580A mutant) fused to the Kruppel associated box (KRAB) domain. KRAB transcriptional suppression domain can suppress gene expression when localized to promoters by recruiting suppressive elements.
  • Genscript https://www.genscript.com
  • KRAB was tethered to the C-terminus of dSaCas9, which is referred to as dSaCas9-KRAB hereinafter, and targeted to human DUX4 gene regulatory regions as directed by targeting sequences (Tables 1 and 2).
  • the generated backbone plasmid was named pED316.
  • gRNA cloning Three negative control non-targeting sequences, three positive control targeting sequences, 76 targeting sequences (Table 1), and 85 targeting sequence (Table 2) were cloned into pED316.
  • Forward and reverse oligos were synthesized by Integrated DNA Technologies in the following format: Forward; 5’ CACC(G)-21 basepair targeting sequence - 3’, and Reverse: 5’ AAAC - 19-21 basepair reverse complement targeting sequence - (C) - 3’, where bases in parenthesis were added if the target did not begin with a G. Oligos were resuspended in Tris-EDTA buffer (pH 8.0) at 100 ⁇ M.
  • NEB Stable Competent cells NEB catalog number: C3040I
  • the resulting construct drives expression of sgRNAs comprising crRNA encoded by individual targeting sequences fused with tracrRNA (gttttagtactctggaaacagaatctactaaaacaaggcaaaatgccgtgtttatctcgtcaacttgttggcgagatttttt; SEQ ID NO: 97) by a U6 promoter.
  • Lentivirus Generation HEK293TA cells were seeded at 0.75x10 6 cells/well (for the targeting sequences listed in Table 1) or 1 x10 6 cells/well (for the targeting sequences listed in Table 2) in 6 well cell culture dishes (VWR catalog number: 10062-892) in 2 ml growth medium (DMEM media supplemented with 10% FBS and 2 mM fresh L-glutamine, 1 mM sodium pyruvate and non-essential amino acids) and incubated at 37°C/5% CO 2 for 24 hours.
  • DMEM media supplemented with 10% FBS and 2 mM fresh L-glutamine, 1 mM sodium pyruvate and non-essential amino acids
  • Lentivirus was harvested 48 hours (for the targeting sequences listed in Table 1) or 72 hours (for the targeting sequences listed in Table 2) following transfection by passing media supernatant through a 0.45 ⁇ m PES filter (VWR catalog number: 10218-488). Until ready to use, the purified and aliquoted lentiviruses were stored in -80°C freezer.
  • FSHD patient derived lymphoblast cell lines When using the targeting sequences listed in Table 1: Two FSHD patient derived B-lymphoblast cell lines (LCLs) GM16343 and GM16414 were obtained from Coriell Institute. The cells were cultured in RPMI-1640 medium supplemented with 15% fetal bovine serum. For transduction, 100,000 cells were mixed with 8 ⁇ g/ml Polybrene (Sigma catalog number: TR-1003-G) and 200 ⁇ l lentivirus supernatants (see above) corresponding to each sgRNA (Table 1) was added to each well (96-well plate).
  • Polybrene Sigma catalog number: TR-1003-G
  • lentivirus supernatants see above
  • Cell and virus mixture were then spun down for 1 hour at 1200Xg , 37°C, followed by resuspension in fresh media at 0.25-0.5 ⁇ 10 6 cells per ml. 72 hours after transduction, cells were fed selection medium [growth media supplemented with 0.5 ⁇ g/ml puromycin (Sigma Aldrich catalog number: P8833-100MG)]. Cells were given fresh selection medium every 2-3 days. Following 7-15 days of cells being in selection medium, cells were harvested and RNA extracted with RNeasy 96 kit (Qiagen catalog number: 74182) as directed by manufacturer.
  • An FSHD patient derived B-lymphoblast cell lines (LCLs) GM16343 was obtained from Coriell Institute. The cells were cultured in RPMI-1640 medium supplemented with 15% fetal bovine serum. For transduction, 500,000 cells were mixed with 6.66 ⁇ g/ml Polybrene (Sigma catalog number: TR-1003-G) and 500 ⁇ l lentivirus supernatants (see above) corresponding to each sgRNA (Table 2) was added to each well (24-well plate). Cell and virus mixture were then spun down for 1 hour at 1200Xg , 37°C, followed by resuspension in fresh media at 0.5 ⁇ 10 6 cells per ml.
  • Polybrene Sigma catalog number: TR-1003-G
  • 500 ⁇ l lentivirus supernatants see above
  • cDNA was generated from ⁇ 0.5-0.8 ⁇ g of total RNA according to High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems; ThermoFisher catalog number: 4368813) protocol in a 10 ⁇ l volume. cDNA was diluted 10-fold and analyzed using Taqman Fast Advanced Master Mix according to manufacturer’s protocol.
  • Taqman probes (DUX4: Custom designed; MBD3L2: Assay Id Hs00544743_m1; TRIM43: Assay Id Hs00299174_m1; ZSCAN4: Assay Id Hs00537549_m1; HPRT: Assay Id Hs99999909_m1 VIC_PL) were obtained from Life Technologies.
  • Taqman probe-based real-time PCR reactions were processed and analyzed by QuantStudio 5 Real-Time PCR system as directed by Taqman Fast Advanced Master Mix protocol.
  • deltaCt values were calculated by subtracting the average Ct values from 3 technical replicates of the target gene (DUX4, MBD3L2, TRIM43 and ZSCAN4) probe from the HPRT probe (Average Ct DUX4 - Average Ct HPRT). The average deltaCt of the 3 control sgRNAs was then calculated. The deltaCt of each sample and control was then subtracted from the average control deltaCt to obtain a deltadeltaCt value for each sample and control. Normalized expression values were then determined for each sample and control using the formula 2 ⁇ -(deltadeltaCt). In this case the individual expression value of each control is normalized to the average expression value of all three control samples. The graphed bar denoting the control sample is an average of the three controls over three separate experiments.
  • DUX4 causes the aberrant upregulation of many downstream targets, including genes expressed in the germline and in early development.
  • TRIM43, ZSCAN4, and MBD3L2 are downstream targets of DUX4 that were also found to be upregulated in the FSHD patient derived LCLs cultures used in this study.
  • dCas9-KRAB-mediated repression of DUX4 also results in repression of these DUX4 target genes.
  • DUX4 causes the aberrant upregulation of many downstream targets, including genes expressed in the germline and in early development.
  • TRIM43, ZSCAN4, and MBD3L2 are downstream targets of DUX4 that were also found to be upregulated in the FSHD patient derived LCLs cultures used in this study.
  • dCas9-KRAB-mediated repression of DUX4 also results in repression of these DUX4 target genes.
  • the expression of DUX4 gene in human cells can be suppressed.
  • the present invention is expected to be extremely useful for the treatment and/or prevention of FSHD.
  • a numerical limit or range is stated herein, the endpoints are included.
  • all values and subranges within a numerical limit or range are specifically included as if explicitly written out.
  • the words “a” and “an” and the like carry the meaning of “one or more.”

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Toxicology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Public Health (AREA)
  • Virology (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Neurology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/JP2021/031973 2020-08-31 2021-08-31 Method for treating facioscapulohumeral muscular dystrophy (fshd) by targeting dux4 gene Ceased WO2022045366A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US18/043,124 US20230323456A1 (en) 2020-08-31 2021-08-31 Method for treating facioscapulohumeral muscular dystrophy (fshd) by targeting dux4 gene
JP2023513722A JP7736329B2 (ja) 2020-08-31 2021-08-31 Dux4遺伝子を標的とした顔面肩甲上腕型筋ジストロフィーの治療方法
EP21861786.8A EP4204556A4 (en) 2020-08-31 2021-08-31 Method for treating facioscapulohumeral muscular dystrophy (fshd) by targeting dux4 gene
CN202180050873.1A CN116194578A (zh) 2020-08-31 2021-08-31 通过靶向dux4基因来治疗面肩肱型肌营养不良症(fshd)的方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202063072327P 2020-08-31 2020-08-31
US63/072,327 2020-08-31
US202163235359P 2021-08-20 2021-08-20
US63/235,359 2021-08-20

Publications (1)

Publication Number Publication Date
WO2022045366A1 true WO2022045366A1 (en) 2022-03-03

Family

ID=80353460

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2021/031973 Ceased WO2022045366A1 (en) 2020-08-31 2021-08-31 Method for treating facioscapulohumeral muscular dystrophy (fshd) by targeting dux4 gene

Country Status (5)

Country Link
US (1) US20230323456A1 (https=)
EP (1) EP4204556A4 (https=)
JP (1) JP7736329B2 (https=)
CN (1) CN116194578A (https=)
WO (1) WO2022045366A1 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11845937B2 (en) 2020-09-11 2023-12-19 Arrowhead Pharmaceuticals, Inc. RNAi agents for inhibiting expression of DUX4, compositions thereof, and methods of use
US12104157B2 (en) 2020-04-02 2024-10-01 Mirecule, Inc. Targeted inhibition using engineered oligonucleotides
WO2024192263A3 (en) * 2023-03-16 2024-11-07 Epicrispr Biotechnologies, Inc. Systems and methods for regulating aberrant gene expressions

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018057863A1 (en) * 2016-09-23 2018-03-29 University Of Massachusetts Silencing of dux4 by recombinant gene editing complexes
WO2019235627A1 (ja) * 2018-06-08 2019-12-12 株式会社モダリス 改変されたCas9タンパク質及びその用途
WO2020085441A1 (ja) * 2018-10-24 2020-04-30 株式会社モダリス 改変されたCas9タンパク質及びその用途

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11160823B2 (en) * 2016-11-07 2021-11-02 University Of Massachusetts Therapeutic targets for facioscapulohumeral muscular dystrophy
AU2021257213A1 (en) * 2020-04-17 2022-11-03 Nevada Research & Innovation Corporation CRISPR-inhibition for facioscapulohumeral muscular dystrophy

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018057863A1 (en) * 2016-09-23 2018-03-29 University Of Massachusetts Silencing of dux4 by recombinant gene editing complexes
WO2019235627A1 (ja) * 2018-06-08 2019-12-12 株式会社モダリス 改変されたCas9タンパク質及びその用途
WO2020085441A1 (ja) * 2018-10-24 2020-04-30 株式会社モダリス 改変されたCas9タンパク質及びその用途

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CHARIS L HIMEDA, TAKAKO I JONES, PETER L JONES: "CRISPR/dCas9-mediated Transcriptional Inhibition Ameliorates the Epigenetic Dysregulation at D4Z4 and Represses DUX4-fl in FSH Muscular Dystrophy", MOLECULAR THERAPY, vol. 24, no. 3, 1 March 2016 (2016-03-01), US , pages 527 - 535, XP055497884, ISSN: 1525-0016, DOI: 10.1038/mt.2015.200 *
DAS SUNNY, CHADWICK BRIAN P.: "CRISPR mediated targeting of DUX4 distal regulatory element represses DUX4 target genes dysregulated in Facioscapulohumeral muscular dystrophy", SCIENTIFIC REPORTS, vol. 11, no. 1, 1 December 2021 (2021-12-01), pages 1 - 13, XP055902608, DOI: 10.1038/s41598-021-92096-0 *
F. ANN RAN, CONG LE, YAN WINSTON X., SCOTT DAVID A., GOOTENBERG JONATHAN S., KRIZ ANDREA J., ZETSCHE BERND, SHALEM OPHIR, WU XUEBI: "In vivo genome editing using Staphylococcus aureus Cas9", NATURE, vol. 520, no. 7546, 9 April 2015 (2015-04-09), pages 186 - 191, XP055206733, ISSN: 00280836, DOI: 10.1038/nature14299 *
HIMEDA CHARIS L., JONES TAKAKO I., JONES PETER L.: "Targeted epigenetic repression by CRISPR/dSaCas9 suppresses pathogenic DUX4-fl expression in FSHD", MOLECULAR THERAPY, vol. 20, 1 March 2021 (2021-03-01), GB , pages 298 - 311, XP055865179, ISSN: 2329-0501, DOI: 10.1016/j.omtm.2020.12.001 *
See also references of EP4204556A4 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12104157B2 (en) 2020-04-02 2024-10-01 Mirecule, Inc. Targeted inhibition using engineered oligonucleotides
US11845937B2 (en) 2020-09-11 2023-12-19 Arrowhead Pharmaceuticals, Inc. RNAi agents for inhibiting expression of DUX4, compositions thereof, and methods of use
WO2024192263A3 (en) * 2023-03-16 2024-11-07 Epicrispr Biotechnologies, Inc. Systems and methods for regulating aberrant gene expressions

Also Published As

Publication number Publication date
JP7736329B2 (ja) 2025-09-09
EP4204556A4 (en) 2024-10-02
EP4204556A1 (en) 2023-07-05
JP2023539631A (ja) 2023-09-15
US20230323456A1 (en) 2023-10-12
CN116194578A (zh) 2023-05-30

Similar Documents

Publication Publication Date Title
JP4063319B2 (ja) 組換えウイルスベクター系
JP4117023B2 (ja) 組換えウイルスベクター系
JP7069426B2 (ja) ユートロフィン遺伝子を標的とした筋ジストロフィーの治療方法
WO2022045366A1 (en) Method for treating facioscapulohumeral muscular dystrophy (fshd) by targeting dux4 gene
JP2023515710A (ja) CRISPR媒介式エクソン欠失用の最適なgRNA対を発見するためのハイスループットスクリーニング法
JP7565620B2 (ja) Dmpk遺伝子を標的とした筋ジストロフィーの治療方法
US12502418B2 (en) Method for treating muscular dystrophy by targeting LAMA1 gene
WO2022145495A1 (en) Method for treating spinocerebellar ataxias (sca) by targeting atxn7 gene
WO2021230385A1 (en) Method for treating muscular dystrophy by targeting utrophin gene
JP7749244B2 (ja) Mapt遺伝子を標的としたアルツハイマー病の治療方法
WO2022176859A1 (en) Method for treating muscular dystrophy by targeting lama1 gene
WO2022114243A1 (en) Method for treating muscular dystrophy by targeting dmpk gene
WO2023190935A1 (en) Method for treating myopathies by targeting titin gene
WO2025187834A1 (en) Method for treating muscular dystrophy by targeting lama1 gene
EP1015617A1 (en) Sv40 viral vectors for targeted integration into cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21861786

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2023513722

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021861786

Country of ref document: EP

Effective date: 20230331