WO2022026442A1 - Traitement du cancer bronchique non à petites cellules avec poziotinib - Google Patents

Traitement du cancer bronchique non à petites cellules avec poziotinib Download PDF

Info

Publication number
WO2022026442A1
WO2022026442A1 PCT/US2021/043274 US2021043274W WO2022026442A1 WO 2022026442 A1 WO2022026442 A1 WO 2022026442A1 US 2021043274 W US2021043274 W US 2021043274W WO 2022026442 A1 WO2022026442 A1 WO 2022026442A1
Authority
WO
WIPO (PCT)
Prior art keywords
subject
egfr
mutations
exon
poziotinib
Prior art date
Application number
PCT/US2021/043274
Other languages
English (en)
Inventor
Gajanan Bhat
Francois Lebel
Sribalaji LAKSHMIKANTHAN
John A. Barrett
Original Assignee
Spectrum Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Spectrum Pharmaceuticals, Inc. filed Critical Spectrum Pharmaceuticals, Inc.
Publication of WO2022026442A1 publication Critical patent/WO2022026442A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57423—Specifically defined cancers of lung
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • EGFR-TKI epidermal growth factor receptor tyrosine kinase inhibitor
  • EGFR tyrosine kinase inhibitors such as erlotinib, gefitinib or afatinib.
  • TKIs EGFR tyrosine kinase inhibitors
  • mutations in exon 20 of EGFR which account for 5% to 10% of all EGFR mutations, have been generally associated with de novo resistance to EGFR TKIs.
  • the reported response rate of patients with EGFR exon 20 insertions to gefitinib and erlotinib is low at 5% with a median Progression Free Survival (PFS) of 1.5 months.
  • HER2 ErbB-2/neu Human epidermal growth factor 2
  • the ErbB2 gene which encodes for HER2, is a major proliferative driver that activates downstream signaling through PI3K-AKT and MEK-ERK pathways.
  • HER2 mutations consist of in-frame insertions in exon 20, leading to constitutive activation of the receptor and downstream AKT and MEK pathways. [0006] HER2 mutations have been identified in approximately 1% to 4% of NSCLC. In an initial report, mutations in the HER2 kinase domain were identified in 4.2% of 120 primary NSCLC overall and 9.8% in adenocarcinomas. A subsequent study of 671 primary resected NSCLC, HER2 mutations were found in 1.6% of samples overall, but in 3.9% of adenocarcinoma samples, and more frequently in Asian ethnicity.
  • Crystallography of the EGFR exon 20 insertion D770insNPG has revealed a stabilized and ridged active conformation inducing resistance to the first generation TKIs in insertions after residue 764. It has been reported that in a patient derived xenograft (PDX) model of EGFR exon 20 driven NSCLC where insertions are in the loop after the c-helix (EGFR H773insNPH), the third generation EGFR TKIs, osimertinib (AZD9291) and rociletinib (CO-1696) were found to have minimal activity. [0008] There is no FDA approved targeted therapy for HER2 exon 20 insertion mutation NSCLC.
  • Chemotherapy remains the standard of care for metastatic disease with severe side effects and modest efficacy. Therefore, there is a significant clinical need to identify targeted novel therapies to overcome the innate drug resistance of NSCLC tumors harboring exon 20 mutations, particularly insertion mutations, in EGFR and HER2.
  • SUMMARY OF THE INVENTION [0009] The therapy disclosed in this patent document met such a need.
  • An aspect of the document provides a method for treating a cancer in a subject, wherein the subject has been determined to have certain EGFR or HER2 mutations including for example insertion mutations and point mutations.
  • the method generaly includes administering a therapeutically effective amount of poziotinib or a pharmaceutically acceptable salt thereof to the subject in need thereof who are at risk or have been determined to show at least one mutation within EGFR or HER2 Exons.
  • the NSCLC is diagnosed to be locally advanced.
  • the subject has been determined to have one or more EGFR Exon 20 mutations or HER2 Exon 20 mutations, including for example other in-frame insertion mutation and duplication, wherein at least one of the EGFR Exon mutations is a EGFR Exon 20 insertion mutation, and wherein at least one of the HR2 Exon mutations is a HER2 Exon 20 insertion mutation.
  • the subjet has een determined to have only EGFR Exon 20 insertion mutations or HER2 Exon 20 insertion mutations.
  • the subject has been determined to have one or more EGFR Exon 20 insertion mutation or HER2 Exon 20 insertion mutation, wherein the subject is free from EGFR exon 20 point mutation.
  • the subject is free from EGFR T790M mutation.
  • the subject is free from EGFR exon 20 point mutation.
  • the subject has been determined to have 2, 3 or 4 EGFR Exon 20 insertion mutations or HER2 Exon 20 insertion mutations.
  • the subject has been determined to have 1, 2, 3, 4 or more EGFR Exon 20 mutations selected from the group consisting of T790M, V769M, V769L, M766_A767insASV, A767insASV, A767insTLA, A767_V769dupASV, V769_D770insASV, V769_D770insGSV, V769_D770insGVV, V769_D770insSAVS, V769_D770insSLRD, V769_H773>LDNPNPH, V769_D770insE, V769_D770insGTV, V769_D770insGVM, V769_N771dupVDN, D770_N771insSVD, D770>GY, D770_N771insG, D770_N771insY, D770_N771insNPG, N771
  • the subject has been determined to have 1, 2, 3, 4 or more EGFR Exon 20 mutations selected from the group consisting of M766_A767insASV, A767insASV, A767insTLA, A767_V769dupASV, V769_D770insASV, V769_D770insGSV, V769_D770insGVV, V769_D770insSAVS, V769_D770insSLRD, V769_H773>LDNPNPH, V769_D770insE, V769_D770insGTV, V769_D770insGVM, V769_N771dupVDN, D770_N771insSVD, D770>GY, D770_N771insG, D770_N771insY, D770_N771insNPG, N771_P772insT, D770_N77
  • the subject has been determined to have 1, 2, 3, 4 or more HER2 Exon 20 mutation selected from the group consisting of T790M, A775_G776insYVMA, A775_G776insSVMA, A775_G776insVVMA, A775_G776insYVMS, A775_G776insAVMA, A775_G776insSVMA, A775_G776insC, Y772_V773insM, Y772dupYVMA, Y772_A775dup, A775_G776insI, G776delinsVC, G776delinsVV, G776delinsLC, G776delinsIC, G776_V777delinsCVC, G776delinsAVG, M774delinsWLV, G776delinsLC, G778_S779InsCPG, G
  • the subject has been determined to have 1, 2, 3, 4 or more HER2 Exon 20 mutation selected from the group consisting of A775_G776insYVMA, A775_G776insSVMA, A775_G776insVVMA, A775_G776insYVMS, A775_G776insAVMA, A775_G776insSVMA, A775_G776insC, Y772_V773insM, Y772dupYVMA, Y772_A775dup, A775_G776insI, G776delinsVC, G776delinsVV, G776delinsLC, G776delinsIC, G776_V777delinsCVC, G776delinsAVG, M774delinsWLV, G776delinsLC, G778_S779InsCPG, G778_P7
  • the subject has not previously received a systemic treatment for the NSCLC.
  • the subject has previously received a systemic treatment for the NSCLC including a tyrosine kinase inhibitor, immune checkpoint inhibitor or a VEGF inhibitor, such as erlotinib, gefitinib, dacomitinib, osimertinib, dabrafenib, trametinib, ceritinib, crizotinib, afatinib, durvalumab, bevacizumab, ranibizumab, nivolumab and pembrolizumab.
  • a tyrosine kinase inhibitor such as erlotinib, gefitinib, dacomitinib, osimertinib, dabrafenib, trametinib, ceritinib, crizotinib, afatinib, durvalumab, bevacizumab
  • the NSCLC is resistant to a previously administered tyrosine kinase inhibitor and/or the VEGF inhibitor.
  • the subject has acquired EGFR mutations resulting from the previously administered tyrosine kinase inhibitor.
  • the subject is resistant to osimertinib.
  • the subject has been determined to have one or more mutations selected from the group consisting of C797S, L792, G796D/S/R, L792F/Y/H, C797G and L718Q.
  • the subject has been determined to have an atypical mutation or one or more Exon 18 to 21 activating mutations.
  • the subject has been determined to have one or more EGFR activating mutations selected from the group consisting of E709X, E709_T710del insD, L718X, G719X, I740_K745dupIPVAIK, L747X, A750P, S768I, S768I/V769L, S768I/V774M, L833V, and L861Q.
  • the subject has been determined to have one or more HER2 activating mutations selected from the group consisting of S310F, I655V, L755X, I767M, D769X, V777X, L786V, V842I, and L869R.
  • the subject is free from EGFR & HER2 Exon 20 insertion mutation, Exon 19 deletion, L858R and HER2 T981I mutation.
  • the poziotinib or the pharmaceutically acceptable salt thereof is administered orally. In some embodiments, the poziotinib or pharmaceutically acceptable salt thereof is administered at a daily dose of 2 to 20 mg. In some embodiments, the poziotinib or pharmaceutically acceptable salt thereof is administered at a daily dose of 8 mg, 10 mg, 12 mg, 14 mg, 16 mg or 24 mg. In some embodiments, the poziotinib or the pharmaceutically acceptable salt thereof is administered daily.
  • the poziotinib or the pharmaceutically acceptable salt thereof is administered once a day. In some embodiments, the poziotinib or the pharmaceutically acceptable salt thereof is administered twice a day (e.g. 6 mg BID, 7 mg BID, 8 mg BID, etc). In some embodiments, the pharmaceutically acceptable salt is a hydrochloride salt.
  • Another aspect provides a method of treating or preventing CNS metastases in a subject, wherein the subject has been diagnosed to have a cancer. The method includes administering a therapeutically effective amount of poziotinib or a pharmaceutically acceptable salt thereof to the subject in need thereof. In some embodiments, the subject has been diagnosed to lung cancer.
  • the subject has been diagnosed to have small cell lung cancer (SCLC). In some embodiments, the subject has been diagnosed to have non- small cell lung cancer (NSCLC). [0022] In some embodiments, the subject has been determined to have CNS metastases. In some embodiments, the subject has been determined to have no CNS metastases. [0023] In some embodiments, the subject has been determined to have EGFR Exon 20 insertion mutation at one or more locations selected from the group consisting of 762E, 763A, 764Y, 765V, 766M, 767A, 768S, 769V, 779D, 771N, 772P, 773H, 774V, and 775C.
  • the subject has previously received treatment with an EGFR tyrosine kinase inhibitor.
  • the subject has been determined to have one or more EGFR Exon 20 mutations selected from the group consisting of M766_A767insASV, A767insASV, A767insTLA, A767_V769dupASV, V769_D770insASV, V769_D770insGSV, V769_D770insGVV, V769_D770insSAVS, V769_D770insSLRD, V769_H773>LDNPNPH, V769_D770insE, V769_D770insGTV, V769_D770insGVM, V769_N771dupVDN, D770_N771insSVD, D770>GY, D770_N771insG, D770_N771insY, D770_N771inss.
  • At least one of the EGFR Exon mutations is a EGFR Exon 20 insertion mutation, and wherein at least one of the HR2 Exon mutations is a HER2 Exon 20 insertion mutation.
  • the subject has not previously received treatment with a EGFR tyrosine kinase inhibitor.
  • the subject has previously received one, two, three or more lines of therapy for the cancer, which is NSCLC.
  • the subject has previously received treatment with an EGFR tyrosine kinase inhibitor.
  • the poziotinib or pharmaceutically acceptable salt thereof is administered either as a single or divided daily dose of about 8 mg, about 10 mg, about 12 mg, or about 16 mg.
  • Another aspect discloses a method of treating non-small cell lung cancer (NSCLC) in a subject, comprising administering a therapeutically effective amount of poziotinib or a pharmaceutically acceptable salt thereof to the subject in need thereof, wherein the subject has been determined to have one or more HER2 Exon 20 insertion mutations and has received at least one line of therapy for the NSCLC.
  • NSCLC non-small cell lung cancer
  • At least one of the EGFR Exon mutations is a EGFR Exon 20 insertion mutation, and/or wherein at least one of the HR2 Exon mutations is a HER2 Exon 20 insertion mutation.
  • Another aspect discloses a method of treating or preventing CNS metastases in a subject, wherein the subject has been diagnosed to have a cancer and HER2 exon 20 mutations, comprising administering a therapeutically effective amount of poziotinib or a pharmaceutically acceptable salt thereof to the subject in need thereof.
  • At least one of the EGFR Exon mutations is a EGFR Exon 20 insertion mutation, and/or wherein at least one of the HR2 Exon mutations is a HER2 Exon 20 insertion mutation.
  • Another aspect discloses a method of reducing adverse events in treating a subject with cancer, comprising administering twice a day a therapeutically effective amount of poziotinib or a pharmaceutically acceptable salt thereof to the subject in need thereof, wherein the daily dosage of poziotinib or a pharmaceutically acceptable salt thereof ranges from about 10 mg to about 20 mg.
  • Figure 1 shows an example study design diagram.
  • Figure 2 shows the schedule of study assessments and procedures.
  • Figure 3 shows clinical activity of poziotinib in previously treated patients with EGFR insertion mutations.
  • Figure 4 shows ORR and tumor shrinkage in previously treated and NSCLC exon 20 patients.
  • Figure 5(a) shows response for EGFR insetions at helical location, near loop and far loop.
  • Figure 5(b) shows ORR for different insertions.
  • Figure 6 shows the comparison of a patient between baseline scan and on- treatment scan.
  • Figure 7 shows clinically meaningful activity in treatment-na ⁇ ve NSCLC patient with exon 20 EGFR mutantations.
  • Figure 8(a) shows a comparison of the efficacy between 16 mg QD and 8 mg BID dosing.
  • Figure 8(b) shows a comparison of the adverse events between 16 mg QD and 8 mg BID dosing.
  • Figure 9 shows a comparison of the efficacy between 12 mg QD and 6 mg BID dosing.
  • Figure 10 shows a comparison of the adverse events between 12 mg QD and 6 mg BID dosing.
  • Fig. 11 shows that atypical EGFR mutations are heterogeneous and are associated with worse patient outcomes.
  • E. Heat map with unsupervised hierarchical clustering of log (Mutant/WT) ratios from Ba/F3 cells expressing indicated mutations after 72 hours of indicated drug treatment. Squares are representative of the average of n 3 replicates. For co-occurring mutations, the order of exons 1, 2, and 3 were assigned arbitrarily. Groups were assigned based on predicted mutational impact.
  • Dot plot of mutant/WT IC 50 values of Ba/F3 cells expressing classical EGFR mutations (white bars) or classical EGFR mutations and acquired PACC mutations (colored bars) treated with indicated classes of EGFR TKIs. Dots are representative of average of n 3 replicate mutant/WT IC 50 values of individual cell lines expressing indicated mutations with individual drugs. Bars are representative of average mutant/WT IC 50 values ⁇ SEM for each class of EGFR TKI and indicated cell lines. p-values were determined by ANOVA analysis with unequal SD as determined by Brown-Forsythe test to determine differences in SD. Holm-Sidak's multiple comparisons test was used to determine differences between groups. G.
  • Fig. 14 shows Structure-function groups better predict patient outcomes than exon based groups – ALL DATA.
  • B Forrest plot of hazard ratios calculated from Kaplan-Meier plots in panel A. Hazard ratios and p-value were calculated using the Mantel-Cox, Log-Rank method.
  • Exon 20 insertions are a distinct class of EGFR mutations.
  • Fig 16 shows that drug repurposing can overcome T790M-like resistance mutations.
  • B-C Heat map with unsupervised hierarchical clustering of log (Mutant/WT)
  • Fig.17 shows PACC mutations alter the orientation of the P-loop and/or ⁇ -C- helix and are sensitive to second-generation TKIs.
  • A. Overlap of G719S (PDB 2ITN) and WT EGFR (PDB 2ITX, grey) crystal structures demonstrate a significant shift of F723 in the P- loop orienting the benzyl ring in a downward position condensing the P-loop in the drug binding pocket. Further, G719S has an inward shift of the ⁇ -C-helix compared to the WT crystal structure.
  • PDB 2ITN P-t EGFR
  • a space filling model of G719S (PDB 2ITN) is shown with P-loop, ⁇ -C- helix (blue), hinge region (orange), C797 (yellow), and DFG motif highlighted to demonstrate steric hindrance of drug binding pocket caused by shifted P-loop.
  • poziotinib is less effected by Q719 and is still positioned to react with C797, even in the context of L719Q mutations.
  • D In silico modeling of EGFR G719S (purple) with poziotinib (blue) shows no predicted changes in poziotinib binding or TKI-protein interactions.
  • E Dot plot of percent change in tumor volume on day 28 of tumors described in Fig.3C. Dots are representative of each tumor, and bars are representative of average ⁇ SEM for each group. Statistical differences were determined by ordinary one-way ANOVA with post-hoc Tukey's multiple comparisons test to determine differences between groups.
  • F F.
  • Fig.18 shows Second generation TKIs confer durable clinical benefit in patients with acquired osimertinib-resistant NSCLC.
  • CT scan of a patient after 10 months of osimertinib treatment showed new pleural lesion that tested positive for both EGFR L858R and L718V mutations (red arrow), and CT image of patient four weeks after beginning poziotinib treatment shows reduction in size of the pleural lesion (red arrow). Blue arrow indicates resolved pleural effusion.
  • CT images shows timeline of patient treatments and outcomes.
  • B Schematic representations of a patient treatments and outcomes that acquired two PACC mutations after 18 months of osimertinib treatment.
  • PR partial response
  • PD progressive disease
  • SD stable disease
  • SRS stereotactic radiosurgery.
  • Figure 20 A and 20B show EGFR mutant vectors used to generate cell lines.
  • Figure 21 shows patients with atypical EGFR mutations have worse clinical outcomes than those with classical EGFR mutations.
  • the order of exons 1, 2, and 3 were assigned arbitrarily. Groups were assigned based on structural predictions [0053] Fig.
  • FIG. 23 shows structure-function based groupings are more predictive of drug and mutation sensitivity compared to exon based groupings.
  • Bar plot of Spearman rho values for indicated mutations compared to exon based groups or structure-function based groups is illustrated.
  • the delta of the two rho values is shown as an overlapped grey bar. When the delta bar shifts to the right, the spearman rho value was higher for structure-function based groups, and when the grey bar shifts to the left, the spearman rho value was higher for the exon based groups.
  • Fig.24 shows classical-like EGFR mutations are not predicted to alter the drug- binding pocket and are most sensitive to third-generation EGFR TKIs. A-B.
  • F Tumor growth curves for PDXs harboring EGFR L858R E709K complex mutation treated with indicated inhibitors. Tumors were measured three times per week and symbols are average of tumor volumes ⁇ SEM.
  • Mice received drug 5 days per week, and mice were euthanized at day 28 to harvest tumors.
  • G Dot plot of percent change in tumor volume on day 28 of tumors described in panel F. Dots are representative of each tumor, and bars are representative of average ⁇ SEM for each group.
  • Fig.25 shows Second generation TKIs confer durable clinical benefit in patients with acquired osimertinib-resistant NSCLC.
  • A. CT scan of a patient after 10 months of osimertinib treatment showed new pleural lesion that tested positive for both EGFR L858R and L718V mutations (red arrow), and CT image of patient four weeks after beginning poziotinib treatment shows reduction in size of the pleural lesion (red arrow). Blue arrow indicates resolved pleural effusion. Schematic below CT images shows timeline of patient treatments and outcomes.
  • FIG. 26 shows an exemplary clinical trial design including primary and secondary endpoints, timeline of follow-up scans, inclusion criteria, and dose reduction plan.
  • Figure 27 shows a List of genes covered in the Solid Tumor Assay.
  • Figure 28 shows a list of genes covered in Fusions Assay.
  • Figure 29 shows a list of genes covered by the LB70 plasma assay.
  • White boxes genes covered by single nucleotide variants (SNVs) and indels.
  • Figure 30 shows exemplary plasmids used.
  • Figure 31 shows characteristics of the patients at baseline.
  • Figure 32 shows all regimens of systemic therapy prior to study enrollment in an exemplary study.
  • Figure 34 shows resistance to poziotinib is driven by both EGFR-dependent and –independent mechanisms.
  • each column denotes the primary exon 20 mutation as follows: A: H773_V774VdupHV, B: D770_N771insG, C: S768_D770dupSVD, D: H773_V774insAH, E: A767_V769dupASV, F: D770_N771dupDN, G: H773dupH, H: P772_H773dupPH, I: P772_H773insPNP.
  • the left-side column lists the alterations acquired at resistance. Red box: mutation, blue box: amplification. Objective response to poziotinib is shown in the bottom row. Green box: partial response, orange box: stable disease. B.
  • IC 50 values of Ba/F3 cells expressing the indicated EGFR exon 20 mutations Bars are representative of the average IC 50 value ⁇ SEM. Dotted red line indicates the average IC 50 value of Ba/F3 cells expressing WT EGFR. All IC 50 values were determined in at least three independent replicates.
  • C In silico modelling of EGFR D770insNPG with T790M and poziotinib. The top panel shows the methionine at 790 displaces the interactions of poziotinib away from the hydrophobic cleft, increasing the distance between the acrylamide of poziotinib and C797.
  • FIG. 35 shows far loop mutants are less sensitive to EGFR TKIs.
  • A Schematic representation of the first 15 amino acids of exon 20 of EGFR divided by structural features corresponding to amino acids. Mutations are listed with the frequency observed in this study. Bars are representative of overall frequency of variants at the indicated amino acid.
  • B- C (B) Waterfall plot and (C) bar graph of evaluable patient confirmed response to poziotinib divided by mutation location.
  • Objective response rate (ORR) and disease control rate (DCR) are shown for the intent to treat population for near and far. Statistical differences were determined by Chi-square test.
  • D Kaplan-Meier plot of progression free survival of patients with near loop and far loop mutants in the intent to treat population. Long-Rank Mantel-Cox approach was used to determine p-value.
  • FIG. 36 shows EGFR TKI activity correlates with exon 20 insertion mutation location in drugs under clinical evaluation.
  • “about 10%” may indicate a range of 9% to 11%, and “about 20” may mean from 18 to 22. Other meanings of “about” may be apparent from the context, such as rounding off, so, for example “about 1” may also mean from 0.5 to 1.4.
  • the term “and/or” includes any and all combinations of one or more of the associated listed items. Expressions such as “at least one of,” when preceding a list of elements, modify the entire list of elements and do not modify the individual elements of the list.
  • the term “day”, “per day” and the like refer to a time within one calendar day which begins at midnight and ends at the following midnight.
  • the term “daily dosage” as used herein generally refers to the total amount of poziotinib or a pharmaceutically acceptable salt thereof administered during the same day. When the poziotinib or a pharmaceutically acceptable salt thereof is administered more than once during the same day, the daily dosage is generally splitted equally among the multiple administrations.
  • the term “resistant” or “resistance” in the context of cancer treatment refers to a cancer that does not respond, or exhibits a decreased response to, one or more chemotherapeutic agents (e.g., any agent described herein).
  • treating or “treatment” and any derivatives thereof as used herein, is meant therapeutic therapy.
  • treating means: (1) to ameliorate or prevent the condition of one or more of the biological manifestations of the condition, (2) to interfere with (a) one or more points in the biological cascade that leads to or is responsible for the condition or (b) one or more of the biological manifestations of the condition, (3) to alleviate one or more of the symptoms, effects or side effects associated with the condition or treatment thereof, or (4) to slow the progression of the condition or one or more of the biological manifestations of the condition.
  • treating or treatment and rate of success for a treatment can be evaluated by such measurements as (a) Progression-free Survival (PFS) defined herein as the time from first dose administration of therapeutic intervention in a clinical trial to disease progression or death from any cause; (b) Objective Response Rate (ORR ) defined herein as proportion of patients with a tumor size reduction of a predefined amount and for a minimum period of time using RECIST v1.1 criteria; Disease Control Rate (DCR) defined herein as the percentage of patients with advanced or metastatic cancer who have achieved either a complete response, partial response or stable disease to a therapeutic intervention in clinical trials of anticancer agents; Overall Survival (OS) Rate defined herein as the percentage of people in a study or treatment group who are still alive for a certain period of time after they were diagnosed with or started treatment for a disease; Time to Progression (TTP) define herein as the length of time from the date of diagnosis or the start of treatment for a disease until the disease starts to get worse or spread to other parts of the body;
  • PFS Progression-free Survival
  • the term "effective amount” as used herein means that amount of a drug or pharmaceutical agent that will elicit the biological or medical response of a tissue, system, animal or human that is being sought, for instance, by a researcher or clinician.
  • therapeutically effective amount means any amount which, as compared to a corresponding subject who has not received such amount, results in improved treatment, healing, prevention, or amelioration of a disease, disorder, or side effect, or a decrease in the rate of advancement of a disease or disorder.
  • the term also includes within its scope amounts effective to enhance normal physiological function.
  • stage III lung cancer refers to stage III lung cancer which is found in the lung and in the lymph nodes in the middle of the chest, also described as locally advanced disease. Stage III has two subtypes: If the cancer has spread only to lymph nodes on the same side of the chest where the cancer started, it is called stage IIIA. If the cancer has spread to the lymph nodes on the opposite side of the chest, or above the collar bone, it is called stage IIIB.
  • stage IIIA If the cancer has spread to the lymph nodes on the opposite side of the chest, or above the collar bone, it is called stage IIIB.
  • metalastatic or “metastasis” as used herein refers to the spread of cancer from the primary site (place where it started) to other places in the body.
  • the term “acquired mutation” or “acquired resistance mutation” as used herein refers to a new mutation which is associated with resistance to the cancer therapy such as HER2 or EGFR TKIs (erlotinib, gefitinib, and afatinib, etc) and developed in some patients.
  • pharmaceutically acceptable carrier and/or excipient refers to a carrier and/or excipient pharmacologically and/or physiologically compatible to a subject and an active component.
  • a pharmaceutically acceptable carrier includes, without limitation, pH regulators, surfactants, adjuvants, and ionic strength enhancers.
  • pH regulators include, without limitation, phosphate buffer solutions; surfactants include, without limitation, cationic, anionic or nonionic surfactants, for example, Tween-80; ionic strength enhancers include, without limitation, sodium chloride.
  • subject in need thereof refers to a subject or patient suffering from a condition or disease that is associated with overexpression of EGFR (HER1) or HER2 or any mutant thereof, who would benefit from the administration of poziotinib or a pharmaceutically acceptable salt thereof or a pharmaceutical composition thereof comprising additionally a pharmaceutically acceptable carrier and/or excipient.
  • Such subjects particularly include those NSCLC patients positive for or suffering from EGFR or HER2 mutation, typical or atypical, namely EGFR Exon 20 insertion mutation or HER2 exon 20 insertion mutation.
  • systemic therapy as used herein include conventional therapy such as stereotactic body radiotherapy, chemotherapy, radiation therapy, surgery and immunotherapy.
  • wild-type as used herein is understood in the art and refers to a polypeptide or polynucleotide sequence that occurs in a native population without genetic modification.
  • a mutant includes a polypeptide or polynucleotide sequence having at least one modification to an amino acid or nucleic acid compared to the corresponding amino acid or nucleic acid found in a wild-type polypeptide or polynucleotide, respectively. Included in the term mutant is Single Nucleotide Polymorphism (SNP) where a single base pair distinction exists in the sequence of a nucleic acid strand compared to the most prevalently found (wild-type) nucleic acid strand.
  • SNP Single Nucleotide Polymorphism
  • Example 20 insertion mutation includes in-frame insertion mutation and duplication.
  • X refers to any amino acides (e.g., A, R, N, D, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, V).
  • An amino acid substitution with X means the original amino acid is replaced with any one amino acid other than the original amino acid.
  • An aspect of this patent document provides a method of treating non-small cell lung cancer (NSCLC) in a subject. The method includes administering an effective amount of poziotinib or a pharmaceutically acceptable salt thereof to the subject.
  • NSCLC non-small cell lung cancer
  • Poziotinib is a quinazoline-based pan-HER inhibitor that irreversibly blocks signaling through the EGFR family of tyrosine-kinase receptors, including human epidermal growth factor receptor (HER1/ErbB1/EGFR), HER2 (ErbB2), and HER4 (ErbB4), as well as HER receptor mutations. This, in turn, leads to inhibition of the proliferation of tumor cells that overexpress these receptors. It is well established that several malignancies, including lung, breast, stomach, colorectal, head, and neck, and pancreatic carcinomas, are associated with a mutation in or overexpression of members of the EGFR receptor family.
  • the administration of poziotinib or a pharmaceutically acceptable salt thereof can lead to the inhibition of the proliferation of tumor cells that overexpress these receptors.
  • the chemical formula of poziotinib is 1-[4-[4-(3,4-dichloro-2-fluorophenylamino)-7-methoxyquinazolin-6- yloxy]-piperidin-1-yl]prop-2-en-1-one shone below.
  • the pharmaceutically acceptable salt may be an inorganic acid salt, an organic acid salt, or a metal salt.
  • the inorganic acid salt may be a salt of hydrochloric acid, hydrobromic acid phosphoric acid, sulfuric acid, disulfuric acid, nitric acidm phosphoric acid, perchloric acid and the like.
  • the organic acid salt may be a salt of malic acid, maleic acid, citric acid, formic acid, acetic acid, embonic acid, aspartic acid, camsylic acid, acetylsalicylic acid, fumaric acid, besylic acid, camsylic acid, edisylic acid, 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, 2-naphthalenesulfonic acid, 3-phenylpropionic acid, 4,4 ′ -methylenebis(3-hydroxy- 2-ene-1-carboxylic acid), 4-methylbicyclo[2.2.2]oct-2-ene- 1-carboxylic acid, aliphatic mono- and dicarboxylic acids, aliphatic sulfuric
  • the metal salt may be a calcium salt, sodium salt, magnesium salt, strontium salt, or potassium salt.
  • Poziotinib is in the form of a hydrochloride salt.
  • Poziotinib or a pharmaceutically acceptable salt thereof may be in a crystalline form or amorphous form and can be administered in an amount of 0.1 mg to 50 mg.
  • the methods disclosed herein are applicable to the treatment of various cancers and associated conditions.
  • Non-limiting examples of the cancers include ovarian cancer, breast cancer, lung cancer, glioblastoma, melanoma, bladder cancer, head and neck cancer, renal cell cancer, colorectal cancer, biliary tract cancer, bladder cancer, brain cancer, cervical cancer, choriocarcinoma, endometrial cancer, esophageal cancer, gastric cancer, hematological neoplasms, intraepithelial neoplasms, liver cancer, lymphomas, neuroblastomas, oral cancer, pancreatic cancer, prostate cancer, sarcoma, basocellular cancer, squamous cell cancer, testicular cancer, stromal tumors, germ cell tumors, thyroid cancer, renal cancer, endometrial cancer, lymphoma, leukemia, multiple myeloma, and hepatocellular carcinoma.
  • the cancer is lung cancer or breast cancer.
  • the cancer is non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC).
  • NSCLC non-small cell lung cancer
  • SCLC small cell lung cancer
  • the NSCLC to be treated can be an early cancer, a non-metastatic cancer, a primary cancer, an advanced cancer, a locally advanced cancer, a metastatic cancer, a cancer in remission, a recurrent cancer, an adjuvant setting.
  • the cancer is locally advanced or or metastatic.
  • Tyrosine Kinase (TK) domain mutations in EGFR or HER2 are referred to as “activating mutations” because they lead to a ligand-independent constitutive activation of TK activity.
  • the activating mutations of the EGFR gene are found in the first four exons (18 through 21) of the TK domain. These mutations fall into three major classes, class I, II and III. Class I mutations are in-frame deletions in exon 19; these deletions almost always include amino-acid residues leucine-747 to glutamic acid-749 ( ⁇ LRE), and account for about 44% of all EGFR TK mutations. Class II mutations are single-nucleotide substitutions that cause an amino-acid alteration. The predominant single-point mutation is in exon 21, which substitutes an arginine for a leucine at codon 858 (L858R).
  • L858R has the highest prevalence of any single-point activating mutation in EGFR TK and accounts for about 41% of all EGFR TK activating mutations.
  • Other class II activating mutations result in a glycine-719 (G719) change to serine, alanine or cysteine (4% of all EGFR TK activating mutations), and other missense mutations account for another 6% of EGFR mutations.
  • Class III mutations are in-frame duplications and/or insertions in exon 20. These account for the remaining 5% of EGFR TK activating mutations.
  • a variety of other activating mutations have been detected with low frequency, including V765A and T783A ( ⁇ 1%) in exon 20.
  • the NSCLC patient is determined to have one or more EGFR Exon 20 insertion mutations or HER2 Exon 20 insertion mutations.
  • the EGFR exon 20 mutation may be a helical mutantion, a near loop mutation, or a far loop mutation. Examples of locations of helical mutations include 762E, 763A, 764Y, 765V, and 766M. Examples of locations of near loop mutations include 767A, 768S, 769V, 779D, 771N, and 772P.
  • the NSCLC patient is determined to have one, two, three, four, five or more mutations from one, two, or three locations of the group consisting of the helical loop, the near loop mutation, and the far loop mutation.
  • the subject may have been disclosed with one or more HER2 or EGFR exon 29 mutations.
  • Non-limiting examples of EGFR exon 20 insertion mutations include M766_A767insASV, A767insASV, A767insTLA, A767_V769dupASV, V769_D770insASV, V769_D770insGSV, V769_D770insGVV, V769_D770insSAVS, V769_D770insSLRD, V769_H773>LDNPNPH, V769_D770insE, V769_D770insGTV, V769_D770insGVM, V769_N771dupVDN, D770_N771insSVD, D770>GY, D770_N771insG, D770_N771insY, D770_N771insNPG, N771_P772insT, D770_N771insGL, D770_N771insSVG, D770delinsG
  • the NSCLC patient has been determined to have one, two three, four, or more these EGFR exon 20 insertion mutations. In some embodiments, the patient has been determined to have only one EGFR exon 20 insertion mutation, which is M766_A767insASV, A767insASV, A767insTLA, A767_V769dupASV, V769_D770insASV, V769_D770insGSV, V769_D770insGVV, V769_D770insSAVS, V769_D770insSLRD, V769_H773>LDNPNPH, V769_D770insE, V769_D770insGTV, V769_D770insGVM, V769_N771dupVDN, D770_N771insSVD, D770>GY, D770_N771insG, D770_N771insY, D770_N
  • the patient has been determined to two, three or more EGFR exon 20 insertion mutations, which include at least one mutation selected from the group consisting of M766_A767insASV, A767insASV, A767insTLA, A767_V769dupASV, V769_D770insASV, V769_D770insGSV, V769_D770insGVV, V769_D770insSAVS, V769_D770insSLRD, V769_H773>LDNPNPH, V769_D770insE, V769_D770insGTV, V769_D770insGVM, V769_N771dupVDN, D770_N771insSVD, D770>GY, D770_N771insG, D770_N771insY, D770_N771insNPG, N771_P772insT, D770_N
  • the patient has T790M mutation. In some embodimens, the patient is free from T790M mutation.
  • the term “one or more mutations” in this patent document include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and more than 10 mutations.
  • non- limiting examples of HER2 exon 20 insertion mutations include A775_G776insYVMA, G776_V777insVC, P780_Y781insGSP.
  • the NSCLC patient has been determined to have one, two three, four, or more these HER2 exon 20 insertion mutations including for example A775_G776insYVMA, A775_G776insSVMA, A775_G776insVVMA, A775_G776insYVMS, A775_G776insAVMA, A775_G776insSVMA, A775_G776insC, Y772_V773insM, Y772dupYVMA, Y772_A775dup, A775_G776insI, G776delinsVC, G776delinsVV, G776delinsLC, G776delinsIC, G776_V777delinsCVC, G776delinsAVG, M774delinsWLV, G776delinsLC, G778_S779InsCPG, G778_
  • the patient has been determined to have only one HER2 exon 20 insertion mutation disclosed above. In some embodiments, the patient has been determined to two, three or more HER2 exon 20 insertion mutations, which include at least one mutation disclosed above. In some embodiments, the patient has T790M mutation. In some embodimens, the patient is free from T790M mutation.
  • Poziotinib or the pharmaceutically acceptable salt thereof can be used as a first line therapy, second line therapy, or third line therapy against NSCLC. In some embodiments, the patient has not received a systemic treatment for NSCLC. In some embodiments, Poziotinib or the pharmaceutically acceptable salt thereof is administered as a first line of therapy.
  • the patient has not received treatment with a different anti- cancer agent.
  • the patient has not been administered a tyrosine kinase inhibitor (TKI) for cancer treatment.
  • TKI tyrosine kinase inhibitor
  • the patient has not been administered poziotinib or EGFR or HER2 exon 20 insertion mutation-selective TKIs.
  • the patient has received a systemic treatment for NSCLC, which has developed resistance to the treatment.
  • the patient has received treatment with a different anti-cancer agent, which has developed resistance to the anti-cancer agent.
  • the patient has been administered a tyrosine kinase inhibitor (TKI) for the treatment of NSCLC, which has developed resistance to the treatment with the TKI.
  • TKI tyrosine kinase inhibitor
  • the patient has been administered poziotinib or EGFR or HER2 exon 20 insertion mutation-selective TKIs for the treatment of NSCLC, which has developed resistance to the treatment with the TKI.
  • the patient has been with osimertinib and developed resistance to the treatment. The resistance can result from the development of one or more mutations including C797S, L792, G796D/S/R, L792F/Y/H, C797G and L718Q.
  • the patient has T790M mutation. In some embodiments, the patient is free from T790M mutation. [0096] In some embodiments, the patient has been determined to have one or more exon 18 to 21 activating mutations. In some embodiments, the patient is from exon 20 insertion mutation. In some embodiments, the patient has been determined to have one or more EGFR activating mutations selected from the group consisting of E709X, E709_T710del insD, L718X, G719X, I740_K745dupIPVAIK, L747X, A750P, S768I, S768I/V769L, S768I/V774M, L833V, and L861Q.
  • the patient has been determined to have one or more HER2 activating mutations selected from the group consisting of S310F, I655V, L755X, I767M, D769X, V777X, L786V, V842I, and L869R.
  • the patient has been determined to be free from Exon 19 deletion, L858R and / or Her2 T981I mutation.
  • the patient has T790M mutation. In some embodiments, the patient is free from T790M mutation.
  • the patient has been determined to have one or more EGFR activating mutations selected from the group consisting of EGFRvIII, R108K, R222C, A289T, P596L, G598V, E709K, E709X, E709_T710del insD, L718X, G719X, I740_K745dupIPVAIK, V742I, E746_A750del, L747X, A750P, S768I/V769L, S768I/V774M, S768I, V769M, V774M, R831C, R831H, L858R, L861Q, and A864V.
  • EGFR activating mutations selected from the group consisting of EGFRvIII, R108K, R222C, A289T, P596L, G598V, E709K, E709X, E709_T710del insD, L7
  • the patient has been determined to have one or more HER2 activating mutations selected from the group consisting of S310F/Y, I655V, V659E, R678Q, V697L, T733I, L755X, I767M, D769H/N/Y, V773M, V777L/M, L786V, V842I, and L869R.
  • the patient or the subject has been treated with one, two, three or more lines of therapy before the treatment with poziobinib or a pharmaceutically acceptable salt thereof.
  • Nonlimiting examples of therapy or treatment for nsclc include stereotactic body radiotherapy, chemotherapy, radiation therapy, and drug therapy.
  • drugs have been used for treatment of cancers, including, drugs that target cells with alk gene changes (e.g.crizotinib (xalkori),ceritinib (zykadia),alectinib (alecensa),brigatinib (alunbrig),lorlatinib (lorbrena)), drugs that target cells with ros1 gene changes (e.g. crizotinib (xalkori), ceritinib (zykadia), lorlatinib (lorbrena),entrectinib (rozlytrek)), drugs that target cells with braf gene changes (e.g.
  • drugs that target cells with alk gene changes e.g.crizotinib (xalkori),ceritinib (zykadia),alectinib (alecensa),brigatinib (alunbrig),lorlatinib (lorbrena)
  • drugs that target cells with ros1 gene changes e.g. crizotinib
  • dabrafenib (tafinlar) , trametinib (mekinist)), drugs that target cells with ret gene changes (e.g. selpercatinib (retevmo)), drugs that target cells with met gene changes (e.g. capmatinib (tabrecta) ), drugs that target cells with ntrk gene changes as well as angiogenesis inhibitors (e.g. bevacizumab (avastin), ramucirumab (cyramza)).
  • EGFR inhibitors include for example agents used in nsclc with egfr gene mutations (e.g.
  • erlotinib (tarceva), afatinib (gilotrif),gefitinib (iressa),osimertinib (tagrisso),dacomitinib (vizimpro)), agents targeting cells with the t790m mutation (e.g. osimertinib (tagrisso) ), agents used for squamous cell nsclc (e.g. necitumumab (portrazza)).
  • the patient or the subject has not previously received treatment with an EGFR tyrosine kinase inhibitor.
  • the subject has previously received treatment with a EGFR tyrosine kinase inhibitor.
  • a EGFR tyrosine kinase inhibitor selected from the group consisting of gefitinib, erlotinib, afatinib, dacomitinib, and osimertinib.
  • the patient or the subject has been determined to have EGFR Exon 20 insertion mutation at one or more locations selected from the group consisting of 762E, 763A, 764Y, 765V, 766M, 767A, 768S, 769V, 779D, 771N, 772P, 773H, 774V, and 775C.
  • the patient or the subject has been determined to have EGFR Exon 20 insertion mutation at one or more locations selected from the group consisting of 767A, 768S, 769V, 770D, 771N, and 772P.
  • the subject has been determined to have one or more EGFR Exon 20 insertion mutations selected from the group conisiting of 768_770dupSVD, V769_D770insASV, D770_N771insSVD, and D770>GY. [0102] In some embodiments, the subject has also been determined to have CNS metastases. In some embodiments, the subject has been determined to have no CNS metastases. [0103] Wild-type or mutant EGFR and HER2 tumor cells can be identified by DNA amplification and sequencing techniques, DNA and RNA detection techniques, including, without limitation, Northern and Southern blot, respectively, and/or various biochip and array technologies or in-situ hybridization.
  • a variety of techniques can be used in the analysis including, without limitation, immunodiagnostic techniques such as ELISA, Western blot or immunocytochemistry.
  • the determination may use a next generation sequencing diagnostic test, such as OncoMine Comprehensive Assay (OCA) or FoundationOne Assay, or by an FDA approved test (eg, cobas® EGFR mutation test v2 or therascreen EGFR RGQ PCR kit) performed by a US CLIA certified and locally licensed clinical laboratory or similarly accredited lab for ex-US sites using tissue samples.
  • OCA OncoMine Comprehensive Assay
  • FDA FDA approved test
  • mutations can be determined from a patient’s biological sample such as plasma.
  • the present invention is directed to methods of treating patients suffering from NSCLC having overexpressed EGFR or HER2 mutations and resistant to other TKIs by administering poziotinib hydrocholoride or a pharmaeucially acceptable salt thereof at daily doses of 10, 12, 16, 20 or 24 mg until an objective response rate has been achived.
  • a daily dosage of 10, 12, 14, 16 mg of poziotinib or a pharmaceutically acceptable salt thereof can be administered once or twice a day.
  • a daily dosage of 24 mg of poziotinib or a pharmaceutically acceptable salt thereof can be administered once, twice or three times a day for two weeks followed by a drug holiday or rest of one week when no poziotinib or a pharmaceutically acceptable salt thereof is administered.
  • poziotinib or a pharmaceutically acceptable salt thereof is administered twice a day (10 mg BID) at a daily dosage of 20 mg.
  • poziotinib or a pharmaceutically acceptable salt thereof is administered twice a day (9 mg BID) at a daily dosage of 18 mg.
  • poziotinib or a pharmaceutically acceptable salt thereof is administered twice a day (8 mg BID) at a daily dosage of 16 mg. In some embodiments, poziotinib or a pharmaceutically acceptable salt thereof is administered twice a day (7 mg BID) at a daily dosage of 14 mg. In some embodiments, poziotinib or a pharmaceutically acceptable salt thereof is administered twice a day (6 mg BID) at a daily dosage of 12 mg. In some embodiments, poziotinib or a pharmaceutically acceptable salt thereof is administered twice a day (5 mg BID) at a daily dosage of 10 mg.
  • the present invention is directed to a method of treating non-small cell lung cancer (NSCLC) in a subject, comprising administering a therapeutically effective amount of poziotinib or a pharmaceutically acceptable salt thereof to the subject in need thereof, wherein the subject has been determined to have one or more HER2 Exon 20 insertion mutations and has received at least one line of therapy for the NSCLC.
  • NSCLC non-small cell lung cancer
  • the HER2 Exon 20 mutations are selected from the group consisting of A775_G776insYVMA, G776_V777insVC, and P780_Y781insGSP.
  • the subject has received at least one, at least two, or at least three lines of therapy for the NSCLC. In some emodiments, the subject has received at therapy selected from Her2-targeted agent, non-Exon 20 insertion-selective tyrosine kinase inhibitor, immune checkpoint inhibitor, and other chemotherapy for the NSCLC. In some emodiments, the subject has received chemotherapy only. In some emodiments, the subject has received a therapy of Her2-targeted agent. In some emodiments, the subject has received a therapy of immune checkpoint inhibitor. In some emodiments, the subject has received a therapy of immune checkpoint inhibitor but without a Her2-targeted agent.
  • the subject has been diagnosed to have CNS metastasis. In some emodiments, the subject has been determined to have no CNS metastases. In some embodiments, the CNS metastases is brain metastases. In some embodiments, the subject has received at least one, at least two, or at least three lines of therapy for the NSCLC. In some embodiments, the subject has received at therapy selected from her2- targeted agent, non-exon 20 insertion-selective tyrosine kinase inhibitor, immune checkpoint inhibitor, radiation therapy, hormone therapy, targeted therapy, stem cell transplant, precision medicine, and other other chemotherapy. In some embodiments, the subject has received chemotherapy only. In some embodiments, the subject has received a therapy of Her2-targeted agent.
  • the subject has received therapy of an immune checkpoint inhibitor. In some embodiments, the subject has received therapy of an immune checkpoint inhibitor but without a Her2-targeted agent. In some embodiments, the subject has not received therapy of other EGFR or HER2 Exon 20 insertion mutation-selective tyrosine kinase inhibitor (TKI). In some embodiments, the subject has not received therapy of other EGFR or HER2 Exon 20 mutation-selective tyrosine kinase inhibitor (TKI). [0106] Another aspect is directed to a method of treating or preventing CNS metastases in a subject, wherein the subject has been diagnosed to have a cancer.
  • the method includes administering a therapeutically effective amount of poziotinib or a pharmaceutically acceptable salt thereof to the subject in need thereof.
  • the CNS metastases is brain metastases.
  • the cancer is non-small cell lung cancer (NSCLC).
  • NSCLC non-small cell lung cancer
  • the subject has been determined to have CNS metastases. In some embodiments, the subject has been determined to have no CNS metastases.
  • the subject has been determined to have EGFR Exon 20 insertion mutation at one, two, three or more locations selected from the group consisting of 762E, 763A, 764Y, 765V, 766M, 767A, 768S, 769V, 779D, 771N, 772P, 773H, 774V, and 775C.
  • the subject has been determined to have EGFR Exon 20 insertion mutation at one or more locations selected from the group consisting of 767A, 768S, 769V, 770D, 771N, and 772P.
  • the subject has been determined to have one or more EGFR Exon 20 insertion mutations selected from the group conisiting of M766_A767insASV, A767insASV, A767insTLA, A767_V769dupASV, V769_D770insASV, V769_D770insGSV, V769_D770insGVV, V769_D770insSAVS, V769_D770insSLRD, V769_H773>LDNPNPH, V769_D770insE, V769_D770insGTV, V769_D770insGVM, V769_N771dupVDN, D770_N771insSVD, D770>GY, D770_N771insG, D770_N771insY, D770_N771insNPG, N771_P772insT, D770_N771insGL,
  • the patient or the subject has been treated with one, two, three or more lines of therapy before the treatment with poziobinib or a pharmaceutically acceptable salt thereof.
  • therapy or treatment for nsclc include stereotactic body radiotherapy, chemotherapy, radiation therapy, and drug therapy.
  • the patient or the subject has not previously received treatment with a EGFR tyrosine kinase inhibitor.
  • poziotinib or a pharmaceutically acceptable salt thereof is administered as the first line of therapy.
  • the subject has previously received treatment with a EGFR tyrosine kinase inhibitor.
  • the patient or the subject has previously received treatment with a EGFR tyrosine kinase inhibitor selected from the group consisting of gefitinib, erlotinib, afatinib, dacomitinib, and osimertinib.
  • a EGFR tyrosine kinase inhibitor selected from the group consisting of gefitinib, erlotinib, afatinib, dacomitinib, and osimertinib.
  • the poziotinib or pharmaceutically acceptable salt thereof is administered at a daily dose of 8 mg, 10 mg, 12 mg, or 16 mg.
  • the subject has been diagnosed to have a cancer and HER2 exon 20 insertion mutations.
  • the HER2 Exon 20 mutations are selected from the group consisting of A775_G776insYVMA, G776_V777insVC, and P780_Y781insGSP.
  • the subject has been determined to have CNS metastases.
  • the subject has been determined to have no CNS metastases.
  • the CNS metastases is brain metastases.
  • the subject has received at least one, at least two, or at least three lines of therapy for the NSCLC.
  • the subject has received a therapy selected from Her2-targeted agent, non-exon 20 insertion-selective tyrosine kinase inhibitor, immune checkpoint inhibitor, radiation therapy, hormone therapy, targeted therapy, stem cell transplant, precision medicine, and other other chemotherapy. In some embodiments, the subject has received chemotherapy only. In some embodiments, the subject has received a therapy of Her2-targeted agent. In some embodiments, the subject has received therapy of an immune checkpoint inhibitor. In some embodiments, the subject has received therapy of an immune checkpoint inhibitor but without a Her2-targeted agent.
  • the subject has not received therapy of other EGFR or HER2 Exon 20 insertion mutation-selective tyrosine kinase inhibitor (TKI).
  • Another aspect is directed to a method of reducing adverse events in treating a subject with cancer.
  • the method includes administering twice or three time or more a day a therapeutically effective amount of poziotinib or a pharmaceutically acceptable salt thereof to the subject in need thereof, wherein the daily dosage of poziotinib or a pharmaceutically acceptable salt thereof ranges from about 10 mg to about 20 mg.
  • Nonlimiting examples of adverse events include diarrhea, rash, stomatitis, and pneumonitis.
  • the adverse event is grade 3 or higher level.
  • the cancer is lung cancer or breast cancer.
  • the cancer is non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC).
  • NSCLC non-small cell lung cancer
  • SCLC small cell lung cancer
  • the method also effectively reduces drug interruptions. Drug interruption is one or more days of a drug-free period after continuous daily administration of the drug. A medical professional is able to determine whether a drug interruption is necessary based on factors such as side effect, toxicity and other factors. In some embodiments, the method reduces drug interruption by at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or at least 55% in comparison with same daily dosage of QD (once a day) administration.
  • the method prolongs the length to first drug interruption with median days to first interruption ranging from 10 to 50 days including for example at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29 and at least 30 days.
  • the method provides delayed first interruption by 1-20 days including at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, and at least 12 days in comparison with same daily dosage of QD (once a day) administration.
  • the method provides median days to first dose reduction of at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or at least 60 days.
  • the cancer is non- small cell lung cancer (NSCLC).
  • NSCLC non- small cell lung cancer
  • poziotinib or a pharmaceutically acceptable salt thereof is administered once, twice or three times a day at a daily dosage ranging from about 10 mg to about 24 mg including 12, 13, 14, 15, and 16 mg. In some embodiments, the daily dosage is about 16 mg.
  • poziotinib or a pharmaceutically acceptable salt thereof is administered once a day.
  • poziotinib or a pharmaceutically acceptable salt thereof is administered twice a day (10 mg BID) at a daily dosage of 20 mg. In some embodiments, poziotinib or a pharmaceutically acceptable salt thereof is administered twice a day (9 mg BID) at a daily dosage of 18 mg. In some embodiments, poziotinib or a pharmaceutically acceptable salt thereof is administered twice a day (8 mg BID) at a daily dosage of 16 mg. In some embodiments, poziotinib or a pharmaceutically acceptable salt thereof is administered twice a day (7 mg BID) at a daily dosage of 14 mg.
  • poziotinib or a pharmaceutically acceptable salt thereof is administered twice a day (6 mg BID) at a daily dosage of 12 mg. In some embodiments, poziotinib or a pharmaceutically acceptable salt thereof is administered twice a day (5 mg BID) at a daily dosage of 10 mg. [0115] In some embodiments of any method disclosed herein, the subject has not previously received a systemic treatment (e.g. chemotherapy, radiotherapy, gene therapy, surgery, hormonal therapy, anti-angiogenic therapy or immunotherapy) for the cancer. In some embodiments, poziotinib or a pharmaceutically acceptable salt thereof is administered as a first line of therapy.
  • a systemic treatment e.g. chemotherapy, radiotherapy, gene therapy, surgery, hormonal therapy, anti-angiogenic therapy or immunotherapy
  • the subject has previously received at least one, at least two, at least three, at least four, at least five, at least six, at least seven or more lines of therapy for the cancer.
  • the subject has previously received treatment with a HER2 or EGFR tyrosine kinase inhibitor.
  • with the subject has been diagnosed to have EGFR or HER2 exon 20 insertion mutations.
  • there may include a step or process of predicting efficacy of a tyrosine kinase inhibitor (TKI) for the treatment of cancer in a subject.
  • TKI tyrosine kinase inhibitor
  • the method includes determining whether the subject has a P-loop and ⁇ -C-helix compressing (PACC) mutation at interior surface of ATP binding pocket and c-terminal of the ⁇ -c-helix within exons 18-21.
  • PACC mutations have been observed to be sensitive/responsive to treatment with second-generation inhibitors, including poziotinib, afatinib, dacomitinib and pharmaceutically acceptables thereof.
  • PAPC mutations are often not responsive to first-generation EGFR TKIs (gefitinib, erlotinib and icotinib) or third-generation TKIs (e.g.
  • this disclosure further provides a method of treating cancer in a subject using a TKI.
  • the method comprises: (a) identifying a subject having one or more P-loop and ⁇ -C-helix compressing (PACC) mutations at interior surface of ATP binding pocket and c-terminal of the ⁇ -c-helix within exons 18-21 of EGFR or HER2 as likely to benefit from treatment using the TKI selected from poziotinib, afatinib, dacomitinib and pharmaceutically acceptable salts thereof; and (b) administering to the subject an therapeutically effective amount of the TKI, thereby the cancer is treated.
  • PACC P-loop and ⁇ -C-helix compressing
  • the PACC mutation comprises one or more mutations at the position 719, 747, 768, 792, and 854. In some embodiments, the PACC mutation comprises one or more muations at the position G719, L747, S768, L792, and T854 of EGFR. In some embodiments, the PACC mutation comprises one or more muations selected from G719A, G719S, L747P, S768I, S768dupSVD, L792H, and T854I of EGFR. [0119] In some embodiments, the subject has one or more acquired mutations at position L718, V765, and C797 of EGFR, such as L718X, V765X, and C797X.
  • the one or more acquired mutations comprise one or more mutatioins selected from L718V, V765L, and C797S of EGFR.
  • X can be A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W or Y.
  • the subject has one or more mutations of L858R/T790M/C797S, Ex19del/T790M/C797S, L858R/T790M/L718Q, L858R/T790M/L718V, L718O/T790M, Ex19del/T790M/L792H, Ex19del/T790M/L711M, G724S/T790M, T790M, Ex190del/T790M/G724S, S7681/T790M, T790M, Ex19del/T790M/G724S, S7681/T790M, L858R/T790M/L792H, Ex19del/L792H, G719B/T790M, G719A/T790M, L858R/T790M/V843I, L
  • the subject has one or more mutations of Ex19del/792H, Ex19del/G796S, Ex19del/T854S, Ex19del/T854I, L858R/L718Q, Ex19del/L718Q, L858R/C797S, Ex19del/C797S, L858R/L718V, L858R/L792H, Ex19del/L718V, L858R/S784F, L858R/V834L, L858R/G724S.
  • the subject has one or more mutations of L858R/T790M/C797S, Ex19del/T790M/C797S, L858R/T790M/L718Q, L858R/T790M/L718V, L718Q/T790M, Ex19del/790M/L792H, Ex19del/790M/L718V, G724S/T790M, S768I/T790M, T790M, Ex19del/T790M/G724S, L858R/T790M/843I, L858R/T790M, Ex19del/T790M, G719A/T790M, L858R/T790M/792H, L747_K754dellnsATSPE.
  • the subject has one or more mutations of E709_T710delinsD, E709A, E709A/G719S, E709K, E709K/G719S, G719A, G719A/L861Q, G719A/R776C, G719A/T790M, G719S, G719S/T790M, G724S, G724S/T790M, L718Q, L718Q/T790M, L178Q, L718Q/T790M, L718V, S720P, T725M, D761N, Ex19del, Ex19del/C797S, Ex19del/G724S, Ex19del/G796S, Ex19del/L718Q, Ex19del/L718Q, Ex19del/L718V, Ex19del/L792H
  • the subject has one or more mutations of A763insFQEA, A769InsLQEA, D761N, E709K/L858R, Ex19del, K754E, L833F, L833V, L858R, L858R/S784F, L858R/N834L, L861Q, L861R, S720P, S784F, S811F, T725M, A767insASV, D770insNPG, H773insNPH, N771dupN, N771dupN/G724S, S768dupSVD, S768dupSVD/V789M, E709_T710delinsD, E709K, E709K/G719S, Ex19del/C797S, Ex19del/G724S, Ex19del/G796S,
  • the methods further including administering to the subject one, two, three or more of the anticancer agents disclosed herein or therapies including chemotherapy, biologics, immunotherapy, HER2 targeted therapy, or curative-intent radiotherapy for the treatement of the cancer.
  • poziotinib or a pharmaceutically acceptable salt thereof is administered to a subject in need thereof as a first line therapy.
  • the subject has received one, two, three or more of the above disclosed therapies or anti-cancer agents.
  • the cancer has developed resistance to one or more therapies, including for example, one, two, three or more anti-cancer agents described herein.
  • the subject has not received therapy of other EGFR or HER2 Exon 20 mutation-selective tyrosine kinase inhibitor (TKI).
  • HER2-targeted agents include trastuzumab, pertuzumab, lapatinib, neratinib, SYD985 and trastuzumab emtansine (T-DM1), and antibody- drug conjugate thereof (e.g. Trastuzumab duocarmazine).
  • checkpoint inhibitors include those that target PD-1, PD-L1, CTLA4 and TIGIT (T cell immunoglobulin and ITIM domain).
  • Ipilimumab (Yervoy®; blocking a checkpoint protein called CTLA-4); pembrolizumab (Keytruda®), Cemiplimab (Libtayo) and nivolumab (Opdivo®) (targeting another checkpoint protein called PD-1); atezolizumab (Tecentriq®), Avelumab (Bavencio), and Durvalumab (Imfinzi) (targeting PD-L1); MK-7684, Etigilimab /OMP-313 M32, Tiragolumab/MTIG7192A/RG-6058, BMS-986207, AB-154 and ASP-8374 (targeting TIGIT), and V-domain Ig suppressor of T cell activation (VISTA).
  • VISTA V-domain Ig suppressor of T cell activation
  • Non-limiting examples of tyrosine kinase inhibitors as chemotherapy include erlotinib, gefitinib, afatinib, dacomitinib and osimertinib.
  • Further non-limiting examples of the chemothrapy include alkylating agents: Busulfan, dacarbazine, ifosfamide, hexamethylmelamine, thiotepa, dacarbazine, lomustine, chlorambucil, procarbazine, altretamine, estramustine phosphate, mechlorethamine, streptozocin, temozolomide, Semustine cyclophosphamide; platinum agents: spiroplatin, tetraplatin, ormaplatin, iproplatin, ZD-0473 (AnorMED), oxaliplatin carboplatin, lobaplatin (Aeterna), satraplatin (Johnson Matthey), BBR-
  • Vistusertib everolimus/Afinitor, rapamycin, dactolisib, BGT226, SF1126, PKI-587, NVPBE235) and Pan-HER inhibitor (e.g. afatinib, neratinb, AC480).
  • Pan-HER inhibitor e.g. afatinib, neratinb, AC480.
  • the agent for chemotherapy is selected from bevacizurnab, bortezomib, capecitabine, cetuximab, fluorouracil, imatinib, irinotecan, leucovorin, oxaliplatin, panitumumab, pemetrexed, temozolomide, cisplatin, paclitaxel, erlotinib, sunitinib, lapatinib, sorafenib, carboplatin, doxorubicin, docetaxel, gemcitabine, etoposide, gefitinib, PD153035, cetuximab, bevacizumab, panitumumab, trastuzumab, anti-c- Met antibodies, gefitinib, ZD6474, EMD-72000, pariitumab, ICR-62, CI-1033, lapatinib, AEE788, EKB-569
  • agent for chemotherapy examples include SHP2 inhibitors (e.g. RMC-4550 and RMC-4630), phosphatase inhibitors (e.g. Tautomycin), CDK 4/6 inhibitors (abemaciclib (Lilly), palbociclib (Pfizer)), protein-protein interaction disruptors (BI 1701963), HSP90 inhibitor, tubulin inhibitor, apoptosis inhibitor, chemopreventative agent, and therapies targeting PBK/AKT/mTOR pathway.
  • SHP2 inhibitors e.g. RMC-4550 and RMC-4630
  • phosphatase inhibitors e.g. Tautomycin
  • CDK 4/6 inhibitors abemaciclib (Lilly), palbociclib (Pfizer)
  • protein-protein interaction disruptors BI 1701963
  • HSP90 inhibitor tubulin inhibitor
  • apoptosis inhibitor chemopreventative agent
  • therapies targeting PBK/AKT/mTOR pathway therapies targeting PBK/AKT/mTOR
  • ADCs Antibody–drug conjugates
  • MAbs monoclonal antibodies
  • This approach combines the high specificity of MAbs against their antigen targets with highly potent cytotoxic drugs, resulting in “armed” MAbs that deliver the payload (drug) to tumor cells with enriched levels of the antigen. Targeted delivery of the drug also minimizes its exposure in normal tissues, resulting in decreased toxicity and improved therapeutic index.
  • ADCETRIS® birentuximab vedotin
  • KADCYLA® tacuzumab emtansine or T-DM1
  • cytokine therapy e.g., interferons ⁇ , ⁇ , and ⁇ , IL-1, GM-CSF, and TNF
  • gene therapy e.g., TNF, IL-1, IL-2, and p53 (Qin et al., 1998; Austin-Ward and Villaseca, 1998; U.S.
  • Patents 5,830,880 and 5,846,945) ; and monoclonal antibodies, e.g., anti-CD20, anti-ganglioside GM2, and anti-p185 (Hollander, 2012; Hanibuchi et al., 1998; U.S. Patent 5,824,311). It is contemplated that one or more anti- cancer therapies may be employed with the antibody therapies described herein. [0134] It is contemplated that other agents may be used in combination with certain aspects of any embodiment disclosed herein to improve the therapeutic efficacy of treatment.
  • additional agents include agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers, or other biological agents. Increases in intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperproliferative cell population.
  • cytostatic or differentiation agents can be used in combination with certain aspects of the present embodiments to improve the anti- hyperproliferative efficacy of the treatments.
  • Inhibitors of cell adhesion are contemplated to improve the efficacy of the present embodiments.
  • cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody c225, could be used in combination with certain aspects of the present embodiments to improve the treatment efficacy.
  • FAKs focal adhesion kinase
  • Lovastatin a cell adhesion inhibitors
  • other agents that increase the sensitivity of a hyperproliferative cell to apoptosis such as the antibody c225, could be used in combination with certain aspects of the present embodiments to improve the treatment efficacy.
  • Poziotinib, or a pharmaceutically acceptable salt thereof for the methods described herein may be administered to the subject by any suitable means.
  • Non-limiting examples of methods of administration include, among others, (a) administration though oral pathways, which administration includes administration in capsule, tablet, granule, spray, syrup, or other such forms; (b) administration through non-oral pathways such as rectal, vaginal, intraurethral, intraocular, intranasal, or intraauricular, which administration includes administration as an aqueous suspension, an oily preparation or the like or as a drip, spray, suppository, salve, ointment or the like; (c) administration via injection, subcutaneously, intraperitoneally, intravenously, intramuscularly, intradermally, intraorbitally, intracapsularly, intraspinally, intrasternally, or the like, including infusion pump delivery; as well as (d) administration topically; as deemed appropriate by those of skill in the art for bringing the active compound into contact with living tissue.
  • Poziotinib, or a pharmaceutically acceptable salt thereof for administrations described above are prepared into dosage forms in a unit dose suited to fit a dose of the active ingredients.
  • dosage forms in a unit dose include, for example, tablets, pills, capsules, injections (ampoules), suppositories, etc.
  • the composition can be a tablet, coated tablet, capsule, caplet, cachet, lozenges, gel capsule, hard gelatin capsule, soft gelatin capsule, troche, dragee, dispersion, powder, granule, pill, liquid, an aqueous or non-aqueous liquid suspension, an oil- in-liquid or oil-in-water emulsion, including sustained release formulations that are known in the art.
  • suspensions, syrups and chewable tablets are especially suitable.
  • the therapeutically effective amount of Poziotinib, or a pharmaceutically acceptable salt thereof required as a dose will depend on the route of administration, the type of subject, including human, being treated, and the physical characteristics of the specific subject under consideration.
  • the dose can be tailored to achieve a desired effect, but will depend on such factors as weight, diet, concurrent medication and other factors which those skilled in the medical arts will recognize.
  • a therapeutically effective amount means an amount of compound effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
  • dosages may range broadly, depending upon the desired effects and the therapeutic indication. Typically, dosages may be about 10 microgram/kg to about 100 mg/kg body weight, preferably about 100 microgram/kg to about 10 mg/kg body weight. Alternatively dosages may be based and calculated upon the surface area of the patient, as understood by those of skill in the art. [0140] The exact formulation, route of administration and dosage for Poziotinib, or a pharmaceutically acceptable salt thereof can be chosen by the individual physician in view of the patient’s condition. (see e.g., Fingl et al.
  • the dose range of Poziotinib, or a pharmaceutically acceptable salt thereof administered to the subject or patient can be from about 0.5 to about 1000 mg/kg of the patient’s body weight.
  • the dosage may be a single one or a series of two or more given in the course of one or more days, as is needed by the patient.
  • those same dosages, or dosages that are about 0.1% to about 500%, more preferably about 25% to about 250% of the established human dosage may be used.
  • the attending physician would know how to and when to terminate, interrupt, or adjust administration due to toxicity or organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxicity).
  • the magnitude of an administrated dose in the management of the disorder of interest will vary with the severity of the condition to be treated and to the route of administration. The severity of the condition may, for example, be evaluated, in part, by standard prognostic evaluation methods. Further, the dose and perhaps dose frequency will also vary according to the age, body weight, and response of the individual patient. A program comparable to that discussed above may be used in veterinary medicine.
  • the daily dosage regimen for an adult human patient may be, for example, an oral dose of about 0.1 mg to 2000 mg of the active ingredient, preferably about 1 mg to about 500 mg, e.g. 5 to 200 mg.
  • an intravenous, subcutaneous, or intramuscular dose of the active ingredient of about 0.01 mg to about 100 mg, preferably about 0.1 mg to about 60 mg, e.g. about 1 to about 40 mg is used.
  • dosages may be calculated as the free acid.
  • Poziotinib, or a pharmaceutically acceptable salt thereof is administered 1 to 4 times per day.
  • Poziotinib, or a pharmaceutically acceptable salt thereof may be administered by continuous intravenous infusion, preferably at a dose of up to about 1000 mg per day.
  • Poziotinib, or a pharmaceutically acceptable salt thereof will be administered for a period of continuous therapy, for example for a week or more, or for months or years.
  • Poziotinib, or a pharmaceutically acceptable salt thereof is formulated into a dosage form for release for a period of 1 to 12, typically 3 to 12 hours, more typically 6-12 hours after administration.
  • the oral pharmaceutical compositions described herein may be administered in single or divided doses, from one to four times a day.
  • the oral dosage forms may be conveniently presented in unit dosage forms and prepared by any methods well known in the art of pharmacy.
  • the subject has a dose reduction of about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, or about 40% within cycle 1, within cycle 2, within cycle 3, within cycle 4, within cycle 5, within cycle 6, within cycle 7, within cycle 8, within cycle 9, within cycle 10, within cycle 11, within cycle 12, within cycle 13, within cycle 14, within cycle 15, or within cycle 16.
  • Each cycle is 5-day, 7-day, 10-day, 12-day, 14-day or 20-day period.
  • Poziotinib, or a pharmaceutically acceptable salt thereof can be evaluated for efficacy and toxicity using known methods.
  • the toxicology of the compound may be established by determining in vitro toxicity towards a cell line, such as a mammalian, and preferably human, cell line.
  • mice, rats, rabbits, or monkeys may be determined using known methods.
  • the efficacy of a particular compound may be established using several recognized methods, such as in vitro methods, animal models, or human clinical trials. Recognized in vitro models exist for nearly every class of condition. Similarly, acceptable animal models may be used to establish efficacy of chemicals to treat such conditions. When selecting a model to determine efficacy, the skilled artisan can be guided by the state of the art to choose an appropriate model, dose, and route of administration, and regime.
  • Poziotinib, or a pharmaceutically acceptable salt thereof may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may for example comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the pack or dispenser may also be accompanied with a notice associated with the container in form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the drug for human or veterinary administration.
  • compositions comprising Poziotinib, or a pharmaceutically acceptable salt thereof formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
  • the specific dose level for any particular patient will depend upon a variety of factors including for example the stage and severity of the cancer being treated; the activity of the poziotinib as formulated in the pharmaceutical composition; the specific pharmaceutical composition employed; the age, body weight, general health, sex, and diet of the subject in need thereof; the time of administration; the prescribed number of doses per administration; the duration of the treatment; the side effects of poziotinib or a pharmaceutically acceptable salt thereof and the tolerability of individual patient; drugs used in combination or coincidental with the specific pharmaceutical composition employed; and like factors well known in the medical arts.
  • Poziotinib or a pharmaceutically acceptable salt thereof can be administered to a NSCLC patient via routes such as intravenous (IV) infusion and oral administration.
  • poziotinib or a pharmaceutically acceptable salt thereof is administered via oral route.
  • Poziotinib or a pharmaceutically acceptable salt thereof can be administered once, twice, or three times a day or as needed within a 24 hour period.
  • the daily dose ranges from about 1 to about 25 mg, from about 5 to about 25 mg, from about 2 to about 20 mg, from about 5 to about 15 mg.
  • the daily dose is about 2, about 4, about 6, about 8, about 10, about 12, about 16 or about 18 mg.
  • Example [0150] Example 1 [0151] Use of Poziotinib in Patients with NSCLC, Locally Advanced or Metastatic, with EGFR or HER2 Exon 20 Insertion Mutation. [0152] To evaluate the efficacy and the safety/tolerability of poziotinib in NSCLC patients, a study protocol including seven (7) patient cohorts has been designed. Each treatment cycle is 28 calendar days in duration.
  • Eligible patients were enrolled into seven cohorts in parallel based on EGFR or HER2 exon 20 mutation status and prior treatment status: [0153]
  • 115 patients were enrolled that were previously treated with at least one prior systemic treatment for locally advanced or metastatic NSCLC and have documented EGFR exon 20 insertion mutation positive NSCLC using a sequencing diagnostic test such as OncoMine Comprehensive Assary (OCA) or Foundation One Assay or any other such tests known in the art.
  • OCA OncoMine Comprehensive Assary
  • 90 patients were enrolled that were previously treated with one prior systemic treatment for locally advanced or metastatic NSCLC and have a documented HER2 exon 20 insertion mutation positive NSCLC using a sequencing diagnosic tests as described above for Cohort 1.
  • the fifth Cohort included patients who meet the criteria for enrollment in Cohorts 1 to 4.
  • the sixth Cohort included patients with acquired EGFR mutation who progressed while on treatment with first-line osimertinib and in the 7 th Cohort 30 patients with EGFR or HER2 activating mutations who had at least one priory treatment for locally advanced or metastatic NSCLC are added to undergo treatment.
  • Cohort 5 Patients who meet the criteria for enrollment in Cohorts 1 to 4, but the enrollment in the respective cohort has been closed where then enrolled in Cohort 5.
  • Cohort 6 Patients with EGFR mutation-positive NSCLC who progressed while on treatment with first-line osimertinib.
  • Cohort 7 Patient has had at least one prior systemic treatment for locally advanced or metastatic NSCLC [0157] Tissue and plasma samples for mutation confirmation were assessed according to the following procedural steps:
  • Cohorts 1 to 5 Patient has adequate tumor tissue obtained from a biopsy or surgical procedure to enable molecular profiling for retrospective central laboratory confirmation of the mutation.
  • Cohort 6 A tissue sample must be provided after osimertinib progression
  • Cohort 7 Either tissue or plasma samples are acceptable for enrollment [0158] Patients were determined to be positive for EGFR or HER2 mutations based on the following criteria: • Cohorts 1 and 3: Documented EGFR exon 20 insertion mutation (including duplication mutations) using a next generation sequencing diagnostic test, such as OncoMine Comprehensive Assay (OCA) or FoundationOne Assay, or by an FDA approved test (eg, cobas® EGFR mutation test v2 or therascreen EGFR RGQ PCR kit) performed by a US CLIA certified and locally licensed clinical laboratory or similarly accredited lab for ex-US sites using tissue samples • Cohorts 2 and 4: Documented HER2 exon 20 insertion mutation (including duplication mutations) using a next generation sequencing diagnostic test, such as OncoMine Comprehensive Assay (OCA) or FoundationOne Assay, or by an FDA approved test (eg, cobas® EGFR mutation test v
  • Brain metastases were allowed if patient’s condition is stable, defined asymptomatic, no requirement for high dose or increasing dose of systemic corticosteroids, and no need for any anticonvulsant therapy for metastatic brain disease.
  • sequential post-treatment MRI tests at least 4-6 weeks apart, should show no increases in brain lesion size/volume within 4 weeks prior to the study.
  • patient who had an Eastern Cooperative Oncology Group (ECOG) performance status 0 or 1 and has a life-expectancy of more than 6 months were permitted.
  • EOG Eastern Cooperative Oncology Group
  • TKI tyrosine kinase inhibitor
  • the study also excluded those patients who were concurrently receiving chemotherapy, biologics, immunotherapy for cancer treatment; systemic anti-cancer treatment or investigational treatment within 2 weeks prior to the Cycle 1, Day 1. Yet local radiation therapy for bone pain was allowed.
  • CHF congestive heart failure
  • NYHA New York Heart Association
  • ECHO echocardiogram
  • MUGA multi- gated acquisition
  • Toxicity associated with the treatment was assessed based on the severity grade of the adverse events using CTCAE version 4.03.
  • the duration of study was approximately 2 years and participation for each patient, in general, included the following segments: (a) Screening Period: up to 30 days; (b) Treatment Period: 28 days per cycle until 24 months of treatment, disease progression (except for first progression in Cohort 5), death, intolerable adverse events (AEs), or other protocol- specified reasons for patient withdrawal, (c) Safety Follow-up Visit: 35 ( ⁇ 5) days after the last dose of poziotinib.
  • Tumor assessments was performed at 4 weeks (Cycle 2, Day 1 [up to Cycle 2, Day 7]), 8 weeks (Cycle 3, Day 1 [up to Cycle 3, Day 7, with at least 28 days from previous tumor assessment]), and then every 8 weeks ( ⁇ 7 days) until disease progression (except for first progression in Cohort 5), death, intolerable adverse events (AEs), or other protocol- specified reasons for patient withdrawal.
  • Each subsequent tumor assessment used the same Baseline radiographic technique, either CT, PET/CT, or MRI. Tumor assessments will be made according to RECIST criteria, Version 1.1 (European journal of cancer (Oxford, England: 1990). 2009;45(2): 228-47) using appropriate radiographic imaging or other techniques. For radiographic assessment, CT, PET/CT, or MRI must be performed at every assessment. Patient enrollment and clinical decisions were based on local review and the efficacy assessments.
  • Tissue Samples [0171] Tissue Samples [0172] Once patients were enrolled based upon confirmation of mutational status from the results of a tissue-based test such as OncoMine Comprehensive Assay (OCA) or FoundationOne Assay, or by an FDA approved test (eg, Cobas EGFR mutation test v2 or therascreen EGFR RGQ PCR kit) performed by a US CLIA certified and locally licensed clinical laboratory or similarly accredited lab for ex-US sites using tissue samples, they were stratified based on the documentation of mutation as noted below: • Cohorts 1 and 3: Documented EGFR exon 20 insertion mutation, including D770_N771insSVD, D770_N771insNPG, V769_D770insASV, H773_V774insNPH, or any other EGFR exon 20 in-frame insertion mutation (including duplications).
  • OCA OncoMine Comprehensive Assay
  • FoundationOne Assay FoundationOne Assay
  • FDA approved test eg, Co
  • Cohorts 2 and 4 Documented HER2 exon 20 insertion mutation, including A775_G776insYVMA, G776_V777insVC, or P780_Y781insGSP, or any other HER2 exon 20 in-frame insertion mutation (including duplications).
  • Cohort 5 Documented EGFR or HER2 exon 20 insertion mutations using tissue samples using the criteria described for Cohorts 1 to 4
  • Cohort 6 Documented acquired EGFR mutation who have progressed while on first- line osimertinib treatment using tissue tested with a next-generation sequencing assay.
  • Cohort 7 Documented EGFR or HER2 activating mutations (see table 1 for reference) using tissue tested with a next-generation sequencing assay or plasma tested with a Guardant assay.
  • Tissue samples acquired prior to Cycle 1, Day 1 during the screening period were sent for retrospective central laboratory confirmation of receptor mutations and for companion diagnostic development. If possible, tumor tissue samples from a biopsy when progression occurs during the study should be collected. This is not mandatory, but it is highly encouraged.
  • plasma samples were collected at Screening, at each imaging session, beginning at the 8-week imaging session, and if the patient progresses for biomarker analysis (optional).
  • Plasma samples were not to be used for eligibility verification in Cohorts 1 to 6 but are allowed for eligibility verification for Cohort 7 if a tissue sample is not available.
  • Whole blood samples were collected once at Screening for pharmacogenomic analysis.
  • All patients had blood samples drawn pre-dose and at 1 hour and 3 hours ( ⁇ 15 min) post-dose for sparse PK sampling and time-matched concentration-QT analysis on Day 1 of Cycle 1 and pre-dose on Day 1 of Cycle 2 for time-matched concentration-QT analysis.
  • a 12-lead ECG were performed at Screening, on Cycle 1, Day 1 (pre-dose), 1 hour and 3 hours after dosing, and on Cycle 2, Day 1 (pre- dose) for time-matched concentration-QT analysis, and at the patient’s Safety Follow-up Visit.
  • an ECG would have been performed at the clinic visit. All ECGs were sent for central analysis.
  • cardiac ejection fractions were assessed by either echocardiogram or multi-gated acquisition (MUGA) scan at Screening, or subsequetly if so needed based on the standard of care as determined by the Investigator.
  • MUGA multi-gated acquisition
  • Premedications (such as antiemetics) used for supportive care were allowed as per institutional standards or guidelines and Investigator discretion. Other supportive and palliative therapies were also allowed during the study upon prior authorization from Sponsor’s Medical Monitor.
  • poziotinib is a substrate for cytochrome P450 (CYP) 3A4 and 2D6 enzymes, patients who were taking medications that are strong inhibitors or inducers of these two enzymes (see Table below) would have been assessed for te plasma concentration of poziotinib.
  • Poziotinib is also a moderate inhibitor of CYP2C8 and CYP2D6, so patients who take medications that are sensitive substrates for these two enzymes (see Table below) should be followed closely for possible changes in the patient’s response to these medications. Patients should be advised that grapefruit juice and St. John’s Wort should be avoided during the study treatment. [0183] Side effects were managed according to the appropriate standare of care. For example for diarrhea, suitable medications such as loperamide were supplied for management. Diarrhea was monitored very closely and was managed per standard of care as determined by the Investigators or Institutional Guidelines. Other side effects such as mucositis/stomatitis were treated in a supportive manner aiming to control symptoms.
  • Prophylactic methods to reduce or prevent mucositis/stomatitis including for example: (a) avoidance of spicy, acidic, or irritating foods and alcoholic drinks, (b) use of solutions such as saline (diluted solution with salt water and baking soda by dissolving 1 /2 teaspoon of salt and 1 teaspoon of baking soda in approximately 1 liter of water) and using this solution every 4 hours, (c) use of Nystatin solution or other combinations of mouthwash.
  • solutions such as saline (diluted solution with salt water and baking soda by dissolving 1 /2 teaspoon of salt and 1 teaspoon of baking soda in approximately 1 liter of water) and using this solution every 4 hours, (c) use of Nystatin solution or other combinations of mouthwash.
  • No additional cytotoxic agents, biologic therapy, or immune response modifiers for cure-intent purpose are to be administered to patients until study treatment has been discontinued.
  • In vitro studies have shown that the solubility of poziotinib is pH dependent.
  • Poziotinib is highly soluble at acidic pH, its solubility is significantly reduced at neutral or basic pH. Although the effect of pH on systemic exposure of poziotinib has not been established, based on the solubility profile, it is quite likely that the absorption of poziotinib could be lower at higher pH. Because proton pump inhibitors (PPIs), H2 histamine receptor antagonists and antacids increase the gastric pH, we recommend that if possible, concomitant administration of long-acting PPIs or H2 receptor antagonists with poziotinib should be avoided, which is similar to the instructions for other TKIs.
  • PPIs proton pump inhibitors
  • H2 histamine receptor antagonists and antacids increase the gastric pH
  • poziotinib administration and Dose Modification
  • the poziotinib drug substance was a hydrochloride salt of poziotinib which is formulated as a tablet for oral administration.
  • Poziotinib tablets were supplied in 2.0 mg and 8.0 mg dose strengths. Poziotinib was taken by the patient orally, once daily with food and a glass of water at approximately the same time each morning according to the schedule for each cohort during each 28-day cycle.
  • the missed dose may be administered any time during the day preferably with food, at least 8 hours prior to the next scheduled dose.
  • patients received a dose of poziotinib16 mg, once a day (QD). All eleigible patients entering Cohort 5 were randomized in a 1:1:1 ratio to starting doses of 10 mg, 12 mg, or 16 mg QD. If a treatment group was stopped for futility, all newly enrolled patients would be re-randomized to the continuing dose group (10 mg or 12 mg) or 16 mg treatment group if on such dose.
  • Adverse Events and Safety Measures [0190] An Adverse Event (AE) is defined as any untoward medical occurrence in a patient or clinical investigation patient, temporally associated with the use of a medicinal product, whether or not considered related to the medicinal product.
  • an AE can be any unfavorable and unintended sign (including an abnormal laboratory finding), symptom, or disease (new or exacerbated) temporally associated with the use of a medicinal product.
  • a treatment-emergent AE (TEAE) is any AE that occurs from the first dose of study treatment until 35 ( ⁇ 5) days after the last dose of study treatment.
  • adverse events were assessed by the investigators and were characterized by intensity (severity), causality, and seriousness based on the applicable regulatory definitions utilizing the National Cancer Institute (NCI) Common Terminology Criteria for Adverse Events (CTCAE) Scale Version 4.03 for AE grading.
  • AEs include: (a) Exacerbation of a chronic or intermittent pre-existing condition including either an increase in frequency and/or intensity of the condition, (b) New conditions detected or diagnosed after investigational product administration, (c) Signs, symptoms, or the clinical sequelae of a suspected overdose of either investigational drug, a concurrent medication or a suspected drug interaction, (d) AEs may include pre-treatment or post-treatment events that occur as a result of protocol-mandated procedures (eg, invasive procedures).
  • protocol-mandated procedures eg, invasive procedures
  • Certain abnormal laboratory results were recorded as AEs, if any of the following conditions are met: (a) The abnormal laboratory value leads to a therapeutic intervention, (b) The abnormal laboratory value is considered to be clinically significant by the Investigator, and (c) The abnormal laboratory value is predefined as an AE in the protocol or in another document communicated to the Investigator by Spectrum or designee.
  • Examples of events that do not constitute AEs include but are not limited to: (a) Medical or surgical procedures (eg, endoscopy, appendectomy); the condition that leads to the procedure is an AE, (b) Anticipated day-to-day fluctuations of pre-existing disease(s) or condition(s) present or detected at the start of the study that do not worsen, and (c) Progressive disease.
  • the adverse events of special interest identified with poziotinib treatment include diarrhea, skin rash, oral cavity mucositis/stomatitis, fatigue, and vomiting/nausea. Guidelines for Recording and Attribution Scoring of Adverse Events were developed as provided.
  • the date of death should be the date of AE stop for all ongoing AEs at the time of death and
  • the outcome of the AE is to be followed for 35 ( ⁇ 5) days from the date of discontinuation or until the AE has returned to Grade ⁇ 1.
  • the status of the AE and the date of last contact with the patient will be captured. If the AE has not returned to Grade ⁇ 1 by the end of the study, the AE stop date should be left as ongoing.
  • Tumor assessments (by computed tomography [CT], positron emission tomography [PET]/CT, or magnetic resonance imaging [MRI]) were performed.
  • the response evaluation was performed using RECIST Criteria v1.1 by a blinded independent committee review (BICR), at screening, baseline, after approximately 4 and 8 weeks of treatment, and approximately every 8 weeks thereafter for up to 24 months.
  • BICR blinded independent committee review
  • consenting patients entered a long-term follow-up period to continue receiving treatment during which they were contacted every 3 months for up to 2 years following the first dose of poziotinib for survival assessment and to record serious adverse events (SAEs) if there was a suspected causal relationship to the study drug.
  • SAEs serious adverse events
  • the median time to response was 32 days (range: 23 to 183), median DoR was 5.1 months (95% CI: 4.2 to 5.5 months), median PFS was 5.5 months (95% CI: 3.9 to 6.2 months), and 24% had a DoR >6 months.
  • the median PFS for all patients was 5.5 months (95% CI: 3.9 to 5.8 months) and 37.8% of patients (95% CI: 25.5% to 50.0%) were progression-free and alive at 6 months.
  • Out of a subset of patients who had received prior CPI therapy (n 61), 16 (26.2%) were responders, indicating that the benefit of a new TKI was preserved. Twenty-five patients had received prior anti-HER2 therapy with at least one antibody or ADC agent, and all had prior chemotherapy.
  • trastuzumab and afatinib Three patients were treated previously with trastuzumab and afatinib, and 1 received prior trastuzumab and neratinib therapies. Among the 25, six patients achieved a PR (24.0%), including 2 patients who received prior trastuzumab and afatinib treatments. The patient with prior neratinib therapy had a reported tumor reduction, but the response status was not confirmed. [0205] Fourteen patients had known stable CNS metastases upon enrollment as identified by BICR. The ORR for these patients was 28.6%, with a median PFS of 7.4 months. One patient with two brain lesions at baseline was reported to have the absence of both brain lesions on more than two MRI scans.
  • CNS metastasis represents a clinical challenge for NSCLC, as these patients have a median overall survival of only 6 months and the 1, 2, and 3-year survival rates are 29.9%, 14.3%, and 8.4%, respectively.
  • Treatment-emergent AEs occurred in all patients.
  • 88 (97.8%) patients reported treatment-related AEs (TRAEs) with 73 (81.1%) having Grade 3 or 4 TRAEs.
  • Health-related quality of life was measured using EORTC Quality of Life Core30 (QLQ-C30) and Quality of Life Lung Cancer 13 questionnaire (QLQ-LC13), scored from 0-100 ( ⁇ 10 point change from baseline [Cycle 1 Day 1] considered clinically meaningful) QLQ-C30 functional and symptom scores were stable without deterioration during treatments.
  • QLQ-LC13 mean scores indicated meaningful improvement in cough (-16.5 to -13.9) from Cycle 2 to Cycle 7, and numerical improvement in dyspnea (between -8.7 to - 2.4) and chest pain (-6.9 to -5.5) were also maintained to cycle 7.
  • the duration of treatment ranged from 1 to 708 days (median, 112.5 days), with treatment being administered for 1 to 675 days (median, 86.5 days). Seven patients (7.8%) were on treatment for more than 12 months, and another 4 patients (4.4%) were treated for more than 9 months.
  • One patient who responded to the study drug from Week 4 and progressed at Week 64 by BICR review is still receiving treatment after 2 years due to SD as assessed by local review.
  • poziotinib has shown sustained response with better ORR in patients with 3 or more lines of therapy.
  • Common grade 3 TRAEs include diarrhea (26%), rash (28%), stomatitis (16%) and paronychia (6%).
  • higher response rate was observed in newar loop insertions that have higher prevalence.
  • ORR for patients with V769_D770insASV, D770_N771insSVD, and D770>GY insertions respectively were analyzed.
  • Meaningful response in patients with CNS metastases was also observed. Twelve of the patients had stable CNS metastases at baseline and 83% had no CNS progression.
  • FIG. 6 shows the comparison between baseline scan and on-treatment scan for a 66 year-old female patient, who never smoked before and was diagnosed with metastatic lung adenocarcinoma with brain, bone and pancreas metastases.
  • the tumor harbors EGFR 768_770dupSVD insertion. She had whole brain radiation and chemo-immunotherapy.
  • the patient subsequently started on poziotinib from September 2018.
  • the target lesions achieved stable disease with tumor size reduction (27%).
  • Her brain lesions were stable with decreasing size. She was on poziotinib from September 2018 to May 2019, and progressed due to liver metastasis.
  • Table 5 shows the efficacy of cohort 3 study, which demonstrated clinically meaningful activity in treatment-na ⁇ ve exon 20 mutant EGFR mNSCLC patients. Additioanl result in waterfall plot showing an estimated change from baseline in tumor volume is presented in Figure 7. Table 6 Efficacy data based on central review using RECIST 1.1 [0222] Cohort 5 enrolled patients with locally advanced or mNSCLC with EGFR or HER2 exon 20 insertion mutations. Patients were randomized to various arms: 10, 12, and 16 mg QD or 6 and 8 mg BID. Dose reductions were allowed in the presence of toxicity and patients were treated until death, disease progression or intolerable toxicity.
  • Inclusion criteria were as follows: • Histologically or cytologically confirmed NSCLC which is locally advanced or metastatic • Documented EGFR or HER2 exon 20 insertion mutation by a tissue next generation sequencing test • Received at least one prior systemic treatment for locally advanced or mNSCLC • Eastern Cooperative Oncology Group (ECOG) performance status 0 or 1 [0224] Exclusion criteria were as follows: • Previously treated with poziotinib or any other EGFR or HER2 exon 20 insertion mutation- selective TKI. • EGFR exon 20 point mutation [0225] Table 8 shows demographics and baseline characteristics of enrolled patients. Talbe 9 summarizes patient disposition.
  • Table 7 Initial Cohort 5 randomized to 10mg or 12mg or 16mg QD; amended to randomized to 6 or 8mg BID or 10mg QD Table 8 [0226]
  • Table 9 summarizes QD and BID dosing exposure and safety in cohort 5 clinical study. Reduced drug interruption and delayed first interruption were observed from QD to BID administration of the same daily dosage. Meanwhile, a smaller percentage of patient population required dose reduction. Further, reduced treatment emergent ⁇ Grade 3 adverse events and treatment-related adverse events were observed in BID dosing over QD dosing as shown in Table 11.
  • Table 9 Denominator is the number of patients with dosing data from patient diary for at least one cycle
  • Table 10 [0227] The efficacy of different dosing regimens was investigated. The 8 mg BID dosing scored much better in terms of overall response rate and disease control rate than the 16 mg QD dosing. The efficacy and safety comparion between 16 mg QD and 8 mg BID dosing is shown in Figures 8(a) and (8b). The efficacy and safety comparion between 12 mg QD and 6 mg BID dosing is shown in Figures 9. [0228] BID administration schedule also Dose reduction was Reduced dose interruption by 23% and delayed first interruption by 3 days in 16mg was observed. Reduced dose interruption by 43% and delayed first interruption by 9 days in 12mg was also observed.
  • Table 11 Preliminary data from Cohort 5 also showed retained or possibly improved anti- tumor activity with 8 mg BID from that seen in 16mg QD in the first 10 patients (Table 12).
  • Table 12 [0231]
  • Prevalent hotspots for atypical mutations were the P-loop in exon 18 (L718-V726, 13.6%) and the C- terminal loop of the ⁇ -C-helix in exon 20 (A767-G779, 29.4%, Fig.11C).
  • the mPFS of patients with NSCLC harboring either classical or atypical EGFR mutations that received any EGFR TKI treatment were analyzed.
  • Fig. 21C,D Patients with atypical EGFR mutations had a shorter PFS and OS irrespective of treatment or stage. These data exhibit that atypical EGFR mutations are associated with a shorter PFS compared to classical EGFR mutations.
  • Fig.11 shows Atypical EGFR mutations are heterogeneous and are associated with worse patient outcomes.
  • A. Pie chart of frequency of patients with classical and atypical EGFR mutations with NSCLC (N 11,619 patients).
  • B. Pie chart of frequency of atypical EGFR mutations observed in patients with NSCLC (N 7,199 mutations).
  • a secondary approach which employed a machine learning approach was used to analyze data by the classification and regression trees (CART) algorithm and determine variable importance (Fig 23B).
  • Structure-based groups had a higher variable importance than exon-based groups suggesting that structure-based groups were predictive of which mutational groups would be sensitive to a particular drug compared to exon-based groups (p ⁇ 0.0001, Fig 12G).
  • Classical-like, atypical EGFR mutations were predicted to have little impact on the overall structure of EGFR compared to WT EGFR (Fig. 24A-D), and were sensitive and selective for all classes of EGFR TKIs, particularly third- generation TKIs in vitro (Fig.24E) and in vivo (Fig.24F,G).
  • Fig. 15A shows EGFR mutations can be separated into four distinct subgroups based on drug sensitivity and structural changes.
  • Fig.22 shows Heat maps generated through supervised clustering by structure- function based groups cluster drug sensitivity better than exon based groups.
  • A-B Heat maps supervised clustering by (A) exon based or (B) structure-function based groups of log (Mutant/WT) ratios from Ba/F3 cells expressing indicated mutations after 72 hours of indicated drug treatment.
  • the order of exons 1, 2, and 3 were assigned arbitrarily. Groups were assigned based on structural predictions [0242] EGFR TKI resistant T790M-like mutations can be inhibited by ALK and PKC inhibitors.
  • T790M-like mutants had at least one mutation in the hydrophobic core, there were two distinct subgroups of T790M-like mutants, third generation TKI sensitive (T790M-like-3S) and third generation TKI resistant (T790M-like-3R, Fig.16A).
  • T790M-like- 3S mutants had high selectivity for third generation TKIs and some exon 20 specific inhibitors and moderate selectivity for ALK and PKC inhibitors (Fig. 16B).
  • T790M-like-3R mutants were complex mutations comprised of T790M and a known drug resistance mutation (i.e.
  • T790M-like mutants contained at least one mutation in the hydrophobic cleft, which is known to convey resistance to first and second generation TKIs, but the addition of a known resistance mutations caused reduced sensitivity to classical EGFR TKIs that could be overcome by drug repurposing with ALK or PKC inhibitors.
  • PACC mutations are most sensitive to second generation TKIs
  • PACC mutations were comprised of mutations spanning exons 18-21 including mutations such as G719X, L747X, S768I, L792X, and T854I and others.
  • PACC mutations were predicted to impact the overall volume of the ATP and drug binding pocket through alterations of the orientation of the P-loop or ⁇ -c-helix (Fig.17A,B).
  • Fig. 13 shows PACC mutations are robustly sensitive to second-generation TKIs.
  • A. In silico modeling of EGFR G179S (PDB 2ITN, purple) with osimertinib in the reactive conformation (green) and predicted conformation with G719S (orange) demonstrate destabilization of TKI-protein interactions at the indole ring.
  • Tumor growth curves for PDXs harboring EGFR S768dupSVD exon 20 insertion mutation treated with indicated inhibitors were measured three times per week and symbols are average of tumor volumes ⁇ SEM.
  • Mice received drug 5 days per week, and mice were euthanized at day 28 to harvest tumors. D.
  • E. Heat map with unsupervised hierarchical clustering of log (Mutant/WT) ratios from Ba/F3 cells expressing indicated mutations after 72 hours of indicated drug treatment. Squares are representative of the average of n 3 replicates. For co-occurring mutations, the order of exons 1, 2, and 3 were assigned arbitrarily. Groups were assigned based on predicted mutational impact.
  • Dot plot of mutant/WT IC 50 values of Ba/F3 cells expressing classical EGFR mutations (white bars) or classical EGFR mutations and acquired PACC mutations (colored bars) treated with indicated classes of EGFR TKIs. Dots are representative of average of n 3 replicate mutant/WT IC 50 values of individual cell lines expressing indicated mutations with individual drugs. Bars are representative of average mutant/WT IC 50 values ⁇ SEM for each class of EGFR TKI and indicated cell lines. p-values were determined by ANOVA analysis with unequal SD as determined by Brown-Forsythe test to determined differences in SD. Holm-Sidak's multiple comparisons test was used to determine differences between groups. G.
  • Fig.23 shows Structure/function-based groupings are more predictive of drug and mutation sensitivity compared to exon-based groupings.
  • Structure/function-based subgroups predict patient outcomes to TKI better than exon-based subgroups [0249] To determine if structure/function-based groups could better identify patients most likely to benefit from a given drug compared to exon-based groups, a publicly available database of clinical outcomes from patients with NSCLC harboring atypical EGFR mutations treated with afatinib was used, and performed a retrospective analysis of ORR and duration of treatment (DoT) of 847 patients. Structure/function-based grouping showed clear differences between sensitive (classical-like and PACC) and resistant (T790M-like and Ex20ins) subgroups (ORR 63% vs 20%), whereas exon-based groups had less variation between groups (Fig.19A,B).
  • Guardant360® is a CLIA - certified, CAP / NYSDOH accredited comprehensive circulating free DNA (cfDNA) NGS test that reports out SNVs, indels, fusions, and SNVs in up to 73 genes.
  • EGFR positive cell lines were stained with PE-EGFR (Biolegend) and sorted by FACS. After sorting, EGFR positive cells were maintained in RPMI containing 10% FBS, 1% penicillin/streptomycin, and 1ng/ml EGF to support cell viability. Drug screening was performed as previously described. Shortly, cells were plated in 384-well plates (Greiner Bio-One) at 2000-3000 cells per well in technical triplicate. Seven different concentrations of TKIs or DMSO vehicle were added to reach a final volume of 40 ⁇ L per well.
  • Mutant to WT ratios (Mut/WT) for each drug were calculated by dividing the IC 50 values of mutant cell lines by the average IC 50 value of Ba/F3 cells expressing WT EGFR supplemented with 10ng/ml EGF for each drug. Statistical differences between groups were determined by ANOVA as described in the figure legends. [0259] In silico mutational mapping and docking experiments [0260] X-ray structures of wild type EGFR in complex with AMP-PNP (2ITX) and EGFR L858R mutant in complex with AMP-PNP (2ITV) retrieved from PDB was used for MD simulation. All crystallographic ligands, ions, and water molecules were removed from the X- ray structures.
  • Missing side-chain atoms and loops in these structures were built using the Prime homology module 47 in Schrodinger.
  • the missing activation loop region (862-876) in the EGFR L858R mutant structure was built using the activation loop from another EGFR structure (5XGN).
  • Exon 19 deletion mutant ( ⁇ ELREA) was modeled on the wild type EGFR, using the Prime program, followed by MM/GBSA based loop refinement for the ⁇ 3- ⁇ C loop region.
  • Heatmap generation Heat maps and hierarchical clustering were generated by plotting the median log (Mut/WT) value for each cell line and each drug using R and the ComplexHeatmap package (R Foundation for Statistical Computing, Vienna, Austria. Complex Heatmap). Hierarchical clustering was determined by Euclidean distance between Mut/WT ratios. For co-occurring mutations, exon order was assigned arbitrarily, and for acquired mutations, exons were assigned in the order mutations are observed clinically. Structure-function groups were assigned based on predicted impact of mutation on receptor conformation.
  • the structure function group variable was involved in the first and second splits in all of the 18 regression trees of drug sensitivity.
  • the variable importance of this variable was in a range of 66 - 94%. Both the order of the split and variable importance indicate that the structure function group variable was more predictive than the exon-based variables in evaluation of drug sensitivity.
  • PDX generation and in vivo experiments [0266] As part of the MD Anderson Cancer Center Lung Cancer Moon Shots program, patient derived xenografts (PDX) harboring EGFR G719S and L858R/E709K were generated and maintained in accordance with Good Animal Practices and with approval from MD Anderson Cancer Center Institutional Animal Care and Use Committee (Houston, TX) on protocol number PA140276 as previously described. Surgical samples were rinsed with serum- free RPMI supplemented with 1% penicillin-streptomycin then implanted into the right flank of 5- to 5-week old NSG mice within two hours of resection. Tumors were validated for EGFR mutations by DNA fingerprinting and qPCR as described.
  • PDXs harboring EGFR S768dupSVD were purchased from Jax Labs (J100672).
  • 5- to 6-week old female NSG mice (NOD.Cg-Prkdcscid IL2rgtmWjl/Szj) were purchased from Jax Labs (#005557).
  • Fragments of NSCLC tumors expressing EGFR S768dupSV, G719S or L858R/E709K were implanted into 6-8 week old female NSG mice. Once tumors reached 2000 mm 3 , tumors were harvest and re-implanted into the right flank of 6-8week old female NSG mice.
  • Tumors were measured three times per week, and were randomized into treatment groups when tumors reached a volume of 275-325 mm 3 for the EGFR G719S and S768dupSVD models, and 150-175 mm 3 for the L858R/E709K model.
  • Treatment groups included vehicle control (0.5% Methylcellulose, 0.05% Tween-80 in dH2O), 100mg/kg erlotinib, 20mg/kg afatinib, 2.5 mg/kg poziotinib, 5mg/kg osimertinib, and 20mg/kg osimertinib.
  • Example 3 This example studied the efficacy, safety, and molecular determinants of response for poziotinib from an open-label, phase II study of patients with advanced EGFR exon 20 mutant NSCLC. It was found that poziotinib was a clinically active and tolerable exon 20 inhibitor; and, that acquired resistance to poziotinib was associated with both EGFR- dependent and -independent mechanisms of resistance in patients and preclinical models, reminiscent of mechanisms observed for classical EGFR mutant patients.
  • TKI sensitivity highly dependent on the location of the exon 20 insertion, with markedly higher activity observed against those in the loop near the C-terminal end of the ⁇ -C helix (termed near loop, codons 767-772) compared to mutations distal from the ⁇ -C helix (far loop, codons 773-775).
  • This finding was confirmed by preclinical studies and molecular modeling, and was also observed in several other, but not all, EGFR exon 20 TKIs under clinical investigation.
  • the mechanism for this heterogeneity in TKI sensitivity was driven by insertion-induced alterations in the conformation of the drug binding pocket that impacted TKI binding.
  • Tumor biopsies were analyzed using targeted next generation sequencing (MD Anderson Cancer Center Solid Tumor Assay) that covers the coding sequence of 134 genes and selected copy number variations (amplifications) in 47 genes as well as inter- and intragenic fusions involving 51 genes (list of genes provided in Figure 27 and Figure 28 generation panel (LB-70) that covers 70-cancer related genes with analytic sensitivity of 0.1-0.3% developed in collaboration with Guardant Health (list of genes provided in Figure 29). Resistance mechanisms identified in patients' samples were validated in preclinical models using Ba/F3 cells.
  • MD Anderson Cancer Center Solid Tumor Assay that covers the coding sequence of 134 genes and selected copy number variations (amplifications) in 47 genes as well as inter- and intragenic fusions involving 51 genes (list of genes provided in Figure 27 and Figure 28 generation panel (LB-70) that covers 70-cancer related genes with analytic sensitivity of 0.1-0.3% developed in collaboration with Guardant Health (list of genes provided in Figure 29). Resistance mechanisms identified in patients' samples were validated in preclinical
  • the evaluable for response population was defined as all patients who received at least one dose of poziotinib and had measurable disease that was evaluated for response. Progression-free survival and duration of response outcomes were calculated with the Kaplan-Meier method. Data were analyzed using a December 1, 2020, data cut-off. [0286] Ba/F3 cell generation and IC50 approximation [0287] Ba/F3 cells were acquired from Dr. Gordon Mills (MD Anderson Cancer Center), and cultured in RPMI (Sigma) containing 10% FBS, 1% penicillin/streptomycin, and 10ng/ml recombinant mIL-3 (R&D Biosystems).
  • Retroviral transduction containing mutant EGFR plasmids was completed for 12-24 hours.
  • Retroviruses were generated using Phoenix 293T-ampho cells (Orbigen) transfected with Lipofectamine 2000 (Invitrogen) and pBabe-Puro based vectors listed in Figure 30.
  • Vectors were generated by GeneScript or Bioinnovatise using parental vectors from Addgene listed in Figure 30. Stable lines were selected after 24-48 hours using 2 ⁇ g/ml puromycin (Invitrogen). Cells were then stained with PE-EGFR (Biolegend) and sorted by FACS.
  • EGFR positive cells were maintained in complete RPMI media containing 1ng/ml EGF to support cell viability.
  • Drug screening was performed as previously described in literature.
  • Cell Titer Glo was used to determine cell viability and raw bioluminescence values were normalized to DMSO control treated cells, and values were plotted in GraphPad Prism.
  • Non-linear regression models were used to fit the normalized data with a variable slope, and IC5o values were determined by GraphPad prism by interpolation of concentrations at 50% inhibition.
  • Drug screens were performed in technical triplicate on each plate and triplicate independent replicates. Correlations between drug sensitivity and mutation location were completed by plotting the calculated average IC 50 values against the amino acid residue number using an x-y scatter plot.
  • EGFR was amplified in three overlapping segments by traditional PCR using the primers the following primers: EGFR #1 Forward: ATGCGACCCTCCGGGAC, EGFR #2 Reverse: TCATGCTCCAATAAATTCACTGCT, EGFR #2 Forward: ATGCGACCCTCCGGG, EGFR #2 Reverse: TCATGCTCCAATAAATTCACTGCTT, EGFR #3 Forward: CTCCGGTCAGAAAACCAAAA, and EGFR #3 Reverse: CTTCCAGACCAGGGTGTTGT. Sanger sequencing was performed using Applied Biosystems Sequence Detection System by the MD Anderson Advanced Technology Genomics Core.
  • PDB entry 2ITO a structurally similar ligand (gefitinib) complexed to EGFR.
  • PDB entry 2ITO was used as the primary template for homology modeling, and the coordinates of gefitinib were transferred to the modeled structure.
  • loop refinement was carried out to refine flexible loop regions around the binding pocket.
  • a docked model of poziotinib covalently bound to EGFR mutants was generated using the covalent docking program CovDock 33 , available through the Schrodinger package. The covalent link was removed, and the noncovalent complex was used as the starting structure for subsequent MD simulations.
  • PDB entries 6JWL and 3UG2 were considered for modeling the structure of EGFR H773insNPH insertion mutant bound to mobocertinib.
  • the crystal structure of AZD9291 (osimertinib) bound to mutant EGFR (6JWL) was identified to have an inhibitor structurally similar to mobocertinib.
  • a model of EGFR insertion mutants was generated using AZD9291 bound to EGFR the binding mode of mobocertinib was modeled by making a simple modification to AZD9291.
  • All-atom molecular dynamics simulations of the mutants bound to poziotinib and mobocertinib were carried out using the AMBER simulation package (Version 18).
  • the system was prepared using the LEaP module of Within AmberTools (Version 19).
  • Amber force field 14SB, GAFF, and TIP3P parameter sets were used for parametrizing the protein, ligand, and water, respectively.
  • AM1BCC partial charges were assigned for the ligand.
  • the structures were then solvated in a cubic box, keeping the boundary of the box at least 10.0 ⁇ away from any solute atom. Additional Na + /Cl- ions were added to the simulation box to neutralize the system and to ensure a salt concentration of 0.1M concentration.
  • a thorough minimization and equilibration scheme was applied to relax the system. MDS was then performed under periodic boundary conditions. Bond lengths of hydrogen atoms were constrained using the SHAKE algorithm.
  • the simulation used a time step of 2 fs.
  • Particle Mesh-Ewald method was used to evaluate long-range electrostatic and short-range van der Waals forces interactions with a distance cut-off of 9.0 ⁇ .
  • the system was linearly heated from 10 K to 300 K in NVT ensemble for 200 ps and held at 300 K for over 50 ps, with harmonic restraints on the system. Subsequently, 250 ps of NVT equilibration was carried out, applying harmonic constraints on the protein and the ligand to allow the solvent to equilibrate around the solute. The system was further equilibrated for 1.5 ns in the NPT ensemble prior to the NPT production run.
  • the binding free energies of poziotinib and mobocertinib towards the mutants were calculated using two end-point-based methods, namely MM/PBSA and MM/GBSA. A single trajectory approach was employed, and the binding energies were calculated using MD snapshots taken at 1ns interval from the simulation.
  • the solvation free energy (Gsol) component is the sum of polar contributions calculated using either an GB or PB model, while the non-polar contribution is estimated by a linear relationship to the change in solvent accessible surface area (SASA)
  • Gsol GGB/PB + GSASA --------- (4)
  • T ⁇ SSolute> is the product of the absolute temperature T and the solute entropy S solute . The solute entropy term was ignored in our calculations.
  • the values reported herein essentially represent the binding energy component.
  • Patients were eligible if they were at least 18 years of age and had histologically or cytologically confirmed, locally advanced or metastatic NSCLC (stage IIIB and IV), measurable disease (using CT, PET-CT or MRI) as defined by Response Evaluation Criteria In Solid Tumors (RECIST) version 1.1 guidelines, Eastern Cooperative Oncology Group (ECOG) performance status 0 or 1. The study originally had two independent cohorts; EGFR cohort (cohort 1) and HER2 cohort (cohort 2).
  • Eligible patients for the EGFR cohort had treatment na ⁇ ve or previously treated (with any number of therapy lines) NSCLC with documented EGFR exon 20 mutation by one of the following CLIA certified tests: OncoMine Comprehensive Assay (OCA), Guardant360 Assay (using plasma), or FoundationOne Assay or by an FDA approved device using cobas® EGFR mutation test v2 or therascreen EGFR RGQ PCt kit.
  • OCA OncoMine Comprehensive Assay
  • Guardant360 Assay using plasma
  • FoundationOne Assay or by an FDA approved device using cobas® EGFR mutation test v2 or therascreen EGFR RGQ PCt kit.
  • Previously untreated patients are eligible only if the EGFR exon 20 mutation was confirmed using an FDA approved device: cobas® EGFR Mutation Test v2 or therascreen® EGFR RGQ PCR Kit prior to study enrollment.
  • TKIs Prior treatment with an EGFR TKI was allowed including TKIs with reported specific EGFR exon 20 insertion activity. Eligible mutations included D770_N771insSVD, D770_N771insNPG, V769_D770insASV, H773_V774insNPH, or any other exon 20 in-frame insertion or point mutation excluding acquired T790M. Patients with CNS metastases were eligible if the disease was asymptomatic, stable, and did not require steroids for at least 4 weeks before the first dose of poziotinib. Physical examinations, clinical chemistry, hematology, vital signs, digital electrocardiogram, and echocardiogram measurements were required at screening.
  • the primary endpoint of the study was the ORR according to RECIST version 1.1, with a pre-defined ORR of 30% or greater considered to be clinically meaningful.
  • Patients received daily 16mg orally poziotinib until objective disease progression, and could continue beyond progression for as long as clinical benefit was observed, as judged by the investigator and in the absence of other discontinuation criteria (patient withdrawal, adverse event).
  • Fifty patients with EGFR exon 20 mutant metastatic NSCLC were enrolled and, baseline characteristics are shown in Figure 31.
  • the median duration of investigator-assessed response was 8.5 months (95% CI: 4.0 to 19.3), and the mPFS was 5.5 months (95% CI: 5.4 to 10.4).
  • the median duration of poziotinib treatment irrespective of dose interruptions, was 6.0 months (IQR 3 ⁇ 0–12 ⁇ 0; range 0 ⁇ 1–44.5).
  • VAF variant allelic frequency
  • Ba/F3 cells engineered to co-express EGFR exon 20 mutations and T790M or C797S were resistant to poziotinib (Fig 34B).
  • the C797S mutation which also causes resistance to other covalent inhibitors, such as osimertinib, was not observed in patients.
  • Structural modeling of EGFR exon 20 insertion (D770_N771insNPG) and T790M with poziotinib showed distinct interactions between the terminal halogenated benzene ring of poziotinib and the hydrophobic cleft of EGFR (Fig.34C).
  • MDS microsecond time scale molecular dynamics simulations
  • mobocertinib had the opposite relationship as poziotinib, with closer interaction of the acrylamide group in the far mutant (6.6 ⁇ ) compared to the near mutant (7.4 ⁇ ), recapitulating drug screening data in this study and others that mobocertinib has greater inhibitory activity for insertions at H773 compared to those at S768.
  • location of the insertion at the C-terminal of the ⁇ - c-helix influences the orientation of distinct residues of the P-loop that stabilize EGFR TKIs and influence the distance between the two reactive groups which effects drug binding affinities.
  • the rate of dose reduction for poziotinib treated patients was 72% compared to 66% and 53% with dacomitinib and afatinib, respectively.
  • poziotinib is a clinically active inhibitor of EGFR exon 20 mutations and has a similar toxicity profile as other FDA-approved second-generation EGFR TKIs.
  • twice-daily dosing regimens are now being studied which may enable improve tolerability by reducing peak drug concentrations maintaining inhibitor trough concentrations.
  • mobocertinib lacks a direct correlation between drug sensitivity and mutation location, but preferentially inhibited far-loop mutations at residue H773 compared to those at S768.
  • insertions at H773 cause the P-loop to take on an extended conformation which favored binding with mobocertinib.
  • Phase I/II study of mobocertinib in patients with EGFR exon 20 also reported no direct correlation between mutation location and response rate, but patients with far-loop mutations had a higher response rate (57%) than the overall study cohort (43%), supporting the findings in this study.
  • poziotinib and other exon 20 specific TKIs have distinct subsets of exon 20 insertions for which the TKIs bind more tightly due to structural features of the compounds.
  • These data support the use of more detailed location information (e.g. helical, near-loop, or far-loop) in clinical trial design for EGFR exon 20 - directed kinase inhibitors.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Oncology (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne une méthode de traitement d'un cancer bronchique non à petites cellules (CBNPC) chez un sujet. La méthode comprend l'administration d'une quantité thérapeutiquement efficace de poziotinib ou d'un sel pharmaceutiquement acceptable correspondant à un sujet en ayant besoin. Le poziotinib présente des efficacités Améliorées chez des sujets Présentant certaines mutations de l'exon 20 de EGFR ou de HER2, ce qui entraîne une résistance aux inhibiteurs de la tyrosine kinase classiques.
PCT/US2021/043274 2020-07-27 2021-07-27 Traitement du cancer bronchique non à petites cellules avec poziotinib WO2022026442A1 (fr)

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US202063056895P 2020-07-27 2020-07-27
US63/056,895 2020-07-27
US202063199446P 2020-12-29 2020-12-29
US63/199,446 2020-12-29
US202163155123P 2021-03-01 2021-03-01
US63/155,123 2021-03-01
US202163166722P 2021-03-26 2021-03-26
US63/166,722 2021-03-26

Publications (1)

Publication Number Publication Date
WO2022026442A1 true WO2022026442A1 (fr) 2022-02-03

Family

ID=80036135

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/043274 WO2022026442A1 (fr) 2020-07-27 2021-07-27 Traitement du cancer bronchique non à petites cellules avec poziotinib

Country Status (3)

Country Link
TW (1) TW202211923A (fr)
UY (1) UY39342A (fr)
WO (1) WO2022026442A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022147150A1 (fr) * 2020-12-29 2022-07-07 Spectrum Pharmaceuticals, Inc. Traitement de tumeurs solides malignes

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018094225A1 (fr) * 2016-11-17 2018-05-24 Board Of Regents, The University Of Texas System Composés à activité antitumorale contre des cellules cancéreuses porteuses de mutations egfr ou her2 exon 20
US20180298019A1 (en) * 2015-10-19 2018-10-18 Sunshine Lake Pharma Co., Ltd. A salt of egfr inhibitor, crystalline form and uses thereof
WO2019223716A1 (fr) * 2018-05-23 2019-11-28 江苏恒瑞医药股份有限公司 Utilisation d'un inhibiteur de cdk4/6 en combinaison avec un inhibiteur de l'egfr dans la préparation d'un médicament pour le traitement de maladies tumorales
WO2020052575A1 (fr) * 2018-09-12 2020-03-19 江苏恒瑞医药股份有限公司 Utilisation d'une combinaison d'un inhibiteur de kinase jak et d'un inhibiteur d'egfr dans la préparation d'un médicament pour le traitement de maladies tumorales

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180298019A1 (en) * 2015-10-19 2018-10-18 Sunshine Lake Pharma Co., Ltd. A salt of egfr inhibitor, crystalline form and uses thereof
WO2018094225A1 (fr) * 2016-11-17 2018-05-24 Board Of Regents, The University Of Texas System Composés à activité antitumorale contre des cellules cancéreuses porteuses de mutations egfr ou her2 exon 20
WO2019223716A1 (fr) * 2018-05-23 2019-11-28 江苏恒瑞医药股份有限公司 Utilisation d'un inhibiteur de cdk4/6 en combinaison avec un inhibiteur de l'egfr dans la préparation d'un médicament pour le traitement de maladies tumorales
WO2020052575A1 (fr) * 2018-09-12 2020-03-19 江苏恒瑞医药股份有限公司 Utilisation d'une combinaison d'un inhibiteur de kinase jak et d'un inhibiteur d'egfr dans la préparation d'un médicament pour le traitement de maladies tumorales

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TCHEKMEDYIAN NISHAN, PAXTON BILL, LEBEL FRANCOIS, KEOSSAYAN LENA, HEYMACH JOHN V.: "Prolonged Central Nervous System Response in a Patient With HER2 Mutant NSCLC Treated With First-Line Poziotinib", JTO CLINICAL AND RESEARCH REPORTS, vol. 1, no. 4, 7 August 2020 (2020-08-07), pages 100081, XP055905751, ISSN: 2666-3643, DOI: 10.1016/j.jtocrr.2020.100081 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022147150A1 (fr) * 2020-12-29 2022-07-07 Spectrum Pharmaceuticals, Inc. Traitement de tumeurs solides malignes

Also Published As

Publication number Publication date
UY39342A (es) 2022-02-25
TW202211923A (zh) 2022-04-01

Similar Documents

Publication Publication Date Title
US10221248B2 (en) Anti-MERTK agonistic antibodies and uses thereof
AU2022200583B2 (en) G protein-coupled receptor (GPCR) modulation by imipridones
US11793895B2 (en) Residualizing linkers and uses thereof
US20210236499A1 (en) Imipridones for gliomas
WO2022026442A1 (fr) Traitement du cancer bronchique non à petites cellules avec poziotinib
WO2011150256A2 (fr) Méthodes et compositions de diagnostic et de traitement de troubles de prolifération cellulaire
TW202317204A (zh) 放射免疫結合物及檢查點抑制劑組合療法
WO2023015149A1 (fr) Traitement du cancer du poumon non à petites cellules avec du poziotinib
EP4017495A1 (fr) Combinaison de poziotinib avec des inhibiteurs de vegfr2 et ses méthodes d'utilisation
TW202237122A (zh) 惡性實體腫瘤之治療
US20230150976A1 (en) 4-Amino Pyrimidine Compounds for the Treatment of Cancer
US20220016212A1 (en) Methods of treating chemotherapy induced neutropenia using fixed doses of g-csf protein complex
WO2024030645A1 (fr) Compositions pharmaceutiques et leurs utilisations pour le traitement du gliome
TW202337501A (zh) 靶向ｐｓｍａ之放射性藥物及檢查點抑制劑之組合療法
WO2004073631A2 (fr) Polytherapie pour le traitement de neoplasmes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21850419

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21850419

Country of ref document: EP

Kind code of ref document: A1