WO2022031914A2 - Methods of treating cardiac disorders and congestive heart failure and administering aav vectors - Google Patents

Methods of treating cardiac disorders and congestive heart failure and administering aav vectors Download PDF

Info

Publication number
WO2022031914A2
WO2022031914A2 PCT/US2021/044650 US2021044650W WO2022031914A2 WO 2022031914 A2 WO2022031914 A2 WO 2022031914A2 US 2021044650 W US2021044650 W US 2021044650W WO 2022031914 A2 WO2022031914 A2 WO 2022031914A2
Authority
WO
WIPO (PCT)
Prior art keywords
cardiomyopathy
heart
seq
heart failure
syndrome
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/044650
Other languages
English (en)
French (fr)
Other versions
WO2022031914A3 (en
Inventor
Michael W. O'CALLAGHAN
Michael L. Roberts
Jorge Omar YANEZ-CUNA
Juan Manuel IGLESIAS GONZALEZ
Antonia EVRIPIOTI
Sinclair COOPER
Ferzin SETHNA
Roger Hajjar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
AskBio UK Ltd
AskBio Inc
Original Assignee
Synpromics Ltd
Asklepios Biopharmaceutical Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Synpromics Ltd, Asklepios Biopharmaceutical Inc filed Critical Synpromics Ltd
Priority to AU2021320244A priority Critical patent/AU2021320244A1/en
Priority to CN202180068345.9A priority patent/CN116406297A/zh
Priority to JP2023507620A priority patent/JP2023536921A/ja
Priority to CA3188398A priority patent/CA3188398A1/en
Priority to IL300367A priority patent/IL300367A/en
Priority to EP21853948.4A priority patent/EP4192580A4/en
Priority to US18/019,421 priority patent/US20230340528A1/en
Publication of WO2022031914A2 publication Critical patent/WO2022031914A2/en
Publication of WO2022031914A3 publication Critical patent/WO2022031914A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/04Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151Methods of production or purification of viral material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Definitions

  • the technology herein relates to AAV vectors and regulatory nucleic acid sequences, in particular cardiac-specific promoters, muscle cell specific promoters, and elements thereof for the treatment of cardiac disorders, heart failure, including chronic heart failure (CHF).
  • the technology herein also relates to expression methods of administering AAV vectors for the treatment of cardiac disorders.
  • the technology herein also relates to constructs, vectors, virions, pharmaceutical compositions and cells comprising such promoters for decreasing phosphatase activity to improve [3-adrenergic responsiveness, and to methods of their use.
  • Heart failure defined by the ACC/AHA as the complex clinical syndrome that results from any structural or functional impairment of ventricular filling or ejection of blood — remains one of the most common, costly, and debilitating diseases in the United States. Based on National Health and Nutrition Examination Survey data from 2011 to 2014, an estimated 6.5 million US adults have it, with projections of more than 8 million by 2030. More than 960,000 new cases are thought to occur annually, with a lifetime risk of developing it of roughly 20% to 45%. Heart failure (HF), also called congestive heart failure (CHF) is therefore a disease of epidemic portions in the United States.
  • HF also called congestive heart failure
  • Heart failure is a disorder in which the contractility of the heart muscle decreases, and the heart loses its ability to pump blood efficiently. Heart failure is almost always a chronic, long-term condition, and consumes an inordinate amount of medical intervention and human resource dollars. In particular, the consequences of heart failure to the rest of the body organs can be devastating both in terms of the overall reduction in productive life of the patient, and the expense of treatment. The condition may affect the right side, the left side, or both sides of the heart. As the pumping action of the heart is compromised, blood begins backing up into other areas of the body. Many organs and organ systems begin to suffer cumulative damage from lack of oxygen and nutrients.
  • HFrEF heart failure with reduced ejection fraction
  • New drugs that target pathways critical to progression of HF along with implantable cardiac defibrillators and resynchronization devices, have been introduced over the past 3 decades.
  • both the morbidity and mortality associated with HFrEF remains at unacceptable levels, with as many as 50% of affected individuals dying within 5 years of diagnosis. This has led investigators to evaluate the role of gene therapy in mitigating or curing HFrEF by increasing the amount of a specific protein in the heart
  • Protein kinases and their phospho-protein substrates are important in the heart's pumping action and have been well characterized, however, the protein phosphatases that reverse the increased cardiac contractility are also important.
  • the major Ser/Thr phosphatases (type 1, type 2A and type 2B (calcineurin)
  • type 1A and type 2B are highly homologous proteins (40-50%) (Cohen, P., 1990 Phosphoprotein Res; 24:230-5) that play critical roles in the control of cardiac contractility and hypertrophy.
  • Overexpression of the catalytic subunit of protein phosphatase 2A has been shown to decrease cardiac function and lead to a pathologic cardiac hypertrophy (Brewis, N.
  • PKC-a Protein Kinase C alpha
  • Gene therapy has been useful for the treatment of a variety of diseases and disorders. However, it is important that both the delivery of the gene therapy is optimal, as well as the expression of the gene or nucleic acid to a particular tissue and/or cell type.
  • Gene therapy has the potential to not only cure genetic disorders, but to also facilitate the longterm non-invasive treatment of acquired and degenerative diseases using a virus.
  • One gene therapy vector is adeno-associated virus (AAV).
  • AAV itself is a non-pathogenic-dependent parvovirus that needs helper viruses for efficient replication.
  • AAV has been utilized as a virus vector for gene therapy because of its safety and simplicity.
  • AAV has a broad host and cell type tropism capable of transducing both dividing and non-dividing cells.
  • Heart failure including congestive heart failure (CHF), and other heart diseases and disorders.
  • CHF congestive heart failure
  • viral vectors for treatment of diseases.
  • One or more aspects of the present invention are intended to address one or more of the above-mentioned problems.
  • AAV vectors for the treatment of heart disorders and diseases include, e.g., an AAV vector encoding a phosphatase inhibitor, for example, for expression of the phosphatase inhibitor in heart cells for the treatment of cardiac disorders, e.g., heart failure. Decreasing phosphatase activity can improve [3-adrenergic responsiveness.
  • aspects of the present invention are directed to novel methods of administration and novel rAAV compositions for the treatment of subjects with heart failure, including methods of administration comprising administering to a subject with a classification of heart failure a dose of a rAAV where upon at least 12-months after the administration the classification of the heart failure is improved by at least one, or at least two stages or classification levels.
  • the methods of administration disclosed herein can be used in combination with other agents, including but not limited to use of immunomodulators and/or vasodilators, as well as rAAV vectors comprising a codon optimized nucleic acid sequence to encode I-lc (a constitutively active truncated inhibitor- 1 that inhibits protein phosphatase 1 activity), and/or rAAV vectors comprising novel cardiac-specific muscle promoters.
  • rAAV vectors comprising a codon optimized nucleic acid sequence to encode I-lc (a constitutively active truncated inhibitor- 1 that inhibits protein phosphatase 1 activity), and/or rAAV vectors comprising novel cardiac-specific muscle promoters.
  • the inventors have demonstrated different ways to treat subjects with heart failure, including subjects with non-ischemic cardiomyopathy and ischemic cardiomyopathy that have the ability to significantly improve the subjects’ categorization in a classification system used to assess heart failure.
  • a range of classification systems to categorize the extent of a subjects’ of heart failure can be used and are well known in the art, and includes but are not limited to American Heart Association (AHA), the American College of Cardiology (ACC), Minnesota LIVING WITH HEART FAILURE® Questionnaire (MLHFQ), Kansas City Cardiomyopathy questionnaire (KCCQ), or the 2016 European Society of Cardiology guidelines (ESCG), the Japanese heart failure Society (JHFS) guidelines, The Japanese Circulation Society (JCS) Guidelines, or, the New York Heart Association (NYHA), or modified assessments or combinations or merged assessments thereof.
  • AHA American Heart Association
  • ACC American College of Cardiology
  • MLHFQ Minnesota LIVING WITH HEART FAILURE® Questionnaire
  • KCCQ Kansas City Cardiomyopathy questionnaire
  • ECG European Society of Cardiology guidelines
  • JHFS Japanese heart failure Society
  • JHFS The Japanese Circulation Society
  • NJHA New York Heart Association
  • the methods of treating a subject with heart failure as disclosed herein, or administration methods as disclosed herein have been demonstrated to improve a subject’s classification of heart failure, within at 12-months post-administration of a rAAV disclosed herein, from, e.g., a category IV to a category III or less than category III, or for e.g., from a category III to a category II or less than category II, according to a heart failure classification system as disclosed herein.
  • a system equivalent to the NYHA or the AHA or the ACC classifications are used, or any other comparative heart failure classification system known to a person of ordinary skill in the art.
  • the rAAV vector encoding a I-lc protein comprises a codon optimized nucleic acid sequence encoding I-lc, e.g., selected from any of SEQ ID NO: 385-412, or a nucleic acid sequence that has at least 85% sequence identity thereto.
  • the rAAV vector encoding a lie protein comprise a codon optimized nucleic acid sequence encoding lie e.g.
  • the rAAV vector comprising codon optimized nucleic acid sequence encoding lie, e.g. selected from any of SEQ ID NOS: 385-412, or a nucleic acid sequence that has 85% sequence identity thereto, further comprise reverse poly A or, ds RNA termination element.
  • the rAAV vector encoding a I-Ic protein for use in the methods and compositions as disclosed herein comprises a nucleic acid sequence selected from any of SEQ ID NO: 413-440, or a nucleic acid sequence that has at least 85% sequence identity thereto.
  • close ended linear duplex DNA (or, also referred to as closed linear DNA herein) comprising a nucleic acid sequence of any of SEQ ID NO: 357-384.
  • the rAAV vector lacking bacterial sequences and encoding a I-Ic protein for use in the methods and compositions as disclosed herein is manufactured using a close ended linear duplex DNA of SEQ ID NO: 357-384.
  • One aspect of the technology described herein relates to a method to administer a rAAV vector, where the method is a single administration to the subject, where the single total dose administration comprises at least 2, or 3, or 4, or 5 or more sub-doses within the single administration. That is, stated differently, in some embodiments, the method comprises administering a rAAV vector to the subject in a single administration, where the single total dose administration comprises the administration of rAAV from least 2, or 3, or 4, or 5 or more vials, in which the total rAAV dose us administered from each vial over a time period between 1-5 minutes, or more than 5 minutes.
  • the rAAV vector is selected from the group consisting of AAV2, AAV6, AAV8, AAV9, AAV2i8, rhlO, AAV2.5 and AAV2G9.
  • the rAAV vector is AAV2i8 (also referred to as BNP116).
  • the rAAV vector comprises a VP1, a VP2, and/or VP3 capsid protein from a serotype selected from the group of AAV serotypes listed in table 11, which also lists the capsid protein sequences known in the art.
  • the methods relate to administration of a rAAV vector to the heart of a subject, e.g., a human subject.
  • the rAAV vector comprises a cardiac-specific promoter, for example, an exemplary cardiac-specific promoter selected from any of these disclosed in Table 2A herein, or a functional variant or functional fragment thereof, or any cardiac specific promoter (CSP) selected from Tables 2 and 3 herein.
  • the rAAV vector is administered according to the disclosed methods for the treatment of cardiovascular conditions, heart failure or a heart disease or disorder.
  • the rAAV vector administered according to the methods disclosed herein is a rAAV vector comprising a nucleic acid encoding a therapeutic agent for treatment of heart failure, wherein the nucleic acid is operatively linked to a cardiac-specific promoter as disclosed in Table 2A herein, or a functional variant or functional fragment thereof, or any CSP selected from Tables 2 and 3 herein.
  • the technology described herein relates to a method to co-administer a rAAV vector with an immune modulator, as disclosed herein.
  • AAV adeno- associated virions configured for delivering an inhibitor of protein phosphate 1 (PPI) to a subject, and more particularly for delivering a PPI inhibitor for expression in the heart of a subject.
  • PPI protein phosphate 1
  • this disclosure features a method that includes administering, into heart cells, e.g., cardiomyocytes, a rAAV vector expressing an agent that modulates phosphatase activity, e.g., type 1 phosphatase activity, in the cells.
  • the heart cells can be in vitro or in vivo.
  • the heart cells can be in a heart of a subject.
  • the method can be used to treat a subject, e.g., a subject having a cardiac disorder, e.g., heart failure.
  • the subject is a mammal, e.g., a human or non-human mammal.
  • Type 1 phosphatases include, but are not limited to, PPlca, PPlc[3, PPlcS and PPlcy.
  • the agent is a nucleic acid that comprises a sequence encoding a protein that inhibits phosphatase activity, e.g., type 1 phosphatase activity.
  • the rAAV vector can be administered in an amount effective to decrease phosphatase activity and/or increase [3-adrenergic responsiveness in the treated cells.
  • the rAAV vector expresses a nucleic acid that increases expression of an endogenous nucleic acid that encodes a protein that inhibits phosphatase activity.
  • the nucleic acid can include a sequence that encodes a transcription factor, e.g., an engineered transcription factor such as a chimeric zinc finger protein.
  • the nucleic acid is a regulatory sequence that integrates in or near the endogenous nucleic acid that encodes a protein that inhibits phosphatase activity, e.g., in or near a gene encoding phosphatase inhibitor- 1 (“I- 1 ”).
  • the rAAV vector expresses a nucleic acid that can provide a nucleic acid modulator of gene expression.
  • the nucleic acid can be a nucleic acid that can express such a nucleic acid modulator, e.g., a dsRNA (e.g., siRNA), an anti-sense RNA, or a ribozyme.
  • a nucleic acid modulator e.g., a dsRNA (e.g., siRNA), an anti-sense RNA, or a ribozyme.
  • the rAAV vector disclosed herein comprises, in its genome: 5’ and 3’ AAV inverted terminal repeats (ITR) sequences, and located between the 5 ’ and 3 ’ ITRs, a heterologous nucleic acid sequence encoding a protein phosphate 1 (PPI) inhibitor, wherein the heterologous nucleic acid is operatively linked to a cardiac-specific promoter (CSP).
  • the PPI inhibitor is Inhibitor- 1 (1-1) or a functional variant thereof.
  • the cardiac-specific promoter is a synthetic cardiac specific promoter selected from any promoter listed in Table 2A herein, or a functional variant or functional fragment thereof, or any CSP selected from Tables 2 and 3 herein.
  • the rAAV is administered by an injection, e.g., a direct injection into the heart, e.g., a direct injection into the left ventricle surface.
  • the rAAV is administered into a lumen of the circulatory system, e.g., into a chamber or the lumen of the heart or a blood vessel of the heart of a subject.
  • the pericardium can be opened and the rAAV can be injected into the heart, e.g., using a syringe and a catheter.
  • the rAAV can be administered into the lumen of the aorta, e.g., the aortic root, introduced into the coronary ostia or introduced into the lumen of the heart.
  • the rAAV can be administered into a coronary artery. It is also possible to restrict blood flow to increase resident time in the blood vessel, e.g., in the coronary artery, e.g., using an antegrade or retrograde blockade.
  • the rAAV is administered using syringe fitted with injection pump or, infusion pump.
  • the rAAV is administered using manually controlled syringe.
  • the rAAV vector as disclosed herein is introduced by a percutaneous injection, e.g., retrograde from the femoral artery retrograde to the coronary arteries.
  • the rAAV vector as disclosed herein is introduced, e.g., using a stent.
  • the rAAV vector as disclosed herein is coated on the stent and the stent is inserted into a blood vessel, such as a coronary artery, peripheral blood vessel, or cerebral artery.
  • introducing the rAAV vector as disclosed herein includes restricting blood flow through coronary vessels, e.g., partially or completely, introducing the viral delivery system into the lumen of the coronary artery, and allowing the heart to pump, while the coronary vein outflow of blood is restricted.
  • Restricting blood flow through coronary vessels can be performed, e.g., by inflation of at least one, two, or three angioplasty balloons.
  • Restricting blood flow through coronary vessels can last, e.g., for at least one, two, three, or four minutes.
  • Introduction of the viral particle into the coronary artery can be performed, e.g., by an antegrade injection through the lumen of an angioplasty balloon.
  • the restricted coronary vessels can be: the left anterior descending artery (LAD), the distal circumflex artery (LCX), the great coronary vein (GCV), the middle cardiac vein (MCV), or the anterior interventricular vein (AIV).
  • LAD left anterior descending artery
  • LCX distal circumflex artery
  • GCV great coronary vein
  • MCV middle cardiac vein
  • AIV anterior interventricular vein
  • Introduction of the viral particle can be performed after ischemic preconditioning of the coronary vessels, e.g., by restricting blood flow by e.g., inflating at least one, two, or three angioplasty balloons.
  • Ischemic preconditioning of the coronary vessels can last for at least one, two, three, or four minutes.
  • introducing the rAAV vector as disclosed herein includes restricting the aortic flow of blood out of the heart, e.g., partially or completely, introducing the viral delivery system into the lumen of the circulatory system, and allowing the heart to pump, e.g., against a closed system (isovolumically), while the aortic outflow of blood is restricted.
  • Restricting the aortic flow of blood out of the heart can be performed by redirecting blood flow to the coronary arteries, e.g., to the pulmonary artery.
  • Restricting the aortic flow of blood can be accomplished by clamping, e.g., clamping a pulmonary artery.
  • Introducing the viral particle can be performed e.g., with the use of a catheter or e.g., by direct injection. Introducing the viral particle can be performed by a delivery into the aortic root.
  • a cardiac specific promoter can be expressed in other cells. However, it has a higher degree of expression in the cardiac cells such as cardiomyocytes in the heart, as well as non-cardiomyocyte cells or located in the heart.
  • a cardiac-specific promoter expresses a gene at least 25%, or at least 35%, or at least 45%, or at least 55%, or at least 65%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or any integer between 25%-95% higher in cells located in the heart, including cardiomyocyte and non-cardiomyocyte cells located in the heart as compared to cells located outside the heart.
  • the synthetic cardiac-specific promoter may comprise a sequence which is at least 60%, 65%, 70%, 75%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to any one of SEQ ID NOs: 3-64.
  • the synthetic cardiac-specific promoter may comprise a sequence which is at least 60%, 65%, 70%, 75%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to any one of SEQ ID NO: 3-64, operably linked to a sequence which is at least 60%, 65%, 70%, 75%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to any one of SEQ ID NOs: 3-32.
  • a synthetic cardiac-specific promoter comprising or consisting of at least one of the following cis-regulatory elements (CREs) disclosed herein.
  • One aspect of the technology disclosed herein relates to a method of treating a patient having a heart failure, comprising: administering into heart cells of the patient, at least one total dose of a rAAV vector comprising a nucleic acid sequence encoding a phosphatase inhibitor protein that inhibits phosphatase activity, wherein, at least one dose of the rAAV is selected from a total dose-range of about 10 13 vg to about 10 15 vg, and wherein, six months post-administration NT-proBNP level in serum of the patient is below 900 pg/ml.
  • Another aspect of the technology described herein relates to a method of treating a patient having a heart failure, comprising: administering into heart cells of the patient, at least one total dose of a rAAV vector comprising (i) a nucleic acid sequence encoding a phosphatase inhibitor protein that inhibits phosphatase activity, (ii) a synthetic promoter, operatively linked to the phosphatase inhibitor (1-1) protein.
  • Another aspect of the technology described herein relates to a method of treating a patient having a cardiovascular condition or a heart disease, comprising: administering into heart cells of the patient, at least one total dose of a rAAV vector comprising a therapeutic nucleic acid operatively linked to a cardiacspecific promoter selected from Table 2A or a variant thereof, or a muscle -specific promoter active in cardiac and skeletal muscle selected from Table 5A or a variant thereof, wherein the therapeutic nucleic acid is RNA or DNA, and wherein the therapeutic nucleic acid expresses a therapeutic protein selected from Table 18A or 18B.
  • Another aspect of the technology described herein relates to a method of treating a patient having congestive heart failure, comprising: administering to a patient, at least one dose of a rAAV vector, wherein the rAAV vector is AAV2i8 and comprises a nucleic acid encoding phosphatase inhibitor 1 (1-1) operatively linked to a promoter selected from: a CMV promoter, a cardiac-specific promoter selected from Table 2A or a variant thereof, or a muscle-specific promoter active in cardiac and skeletal muscle selected from Table 5A or a variant thereof.
  • a promoter selected from: a CMV promoter, a cardiac-specific promoter selected from Table 2A or a variant thereof, or a muscle-specific promoter active in cardiac and skeletal muscle selected from Table 5A or a variant thereof.
  • the rAAV vector comprises a nucleic acid sequence encoding a polypeptide comprising amino acids 1-65 of SEQ ID NO: 2, wherein threonine at position 35 of SEQ ID NO: 1 is replaced with aspartic acid (T35D).
  • the nucleic acid sequence is a codon optimized nucleic acid sequence selected from any of SEQ ID NO: 385-412.
  • closed linear DNA constructs comprising a nucleic acid sequence of any of SEQ ID NO: 385-412.
  • the closed linear DNA can be used in methods for making rAAV that lack bacterial DNA sequences.
  • pharmaceutical compositions for treatment of heart failure that comprise rAAV encoding constitutively active I-lc, wherein the rAAV compositions lack bacterial nucleic acid sequences.
  • the rAAV vector further comprises CMV promoter or a synthetic promoter, operatively linked to the phosphatase inhibitor protein.
  • the synthetic promoter is a cardiac-specific promoter selected from Table 2A or a variant thereof, or a muscle-specific promoter active in cardiac and skeletal muscle selected from Table 5A or a variant thereof.
  • the synthetic promoter causes expression of the therapeutic nucleic acid or phosphatase inhibitor protein preferentially in smooth muscle cells.
  • the synthetic promoter causes expression of the therapeutic nucleic acid or phosphatase inhibitor protein preferentially in cardiac cells.
  • the expression of the therapeutic nucleic acid or phosphatase inhibitor protein by the cardiac- or muscle-specific promoter is equivalent to, or greater than, the expression caused by CMV promoter.
  • the total dose is administered over a period of time of about 20 minutes to about 30 minute.
  • the total dose is performed in sub-doses, wherein each sub-dose is administered over a period of time of 1- 5 minutes, for example, the administration of the total dose is performed in five sub-doses, each sub-dose is administered over a period of time of 1-5 minutes, where, for example, the five sub-doses are administered over a period of about 20 minutes to about 30 minutes.
  • the rAAV is selected from the group consisting of AAV2, AAV6, AAV8, AAV9, AAV2i8, rhlO, AAV2.5 and AAV2G9. In some embodiments, the rAAV is AAV2i8 or AAV9. In some embodiments, the rAAV is selected from any AAV serotypes disclosed in Table 11.
  • the at least one total dose of the rAAV is 10 13 vg, 3X10 13 vg, 10 14 vg, 3X10 14 vg, or, 10 15 vg. In some embodiments, the at least one total dose of the rAAV is selected from a dose-range of about 10 13 vg to about 10 15 vg.
  • NT-proBNP level in serum of the patient is measured and is below 900 pg/ml.
  • the method further comprises administering an immune modulator.
  • the administration further comprises nitroprusside or nitroglycerin.
  • the administration is into the lumen of the coronary artery of the heart of the patient or systemic administration.
  • a close ended linear duplex DNA (also referred to as closed linear DNA in the application) of any of SEQ ID NO: 357-384 that is used to generate rAAV of the present invention.
  • the methods are useful to treat heart failure, including congestive heart failure (CHF), wherein the HF or CHF is selected from any of: left ventricular remodeling, peripheral arterial occlusive disease (PAOD), dilated cardiomyopathy (DCM) including idiopathic dilated cardiomyopathy (IDCM), coronary artery disease, ischemia, arrhythmia, myocardial infarction (MI), abnormal heart contractility, acute (decompensated) heart failure (AHF), abnormal Ca2+ metabolism, myocardial ischemia, atherosclerosis, cardiomyopathy, idiopathic cardiomyopathy, cardiac arrhythmias, muscular dystrophy, muscle mass abnormality, muscle degeneration, infective myocarditis
  • CHF congestive heart failure
  • PAOD peripheral arterial occlusive disease
  • DCM
  • the methods are useful to treat non-ischemic cardiomyopathy, or non-ischemic heart failure.
  • the methods are useful to treat ischemic cardiomyopathy, or non-ischemic heart failure.
  • One aspect of the technology described herein relates to a method of treating a patient having a heart failure, comprising: (i) administering into heart cells of the patient having a classification of congestive heart failure (CHF), at least one total dose of a rAAV vector comprising a nucleic acid sequence encoding a phosphatase inhibitor (1-1) protein that inhibits phosphatase activity, where at least one dose of the rAAV is selected from a total dose-range of about 10 13 vg to about 10 15 vg, and where, at least twelve months post-administration, there is an improvement in the classification of congestive heart failure.
  • CHF congestive heart failure
  • the classification of heart failure is based upon a classification system used by the American Heart Association (AHA), the American College of Cardiology (ACC), Minnesota LIVING WITH HEART FAILURE® Questionnaire (MLHFQ), Kansas City Cardiomyopathy questionnaire (KCCQ), or the 2016 European Society of Cardiology guidelines (ESCG), the Japanese heart failure Society (JHFS) guidelines, The Japanese Circulation Society (JCS) Guidelines, or, the New York Heart Association (NYHA), or an equivalent classification system thereof.
  • AHA American Heart Association
  • ACC American College of Cardiology
  • KCCQ Kansas City Cardiomyopathy questionnaire
  • ECG European Society of Cardiology guidelines
  • JHFS Japanese heart failure Society
  • JHFS The Japanese Circulation Society
  • NYHA New York Heart Association
  • the classification of heart failure is NYHA and the level of classification is selected from the group consisting of: Class I, Class II, Class III, and Class IV.
  • the classification system is the American College of Cardiology /American Heart Association (ACC/AHA) complementary staging system and the level of classification is selected from the group consisting of: Stages A, Stage B, Stage C, Stage D.
  • the classification system is KCCQ and the level of classification is a KQQC overall summary score range selected from the group consisting of: KCCQ fair to excellent scores of 50 to 100, very poor to fair scores of 0 to 49, good to excellent scores of 75 to 100, and very poor to good scores of 0 to 74.
  • Another aspect of the technology described herein relates to a method of treating a patient having cardiomyopathy, comprising administering into heart cells of the patient at least one total dose of a rAAV vector comprising a nucleic acid sequence encoding a phosphatase inhibitor (1-1) protein that inhibits phosphatase activity, where at least one dose of the rAAV is selected from a total dose-range of about 10 13 vg to about 10 15 vg, and where, at least twelve months post-administration, there is an improvement in the at least one parameter from a baseline level in the patient, where the at least one parameter is selected from the group consisting essentially of: (i) ejection fraction (EF), (ii) end systolic volume (ESV), (iii) cardiac contractility, selected from ejection fraction (EF) and fractional shortening (FS); (iv) cardiac volumes selected from any of: end diastolic volume (DV) and end systolic volume (ESV), (
  • the improvement is selected from any of: (a) at least a 5% or more increase in ejection fraction from baseline, (b) at least a 10% decrease, or at least a 20ml decrease in end systolic volume from baseline, (c) at least a 50-meter increase in 6-minute walk test from baseline, (d) at least a 40% decrease in BNP levels (pg/ml) in the blood from baseline, (e) at least a 35% decrease in proBNP levels (pg/ml) in the blood from baseline, (f) at least a 10% reduction in a biomarker selected from: troponin, serum creatinine, cystatin-C, or hepatic transaminases from a baseline level of the same biomarker, (g) at least a 1.5ml/kg/min increase in myocardial oxygen consumption (MV02) from baseline, or, (h) a discharge from hospital due to improved HF symptoms, or a reduced intervention selected from a decrease in the use of any of:
  • the rAAV vector further comprises CMV promoter or a synthetic promoter, operatively linked to the phosphatase inhibitor protein.
  • a total dose or rAAV is administered as any of the following administration methods: (a) over a period of time of about 20 minutes to about 30 minutes, (b) administered in a series of sub-doses, wherein each sub-dose is administered over a period of time of about Iminute to about 5 minutes or (c) administered in a series of five sub-doses, each sub-dose is administered over a period of time of about Iminute to about5 minutes, and wherein the five sub-doses are administered over a period of about 20 minutes to about 30 minutes.
  • the rAAV vector comprises a capsid that detargets the liver - that is, the rAAV preferentially targets tissues other than the liver.
  • the rAAV can preferentially target muscle cells, including but not limited to, cardiac muscle and cardiomyocytes.
  • the rAAV is selected from the group consisting of: AAV1, AAV2, AAV6, AAV8, AAV9, AAV2i8, rhlO, AAV2.5 and AAV2G9, or any rAAV selected from Table 11.
  • the rAAV vector is AAV2i8.
  • the rAAV vector is administered in at least one total dose of the rAAV is 10 13 vg, 3X10 13 vg, 10 14 vg, 3X10 14 vg, or, 10 15 vg.
  • the rAAV vector encodes a protein selected from any of the proteins listed in Table 18A or 18B.
  • the rAAV vector comprises a nucleic acid sequence encoding a phosphatase inhibitor (I- 1) protein, for example a constitutively active protein (I-lc).
  • the I-lc is selected from any of: (a) a polypeptide comprises at least amino acid residues 1-54 of SEQ ID NO: 1, wherein SEQ ID NO: 1 is truncated at the C-terminus at amino acid 70, 67, 66, 65, or 61, or 54, and where the there is an aspartic acid at position 35 (T35D), (b) a polypeptide comprising amino acids 1-54 of SEQ ID NO: 1 or a functional fragment thereof, wherein the functional fragment has at least 85% sequence identity to amino acid residues 1-54 of SEQ ID NO: 1, or truncated at the C-terminus at amino acid 70, 67, 66, 65, or 61, or 54, and where the there is an aspartic acid at position 35 (T35D), or (c) a polypeptide selected from any of: SEQ ID NOS: 507 or 527-532 or a functional equivalent thereof having at least 85% sequence identity to amino acid residues
  • the rAAV genome comprises nucleic acid sequence selected from the group consisting of: SEQ ID NO: 413-441.
  • the nucleic acid sequence encoding the 1-1 polypeptide is selected from: (a) a nucleic acid sequence encoding a polypeptide comprising amino acids 1-65 of SEQ ID NO: 1, wherein threonine (T) at position 35 of SEQ ID NO: 1 is replaced with an amino acid that is not T, (b) a nucleic acid sequence encoding a polypeptide comprising amino acids 1-65 of SEQ ID NO: 1, wherein threonine (T) at position 35 of SEQ ID NO: 1 is replaced with an acid amino acid selected from any of: aspartic acid (D), glutamic acid (E), asparagine (N), glutamine (Q), or (c) a nucleic acid sequence encoding a polypeptide comprising amino acids 1-65 of SEQ ID NO: 1, where
  • the nucleic acid sequence encoding the 1-1 protein is a codon optimized nucleic acid sequence, for example, but not limited to, a nucleic acid sequence encoding the 1-1 protein is selected from any of SEQ ID NO: 385-412, or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 385-412.
  • the methods and compositions disclosed herein can be used to treat a subject with cardiomyopathy, wherein the subject with cardiomyopathy has nonischemic heart failure and/or non-ischemic cardiomyopathy, including but not limited to, acquired cardiomyopathy, cardiomyopathy acquired as a result of an infection, or toxin, etc., or a congenital cardiomyopathy or a genetic disorder with a cardiac manifestation.
  • a subject with a congenital cardiomyopathy or a genetic disorder with a cardiac manifestation has a disease or disorder selected from the group consisting of: Arrhythmogenic right ventricular cardiomyopathy, Atrial myxoma, familial, Atrial septal defect ostium primum, Atrial septal defect sinus venosus, Barth syndrome, muscular dystrophy, Buerger disease, Cardioencephalomyopathy, Chromosome lp36 deletion syndrome, Congenital generalized lipodystrophy type 4 , Congenital heart block, Dilated cardiomyopathy, Duchenne muscular dystrophy (DMD), Fabry disease, Familial atrial fibrillation, Familial dilated cardiomyopathy, Familial hypertrophic cardiomyopathy , Familial progressive cardiac conduction defect, Familial thoracic aortic aneurysm and aortic dissection, Fibromuscular dysplasia, Friedreich ataxia, Gaucher disease, Glycogen storage disease (types 2, 3 or 4
  • the methods and compositions disclosed herein can be used to treat a subject with cardiomyopathy, wherein the subject with cardiomyopathy has an ischemic cardiomyopathy.
  • the methods and compositions disclosed herein can be used to treat a subject with cardiomyopathy, where the subject with cardiomyopathy has heart failure.
  • the subject with heart failure has a classification that is equivalent to class III or above in the New York Heart Association (NYHA) classification system.
  • NYHA New York Heart Association
  • the subject with heart failure has a cardiovascular disease or heart disease is selected from any of: congestive heart failure (CHF), left ventricular remodeling, peripheral arterial occlusive disease (PAOD), dilated cardiomyopathy (DCM) including idiopathic dilated cardiomyopathy (IDCM), coronary artery disease, ischemia, arrhythmia, myocardial infarction (MI), abnormal heart contractility, acute (decompensated) heart failure (AHF), abnormal Ca2+ metabolism, myocardial ischemia, atherosclerosis, cardiomyopathy, idiopathic cardiomyopathy, genetic disorder induced cardiomyopathy, cardiac arrhythmias, muscular dystrophy, muscle mass abnormality, muscle degeneration, infective myocarditis, drug- or toxin-induced muscle abnormalities, hypersensitivity myocarditis, an autoimmune endocarditis and congenital heart disease and pulmonary heart hypertension.
  • CHF congestive heart failure
  • PAOD peripheral arterial occlusive disease
  • DCM dilated
  • the methods and compositions disclosed herein can be used to treat a subject with cardiomyopathy, where the subject with cardiomyopathy has reduced ejection fraction (rEF or HFrEF), or, preserved ejection fraction (HFpEF).
  • an improvement of a classification of HF is an improvement of at least 2, or at least 3, or at least 4, or at least 5 parameters at least 12 months after administration. In some embodiments, there is an improvement of at least 2, or at least 3, or at least 4, or at least 5 parameters at least 6 months after administration. In some embodiments, there is an improvement in the classification of at least one level, or at least two levels, within six months after administration of the rAAV. In some embodiments, there is an improvement of at least a 10 point decrease in quality of life MLWHFQ or KCCQ from the baseline level.
  • the subject is administered a vasodilator concurrent with and/or, before, and/or, after the administration of the at least one total dose of a rAAV vector.
  • the subject is administered an immune modulator concurrent with, or before, or after the administration of the at least one total dose of a rAAV vector.
  • a pharmaceutical composition comprising an AAV vector that comprises a codon optimized I-Ic nucleic sequence selected from any of SEQ ID NO: 385-412, or nucleic acid sequence having at least 80% sequence identity to SEQ ID NOS: 385-412.
  • the codon optimized nucleic acid sequence is operably linked to a CMV promoter or a synthetic promoter, for example a cardiac-specific promoter selected from any of Table 2A, or a muscle -specific promoter active in cardiac and skeletal muscle, e.g., a promoter selected from Table 5 A or 13 A, or a variant thereof.
  • the pharmaceutical composition comprises a nucleic acid sequence selected from the group consisting of: SEQ ID NO: 41-42, or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NOS: 385-412.
  • the pharmaceutical composition can be used in a method to treat a subject with cardiomyopathy, including non-ischemic cardiomyopathy or ischemic cardiomyopathy, as disclosed herein.
  • the pharmaceutical composition can be used in a method to treat a subject with heart failure as disclosed herein.
  • AAV vector comprising a nucleic acid sequence encoding a Phosphatase inhibitor (1-1) polypeptide operably linked to a promoter selected from any of: (a) a cardiac-specific promoter selected from Table 2A or a variant thereof, or (b) a muscle-specific promoter active in cardiac and skeletal muscle, or a variant thereof, or (c) any promoter when a cardiac tissue specific enhancer is present.
  • the muscle-specific promoter active in cardiac and skeletal muscle is selected from Table 5 A or Table 13A or a variant thereof.
  • the AAV is selected from the group consisting of adeno-associated virus-1 (AAV1), AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAV2i8.
  • AAV1 adeno-associated virus-1
  • the AAV comprises a capsid that detargets the liver - that is, the capsid targets the rAAV to a tissue other than the liver in vivo.
  • the rAAV vector is AAV2i8.
  • the phosphatase inhibitor (1-1) polypeptide is a constitutively active protein (I-lc), for example, where the I-lc is selected from any of: (a) a polypeptide comprises at least amino acid residues 1-65 of SEQ ID NO: 1 or a functional equivalent thereof; (b) a polypeptide comprising at least amino acids 1-54 of SEQ ID NO: 1, wherein the polypeptide is truncated at a C-terminus at amino acid selected from residue 70, 67, 66, 65, or 61, or 54, and where the there is an aspartic acid at position 35 (T35D), (c) a polypeptide comprising amino acids 1-65 of SEQ ID NO: 1 or a functional equivalent thereof having at least 85% sequence identity to amino acid residues 1-65 of SEQ ID NO: 1, or, (d) a polypeptide selected from any of: SEQ ID NOS: 507 or 527-532 or
  • the AAV vector comprises a nucleic acid sequence encoding a 1-1 polypeptide is selected from: (a) a nucleic acid sequence encoding a polypeptide comprising amino acids 1-65 of SEQ ID NO: 1, wherein threonine (T) at position 35 of SEQ ID NO: 1 is replaced with an amino acid that is not T, (b) a nucleic acid sequence encoding a polypeptide comprising amino acids 1-65 of SEQ ID NO: 1, wherein threonine (T) at position 35 of SEQ ID NO: 1 is replaced with an acid amino acid selected from any of: aspartic acid (D), glutamic acid (E), asparagine (N), glutamine (Q), (c) a nucleic acid sequence encoding a polypeptide comprising amino acids 1-65 of SEQ ID NO: 1, wherein threonine (T) at position 35 of SEQ ID NO: 1 is replaced with aspartic acid (D), or a conservative amino acid
  • the rAAV encodes a I-lc polypeptide selected from: amino acids 1-54 of SEQ ID NO: 1, amino acids 1-61 of SEQ ID NO: 1, amino acids 1-65 of SEQ ID NO: 1, amino acids 1-66 of SEQ ID NO: 1, amino acids 1-67 of SEQ ID NO: amino acids 1 or 1-77 of SEQ ID NO: 2, or a functional variant thereof, wherein the threonine at position 35 of SEQ ID NO: 1 is replaced with an aspartate acid (T35D), or a conservative amino acid of aspartate.
  • T35D aspartate acid
  • the nucleic acid sequence encoding the 1-1 polypeptide is a codon optimized nucleic acid sequence, for example, where the codon optimized nucleic acid sequence has reduced CpG content or reduced CpG islands as compared to the wild-type reference sequence of a SEQ ID NO: 1, or a fragment thereof.
  • the nucleic acid sequence encoding the I- 1 polypeptide is a codon optimized nucleic acid sequence selected from any of: SEQ ID NO: 385-412 or a nucleic acid sequence at least 80%, or at least 85%, or at least 90% or at least 95% or at least 98% sequence identity to SEQ ID NO: 385-412.
  • the rAAV vector can comprise at least one ITR located 5’ of the nucleic acid sequence encoding a Phosphatase inhibitor (1-1) polypeptide operably linked to the cardiac-specific promoter or muscle-specific promoter. In some embodiments of all aspects disclosed herein, the rAAV vector can comprise at least two ITRs flanking the nucleic acid sequence encoding a Phosphatase inhibitor (1-1) polypeptide operably linked to the cardiac-specific promoter or muscle-specific promoter.
  • ITR sequence known to a person of ordinary skill in the art can be used, and includes, but is not limited to an ITR sequences selected from any one or more of: SEQ ID NO: 70-78, or a nucleic acid sequence having at least 85%, or at least 90% or at least 95% or at least 98% sequence identity to SEQ ID NOS: 70-78.
  • the AAV vector comprises a reverse poly A sequence or double stranded RNA termination element, wherein the reverse polyA sequence or double stranded termination element are located 3 ’ of the nucleic acid sequence encoding a Phosphatase inhibitor (1-1) polypeptide.
  • the reverse poly A sequence, or double stranded RNA termination element is located between 3’ of the nucleic acid sequence encoding a Phosphatase inhibitor (1-1) polypeptide and 5’ of the right ITR.
  • the AAV vector further comprising a polyA sequence selected from any of SV40 polyA (SEQ ID NO: 334), HGH poly A (SEQ ID NO: 66), SEQ ID NO: 284-287, SEQ ID NO 331-335, or a nucleic acid sequence at least 85%, or at least 90% or at least 95% or at least 98% sequence identity to SEQ ID NOS: 334, 66, 284-287 or 331-335, wherein the polyA sequence is located 3’ of the nucleic acid sequence encoding a Phosphatase inhibitor (1-1) polypeptide.
  • the AAV vector can further comprise a nucleic acid sequence encoding at least one immune modulator and/or a vasodilator, as disclosed herein.
  • the rAAV vector can be present in a composition or solution, where the solution further comprises an immune modulator.
  • the rAAV vector can be present in a composition or solution, where the solution further comprises a vasodilator.
  • AAV adeno-associated virus
  • a pharmaceutical composition comprising: (i)adeno-associated virus (AAV) vector comprising a nucleic acid sequence encoding a Phosphatase inhibitor (1-1) polypeptide operably linked to any one of: (a) a cardiac-specific promoter selected from Table 2A or a variant thereof, (b) a muscle-specific promoter active in cardiac and skeletal muscle, or (c) any promoter when a cardiac tissue specific enhancer is present, or a variant thereof; and a pharmaceutically acceptable carrier.
  • AAV adeno-associated virus
  • the muscle -specific promoter active in cardiac and skeletal muscle is selected from Table 5 A or Table 13A or a variant thereof, e.g., a variant comprising a nucleic acid sequence having at least at least 85%, or at least 90% or at least 95% or at least 98% sequence identity to a promoter listed in Table 5A or Table 13A.
  • the AAV is selected from the group consisting of adeno-associated virus-1 (AAV1), AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAV2i8.
  • AAV1 adeno-associated virus-1
  • the AAV comprises a capsid that detargets the liver, as disclosed herein.
  • the AAV is AAV2i8.
  • the pharmaceutical composition comprises a AAV which comprises a nucleic acid selected from the group consisting of SEQ ID NO: 413-440, or a nucleic acid sequence at least 80%, or at least 85%, or at least 90% or at least 95% or at least 98% sequence identity sequence to a sequence selected from SEQ ID NO: 413-440, wherein the nucleic acids set forth in SEQ ID NO: 413-440 comprise a CMV promoter of SEQ ID NO: 330, wherein the CMV promoter of SEQ ID NO: 330 is replaced by any of: (a) a cardiac-specific promoter selected from Table 2A or a variant thereof (e.g., a variant comprising a nucleic acid sequence having at least at least 85%, or at least 90% or at least 95% or at least 98% sequence identity to a promoter listed in Table 2A), (b) a muscle-specific promoter active in cardiac and skeletal muscle, or (c) any promoter when a cardiac tissue specific enhancer is present,
  • the pharmaceutical composition comprises a vasodilator. In some embodiments, the pharmaceutical composition comprises an immune modulator.
  • the pharmaceutical composition comprises AAV vector comprises a nucleic acid sequence encoding a 1-1 polypeptide is selected from: (a) a nucleic acid sequence encoding a polypeptide comprising amino acids 1-65 of SEQ ID NO: 1, wherein threonine (T) at position 35 of SEQ ID NO: 1 is replaced with an amino acid that is not T, (b) a nucleic acid sequence encoding a polypeptide comprising amino acids 1-65 of SEQ ID NO: 1, wherein threonine (T) at position 35 of SEQ ID NO: 1 is replaced with an acid amino acid selected from any of: aspartic acid (D), glutamic acid (E), asparagine (N), glutamine (Q), (c) a nucleic acid sequence encoding a polypeptide comprising amino acids 1-65 of SEQ ID NO: 1, wherein threonine (T) at position 35 of SEQ ID NO: 1 is replaced with aspartic acid (D
  • the pharmaceutical composition comprises a rAAV which encodes a I-lc polypeptide selected from: amino acids 1-54 of SEQ ID NO: 1, amino acids 1- 61 of SEQ ID NO: 1, amino acids 1-65 of SEQ ID NO: 1, amino acids 1-66 of SEQ ID NO: 1, amino acids 1-67 of SEQ ID NO: amino acids 1 or 1-77 of SEQ ID NO: 2, or a functional variant thereof, wherein the threonine at position 35 of SEQ ID NO: 1 is replaced with an aspartate acid (T35D), or a conservative amino acid of aspartate.
  • T35D aspartate acid
  • the pharmaceutical composition comprises a nucleic acid sequence encoding the 1-1 polypeptide which is a codon optimized nucleic acid sequence, for example, where the codon optimized nucleic acid sequence has reduced CpG content or reduced CpG islands as compared to the wild-type reference sequence of a SEQ ID NO: 1, or a fragment thereof.
  • the nucleic acid sequence encoding the I- 1 polypeptide is a codon optimized nucleic acid sequence selected from any of: SEQ ID NO: 385-412 or a nucleic acid sequence at least 80%, or at least 85%, or at least 90% or at least 95% or at least 98% sequence identity to SEQ ID NO: 385-412.
  • Another aspect of the technology described herein relates to the use of an AAV vector as disclosed herein, for the manufacturer of a pharmaceutical composition for the treatment of a subject having cardiomyopathy.
  • the subject with cardiomyopathy to be treated has non-ischemic heart failure and/or non-ischemic cardiomyopathy.
  • the subject with cardiomyopathy has a congenital cardiomyopathy or a genetic disorder with a cardiac manifestation, for example, a genetic disorder with a cardiac manifestation as disclosed herein, which includes, but is not limited to a disease or disorder selected from the group consisting of: Arrhythmogenic right ventricular cardiomyopathy, Atrial myxoma, familial, Atrial septal defect ostium primum, Atrial septal defect sinus venosus, Barth syndrome, muscular dystrophy, Buerger disease, Cardioencephalomyopathy, Chromosome lp36 deletion syndrome, Congenital generalized lipodystrophy type 4 , Congenital heart block, Dilated cardiomyopathy, Duchenne muscular dystrophy (DMD), Fabry disease, Familial atrial fibrillation, Familial dilated cardiomyopathy, Familial hypertrophic cardiomyopathy , Familial progressive cardiac conduction defect, Familial thoracic aortic aneurys
  • a genetic disorder with a cardiac manifestation which includes, but is not
  • the rAAV as disclosed herein can be used to treat a subject with cardiomyopathy who has an ischemic cardiomyopathy.
  • the rAAV as disclosed herein can be used to treat a subject with cardiomyopathy who has heart failure, for example, where the subject with heart failure has a classification of heart failure based upon a classification system used by the American Heart Association (AHA), the American College of Cardiology (ACC) or the New York Heart Association (NYHA), or an equivalent classification thereof.
  • AHA American Heart Association
  • ACC American College of Cardiology
  • NYHA New York Heart Association
  • the rAAV as disclosed herein can be used to treat a subject with heart failure, e.g., where the subject with heart failure has a classification of a class III or above class III in the New York Heart Association (NYHA) classification system.
  • NYHA New York Heart Association
  • AAV vector as disclosed herein, for the manufacturer of a pharmaceutical composition for the treatment of a subject having a condition or disease associated with heart failure.
  • the subject has a classification of congestive heart failure (CHF) or heart failure (HF), for example, but not limited to a classification is based upon a classification system used by the American Heart Association (AHA), the American College of Cardiology (ACC) or the New York Heart Association (NYHA), or an equivalent classification system as disclosed herein.
  • AHA American Heart Association
  • ACC American College of Cardiology
  • NYHA New York Heart Association
  • the subject has non-ischemic heart failure or non-ischemic cardiomyopathy.
  • the subject has ischemic heart failure or ischemic cardiomyopathy.
  • the subject being treated according to the methods and compositions as disclosed herein has a reduced ejection fraction (rEF or HFrEF).
  • the cell comprising a AAV vector as disclosed herein.
  • the cell is a cardiac cell or a muscle cell, and in some embodiments, the cell is in cell culture (i.e., in vitro), and in some embodiments, the cell is present in a subject (e.g., in vivo).
  • AAV vector as disclosed herein, or a pharmaceutical formulation as disclosed herein, or a cell as disclosed herein, for use in the treatment of a subject having cardiomyopathy.
  • the delivery of the rAAV vector disclosed herein is cells which are non-mitotic, (e.g., cardiomyocytes). Accordingly, transgene expression can persist for the life of the cell, after at least 1 dose.
  • AAV vector as disclosed herein, or a pharmaceutical formulation as disclosed herein, or a cell as disclosed herein, for use in the treatment of a patient having heart failure.
  • the AAV vector for use according to the methods disclosed herein is administered to a subject who has a classification of congestive heart failure (CHF), e.g., where the classification is based upon a classification system used by the American Heart Association (AHA), the American College of Cardiology (ACC) or the New York Heart Association (NYHA), or an equivalent classification system thereof.
  • CHF congestive heart failure
  • the subject has non-ischemic heart failure or non-ischemic cardiomyopathy. In some embodiments of all aspects of the compositions and methods as disclosed herein, the subject has ischemic heart failure or ischemic cardiomyopathy. In some embodiments of all aspects of the compositions and methods as disclosed herein, the subject has reduced ejection fraction (rEF or HFrEF).
  • rEF ejection fraction
  • the subject with heart failure has a cardiovascular disease or heart disease is selected from any of: congestive heart failure (CHF), left ventricular remodeling, peripheral arterial occlusive disease (PAOD), dilated cardiomyopathy (DCM) including idiopathic dilated cardiomyopathy (IDCM), coronary artery disease, ischemia, arrhythmia, myocardial infarction (MI), abnormal heart contractility, acute (decompensated) heart failure (AHF), abnormal Ca2+ metabolism, myocardial ischemia, atherosclerosis, cardiomyopathy, idiopathic cardiomyopathy, genetic disorder induced cardiomyopathy, cardiac arrhythmias, muscular dystrophy, muscle mass abnormality, muscle degeneration, infective myocarditis, drug- or toxin-induced muscle abnormalities, hypersensitivity myocarditis, an autoimmune endocarditis and congenital heart disease and pulmonary heart hypertension.
  • CHF congestive heart failure
  • PAOD peripheral arterial occlusive disease
  • DCM dilated
  • the subject has one or more of: (a) non-ischemic heart failure; (b) non-ischemic cardiomyopathy, (c) a classification of congestive heart failure (CHF) is based upon a classification system used by the American Heart Association (AH), the American College of Cardiology (ACC) or the New York Heart Association (NYHA) or an classification using an equivalent classification system; or (d) a reduced ejection fraction (rEF or HFrEF).
  • CHF congestive heart failure
  • AH American Heart Association
  • ACC American College of Cardiology
  • NYHA New York Heart Association
  • rEF reduced ejection fraction
  • Another aspects of the technology disclosed herein relates to a method of expressing a phosphatase inhibitor (1-1) polypeptide in a subject with cardiomyopathy, the method comprising introducing into the subject with cardiomyopathy, at least one dose of the AAV vector according to the methods as disclosed herein, where the subject with cardiomyopathy has a classification of heart failure, and where the at least one dose of the rAAV is selected from a total dose-range of about 10 13 vg to about 10 15 vg, and where at least twelve months post-administration there is an improvement in the classification of heart failure.
  • the classification of heart failure is based upon a classification system used by the American Heart Association (AH), the American College of Cardiology (ACC) or the New York Heart Association (NYHA), or an equivalent classification system.
  • AH American Heart Association
  • ACC American College of Cardiology
  • NYHA New York Heart Association
  • AH American Heart Association
  • ACC American College of Cardiology
  • NYHA New York Heart Association
  • the rAVV is administered with an immune modulator concurrent with, or before, or after the administration of the at least one dose of a rAAV vector. In some embodiments of all aspects of the methods as disclosed herein, the rAVV is administered with a vasodilator concurrent with, and/or before, and/or after the administration of the at least one dose of a rAAV vector.
  • administration of the rAAV is into the lumen of the coronary artery of the heart of the patient. In some embodiments where administration of the rAAV is for treatment of a subject with ischemic cardiomyopathy, administration is directly into the muscle of the heart, e.g., into the ischemic cardiac muscle or MI. [00100] In some embodiments of all aspects of the methods as disclosed herein, administration of at least one dose of the rAAV is a total dose-range of about 10 13 vg to about 10 15 vg., and can be administered in one dose or 2 to 5 sub-doses.
  • the total dose is administered as any of the following administration methods: (a) over a period of time of about 20 minutes to about 30 minutes, (b) administered in a series of sub-doses, wherein each sub-dose is administered over a period of time of about 1 minute to about5 minutes, and (c) administered in a series of five sub-doses, each sub-dose is administered over a period of time of aboutl minute to about 5 minutes, and wherein the five sub-doses are administered over a period of about 20 minutes to about 30 minutes.
  • Another aspect of the technology described herein relates to a method of treating a patient having a heart failure, comprising: administering into heart cells of the patient, at least one total dose of a rAAV vector comprising a nucleic acid sequence encoding a phosphatase inhibitor protein that inhibits phosphatase activity, wherein, at least one total dose of the rAAV is selected from a dose-range of about 10 13 vg to about 10 15 vg, wherein, the total dose is administered over a period of time of about 20 minutes to about 30 minutes, wherein, the administration of the total dose is performed in sub-doses, wherein each sub-dose is administered over a period of time of 1-5 minutes.
  • the heart failure is selected from any one or more of: ischemia, arrhythmia, myocardial infarction, abnormal heart contractibility, or abnormal Ca2+ metabolism.
  • the rAAV vector further comprises CMV promoter or a synthetic promoter, operatively linked to the phosphatase inhibitor protein.
  • the synthetic promoter is a cardiac-specific promoter selected from Table 2A or a variant thereof, or a muscle-specific promoter active in cardiac and skeletal muscle selected from Table 5A or a variant thereof.
  • the synthetic promoter causes expression of the therapeutic nucleic acid or phosphatase inhibitor protein preferentially in smooth muscle cells.
  • the synthetic promoter causes expression of the therapeutic nucleic acid or phosphatase inhibitor protein preferentially in cardiac cells.
  • the expression of the therapeutic nucleic acid or phosphatase inhibitor protein by the cardiac- or muscle-specific promoter is equivalent to, or greater than, the expression caused by CMV promoter.
  • the rAAV in the method for a method of treating a patient having a heart failure, is selected from the group consisting of AAV2, AAV6, AAV8, AAV9, AAV2i8, rhlO, AAV2.5 and AAV2G9. In some embodiments, the rAAV is AAV2i8 or AAV9. In some embodiments, the rAAV is selected from any AAV serotypes disclosed in Table 11.
  • the administration of the total dose is performed in five sub-doses, each sub-dose is administered over a period of time of 1-5 minutes. In some embodiments, the five sub-doses are administered over a period of about 20 minutes to about 30 minutes.
  • the at least one total dose of the rAAV is 10 13 vg, 3X10 13 vg, 10 14 vg, 3X10 14 vg, or, 10 15 vg.
  • at least one sub-dose of the rAAV is 10 13 vg, 3X10 13 vg, 10 14 vg, 3X10 14 vg, or, 10 15 vg.
  • at least one dose is a total dose-range of about 10 13 vg to about 10 15 vg., administered in 2 to 5 sub-doses.
  • the administration is into the lumen of the coronary artery of the heart of the patient.
  • the phosphatase inhibitor 1-1 comprises amino acids 1-65 of SEQ ID NO: 1 or a functional fragment thereof, wherein the threonine at position 35 of SEQ ID NO: 1 is replaced with an aspartate acid (T35D).
  • the nucleic acid encoding phosphatase inhibitor encodes a constitutively active fragment of 1-1 (I-lc) comprising a fragment of SEQ ID NO: 1, wherein the fragment is selected from: amino acids 1-54 of SEQ ID NO: 1, 1- 61 of SEQ ID NO: 1, 1-65 of SEQ ID NO: 1, 1-66 of SEQ ID NO: 1, 1-67 of SEQ ID NO: 1 or 1-77 of SEQ ID NO: 1, or a functional variant thereof, wherein the threonine at position 35 of SEQ ID NO: 1 is replaced with an aspartate acid (T35D).
  • I-lc constitutively active fragment of 1-1
  • AAV adeno-associated virus
  • AAV vector comprising a nucleic acid sequence encoding a polypeptide comprising at least amino acids 1-54 of SEQ ID NO: 1, wherein threonine at amino acid 35 of SEQ ID NO: 1 is replaced with an aspartic acid, and wherein said nucleic acid sequence is operably linked to a promoter selected from any of: a CMV promoter, a cardiac-specific promoter selected from Table 2A or a variant thereof, or a muscle-specific promoter active in cardiac and skeletal muscle selected from Table 5A or a variant thereof.
  • a promoter selected from any of: a CMV promoter, a cardiac-specific promoter selected from Table 2A or a variant thereof, or a muscle-specific promoter active in cardiac and skeletal muscle selected from Table 5A or a variant thereof.
  • the polypeptide is selected from: amino acids 1-54 of SEQ ID NO: 1, amino acids 1-61 of SEQ ID NO: 1, amino acids 1-65 of SEQ ID NO: 1, amino acids 1-66 of SEQ ID NO: 1, amino acids 1-67 of SEQ ID NO: amino acids 1 or 1-77 of SEQ ID NO: 2, or a functional variant thereof, wherein the threonine at position 35 of SEQ ID NO: 1 is replaced with an aspartate acid (T35D).
  • the rAAV is selected from the group consisting of AAV2, AAV6, AAV8, AAV9, AAV2i8, rhlO, AAV2.5 and AAV2G9.
  • the rAAV is AAV2i8 or AAV9.
  • the rAAV is selected from any AAV serotypes disclosed in Table 11.
  • AAV adeno-associated virus
  • T35D aspartic acid
  • the rAAV vector of the pharmaceutical composition comprises a nucleic acid sequence encoding a polypeptide selected from: amino acids 1-54 of SEQ ID NO: 1, amino acids 1-61 of SEQ ID NO: 1, amino acids 1-65 of SEQ ID NO: 1, amino acids 1-66 of SEQ ID NO: 1, amino acids 1- 67 of SEQ ID NO: amino acids 1 or 1-77 of SEQ ID NO: 2, or a functional variant thereof, wherein the threonine at position 35 of SEQ ID NO: 1 is replaced with an aspartate acid (T35D).
  • T35D aspartate acid
  • the rAAV in the pharmaceutical composition is selected from the group consisting of AAV2, AAV6, AAV8, AAV9, AAV2i8, rhlO, AAV2.5 and AAV2G9.
  • the rAAV is AAV2i8 or AAV9.
  • the rAAV is selected from any AAV serotypes disclosed in Table 11.
  • the method can be performed more than once.
  • the patient can be administered the rAAV vector at a first time point, and for example, after about 3 months, or after about 6 months, or after about 12-months, or after about 2 years, or after about 3 years, the patient can be administered the rAAV vector according to the methods disclosed herein a second time.
  • the subject or patient can be administered the rAAV vector according to the methods as disclosed herein multiple times, e.g., at least 2, or at least 3, or at least 4, or at least 5 or at least 6 or more than 6 times according to the methods disclosed herein.
  • FIG. 1 shows in vivo expression of the luciferase gene in heart tissue (cardiac muscle) from the muscle specific promoter SP0067, as compared to other control promoters (CBA and CK8b intron), or a saline control.
  • FIG. 2 shows in vivo expression of luciferase gene in Tibialis Anterion (TA) muscle from the muscle specific promoter SP0067, as compared to other control promoters (CBA and CK8b intron), or a saline control.
  • TA Tibialis Anterion
  • FIG. 3 shows the in vivo expression of luciferase gene from synthetic cardiac-specific promoter SP0067 in diaphragm (diaph), quadriceps (Quad), tibialis anterior (TA), heart, intestine and liver.
  • SP0067 is active in vivo in heart muscle but not active in skeletal muscles (diaphragm (diaph), quadriceps (Quad), tibialis anterior (TA)).
  • SP0067 also has some in vivo activity in liver.
  • FIG. 4A-4B shows the average in vitro expression of synthetic cardiac-specific promoters in human cardiac and skeletal muscle cells (H9C2 or H2K cells).
  • FIG. 4A shows expression of a marker gene in a pAAV-SYNP vector operatively linked to SP0067, SP0424 or SP0425 synthetic promoters in H2K mouse skeletal muscle cells, where H2K cells have been differentiated into skeletal muscle myotubes, where the data is normalised to the activity of the known promoter CBA. A relative activity of 1 is equal to the activity of CBA. The error bar is standard deviation.
  • FIG. 4A shows expression of a marker gene in a pAAV-SYNP vector operatively linked to SP0067, SP0424 or SP0425 synthetic promoters in H2K mouse skeletal muscle cells, where H2K cells have been differentiated into skeletal muscle myotubes, where the data is normalised to the activity of the known promoter CBA. A relative activity of 1 is equal to the activity of CBA
  • FIG. 4B shows the average expression of a marker gene in a pAAV-SYNP vector operatively linked to SP0067, SP0424, SP0425, SP0429, SP0430, SP0344, SP0433, SP0435, SP0436 synthetic promoters in H9C2 rat cardiomyocyte cells, where H9C2 cells have been differentiated into cardiac muscle (heart) myotubes, and normalised to the activity of the known promoter CBA. A relative activity of 1 is equal to the activity of CBA.
  • the error bar is standard deviation. The error is standard deviation of at least three replicate experiments.
  • FIGS. 5A-5F shows in vivo activity of synthetic muscle specific promoters that are active in skeletal and cardiac muscle.
  • FIG. 5A shows the in vivo activity of synthetic muscle specific promoters, the control promoters CBA and CK8 as well as saline negative control in the heart.
  • FIG. 5B shows the in vivo activity of synthetic muscle specific promoters, the control promoters CBA CK8 as well as saline negative control in the diaphragm.
  • FIG. 5C shows the in vivo activity of synthetic muscle specific promoters, the control promoters CBA and CK8 as well as saline negative control in the quadriceps.
  • FIG. 5A shows the in vivo activity of synthetic muscle specific promoters, the control promoters CBA and CK8 as well as saline negative control in the quadriceps.
  • FIG. 5D shows the in vivo activity of synthetic muscle specific promoters, the control promoters CBA and CK8 as well as saline negative control in the intestine.
  • FIG. 5E shows the in vivo activity of synthetic muscle specific promoters, the control promoters CBA and CK8 as well as saline negative control in the tibialis anterior.
  • FIG. 5F shows the in vivo activity of synthetic muscle specific promoters, the control promoters CBA and CK8 as well as saline negative control in the liver.
  • FIGS. 6A-6K shows in vivo activity of exemplary synthetic muscle specific promoters SP0173, SP0270, SP0268, SP0320, SP0279, SP0134, SP0057, SP0229, SP0067, SP0310 and SP0267 that are active in cardiac and skeletal muscle.
  • FIG. 6A shows the in vivo activity of synthetic muscle specific promoter SP0173 in the diaphragm, heart, intestine, liver, quadriceps (quad) and tibialis anterior (TA).
  • FIG. 6B shows the in vivo activity of synthetic muscle specific promoter SP0270 in the diaphragm, heart, intestine, liver, quadriceps (quad) and tibialis anterior (TA).
  • FIG. 6C shows the in vivo activity of synthetic muscle specific promoter SP0268 in the diaphragm, heart, intestine, liver, quadriceps (quad) and tibialis anterior (TA).
  • FIG. 6D shows the in vivo activity of synthetic muscle specific promoter SP0320 in the diaphragm, heart, intestine, liver, quadriceps (quad) and tibialis anterior (TA).
  • FIG. 6E shows the in vivo activity of synthetic muscle specific promoter SP0279 in the diaphragm, heart, intestine, liver, quadriceps (quad) and tibialis anterior (TA).
  • FIG. 6F shows the in vivo activity of synthetic muscle specific promoter SP0134 in the diaphragm, heart, intestine, liver, quadriceps (quad) and tibialis anterior (TA).
  • FIG. 6G shows the in vivo activity of synthetic muscle specific promoter SP0057 in the diaphragm, heart, intestine, liver, quadriceps (quad) and tibialis anterior (TA).
  • FIG. 6H shows the in vivo activity of synthetic muscle specific promoter SP0229 in the diaphragm, heart, intestine, liver, quadriceps (quad) and tibialis anterior (TA).
  • FIG. 61 shows the in vivo activity of synthetic muscle specific promoter SP0067 in the diaphragm, heart, intestine, liver, quadriceps (quad) and tibialis anterior (TA).
  • FIG. 6J shows the in vivo activity of synthetic muscle specific promoter SP0310 in the diaphragm, heart, intestine, liver, quadriceps (quad) and tibialis anterior (TA).
  • FIG. 6K shows the in vivo activity of synthetic muscle specific promoter SP0267 in the diaphragm, heart, intestine, liver, quadriceps (quad) and tibialis anterior (TA).
  • FIG. 7A-7P shows in vivo activity of exemplary synthetic cardiac muscle specific promoters SP0067, SP0451, SP0452, SP0430, SP0450, SP0429, SP0424, SP0435, SP0436, SP0433, SP0449, SP0344, SP0475 that are active in cardiac muscle, in selected tissues (liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), as compared to the muscle specific promoters CK8, or cardiac specific promoters control 1 or control 2.
  • FIG. 1 shows in vivo activity of exemplary synthetic cardiac muscle specific promoters SP0067, SP0451, SP0452, SP0430, SP0450, SP0429, SP0424, SP0435, SP0436, SP0433, SP0449, SP0344, SP0475 that are active in cardiac muscle, in selected tissues (liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus,
  • FIG. 7A shows the in vivo activity of the exemplary comparison liver promoter CK8 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing liver expression at IxlO 5 RLU/mg and heart expression at IxlO 6-7 RLU/mg.
  • FIG. 7B shows the in vivo activity of the cardiac muscle promoter SP0067 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing specific expression in the heart at IxlO 5 RLU/mg and lower expression in skeletal or smooth muscle tissues, and also lower expression in liver at IxlO 4 RLU/mg.
  • FIG. 7C shows the in vivo activity of the cardiac muscle promoter SP0344 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing specific expression in the heart at about IxlO 7 RLU/mg and lower expression in skeletal or smooth muscle tissues.
  • FIG. 7C shows the in vivo activity of the cardiac muscle promoter SP0344 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing specific expression in the heart at about IxlO 7 RLU/mg and lower expression in skeletal or smooth muscle tissues.
  • FIG. 7D shows the in vivo activity of the cardiac muscle promoter SP0424 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing very specific expression in the heart at IxlO 7 to IxlO 8 RLU/mg and lower expression at about IxlO 4 RLU/mg in the liver and skeletal or smooth muscle tissues.
  • FIG. 7D shows the in vivo activity of the cardiac muscle promoter SP0424 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing very specific expression in the heart at IxlO 7 to IxlO 8 RLU/mg and lower expression at about IxlO 4 RLU/mg in the liver and skeletal or smooth muscle tissues.
  • FIG. 7E shows the in vivo activity of the cardiac muscle promoter SP0429 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing very specific expression in the heart at IxlO 8 RLU/mg and lower expression at about IxlO 4 to about IxlO 5 RLU/mg in the liver and skeletal or smooth muscle tissues.
  • FIG. 7F shows the in vivo activity of the cardiac muscle promoter SP0430 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing very specific expression in the heart at IxlO 8 RLU/mg and lower expression at about IxlO 4 to about IxlO 5 RLU/mg in the liver and skeletal or smooth muscle tissues.
  • FIG. 7G shows the in vivo activity of the cardiac muscle promoter SP0433 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing specific expression in the heart at IxlO 7 RLU/mg and lower expression in skeletal or smooth muscle tissues and in the liver.
  • FIG. 7H shows the in vivo activity of the positive control cardiac muscle promoter control 1 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing expression in the heart at IxlO 7 RLU/mg and lower expression in skeletal or smooth muscle tissues, and in the liver tissue.
  • FIG. 7G shows the in vivo activity of the cardiac muscle promoter SP0433 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing specific expression in the heart at Ixl
  • FIG. 71 shows the in vivo activity of the cardiac muscle promoter SP0435 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing very specific expression in the heart at between IxlO 7 and IxlO 8 RLU/mg and lower expression at about IxlO 4 RLU/mg in the liver and skeletal or smooth muscle tissues.
  • FIG. 7 J shows the in vivo activity of the cardiac muscle promoter SP0436 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing expression in the heart at IxlO 7 RLU/mg and expression levels below about IxlO 4 and IxlO 6 RLU/mg in the liver and skeletal or smooth muscle tissues.
  • FIG. 7K shows the in vivo activity of the positive control cardiac muscle promoter control 2 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing very specific expression in the heart at 1.5xl0 6 RLU/mg and expression levels below about IxlO 4 in skeletal or smooth muscle tissues.
  • FIG. 7K shows the in vivo activity of the positive control cardiac muscle promoter control 2 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing very specific expression in the heart at 1.5xl0 6 RLU/mg and expression levels below about IxlO 4 in skeletal or smooth muscle tissues.
  • FIG. 7L shows the in vivo activity of the cardiac muscle promoter SP0449 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing expression in the heart at lxlO 7 RLU/mg and expression levels below about 1.5xl0 5 RLU/mg in the liver and skeletal or smooth muscle tissues.
  • FIG. 7L shows the in vivo activity of the cardiac muscle promoter SP0449 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing expression in the heart at lxlO 7 RLU/mg and expression levels below about 1.5xl0 5 RLU/mg in the liver and skeletal or smooth muscle tissues.
  • FIG. 7M shows the in vivo activity of the cardiac muscle promoter SP0450 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing very specific expression in the heart at l.OxlO 8 RLU/mg and expression levels below about 1x10 5 in the liver and skeletal or smooth muscle tissues.
  • FIG. 7M shows the in vivo activity of the cardiac muscle promoter SP0450 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing very specific expression in the heart at l.OxlO 8 RLU/mg and expression levels below about 1x10 5 in the liver and skeletal or smooth muscle tissues.
  • FIG. 7N shows the in vivo activity of the cardiac muscle promoter SP0451 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing specific expression in the heart at above l.OxlO 8 RLU/mg and expression levels below about 1.5xl0 5 in skeletal or smooth muscle tissues, and expression in liver is even below at about IX 10 4 RLU/mg.
  • FIG. 70 shows the in vivo activity of the cardiac muscle promoter SP0452 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing specific expression in the heart at above 1.OxlO 8 RLU/mg and expression levels below about 1.5xl0 5 in skeletal or smooth muscle tissues, and expression in liver at about 1.5xl0 4 RLU/mg.
  • FIG. 7P shows the in vivo activity of the cardiac muscle promoter SP0475 in the liver, heart, tibialis anterior (TA), quadriceps (Quad), soleus, and diaphragm (Diaph), showing expression in the heart at above IxlO 5 RLU/mg and expression levels below about 1.5xl0 4 RLU/mg in the liver and skeletal or smooth muscle tissues.
  • FIG. 8 shows the in vitro activity of synthetic muscle specific promoter SP0521 and SP4169 in the muscle cell line H9C2 as compared to CBA and CK8 control promoters.
  • This figure shows the average activity, normalized to the CBA promoter, of synthetic short muscle-specific promoters SP0521 and SP4769 in H9C2 cell line differentiated into heart myotubes.
  • the error bar is standard deviation from triplicate experiments.
  • AAV vectors for administration for cardiovascular diseases and disorders, heart disorders and diseases, including cardiomyopathy, heart failure and congestive heart failure (CHF).
  • the heart failure is non-ischemic heart failure or the subject has nonischemic cardiomyopathy.
  • the heart failure is ischemic heart failure or the subject has ischemic cardiomyopathy.
  • Non-ischemic heart failure includes genetic based and nutritionally caused failures.
  • aspects of the present invention are directed to novel methods of administration and novel rAAV compositions for the treatment of subjects with heart failure, including methods of administration comprising administering to a subject with a classification of heart failure a dose of a rAAV where upon at least 12-months after the administration the classification of the heart failure is improved by at least one, or at least two stages or classification levels.
  • the methods of administration disclosed herein can be used in combination with other agents, including but not limited to use of immunomodulators and/or vasodilators, as well as rAAV vectors comprising a codon optimized nucleic acid sequence to encode I-lc, and/or rAAV vectors comprising novel cardiac-specific muscle promoters.
  • a range of classification systems to categorize the extent of a subjects’ of heart failure can be used and are well known in the art, and includes but are not limited to American Heart Association (AHA), the American College of Cardiology (ACC), Minnesota LIVING WITH HEART FAILURE® Questionnaire (MLHFQ or, MLWHF), Kansas City Cardiomyopathy questionnaire (KCCQ), or the 2016 European Society of Cardiology guidelines (ESCG), the Japanese heart failure Society (JHFS) guidelines, The Japanese Circulation Society (JCS) Guidelines, or, the New York Heart Association (NYHA), or equivalent or modified assessments or combinations or merged assessments thereof.
  • AHA American Heart Association
  • ACC American College of Cardiology
  • ACC Minnesota LIVING WITH HEART FAILURE® Questionnaire
  • KCCQ Kansas City Cardiomyopathy questionnaire
  • ECG European Society of Cardiology guidelines
  • JHFS Japanese heart failure Society
  • JHFS The Japanese Circulation Society
  • NJHA The New York Heart Association
  • the methods of treating a subject with heart failure as disclosed herein, or administration methods as disclosed herein have been demonstrated to improve a subject’s classification of heart failure, within at 12-months post-administration of a rAAV disclosed herein, from, e.g., a category IV to a category III or less than category III, or for e.g., from a category III to a category II or less than category II, according to a heart failure classification system as disclosed herein.
  • the NYHA or the AHA or the ACC classifications are used, or any other comparative heart failure classification system known to a person of ordinary skill in the art.
  • the one aspect of the technology described herein generally relates to a method to administer a recombinant AAV (rAAV) vector, where the method is a single administration to the subject, where the single administration comprises at least 2, or 3, or 4, or 5 or more doses within the single administration. That is, stated differently, in some embodiments, the method comprises administering a rAAV vector to the subject in a single administration constituting multiple doses, e.g., using a bolus to administer a discrete amount over a specific time period in small sub-doses within that time period.
  • rAAV recombinant AAV
  • the single administration can also comprise the administration of rAAV from least 2, or 3, or 4, or 5 or more vials or, syringes, in which the delivery of the rAAV from each vial or, each syringe between 1-5 minutes, or more than 5 minutes.
  • an exemplary syringe can be a simple reciprocating pump consisting of a plunger (though in modem syringes, it is actually a piston) that fits tightly within a cylindrical tube called a barrel. The plunger is linearly pulled and pushed along the inside of the tube, allowing the syringe to take in and expel liquid or gas through a discharge orifice at the front (open) end of the tube.
  • the methods relate to administration of a rAAV vector to the heart.
  • the rAAV vector comprises a cardiacspecific promoter, for example, an exemplary cardiac-specific promoter disclosed in Tables 1-3 herein.
  • the rAAV vector is administered according to the disclosed methods for the treatment of cardiovascular conditions, heart failure or a heart disease or disorder.
  • the rAAV vector administered according to the methods disclosed herein is a rAAV vector comprises a nucleic acid encoding a therapeutic agent for treatment of heart failure, where the nucleic acid is operatively linked to a cardiac-specific promoter as disclosed in Tables 1-3.
  • the promoter can be a regulatable promoter, e.g., an inducible promoter or a repressible promoter, or a promoter with zinc- fingers, TALONS, etc., as known in the art.
  • the technology described herein relates to a method where administration of a single doses of a viral vector in sub-doses are intended as disclosed herein, and the viral vector is coadministered with an immune modulator, as disclosed herein.
  • rAAV recombinant AAV
  • PPI protein phosphatase 1
  • the technology described herein relates in general to a rAAV vector, or a rAAV genome for producing an inhibitor of PPI, e.g., a I- 1 polypeptide, or functional fragment or variant thereof, that is expressed in the heart, for example, human cardiac and skeletal muscle cells.
  • the technology relates to a rAAV vector for expressing a transgene in the heart, e.g., cardiac and smooth muscle cells.
  • the inhibitor of PP 1 is expressed under the control of cardiacspecific promoters (CSP) in a recombinant rAAV vector.
  • CSP cardiacspecific promoters
  • a rAAV vector that comprises a nucleotide sequence containing inverted terminal repeats (ITRs), a promoter, a heterologous gene, a poly- A tail and potentially other regulator elements for use to treat a cardiovascular condition, heart disorder or heart disease, such as heart failure, and further, for the treatment of heart failure, wherein the heterologous gene is an inhibitor of PPI and wherein the rAAV PPI inhibitor can be administered to a patient in a therapeutically effective dose that is delivered to the appropriate tissue and/or organ for expression of the heterologous gene and treatment of the disease.
  • ITRs inverted terminal repeats
  • the heterologous gene is an inhibitor of PPI
  • the rAAV PPI inhibitor can be administered to a patient in a therapeutically effective dose that is delivered to the appropriate tissue and/or organ for expression of the heterologous gene and treatment of the disease.
  • a rAAV vector that comprises in its genome the following in a 5’ to 3’ direction: 5’- and 3’-AAV inverted terminal repeats (ITR) sequences, and located between the 5’ and 3’ ITRs, a heterologous nucleic acid sequence encoding an inhibitor of protein phosphatase 1 (PPI), wherein the heterologous nucleic acid is operatively linked to a cardiacspecific promoter (CSP), for example, a cardiac specific promoter disclosed in Table 2A herein, or a functional variant thereof.
  • ITR inverted terminal repeats
  • PPI protein phosphatase 1
  • CSP cardiacspecific promoter
  • the a rAAV vector described herein is from any serotype.
  • the rAAV vector is a AAV3b serotype, including, but not limited to, an AAV3b265D virion, an AAV3b265D549A virion, an AAV3b549A virion, an AAV3bQ263Y virion, or an AAV3bSASTG virion (i.e., a virion comprising a AAV3b capsid comprising Q263A/T265 mutations).
  • the virion can be rational haploid, or a chimeric or any mutant, such as capsids can be tailored for increased update at a desired location, e.g., the heart.
  • Other capsids can include capsids from any of the known AAV serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, etc.
  • the rAAV vector comprises a liver specific capsid, e.g., a liver specific capsid selected from XL32 and XL32.1, as disclosed in WO2019/241324, which is incorporated herein in its entirety by reference.
  • the rAAV vector is a AAVXL32 or AAVXL32.1 as disclosed in WO2019/241324, which is incorporated herein in its entirety by reference.
  • Heart failure is a complex syndrome caused by the heart not functioning properly. Different types of heart failure are classified by specific characteristics, including symptoms and limitations of function. Heart failure can have identifiable or unknown causes. The diagnosis of heart failure, according to established guidelines, is based on criteria which include the presence of symptoms and signs, evidence of reduced cardiac function on diagnostic tests, and/or a favourable response to treatment.
  • One aspect of the technology disclosed herein is a method of treating a subject with heart failure with a rAAV, or where upon after 12-months or earlier after administration there is an improvement in at least one level of the subject’s classification of heart failure.
  • a subject can be assessed by a physician as going from, e.g., a category IV to a category III or less than category III, or for e.g., from a category III to a category II or less than category II, in one or more heart failure classification system, as disclosed herein.
  • the NYHA or the AHA or the ACC classifications are used, or any other comparative heart failure classification system known to a person of ordinary skill in the art.
  • Heart failure classification systems are well known in the art, and includes but are not limited to American Heart Association (AHA), the American College of Cardiology (ACC), Minnesota LIVING WITH HEART FAILURE® Questionnaire (MLHFQ), Kansas City Cardiomyopathy questionnaire (KCCQ), or the 2016 European Society of Cardiology guidelines (ESCG), the Japanese heart failure Society (JHFS) guidelines, The Japanese Circulation Society (JCS) Guidelines, or, the New York Heart Association (NYHA), or modified assessments or combinations or merged assessments thereof.
  • AHA American Heart Association
  • ACC American College of Cardiology
  • MLHFQ HEART FAILURE® Questionnaire
  • KCCQ Kansas City Cardiomyopathy questionnaire
  • ECG European Society of Cardiology guidelines
  • JHFS Japanese heart failure Society
  • JHFS The Japanese Circulation Society
  • NYHA New York Heart Association
  • New York Heart Association NYHA
  • One heart failure classification system useful in the methods disclosed herein is the NYHA classification system.
  • the NYHA New York Heart Association
  • the NYHA classifies HF into classes I, II, III, and IV based on symptom severity.
  • Yancy CW et al., Circulation 2013;128:e240-e327; Adapted from Dolgin M, Association NYH, Fox AC, Gorlin R, Levin RI, New York Heart Association. Criteria Committee.
  • Physicians can classify a subject’s heart failure according to the severity of their selfreported symptoms.
  • the classification system used most often is the New York Heart Association (NYHA) Functional Classification.
  • NYHA New York Heart Association
  • Symptom severity is compared to normal breathing, shortness of breath, and/or angina (chest pain or discomfort).
  • Classification of heart failure based on function during physical activity, often called exertion is often an important indicator of prognosis.
  • There are 4 classes or stages in the NYHA which are as follows:
  • Class I No limitation of physical activity, ordinary physical activity does not cause undue fatigue, palpitation, dyspnea (shortness of breath).
  • Class III Mode: Marked limitation of physical activity. Comfortable at rest. Less than ordinary activity causes fatigue, palpitation, or dyspnea.
  • Class IV severe: Symptoms of heart failure occur even at rest. Unable to carry on any physical activity without discomfort. If any physical activity is undertaken, discomfort increases.
  • Class I and II are typically considered mild heart failure, while class III and IV are considered more severe or advanced heart failure. A person can move back and forth between these classes as they are based on symptoms. When a patient has a heart failure exacerbation, they will have more symptoms and likely be a higher class, but when their symptoms are better controlled, they will be a lower class.
  • Table 1A New York Heart Association (NYHA) Classification classes/stages:
  • NYHA class III patient receiving rAAV administration as disclosed herein is improved to NYHA class II patient after 1 month, or, 2 months, or, 3 months, or, 4 months, or 5 months, or, 6 months, or, 7 months, or, 8 months, or, 9 months or, 12 months or, more months of post administration of rAAV dose.
  • NYHA class II patient receiving rAAV administration as disclosed herein is improved to NYHA class I patient after 1 month, or, 2 months, or, 3 months, or, 4 months, or 5 months, or, 6 months, or, 7 months, or, 8 months, or, 9 months or, 12 months or, more months of post administration of rAAV dose.
  • NYHA class III patient receiving rAAV administration as disclosed herein is improved to NYHA class I patient after 1 month, or, 2 months, or, 3 months, or, 4 months, or 5 months, or, 6 months, or, 7 months, or, 8 months, or, 9 months or, 12 months or, more months of post administration of rAAV dose.
  • NYHA class IV patient receiving rAAV administration as disclosed herein is improved to NYHA class III patient or, NYHA class II patient after 1 month, or, 2 months, or, 3 months, or, 4 months, or 5 months, or, 6 months, or, 7 months, or, 8 months, or, 9 months or, 12 months or, more months of post administration of rAAV dose.
  • One heart failure classification system useful in the methods disclosed herein is the ACC/AHA classification system.
  • the American College of Cardiology (ACC) and the American Heart Association (AHA) worked together to create another classification system that complements the NYHA approach. It considers people who do not yet have HF but are at high risk for developing it.
  • the ACC/AHA classifies heart failure on the disease progression, and classifies HF in stages A, B, C, D according to presence of HF symptoms and signs and cardiac structural changes. See, e.g., Yancy CW, et al., Circulation 2013 ; 128: e240-e327, and Hunt SA, et al., Circulation 2001;104:2996-3007.
  • the American College of Cardiology/American Heart Association (ACC/AHA) staging system defines four stages:
  • Stage B Structural heart disease but no symptoms of heart failure (pre-heart failure)
  • Stage C Structural heart disease and symptoms of heart failure
  • Stage D Refractory heart failure requiring specialized interventions
  • Table IB AHA/ACC 2013 - Staging System of the heart
  • the stages denote the level of risk for developing heart failure on through the development of advanced heart failure.
  • the stages are progressive and correlated to treatment plans. As heart failure worsens, the condition advances to the next stage. There is no reverting back through the stages. With treatment, progression through the stages may be delayed. Diagnostic considerations include evaluating when heart failure starts, where it develops, how it impairs function, and whether or not it can be effectively managed with treatment.
  • ACC/AHA Stage D patient receiving rAAV administration as disclosed herein is improved to ACC/AHA Stage C patient after 1 month, or, 2 months, or, 3 months, or, 4 months, or 5 months, or, 6 months, or, 7 months, or, 8 months, or, 9 months or, 12 months or, more months of post administration of rAAV dose.
  • ACC/AHA Stage C patient receiving rAAV administration as disclosed herein is improved to ACC/AHA Stage B patient after 1 month, or, 2 months, or, 3 months, or, 4 months, or 5 months, or, 6 months, or, 7 months, or, 8 months, or, 9 months or, 12 months or, more months of post administration of rAAV dose.
  • ACC/AHA Stage D patient receiving rAAV administration as disclosed herein is improved to ACC/AHA Stage C or B patient or, ACC/AHA Stage A patient after 1 month, or, 2 months, or, 3 months, or, 4 months, or 5 months, or, 6 months, or, 7 months, or, 8 months, or, 9 months or, 12 months or, more months of post administration of rAAV dose.
  • ACC/AHA Stage C patient receiving rAAV administration as disclosed herein is improved to ACC/AHA Stage B or stage A patient after 1 month, or, 2 months, or, 3 months, or, 4 months, or 5 months, or, 6 months, or, 7 months, or, 8 months, or, 9 months or, 12 months or, more months of post administration of rAAV dose.
  • Table 1C Comparison of the NYHA classification and the ACC/AHA guidelines (obtained from Haselhuhn et al., Cleveland Clinic Journal of Medicine February 2019, 86 (2) 123-139.)
  • the ACCF/AHA guidelines for the management of heart failure can also be used, which are developed in collaboration with the American Academy of Family Physicians, American College of Chest Physicians, and the International Society for Heart and Lung Transplant, disclosed in Yancy, Clyde W., et al. "2017 ACC/AHA/HFSA focused update of the 2013 ACCF/AHA guideline for the management of heart failure: a report of the American College of Cardiology /American Heart Association Task Force on Clinical Practice Guidelines and the Heart Failure Society of America.” Journal of the American College of Cardiology 70.6 (2017): 776-803, which is incorporated herein in its entirety by reference.
  • the 2017 focused update of the 2013 ACC/AHA guideline on heart failure contains important recommendations on prevention, novel biomarker uses, heart failure with preserved ejection fraction (HFpEF), and comorbidities such as hypertension, iron deficiency, and sleep-disordered breathing. Potential implications for management of acute decompensated heart failure will also be explored (see, e.g., Haselhuhn et al., Cleveland Clinic Journal of Medicine February 2019, 86 (2) 123-139.
  • HFpEF preserved ejection fraction
  • JHFS Japanese heart failure Society
  • KCCQ scores are scaled from 0 to 100 and frequently summarized in 25-point ranges, where scores represent health status as follows: 0 to 24: very poor to poor; 25 to 49: poor to fair; 50 to 74: fair to good; and 75 to 100: good to excellent as described in Spertus JA et al., JACC, Volume 76, Issue 20, 17 November 2020, Pages 2379-2390. Because the most common means of quantifying health status in clinical practice and trials is the NYHA functional class, it is valuable to appreciate what KCCQ scores correlate to which NYHA functional class.
  • NYHA functional class III/IV About 85% of patients with scores of 0 to 24 are NYHA functional class III/IV; 60% of patients with scores of 25 to 49 are NYHA functional class III; one-half of patients with scores of 50 to 75 are NYHA functional class III and one-half are NYHA functional class II; and of those with scores over 75, over 80% are NYHA functional class I or II.
  • Ejection Fraction Classifies HF in HFrEF, HFmrEF, HFpEF based on left ventricular ejection fraction Ponikowski P, et al., Eur J Heart Fail 2016;18:891-975.
  • Aetiology Classifies HF in stages specific aetiology of HF, e.g. ischaemic/non-ischaemic, valvular, hypertensive, infiltrative cardiomyopathy such as cardiac amyloidosis, peripartum cardiomyopathy, viral myocarditis, chemotherapy -induced cardiomyopathy, as disclosed in Yancy CW, et al., Circulation 2013;128:e240-e327 and Ponikowski P, et al., Eur J Heart Fail 2016;18:891-975.
  • aetiology Classifies HF in stages specific aetiology of HF, e.g. ischaemic/non-ischaemic, valvular, hypertensive, infiltrative cardiomyopathy such as cardiac amyloidosis, peripartum cardiomyopathy, viral myocarditis, chemotherapy -induced cardiomyopathy, as disclosed in Yancy CW, et al.,
  • MOGES classifies HF in levels of a morpho-fiinctional phenotype (M), organ(s) involvement (O), genetic inheritance pattern (G), etiological annotation (E) including genetic defect or underlying disease/substrate, and the functional status (S). See, e.g., Arbustini E, et al., The MOGE(S) classification of cardiomyopathy for clinicians. J Am Coll Cardiol 2014;64:304-318.
  • INTERMACS profiles of advanced HF
  • Assessment of heart failure can be categorized or classified using a variety of self-assessed questionnaires, e.g., selected from any of: Minnesota LIVING WITH HEART FAILURE® Questionnaire (MLHFQ, also known as MLWHF, LHFQ, MQOL)), (Rector et al.,); Chronic Heart failure Questionnaire (CHFQ, CHQ) (Guyatt et al., 1989); Quality of Life Questionnaire for Severe Heart Failure (QLQ-SHF or QQL-SHF) (Wiklund et al., 1987), Kansas city cardiomyopathy Questionnaire (KCCQ) (Spertus et al, 1999), and Left Ventricular Dysfunction Questionnaire-36 (LVD-36) (O’Learly et al., 1998), each of which are reviewed in Garin, Olatz, et al.
  • MLHFQ Minnesota LIVING WITH HEART FAILURE® Questionnaire
  • CHQ Chronic Heart failure Questionnaire
  • KCCQ
  • a clinically meaningful change in a Quality of Life (QOL) questionnaire is a 10 point decrease, or greater than 10 point decrease in the QOF Questionnaire score measured at least 6- months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the QOF Questionnaire score prior to administration of the rAAV to the subject.
  • a clinically meaningful change in a Quality of Life (QOL) questionnaire score is a 10- point decrease, or a 11-point decrease, or a 12-point decrease, or a 13-point decrease, or a 14-point decrease, or a 15-point decrease, or a 16-point decrease, or a 17-point decrease, or a 18-point decrease, or a 19-point decrease, or a 20-point decrease, or a 21 point decrease, or 22 point decrease, or 23 point decrease, or 24 point decrease, or 25 point decrease, or a greater than 25-point decrease in a QOL Questionaire score e.g., in KCCQ score or, in MLWHF score measured at least 3 months, or, at least 6- months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the ESV prior to administration of the rAAV to the subject.
  • QOL Quality of Life
  • the methods to treat HF as disclosed herein improvement in the at least one parameter from a baseline level in the patient where the at least one parameter is selected from the group consisting essentially of: (i) ejection fraction (EF or, interchangeably used as Left ventricular ejection fraction or, LVEF), (ii) end systolic volume (ESV), (iii) cardiac contractility, selected from ejection fraction (EF) and fractional shortening (FS), (iv) cardiac volumes selected from any of: end diastolic volume (DV) and end systolic volume (ESV), (iv) functional criteria, selected from any of: a 6-minute walk test (6MWT), exercise and V02max (also referred to as pV02max or myocardial oxygen consumption (MV02) (measured in ml/kg/min); (v) BNP level, (vi) Pro-BNP level, (vii) biomarker level, wherein the biomarker level is selected from the group of
  • a clinically meaningful change in End Systolic Volume is a 10% decrease, or greater than 10% decrease in ESV measured at least 1 month or, at least 3 months, or, at least 6-months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the ESV prior to administration of the rAAV to the subject.
  • a clinically meaningful change in ESV is a 10% decrease, or about 11%, or about 12%, or about 13%, or about 14%, or about 15%, or greater than a 15% decrease in ESV measured at least 3 months, or at least 6- months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the ESV prior to administration of the rAAV to the subject.
  • a clinically meaningful change in End Systolic Volume is a 20 ml decrease, or greater than 20 ml decrease in ESV measured at least 1 month, or, at least 3 months, or, at least 6-months, or at least 12- months after administration of the rAAV according to the methods as disclosed herein, as compared to the ESV prior to administration of the rAAV to the subject.
  • the method of treatment as disclosed herein can be assessed by measuring biomarkers, such as, e.g., circulating natriuretic peptide (either BNP or NT-proBNP) levels in the serum obtained from the subject after a pre-defined period of time, such as, for example, at least about 1, or 2, or 3, or 4, or 5, or 6, or 9, or, 12, or more months after administration.
  • biomarkers such as, e.g., circulating natriuretic peptide (either BNP or NT-proBNP) levels in the serum obtained from the subject after a pre-defined period of time, such as, for example, at least about 1, or 2, or 3, or 4, or 5, or 6, or 9, or, 12, or more months after administration.
  • the method of treatment or administration as disclosed herein can be assessed by measuring BNP and/or NT-proBNP levels in the serum before administration, and after a period of about 4-6 months, or after 6-months after administration, or after more than 6-months post-administration.
  • Acute heart failure is unlikely if the level of BNP in the serum from the subject is equal or less than lOOpg/ml or if the NT- proBNP in the serum from the subject is equal or less than 300pg/ml.
  • a diagnosis of HF is likely where the level of BNP in the serum from the subject is >400pg/ml or if the NT-proBNP in the serum from the subject is >450 pg/ml for subjects less than 50 years of age, or > 900 pg/ml for subjects between 50-75 years of age, or >1800 pg/ml for subjects >75 years of age.
  • a BNP level of equal or less than 400pg/ml in the serum of a treated patient at least 6 months after administration indicates effective treatment.
  • a NT-proBNP level of equal or less than 450pg/ml in the serum of a treated patient of less than 50 years of age at least 6 months after administration indicates effective treatment.
  • a NT-proBNP level of equal or less than 900pg/ml in the serum of a treated patient of 50-75 years of age at least 6 months after administration indicates effective treatment.
  • a NT-proBNP level of equal or less than 1700pg/ml in the serum of a treated patient of >75 years of age at least 6 months after administration indicates effective treatment.
  • a clinically meaningful change in NT-pro-BNP is a 35% decrease, or greater than 35% decrease in the level of NT-pro-BNP (pg/ml) measured at least 1 month, at least 3 months, or, at least 6-months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the level of level of NT-pro-BNP (pg/ml) measured prior to administration of the rAAV to the subject.
  • a clinically meaningful change in NT- pro-BNP is a 35% decrease, or about a 36%, or about a 37%, or about a 38%, or about a 39%, or about a 40%, or about a 40-45% or about a 46-50% decrease or a greater than a 50% decrease in the level of NT-pro-BNP (pg/ml) measured at least 1 month or, at least 3 months, or, at least 6-months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the level of of NT-pro-BNP (pg/ml) measured prior to administration of the rAAV to the subject.
  • a decrease of about 10%, or about 15%, or about 20%, or about 25%, or about 30% or >30% in BNP levels or NT-proBNP levels in the serum of a subject at least 3- months, or at least about 6-months after administration of the rAAV of as compared to levels of BNP or NT-proBNP levels pre-administration is indicative of effective treatment.
  • a decrease of about 0.1-fold, 0.2-fold, 0.3-fold, 0.4-fold, 0.5-fold, 0.6-fold, 0.7-fold, 0.8-fold, 0.9-fold, 1.0-fold, 1.1-fold, 1.2- fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, or 2.0-fold, or greater of 2.0-fold in the serum level of BNP or NT-proBNP in a subject at least 3- months, or at least about 6-months after administration of the rAAV of as compared to levels of BNP or NT-proBNP levels pre-administration is indicative of effective treatment.
  • an effective treatment is considered if the serum level of BNP in a subject (of any age) is less than 400pg/ml, or about 350pg/ml, or about 300pg/ml, or about 250pg/ml, or about 200pg/ml, or about 150pg/ml, or about lOOpg/ml, or less than lOOpg/ml at least 3- months, or at least about 6-months after administration of the rAAV of as compared to levels of BNP levels pre-administration.
  • an effective treatment is considered if the serum level of NT-proBNP in a subject aged less than 50 years of age is less than 450pg/ml, or about 400pg/ml, or about 350pg/ml, or about 300pg/ml, or about 250pg/ml, or about 200pg/ml, or about I50pg/ml, or about lOOpg/ml, or less than lOOpg/ml at least 3- months, or at least about 6-months after administration of the rAAV of as compared to levels of NT-proBNP levels pre-administration.
  • the age of the patient being treated is less than 50 years of age, or, between 50-75 years of age, or, >75 years of age.
  • an effective treatment is considered if the serum level of NT-proBNP in a subject aged between 50-75 years of age is less than 900pg/ml, or about 850pg/ml, or about 800pg/ml, or about 750pg/ml, or about 700pg/ml, or about 650pg/ml, or about 600pg/ml, or about 550pg/ml, or about 500pg/ml, or about 450pg/ml, or less than 450pg/ml at least 3- months, or at least about 6-months after administration of the rAAV of as compared to levels of NT-proBNP levels pre-administration.
  • the age of the patient being treated is less than 50 years of age, or, between 50-75 years of age, or, >75 years of age.
  • an effective treatment is considered if the serum level of NT-proBNP in a subject aged >75 years of age is less than about I800pg/ml, or about I700pg/ml, or about I600pg/ml, or about I500pg/ml, or about I400pg/ml, or about I300pg/ml, or about I200pg/ml, or about 1 lOOpg/ml, or about lOOOpg/ml, or about 900pg/ml, or about 800pg/ml, or about 700pg/ml, or about 600pg/ml, or about 500pg/ml, or about 450pg/ml or less than 450pg/ml at least 3- months, or at least about 6-months after administration of the rAAV of as compared to levels of NT-proBNP levels pre-administration.
  • the age of the patient being treated is less than 50 years of age
  • a clinically meaningful change in BNP is a 40% decrease, or greater than 40% decrease in the level of BNP (pg/ml) measured at least 6-months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the level of BNP (pg/ml) measured prior to administration of the rAAV to the subject.
  • a clinically meaningful change in BNP is a 40% decrease, or about a 41%, or about a 42%, or about a 43%, or about a 44%, or about a 45%, or about a 45-50% or about a 51-55% decrease, or a 56-60% decrease or a greater than a 60% decrease in the level of BNP (pg/ml) measured at least 1 month or, at least 3 months, or at least 6-months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the level of level of BMP (pg/ml) measured prior to administration of the rAAV to the subject.
  • Ejection Fraction (also interchangeably used with Left Ventricle Ejection Fraction (LVEF))
  • EF Ejection Fraction
  • LVEF Left Ventricle Ejection Fraction
  • cardiopulmonary exercise testing can be assessed using a modified Bruce protocol according to methods known in the art.
  • An observed and change from baseline in Echocardiographic assessment in Left Ventricular Ejection Fraction (LVEF) can also be used to assess the treatment, where the LVEF can be assessed at the following timepoints: before administration, 18-24 hours post administration, after 4 weeks, at about 6 months, and at about 12 months-post administration.
  • a clinically meaningful change in Ejection Fraction is a 5% increase, or greater than 5% increase in ejection fraction measured at least 1 month, or, at least 3 months, at least 6- months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the ejection fraction (EF) prior to administration of the rAAV to the subject.
  • a clinically meaningful change in Ejection Fraction is a 5% increase, or about 6%, or about 7%, or about 8%, or about 9%, or about 10%, or greater than a 10% increase in ejection fraction measured at least 1 month, or, at least 3 months, at least 6-months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the ejection fraction (EF) prior to administration of the rAAV to the subject.
  • the improved function may be an improvement of any amount as compared to the cardiac function of a matched control subject receiving vehicle only.
  • the improvement i.e., increase
  • the improvement in LVEF at least 3- or at least 6-months after administration of a rAAV vector according to the methods disclosed herein be about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more than about 200% as compared to the LVEF measured at or before the rAAV administration.
  • the improvement in E/A ratio after treatment may be about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more than about 200% as compared to the E/A ratio measured at or before the rAAV administration.
  • the improvement in left atrial volume (LAV) may be about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more than about 200% as compared to the level of LAV measured at or before the rAAV administration.
  • the rAAV vector and the administration methods is considered an effective treatment (e.g., see Dokainish, Glob Cardiol Sci Pract. 2015; 2015: 3).
  • a normal LVEF ranges from 50% to 75%, and a LVEF of below 53% for women and 52% for men is considered low, and a subject with a LVEF of 49% or less, or about 45%, or about 40%, or about 36%, or between 36-49% is indicative of heart failure.
  • the methods also include administration of a rAAV vector as disclosed herein, according to the methods as disclosed herein, to attenuate cardiac remodeling.
  • Cardiac remodeling may be measured by any method known in the art, including the methods, such as, e.g., echocardiography.
  • left ventricle chamber size may be used as a measure for cardiac remodeling.
  • an attenuation of the increase in size of the left ventricle may be an attenuation of any amount as compared with the left ventricle size before administration of a rAAV vector as disclosed herein, according to the methods as disclosed herein.
  • a clinically meaningful change in End Systolic Volume is a 10% decrease, or greater than 10% decrease in ESV measured at least 1 month, or, at least 3 months, at least 6- months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the ESV prior to administration of the rAAV to the subject.
  • a clinically meaningful change in ESV is a 10% decrease, or about 11%, or about 12%, or about 13%, or about 14%, or about 15%, or greater than a 15% decrease in ESV measured at least 1 month, or, at least 3 months, at least 6-months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the ESV prior to administration of the rAAV to the subject.
  • a clinically meaningful change in End Systolic Volume is a 20ml decrease, or greater than 20ml decrease in ESV measured at least 1 month, or, at least 3 months, at least 6- months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the ESV prior to administration of the rAAV to the subject.
  • a clinically meaningful change in ESV is a 20ml decrease, or about 22ml, or about 23ml or about 24ml, or about 25ml, or about 26ml, or about 27ml, or about 28ml, or about 29ml, or about 30ml, or greater than a 30ml decrease in ESV measured at least 1 month, or, at least 3 months, at least 6-months, or at least 12- months after administration of the rAAV according to the methods as disclosed herein, as compared to the ESV prior to administration of the rAAV to the subject.
  • an attenuation of the increase in size of the left ventricle may be an attenuation of any amount as compared with the left ventricle size of a matched control subject receiving vehicle only.
  • Left ventricle chamber size may be measured, for example, by assaying left ventricle end diastolic dimension (LVEDD) or left ventricle end systolic dimension (LVESD).
  • the change in LVEDD at least 3- or at least 6-months after administration with a rAAV vector as disclosed herein, according to the methods as disclosed herein may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more than about 200% as compared to the levels measured at, or before administration of the rAAV.
  • the change in LVESD at least 3- or at least 6-months after administration with a rAAV vector as disclosed herein, according to the methods as disclosed herein may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more than about 200% as compared to the LVESD level measured at, or before administration of the rAAV.
  • VO2max also referred to as pVO2max or myocardial oxygen consumption (MVO2)
  • the methods also include administration of a rAAV vector as disclosed herein, according to the methods as disclosed herein, to improve exercise capacity in a subject having congestive heart failure.
  • the improvement in exercise capacity may be measured by any method known in the art.
  • the improvement in exercise capacity may be measured by assaying peak VO2 uptake or exercise capacity to peak lactate ratio. Peak oxygen uptake during exercise may be measured, for example, by indirect calorimetry.
  • the change in exercise capacity to peak lactate ratio measured at least 3- or at least 6-months after administration with a rAAV vector as disclosed herein, according to the methods as disclosed herein may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more than about 200% as compared to the peak lactate ratio measured at, or before administration of the rAAV.
  • a clinically meaningful change in myocardial oxygen consumption is a 1.5ml/kg/min increase, or greater than 1.5ml/kg/min increase in MVO2 measured at least 1 month, or, at least 3 months, at least 6-months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the MVO2 measured prior to administration of the rAAV to the subject.
  • a clinically meaningful change in MV0 2 is a 1.5ml/kg/min increase, 1.6ml/kg/min, or about a 1.7ml/kg/min, or about 1.8ml/kg/min, or about 1.9ml/kg/min, or about 2.0ml/kg/min, or about 2. Iml/kg/min, or greater than a 2. Iml/kg/min increase in MVO2 measured at least 1 month, or, at least 3 months, at least 6-months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the MVO2 measured prior to administration of the rAAV to the subject.
  • the method of treatment as disclosed herein can be assessed by measuring a peak oxygen update (VO2), measured at least about 3, or 4, or 5, or 6 months or between 6-10 months, or 12 months after administration of the rAAV vector.
  • VO2 peak oxygen update
  • a modest pVO2 is indicative of an effect treatment - that is, a modest increase in peak VO2 over 3 months was associated with a more favourable outcome. Accordingly, monitoring the change in peak VO2 for treated subjects can be used to assess prognosis and therapeutic effect of the rAAV vector and method of administration.
  • post-administration peak VO2 is increased from baseline peak VO2 by about 2%, or, about 3%, or, about 4%, or, about 5%, or, about 6%, or, about 7%, or, about 8%, or, about 9%, or, about 10%, or, about 11%, or, about 12%, or, about 13%, or, about 14%, or, about 15%, or, about 16%, or, about 17%, or, about 18%, or, about 19%, or, about 20%, or, about 21%, or, about 22%, or, about 23%, or, about 24%, or, about 25%, or, about 26%, or, about 27%, or, about 28%, or, about 29%, or, about 30%.
  • post-administration peak VO2 is increased from baseline peak VO2 by at least 2%. In some embodiments, post-administration peak VO2 is increased from baseline peak VO2 by at least 5%. In other embodiments, post-administration peak VO2 is increased from baseline peak VO2 by at least 10%. In yet another embodiment, post-administration peak VO2 is increased from baseline peak VO2 by at least 20%. In certain embodiments, post-administration peak VO2 is increased from baseline peak VO2 by at least 30%.
  • post-administration peak VO2 is increased from baseline peak VO2 by about 1.1 fold, or, about 1.15 fold, or, about 1.2 fold, or, about 1.25 fold, or, about 1.3 fold, or, about 1.35 fold, or, about 1.4 fold, or, about 1.45 fold, or, about 1.5 fold, or, about 1.55 fold, or, about 1.6 fold, or, about 1.65 fold, or, about 1.7 fold, or, about 1.75 fold, or, about 1.8 fold, or, about 1.85 fold, or, about 1.9 fold, or, about 1.95 fold, or, about 2 fold, or, about 2.5 fold, or, about 3 fold, or, about 3.5 fold, or, about 4 fold, or, about 4.5 fold, or, about 5 fold, or, about 5.5 fold, or, about 6 fold, or, about 6.5 fold, or, about 7 fold, or, about 7.5 fold, or, about 8 fold, or, about 8.5 fold, or, about 9 fold, or, about 9.5 fold, or, about 10 fold.
  • post-administration peak VO2 is increased from baseline peak VO2 by at least 1.1 fold, or, at least 1.2 fold, or, at least 1.5 fold, or, at least 2 fold, or, at least 2.5 fold, or, at least 3 fold, or, at least 3.5 fold, or, at least 4 fold, or, at least 4.5 fold, or, at least 5 fold, or, at least 6 fold, or, at least 6.5 fold, or, at least 7 fold, or, at least 8 fold, or, at least 9 fold, or, at least 10 fold, or, at least 11 fold, or, at least 12 fold, or, at least 13 fold, or, at least 14 fold, or, at least 15 fold, or, at least 16 fold, or, at least 17 fold, or, at least 18 fold, or, at least 19 fold, or, at least 20 fold, or, at least 22 fold, or, at least 25 fold, or, at least 30 fold, or, at least 35 fold, or, at least 40 fold, or, at least 45 fold or, at least 50 fold.
  • the improved function may be an improvement of any amount as compared with the cardiac functioning prior to administration of a rAAV vector as disclosed herein, according to the methods as disclosed herein.
  • the method of treatment as disclosed herein can be assessed by measuring secondary outcome measures, e.g., assessing the subject in a 6-minute walk distance test (referred to as a 6-minute walk test (6MWT) at the following timepoints: before administration, 18-24 hours post administration, after 4 weeks, at about 6 months, and at about 12 months-post administration.
  • 6MWT 6-minute walk test
  • the 6-minute walk test can be performed at any of the above time points is improved from the baseline at least by 15m, or, at least by 20 m, or at least by 25 m, or, at least by 30 m, or at least by 40 m, or, at least by 50 m, or, at least by 55 m, or, at least by 60m, or, at least by 65 m, or, at least by 70 m, or, at least by 75 m, or, at least by 80 m, or, at least by 85 m, or, at least by 90 m, or, at least by 100 m, or, at least by 120 m, or, at least by 150 m, or, at least by 170 m, or at least by 180 m, or at least by 200 m, or more.
  • a clinically meaningful change in the 6MWT is a 50 meters increase, or greater than 50 meter increase in the distance walked in the 6MWT measured at least 1 month, or, at least 3 months, at least 6-months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the distance walked in the 6MWT prior to administration of the rAAV to the subject.
  • a clinically meaningful change in the 6MWT is a 50 meter increase, or an increase of about 60m, or about 70m, or about 80m, or about 90m, or about 100m, or about 110m, or about 120m, or about 130m, or about 140m, or about 150m, or an increase of greater than 150 meters in the distance walked in the 6MWT measured at least 1 month, or, at least 3 months, at least 6- months, or at least 12-months after administration of the rAAV according to the methods as disclosed herein, as compared to the distance walked in the 6MWT prior to administration of the rAAV to the subject.
  • Such a 6MWT can be conducted according to the methods as disclosed in Giannitsi et al., Ther Adv Cardiovas Disorders, 2019, 2019; 13: 1753944719870084, which is incorporated herein in its entirety by reference.
  • the methods also include administration of a rAAV vector as disclosed herein, according to the methods as disclosed herein, to improve cardiac contractility.
  • Improving cardiac contractility may include any increase in the number of cardiac myocytes available for contraction, the ability of cardiac myocytes to contract, or both.
  • any mode of assessment may be used. For example, clinical observation, such as an increase in cardiac output or a decrease in cardiac rate or both, may lead to a determination of increased cardiac contractility.
  • an increased contractility of the heart may be assessed by a determination of an increased fractional shortening of the left ventricle. Fractional shortening of the left ventricle may be observed by any available means such as echocardiograph.
  • the increase in fractional shortening of the left ventricle may be an increase of any amount as compared with the fractional shortening before administration of a rAAV vector as disclosed herein, according to the methods as disclosed herein.
  • the increase in shortening measured at least 3- or at least 6-months after administration with a rAAV vector according to the methods as disclosed herein can about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more than about 200% as compared to the levels of shortening measured at, or before the administration of rAAV.
  • prophylactic and therapeutic methods are provided. Treatment on an acute or chronic basis is contemplated.
  • treatment on an acute basis may be extended to chronic treatment, if so indicated.
  • a method for the treatment or prevention of a condition associated with congestive heart failure in a subject in need thereof generally comprises administering to the subject an amount of rAAV vector as disclosed herein, according to the methods as disclosed herein, effective to prevent or ameliorate congestive heart failure, wherein the condition associated with congestive heart failure is thereby improved.
  • the rAAV vector expresses an 1-1 protein or a functional variant thereof as disclosed herein in the heart of the subject in an amount effective to increase cardiac contractility and reduce morphological deterioration associated with cardiac remodeling in the subject with existing heart failure.
  • the increase in contractility is determined by increased myocyte shortening (myocyte length change), rates of myocyte cell shortening (dL/dt) and relengthening (-dL/dt), a lower time constant for relaxation (tau(.tau.)), and accelerated calcium signal decay.
  • the methods further comprise the identification of a subject in need of treatment. Any effective criteria may be used to determine that a subject may benefit from administration of a rAAV vector as disclosed herein, according to the methods as disclosed herein.
  • Methods for the diagnosis of heart disease and diabetes, for example, as well as procedures for the identification of individuals at risk for development of these conditions, are well known to those in the art. Such procedures may include clinical tests, physical examination, personal interviews and assessment of family history.
  • Biomarkers from blood can help detect the presence of HF, determine its severity, assess risk of future events, and guide the efficacy of the treatment of a rAAV according to the methods as disclosed herein. While BNP and Pro-BNP are commonly assessed biomarkers in classification of HF, other biomarkers can be used to further assess prognoses and effectiveness of a HF therapy.
  • a panel of biomarkers can be used to assess efficacy of treatment, as disclosed in US Patent 8,450,069, which is incorporated herein in its entirety by reference, including measuring levels of cTnl and/or BNP in combination with one or more and vascular inflammation markers, e.g., IL-6, TNFa, IL-17a.
  • vascular inflammation markers e.g., IL-6, TNFa, IL-17a.
  • biomarkers associated with HF are well recognized, and measuring their concentrations in circulation can be a convenient and non-invasive approach to provide important information about disease severity and helps in the detection, diagnosis, prognosis, and management of HF.
  • biomarkers include natriuretic peptides, soluble suppressor of tumorgenicity 2, highly sensitive troponin, galectin-3, midregional proadrenomedullin, cystatin-C, interleukin-6, procalcitonin, and others.
  • a biomarker is selected from the group of: troponin, serum creatinine, cystatin-C, or hepatic transaminases. Measurement of these biomarkers are disclosed in Chow, et al. "Role of biomarkers for the prevention, assessment, and management of heart failure: a scientific statement from the American Heart Association.” Circulation 135.22 (2017): el054-el091, which is incorporated herein in its entirety..
  • the biomarker is a miRNA.
  • miRNAs biomarkers have been used and as they are stable in the circulation, selected miRNAs can be used as potential biomarkers in coronary artery disease, myocardial infarction, hypertension, diabetes mellitus, viral myocarditis, and HF.
  • seven miRNAs were validated to be enriched in plasma of HF patients (miR-423-5p, miR-18b*, miR-129-5p, HS 202.1, miR-622, miR-654-3p, and miR-1254), among which miR-423-5p was most strongly related to the clinical diagnosis of HF.
  • the circulating levels of miR-423-5p were related to disease severity as shown by an inverse correlation with ejection fraction and higher levels of miR-423-5p in patients with a higher New York Heart Association (NYHA) classification.
  • MiR-423-5p was also correlated to the levels of the current clinically used biomarker N-terminal pro-brain natriuretic peptide (NT-proBNP).
  • NT-proBNP N-terminal pro-brain natriuretic peptide
  • miR-499-5p and miR-423-5p have been demonstrated to show the effect of therapy in a in a rat model of HF (Montgomery RL, et al., Therapeutic inhibition of miR-208a improves cardiac function and survival during heart failure. Circulation 124: 1537-1547, 2011).
  • miR-1, miR-133a, miR-133b, and miR-499-5p were elevated in patients with MI, whereas miR-122 and miR-375 were reduced (see, e.g., Tijsen AJ, et al., Circulating microRNAs as diagnostic biomarkers for cardiovascular diseases. Am J Physiol Heart Circ Physiol. 2012; 303:H1085- H1095).
  • the protection against morphological deterioration associated with cardiac remodeling is determined by measuring the heart-to-body weight ratio, infarct size, and the presence of cardiac fibrosis, wherein protection is present if expression of said human phosphatase inhibitor-1 (1-1) or variant thereof results in a reduced heart-to-body weight ratio, a decreased infarct size, or reduced cardiac fibrosis as compared to a control.
  • a subject treated with a rAAV vector and according to the administration methods as disclosed herein can be evaluated by assessing the effect of the treatment on a parameter related to cardiac function or cardiac cellular function, e.g., contractility.
  • a parameter related to cardiac function or cardiac cellular function e.g., contractility.
  • SR Ca2+ ATPase activity or intracellular Ca2+ concentration can be measured, using the methods described above.
  • force generation by hearts or heart tissue can be measured using methods described in Strauss et al., Am. J. Physiol., 262: 1437-45, 1992.
  • a subject treated with a rAAV vector and according to the administration methods as disclosed herein can also be evaluated by its effect on a subject, e.g., according to parameters that one skilled in the art of treatment would recognize as relevant for the particular treatment.
  • exemplary parameters may relate to cardiac and/or pulmonary function.
  • Cardiac parameters include pulse, EKG signals, lumen loss, heart rate, heart contractility, ventricular function, e.g., left ventricular end-diastolic pressure (LVEDP), left ventricular systolic pressure (LVSP), Ca2+ metabolism, e.g., intracellular Ca2+ concentration or peak or resting Ca2+, force generation, relaxation and pressure of the heart, a force frequency relationship, cardiocyte survival or apoptosis or ion channel activity, e.g., sodium calcium exchange, sodium channel activity, calcium channel activity, sodium potassium ATPase pump activity, activity of myosin heavy chain, troponin I, troponin C, troponin T, tropomyosin, actin, myosin light chain kinase, myosin light chain 1, myosin light chain 2 or myosin light chain 3, IGF-1 receptor, PI3 kinase, AKT kinase, sodium -calcium exchanger, calcium channel (L
  • the evaluation can include performing angiography (e.g., quantitative angiography) and/or intravascular ultrasound (IVUS), e.g., before, after, or during the treatment.
  • angiography e.g., quantitative angiography
  • IVUS intravascular ultrasound
  • echocardiographic assessments of LVEF, LVEVD, LVEDVI, VLESV, LVEVI, Spl , GLS or, degree of mitral regurgitation or, any combination of these or, all of these are performed at 4weeks after, or, 6 weeks after, or, 8 weeks after, or, 12 weeks after, or, 3 months after, or, 6 months after, or, 9 months after, or, 12 months or, more months after administering the rAAV vector as described herein.
  • assessment of all-cause mortality and/or, Heart failure related hospitalization indicates the safety and/or, efficacy of the rAAV treatment as described herein.
  • survival, cardiac transplantation, or, left ventricular assist device (LAVD) implantation or, any combination of these are assessed in the monitoring of the rAAV administered patients.
  • LAVD left ventricular assist device
  • the rAAV vector is introduced in an amount effective to result in a condition selected from the group consisting of myocyte shortening, lowering of the time constant for relaxation, and accelerating calcium signal decay, and combinations thereof.
  • the rAAV vector is introduced in an amount effective to improve the end-systolic pressure dimension relationship or combinations thereof.
  • the methods of administration and treatment as disclosed herein comprise expressing a therapeutic amount of the inhibitor of PPI (I- 1 , or I-lc, or variant thereof) in the heart tissue of said subject.
  • expressing a therapeutic amount of the inhibitor of PPI in the heart tissue reduces the symptoms of heart failure or a heart disorder of a subject.
  • expressing a therapeutic amount of the inhibitor of PP 1 in the heart tissue may attenuate cardiac remodelling, improve exercise capacity, or improve cardiac contractility.
  • expressing a therapeutic amount of the inhibitor of PP 1 in the heart tissue may result in myocyte shortening, lowering of the time constant for relaxation, and accelerating calcium signal decay, improving the end-systolic pressure dimension relationship and combinations thereof.
  • the method before, or after administration of the rAAV vector as disclosed herein, or both, the method further comprises evaluating a parameter of heart function in the subject.
  • the parameter of heart function may, without limitation, be one or more of: heart rate, cardiac metabolism, heart contractility, ventricular function, Ca2+ metabolism, and sarcoplasmic reticulum Ca2+ ATPase activity.
  • the methods of administration and rAAV vectors disclosed herein can be used for treating a cardiovascular condition or heart disease, wherein the rAAV vector as disclosed herein is targeted to the heart of a patient whereby the nucleic acid sequence, e.g., inhibitor of PPI, or other therapeutic agents (e.g., an angiogenic protein or protein from Table 18A-18B) is expressed in the myocardium, thus ameliorating cardiac dysfunction by improving blood flow and/or improving cardiac contractile function. Improved heart function ultimately leads to the reduction or disappearance of one or more symptoms of heart disease or heart failure and prolonged life beyond the expected mortality.
  • the nucleic acid sequence e.g., inhibitor of PPI
  • other therapeutic agents e.g., an angiogenic protein or protein from Table 18A-18B
  • the methods of administration and rAAV vectors disclosed herein can be used for the treatment of peripheral vascular disease, wherein the rAAV vector as disclosed herein is targeted to the heart of a patient whereby the nucleic acid sequence, e.g., inhibitor of PP 1 , or other therapeutic agents (e.g., an angiogenic protein) is targeted to the affected tissue, for example ischemic skeletal muscle, whereby expression of the therapeutic protein, e.g., inhibitor of PPI or angiogenic protein ameliorates and/or cures symptoms of the peripheral vascular disease, for example by increasing blood flow to the affected (e.g., ischemic) region of the tissue and/or, in muscle, by improving contractile function of the affected muscle.
  • the nucleic acid sequence e.g., inhibitor of PP 1
  • other therapeutic agents e.g., an angiogenic protein
  • the technology described herein relates to methods of administration and rAAV vectors disclosed herein in a method for treating a cardiovascular condition or heart disease in a patient having myocardial ischemia, comprising administering the rAAV vector according to the administration methods disclosed herein to the myocardium of the patient by intracoronary injection, preferably by injecting the rAAV vector directly into one or both coronary arteries (or grafts), whereby the expression of the transgene (e.g., inhibitor of PPI and/or angiogenetic protein) is expressed and blood flow and/or contractile function are improved.
  • a rAAV vector is delivered to the heart where the protein or peptide is produced to a therapeutically significant degree in the myocardium continuously for sustained periods, angiogenesis can be promoted in the affected region of the myocardium.
  • Heart failure [00216]
  • Subjects amenable to treatment with the rAAV vectors as disclosed herein, and methods of administration as disclosed herein include, but are not limited to, a subject having heart failure, including congestive heart failure (CHF), who has a condition selected from the group consisting of ischemia, arrhythmia, myocardial infarction (MI), abnormal heart contractility, and abnormal Ca2+ metabolism, and combinations thereof, in addition to heart failure.
  • CHF congestive heart failure
  • MI myocardial infarction
  • the subject is human.
  • patients suffering from congestive heart failure are those exhibiting dilated cardiomyopathy and those who have exhibited severe myocardial infarctions, typically associated with severe or occlusive coronary artery disease.
  • the subjects, to be treated have non-ischemic cardiomyopathy.
  • ACC/AHA American College of Cardiology/American Heart Association
  • HFA/ESC HFA/ESC
  • JHFS JHFS guidelines
  • AHF Acute heart failure
  • AHF Acute Heart failure
  • AHF refers to rapid onset or worsening of symptoms and/or signs of HF. It is a life-threatening medical condition requiring urgent evaluation and treatment, typically leading to urgent hospital admission.
  • AHF may present as a first occurrence (de novo) or, more frequently, as a consequence of acute decompensation of chronic HF, and may be caused by primary cardiac dysfunction or precipitated by extrinsic factors, often in patients with chronic HF.
  • Acute myocardial dysfunction ischaemic, inflammatory or toxic
  • acute valve insufficiency or pericardial tamponade are among the most frequent acute primary cardiac causes of AHF.
  • Decompensation of chronic HF can occur without known precipitant factors, but more often with one or more factors, such as infection, uncontrolled hypertension, rhythm disturbances or non-adherence with drugs/diet
  • AHF acute heart failure
  • AHF can present with rapid swelling and fluid retention characterized by sudden weight gain. Coughing, wheezing, and shortness of breath, as well as an irregular heartbeat, could be symptoms of acute heart failure. In some cases, it is related to pre-existing cardiomyopathy. AHF often requires unexpected hospital admission. It can also be associated with a poor prognosis and a high risk of readmission and death postdischarge. Treatment options include medication, surgery, and implanted medical devices, as well as recommended lifestyle modifications.
  • Heart failure is a complex syndrome with many possible causes that result from impaired ability of the left ventricle to either fill with blood during the diastolic phase of the cardiac cycle or eject blood during the systolic phase of the cardiac cycle.
  • the affected heart is consequently increasingly less able to pump a sufficient blood volume to meet the oxygen demands of the body.
  • Heart failure is a common chronic condition, which predominantly affects the elderly. Prevalence is 0.8-2 % in the general population but 10-20 % among those aged >70 years. With an ever-aging population, prevalence is increasing. In the US, HF currently affects 5.8 million; one estimate predicts that this will rise to more than 8 million by 2030.
  • CHF Chronic heart failure
  • CHF is the inability of the heart to pump the required quantity of the blood to meet the demands of the body. This is caused by a weaker than a normal heart.
  • the body receives a poor inflow of the blood from the heart, several tissues and organs begin to function below their potential, making it impossible for an individual to possess the needed energy to indulge in regular activities.
  • the heart cannot fill properly or pump blood forward, it causes fluid to build up into the tissues of the body, resulting in congestion or swelling.
  • the typical symptoms of CHF are shortness of breath and fatigue, however, some people with CHF only experience fatigue and decreased activity tolerance.
  • Heart failure can also affect the kidneys' ability to process and eliminate sodium and water. This may result in even more fluid retention and subsequent swelling. In many cases, the improper heart functioning leads to death, as the heart fails to receive oxygen and blood to the heart muscle.
  • the heart failure can occur to the left side or the right side.
  • Left Side Cardiac Failure occurs when the failure occurs due to improper functioning of the left ventricle. In such cases, the left ventricle fails in pumping with necessary force to pump the blood from the heart, as needed by the body. Due to this, the left chamber accumulates with blood that eventually leads to pulmonary edema and pulmonary hypertension. The causes of the same include hypertension, ischemic heart diseases, aortic valve diseases, and primary myocardial diseases.
  • Right Side Heart Failure The primary reason for the failure of right side ventricle is because of left side heart failure. However, if the occurrence of the failure of the right side is due to pathology in the lungs, then it is coronary pulmonale.
  • CHF is most common in men and risk factors include age, high blood pressure, being overweight and the presence of metabolic disorders like diabetes. CHF is as its name describes - it is a long-term condition that can get worse over time. Prior to the current invention, it generally cannot be cured but it can be medically managed.
  • Ejection fraction The ejection fraction describes the pumping ability of the heart; a muscle that contracts and relaxes with every beat.
  • the EF measures the percentage of blood pumped out of the heart each time it contracts. With every beat, the heart pumps blood throughout the body. When the pumping ability of the heart is impaired, the ejection fraction measurements decline. The normal range for an EF is 55% to 70%.
  • the methods as disclosed herein are used for a subject who has a heart failure with a reduced EF (HFrEF).
  • HFrEF reduced EF
  • Diastolic HF is also known as heart failure with preserved ejection fraction (HFpEF), and develops when the left ventricle becomes rigid or stiff and cannot relax during diastole, the time between beats. This prevents the heart from properly refilling with blood. Representing about half of all HF cases, diastolic heart failure is most common in older people and in women. It is often present when there are other underlying medical conditions (comorbidities) that can contribute to the development of HF. HFpEF denotes a preserved ejection fraction because although the muscle cannot relax as well as it should, the left ventricle is still pumping normally.
  • HFpEF denotes a preserved ejection fraction because although the muscle cannot relax as well as it should, the left ventricle is still pumping normally.
  • stolic HF is also known as heart failure with reduced ejection fraction (HFrEF), and develops when the left ventricle does not contract normally. This means the heart no longer pumps with enough force to squeeze enough blood into circulation. Conditions like high blood pressure, arrhythmias, coronary artery disease, and abuse of alcohol and drugs can contribute to the development of heart failure. HFrEF progresses as the left ventricle, the lower-left chamber of the heart, gets larger and works harder to squeeze pump the right amount of oxygen-rich blood out to fuel the body.
  • HFrEF heart failure with reduced ejection fraction
  • DHF Decompensated heart failure
  • patients who have known HF develop worsening signs and symptoms of congestion. This is also called fluid overload, as the body has more fluid than it can get rid of. Patients may have weight gain, worsening dyspnea, swelling or edema in their legs or abdomen, nausea, and are short of breath while lying down. Decompensated heart failure can also cause fatigue, making you feel more tired when doing vigorous or everyday activities. This can interfere with carrying out household activities or any strenuous tasks at work. These patients may need to be admitted to the hospital for treatment.
  • Non-ischemic heart failure can be genetically based, caused by an illness (Kawasaki disease), cardiomyopathy, nutritionally based, such as alcohol induced heart failure, or virus infections (and possibly by Covid- 19). It can also be caused by ischemia.
  • myocardial infarction including antecedent myocardial infarction (MI), coronary artery disease/ischemia, abnormal heart valves or chambers (congenital or acquired), Pulmonary embolus (PE) and hypertension, heart arrhythmias, cardiomyopathy, diabetes mellitus, age-related deterioration, substance abuse, toxins, Obstructive sleep apnea, and Infections (myocarditis, endocarditis).
  • MI myocardial infarction
  • PE Pulmonary embolus
  • hypertension e.g., hypertension, renal insufficiency, damaged heart tissue (myocardial infarction, including antecedent myocardial infarction (MI), coronary artery disease/ischemia, abnormal heart valves or chambers (congenital or acquired), Pulmonary embolus (PE) and hypertension, heart arrhythmias, cardiomyopathy, diabetes mellitus, age-related deterioration, substance abuse, toxins, Obstructive sleep a
  • Heart imaging allows measurement of the left ventricular ejection fraction (LVEF). This is the % of the total blood volume in the left ventricle that is ejected during systole and is normally around 50-70 %.
  • LVEF left ventricular ejection fraction
  • HF due to impaired ventricular ejection is associated with reduced ejection fraction (rEF), i.e. less than 50 % and is referred to as HFrEF or systolic heart failure.
  • HF due to impaired ventricle filling is associated with preserved EF (i.e. >55 %) and is referred to as HFpEF or diastolic heart failure.
  • Heart imaging allows detection of left ventricular dysfunction (either systolic or diastolic) before symptoms of heart failure occur.
  • the patients administered with rAAV as disclosed herein have 40% LVEF, or 35% LVEF, or 30% LVEF, or 25% LVEF, or 20% LVEF, or 15% LVEF, or 10% LVEF or, 5% LVEF or less LVEF.
  • the LVEF is measured by Transthoracic echocardiography (TTE).
  • MI myocardial infarction
  • CH chronic hypertension
  • Cardinal symptoms of HF include: breathlessness after only mild exertion (dyspnea); exercise intolerance, fatigue; and eventually ankle swelling/pain due to local fluid (edema) accumulation.
  • HF is a progressively debilitating condition.
  • the New York Heart Association (NYHA) Functional Classification is widely used to classify the severity of HF to one of four classes based on the extent to which physical activity is limited.
  • NYHA Class I is essentially asymptomatic HF
  • NYHA Class IV is applied to patients with most severe HF who are “unable to carry on any physical activity without discomfort”. These Class IV HF patients “experience symptoms (breathlessness, fatigue, etc.) at rest.”
  • the patients administered with rAAV as disclosed herein have either NYHA class III or, NYHA class IV heart failure.
  • AHF acute (decompensated) heart failure
  • the rAAV vectors and methods of administration as disclosed herein is used in a method to treat chronic non-ischemic cardiomyopathy or ischemic cardiomyopathy.
  • the subject has chronic non-ischemic cardiomyopathy.
  • subject with chronic ischemic cardiomyopathy are not amenable to treatment.
  • the subject amenable to treatment if a rAAV vector disclosed herein, administered according to the methods as disclosed herein has LVEF (left ventricle end-diastolic volume) ⁇ 30% by transthoracic echocardiography (TTE) within 6 months prior to enrolment.
  • LVEF left ventricle end-diastolic volume
  • TTE transthoracic echocardiography
  • the subject has an LVEF as follows >120 ventricular volume/ED VI (ml) (severe LV enlargement), or between 100-120 ventricular volume/EDVI (ml) (moderate LV enlargement), or between 84-99 ventricular volume/ED VI (ml) (mild LV enlargement). In some embodiments, if a subject has a ventricular volume/EDVI (ml) of equal or less than 84 (normal LV) the subject is not amenable to treatment with a rAAV vector as disclosed herein as administered according to the disclosed methods.
  • Cardiomyopathy and Congestive Heart Failure are extremely common conditions that are responsible for millions of death around the globe. Cardiomyopathy belongs to the heterogeneous group of diseases that cause either mechanical or electrical dysfunction that exhibits inappropriate dilatation. The occurrence is due to several factors, including genetic factors. They are part of multi-system disorder or confined to the heart alone that leads to cardiovascular death. Congestive heart failure, is the inability of the heart to pump the required quantity of the blood to meet the demands of the body. Cardiomyopathy and heart failure or, congestive heart failure are closely integrated with each other; cardiomyopathy is the pathology of heart muscle wheras heart failure is the syndrome that happens when there is cardiomyopathy.
  • Cardiomyopathy which occurs due to progressive cardiac dilatation with concomitant hypertrophy. causes include genetic mutations, childbirth, iron overload, myocarditis, and alcohol abuse.
  • Hypertrophic Cardiomyopathy which occurs due to genes, myocardial hypertrophy, and improper functioning of the left ventricular myocardium. They lead to abnormal diastolic filling and obstruct the intermittent ventricular outflow.
  • Restrictive Cardiomyopathy which is least common and appears due to decrease in ventricular compliance, which results in an impaired ventricular filling. The causes include radiation fibrosis, amyloidosis, metastatic tumors, and sarcoidosis.
  • the methods encompass treating a subject with heart failure. In some embodiments, the subject has non-ischemic cardiomyopathy. In other embodiments, the subject has ischemic cardiomyopathy.
  • cardiomyopathy refers to “cardio” (heart), “myo” (muscle), “pathy” (disease of).
  • a dilated cardiomyopathy results in left ventricular chamber enlargement, systolic dysfunction and clinical manifestations of congestive heart failure.
  • the subject with a non-ischemic cardiomyopathy has a dilated cardiomyopathy, where there is dilation and impaired contraction of one or both ventricles.
  • a subject has non-ischemic cardiomyopathy due to toxins, e.g., alcohol, drugs (e.g., anthracyclines).
  • a subject has non-ischemic cardiomyopathy due to an infiltrative agent, e.g., sarcoid, iron overload (haemochromatosis or excess blood transfusions).
  • a subject has non-ischemic cardiomyopathy due to dietary issues, e.g., beri-beri (thiamine deficiency.
  • a subject has non-ischemic cardiomyopathy due to a current or prior infection, such as, but not limited to, viral infection, e.g., Chagas’ disease, HI, coxsackie or Lyme disease, coronaviruses (MERS-CoV (causes MERS), SARS-CoV (causes SARS), SARS-CoV2 (causes COVID- 19), and human coronaviruses 229E, NL63, OC43 and HKU1.
  • a subject with nonischemic cardiomyopathy has long-Covid or a long term complication or symptom due to a covid infection.
  • a subject has non-ischemic cardiomyopathy due to a hereditary condition, e.g., familial DCM, muscular dystrophies (Duchenne, myotonia, mitochondrial).
  • subject has non-ischemic cardiomyopathy due a genetic disorder with a cardiac manifestation, selected from the group comprising: 22ql 1.2 deletion syndrome, Abdominal aortic aneurysm, Aberrant subclavian artery, Adult polyglucosan body disease, Alpha-mannosidosis, Alstrom syndrome, Andersen-Tawil syndrome, Aneurysm of sinus of Valsalva, Arrhythmogenic right ventricular cardiomyopathy, Arterial tortuosity syndrome, Ehlers-Danlos syndrome, Atrial myxoma, familial, Atrial septal defect ostium primum, Atrial septal defect sinus venosus, Baroreflex failure, Barth syndrome, Becker muscular dystrophy
  • Cardiovascular condition and cardiovascular diseases in general [00250]
  • the rAAV vectors and methods of administration as disclosed herein are also provided for use in peripheral vascular diseases such as peripheral arterial occlusive disease (PAOD). As described and illustrated herein, these methods are thus useful for treating a cardiovascular condition, heart disease, peripheral vascular disease and similar disorders.
  • PAOD peripheral arterial occlusive disease
  • the rAAV vectors and methods of administration as disclosed herein are useful in methods to treat dilated cardiomyopathy (DCM), a type of heart failure that is typically diagnosed by the finding of a dilated, hypocontractile left and/or right ventricle.
  • DCM can occur in the absence of other characteristic forms of cardiac disease such as coronary occlusion or a history of myocardial infarction.
  • DCM is associated with poor ventricular function and symptoms of heart failure. In these patients, chamber dilation and wall thinning generally results in a high left ventricular wall tension. Many patients exhibit symptoms even under mild exertion or at rest, and are thus characterized as exhibiting severe, i.e.
  • Type-Ill or “Type-IV”, heart failure, respectively (see, e.g., NYHA classification of heart failure).
  • many patients with coronary artery disease may progress to exhibiting dilated cardiomyopathy, often as a result of one or more heart attacks (myocardial infarctions).
  • the rAAV vectors and methods of administration as disclosed herein are useful in a method to prevent, inhibit, slow the progression, or at least lessen deleterious left ventricular remodeling (a.k.a., deleterious remodeling, for short), which refers to chamber dilation after myocardial infarction that can progress to severe heart failure. Even if ventricular remodeling has already initiated, it is still desirable to promote an increase in blood flow, as this can still be effective to offset ventricular dysfunction. Similarly, promotion of angiogenesis can be useful, since the development of a microvascular bed can also be effective to offset ventricular dysfunction. Further, such rAAV vectors and methods of administration as disclosed herein can also have other enhancing effects.
  • deleterious ventricular remodeling is prevented if the patient lacks chamber dilation and if symptoms of heart failure do not develop.
  • Deleterious ventricular remodeling is alleviated if there is any observable or measurable reduction in an existing symptom of the heart failure. For example, the patient may show less breathlessness and improved exercise tolerance.
  • Methods of assessing improvement in heart function and reduction of symptoms are essentially analogous to those described above for DCM.
  • Prevention or alleviation of deleterious ventricular remodeling as a result of improved collateral blood flow and ventricular function and/or other mechanisms is expected to be achieved within weeks after in vivo angiogenic gene transfer in the patient using methods as described herein.
  • the rAAV vectors and methods of administration as disclosed herein transfer of a transgene encoding an inhibitor of PPI, an angiogenic protein or a therapeutic protein selected from Table 18A-18B, is used to treat conditions associated with congestive heart failure (CHF).
  • CHF congestive heart failure
  • the disease may be cardiovascular condition or heart disease and disorders.
  • the disease may be heart failure such as congestive heart failure.
  • the subject may have non-ischemic cardiomyopathy.
  • the disease may be selected from congestive heart failure, coronary artery disease, atherosclerosis, cardiomyopathy, idiopathic cardiomyopathy, cardiac arrhythmias, muscular dystrophy, muscle mass abnormality, muscle degeneration, infective myocarditis, drug- or toxin-induced muscle abnormalities, hypersensitivity myocarditis, an autoimmune endocarditis and congenital heart disease.
  • the disease may be selected from arrhythmia, abnormal heart contractility, non-ischemic cardiomyopathy, peripheral arterial occlusive disease, and abnormal Ca2+ metabolism, and combinations thereof.
  • the disease may be selected from the group of: congestive heart failure, cardiomyopathy, vascular disease, acquired heart disease, congenital heart disease, atherosclerosis, dysfunctional conduction systems, dysfunctional coronary arteries, pulmonary heart hypertension.
  • the muscular disease is a vascular disease.
  • Vascular disease may be coronary artery disease, peripheral arterial disease, cerebrovascular disease, renal artery stenosis or aortic aneurysm.
  • the muscular disease may be cardiomyopathy.
  • the cardiomyopathy may be hypertensive heart disease, heart failure (such as congestive heart failure), pulmonary heart disease, cardiac dysrhythmias, inflammatory heart disease (such as endocarditis, inflammatory cardiomegaly, myocarditis), valvular heart disease, congenital heart disease and rheumatic heart disease.
  • the cardiomyopathy is hypertrophic cardiomyopathy, arrhythmogenic right ventricular dysplasia, dilated cardiomyopathy, restrictive cardiomyopathy, left ventricular noncompaction, Takotsubo cardiomyopathy, myocarditis and eosinophilic myocarditis.
  • the hypertrophic cardiomyopathy is CMH1 (Gene: MYH7), CMH2 (Gene: TNNT2), CMH3 (Gene: TPM1), CMH4 (Gene: MYBPC3), CMH5, CMH6 (Gene: PRKAG2), CMH7 (Gene: TNNI3), CMH8 (Gene: MYL3), CMH9 (Gene: TTN), CMH10 (Gene: MYL2), CMH11 (Gene: ACTC1), or CMH12 (Gene: CSRP3).
  • CMH1 Gene: MYH7
  • CMH4 Gene: MYBPC3
  • CMH5 CMH6
  • CMH7 Gene: TNNI3
  • CMH8 Gene: MYL3
  • CMH9 Gene: TTN
  • CMH10 Gene: MYL2
  • CMH11 Gene: ACTC1
  • CMH12 Gene: CSRP3
  • the arrhythmogenic right ventricular dysplasia is ARVD1 (Gene: TGFB3), ARVD2 (Gene: RYR2), ARVD3, ARVD4, ARVD5 (Gene: TMEM43), ARVD6, ARVD7 (Gene: DES), ARVD8 (Gene: DSP), ARVD9 (Gene: PKP2), ARVD10 (Gene: DSG2), ARVD11 (Gene: DSC2), and/or ARVD12 (Gene: JUP).
  • ARVD1 Gene: TGFB3
  • ARVD2 Gene: RYR2
  • ARVD3, ARVD4, ARVD5 Gene: TMEM43
  • ARVD6, ARVD7 Gene: DES
  • ARVD8 Gene: DSP
  • ARVD9 Gene: PKP2
  • ARVD10 Gene: DSG2
  • ARVD11 Gene: DSC2
  • ARVD12 Gene: JUP
  • the rAAV vectors and methods of administration as disclosed herein can be used for the treatment of any of: congestive heart failure, non-ischemic cardiomyopathy, vascular disease, acquired heart disease, congenital heart disease, atherosclerosis, dysfunctional conduction systems, dysfunctional coronary arteries, pulmonary heart hypertension.
  • the disease is selected from the group consisting of congestive heart failure, coronary artery disease, myocardial infarction, myocardial ischemia, atherosclerosis, cardiomyopathy, idiopathic cardiomyopathy, cardiac arrhythmias, muscular dystrophy, muscle mass abnormality, muscle degeneration, infective myocarditis, drug- or toxin-induced muscle abnormalities, hypersensitivity myocarditis, an autoimmune endocarditis and congenital heart disease.
  • Heart failure also called congestive heart failure (CHF)
  • CHF congestive heart failure
  • Heart failure is a disorder in which the contractility of the heart muscle decreases, and the heart loses its ability to pump blood efficiently. It is estimated to affect over 10 million Americans, alone. Heart failure is almost always a chronic, long-term condition, and consumes an inordinate amount of medical intervention and human resource dollars. In particular, the consequences of heart failure to the rest of the body organs can be devastating both in terms of the overall reduction in productive life of the patient, and the expense of treatment. The condition may affect the right side, the left side, or both sides of the heart. As the pumping action of the heart is compromised, blood begins backing up into other areas of the body. Many organs and organ systems begin to suffer cumulative damage from lack of oxygen and nutrients.
  • the rAAV vectors and methods of administration as disclosed herein is used in a method for substantially reducing myocardial ischemia.
  • the rAAV vectors and methods of administration as disclosed herein is used in a method for substantially reducing myocardial ischemia.
  • the disease may be selected from ischemia, myocardial infarction (MI), ischemic cardiomyopathy and combinations thereof.
  • the disease may be selected from the group of: infarction, tissue ischemia, cardiac ischemia, atherosclerosis or CAD.
  • Myocardial ischemia is an aspect of heart dysfunction that occurs when the heart muscle (the myocardium) does not receive adequate blood supply and is thus deprived of necessary levels of oxygen and nutrients.
  • Myocardial ischemia may result in a variety of heart diseases including, for example, angina, heart attack and/or congestive heart failure.
  • the most common cause of myocardial ischemia is atherosclerosis (also referred to as coronary artery disease or “CAD”), which causes blockages in the coronary arteries, blood vessels that provide blood flow to the heart muscle.
  • CAD coronary artery disease
  • Present treatments for myocardial ischemia include pharmacological therapies, coronary artery bypass surgery and percutaneous revascularization using techniques such as balloon angioplasty.
  • Standard pharmacological therapy is predicated on strategies that involve either increasing blood supply to the heart muscle or decreasing the demand of the heart muscle for oxygen and nutrients.
  • increased blood supply to the myocardium can be achieved by agents such as calcium channel blockers or nitroglycerin. These agents are thought to increase the diameter of diseased arteries by causing relaxation of the smooth muscle in the arterial walls.
  • Decreased demand of the heart muscle for oxygen and nutrients can be accomplished either by agents that decrease the hemodynamic load on the heart, such as arterial vasodilators, or those that decrease the contractile response of the heart to a given hemodynamic load, such as beta-adrenergic receptor antagonists.
  • Surgical treatment of ischemic heart disease is generally based on the bypass of diseased arterial segments with strategically placed bypass grafts (usually saphenous vein or internal mammary artery grafts).
  • Percutaneous revascularization is generally based on the use of catheters to reduce the narrowing in diseased coronary arteries.
  • the patients to be treated with rAAV as disclosed herein are co-administered with nitroglycerin or, nitroprusside.
  • Congestive heart failure is defined as abnormal heart function resulting in inadequate cardiac output to meet metabolic needs (Braunwald, E. (ed), In: Heart Disease, W. B. Saunders, Philadelphia, page 426, 1988). An estimated 5 million people in the United States suffer from congestive heart failure. Once symptoms of CHF are moderately severe, the prognosis is worse than most cancers in that only half of such patients are expected to survive for more than 2 years (Braunwald, E. (ed), In: Heart Disease, W. B. Saunders, Philadelphia, page 471-485, 1988).
  • CHF chronic myelolism
  • Symptoms of CHF include breathlessness, fatigue, weakness, leg swelling and exercise intolerance.
  • patients with heart failure tend to have elevations in heart and respiratory rates, rates (an indication of fluid in the lungs), edema, jugular venous distension, and, in general, enlarged hearts.
  • CHF chronic heart failure
  • coronary artery disease that is so severe in scope or abruptness that it results in the development of chronic or acute heart failure.
  • extensive and/or abrupt occlusion of one or more coronary arteries precludes adequate blood flow to the myocardium, resulting in severe ischemia and, in some cases, myocardial infarction or death of heart muscle.
  • the consequent myocardial necrosis tends to be followed by progressive chronic heart failure or an acute low output state - both of which are associated with high mortality.
  • myocardial infarction can be diagnosed by (i) blood tests to detect levels of creatine phosphokinase (CPK), aspartate aminotransferase (AST), lactate dehydrogenase (LDH) and other enzymes released during myocardial infarction; (ii) electrocardiogram (ECG or EKG) which is a graphic recordation of cardiac activity, either on paper or a computer monitor.
  • CPK creatine phosphokinase
  • AST aspartate aminotransferase
  • LDH lactate dehydrogenase
  • ECG electrocardiogram
  • An ECG can be beneficial in detecting disease and/or damage;
  • echocardiogram heart ultrasound
  • Doppler ultrasound can be used to measure blood flow across a heart valve;
  • nuclear medicine imaging also referred to as radionuclide scanning in the art allows visualization of the anatomy and function of an organ, and can be used to detect coronary artery disease, myocardial infarction, valve disease, heart transplant rejection, check the effectiveness of bypass surgery, or to select patients for angioplasty or coronary bypass graft.
  • DCM dilated cardiomyopathy
  • the cause of DCM is known or suspected.
  • Examples include familial cardiomyopathy (such as that associated with progressive muscular dystrophy, myotonic muscular dystrophy, Freidrich's ataxia, and hereditary dilated cardiomyopathy), infections resulting in myocardial inflammation (such as infections by various viruses, bacteria and other parasites), noninfectious inflammations (such as those due to autoimmune diseases, peripartum cardiomyopathy, hypersensitivity reactions or transplantation rejections), metabolic disturbances causing myocarditis (including nutritional, endocrinologic and electrolyte abnormalities) and exposure to toxic agents causing myocarditis (including alcohol, as well as certain chemotherapeutic drugs and catecholamines).
  • familial cardiomyopathy such as that associated with progressive muscular dystrophy, myotonic muscular dystrophy, Freidrich's ataxia, and hereditary dilated cardiomyopathy
  • infections resulting in myocardial inflammation such as infections by various viruses, bacteria and other parasites
  • Idiopathic dilated cardiomyopathy or “IDCM”.
  • DCM idiopathic dilated cardiomyopathy
  • Heart enlargement can lead to deleterious left ventricular remodeling with subsequent severe dilation and increased wall tension, thus exacerbating CHF.
  • long-term exposure of the heart to norepinephrine tends to make the heart unresponsive to adrenergic stimulation and is linked with poor prognosis.
  • peripheral vasculature like heart disease, often result from restricted blood flow to the tissue (e.g. skeletal muscle) which (like cardiac disease) becomes ischemic, particularly when metabolic needs increase (such as with exercise).
  • tissue e.g. skeletal muscle
  • atherosclerosis present in a peripheral vessel may cause ischemia in the tissue supplied by the affected vessel.
  • This problem known as peripheral arterial occlusive disease (PAOD)
  • PAOD peripheral arterial occlusive disease
  • this condition or at least some of its symptoms may be treated by using drugs, such as aspirin or other agents that reduce blood viscosity, or by surgical intervention, such as arterial grafting, surgical removal of fatty plaque deposits or by endovascular treatments, such as angioplasty. While symptoms may be improved, the effectiveness of such treatments is typically inadequate, for reasons similar to those referred to above.
  • One aspect of the technology described herein relates to a method to administer a rAAV vector, where the method is a single administration of a total dose of a rAAV to the subject, where the single administration comprises delivery of a total dose of rAAV that is divided into at least 2, or 3, or 4, or 5 or more sub-doses within the single administration.
  • the method comprises administering a bolus of rAAV vector to the subject in a single administration, where the single administration of the bolus comprises the administration of rAAV from least 2, or 3, or 4, or 5 doses, and in some embodiments, the doses can be from 2, 3, 4, 5, or 6 or more vials or syringes, where the delivery of the rAAV from each vial or syringe takes between 1-5 minutes, or more than 5 minutes.
  • the method comprises at least one administration or, more than one administration of rAAV to the subject.
  • the method to administer rAAV vector comprises two administrations, three administrations, four administrations, or, five administrations of rAAV to the subject, where each administration comprises delivery of a total dose of rAAV that is divided into at least 2, or, 3, or, 4, or, 5 or, more sub doses.
  • the method to administer AAV vectors is a single injection that comprises within the single injection, discrete pulses of delivery of the AAV vector. That is, in a single injection administration, the rAAV delivery is divided into a number of temporally spaced sub-administrations.
  • a single administration can be a total amount (or total dose, also referred to as “ID”) of rAAV that is divided into at least 2, or at least 3, or at least 4, or at least 5 or more sub-doses (“SD”), where each sub-dose is administered in a sub-administration, where each sub-administration is temporally spaced by a pre-defined period of time, e.g., at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10 or more than 10 minutes between each subadministration of each sub-dose.
  • a single administration of a total dose of rAAV can include a series of pulses of sub-doses, and each sub-dose is injected in a sub-administration (i.e., pulses of a single administration).
  • an exemplary method of administration comprises administration of a single administration of a total dose (TD) of rAAV vector is between about 10 13 vg to about 10 15 vg, which can be divided into at least 2, or at least 3, or at least 4, or at least 5 or more sub-doses (SD), wherein the sub-doses are administered to the subject spaced at least 5 seconds, or at least 10 seconds, or at least 20 seconds, or at least 30 seconds, or at least 40 seconds, or at least 50 seconds or at least 1 minute, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10 or more than 10 minutes apart, wherein the administration of all the sub-doses for the total rAAV dose takes between about lOminutes to about30minutes, or between about lOminutes to about 20 minutes, or between about 15 minutes to about 25 minutes, or between about 15minutes to about 30 minutes, or, between about 25minutes to
  • the total rAAV dose administration is performed for about 10 minutes, or, about 15 minutes, or about 20 minutes, or about 25 minutes or about 30 minutes or about 35 minutes or, about 40 minutes or, about 45 minutes, or about 50 minutes, or about 60 minutes or longer. In certain embodiments, the total rAAV dose administration is performed for about 20 minutes to about 30 minutes. In certain aspects of the embodiments, the rAAV is selected from the group consisting of AAV2, AAV6, AAV8, AAV9, AAV2i8, rhlO, AAV2.5 and AAV2G9. In some aspects of the embodiments, the rAAV administration is performed for one to five minutes in each of total five subdoses, e.g.
  • each subdose has 8 ml, or, 9 ml, or, 10 ml, or, 12 ml, or, 15 ml, or, 20 ml, or 25 ml or more volume of diluent.
  • the total volume of rAAV administration is 20ml, or 25 ml, or 30ml, or, 35 ml, or 40 ml, or 45 ml, or 50 ml, or 60 ml, or 70 ml, or 80 ml, or 90 ml, or 100 ml or, more.
  • the diluent can be saline, or different ratios of saline-blood mixture.
  • the rAAV administered comprises a nucleic acid encoding phosphatase inhibitor protein e.g., 1-1 or a variant thereof such as I-lc, and a promoter selected from CMV promoter or a synthetic promoter selected from Table 18A or 18B or a variant thereof.
  • the rAAV comprises self- complimentary (sc) genome.
  • each sub-dose can be administered or injected into the subject over a pre-defined time period, e.g., at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10 or more than 10 minutes, and wherein there is an interval of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10 or more than 10 minutes between administration of each sub-dose.
  • TD total dose
  • SD sub-doses
  • each sub-dose is administered over a period of 1- 5 minutes.
  • the time interval between the sub-doses can be consistent, e.g., same time in-between each sub-dose, or can vary.
  • the interval between administration of sdl and sd2 can be, e.g., at least 2 minutes
  • the interval between administration of sd3 after sd2 can be, e.g., 5 minutes.
  • the sub-doses of rAAV is by a bolus or in separate vials or separate syringes.
  • the single administration of the rAAV vector is co-administered with an additional agent, or therapeutic agent.
  • the additional agent is an immune modulator as disclosed herein.
  • the additional agent is administered before, or after, or both (before and after) the single injection of the complete rAAV dose.
  • the additional agent e.g., immune modulator
  • the additional agent is administered to the subject in the intervals between sub-doses of the rAAV, that is - for example, in an exemplary administration method where the total dose (TD) of a rAAV vector is divided into 5 sub-doses (sdl, sd2, sd3, sd4, sd5)
  • the additional agent e.g., immune modulator can be administered between any one or more of: between sdl and sd2, between sd2 and sd3, between sd3 and sd4, between sd4 and sd5.
  • the additional agent, e.g., immune modulator is present in the sub-doses of rAAV.
  • the total-dose of the rAAV is selected from any of: about 10 n vg, about 3X10 n vg, about 5X10 11 vg, about 10 12 vg, about 3X10 12 vg, about 5X10 12 vg, about 10 13 vg, about 3xl0 13 vg, about 10 14 vg, 3 xlO 14 vg, or, about 10 15 vg, or more than about 10 15 vg.
  • totaldose of the rAAV is between about 10 13 vg to about 10 15 vg.
  • at least one, or at least two or at least three or more total doses of rAAV is administered.
  • each subdose of rAAV is between about 10 11 vg to about 10 15 vg. In certain embodiments, each subdose of rAAV is between about 10 13 vg to about 10 15 vg. In one embodiment, each subdose of the rAAV is selected from any of about 10 n vg, about 3xl0 n vg, about 5x10 11 vg, about 10 12 vg, about 3x10 12 vg, about 5x10 12 vg, about 10 13 vg, about 3x10 13 vg, about 10 14 vg, 3 xlO 14 vg, or, about 10 15 vg, or more than about 10 15 vg.
  • the rAAV administration is performed for one to five minutes in each of total five subdoses e.g., in each of total five syringes, wherein each subdose has 10 ml volume e.g., saline. In certain embodiments, the rAAV administration is performed for one to five minutes in each of total five syringes, wherein each syringe has 8 ml, or, 9 ml, or, 10 ml, or, 12 ml, or, 15 ml, or, 20 ml, or 25 ml or more volume of diluent.
  • the diluent is saline or, different ratios of saline-blood mixture.
  • the total volume of rAAV administration is 20ml, or 25 ml, or 30ml, or, 35 ml, or 40 ml, or 45 ml, or 50 ml, or 60 ml, or 70 ml, or 80 ml, or 90 ml, or 100 ml or, more.
  • the rAAV administration is performed with 1 syringe, or 2 syringes, or 3 syringes, or 4 syringes, or 5 syringes, or 6 syringes, or 7 syringes, or 8 syringes or more syringes.
  • the rAAV subdose in each syringe is administered over a period of time of 1 minute, or 2 minutes, or 3 minutes, or 4 minutes, or 5 minutes, or 6 minutes, or 7 minutes, or 8 minutes, or 9 minutes, or 10 minutes or, longer.
  • the method comprises administering the rAAV vector systemically.
  • Systemic administration may be enteral (e.g. oral, sublingual, and rectal) or parenteral (e.g. injection).
  • Preferred routes of injection include intravenous, intramuscular, subcutaneous, intra-arterial, intra-articular, intrathecal, and intradermal injections.
  • the gene therapy vector may be delivered by injection into the cardiac tissue.
  • administration of AAV vector or virion comprising the synthetic cardiacspecific promoter or expression cassette according to this invention is intravascular.
  • the AAV vector or virion comprising the synthetic cardiac-specific promoter or expression cassette according to this invention may be administered in the veins of the dorsal hand or the veins of the anterior forearm. Suitable veins in the anterior forearm are the cephalic, median or basilic veins. This is because this administration route is generally safe for the patient.
  • the rAAV vector is directly injected into heart tissue.
  • U.S. Ser. No. 10/914,829 describes a protocol for direct injection. Direct injection or application of a viral vector into the myocardium can restrict expression of the transferred genes to the heart (Gutzman et al, 1993, Cric. Res. 73: 1202-7; French et al., 1994, Circulation. 90:2414-24).
  • the rAAV vector is introduced into the lumen of one or more coronary arteries. Passage of blood out of the coronary arteries can be restricted.
  • the preparation comprising rAAV vectors can be delivered antegrade and allowed to reside in the arteries for between one to five minutes, e.g., between one to three minutes. Non-viral vehicles may be delivered by similar methods.
  • the rAAV vector can be administered to a subject by standard methods.
  • the agent can be administered by any of a number of different routes including intravenous (systemic), intradermal, subcutaneous, oral (e.g., inhalation or ingestion), transdermal (topical), transmucosal or by catheter or, by syringes, or, by a combination of catheter and syringe.
  • the agent is administered by injection, e.g., intra-arterially, intramuscularly, or intravenously.
  • flow of blood through coronary vessels of the heart of the subject is restricted, and the rAAV vector as disclosed herein is introduced into the lumen of a coronary artery in the subject.
  • the heart is pumping while coronary vein outflow is restricted.
  • flow of blood through the coronary vessels is completely restricted.
  • the restricted coronary vessels may comprise, without limitation: the left anterior descending artery (LAD), the distal circumflex artery (LCX), the great coronary vein (GCV), the middle cardiac vein (MCV), or the anterior interventricular vein (AIV).
  • the introduction of the rAAV vector as disclosed herein occurs after ischemic preconditioning of the coronary vessels.
  • the and the rAAV vector as disclosed herein is injected into the heart of the subject while aortic flow of blood out of the heart is restricted, thereby allowing the nucleic acid molecule to flow into the heart.
  • the administering or the rAAV vector as disclosed herein comprises the steps of: restricting aortic flow of blood out of the heart, such that blood flow is re-directed to coronary arteries; injecting the nucleic acid molecule into the lumen of the heart, aorta, or coronary ostia to provide the nucleic acid molecule to a coronary artery; pumping the heart while the aortic flow of blood out of the heart is restricted; and reestablishing the aortic flow of blood.
  • the rAAV vector as disclosed herein is injected into the heart with a catheter.
  • the rAAV vector as disclosed herein is directly injected into a muscle of the heart.
  • a rAAV vector as disclosed herein can be injected into an affected vessel, e.g., an artery, or an organ, e.g., the heart.
  • flow of blood through coronary vessels of a heart is restricted and a rAAV vector as disclosed herein is introduced into the lumen of a coronary artery.
  • the heart is permitted to pump while coronary vein outflow is restricted.
  • a rAAV vector as disclosed herein is injected into the heart while restricting aortic flow of blood out of the heart, thereby allowing the viral delivery system to flow in to and be delivered to the heart.
  • the flow of blood through the coronary vessels is completely restricted, and in specific such embodiments, the restricted coronary vessels comprise: the left anterior descending artery (LAD, the distal circumflex artery (LCX), the great coronary vein (GCV), the middle cardiac vein (MCV), or the anterior interventricular vein (AIV).
  • LAD left anterior descending artery
  • LCX distal circumflex artery
  • GCV great coronary vein
  • MCV middle cardiac vein
  • AIV anterior interventricular vein
  • the introduction of a rAAV vector as disclosed herein occurs after ischemic preconditioning of the coronary vessels.
  • a rAAV vector as disclosed herein injected into the heart by a method comprising the steps of: restricting aortic flow of blood out of the heart, such that blood flow is re-directed to coronary arteries; injecting the vector into lumen of the heart, aorta or coronary ostia such that the vector flows into the coronary arteries; permitting the heart to pump while the aortic flow of blood out of the heart is restricted; and reestablishing the aortic flow of blood.
  • a rAAV vector as disclosed herein is injected into the heart with a catheter, and in an even more specific embodiment, a rAAV vector as disclosed herein is directly injected into a muscle of the heart.
  • the method of delivery comprises restricting blood flow to one or more of the great coronary vein (GCV), the middle cardiac vein (MCV), or the anterior interventricular vein (AIV).
  • the rAAV vector as disclosed herein is introduced into the lumen of the coronary artery after ischemic preconditioning of the left anterior descending artery (LAD) and/or the distal circumflex artery (LCX).
  • the rAAV vector as disclosed herein is introduced into the lumen of the coronary artery with a catheter, e.g., the distal circumflex artery (LCX), or a coronary vessel, e.g., a left anterior descending artery (LAD).
  • the coronary artery is the left anterior descending artery (LAD) or the distal circumflex artery (LCX).
  • the AAV vector or virion disclosed herein may be administered concurrently or sequentially with one or more additional therapeutic agents or with one or more saturating agents designed to prevent clearance of the vectors by the reticular endothelial system, e.g., can be administered with one or more immune modulators as disclosed herein.
  • the dosage of the vector may be from IxlO 10 gc/kg to IxlO 15 gc/kg or more, suitably from IxlO 12 gc/kg to IxlO 14 gc/kg, suitably from 5xl0 12 gc/kg to 5xl0 13 gc/kg.
  • the amount of the viral vector is between IxlO 11 and IxlO 16 plaque forming units (pfii).
  • the subject in need thereof will be a mammal, and preferably a primate, more preferably a human.
  • the subject in need thereof will display symptoms characteristic of a cardiovascular condition, e.g., heart disease or heart failure.
  • the method typically comprises ameliorating the symptoms displayed by the subject in need thereof, by expressing the therapeutic amount of the therapeutic product.
  • the present invention also provides a method of gene therapy of a subject, preferably a human, in need thereof, the method comprising: administering to the subject (suitably introducing into the heart of the subject) a synthetic cardiac-specific expression cassette, vector, virion or pharmaceutical composition of the present invention, which comprises a gene encoding an inhibitor of the PPI, or an angiogenic protein or peptide or any protein disclosed in Tables 4A-4B herein.
  • the method suitably comprises expressing a therapeutic amount of the inhibitor of PP 1 in the heart tissue of said subject.
  • a therapeutic amount of the inhibitor of PP 1 in the heart tissue of said subject.
  • Various conditions and diseases that can be treated are discussed herein.
  • Genes encoding suitable therapeutic products are discussed herein and include but not limited to those disclosed in Tables 4A-4B.
  • Gene therapy protocols for therapeutic gene expression in target cells in vitro and in vivo are well- known in the art and will not be discussed in detail here. Briefly, they include intravenous or intraarterial administration (e.g. intra-corotid artery, intra-hepatic artery, intra-hepatic vein), intracerebroventricular, intracranial administration, intramuscular injection, interstitial injection, instillation in airways, application to endothelium and intra-hepatic parenchyme, of plasmid DNA vectors (naked or in liposomes) or viral vectors.
  • intravenous or intraarterial administration e.g. intra-corotid artery, intra-hepatic artery, intra-hepatic vein
  • intracerebroventricular intracranial administration
  • intramuscular injection e.g. intra-corotid artery, intra-hepatic artery, intra-hepatic vein
  • intracerebroventricular e.g. intracranial administration
  • intramuscular injection e
  • the gene therapy vector may be administered to a subject (e.g., to the heart of a subject) in a therapeutically effective amount to reduce the symptoms of heart failure or a heart disorder of a subject (e.g., determined using a known evaluation method).
  • cardiac specific synthetic promoters or, skeletal muscle specific synthetic promoters active in cardiac cells as listed in Tables 2A, 5 A, or 13A provide activity in cardiac cells along with liver detargeting effect.
  • the invention provides a method for repeat dosing comprising two administrations, wherein, the repeat dosing comprises one administration of a liver detargeting AAV virion with activity in cardiac cells, and other administration of any other AAV virion that is not used in prior administration, wherein, in one administration, the AAV virion comprises a nucleic acid encoding phosphatase inhibitor (I- 1), wherein the nucleic acid operatively linked to a promoter selected from the group of CMV, CK7, myosin, CBA, CK8.
  • I- 1 nucleic acid encoding phosphatase inhibitor
  • the AAV virion comprises a nucleic acid encoding phosphatase inhibitor, wherein the nucleic acid operatively linked to a cardiac specific promoter selected from the Table 2A or, variant thereof, or a muscle-specific promoter active in cardiac and skeletal muscle selected from Table 5A or a variant thereof, or a shortened muscle-specific promoter active in cardiac and skeletal muscle selected from Table 13A or a variant thereof, and wherein, in one administration, the AAV virion comprises an AAV capsid that is different than prior administration.
  • the 1-1 comprises amino acids 1-65 of SEQ ID NO: 1 or a functional fragment thereof, wherein the threonine at position 35 of SEQ ID NO: 1 is replaced with an aspartate acid (T35D).
  • the nucleic acid encoding phosphatase inhibitor encodes a constitutively active fragment of 1-1 (I- 1c) comprising a fragment of SEQ ID NO: 1, wherein the fragment is selected from: amino acids 1-54 of SEQ ID NO: 1, 1-61 of SEQ ID NO: 1, 1-65 of SEQ ID NO: 1, 1 -66 of SEQ ID NO: 1, 1 -67 of SEQ ID NO: 1 or 1 -77 of SEQ ID NO: 1 ,or a functional variant thereof, wherein the threonine at position 35 of SEQ ID NO: 1 is replaced with an aspartate acid (T35D).
  • the nucleic acid sequence encoding a polypeptide comprises at least amino acids 1-54 of SEQ ID NO: 1, wherein threonine at position 35 of SEQ ID
  • an example of a method of repeat dosing comprises a first and a second administration, wherein in the first administration, , AAV2i8 (or, BNP 116) vector comprising nucleic acid encoding phosphatase inhibitor (1-1) polypeptide as described herein is used to administer subjects having congestive heart failure, and wherein the nucleic acid is operatively linked with CMV promoter; in the second administration, recombinant AAV2/9 vector comprising nucleic acid encoding phosphatase inhibitor polypeptide (1-1) as described herein is used to administer said subjects, and wherein the nucleic acid is operatively linked with synthetic promoters selected from the group of SP0173, SP0320, SP0279, SP0134, SP0057, SP0229, SP0067, SP0310, SP0311, SP0267, or a variant thereof.
  • rAAV vector comprising cardiac specific promoter selected from the Table 2A or, variant thereof, or a muscle-specific promoter active in cardiac and skeletal muscle selected from Table 5A or a variant thereof or a shortened muscle-specific promoter active in cardiac and skeletal muscle selected from Table 13 A, or a variant thereof allow efficacious repeat administration of rAAV vector to treat heart disease (e.g., congestive heart failure) using a rAAV virion with any AAV capsid that is different than the prior administrations, and wherein the rAAV comprises a nucleic acid encoding phosphatase inhibitor (1-1) that is operatively linked to said promoter.
  • heart disease e.g., congestive heart failure
  • the rAAV comprising cardiac specific promoter selected from the Table 2A or, variant thereof, or a muscle -specific promoter active in cardiac and skeletal muscle selected from Table 5A or a variant thereof, or a shortened muscle-specific promoter active in cardiac and skeletal muscle selected from Table 13 A, or a variant thereof allow efficacious repeat administration of rAAV vector to treat heart disease (e.g., congestive heart failure) using a rAAV virion with any AAV capsid that is different than the prior administrations, wherein the rAAV comprises a nucleic acid encoding phosphatase inhibitor (1-1) that is operatively linked to said promoter, and wherein the rAAV is from about IxlO 11 vg/ml to about IxlO 13 vg/ml.
  • the rAAV comprising cardiac specific promoter selected from the Table 2A or, variant thereof, or a muscle-specific promoter active in cardiac and skeletal muscle selected from Table 5A or a variant thereof, or a shortened muscle-specific promoter active in cardiac and skeletal muscle selected from Table 13 A, or a variant thereof allow efficacious repeat administration of rAAV vector to treat heart disease (e.g., congestive heart failure) using a rAAV virion with any AAV capsid that is different than the prior administrations, wherein the rAAV comprises a nucleic acid encoding phosphatase inhibitor (1-1) that is operatively linked to said promoter, and wherein at least one total dose of rAAV is from about 10 n vg to about 10 15 vg.
  • At least one total dose of rAAV is from about 10 11 vg to about 10 14 vg. In some embodiments, at least one total dose of rAAV is 10 12 vg, or, I0 13 vg, or, 3X10 13 vg, or, 10 14 vg, or, 3X10 14 vg.
  • SP0173, SP0320, SP0279, SP0134, SP0057, SP0229, SP0067, SP0310, SP03I I, or, SP0267 allow efficacious repeat administration of rAAV vector to treat heart disease (e.g., congestive heart failure) using a rAAV virion with any AAV capsid that is different than prior administration, i.e. an AAV capsid with a different immune profile.
  • the methods and compositions for treating heart failure further comprises administering an immune modulator.
  • the immune modulator can be administered at the time of rAAV vector administration, before rAAV vector administration or, after the rAAV vector administration.
  • the immune modulator is an immunoglobulin degrading enzyme such as IdeS, IdeZ, IdeS/Z, Endo S, or, their functional variant.
  • immunoglobulin degrading enzymes such as IdeS, IdeZ, IdeS/Z, Endo S, or, their functional variant.
  • the immune modulator is Proteasome inhibitor.
  • the proteasome inhibitor is Bortezomib.
  • the immune modulator comprises bortezomib and anti CD20 antibody, Rituximab.
  • the immune modulator comprises bortezomib, Rituximab, methotrexate, and intravenous gamma globulin.
  • Nonlimiting examples of such references disclosing proteasome inhibitors and their combination with Rituximab, methotrexate and intravenous gamma globulin, as described in US 10,028,993, US 9,592,247, and, US 8,809,282, each of which are incorporated in their entirety by reference.
  • the immune modulator is an inhibitor of the NF-kB pathway.
  • the immune modulator is Rapamycin or, a functional variant.
  • the immune modulator is synthetic nanocarriers comprising an immunosuppressant.
  • the immune modulator is synthetic nanocarriers comprising rapamycin (ImmTORTM nanoparticles) (Kishimoto, et al., 2016, Nat Nanotechnol, 11(10): 890-899; Maldonado, et al., 2015, PNAS, 112(2): E156-165), as disclosed in US20200038463, US Patent 9,006,254 each of which is incorporated herein in its entirety.
  • the immune modulator is an engineered cell, e.g., an immune cell that has been modified using SQZ technology as disclosed in WO2017192786, which is incorporated herein in its entirety by reference.
  • the immune modulator is selected from the group consisting of poly-ICLC, 1018 ISS, aluminum salts, Amplivax, AS15, BCG, CP-870,893, CpG7909, CyaA, dSLIM, GM-CSF, IC30, IC31, Imiquimod, ImuFact IMP321, IS Patch, ISS, ISCOMATRIX, Juvhnmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PEPTEL, vector system, PLGA microparticles, resiquimod, SRL172, Virosomes and other Virus-like particles, YF-17D, VEGF trap, R848, beta-glucan, Pam3Cys, and Aquila's QS21 stimul
  • the immune modulator is a small molecule that inhibit the innate immune response in cells, such as chloroquine (a TLR signaling inhibitor) and 2-aminopurine (a PKR inhibitor), can also be administered in combination with the composition comprising at least one rAAV as disclosed herein.
  • chloroquine a TLR signaling inhibitor
  • 2-aminopurine a PKR inhibitor
  • TLR-signaling inhibitors include BX795, chloroquine, CLI-095, OxPAPC, polymyxin B, and rapamycin (all available for purchase from INVIVOGENTM).
  • inhibitors of pattern recognition receptors which are involved in innate immunity signaling
  • PRR pattern recognition receptors
  • 2-aminopurine, BX795, chloroquine, and H-89 can also be used in the compositions and methods comprising at least one rAAV vector as disclosed herein for in vivo protein expression as disclosed herein.
  • a rAAV vector can also encode a negative regulators of innate immunity such as NLRX1. Accordingly, in some embodiments, a rAAV vector can also optionally encode one or more, or any combination of NLRX1, NS1, NS3/4A, or A46R. Additionally, in some embodiments, a composition comprising at least one rAAV vector as disclosed herein can also comprise a synthetic, modified-RNA encoding inhibitors of the innate immune system to avoid the innate immune response generated by the tissue or the subject.
  • an immune modulator for use in the administration methods as disclosed herein is an immunosuppressive agent.
  • immunosuppressive drug or agent is intended to include pharmaceutical agents which inhibit or interfere with normal immune function.
  • immunosuppressive agents suitable with the methods disclosed herein include agents that inhibit T-cell/B- cell costimulation pathways, such as agents that interfere with the coupling of T-cells and B-cells via the CTLA4 and B7 pathways, as disclosed in U.S. Patent Pub. No 2002/0182211.
  • an immunosuppressive agent is cyclosporine A.
  • Other examples include myophenylate mofetil, rapamicin, and anti- thymocyte globulin.
  • the immunosuppressive drug is administered in a composition comprising at least one rAAV vector as disclosed herein, or can be administered in a separate composition but simultaneously with, or before or after administration of a composition comprising at least one rAAV vector according to the methods of administration as disclosed herein.
  • An immunosuppressive drug is administered in a formulation which is compatible with the route of administration and is administered to a subject at a dosage sufficient to achieve the desired therapeutic effect.
  • the immunosuppressive drug is administered transiently for a sufficient time to induce tolerance to the rAAV vector as disclosed herein.
  • a subject being administered a rAAV vector or rAAV genome as disclosed herein is also administered an immunosuppressive agent.
  • an immunosuppressive agent such as a proteasome inhibitor.
  • proteasome inhibitor known in the art, for instance as disclosed in U.S. Patent No. 9,169,492 and U.S. Patent Application No. 15/796,137, both of which are incorporated herein by reference, is bortezomib.
  • an immunosuppressive agent can be an antibody, including polyclonal, monoclonal, scfv or other antibody derived molecule that is capable of suppressing the immune response, for instance, through the elimination or suppression of antibody producing cells.
  • the immunosuppressive element can be a short hairpin RNA (shRNA).
  • shRNA short hairpin RNA
  • the coding region of the shRNA is included in the rAAV cassette and is generally located downstream, 3’ of the poly -A tail.
  • the shRNA can be targeted to reduce or eliminate expression of immunostimulatory agents, such as cytokines, growth factors (including transforming growth factors [31 and [32, TNF and others that are publicly known).
  • immune modulating agents facilitates the ability to for one to use multiple dosing (e.g., multiple administration) over numerous months and/or years. This permits using multiple agents as discussed below, e.g., a rAAV vector encoding multiple genes, or multiple administrations to the subject.
  • the methods and compositions for treating heart failure further comprises administering a vasodilator.
  • the vasodilator can be administered at the time of rAAV vector administration (i.e., concurrent with, or substantially concurrent with the rAAV administration), before rAAV vector administration or, after the rAAV vector administration.
  • Vasodilators can assist delivery of the rAAV vector by enlarging (dilating) blood vessels.
  • the vasodilator is administered at least about 1 minute prior, at least about 5 minutes prior, at least about 10 minutes prior, at least about 15 minutes prior, at least about 20 minutes prior, at least about 25 minutes prior, at least about 30 minutes prior, at least about 35 minutes prior, at least about 40 minutes prior, or more than 40 minutes prior the rAAV vector administration.
  • the rAAV vector can be administered with at least one vasodilator selected from any of: Isosorbide dinitrate (ISORDIU®), Nesiritide (NATRECOR®), Hydralazine (APRESOUINE®), Nitrate drugs, Minoxidil, 4CAPTOPRILTM, Nitrovasodilators (nitroglycerin, isosorbide mononitrate, isosorbide dinitrate, and sodium nitroprusside, serelaxin, Endothelin antagonists (e.g., endothelin-1 (ET-1) antagonists e.g, tezosentan); other natriuretic peptides (e.g., Ularitide, CD-NP), Relaxin, Cenderitide, Clevidipine, TRV120027, Cinaciguat, BAY 1021189, BAY 28-2667 (N) and hemeindependent soluble G protein activator), 1021189 CXL-1020,
  • vasodilator selected
  • Vasodilators improves cardiac function mainly through peripheral vasodilation in a mouse model of dilated cardiomyopathy.
  • Vasodilators are well known to the skilled artisan and are encompassed for use in the methods and compositions as disclosed herein. Some vasodilators useful in the methods as disclosed herein are disclosed in: Holt et al., Vasodilator Therapies in the Treatment of Acute Heart Failure. Curr Heart Fail Rep. 2019 Feb;16(l):32- 37, Travessa AM, Menezes Falcao L. Vasodilators in acute heart failure - evidence based on new studies. Eur J Intern Med.
  • rAAVs can be administered with vasoactive agents or, vasculature permeability agents along with vasodilators. In some embodiments, rAAVs can be administered with only vasoactive agents or, vasculature permeability agents. In some embodiments, vasoactive agents and vasodilators are co administered at different times.
  • vasoactive agents or, vasculature permeability agents can be without limitation, histamine, histamine agonist, vascular endothelial growth factor protein (VEGF protein), serotonin, bradykinin, platelet activating factor (PAF), prostaglandin El (PGE1), zona occludens toxin (ZOT), interleukin 2, bradykinin, other plasmakinins as described in International Publication no. WO1999040945A3; US Patent no. 6,855,701 all of which are incorporated herein by reference in their entirety.
  • VEGF protein vascular endothelial growth factor protein
  • PAF platelet activating factor
  • PGE1 prostaglandin El
  • ZOT zona occludens toxin
  • interleukin 2 bradykinin
  • other plasmakinins as described in International Publication no. WO1999040945A3; US Patent no. 6,855,701 all of which are incorporated herein by reference in their entirety.
  • rAAV for administration and rAAV Genome elements a. Agent that modulates protein phosphate activity.
  • PPI Protein phosphatase 1
  • Phosphatase Inhibitor- 1 (“1-1”) is the main physiological modulator and is an effective inhibitor when phosphorylated on threonine-35 by PKA (Endo, S. et al., 1996 Biochemistry; 35(16): 5220-8). Inhibition of PPI, removes its opposition to the actions of PKA protein phosphorylation, leading to amplification of the [3-agonist responses in the heart (Ahmad, Z. J. 1989 Biol Chem; 264:3859-63; Gupta, R. C. et al., 1996 Circulation; (Suppl 1):I-361).
  • phosphatase activity is increased in heart failure.
  • Reducing phosphatase activity e.g., phosphatase 1 activity
  • cardiomyocytes can relieve one or more symptoms of associated with heart failure.
  • Reduced phosphatase activity is associated with attenuated P-adrenergic responsiveness.
  • expression of a phosphatase inhibitor in heart cells can be used to treat cardiac disorders, e.g., heart failure. Decreasing phosphatase activity can improve P-adrenergic responsiveness.
  • one aspect of the disclosure is a method of treating a subject having heart failure comprising administering a rAAV vector expressing an inhibitor the phosphorylation activity of PKC-a.
  • phosphatase activity can be decreased by inhibiting type 1 phosphatases (PPI).
  • Type 1 phosphatases include, but are not limited to PPlca, PPlcP, PP led and PPlcy. See Sasaki et. al. (1990) Jpn J Cancer Res. 81: 1272-1280, the contents of which are incorporated herein by reference.
  • the phosphatase inhibitor- 1 (or “1-1”) protein is an endogenous inhibitor of type 1 phosphatase. Increasing 1-1 levels or activity can restore [3-adrenergic responsiveness in failing human cardiomyocytes.
  • the rAAV vector comprises a nucleic acid encoding a constitutively active 1-1 protein.
  • a nucleic acid encoding I-1T35D comprises a truncation of the 1-1 cDNA to encode for the first 65 amino acids and introduction of nucleotide changes to replace the PKA phosphorylation site (GGT: Thr35) with aspartic acid (GTC: Asp35), resulting in a constitutively active inhibitor.
  • the rAAV vector comprises a nucleic acid construct encoding a constitutively active 1-1 protein, where threonine 35 is replaced with glutamic acid instead of aspartic acid.
  • substitutions can also be made in a full length inhibitor molecule. Failing human cardiomyocytes expressing I-1T35D exhibit normal contractile function under basal conditions and their beta adrenergic function is restored to normal. Thus, delivery of inhibitor-1 completely restores function and reverses remodeling in the setting of pre-existing heart failure.
  • the rAAV vector as disclosed herein can comprise nucleic acid sequences encoding other phosphatase inhibitors and other variants of I- 1.
  • a rAAV vector as disclosed herein can comprise a nucleic acid encoding any one or more of the inhibitors selected from: phosphatase inhibitor 2 (PP2); okadaic acid or caliculin; and nippl which is an endogenous nuclear inhibitor of protein phosphatase 1.
  • the rAAV vector as disclosed herein comprises a nucleic acid encoding a phosphatase inhibitor is specific for protein phosphatase 1 (PPI).
  • proteins that modulate cardiac activity include, but are not limited to: a protein that modulates phosphatase activity (e.g., a phosphatase type 1 inhibitor, e.g., 1-1) or a sacroplasmic reticulum Ca2+ ATPase (SERCA), e.g., SERCA1 (e.g., la or lb), SERCA2 (e.g., 2a or 2b), or SERCA3.
  • a protein that modulates phosphatase activity e.g., a phosphatase type 1 inhibitor, e.g., 1-1
  • SERCA sacroplasmic reticulum Ca2+ ATPase
  • SERCA1 e.g., la or lb
  • SERCA2 e.g., 2a or 2b
  • SERCA3 sacroplasmic reticulum Ca2+ ATPase
  • a method of treatment comprises introduction into the heart cells of the subject, a rAAV vector comprising a nucleic acid sequence encoding a mutant form of phosphatase inhibitor- 1 protein, wherein the mutant form comprises at least one amino acid at a position that is a PKC-a phosphorylation site in the wild type, wherein the at least one amino acid is constitutively unphosphorylated or mimics an unphosphorylated state in the mutant form.
  • Phosphatase Inhibitor Protein-I (1-1) is a key regulator of cardiac contractility. 1-1 is also known as Type-1 phosphtatase (PPI or PP-1) is known to regulate cardiac contractility by inhibiting the activity of Protein Phosphatase- 1 ("PP-1"). I-l's ability to inhibit PP-1 is further known to be regulated by phosphorylation. When threonine 35 of 1-1 is phosphorylated by Protein Kinase A (PKA), PP-1 activity is inhibited, cardiac contractility is enhanced (Pathak, A., et al. 2005 Circ Res 15 : 756'-66).
  • PKA Protein Kinase A
  • phosphatase activity can be decreased by inhibiting type 1 phosphatases (PPI).
  • Type 1 phosphatases include, but are not limited to PPlca, PPlc[3, PP led and PPlcy. See Sasaki et. al. (1990) Jpn J Cancer Res. 81: 1272-1280, the contents of which are incorporated herein by reference.
  • the phosphatase inhibitor- 1 (or “1-1”) protein is an endogenous inhibitor of type 1 phosphatase. Increasing 1-1 levels or activity can restore [3-adrenergic responsiveness in failing human cardiomyocytes.
  • a constitutively active 1-1 protein can be administered.
  • I-1T35D One such construct exemplified herein (I-1T35D) entails truncation of the 1-1 cDNA to encode for the first 65 amino acids and introduction of nucleotide changes to replace the PKA phosphorylation site (GGT: Thr35) with aspartic acid (GTC: Asp35), resulting in a constitutively active inhibitor.
  • Another way to make a constitutively active inhibitor is to substitute threonine 35 with glutamic acid instead of aspartic acid. These substitutions can also be made in a full length inhibitor molecule.
  • the nucleic acid encoding 1-1 is shown as follows: agtgtccccg gageegegag ctgggagcgc tgtgccggga gccgggagcc gagcgcgccg 60 ggctggggcc ggggccggag eggageggag agggagcgcgcgccccag ccccgagtcc 120 cgccgcttc cccgcg cagcgcgggc ccaccggccg ccgcccagc catggagcaa 180 gacaacagcc cccaaagat ccagttcacg gtcccgctgc tggageegea ccttgacccc 240 gaggcggcgg agcagattcg gaggcgccgcgcgcgcgcgcgcggg
  • the rAAV vector comprises a nucleic acid sequence encoding a 1-1 or I-lc protein of amino acids SEQ ID NO: 1 or a modified variant of SEQ ID NO: 1.
  • the rAAV vector comprises a nucleic acid sequence of SEQ ID NO: 2, or a fragment thereof, wherein the fragment of SEQ ID NO: 2 encodes amino acids 1-65 of SEQ ID NO: 1, or a fragment from amino acid 1 to C-terminal amino acid 70, 67, 66, 65, or 61, or 54 of SEQ ID NO: 1, where threonine at position 35 of SEQ ID NO: 1 is replaced with an aspartic acid (T35D).
  • the rAAV vector comprises a nucleic acid sequence encoding a 1-1 or I-lc protein which is a codon optimized nucleic acid sequence, for enhanced expression in vivo and/or to reduce CpG islands, and/or to reduce the innate immune response.
  • Exemplary codon optimized 1-1 or I-lc nucleic sequences encompassed for use in the methods and rAAV compositions as disclosed herein can be used, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 2 or a portion thereof, or SEQ ID NOS: 385-412, which is codon optimized according to methods known in the art, or a nucleic acid sequence that has at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of SEQ ID NO: 2 or 385- 412.
  • the 1-1 or I-lc nucleic acid sequences encompassed for use in the methods and rAAV compositions as disclosed herein are further modified with at least one or more of the following modifications: (i) removal of at least one, or two or in some embodiments, all alternative reading frames, (ii) removal of one or more CpGs islands, (iii) modification of the Kozak sequence, (iv) modification of a translational terminator sequence, and (v) removal of a spacer between promoter and Kozak sequence.
  • the human 1-1 protein expressed by the AAV is encoded by a codon optimized nucleic acid sequence, for example, a sequence selected from any of SEQ ID NO: 385-412.
  • the 1-1 protein expressed by the rAAV vector is encoded by a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NOS: 385-412.
  • such a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NOS: 385-412 can be assessed using in vitro assays as disclosed in the Examples herein, or using cardiomyocytes from failing hearts (e.g., tissues from failing left ventricles (LV)) where PPI activity can be assayed with 32P-labeled rabbit glycogen phosphorylase as the substrate.
  • cardiomyocytes from failing hearts e.g., tissues from failing left ventricles (LV)
  • LV left ventricles
  • PP2A okadaic acid, 4 nM
  • EDTA calcineurin phosphatase
  • such a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NOS: 385-412 can also be assessed using in vivo and in vitro assays as disclosed in the Examples herein and disclosed in Patkak et al, e.g., by assessing in vivo cardiac function by non-invasive echocardiography and echocardiographic assessment, and in vitro contractility was examined using the Langendorff perfusion system. Cardiac catheritization and pressurevolume loop measurements in the murine heart can also be performed, as disclosed in Patjak, et al. "Enhancement of cardiac function and suppression of heart failure progression by inhibition of protein phosphatase 1.” Circulation research 96.7 (2005): 756-766, which is incorporated herein in its entirety by reference.
  • amino acid sequence of 1-1 is as follows: MEQDNSPQKIQFTVPLLEPH LDPEAAEQIRRRRPTPATLV LTSDQSSPEIDEDRIPNPHL
  • inhibitor- 1 (lie) in a cardiomyocyte restricted manner. This form of inhibitor- 1 was chosen because it specifically inhibits protein phosphatase 1, albeit at higher concentration than the native phosphorylated inhibitor.
  • the rAAV vector disclosed herein comprises a nucleic acid sequence encoding a polypeptide comprising amino acids 1-65 of SEQ ID NO: 1, wherein threonine at position 35 of SEQ ID NO: 1 is replaced with an aspartic acid (T35D); and wherein said nucleic acid sequence is operably linked to a cardiac-specific promoter as disclosed in Table 2A, 3 or 4 herein.
  • the 1-1 protein or a functional variant thereof is expressed in the heart of the subject in an amount effective to increase cardiac contractility and reduce morphological deterioration associated with cardiac remodeling in the subject with existing heart failure.
  • the rAAV vector disclosed herein comprises a nucleic acid sequence encoding a constitutively active fragment of 1-1 (I- 1c), wherein I-lc is a polypeptide comprising amino acids of SEQ ID NO: 1, wherein SEQ ID NO: 1 is truncated at the C-terminus at amino acid 70, 67, 66, 65, or 61, or 54, and where the there is an aspartic acid at position 35 (T35D).
  • the 1-1 polypeptide is described in US patents 9,114,148, which is incorporated herein in its entirety by reference.
  • the 1-1 polypeptide can comprise a secretory signal (SS).
  • SS secretory signal
  • one of ordinary skill in the art can appreciate particular positions of 1-1 or I-lc which a secretory signal peptide (SS) can be fused.
  • the invention relates to a 1-1 protein, beginning at amino acid 1 and terminating at amino acid 70, 67, 66, 65, or 61, or 54 of human 1-1 of SEQ ID NO: 1, or a modified 1-1 protein of SEQ ID NO: 1, where there is an aspartic acid at position 35 (T35D) of SEQ ID NO: 1.
  • the human 1-1 protein expressed by the AAV comprises amino acids of SEQ ID NO: 1, or fragments or variants thereof, for example a 1-1 protein beginning at residue 70, 67, 66, 65, or 61, or 54 of SEQ ID NO: 1.
  • the 1-1 protein expressed by the rAAV vector comprises amino acids beginning at any one or 70, 67, 66, 65, or 61, or 54 of SEQ ID NO: 1, or a protein at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical to SEQ ID NO: 1, beginning at amino acids 70, 67, 66, 65, or 61, or 54.
  • the 1-1 protein expressed by the rAAV comprises amino acids beginning at residue 70, 67, 66, 65, or 61, or 54 of SEQ ID NO: 1, or a protein at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical thereto.
  • the 1-1 protein expressed by the rAAV vector comprises amino acids of beginning at residue 70, 67, 66, 65, or 61, or 54 of any of SEQ ID NO: 1, where there is an aspartic acid at position 35 (T35D) of SEQ ID NO: 1, or a protein at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical thereto.
  • the effect of a rAAV vector as disclosed herein on phosphatase enzymatic activity can be evaluated in vitro.
  • protein phosphatase 1 activity can be assayed as described (Endo, S., et al. (1996) Biochemistry 35, 5220-5228) in a 30-pl reaction mixture containing 50 mM Tris.HCl (pH 7.4), 1 mM DTT, 0.5 mM MnC12, 10 pM [32P]phosphorylase a, and 0.5 pg/ml PPI.
  • the reaction is initiated by the addition of 1 pl of PPI to 20 pl of assay mixture containing the rest of the assay components. After 20 min at 30° C.
  • [32P]Phosphorylase a used for PPI assays was prepared at 30° C. for 30 min as described. [32P]Phosphorylase a was dialyzed in 50 mM Tris.HCl, pH 7.4, 1 mM EDTA, 1 mM DTT and stored frozen at -80° C. until used (see also Huang et al. Proc Natl Acad Sci USA. 2000 May 23;
  • a rAAV vector as disclosed herein expressing an inhibitor of PPI e.g., 1-1, I-lc or a variant thereof can be assessed by generating dose response curves from data obtained using various concentrations of the test compounds.
  • a control assay can also be performed to provide a baseline for comparison. In the control assay, the heart cell is incubated in the absence of a test compounds.
  • Table 17 shows, without being construed to any limitation exemplary nucleic acid sequences encoding lie genes (SEQ ID NO: 385-412), where the rAAV vector can comprise a nucleic acid sequence selected from any of SEQ ID NOS 413-440, which comprise the I-lc nucleic acid and other components and flanked within left and right ITR sequences, or a nucleic acid sequence that has at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 413-440.
  • Exemplary close ended linear duplex useful herein can comprises a nucleic acid sequence selected from of any of SEQ ID NO: 357-384, or a nucleic acid that has at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
  • a porcine models can be used.
  • the pig is a particularly suitable model for studying a cardiovascular condition, including heart diseases of humans because of its relevance to human physiology.
  • the pig heart closely resembles the human heart in the following ways.
  • the pig has a native coronary circulation very similar to that of humans, including the relative lack of native coronary collateral vessels.
  • the size of the pig heart is similar to that of the human heart.
  • the pig is a large animal model, therefore allowing more accurate extrapolation of various parameters such as effective vector dosages, toxicity, etc.
  • the hearts of animals such as dogs and members of the murine family have a lot of endogenous collateral vessels.
  • the size of the dog heart is twice that of the human heart.
  • An exemplary porcine model is a myocardial ischemia porcine model, which mimics clinical coronary artery disease, is described in US Application 2003/0148968, which is incorporated herein in its entirety by reference. Based on published studies, those skilled in the art will appreciate that the results in a pig model are expected to be predictive of results in humans.
  • these models can be used to determine whether the methods of administration of a rAAV vector as disclosed herein, and/or the rAAV vector encoding an inhibitor of PPI (e.g., 1-1, 1-lc or a variant thereof) and/or another therapeutic protein (e.g., angiogenic protein or peptide) is effective to alleviate at least one cardiac dysfunctions associated with these conditions.
  • PPI e.g., 1-1, 1-lc or a variant thereof
  • another therapeutic protein e.g., angiogenic protein or peptide
  • the rAAV vector as disclosed herein can express other phosphatase inhibitors and other variants of 1-1.
  • examples of such other inhibitors include phosphatase inhibitor 2; okadaic acid or caliculin; and nippl which is an endogenous nuclear inhibitor of protein phosphatase 1.
  • the phosphatase inhibitor is specific for protein phosphatase 1.
  • the rAAV vector as disclosed herein can express other therapeutic agents to treat heart failure, e.g., adenylyl cyclase 6 (AC6, also referred to as adnenylyl cyclase VI), S100A1, [3- adrenergic receptor kinase-ct (J3ARKct), sarco/endoplasmic reticulum (SR) Ca -ATPase (SERCA2a), IL- 18, VEGF, VEGF activators, urocortins, and B-cell lymphoma 2 (Bcl2)-associated anthanogene-3 (BAG3).
  • AC6 adenylyl cyclase 6
  • S100A1 [3- adrenergic receptor kinase-ct (J3ARKct)
  • SR sarco/endoplasmic reticulum
  • SERCA2a Ca -ATPase
  • Table 18A Exemplary genes to be encoded by a rAAV vector comprising a synthetic cardiacspecific promoter as disclosed herein.
  • Table 18B Exemplary therapeutic agents to be expressed by the rAAV vectors for the treatment of arrhythmia or myopathy
  • the rAAV vector encodes a nucleic acid sequence as disclosed in Table 1, 2, 3, 4, 5, 6 or 7 of US patent 10/086,043, which is incorporated in its entirety by reference.
  • the rAAV vector for use in the methods and compositions as disclosed herein comprises a nucleic acid sequence that encodes a protein disclosed in Table 18A or variant thereof, where the nucleic acid sequence is selected from any of: SEQ ID NOS: 1, 450-507, or 527-532 or a variant thereof having at least 80%, or at least 85%, or at least 90%, or at least 95% or at least 98% sequence identity to any of SEQ ID NOS: 1, 450-507, or 527-532.
  • the rAAV vector for use in the methods and compositions as disclosed herein comprises a nucleic acid sequence that is codon optimized that encodes for a protein or variant of a protein selected from any in Table 18A, where the codon optimized nucleic acid sequence is a codon optimized nucleic acid sequence selected from any of selected from any of: SEQ ID NOS: 1, 450-507, or 527-532 and has at least 60%, or at least 70% or at least 80%, or at least 85%, or at least 90%, or at least 95% or at least 98% sequence identity to SEQ ID NOS: SEQ ID NOS: 1, 450-507, or 527-532.
  • rAAV vector comprises a nucleic acid sequence encoding any of SEQ ID NOS: 1, 450-507, or 527-532, and is codon optimized to have at least 50%, or 60% or 70% or 75%, 80%, 85%, 90%, 95% reduced CpG site content relative to the CpG site content of the nucleic acid sequence of SEQ ID NOS: 1, 450-507, or 527-532.
  • the rAAV vector for use in the methods and compositions as disclosed herein comprises a nucleic acid sequence that encodes a protein disclosed in Table 18B or variant thereof, where the nucleic acid sequence is selected from any of: SEQ ID NOS: 508-526 or a variant thereof having at least 80%, or at least 85%, or at least 90%, or at least 95% or at least 98% sequence identity to any of SEQ ID NOS: 508-526.
  • the rAAV vector for use in the methods and compositions as disclosed herein comprises a nucleic acid sequence that is codon optimized that encodes for a protein or variant of a protein selected from any in Table 18B, where the codon optimized nucleic acid sequence is a codon optimized nucleic acid sequence selected from any of selected from any of: SEQ ID NOS: 508-526 and has at least 60%, or at least 70% or at least 80%, or at least 85%, or at least 90%, or at least 95% or at least 98% sequence identity to SEQ ID NOS: SEQ ID NOS: 508-526.
  • rAAV vector comprises a nucleic acid sequence encoding any of SEQ ID NOS: 508-526 and is codon optimized to have at least 50%, or 60% or 70% or 75%, 80%, 85%, 90%, 95% reduced CpG site content relative to the CpG site content of the nucleic acid sequence of SEQ ID NOS: 508-526.
  • the rAAV vector encodes a nucleic acid for increasing angiogenesis, e.g., an angiogenic protein, as defined herein.
  • Angiogenesis refers generally to the development and differentiation of blood vessels. A number of proteins, typically referred to as “angiogenic proteins,” are known to promote angiogenesis.
  • Such angiogenic proteins include members of the fibroblast growth factor (FGF) family, the vascular endothelial growth factor (VEGF) family, the platelet-derived growth factor (PDGF) family, the insulin-like growth factor (IGF) family, and others.
  • FGF fibroblast growth factor
  • VEGF vascular endothelial growth factor
  • PDGF platelet-derived growth factor
  • IGF insulin-like growth factor
  • FGF and VEGF family members have been recognized as regulators of angiogenesis during growth and development.
  • the angiogenic activity of the FGF and VEGF families has been examined. For example, it has been shown that acidic FGF (“aFGF”) protein, within a collagen-coated matrix, when placed in the peritoneal cavity of adult rats, resulted in a well vascularized and normally perfused structure (Thompson et al., Proc. Natl. Acad. Sci.
  • a rAVV vector as disclosed herein comprising a cardiac-specific promoter encodes one or more angiogenic proteins or peptide, such as, for example, FGF-5, FGF-4, aFGF, bFGF and/or a VEGF, or variants thereof.
  • Suitable angiogenic proteins or peptides are exemplified by members of the family of fibroblast growth factors (FGF), vascular endothelial growth factors (VEGF), platelet- derived growth factors (PDGF), insulin-like growth factors (IGF), and others.
  • FGF-1 aFGF
  • FGF-2 bFGF
  • FGF-4 also known as “hst/KS3”
  • FGF-5 FGF-6
  • the rAAV vector disclosed herein encodes a secreted angiogenic protein, such as, FGF-4, FGF-5, or FGF-6 since these proteins contain functional secretory signal sequences and are readily secreted from cells.
  • VEGF proteins including but not limited to VEGF-121 and VEGF-165) also are readily secreted and diffusible after secretion.
  • VEGF has been shown to be expressed by cardiac myocytes in response to ischemia in vitro and in vivo; it is a regulator of angiogenesis under physiological conditions as well as during the adaptive response to pathological states (Banai et al. Circulation 89:2183-2189, 1994).
  • the VEGF family includes, but is not limited to, members of the VEGF-A sub-family (e.g. VEGF-121, VEGF-145, VEGF-165, VEGF-189 and VEGF-206), as well as members of the VEGF-B sub-family (e.g. VEGF-167 and VEGF-186) and the VEGF-C sub-family.
  • PDGF includes, e.g., PDGF A and PDGF B
  • IGF includes, for example, IGF-1.
  • Other angiogenic proteins or peptides are known in the art and new ones are regularly identified. The nucleotide sequences of genes encoding these and other proteins, and the corresponding amino acid sequences are likewise known in the art (see, e.g., the GENBANK sequence database).
  • Angiogenic proteins and peptides include peptide precursors that are post-translationally processed into active peptides and “derivatives” and “functional equivalents” of angiogenic proteins or peptides.
  • Derivatives of an angiogenic protein or peptide are peptides having similar amino acid sequence and retaining, to some extent, one or more activities of the related angiogenic protein or peptide.
  • useful derivatives generally have substantial sequence similarity (at the amino acid level) in regions or domains of the protein associated with the angiogenic activity.
  • functional equivalent is meant a protein or peptide that has an activity that can substitute for one or more activities of a particular angiogenic protein or peptide.
  • Preferred functional equivalents retain all of the activities of a particular angiogenic protein or peptide; however, the functional equivalent may have an activity that, when measured quantitatively, is stronger or weaker than the wild-type peptide or protein.
  • VEGF-A protein see e.g., Tischer et al. J. Biol. Chem. 206: 11947-11954, 1991, and references therein; Muhlhauser et al., Circ. Res. 77: 1077-1086, 1995; and Neufeld et al., WO 98/10071 (Mar. 12, 1998).
  • Other variants of known angiogenic proteins have likewise been described; for example variants of VEGF proteins and VEGF related proteins, see e.g., Baird et al., WO 99/40197, (Aug.
  • angiogenic proteins can promote angiogenesis by enhancing the expression, stability or functionality of other angiogenic proteins.
  • angiogenic proteins or peptides include, e.g., regulatory factors that are induced in response to hypoxia (e.g.
  • hypoxia-inducible factors such as Hif-1, Hif-2 and the like; see, e.g., Wang et al., Proc. Natl. Acad. Sci. USA 90(9): 4304-8, 1993; Forsythe et al., Mol. Cell. Biol. 16(9): 4604-13, 1996; Semenza et al., Kidney Int., 51(2): 553-5, 1997; and O'Rourke et al., Oncol.
  • angiogenic proteins include certain insulin-like growth factors (e.g., IGF-1) and angiopoietins (Angs), which have been reported to promote and/or stimulate expression and/or activity of other angiogenic proteins such as VEGF (see e.g. Goad, et al, Endocrinology, 137(6):2262-68 (1996); Warren, et al., J. Bio. Chem., 271(46):29483-88 (1996); Punglia, et al, Diabetes, 46(10): 1619-26 (1997); and Asahara, et al., Circ.
  • IGF-1 insulin-like growth factors
  • Angs angiopoietins
  • hepatocyte growth factor also referred to as Scatter factor
  • VEGF vascular endothelial growth factor
  • Additional examples of angiogenic polypeptides include natural and synthetic regulatory peptides (angiogenic polypeptide regulators) that act as promoters of endogenous angiogenic genes.
  • Native angiogenic polypeptide regulators can be derived from inducers of endogenous angiogenic genes. Hif, as described above, is one illustrative example of such an angiogenic gene which has been reported to promote angiogenesis by inducing expression of other angiogenic genes.
  • Synthetic angiogenic polypeptide regulators can be designed, for example, by preparing multi-finger zinc-binding proteins that specifically bind to sequences upstream of the coding regions of endogenous angiogenic genes and which can be used to induce the expression of such endogenous genes.
  • genes encoding proteins or peptides having the capacity to directly or indirectly promote angiogenesis are regularly identified and new genes will be identified based on similarities to known angiogenic protein or peptide encoding genes or to the discovered capability of such genes to encode proteins or peptides that promote angiogenesis. Sequence information for such genes and encoded polypeptides is readily obtainable from sequence databases such as GenBank or EMBL. Polynucleotides encoding these proteins can also be obtained from gene libraries, e.g., by using PCR or hybridization techniques routine in the art.
  • the protein can be an inhibitor of a cytokine such as an IL- 18 inhibitor.
  • a cytokine such as an IL- 18 inhibitor.
  • IL-18BP is a soluble protein having a high affinity for IL-18 (Novick et al., 1999; as disclosed in WO 99/09063).
  • IL-18BP is not the extracellular domain of one of the known IL 18 receptors, but a secreted, naturally circulating protein. It belongs to a novel family of secreted proteins, further including several Poxvirus-encoded proteins (Novick et al., 1999). Urinary as well as recombinant IL-18BP specifically bind IL- 18 with a high affinity and modulate the biological affinity of IL-18.
  • IL- 18 binds with high affinity and signals through the IL- 18 receptor (IL-18R), a heteromeric complex of alpha and beta chains encoded by the genes IL18R1 and IL18RAP, respectively (Torigoe K et al (1997) J Biol Chem; 272(41):25737-42).
  • the bioactivity of IL- 18 is negatively regulated by the IL18BP, a naturally occurring and highly specific inhibitor.
  • This soluble protein forms a complex with free IL- 18 preventing its interaction with the IL- 18 receptor, thus neutralizing and inhibiting its biological activity (Dinarello C A (2000) Ann Rheum Dis; 59 Suppl 1 :i 17-20).
  • IL-18BP is a constitutively secreted protein with high affinity binding to IL-18. Alternate mRNA splicing variants of IL-18BP result in four isoforms. The prominent ‘a’ isoform is present in the serum of healthy humans at 20-fold molar excess compared with IL-18 (Dinarello and Kaplanski (2005) Expert Rev Clin Immunol, 1(4), 619-632).
  • the IL-18BP gene was localized to the human chromosome 1 Iq 13, and no exon coding for a transmembrane domain was found in an 8.3 kb genomic sequence.
  • Four splice variants or isoforms of IL- 18BP generated by alternative mRNA splicing have been found in humans so far. They were designated IL-18BP a, b, c and d, all sharing the same N-terminus and differing in the C-terminus (Novick et al, 1999). These isoforms vary in their ability to bind IL-18. Of the four, hIL-18BP isoforms a and c are known to have a neutralizing capacity for IL- 18.
  • Human IL-18BP isoform binds to murine IL-18.
  • the rAAV encodes IL-18 inhibitor as disclosed in WO2015032932 or US20140112915, or IL-18BP, as disclosed in WO 1999009063 which is incorporated herein in its entirety.
  • the rAAV vector can encode a beta-adrenergic signaling protein (betaASPs) (including beta-adrenergic receptors (beta-ARs), G-protein receptor kinase inhibitors (GRK inhibitors) and adenylylcyclases (ACs)) to enhance cardiac function as described and illustrated in detail in U.S. patent application Ser. No. 08/924,757, filed Sep. , 1997 (based on U.S. No. 60/048,933 filed Jun. 16, 1997 and U.S. Pat. No. 08/708,661 filed Sep. , 1996), as well as PCT/US97/15610 filed Sep. , 1997, and U.S. continuing case Ser. No. 09/008,097, filed Jan. 16, 1998, and U.S. continuing case Ser. No.
  • betaASPs beta-adrenergic signaling protein
  • beta-ARs beta-adrenergic receptors
  • GRK inhibitors G-protein receptor kinase
  • rAAV vectors comprising cardiac-specific promoters as disclosed herein can be assessed using a myocardial infarction (MI) model as disclosed in Angeli et al., Comparative Medicine, 2009, 59(3), 272-279.
  • MI myocardial infarction
  • CSP Cardiac specific promoters
  • the rAAV vector comprises a nucleic acid encoding the therapeutic agent, e.g., inhibitor of PPI or other agent, operatively linked to a cardiac-specific promoter.
  • a cardiac-specific promoter Exemplary cardiac specific promoters are disclosed in Table 2A, 2B, 3 and 4 herein.
  • the cardiac specific promoter is a synthetic cardiac specific promoter.
  • the rAAV genotype comprises a cardiac specific promoter (CSP).
  • a CSP enables expression of the operatively linked gene in the heart tissue, and can in some embodiments, be an inducible CSP.
  • a CSP is located upstream 5’ and is operatively linked to the heterologous nucleic acid sequence encoding the transgene, e.g., inhibitor of PPI (e.g., 1-1 or I-lc).
  • a cardiac-specific promoter includes a cardiac-specific cis-regulatory element (CRE), a synthetic cardiacspecific cis-regulatory module (CRM) or a synthetic cardiac-specific promoter as disclosed in Tables 1-3.
  • CRE cardiac-specific cis-regulatory element
  • CRM cardiac-specific cis-regulatory module
  • a synthetic cardiac-specific promoter as disclosed in Tables 1-3.
  • the rAAV genotype comprises a cardiac specific promoter (CSP).
  • a CSP enables expression of the operatively linked gene in the heart, and can in some embodiments, be and inducible CSP.
  • a CSP is located upstream 5’ and is operatively linked to the heterologous nucleic acid sequence encoding the PPI inhibitor protein.
  • Exemplary CSP are disclosed herein, and include for example, the CSP listed in Table 2A herein or functional variants thereof.
  • a cardiac-specific promoter includes a cardiac-specific cis-regulatory element (CRE), a synthetic cardiac-specific cis-regulatory module (CRM) or a synthetic cardiac-specific promoter that comprises elements of minimal cardiac-specific promoters or cardiac-specific proximal promoters.
  • Table 2A shows nucleic acid sequences of exemplary cardiac-specific promoters for use in the methods and composition as disclosed herein.
  • a rAAV vector comprising a synthetic cardiac-specific promoter as disclosed in Table 2A.
  • the rAAV vector comprises a synthetic cardiac- specific promoter disclosed in Table 2A, which operatively linked to a nucleic acid encoding an inhibitor of PPI as disclosed herein, or a gene as disclosed in Table 18A or 18B disclosed herein.
  • the synthetic cardiac-specific promoter disclosed herein can comprise one or more cis-regulatory elements (CREs) and/or a minimal promoter or proximal promoters, and/or a regulatory element (RE) such as a 5’ UTR or intron, or RE that functions as both a 5’UTR and intron (e.g., CMV-IE), which are disclosed herein.
  • CREs cis-regulatory elements
  • RE regulatory element
  • Table 2B CRE and minimal/proximal promoters of the embodiments of cardiac-specific promoters of Table 2A.
  • the CREs, CRMs, introns, UTRs, minimal/proximal promoters and promoters as disclosed herein can be active in various muscle tissues, particularly but not exclusively in skeletal muscle and/or cardiac muscle.
  • CREs, CRMs, promoter elements or promoters which are active in at least one muscle tissue type or at least one muscle cell type may be referred to as ‘muscle-specific’.
  • muscle-specific CREs, CRMs, promoter elements or promoters can be further subdivided in subtypes depending on whether the CREs, CRMs, promoter elements or promoters are predominantly active in skeletal or cardiac muscle.
  • the cis-regulatory elements and promoters of the present invention are skeletal muscle-specific.
  • the cis-regulatory elements, CRMs, promoter elements and promoters of the present invention are active predominantly in skeletal muscle and less active or not active in cardiac muscle. These CREs, CRMs, promoter elements and promoters are called ‘skeletal musclespecific’.
  • the cis-regulatory elements and promoters of the present invention are cardiac muscle-specific.
  • the cis-regulatory elements, CRMs, promoter elements and promoters of the present invention are active predominantly in cardiac muscle and less active or not active in skeletal muscles. These CREs, CRMs, promoter elements and promoters are called ‘cardiac musclespecific’.
  • muscle-specific CREs, CRMs, promoter elements and promoters are active in both skeletal muscle and cardiac muscle. These CREs, CRMs, promoter elements and promoters may be preferred when promoter activity is required in both the skeletal muscle and the heart (in the cardiac muscles). In some embodiments, cardiac muscle -specific CREs, CRMs, promoter elements and promoters may be preferred. These CREs, CRMs, promoter elements and promoters may be preferred when promoter activity is required in the heart (in the cardiac muscles) with little or no activity in the skeletal muscles.
  • Examples of synthetic cardiac muscle-specific promoters include SP0067, SP0075, SP0424, SP0425, SP0429, SP0430, SP0433, SP0436, SP0452, SP0344, SP0483, SP0496, SP0435, SP0449, SP0450, SP0451, SP0475, SP0476, SP0477, SP0478, SP0479, SP0480, SP0481, SP0482, SP0484, SP0485, SP0486, SP0487, SP0488, SP0489, SP0490, SP0491, SP0492, SP0493, SP0494 and SP0495.
  • Examples of preferred synthetic cardiac muscle-specific promoters are SP0067, SP0433, SP0436, SP0452, SP0344 and SP0483.
  • the cardiac muscle-specific CREs, CRMs, promoter element and promoters of the present invention can be active in various cells of the heart.
  • the predominant cell types in the heart are ventricular cardiomyocytes, atrial cardiomyocytes, cardiac fibroblasts, or endothelial cells (EC) in the heart, as well as peri-vascular cells and pacemaker cells.
  • cardiac muscle -specific CREs, CRMs, promoter element and promoters of the present invention can be active in various regions of the heart, such as, for example, activity in any or all of the following heart regions: aortic arch arteries (AA); aorta; cardiomyocytes (CM); endothelial or endocardial cells (ECs); inferior caval vein (ICV); interventricular septum (IVS); left atrium (LA); left superior caval vein (LSCV); left ventricle (LV); outflow tract (OT); pulmonary arteries (PO); proepicardial organ (PEO); pulmonary vein (PV); right atrium (RA); right superior caval vein (RSCV); right ventricle (RV); superior caval vein (SCV); cardiac smooth muscle cells (SMs).
  • AA aortic arch arteries
  • CM cardiomyocytes
  • ECs endothelial or endocardial cells
  • IVS interventricular septum
  • LA left atrium
  • LSCV left superior caval vein
  • muscle-specific CREs, CRMs, promoter elements and promoters which are active in both skeletal muscle and cardiac muscle are also encompassed for use in the AAVs for the methods of administration and treatment as disclosed herein.
  • These CREs, CRMs, promoter elements and promoters may be preferred when promoter activity is required in both the skeletal muscle and the heart (in the cardiac muscles).
  • muscle-specific promoters active in both skeletal and cardiac muscle include SP0010, SP0020, SP0033, SP0038, SP0040, SP0042, SP0051, SP0057, SP0058, SP0061, SP0062, SP0064, SP0065, SP0066, SP0068, SP0070, SP0071, SP0076, SP0132, SP0133, SP0134,SP0136, SP0146, SP0147, SP0148, SP0150, SP0153, SP0155, SP0156, SP0157, SP0158, SP0159, SP0160, SP0161,
  • SP0230 SP0231, SP0232, SP0257, SP0262, SP0264 SP0265, SP0266, SP0267, SP0268, SP0270, SP0271, SP0279, SP0286, SP0305, SP0306, SP0307, SP0309, SP0310, SP0311, SP0312, SP0313, SP0314,
  • SP0330 SP0331, SP0332, SP0333, SP0334, SP0335, SP0336, SP0337, SP0338, SP0339, SP0340,
  • SP0354 SP0355, SP0356, SP0358, SP0359, SP0361, SP0362, SP0363, SP0364, SP0365, SP0366,
  • the promoter is a synthetic cardiac-specific promoter comprising a combination of the cis-regulatory elements (CREs), for example CRE0051 and CRE0042, or functional variants thereof.
  • CREs are operably linked to a promoter element.
  • the cardiac-specific promoter comprises said CREs, or functional variants thereof, in the order recited, such as CRE0051, CRE0042, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the cardiacspecific promoter comprises said CREs, or functional variants thereof, in a different order from that recited, such as CRE0042, CRE0051 and then the promoter element.
  • the cardiac-specific promoter comprises said CREs, or functional variants thereof, in the order recited, such as CRE0033, and then any other CRE element, or the promoter element disclosed herein.
  • the promoter can comprise CRE0033 and at least one CRE, or at least 2 CREs, or at least 3 CREs, or at least 4 CREs or more than 4 CREs selected from any CRE disclosed in Tables 2B, 3, 5B or 6, as disclosed herein.
  • the promoter element can be any suitable proximal promoter or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is cardiac-specific.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0033 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0033 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is SKM_18 or functional variant thereof.
  • SKM_18 is a muscle-specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CRE0033 and then SKM_18.
  • CRE0033 has the nucleic acid sequence of SEQ ID NO: 41: Functional variants of SEQ ID NO: 41 thereof may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CRE0033 are regulatory elements with sequences which vary from CRE0033, but which substantially retain activity as muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fimctional.
  • a functional variant of CRE0033 can be viewed as a CRE which, when substituted in place of CRE0033 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CRE0033 substituted in place of CRE0033 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • CRE0033 in SP0067 can be replaced with a functional variant of CRE0033, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CRE0033 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 41 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 41 or a functional variant thereof also fall within the scope of the invention.
  • the CRE033 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • SKM 18 has the nucleic acid sequence of SEQ ID NO: 55.
  • Functional variants of SEQ ID NO: 51 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • functional variants of SKM 18 substantially retain the ability of SKM 18 to act as a muscle-specific promoter element.
  • the modified promoter retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0067.
  • the functional variant of SKM_18 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 55.
  • a promoter element comprising or consisting of SKM 18 or a functional variant thereof has a length of 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 110 or fewer nucleotides, or 95 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises SEQ ID NO: 3, or a functional variant thereof.
  • functional variants may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 3 is referred to as SP0067.
  • the SP0067 promoter is particularly preferred in some embodiments. This promoter has been found to be very specific for cardiac muscle and is also very short, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0033 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0033 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is SKM_20 or functional variant thereof.
  • SKM_20 is a muscle -specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CRE0033 and then SKM_20.
  • SKM 20 has the nucleic acid sequence of SEQ ID NO: 56.
  • Functional variants of SEQ ID NO: 56 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • functional variants of SKM_20 substantially retain the ability of SKM_20 to act as a muscle-specific promoter element.
  • the modified promoter retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0075.
  • the functional variant of SKM_20 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 56.
  • a promoter element comprising or consisting of SKM 20 or a functional variant thereof has a length of 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 110 or fewer nucleotides, or 95 or fewer nucleotides.
  • the cardiac muscle-specific promoter comprises SEQ ID NO: 4, or a functional variant thereof.
  • functional variants may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 4 is referred to as SP0075.
  • the SP0075 promoter is particularly preferred in some embodiments. This promoter has been found to be very specific for cardiac muscle and is also very short, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0004 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0004 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CRE0082 or functional variant thereof.
  • CRE0082 is a cardiac muscle-specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CRE0004 and then CRE0082.
  • CRE0004 has the nucleic acid sequence of SEQ ID NO: 39.
  • Functional variants of SEQ ID NO: 39 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CRE0004 are regulatory elements with sequences which vary from CRE0004, but which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fimctional.
  • a functional variant of CRE0004 can be viewed as a CRE which, when substituted in place of CRE0004 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CRE0004 substituted in place of CRE0004 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • CRE0004 in SP00424 can be replaced with a functional variant of CRE0004, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CRE0004 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 39 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 39 or a functional variant thereof also fall within the scope of the invention.
  • the CRE004 or a functional variant thereof has a length of 300 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • CRE0082 has the nucleic acid sequence of SEQ ID NO: 57.
  • Functional variants of SEQ ID NO: 57 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • functional variants of CRE0082 substantially retain the ability of CRE0082 to act as a cardiac muscle-specific promoter element.
  • the modified promoter retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0424.
  • the functional variant of CRE0082 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 57.
  • a promoter element comprising or consisting of CRE0082 or a functional variant thereof has a length of 500 or fewer, 400 or fewer, 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 110 or fewer nucleotides, or 95 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises SEQ ID NO: 5, or a functional variant thereof.
  • functional variants may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 5 is referred to as SP0424.
  • the SP0424 promoter is particularly preferred in some embodiments. This promoter has been found to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0028 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0028 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CRE0082 or functional variant thereof.
  • CRE0082 is a cardiac muscle-specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CRE0028 and then CRE0082.
  • CRE0028 has the nucleic acid sequence of SEQ ID NO: 40.
  • Functional variants of SEQ ID NO: 40 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CRE0028 are regulatory elements with sequences which vary from CRE0028, but which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fimctional.
  • a functional variant of CRE0028 can be viewed as a CRE which, when substituted in place of CRE0028 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CRE0028 substituted in place of CRE0028 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • CRE0028 in SP00425 can be replaced with a functional variant of CRE0028, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CRE0028 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 40 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 40 or a functional variant thereof also fall within the scope of the invention.
  • the CRE0028 or a functional variant thereof has a length of 300 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • the sequence of CRE0082 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 6, or a functional variant thereof.
  • functional variants of SEQ ID NO: 6 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 6 is referred to as SP0425.
  • the SP0425 promoter is particularly preferred in some embodiments. This promoter has been found to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0095 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0095 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CRE0082 or functional variant thereof.
  • CRE0082 is a cardiac muscle-specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CRE0095 and then CRE0082.
  • CRE0095 has the nucleic acid sequence of SEQ ID NO: 44.
  • Functional variants of SEQ ID NO: 44 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CRE0095 are regulatory elements with sequences which vary from CRE0095, but which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fimctional.
  • a functional variant of CRE0095 can be viewed as a CRE which, when substituted in place of CRE0095 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CRE0095 substituted in place of CRE0095 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • CRE0095 in SP0429 can be replaced with a functional variant of CRE0095, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CRE0095 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 44 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 44 or a functional variant thereof also fall within the scope of the invention.
  • the CRE0095 or a functional variant thereof has a length of 400 of fewer, 300 or fewer, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 7, or a functional variant thereof.
  • functional variants of SEQ ID NO: 7 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 7 is referred to as SP0429.
  • the SP0429 promoter is particularly preferred in some embodiments. This promoter has been found to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0096 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0096 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CRE0082 or functional variant thereof.
  • CRE0082 is a cardiac muscle-specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CRE0096 and then CRE0082.
  • CRE0096 has the nucleic acid sequence of SEQ ID NO: 45. Functional variants thereof may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CRE0096 are regulatory elements with sequences which vary from CRE0096, but which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fimctional.
  • a functional variant of CRE0096 can be viewed as a CRE which, when substituted in place of CRE0096 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CRE0096 substituted in place of CRE0096 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • CRE0096 in SP0430 can be replaced with a functional variant of CRE0096, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CRE0096 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 45 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 45 or a functional variant thereof also fall within the scope of the invention.
  • the CRE0096 or a functional variant thereof has a length of 500 or fewer nucleotides, 400 or fewer nucleotides, 300 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • the sequence of CRE0082 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 8, or a functional variant thereof.
  • functional variants of SEQ ID NO: 8 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 8 is referred to as SP0430.
  • the SP0430 promoter is particularly preferred in some embodiments. This promoter has been found to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0033 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0033 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CRE0038 or functional variant thereof.
  • CRE0038 is a cardiac muscle-specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CRE0033 and then CRE0038.
  • CRE0038 has the nucleic acid sequence of SEQ ID NO: 64.
  • Functional variants of SEQ ID NO: 64 thereof may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • functional variants of CRE0038 substantially retain the ability of CRE0038 to act as a cardiac muscle-specific promoter element.
  • the modified promoter retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0344.
  • the functional variant of CRE0038 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 64.
  • a promoter element comprising or consisting of CRE0038 or a functional variant thereof has a length of 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 110 or fewer nucleotides, or 95 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises nucleic acid sequence of SEQ ID NO: 9, or a functional variant thereof.
  • functional variants of SEQ ID NO: 9 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 9 is referred to as SP0344.
  • the SP0344 promoter is particularly preferred in some embodiments. This promoter has been found to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising a combination of the cis-regulatory elements CRE0033 and CRE0071.3, or functional variants thereof.
  • the CREs are operably linked to a promoter element.
  • the cardiac muscle-specific promoter comprises said CREs, or functional variants thereof, in the order CRE0033, CRE0071.3, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the cardiac muscle-specific promoter comprises said CREs, or functional variants thereof, in the order CRE0071.3, CRE0033, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the promoter element can be any suitable proximal promoter or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is cardiac muscle-specific or cardiac muscle-specific.
  • the promoter element is CRE0070, or a functional variant thereof.
  • CRE0070 is a muscle-specific proximal promoter.
  • the promoter comprises the following regulatory elements: CRE0033, CRE0071. 3 and CRE0070, or functional variants thereof.
  • the sequence of CRE0033 and variants thereof are set out above.
  • CRE0071.3 has nucleic acid sequence of SEQ ID NO: 43.
  • Functional variants of SEQ ID NO: 43 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CRE0071.3 are regulatory elements with sequences which vary from CRE0071.3, but which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fiinctional.
  • a functional variant of CRE0071.3 can be viewed as a CRE which, when substituted in place of CRE0071.3 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CRE0071.3 substituted in place of CRE0071.3 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • CRE0071.3 in SP00433 can be replaced with a functional variant of CRE0071.3, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CRE0071.3 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 43 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 43 or a functional variant thereof also fall within the scope of the invention.
  • the CRE0071.3 or a functional variant thereof has a length of 300 or fewer, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • CRE0070 has the nucleic acid sequence of SEQ ID NO: 42.
  • Functional variants of SEQ ID NO: 42 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • functional variants of CRE0070 substantially retain the ability of CRE0070 to act as a muscle-specific promoter element.
  • the modified promoter retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0433.
  • the functional variant of CRE0070 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 42.
  • a promoter element comprising or consisting of CRE0070 or a functional variant thereof has a length of 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 110 or fewer nucleotides, or 95 or fewer nucleotides, 85 or fewer nucleotides, 75 or fewer nucleotides, 50 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 10, or a functional variant thereof.
  • functional variants of SEQ ID NO: 10 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 10 is referred to as SP0433.
  • the SP0433 promoter is particularly preferred in some embodiments. This promoter has been found to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0033 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0033 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CRE0082 or functional variant thereof.
  • CRE0082 is a cardiac muscle-specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CRE0033 and then CRE0082.
  • the sequence of CRE0033 and variants thereof are set out above.
  • the sequence of CRE0082 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 11, or a functional variant thereof.
  • functional variants of SEQ ID NO: 11 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 11 is referred to as SP0435.
  • the SP0435 promoter is particularly preferred in some embodiments. This promoter has been found to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising a combination of two cis-regulatory elements CRE0033, or functional variants thereof.
  • the CREs are operably linked to a promoter element.
  • the cardiac muscle-specific promoter comprises said CREs, or functional variants thereof, in the order first CRE0033, second CRE0033, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the promoter element can be any suitable proximal promoter or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle-specific or cardiac muscle-specific.
  • the promoter element is SKM_18, or a functional variant thereof.
  • SKM_18 is a muscle -specific proximal promoter.
  • the promoter comprises the following regulatory elements: a first CRE0033, a second CRE0033 and SKM_18, or functional variants thereof.
  • a synthetic promoter comprising a two identical CREs is predicted to have higher expression it its target tissue or cells than an equivalent promoter which comprises only one of the identical CREs.
  • promoter SP0436 which comprises a first CRE0033, a second CRE0033 and SKM_18 has higher expression in cardiac muscle cells than promoter SP0067 which comprises only CRE0033 and SKM_18.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 12, or a functional variant thereof.
  • functional variants of SEQ ID NO: 12 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 12 is referred to as SP0436.
  • the SP0436 promoter is particularly preferred in some embodiments. This promoter has been found to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising a combination of the cis-regulatory elements CRE0004 and CRE0033, or functional variants thereof.
  • the cardiac muscle-specific promoter comprises said CREs, or functional variants thereof, in the order CRE0004, CRE0033, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the cardiac muscle -specific promoter comprises said CREs, or functional variants thereof, in the order CRE0033, CRE0004, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the promoter element can be any suitable proximal promoter or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle-specific or cardiac muscle-specific.
  • the promoter element is SKM_18, or a functional variant thereof.
  • SKM_18 is a muscle-specific proximal promoter.
  • the promoter comprises the following regulatory elements: CRE0004, CRE0033 and SKM_18, or functional variants thereof.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 13, or a functional variant thereof.
  • functional variants of SEQ ID NO: 13 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 13 is referred to as SP0449.
  • the SP0449 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising a combination of the cis-regulatory elements CRE0095 and CRE0033, or functional variants thereof.
  • the cardiac muscle-specific promoter comprises said CREs, or functional variants thereof, in the order CRE0095, CRE0033, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the cardiac muscle -specific promoter comprises said CREs, or functional variants thereof, in the order CRE0033, CRE0095, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the promoter element can be any suitable proximal promoter or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle-specific or cardiac muscle-specific.
  • the promoter element is SKM_18, or a functional variant thereof.
  • SKM_18 is a muscle-specific proximal promoter.
  • the promoter comprises the following regulatory elements: CRE0095, CRE0033 and SKM_18, or functional variants thereof.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 14, or a functional variant thereof.
  • functional variants of SEQ ID NO: 14 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 14 is referred to as SP0450.
  • the SP0450 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising a combination of the cis-regulatory elements CRE0096 and CRE0033, or functional variants thereof.
  • the cardiac muscle-specific promoter comprises said CREs, or functional variants thereof, in the order CRE0096, CRE0033, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the cardiac muscle -specific promoter comprises said CREs, or functional variants thereof, in the order CRE0033, CRE0096, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the promoter element can be any suitable proximal promoter or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle-specific or cardiac muscle-specific.
  • the promoter element is SKM_18, or a functional variant thereof.
  • SKM_18 is a muscle-specific proximal promoter.
  • the promoter comprises the following regulatory elements: CRE0096, CRE0033 and SKM_18, or functional variants thereof.
  • CRE0096 The sequence of CRE0096 and variants thereof are set out above.
  • the sequence of CRE0033 and variants thereof are set out above.
  • the sequence of SKM_18 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 15, or a functional variant thereof.
  • functional variants of SEQ ID NO: 15 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 15 is referred to as SP0451.
  • the SP0451 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising a combination of the cardiac muscle-specific proximal promoter CRE0082 and cis-regulatory elements CRE0033, or functional variants thereof.
  • cardiac muscle -specific proximal promoter CRE0082 and cis-regulatory elements CRE0033 are operably linked to a further promoter element.
  • the cardiac muscle -specific promoter comprises said proximal promoter and CRE, or functional variants thereof, in the order CRE0082, CRE0033, and then the further promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the further promoter element can be any suitable proximal promoter or minimal promoter. In some embodiments, the further promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle-specific or cardiac muscle-specific.
  • the further promoter element is SKM 18, or a functional variant thereof.
  • SKM_18 is a muscle-specific proximal promoter.
  • the promoter comprises the following regulatory elements: CRE0082, CRE0033 and SKM 18, or functional variants thereof.
  • This promoter comprises two proximal promoters used in tandem.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 16, or a functional variant thereof.
  • functional variants of SEQ ID NO: 16 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 16 is referred to as SP0452.
  • the SP0452 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0033 operably linked to a promoter element and a regulatory element such as a 5’UTR and/or an intron.
  • the synthetic cardiac muscle-specific promoter comprises CRE0033 immediately upstream of the promoter element followed by the regulatory element such as a 5’UTR and/or an intron.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is SKM_18 or functional variant thereof.
  • SKM_18 is a muscle -specific proximal promoter.
  • the intron may be any suitable intron.
  • the 5’UTR may be any suitable 5’UTR.
  • a regulatory element may comprise an intron and a 5’UTR. In some preferred embodiments, the regulatory element is the CMV-IE 5’ UTR and intron
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CRE0033 followed by SKM 18 and then CMV-IE 5’UTR and intron.
  • CMV-IE 5’UTR and intron has the nucleic acid sequence of SEQ ID NO: 65.
  • Functional variants of SEQ ID NO: 65 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • a functional variant of CMV-IE 5’UTR and intron can be viewed as an intron which, when substituted in place of the CMV-IE 5’UTR and intron in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CMV-IE 5’ UTR and intron substituted in place of CMV-IE 5’UTR and intron preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • CMV-IE 5’ UTR and intron in SP0475 can be replaced with a functional variant of CMV-IE 5’UTR and intron, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted intron under equivalent conditions.
  • a synthetic promoter comprising an intron such as the CMV-IE 5’ UTR and intron is predicted to have higher expression it its target tissue or cells than an equivalent promoter which does not comprise the intron.
  • promoter SP0475 which comprises CRE0033, SKM 18 and CMV-IE 5’UTR and intron is predicted to have higher expression in cardiac muscle tissue or cells than promoter SP0067 which only comprises CRE0033 and SKM_18.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 17, or a functional variant thereof.
  • functional variants of SEQ ID NO: 17 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 17 is referred to as SP0475.
  • the SP0475 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CREO 105 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CREO 105 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is SKM_18 or functional variant thereof.
  • SKM_18 is a muscle-specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CREO 105 and then SKM_18.
  • CRE0105 has the nucleic acid sequence of SEQ ID NO: 46.
  • Functional variants of SEQ ID NO: 46 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CREO 105 are regulatory elements with sequences which vary from CREO 105, but which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fimctional.
  • a functional variant of CREO 105 can be viewed as a CRE which, when substituted in place of CREO 105 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CREO 105 substituted in place of CREO 105 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • promoter SP0476 as an example, CREO 105 in SP0476 can be replaced with a functional variant of CREO 105, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CREO 105 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 46 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 46 or a functional variant thereof also fall within the scope of the invention.
  • the CREO 105 or a functional variant thereof has a length of 300 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 18, or a functional variant thereof.
  • functional variants of SEQ ID NO: 18 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 18 is referred to as SP0476.
  • the SP0476 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CREO 106 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CREO 106 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is SKM_18 or functional variant thereof.
  • SKM_18 is a muscle -specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CREO 106 and then SKM 18.
  • CRE0106 has the nucleic acid sequence of SEQ ID NO: 47.
  • Functional variants of SEQ ID NO: 47 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CREO 106 are regulatory elements with sequences which vary from CREO 106, but which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fimctional.
  • a functional variant of CREO 106 can be viewed as a CRE which, when substituted in place of CREO 106 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CREO 106 substituted in place of CREO 106 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • promoter SP0477 as an example, CREO 106 in SP0477 can be replaced with a functional variant of CREO 106, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CREO 106 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 47 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 47 or a functional variant thereof also fall within the scope of the invention.
  • the CREO 106 or a functional variant thereof has a length of 300 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • the sequence of SKM_18 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 19, or a functional variant thereof.
  • functional variants of SEQ ID NO: 19 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 19 is referred to as SP0477.
  • the SP0477 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CREO 107 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CREO 107 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is SKM_18 or functional variant thereof.
  • SKM_18 is a muscle -specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CREO 107 and then SKM_18.
  • CRE0107 has the nucleic acid sequence of SEQ ID NO: 48.
  • Functional variants of SEQ ID NO: 48 thereof may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CREO 107 are regulatory elements with sequences which vary from CREO 107, but which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fimctional.
  • a functional variant of CREO 107 can be viewed as a CRE which, when substituted in place of CREO 107 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CREO 107 substituted in place of CREO 107 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • promoter SP0478 as an example, CREO 107 in SP0478 can be replaced with a functional variant of CREO 107, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CREO 107 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 48 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 48 or a functional variant thereof also fall within the scope of the invention.
  • the CREO 107 or a functional variant thereof has a length of 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • the sequence of SKM_18 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 20, or a functional variant thereof.
  • functional variants of SEQ ID NO: 20 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 20 is referred to as SP0478.
  • the SP0478 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CREO 108 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CREO 108 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is SKM_18 or functional variant thereof.
  • SKM_18 is a muscle -specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CREO 108 and then SKM_18.
  • CRE0108 has the nucleic acid sequence of SEQ ID NO: 49.
  • Functional variants of SEQ ID NO: 49 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CREO 108 are regulatory elements with sequences which vary from CRE0108, but which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fiinctional.
  • a functional variant of CREO 108 can be viewed as a CRE which, when substituted in place of CREO 108 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CREO 108 substituted in place of CREO 108 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • CRE0108 in SP0479 can be replaced with a functional variant of CRE0108, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CREO 108 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 49 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 49 or a functional variant thereof also fall within the scope of the invention.
  • the CRE0108 or a functional variant thereof has a length of 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • the sequence of SKM_18 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 21, or a functional variant thereof.
  • functional variants of SEQ ID NO: 21 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 21 is referred to as SP0479.
  • the SP0479 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CREO 109 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CREO 109 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is SKM_18 or functional variant thereof.
  • SKM_18 is a muscle -specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CREO 109 and then SKM_18.
  • CRE0109 has the nucleic acid sequence of SEQ ID NO: 50.
  • Functional variants of SEQ ID NO: 50 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CREO 109 are regulatory elements with sequences which vary from CREO 109, but which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fiinctional.
  • a functional variant of CREO 109 can be viewed as a CRE which, when substituted in place of CREO 109 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CREO 109 substituted in place of CREO 109 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • promoter SP0480 as an example, CREO 109 in SP0480 can be replaced with a functional variant of CREO 109, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CREO 109 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 50 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 50 or a functional variant thereof also fall within the scope of the invention.
  • the CREO 109 or a functional variant thereof has a length of 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • the sequence of SKM_18 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 22, or a functional variant thereof.
  • functional variants of SEQ ID NO: 22 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 22 is referred to as SP0480.
  • the SP0480 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0033 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0033 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CREO 110 or functional variant thereof.
  • CREO 110 is a cardiac muscle-specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CRE0033 and then CRE0110.
  • CRE0033 and CRE0110 The sequence of CRE0033 and variants thereof are set out above.
  • CRE0110 has the nucleic acid sequence of SEQ ID NO: 59.
  • Functional variants of SEQ ID NO: 59 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • functional variants of CREO 110 substantially retain the ability of CREO 110 to act as a cardiac muscle-specific promoter element.
  • the modified promoter retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0481.
  • the functional variant of CREO 110 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 59.
  • a promoter element comprising or consisting of CREO 110 or a functional variant thereof has a length of 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 110 or fewer nucleotides, or 95 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 23, or a functional variant thereof.
  • functional variants of SEQ ID NO: 23 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 23 is referred to as SP0481.
  • the SP0481 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CREO 111 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CREO 111 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is SKM_18 or functional variant thereof.
  • SKM_18 is a muscle -specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CREO 111 and then SKM 18.
  • CRE0111 has the nucleic acid sequence of SEQ ID NO: 51.
  • Functional variants of SEQ ID NO: 51 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CREO 111 are regulatory elements with sequences which vary from CRE0111, but which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fiinctional.
  • a functional variant of CREO 111 can be viewed as a CRE which, when substituted in place of CREO 111 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CREO 111 substituted in place of CREO 111 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • promoter SP0482 as an example, CREO 111 in SP0482 can be replaced with a functional variant of CREO 111, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CREO 111 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 51 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 51 or a functional variant thereof also fall within the scope of the invention.
  • the CRE0111 or a functional variant thereof has a length of 300 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • the sequence of SKM_18 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 24, or a functional variant thereof.
  • functional variants of SEQ ID NO: 24 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 24 is referred to as SP0482.
  • the SP0482 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0033 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0033 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CREO 112 or functional variant thereof.
  • CREO 112 is a cardiac muscle-specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CRE0033 and then CREO 112.
  • CRE0112 has the nucleic acid sequence of SEQ ID NO: 60.
  • Functional variants of SEQ ID NO: 60 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • CREO 112 substantially retain the ability of CREO 112 to act as a cardiac muscle-specific promoter element.
  • the modified promoter retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0483.
  • the functional variant of CRE0112 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 60.
  • a promoter element comprising or consisting of CREO 112 or a functional variant thereof has a length of 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 110 or fewer nucleotides, or 95 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 25, or a functional variant thereof.
  • functional variants of SEQ ID NO: 25 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 25 is referred to as SP0483.
  • the SP0483 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0033 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0033 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CREO 113 or functional variant thereof.
  • CREO 113 is a cardiac muscle-specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CRE0033 and then CREO 113. The sequence of CRE0033 and variants thereof are set out above.
  • CRE0113 has the nucleic acid sequence of SEQ ID NO: 61.
  • Functional variants of SEQ ID NO: 61 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • CREO 113 substantially retain the ability of CREO 113 to act as a cardiac muscle-specific promoter element.
  • the modified promoter retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0484.
  • the functional variant of CRE0113 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 61.
  • a promoter element comprising or consisting of CREO 113 or a functional variant thereof has a length of 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 110 or fewer nucleotides, or 95 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 26, or a functional variant thereof.
  • functional variants of SEQ ID NO: 26 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 26 is referred to as SP0484.
  • the SP0484 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CREO 114 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CREO 114 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is SKM_18 or functional variant thereof.
  • SKM_18 is a muscle-specific proximal promoter.
  • the cardiac muscle -specific promoter comprises the following elements (or functional variants thereof): CREO 114 and then SKM_18.
  • CRE0114 has the nucleic acid sequence of SEQ ID NO: 52.
  • Functional variants of SEQ ID NO: 52 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • CRE0114 which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fiinctional.
  • a functional variant of CREO 114 can be viewed as a CRE which, when substituted in place of CREO 114 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CREO 114 substituted in place of CREO 114 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • promoter SP0485 as an example, CREO 114 in SP0485 can be replaced with a functional variant of CREO 114, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CREO 114 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 52 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 52 or a functional variant thereof also fall within the scope of the invention.
  • the CRE0114 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 27, or a functional variant thereof.
  • functional variants of SEQ ID NO: 27 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 27 is referred to as SP0485.
  • the SP0485 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0033 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0033 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CREO 115 or functional variant thereof.
  • CREO 115 is a cardiac muscle-specific proximal promoter.
  • the cardiac muscle- specific promoter comprises the following elements (or functional variants thereof): CRE0033 and then CRE0115.
  • CRE0115 has the nucleic acid sequence of SEQ ID NO: 62.
  • Functional variants of SEQ ID NO: 62 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • CREO 115 substantially retain the ability of CREO 115 to act as a cardiac muscle-specific promoter element.
  • the modified promoter retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0486.
  • the functional variant of CRE0115 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 62.
  • a promoter element comprising or consisting of CREO 115 or a functional variant thereof has a length of 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 110 or fewer nucleotides, or 95 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 28, or a functional variant thereof.
  • functional variants of SEQ ID NO: 28 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 28 is referred to as SP0486.
  • the SP0486 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0033 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0033 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CREO 116 or functional variant thereof.
  • CREO 116 is a cardiac muscle-specific proximal promoter.
  • the cardiac muscle -specific promoter comprises the following elements (or functional variants thereof): CRE0033 and then CREO 116. The sequence of CRE0033 and variants thereof are set out above.
  • CRE0116 has the nucleic acid sequence of SEQ ID NO: 63.
  • Functional variants of SEQ ID NO: 63 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • functional variants of CREO 116 substantially retain the ability of CREO 116 to act as a cardiac muscle-specific promoter element.
  • the modified promoter retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0487.
  • the functional variant of CRE0116 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 63.
  • a promoter element comprising or consisting of CREO 116 or a functional variant thereof has a length of 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 110 or fewer nucleotides, or 95 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 29, or a functional variant thereof.
  • functional variants of SEQ ID NO: 29 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 29 is referred to as SP0487.
  • the SP0487 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CREO 117 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CREO 117 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is SKM_18 or functional variant thereof.
  • SKM_18 is a muscle -specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CREO 117 and then SKM_18.
  • CRE0117 has the nucleic acid sequence of SEQ ID NO: 53.
  • Functional variants of SEQ ID NO: 53 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CREO 117 are regulatory elements with sequences which vary from CRE0117, but which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fimctional.
  • a functional variant of CREO 117 can be viewed as a CRE which, when substituted in place of CREO 117 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CREO 117 substituted in place of CRE0117 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • CRE0117 in SP0488 can be replaced with a functional variant of CRE0117, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CREO 117 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 53 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 53 or a functional variant thereof also fall within the scope of the invention.
  • the CRE0117 or a functional variant thereof has a length of 300 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 30, or a functional variant thereof.
  • functional variants of SEQ ID NO: 30 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 30 is referred to as SP0488.
  • the SP0488 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CRE0033 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0033 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CREO 104 or functional variant thereof.
  • CREO 104 is a cardiac muscle-specific proximal promoter.
  • the cardiac musclespecific promoter comprises the following elements (or functional variants thereof): CRE0033 and then CREO 104.
  • CRE0104 has the nucleic acid sequence of SEQ ID NO: 58.
  • Functional variants of SEQ ID NO: 58 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • functional variants of CREO 104 substantially retain the ability of CREO 104 to act as a cardiac muscle-specific promoter element.
  • the modified promoter retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0489.
  • the functional variant of CRE0104 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 58.
  • a promoter element comprising or consisting of CREO 104 or a functional variant thereof has a length of 400 or fewer nucleotides, 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 110 or fewer nucleotides, or 95 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 31, or a functional variant thereof.
  • functional variants of SEQ ID NO: 31 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 31 is referred to as SP0489.
  • the SP0489 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CREO 106 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CREO 106 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle- specific or cardiac muscle-specific. In some preferred embodiments the promoter element is CREO 110 or functional variant thereof. CREO 110 is a cardiac muscle-specific proximal promoter. In some embodiments the cardiac muscle -specific promoter comprises the following elements (or functional variants thereof): CREO 106 and then CREO 110. The sequence of CREO 106 and variants thereof are set out above. The sequence of CREO 110 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 32, or a functional variant thereof.
  • functional variants of SEQ ID NOL 32 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 32 is referred to as SP0490.
  • the SP0490 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CREO 107 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CREO 107 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CREO 110 or functional variant thereof.
  • CREO 110 is a cardiac muscle-specific proximal promoter.
  • the cardiac musclespecific promoter comprises the following elements (or functional variants thereof): CREO 107 and then CREO 110.
  • the sequence of CREO 107 and variants thereof are set out above.
  • the sequence of CREO 110 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 33, or a functional variant thereof.
  • functional variants of SEQ ID NO: 33 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 33 is referred to as SP0491.
  • the SP0491 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CREO 106 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CREO 106 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CREO 116 or functional variant thereof.
  • CREO 116 is a cardiac muscle-specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CREO 106 and then CREO 116.
  • the sequence of CREO 106 and variants thereof are set out above.
  • the sequence of CRE0116 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 34, or a functional variant thereof.
  • functional variants of SEQ ID NO: 34 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 34 is referred to as SP0492.
  • the SP0492 promoter is particularly preferred in some embodiments. This promoter is predicted to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CREO 107 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CREO 107 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is CREO 116 or functional variant thereof.
  • CREO 116 is a cardiac muscle-specific proximal promoter.
  • the cardiac musclespecific promoter comprises the following elements (or functional variants thereof): CREO 107 and then CREO 116.
  • the sequence of CREO 107 and variants thereof are set out above.
  • the sequence of CREO 116 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 35, or a functional variant thereof.
  • functional variants of SEQ ID NO: 35 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 35 is referred to as SP0493.
  • the SP0493 promoter is particularly preferred in some embodiments. This promoter has been found to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising CREO 118 operably linked to a promoter element.
  • the synthetic cardiac muscle-specific promoter comprises CRE0118 immediately upstream of the promoter element.
  • the promoter element can be any suitable proximal or minimal promoter.
  • the promoter element is a minimal promoter.
  • the proximal promoter is muscle- specific or cardiac muscle-specific.
  • the promoter element is SKM_18 or functional variant thereof.
  • SKM_18 is a muscle -specific proximal promoter.
  • the cardiac muscle-specific promoter comprises the following elements (or functional variants thereof): CRE0118 and then SKM_18.
  • CRE0118 has the nucleic acid sequence of SEQ ID NO: 54.
  • Functional variants of SEQ ID NO: 54 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CREO 118 are regulatory elements with sequences which vary from CRE0118, but which substantially retain activity as cardiac muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fimctional.
  • a functional variant of CREO 118 can be viewed as a CRE which, when substituted in place of CRE0118 in a promoter, substantially retains its activity.
  • a cardiac muscle-specific promoter which comprises a functional variant of CRE0118 substituted in place of CRE0118 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • CRE0118 in SP0494 can be replaced with a functional variant of CREO 118, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • the CREO 118 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 54 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 54 or a functional variant thereof also fall within the scope of the invention.
  • the CRE0118 or a functional variant thereof has a length of 300 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 36, or a functional variant thereof.
  • functional variants of SEQ ID NO: 36 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 36 is referred to as SP0494.
  • the SP0494 promoter is particularly preferred in some embodiments. This promoter has been found to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising a combination of the cis-regulatory elements CREO 106 and CRE0033, or functional variants thereof.
  • the CREs are operably linked to a promoter element.
  • the cardiac muscle-specific promoter comprises said CREs, or functional variants thereof, in the order CREO 106, CRE0033, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the cardiac muscle -specific promoter comprises said CREs, or functional variants thereof, in the order CRE0033, CREO 106, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the promoter element can be any suitable proximal promoter or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle-specific or cardiac muscle-specific.
  • the promoter element is CREO 116, or a functional variant thereof. CREO 116 is a cardiac muscle-specific proximal promoter.
  • the promoter comprises the following regulatory elements: CRE0106, CRE0033 and CRE0116, or functional variants thereof.
  • the sequence of CREO 106 and variants thereof are set out above.
  • the sequence of CRE0033 and variants thereof are set out above.
  • the sequence of CREO 116 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 37, or a functional variant thereof.
  • functional variants of SEQ ID NO: 37 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 37 is referred to as SP0495.
  • the SP0495 promoter is particularly preferred in some embodiments. This promoter has been found to be specific for cardiac muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic cardiac muscle-specific promoter comprising a combination of the cis-regulatory elements CREO 107 and CRE0033, or functional variants thereof.
  • the cardiac muscle-specific promoter comprises said CREs, or functional variants thereof, in the order CREO 107, CRE0033, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the cardiac muscle -specific promoter comprises said CREs, or functional variants thereof, in the order CRE0033, CREO 107, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the promoter element can be any suitable proximal promoter or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle-specific or cardiac muscle-specific.
  • the promoter element is CREO 116, or a functional variant thereof.
  • CREO 116 is a cardiac muscle-specific proximal promoter.
  • the promoter comprises the following regulatory elements: CREO 107, CRE0033 and CRE0116, or functional variants thereof.
  • the sequence of CREO 106 and variants thereof are set out above.
  • the sequence of CRE0033 and variants thereof are set out above.
  • the sequence of CRE0116 and variants thereof are set out above.
  • the cardiac muscle -specific promoter comprises the nucleic acid sequence of SEQ ID NO: 38, or a functional variant thereof.
  • functional variants of SEQ ID NO: 38 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 38 is referred to as SP0496.
  • the SP0496 promoter is particularly preferred in some embodiments. This promoter has been found to be specific for cardiac muscle, which is advantageous in some circumstances.
  • a synthetic cardiac muscle-specific promoter comprises two or more promoter elements. Synthetic promoters comprising two or more promoter elements are referred to herein as ‘tandem promoters’.
  • SP0452 is a tandem promoter as it comprises promoter elements CRE0082 and SKM 18.
  • a tandem promoter may comprise a promoter element directly upstream of another promoter element.
  • a tandem promoter may comprise one or more CREs upstream of one or each of the promoter elements.
  • a tandem promoter may comprise one or more CREs between the promoter elements.
  • any one of the synthetic cardiac muscle -specific promoters disclosed herein may be operably linked to a further promoter element.
  • SP0452 is synthetic promoter SP0067 operably linked to a promoter element CRE0082. It will be appreciated that synthetic promoter SP0067 may be operably linked to any other promoter element disclosed herein. Similarly, any other synthetic promoter disclosed herein may be operably linked to any promoter element disclosed herein.
  • the muscle-specific, cardiac muscle -specific or the skeletal muscle-specific promoters as set out above are operably linked to one or more additional regulatory sequences.
  • An additional regulatory sequence can, for example, enhance expression compared to a muscle -specific, a cardiac muscle-specific, or a skeletal muscle-specific promoter which is not operably linked the additional regulatory sequence.
  • the additional regulatory sequence does not substantively reduce the specificity of a muscle-specific, a cardiac muscle-specific, or a skeletal musclespecific promoter.
  • a synthetic muscle-specific, cardiac muscle-specific or skeletal muscle-specific promoter can be operably linked to a sequence encoding a UTR (e.g. a 5’ and/or 3’ UTR), and/or an intron, or suchlike.
  • the cardiac muscle-specific promoter is operably linked to sequence encoding a UTR, e.g. a 5’ UTR.
  • a 5' UTR can contain various elements that can regulate gene expression.
  • the 5’ UTR in a natural gene begins at the transcription start site and ends one nucleotide before the start codon of the coding region.
  • 5' UTRs as referred to herein may be an entire naturally occurring 5 ’ UTR or it may be a portion of a naturally occurring 5’ UTR.
  • the 5’UTR can also be partially or entirely synthetic.
  • 5' UTRs have a median length of approximately 150 nucleotides, but in some cases they can be considerably longer.
  • Regulatory sequences that can be found in 5' UTRs include, but are not limited to: (i) Binding sites for proteins, that may affect the mRNA's stability or translation; (ii) Riboswitches; (iii) Sequences that promote or inhibit translation initiation; and (iv) Introns within 5' UTRs have been linked to regulation of gene expression and mRNA export.
  • a regulatory sequence comprises both a 5’ UTR and an intron
  • a cardiac muscle-specific promoter as set out above is operably linked to a sequence encoding a 5’ UTR and an intron derived from the CMV major immediate gene (CMV-IE gene).
  • CMV-IE gene CMV major immediate gene
  • the 5’ UTR and intron from the CMV-IE gene suitably comprises the CMV-IE gene exon 1 and the CMV-IE gene exon 1, or portions thereof.
  • the promoter element may be modified in view of the linkage to the 5 ‘UTR, for example sequences downstream of the transcription start site (TSS) in the promoter element can be removed (e.g. replaced with the 5’ UTR).
  • TSS transcription start site
  • CMV-IE 5 ’UTR and intron is described in Simari, et al., Molecular Medicine 4: 700-706, 1998 “Requirements for Enhanced Transgene Expression by Untranslated Sequences from the Human Cytomegalovirus Immediate-Early Gene”, which is incorporated herein by reference.
  • Variants of the CMV-IE 5’ UTR and intron sequences discussed in Simari, et al. are also set out in W02002/031137, incorporated by reference, and the regulatory sequences disclosed therein can also be used.
  • UTRs that can be used in combination with a promoter are known in the art, e.g. in Leppek, K., Das, R. & Barna, M. “Functional 5' UTR mRNA structures in eukaryotic translation regulation and how to find them”. Nat Rev Mol Cell Biol 19, 158-174 (2016), incorporated by reference.
  • the sequence encoding the 5’ UTR and intron comprises the nucleic acid sequence of SEQ ID NO: 65, or a functional variant thereof.
  • functional variants of SEQ ID NO: 65 may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • SEQ ID NO: 65 encodes a CMV-IE 5’ UTR and intron.
  • Table 8 discloses the sequence identifier numbers for other exemplary elements (e.g. introns/UTR, polyA sequences) for use in the promoter sequences or in the rAAV contracts as disclosed herein:
  • the 5 ’ UTR suitably comprises a nucleic acid motif that functions as the protein translation initiation site, e.g. sequences that define a Kozak sequence in the mRNA produced.
  • the sequence encoding the 5’ UTR comprises the sequence motif GCCACC at or near its 3’ end.
  • Other Kozak sequences or other protein translation initiation sites can be used, as is known in the art (e.g. Marilyn Kozak, “Point Mutations Define a Sequence Flanking the AUG Initiator Codon That Modulates Translation by Eukaryotic Ribosomes” Cell, Vol.
  • the protein translation initiation site (e.g. Kozak sequence) is preferably positioned immediately adjacent to the start codon.
  • any one of the promoters described above, or variants thereof, is linked to a sequence encoding a 5’ UTR and or 5’UTR and an intron to provide a composite promoter.
  • composite promoter may be referred to simply as “composite promoters”, or in some cases simply “promoters” for brevity.
  • the SP0067 promoter, or variants thereof, as discussed above is linked to a sequence encoding a 5’UTR and an intron to provide a composite promoter.
  • the composite promoter comprises SEQ ID NO: 17, or a functional variant thereof.
  • This composite promoter construct comprises SP0067 operably linked to the 5’ UTR and intron from the CMV-IE gene. This composite promoter is referred to as SP0475 as described herein above.
  • CREs that can be used in construction of cardiac-specific promoters.
  • the CREs are cardiac-specific.
  • These CREs are generally derived from genomic promoter and enhancer sequences, but they are used herein in contexts quite different from their native genomic environment.
  • the CREs constitute small parts of much larger genomic regulatory domains, which control expression of the genes with which they are normally associated. It has been surprisingly found that these CREs, many of which are very small, can be isolated form their normal environment and retain cardiac-specific regulatory activity.
  • sequences of the CREs of the present invention can be altered without causing a substantial loss of activity.
  • Functional variants of the CREs can be prepared by modifying the sequence of the CREs, provided that modifications which are significantly detrimental to activity of the CRE are avoided.
  • modification of CREs to provide functional variants is straightforward.
  • the present disclosure provides methodologies for simply assessing the functionality of any given CRE variant.
  • the relatively small size of certain CREs according to the present invention is advantageous because it allows for the CREs, more specifically promoters containing them, to be provided in vectors while taking up the minimal amount of the payload of the vector. This is particularly important when a CRE is used in a vector with limited capacity, such as an AAV-based vector.
  • Table 3 Sequence Identifier number for the nucleic acid sequences of exemplary CREs (Cis- Regulatory Elements) for cardiac-specific promoters
  • CREs of the present invention comprise certain cardiac-specific transcription factor binding sites (TFBS). It is generally desired that in functional variants of the CREs these Cardiac-specific TFBS remain functional.
  • TFBS sequences can vary yet retain functionality. In view of this, the sequence for a TFBS is typically illustrated by a consensus sequence from which some degree of variation is typically present. Further information about the variation that occurs in a TFBS can be illustrated using a positional weight matrix (PWM), which represents the frequency with which a given nucleotide is typically found at a given location in the consensus sequence.
  • PWM positional weight matrix
  • TF consensus sequences and associated positional weight matrices can be found in, for example, the Jaspar or Transfac databases http://jaspar.genereg.net/ and http://gene-regulation.com/pub/databases.html).
  • This information allows the skilled person to modify the sequence in any given TFBS of a CRE in a manner which retains, and in some cases even increases, CRE functionality.
  • the skilled person has ample guidance on how the TFBS for any given TF can be modified, while maintaining ability to bind the desired TF; the Jaspar system will, for example, score a putative TFBS based on its similarity to a given PWM.
  • CREs can be scanned against all PWM from JASPAR database to identify/analyse all TFBS.
  • the skilled person can of course find additional guidance in the literature, and, moreover, routine experimentation can be used to confirm TF binding to a putative TFBS in any variant CRE. It will be apparent that significant sequence modification in a CRE, even within TFBS in a CRE, can be made while retaining function.
  • CREs of the present invention can be used in combination with a wide range of suitable minimal promoters or Cardiac-specific proximal promoters.
  • Functional variants of a CRE include sequences which vary from the reference CRE element, but which substantially retain activity as Cardiac-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to recruit suitable Cardiacspecific transcription factors (TFs) and thereby enhance expression.
  • a functional variant of a CRE can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-functional.
  • a functional variant of a CRE can be viewed as a CRE which, when substituted in place of a reference CRE in a promoter, substantially retains its activity.
  • a cardiac-specific promoter which comprises a functional variant of a given CRE preferably retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising the unmodified CRE).
  • functional variants of a CRE retain a significant level of sequence identity to a reference CRE.
  • functional variants comprise a sequence that is at least 70% identical to the reference CRE, more preferably at least 80%, 90%, 95% or 99% identical to the reference CRE.
  • Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • Suitable assays for assessing cardiac-specific promoter activity are disclosed herein, e.g. in the examples.
  • a CRE can be combined with one or more additional CREs to create a cis- regulatory module (CRM). Additional CREs can be provided upstream of the CREs according to the present invention, or downstream of the CRE according to the present invention.
  • the additional CREs can be CREs disclosed herein, or they can be other CREs. Suitably, the additional CREs are cardiac-specific.
  • CREs according to the present invention or CRMs comprising CREs according to the present invention may comprise one or more additional regulatory elements.
  • they may comprise an inducible or repressible element, a boundary control element, an insulator, a locus control region, a response element, a binding site, a segment of a terminal repeat, a responsive site, a stabilizing element, a de -stabilizing element, and a splicing element, etc., provided that they do not render the CRE or CRM substantially non-functional.
  • a promoter comprising CREs according to the present invention may comprise spacers between the CRM and the minimal or proximal promoter and/or between CREs. Additionally, or alternatively, a spacer may be present on the 5’ end of the CRM.
  • a CRE according to the present invention or a CRM comprising a CRE according to this invention, or functional variants thereof can be combined with any suitable promoter elements in order to provide a synthetic cardiac-specific promoter according to the present invention.
  • the promoter element is a Cardiac-specific proximal promoter.
  • the CREs according to the present invention or functional variants thereof have a length of 600 or fewer nucleotides, for example 600, 500, 450, 400, 350, 300, 250, 200, 150, 100, 75, 60, 50 or fewer nucleotides.
  • the synthetic cardiac specific CRM comprising at least one of the CREs according to SEQ ID NOs 19-24, 27, 28 or a functional variant thereof has length of 1000 or fewer nucleotides, for example 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 300, 250, 200, 150, 100, 75, 60, 50 or fewer nucleotides.
  • CREs CREs according to SEQ ID NOs 19-24, 27, 28 or a functional variant thereof
  • CRMs of the present invention can be used in combination with a wide range of suitable minimal promoters or Cardiac-specific proximal promoters.
  • Functional variants of a CRM include sequences which vary from the reference CRM element, but which substantially retain activity as Cardiac-specific CRMs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRM while retaining its ability to recruit suitable Cardiacspecific transcription factors (TFs) and thereby enhance expression.
  • a functional variant of a CRM can comprise substitutions, deletions and/or insertions compared to a reference CRM, provided they do not render the CRM substantially non-fimctional.
  • a functional variant of a CRM can be viewed as a CRM which, when substituted in place of a reference CRM in a promoter, substantially retains its activity.
  • a cardiac-specific promoter which comprises a functional variant of a given CRM preferably retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising the unmodified CRM).
  • functional variants of a CRM retain a significant level of sequence identity to a reference CRM.
  • functional variants comprise a sequence that is at least 70% identical to the reference CRM, more preferably at least 80%, 90%, 95% or 99% identical to the reference CRM.
  • Functional variants of a given CRM can, in some embodiments, comprise functional variants of one or more of the CREs present in the reference CRM.
  • functional variants of a given CRM can comprise functional variants of 1 or 2 of the CREs present in the reference CRM.
  • Functional variants of a given CRM can, in some embodiments, comprise the same combination CREs as a reference CRM, but the CREs can be present in a different order from the reference CRM. It is usually preferred that the CREs are present in the same order as the reference CRM (thus, the functional variant of a CRM suitably comprises the same permutation of the CREs as set out in a reference CRM).
  • Functional variants of a given CRM can, in some embodiments, comprise one or more additional CREs to those present in a reference CRM. Additional CREs can be provided upstream of the CREs present in the reference CRM, downstream of the CREs present in the reference CRM, and/or between the CREs present in the reference CRM.
  • the additional CREs can be CREs disclosed herein, or they can be other CREs.
  • a functional variant of a given CRM comprises the same CREs (or functional variants thereof) and does not comprise additional CREs.
  • Functional variants of a given CRM can comprise one or more additional regulatory elements compared to a reference CRM.
  • they may comprise an inducible or repressible element, a boundary control element, an insulator, a locus control region, a response element, a binding site, a segment of a terminal repeat, a responsive site, a stabilizing element, a de -stabilizing element, and a splicing element, etc., provided that they do not render the CRM substantially non-functional.
  • Functional variants of a given CRM can comprise additional spacers between adjacent CREs or, if one or more spacer are present in the reference CRM, said one or more spacers can be longer or shorter than in the reference CRM. Spacers present in the reference CRM can be removed in the functional variant.
  • the CRMs as disclosed herein, or functional variants thereof can be combined with any suitable promoter elements in order to provide a synthetic cardiac-specific promoter according to the present invention.
  • the promoter element is a cardiac-specific proximal promoter.
  • shorter promoter sequences are preferred, particularly for use in situations where a vector (e.g. a viral vector such as AAV) has limited capacity.
  • the synthetic Cardiac-specific CRM has length of 500 or fewer nucleotides, for example 450, 400, 350, 300, 250, 200, 150, 100, 75, 60, 50 or fewer nucleotides.
  • a functional variant of a reference synthetic cardiac-specific promoter is a promoter which comprises a sequence which varies from the reference synthetic cardiac-specific promoter, but which substantially retains cardiac-specific promoter activity. It will be appreciated by the skilled person that it is possible to vary the sequence of a synthetic cardiac-specific promoter while retaining its ability to recruit suitable Cardiac-specific transcription factors (TFs) and to recruit RNA polymerase II to provide cardiac-specific expression of an operably linked sequence (e.g. an open reading frame).
  • TFs Cardiac-specific transcription factors
  • a functional variant of a synthetic cardiac-specific promoter can comprise substitutions, deletions and/or insertions compared to a reference promoter, provided such substitutions, deletions and/or insertions do not render the synthetic cardiac-specific promoter substantially non-fimctional compared to the reference promoter.
  • Table 4 Exemplary minimal or proximal promoters used in some embodiments of the synthetic cardiac-specific promoters of Table 2A.
  • a functional variant of a synthetic cardiac-specific promoter can be viewed as a variant which substantially retains the cardiac-specific promoter activity of the reference promoter.
  • a functional variant of a synthetic cardiac-specific promoter preferably retains at least 70% of the activity of the reference promoter, more preferably at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of its activity.
  • Functional variants of a synthetic cardiac-specific promoter often retain a significant level of sequence similarity to a reference synthetic cardiac-specific promoter.
  • functional variants comprise a sequence that is at least 70% identical to the reference synthetic cardiac-specific promoter, more preferably at least 80%, 90%, 95% or 99% identical to the reference synthetic cardiacspecific promoter.
  • the synthetic cardiac-specific promoter may comprise a sequence which is at least 60%, 65%, 70%, 75%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to any one of SEQ ID NOs: 3-64.
  • Activity in a functional variant can be assessed by comparing expression of a suitable reporter under the control of the reference synthetic cardiac-specific promoter with the putative functional variant under equivalent conditions. Suitable assays for assessing cardiac-specific promoter activity are disclosed herein, e.g. in the examples.
  • Functional variants of a given synthetic cardiac-specific promoter can comprise functional variants of a CRE present in the reference synthetic cardiac-specific promoter.
  • Functional variants of a given synthetic cardiac-specific promoter can comprise functional variants of the CRM present in the reference synthetic cardiac-specific promoter.
  • Functional variants of a given synthetic cardiac-specific promoter can comprise functional variants of the promoter element, or a different promoter element when compared to the reference synthetic cardiac-specific promoter.
  • Functional variants of a given synthetic cardiac-specific promoter can comprise one or more additional CREs to those present in a reference synthetic cardiac-specific promoter.
  • Additional CREs can, for example, be provided upstream of the CREs present in the reference synthetic cardiac-specific promoter or downstream of the CREs present in the reference synthetic cardiac-specific promoter.
  • the additional CREs can be CREs disclosed herein, or they can be other CREs.
  • Functional variants of a given synthetic cardiac-specific promoter can comprise additional spacers between adjacent elements (CREs, CRM or promoter element) or, if one or more spacers are present in the reference synthetic cardiac-specific promoter, said one or more spacers can be longer or shorter than in the reference synthetic cardiac-specific promoter. Alternatively, if one or more spacers are present in the reference synthetic cardiac-specific promoter, these spacers may be removed in the functional variant.
  • synthetic cardiac-specific promoters of the present invention can comprise a CRE of the present invention or a CRM comprising a CRE of the present invention and additional regulatory sequences.
  • they may comprise one or more additional CREs, an inducible or repressible element, a boundary control element, an insulator, a locus control region, a response element, a binding site, a segment of a terminal repeat, a responsive site, a stabilizing element, a de-stabilizing element, and a splicing element, etc., provided that they do not render the promoter substantially nonfunctional.
  • Preferred synthetic cardiac-specific promoters of the present invention exhibit cardiac-specific promoter activity which is at least 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity exhibited by the CMV or myosin promoter in cardiac cells.
  • the expression level of the phosphatase inhibitor gene or other exemplary genes driven by synthetic cardiac specific promoters is equivalent to the expression level of those genes driven by CMV promoter in cardiac cells. In many cases higher levels of promoter activity is preferred, but this is not always the case; thus, in some cases more moderate levels of expression may be preferred.
  • the present disclose provides promoters with such a range of activities.
  • Activity of a given synthetic cardiac-specific promoter of the present invention compared to a known promoter can be assessed by comparing Cardiac-specific expression of a reporter gene under control of the synthetic cardiac-specific promoter with expression of the same reporter under control of the known promoter, when the two promoters are provided in otherwise equivalent expression constructs and under equivalent conditions.
  • a range of promoters with activity in different regions such as different regions of the heart, e.g., ventricles versus atrium, or different heart cells, e.g., ventricular cardiomyocytes versus atrial cardiomyocytes or cardiac fibroblasts, or endothelial cells (EC) in the heart, as well as peri -vascular cells and pacemaker cells.
  • different regions of the heart e.g., ventricles versus atrium
  • different heart cells e.g., ventricular cardiomyocytes versus atrial cardiomyocytes or cardiac fibroblasts, or endothelial cells (EC) in the heart, as well as peri -vascular cells and pacemaker cells.
  • EC endothelial cells
  • the cardiac-specific promoter according to the present invention shows activity in any or all of the following heart regions: aortic arch arteries (AA); aorta; cardiomyocytes (CM); endothelial or endocardial cells (ECs); inferior caval vein (ICV); interventricular septum (IVS); left atrium (LA); left superior caval vein (LSCV); left ventricle (LV); outflow tract (OT); pulmonary arteries (PO); proepicardial organ (PEO); pulmonary vein (PV); right atrium (RA); right superior caval vein (RSCV); right ventricle (RV); superior caval vein (SCV); cardiac smooth muscle cells (SMs).
  • the cardiac-specific promoter according to the present invention shows activity the heart areas mentioned above with little or no activity in other areas of the heart,
  • the cardiac-specific promoter according to the present invention shows activity in cardiomyocytes. In some preferred embodiments, the cardiac-specific promoter according to the present invention shows activity in ventricular cardiomyocytes or in conductive cardiomyocytes. In some preferred embodiments, the cardiac-specific promoter according to the present invention shows activity in cardiomyocytes and smooth muscle cells. In some preferred embodiments, the cardiac-specific promoter according to the present invention shows activity in ventricular cardiomyocytes, in conductive cardiomyocytes and smooth muscle cells in the heart.
  • the cardiac-specific promoter according to the present invention shows activity in cardiomyocytes with little or no expression in other heart cell types. In some embodiments, the cardiacspecific promoter according to the present invention shows activity in cardiomyocytes and smooth muscle cells in the heart with little or no expression in other heart cell types. In some embodiments, the cardiacspecific promoter according to the present invention shows activity in cardiomyocytes and in pacemaker cells with little or no expression in other heart cell types.
  • Preferred synthetic cardiac-specific promoters of the present invention exhibit cardiac-specific promoter activity which is at least 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity exhibited by MLC-2v cardiac specific promoter.
  • Activity of a given synthetic cardiac-specific promoter of the present invention compared to the MLC-2v promoter can be assessed by comparing cardiac-specific expression of a reporter gene under control of the synthetic cardiac-specific promoter with expression of the same reporter under control of MLC-2v promoter in heart tissue or heart cells, e.g., cardiomyocytes, when the two promoters are provided in otherwise equivalent expression constructs and under equivalent conditions.
  • a synthetic cardiac-specific promoter of the invention is able to increase expression of a gene (e.g.
  • a therapeutic gene or gene of interest in the neurones of a subject by at least 20%, at least 40%, at least 60%, at least 80%, at least 100%, at least 200%, at least 300%, at least 500%, at least 1000% or more relative to a known cardiac-specific promoter, suitably MLC-2v promoter.
  • a myosin heavy chain genes such as ventricular a myosin heavy chain gene, [3 myosin heavy chain genes such as ventricular [3 myosin heavy chain gene, ventricular myosin Myosin light chain 2v gene such as light chain 2 gene, myosin light chain 2a gene such as ventricular myosin light chain 2 gene, cardiac myocyte-restricted cardiac ankyrin repeat protein (CARP) gene, cardiac a-actin gene, cardiac m2 muscarinic / acetylcholine gene, There are ANP gene, BNP gene, cardiac troponin C gene, cardiac troponin I gene, cardiac troponin T gene, cardiac sarcoplasmic reticulum Ca-AT ase gene, skeletal a-actin gene, and artificial heart cellspecific
  • the synthetic cardiac-specific promoter as disclosed herein can be compared with other chamber specific promoters or enhancers can be used, for example, the quail slow myosin chain type 3 (MyHC3) or ANP promoter, or cGATA-6 enhancer for atrial specific expression.
  • MyHC3 quail slow myosin chain type 3
  • ANP quail slow myosin chain type 3
  • cGATA-6 enhancer for atrial specific expression.
  • the Iroquois homeobox gene can be used for ventricular specific expression.
  • ventricular myocyte specific promoters include the ventricular myosin light chain 2 promoter and the ventricular myosin heavy chain promoter.
  • the synthetic cardiac-specific promoter as disclosed herein can be compared to other promoters and / or enhancers include Csx / NKX2.5 gene, titin gene, a-actinin gene, myomesin gene, M protein gene, cardiac troponin T gene, RyR2 gene, Cx40 gene, Cx43 gene, and even Mef2, There are genes that bind dHAND, GATA, CarG, E-box, Csx / NKX2.5, or TGF-beta, or combinations thereof.
  • the synthetic cardiac-specific promoter has length of 1000 or fewer nucleotides, for example, 900, 800, 700,600, 500, 450, 400, 350, 300, 250, 200, 150, 100, or fewer nucleotides.
  • Particularly preferred synthetic cardiac-specific promoters are those that are both short and which exhibit high levels of activity.
  • a cardiac-specific promoter according to the present invention which comprises a variant CRE of any one of Table 2A, 5 A or Tables 3 or 6 retains at least 25%, 50%, 75%, 80%, 85%, 90%, 95% or 100% of the activity of the reference CRE.
  • Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • said activity is assessed using the examples as described herein, but other methods can be used.
  • the or each CRE is a cardiac-specific cis-regulatory element.
  • the promoter element is a minimal or proximal promoter.
  • the proximal promoter is a cardiac-specific proximal promoter.
  • the synthetic cardiac-specific promoter comprises or consists of a sequence according to any one of SEQ ID NOs 3-64, or a functional variant thereof. In some embodiments the synthetic cardiac-specific promoter comprises or consists of a sequence which is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to any one of SEQ ID NOs 3-64.
  • the present invention thus provides various synthetic cardiac-specific promoters and functional variants thereof. It is generally preferred that a promoter according to the present invention which is a variant of any one of SEQ ID NO 3-38 or 55, 56, 80-200, 290-329 retains at least 25%, 50%, 75%, 80%, 85%, 90%, 95% or 100% of the activity of the reference promoter. Suitably said activity is assessed using the examples as described herein, but other methods can be used.
  • the minimal or proximal promoter can be operably linked with a CRE or CRM.
  • the CRE may be a CRE according to this invention or any other CRE.
  • the CRM may be a CRM according to this invention or may comprise a CRE according to this invention.
  • the CRE or the CRM is cardiac-specific.
  • the proximal promoter according to the present invention may be operably linked with one or more proximal promoters.
  • a synthetic cardiac-specific promoter according to the present invention may comprise or consist of two proximal promoters.
  • a synthetic cardiac-specific promoter according to the present invention may comprise or consist of two or more proximal promoters.
  • the proximal promoters are Cardiac-specific proximal promoters.
  • the at least two proximal promoters may be operably linked to a CRE or a CRM according to the present invention.
  • the CREs, minimal/proximal promoters or promoters of the present invention can be active in specific region of the heart, preferably in cardiomyocytes, or in specific heart cell type or in a combination of heart cell types or in a combination of both.
  • the CREs, minimal/proximal promoters, or promoters of the present invention are cardiac-specific.
  • the CREs, minimal/proximal promoters or promoters of the present invention can be active in one or more of the various parts of the heart.
  • the CREs, minimal/proximal promoter or promoters of the present invention may be active in the heart.
  • the CREs, minimal/proximal promoter or promoters of the present invention may be active in the cardiomyocytes but not in any other part of the heart.
  • the CREs, minimal/proximal promoter or promoters of the present invention may be active in one or more of the various areas within the heart.
  • the CRE, CRM, minimal/proximal promoter or promoter of the present invention shows widespread activity in the heart.
  • the CRE, CRM, minimal/proximal promoter or promoter of the present invention is active in all parts of the heart (pan-heart).
  • the CRE, CRM, minimal/proximal promoter or promoter of the present invention is active in 1, 2, 3, 4, 5, 6, 7, 8 or 9 of the areas of the heart recited above.
  • the CRE, minimal/proximal promoter or promoter of the present invention shows predominant activity in one area of the heart.
  • the CRE, minimal/proximal promoter or promoter of the present invention shows activity in one area of the heart but no, or only minimal, activity in the rest of the heart.
  • the CRE, minimal/proximal promoter or promoter of the present invention is active in only one area of the areas of the heart recited above.
  • the CREs, minimal/proximal promoters or promoters of the present invention can be active in various cells of the heart.
  • the predominant cell types in the heart are ventricular cardiomyocytes, atrial cardiomyocytes, cardiac fibroblasts, or endothelial cells (EC) in the heart, as well as peri-vascular cells and pacemaker cells.
  • the CREs, minimal/proximal promoters or promoters of the present invention can be active in various regions of the heart, such as, for example, activity in any or all of the following heart regions: aortic arch arteries (AA); aorta; cardiomyocytes (CM); endothelial or endocardial cells (ECs); inferior caval vein (ICV); interventricular septum (IVS); left atrium (LA); left superior caval vein (LSCV); left ventricle (LV); outflow tract (OT); pulmonary arteries (PO); proepicardial organ (PEO); pulmonary vein (PV); right atrium (RA); right superior caval vein (RSCV); right ventricle (RV); superior caval vein (SCV); cardiac smooth muscle cells (SMs).
  • AA aortic arch arteries
  • CM cardiomyocytes
  • ECs endothelial or endocardial cells
  • IVS interventricular septum
  • LA left atrium
  • LSCV left superior caval vein
  • the cardiac-specific promoter according to the present invention shows activity the heart areas mentioned above with little or no activity in other areas of the heart, other areas of the body. Other cell types may be present, particularly in inflammatory condition.
  • the CRE, CRM, minimal/proximal promoter or promoter of the present invention is active in at least four, or at least three, or at least two, or at least one, heart cell types listed above, such as ventricular cardiomyocytes, atrial cardiomyocytes, cardiac fibroblasts, or endothelial cells (EC) in the heart, as well as peri -vascular cells and pacemaker cells.
  • the promoter may be desirable for the promoter to be active in a limited number of heart cell types, or in not more than one heart cell type.
  • the CRE, CRM, minimal/proximal promoter or promoter of the present invention is active in specific subtypes of heart cell, such as for example, ventricular cardiomyocytes, atrial cardiomyocytes, cardiac fibroblasts, or endothelial cells (EC) in the heart, as well as peri-vascular cells and pacemaker cells.
  • Expression driven by a cardiac-specific promoter of the present invention in a desired heart tissue or heart cell may be for a period of at least 1 hour, 2, hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 1 1 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19
  • Expression driven by a promoter of the present invention in a desired tissue or cell may be for a period of more than 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 20 years, 30 years, 40 years, 50 years, 60 years, 70 years, 80 years, 90 years, 100 years.
  • Expression may be for 1-5 hours, 1-12 hours, 1-2 days, 1-5 days, 1-2 weeks, 1- 3 weeks, 1-4 weeks, 1-2 months, 1-4 months, 1-6 months, 2-6 months, 3-6 months, 3-9 months, 4-8 months, 6-12 months, 1-2 years, 1-5 years, 2-5 years, 3-6 years, 3-8 years, 4-8 years, 5-10 years, 10-15 years, 15-20 years, 20-30 years, 30-40 years, 40-50 years, 50-60 years, 60-70 years, 80-90 years or 90-100 years.
  • a pharmaceutical composition comprising a rAAV vector comprising a synthetic cardiac-specific promoter, operatively linked to a transgene for the treatment of heart disease (e.g., but not limited to an inhibitor of PPI and/or angiogenesis protein or peptide) according to the present invention.
  • rAAV vector particles may be prepared as pharmaceutical compositions for use in the methods of administration herein. It will be understood that such compositions necessarily comprise one or more active ingredients and, most often, a pharmaceutically acceptable excipient.
  • the rAAV vector comprises a nucleic acid encoding the therapeutic agent, e.g., inhibitor of PPI or other agent, operatively linked to a muscle-specific promoter, wherein the muscle specific promoter is active in both skeletal muscle and cardiac muscle.
  • the muscle specific promoter is active in both skeletal muscle and cardiac muscle.
  • Exemplary muscle -specific promoters are disclosed in Tables 5A, 5B, 6 and 7 herein.
  • the cardiac specific promoter is a synthetic cardiac specific promoter.
  • the promoter is a synthetic muscle -specific promoter active in both skeletal and cardiac muscle.
  • muscle-specific promoters active in both skeletal and cardiac muscle include SP0010, SP0020, SP0033, SP0038, SP0040, SP0042, SP0051, SP0057, SP0058, SP0061, SP0062, SP0064, SP0065, SP0066, SP0068, SP0070, SP0071, SP0076, SP0132, SP0133, SP0134, SP0136, SP0146, SP0147, SP0148, SP0150, SP0153, SP0155, SP0156, SP0157, SP0158, SP0159, SP0160,
  • preferred synthetic musclespecific promoters which are active in both skeletal and cardiac muscles are SP0057, SP0134, SP0173, SP0279, SP0286, SP0310, SP0316, SP0320 and SP0326.
  • the synthetic muscle-specific promoter that is active in skeletal muscle and cardiac muscle comprises or consists of a sequence according to any one of SEQ ID Nos: 55, 56, 80-200, 290-329, or a functional variant thereof.
  • the synthetic muscle-specific promoter that is active in skeletal muscle and cardiac muscle comprises or consists of a sequence which is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to any one of SEQ ID NOs 55, 56, 80-200, 290-329.
  • Table 5A shows the Sequence Identifier number of the nucleic acid sequences of exemplary muscle-specific promoters active in cardiac and skeletal muscle for use in the methods and composition as disclosed herein.
  • Table 5B CRE and minimal/proximal promoters of the embodiments of muscle-specific promoters active in cardiac and skeletal muscle shown in Table 1C
  • Table 13A shows the sequence identifier numbers for shortened nucleic acid sequences of exemplary muscle-specific promoters active in cardiac and skeletal muscle for use in the methods and composition as disclosed herein.
  • Table 13B CRE and minimal/proximal promoters of the embodiments of shortened muscle specific promoters active in cardiac and skeletal muscle shown in Table 13 A. vii. Functional variants of Muscle-Specific promoters that are active in cardiac and skeletal muscle:
  • the promoter is a synthetic muscle -specific promoter comprising a combination of the cis-regulatory elements CRE0029 and CRE0071, or functional variants thereof.
  • the CREs are operably linked to a promoter element.
  • the muscle-specific promoter comprises said CREs, or functional variants thereof, in the order CRE0029, CRE0071, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the muscle -specific promoter comprises said CREs, or functional variants thereof, in the order CRE0071, CRE0029 and then the promoter element.
  • the promoter element can be any suitable proximal promoter or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle-specific.
  • the promoter element is CRE0070 or a functional variant thereof.
  • CRE0070 is a muscle-specific proximal promoter.
  • the promoter comprises the following regulatory elements: CRE0029, CRE0071 and CRE0070, or functional variants thereof.
  • CRE0029 has a sequence according to SEQ ID NO: 206. Functional variants thereof may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CRE0029 are regulatory elements with sequences which vary from CRE0029, but which substantially retain activity as muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-functional.
  • a functional variant of CRE0029 can be viewed as a CRE which, when substituted in place of CRE0029 in a promoter, substantially retains its activity.
  • a musclespecific promoter which comprises a functional variant of CRE0029 substituted in place of CRE0029 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • CRE0029 in SP0057 can be replaced with a functional variant of CRE0029, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • CRE0029 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 206 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 206 or a functional variant thereof also fall within the scope of the invention.
  • CRE0071 has a sequence according to SEQ ID NO: 216. Functional variants thereof may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CRE0071 are regulatory elements with sequences which vary from CRE0071, but which substantially retain activity as muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-functional.
  • a functional variant of CRE0071 can be viewed as a CRE which, when substituted in place of CRE0071 in a promoter, substantially retains its activity.
  • a musclespecific promoter which comprises a functional variant of CRE0029 substituted in place of CRE0071 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • CRE0071 in SP0057 can be replaced with a functional variant of CRE0071, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • CRE0071 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 216 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 216 or a functional variant thereof also fall within the scope of the invention.
  • the muscle-specific promoter comprises a sequence according to SEQ ID NO: X, or a functional variant thereof.
  • functional variants may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: X is referred to as SP0057.
  • the SP0057 promoter is particularly preferred in some embodiments. This promoter has been found to be very specific for muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic muscle -specific promoter comprising a combination of the cis-regulatory elements CRE0020 and CRE0071, or functional variants thereof.
  • the CREs are operably linked to a promoter element.
  • the muscle-specific promoter comprises said CREs, or functional variants thereof, in the order CRE0020, CRE0071, and then the promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the muscle -specific promoter comprises said CREs, or functional variants thereof, in the order CRE0071, CRE0020 and then the promoter element [00764]
  • the promoter element can be any suitable proximal promoter or minimal promoter. In some embodiments, the promoter element is a minimal promoter. Where the promoter is a proximal promoter, it is generally preferred that the proximal promoter is muscle-specific.
  • the promoter element is CRE0070 or a functional variant thereof.
  • CRE0070 is a muscle-specific proximal promoter.
  • the promoter comprises the following regulatory elements: CRE0020, CRE0071 and CRE0070, or functional variants thereof.
  • CRE0020 has a sequence according to SEQ ID NO: 203. Functional variants thereof may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • Functional variants of CRE0020 are regulatory elements with sequences which vary from CRE0020, but which substantially retain activity as muscle-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
  • a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non-fiinctional.
  • a functional variant of CRE0020 can be viewed as a CRE which, when substituted in place of CRE0020 in a promoter, substantially retains its activity.
  • a skeletal muscle-specific promoter which comprises a functional variant of CRE0020 substituted in place of CRE0020 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
  • CRE0020 in SP0227 can be replaced with a functional variant of CRE0020, and the promoter substantially retains its activity. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
  • CRE0020 or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
  • complementary and reverse complementary sequences of SEQ ID NO: 203 or a functional variant thereof fall within the scope of the invention.
  • Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 203 or a functional variant thereof also fall within the scope of the invention.
  • the CRE0020 or a functional variant thereof has a length of 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
  • the muscle-specific promoter comprises a sequence according to SEQ ID NO: 100, or a functional variant thereof.
  • functional variants may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
  • the promoter having a sequence according to SEQ ID NO: 100 is referred to as SP0134.
  • the SP0134 promoter is particularly preferred in some embodiments. This promoter has been found to be very specific for muscle, which is advantageous in some circumstances.
  • the promoter is a synthetic muscle -specific promoter comprising a combination of muscle specific proximal promoter CRE0010 and cis-regulatory element CRE0035, or functional variants thereof.
  • muscle specific proximal promoter CRE0010 and cis-regulatory element CRE0035 are operably linked to a further promoter element.
  • the synthetic muscle-specific promoter comprises said proximal promoter and CRE, or functional variants thereof, in the order CRE0010, CRE0035 and then the further promoter element (order is given in an upstream to downstream direction, as is conventional in the art).
  • the synthetic muscle-specific promoter comprises said proximal promoter and CRE, or functional variants thereof, in the order CRE0035, CRE0010 and then the further promoter element.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Cardiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Hospice & Palliative Care (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2021/044650 2020-08-05 2021-08-05 Methods of treating cardiac disorders and congestive heart failure and administering aav vectors Ceased WO2022031914A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
AU2021320244A AU2021320244A1 (en) 2020-08-05 2021-08-05 Methods of treating cardiac disorders and congestive heart failure and administering AAV vectors
CN202180068345.9A CN116406297A (zh) 2020-08-05 2021-08-05 治疗心脏疾患和充血性心力衰竭以及施用aav载体的方法
JP2023507620A JP2023536921A (ja) 2020-08-05 2021-08-05 心障害およびうっ血性心不全を処置する方法ならびにaavベクターを投与する方法
CA3188398A CA3188398A1 (en) 2020-08-05 2021-08-05 Methods of treating cardiac disorders and congestive heart failure and administering aav vectors
IL300367A IL300367A (en) 2020-08-05 2021-08-05 Methods for the treatment of heart disorders and heart failure and administration of AAV vectors
EP21853948.4A EP4192580A4 (en) 2020-08-05 2021-08-05 Methods for treating heart disease and congestive heart failure and administration of AAV vectors
US18/019,421 US20230340528A1 (en) 2020-08-05 2021-08-05 Methods of treating cardiac disorders and congestive heart failure and administering aav vectors

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202063061342P 2020-08-05 2020-08-05
US63/061,342 2020-08-05
US202163214119P 2021-06-23 2021-06-23
US63/214,119 2021-06-23

Publications (2)

Publication Number Publication Date
WO2022031914A2 true WO2022031914A2 (en) 2022-02-10
WO2022031914A3 WO2022031914A3 (en) 2022-03-31

Family

ID=80120133

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/044650 Ceased WO2022031914A2 (en) 2020-08-05 2021-08-05 Methods of treating cardiac disorders and congestive heart failure and administering aav vectors

Country Status (8)

Country Link
US (1) US20230340528A1 (https=)
EP (1) EP4192580A4 (https=)
JP (1) JP2023536921A (https=)
CN (1) CN116406297A (https=)
AU (1) AU2021320244A1 (https=)
CA (1) CA3188398A1 (https=)
IL (1) IL300367A (https=)
WO (1) WO2022031914A2 (https=)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022269269A1 (en) * 2021-06-23 2022-12-29 Synpromics Limited Regulatory nucleic acid sequences
CN116256523A (zh) * 2023-02-02 2023-06-13 香港大学深圳医院 生物标志物在制备用于糖尿病患者HFpEF检测试剂中的应用
CN116644347A (zh) * 2023-05-23 2023-08-25 珠海市康利莱医疗器械有限公司 一种用于风湿性瓣膜病的血清差异多肽检测系统
WO2023178338A3 (en) * 2022-03-18 2023-11-02 University Of Florida Research Foundation, Incorporated Methods and compositions for treating tmem43 related cardiomyopathy with a viral vector
WO2023200736A3 (en) * 2022-04-11 2024-01-25 Tenaya Therapeutics, Inc. Plakophillin-2 gene therapy treatment methods
WO2024171063A1 (en) * 2023-02-13 2024-08-22 AstraZeneca Ireland Limited Nucleic acids encoding bcl2-associated athanogene 3 (bag3) for gene therapy
US12104165B2 (en) 2019-04-01 2024-10-01 Tenaya Therapeutics, Inc. Adeno-associated virus with engineered capsid
WO2024249800A1 (en) * 2023-06-01 2024-12-05 Alkahest, Inc. Compositions of blood plasma fractions and blood plasma subfractions and their use in treatment of disease
WO2025051970A3 (en) * 2023-09-06 2025-04-17 Dinaqor Ag Methods of treatment of hypertrophic cardiomyopathy with aav gene therapy vectors and therapeutic formulations
WO2025259575A1 (en) * 2024-06-10 2025-12-18 Asklepios Biopharmaceutical, Inc. Methods and compositions for treatment of duchenne muscular dystrophy
US12576161B2 (en) 2020-10-09 2026-03-17 Tenaya Therapeutics, Inc. Plakophillin-2 gene therapy methods and compositions

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101056539B (zh) * 2004-09-09 2012-12-12 综合医院公司 调节心脏细胞中的磷酸酶活性
BRPI0912559A2 (pt) * 2008-05-16 2015-10-13 Corthera Inc método de tratar insuficiência cardíaca crônica
EP4081643A1 (en) * 2019-12-24 2022-11-02 Asklepios Biopharmaceutical, Inc. Regulatory nucleic acid sequences

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12104165B2 (en) 2019-04-01 2024-10-01 Tenaya Therapeutics, Inc. Adeno-associated virus with engineered capsid
US12576161B2 (en) 2020-10-09 2026-03-17 Tenaya Therapeutics, Inc. Plakophillin-2 gene therapy methods and compositions
WO2022269269A1 (en) * 2021-06-23 2022-12-29 Synpromics Limited Regulatory nucleic acid sequences
WO2023178338A3 (en) * 2022-03-18 2023-11-02 University Of Florida Research Foundation, Incorporated Methods and compositions for treating tmem43 related cardiomyopathy with a viral vector
WO2023200736A3 (en) * 2022-04-11 2024-01-25 Tenaya Therapeutics, Inc. Plakophillin-2 gene therapy treatment methods
CN116256523A (zh) * 2023-02-02 2023-06-13 香港大学深圳医院 生物标志物在制备用于糖尿病患者HFpEF检测试剂中的应用
CN116256523B (zh) * 2023-02-02 2023-09-12 香港大学深圳医院 生物标志物在制备用于糖尿病患者HFpEF检测试剂中的应用
WO2024171063A1 (en) * 2023-02-13 2024-08-22 AstraZeneca Ireland Limited Nucleic acids encoding bcl2-associated athanogene 3 (bag3) for gene therapy
CN116644347A (zh) * 2023-05-23 2023-08-25 珠海市康利莱医疗器械有限公司 一种用于风湿性瓣膜病的血清差异多肽检测系统
WO2024249800A1 (en) * 2023-06-01 2024-12-05 Alkahest, Inc. Compositions of blood plasma fractions and blood plasma subfractions and their use in treatment of disease
WO2025051970A3 (en) * 2023-09-06 2025-04-17 Dinaqor Ag Methods of treatment of hypertrophic cardiomyopathy with aav gene therapy vectors and therapeutic formulations
WO2025259575A1 (en) * 2024-06-10 2025-12-18 Asklepios Biopharmaceutical, Inc. Methods and compositions for treatment of duchenne muscular dystrophy

Also Published As

Publication number Publication date
AU2021320244A1 (en) 2023-03-23
IL300367A (en) 2023-04-01
JP2023536921A (ja) 2023-08-30
CN116406297A (zh) 2023-07-07
CA3188398A1 (en) 2022-02-10
WO2022031914A3 (en) 2022-03-31
EP4192580A2 (en) 2023-06-14
EP4192580A4 (en) 2025-06-18
US20230340528A1 (en) 2023-10-26

Similar Documents

Publication Publication Date Title
US20230340528A1 (en) Methods of treating cardiac disorders and congestive heart failure and administering aav vectors
US12151001B2 (en) Optimized expression cassettes for gene therapy
JP2021045136A (ja) 最適化されたミニ−ジストロフィン遺伝子および発現カセットおよびそれらの使用
US12564647B2 (en) Optimized expression cassettes for gene therapy
JP2019502376A (ja) ジストロフィンエクソン53スキッピングのための効果的な遺伝子治療ツール
US20160166651A1 (en) Systemic delivery of virus vectors encoding urocortin-2 and related genes to treat diabetes-related cardiac dysfunctions and congestive heart failure
TW202117017A (zh) 人類心肌病的aav心臟基因療法
US20200308582A1 (en) Kcnk3-based gene therapy of cardiac arrhythmia
CN114521143A (zh) 减轻fkrp心脏毒性的基因治疗表达系统
ES2975422T3 (es) Proteínas con actividad cardioprotectora
HK40090887A (zh) 治疗心贜疾患和充血性心力衰竭以及施用aav载体的方法
KR20250169529A (ko) 유전자 요법을 위한 Bcl2-관련 아타노진 3(BAG3)을 인코딩하는 핵산
US20240139343A1 (en) Increased packaging efficiency of vector for cardiac gene therapy
EA048262B1 (ru) Повышенная эффективность упаковки вектора для генотерапии сердечных заболеваний

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2023507620

Country of ref document: JP

Kind code of ref document: A

Ref document number: 3188398

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2021853948

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21853948

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2021320244

Country of ref document: AU

Date of ref document: 20210805

Kind code of ref document: A