WO2022011082A1 - Compositions and methods for producing single stranded dna - Google Patents

Abstract

An isolated nucleic acid includes a first sequence from a filamentous bacteriophage, the first sequence having both initiator and terminator functions; a second sequence that is identical to the first sequence; and a single-strand DNA sequence of interest that is located between the first sequence and the second sequence. A host cell including the isolated nucleic acid and a method for producing a single-stranded DNA are also disclosed.

Description

COMPOSITIONS AND METHODS FOR PRODUCING SINGLE STRANDED DNA

This application claims priority to US Provisional Patent Application No. 63/049,584, filed on July 8, 2020, which is incorporated by reference for all purposes as if fully set forth herein.

FIELD OF THE INVENTION

[0001] The present invention relates to compositions and methods for producing single stranded DNA.

BACKGROUND OF THE INVENTION

[0002] Ml 3 bacteriophage has been engineered to obtain customized lengths for a variety of applications including batteries. Single-stranded DNA (ssDNA) extracted from this engineered Ml 3 bacteriophage also may be used for applications such as sequencing, cloning, DNA based data storage, or genome editing. However, it has been difficult to produce highly homogenous ssDNA with varying lengths without any unwanted sequences or without compromising the growth of engineered phages. Producing homogenous phage population may further simplify purification steps and retaining the wild type origin within the engineered phages may minimize impact on the growth of phages.

SUMMARY OF THU INVENTION

[0003] In one embodiment, an isolated nucleic acid includes a first sequence from a filamentous bacteriophage, the first sequence having both initiator and terminator functions; a second sequence that is identical to the first sequence; and a single-strand DNA sequence of interest that is located between the first sequence and the second sequence.

[0004] In another embodiment, the isolated nucleic acid further includes a selectable marker.

[0005] In another embodiment, the isolated nucleic acid is single stranded or double stranded.

[0006] In another embodiment, the isolated nucleic acid is linear or circular. [0007] In another embodiment, the isolated nucleic acid is circular and double stranded.

[0008] In another embodiment, the first sequence has SEQ ID NO: 1.

[0009] In another embodiment, the first sequence has at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO: 1.

[0010] In another embodiment, the single-strand DNA sequence of interest has a length of between 100 and 20,000 nucleotides.

[0011] In another embodiment, a host cell includes: an isolated nucleic acid that includes: a first sequence from a filamentous bacteriophage, the first sequence having both initiator and terminator functions; a second sequence that is identical to the first sequence; and a single-strand DNA sequence of interest that is located between the first sequence and the second sequence; and a nucleic acid helper plasmid for expressing bacteriophage proteins capable of assembling a single-strand DNA into a bacteriophage.

[0012] In another embodiment, the host cell is an E. coli cell.

[0013] In another embodiment, the bacteriophage proteins include PI, P2, P3, P4, P5, P6, P7, P8, P9, P10, and PI 1.

[0014] In another embodiment, a method for producing a single-stranded DNA includes: culturing the host cell of any one of claims 9-11 under conditions suitable for producing the single-stranded DNA from the single-strand DNA sequence of interest in the isolated nucleic acid and producing the bacteriophage proteins from the nucleic acid helper plasmid; allowing the single-stranded DNA and bacteriophage proteins to assemble into an engineered phage; and collecting the engineered phage.

[0015] In another embodiment, the method further includes extracting the single- stranded DNA from the engineered phage.

[0016] In another embodiment, at least 90%, at least 95% or at least 99% of the single-stranded DNA is the same length as the DNA sequence of interest.

[0017] In another embodiment, the single-stranded DNA has a length of between 100 and 20,000 nucleotides. [0018] In another embodiment, the single-stranded DNA is circular.

[0019] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are intended to provide further explanation of the invention as claimed.

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the principles of the invention.

[0021] In the drawings:

[0022] FIG. l is a schematic diagram of the invention.

[0023] FIG. 2 shows the gel images of different forms of DNA donor templates: A) linear double stranded DNA; B) linear single stranded DNA (LiSSD); and C) circular single stranded DNA.

PET ATT, ED DESCRIPTION OF THE 11.1,1 STRATED EMBODIMENTS

[0024] Reference will now be made in detail to embodiments of the present invention, example of which is illustrated in the accompanying drawings.

[0025] Provided herein are compositions and methods for producing customized length of filamentous bacteriophage and single stranded DNA extracted from custom filamentous bacteriophage. A custom sequence is flanked by two wild type origin of replication of the filamentous bacteriophage and integrated in the genome of the host. The rest of the phage genome is either integrated in the genome of the host or encoded in one or more plasmids, providing the complete machinery to produce phage progeny.

[0026] As shown in FIG. 1, in the genome of the host, a sequence of interest is flanked by two wild type fl origin of replications. In between the origin of replication and the sequence of interest, there is a restriction site that will be used to linearize the circular single stranded DNA. A plasmid encoding Ml 3 phage proteins provide expression of all necessary proteins to begin replication. When the replication process reaches the terminator part of the second origin of replication. This then becomes RF form (replicative form) and continue with its phage life cycle.

[0027] Isolated nucleic acids of the present invention are useful for producing single stranded DNA (ssDNA) having uniform length. The isolated nucleic acids may include a first sequence from a filamentous bacteriophage, and this sequence has both initiator and terminator functions. The isolated nucleic acids may include another sequence (second sequence) that is identical to the first sequence. The isolated nucleic acids may include a single-strand DNA sequence of interest that is located between the first sequence and the second sequence.

[0028] A “nucleic acid” is at least two nucleotides covalently linked together, and may contain phosphodiester bonds. “Isolated nucleic acids” include recombinant nucleic acids and synthetic nucleic acids. A “recombinant nucleic acid” refers to a molecule that is constructed by joining nucleic acid molecules, and can replicate in a living cell. A “synthetic nucleic acid” refers to a molecule that is biologically or chemically synthesized. A synthetic nucleic acid includes nucleic acids that are chemically modified or otherwise modified but can base pair with natural nucleic acid molecules.

[0029] Isolated nucleic acids may contain portions of nucleic acids that are naturally occurring, but as a whole, engineered nucleic acids do not occur naturally and require human intervention. Isolated nucleic acid may include a recombinant nucleic acid that is incorporated into a vector, an autonomously replicating plasmid, a bacteriophage, a virus, or into a genomic DNA of a prokaryote or eukaryote.

[0030] A DNA sequence of interest is considered to be directly linked to the first sequence and the second sequence when it is located between the first and second sequences in the absence of intervening nucleic acids. A DNA sequence of interest is considered to be indirectly linked to the first and second sequences when it is located between the first and second sequences in the presence of intervening nucleic acids.

[0031] The isolated nucleic acid may include a selectable marker. Examples of selectable markers include, without limitation, genes encoding proteins that increase or decrease either resistance or sensitivity to antibiotics (e.g., ampicillin resistance genes, kanamycin resistance genes, neomycin resistance genes, tetracycline resistance genes and chloramphenicol resistance genes) or other compounds. Additional examples of selectable markers include genes encoding proteins that enable the cell to grow in media deficient in an otherwise essential nutrient (auxotrophic markers).

[0032] The isolated nucleic acids may be single-stranded or double-stranded. The isolated nucleic acids may be linear or circular.

[0033] The isolated nucleic acids may be introduced into host cells using any means known in the art, including: transformation, transfection such as chemical transfection or non-chemical transfection and transduction.

[0034] The isolated nucleic acids of the present disclosure may be produced using standard molecular biology methods.

[0035] The first and second sequences are a nucleotide sequence that is used for both initiation and termination of viral strand synthesis. The first and second sequences may be a nucleic acid sequence having SEQ ID NO: 1. The first and second sequences may be a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 1.

[0036] DNA Sequence of Interest

[0037] Methods and compositions of the present invention encompass any DNA sequence of interest. The DNA sequence of interest may include a genomic DNA sequence, a coding DNA sequence, or a non-coding DNA sequence. The DNA sequence of interest may have a length of 100 nucleotides to 20,000 nucleotides.

[0038] Host Cells

[0039] Host cells of the present invention are useful for producing ssDNA sequences having uniform length using engineered nucleic acids described herein. Host cells provided herein include at least one isolated nucleic acid.

[0040] A host cell “expresses” a product (e.g., a ssDNA) if the product, encoded by an isolated nucleic acid, is produced in the cell. Gene expression is a process by which genetic instructions in the form of a nucleic acid are used to synthesize a product, such as a ssDNA or a protein. [0041] The host cell may further include a nucleic acid helper plasmid. Nucleic acid helper plasmid refers to a plasmid that expresses at least one bacteriophage protein in a host cell. The nucleic acid helper plasmid may express at least one bacteriophage protein capable of encapsulating ssDNA. The nucleic acid helper plasmid may express at least one bacteriophage protein capable of extruding encapsulated ssDNA from the host cell.

[0042] Nucleic acid helper plasmids described herein may express bacteriophage proteins. The bacteriophage proteins may include one or more bacteriophage proteins, up to eleven bacteriophage proteins. The bacteriophage proteins are selected from the group consisting of PI, P2, P3, P4, P5, P6, P7, P8, P9, P10, and PI 1. In some embodiments, the plurality of proteins comprises P3, P6, P7, P8,

[0043] The nucleic acid helper plasmid may further include a packaging signal.

[0044] The nucleic acid helper plasmid my include additional functional element that can be incorporated into or onto the ssDNA of interest. The additional functional element may be single-guide- or crispr-RNAs (crRNA), anti-sense DNA, anti-sense RNA, a protein, or a combination thereof. The anti-sense RNA may be RNAi, miRNA, piRNA and siRNA. The protein can be therapeutic, nontherapeutic, or a combination thereof. The protein may be a Cas protein, TAL effector protein, or zinc-finger protein. The host cells may also express single-guide- or crispr-RNAs (crRNA) alone or in combination with a Cas protein. Thus, compositions and methods provided herein may be used to package a gene editing composition including a CRISPR/Cas system into a ssDNA.

[0045] The host cell may express a selectable marker. Selectable markers are used to select host cells that have taken up and expressed an engineered nucleic acid following transfection of the cell (or following other procedure used to introduce foreign nucleic acid into the cell).

[0046] Host cells may be prokaryotic cells or eukaryotic cells, preferably, bacterial cells, and more preferably, Escherichia coli cells.

[0047] Producing ssDNA

[0048] The methods for producing ssDNA having uniform length include (1) culturing a host cell provided herein under conditions suitable for producing the ssDNA encoded by the DNA sequence of interest in the isolated nucleic acid and for producing the bacteriophage proteins from the nucleic acid helper plasmid, (2) allowing the ssDNA and the bacteriophage proteins to assemble into an engineered phage; and (3) collecting the engineered phage.

[0049] “Culturing” refers to the process by which host cells are grown under controlled conditions, typically outside of their natural environment. For example, host cells, such as host cells comprising an engineered nucleic acid, may be grown as a cell suspension in liquid nutrient broth, also referred to as liquid “culture medium.”

[0050] Examples of commonly used bacterial E. coli growth media include LB (Lysogeny Broth) Miller broth (1% NaCl): 1% peptone, 0.5% yeast extract, and 1% NaCl;

LB (Lysogeny Broth) Lennox Broth (0.5% NaCl): 1% peptone, 0.5% yeast extract, and 0.5% NaCl; SOB medium (Super Optimal Broth): 2% peptone, 0.5% Yeast extract, 10 mM NaCl, 2.5 mM KC1, 10 mM MgCh, 10 mM MgS0₄; SOC medium (Super Optimal broth with Catabolic repressor): SOB + 20 mM glucose. Host cells are cultured under conditions that result in expression of the ssDNA. Such culture conditions may depend on the particular ssDNA being expressed and the desired amount of the ssDNA produced.

[0051] The host cells may be cultured at a temperature of 30 °C to 40 °C, preferably, at 37 °C. The host cells may be cultured for a period of time of 12 hours to 72 hours, preferably a period of time of 12 to 24 hours.

[0052] The host cells may be cultured to an optical density, measured at a wavelength of 600 nm (OD600), of 5 to 200.

[0053] The host cells may be cultured to a density of 1 x 10⁸ (OD < 1) to 2 x 10¹¹ (OD: 200) viable cells/ml cell culture medium.

[0054] The host cells may be cultured in a bioreactor. A bioreactor is a container in which cells are cultured, such as a culture flask, a dish, or a bag that may be single use, autoclavable, or sterilizable.

[0055] Methods of the present invention encompass large-scale production of ssDNA. For large-scale production methods, host cells may be grown in liquid culture medium in a volume of 5 liters (L) to 250,000 L, or more. [0056] Typically, culturing of host cell is followed by collecting engineered phage including the ssDNA. Collecting engineered phage may including collecting supernatant that contains the engineered phage.

[0057] Methods provided herein encompass extracting ssDNA from engineered phages. Extracting ssDNA from engineered phages may include polyethylene glycol (PEG) extraction, phenol chloroform extraction, or isopropanol extraction. Methods may yield ssDNA at a concentration of 1-50 g/L.

[0058] EXAMPLES

[0059] Example 1: Production of circular single stranded DNA (CiSSD)

[0060] The goal was to produce a circular form of single stranded DNA. As a proof of concept, a donor template resulting in N-terminal GFP fusion of RAB11 A was used as previously described (Roth et al., 2018 Nature). This donor template, represented by SEQ ID NO: 1 was composed of 306 bp of the left homology arm (base nos. 1 - 306 of SEQ ID NO: 1), 729 bp of the GFP coding sequence (base nos. 307 - 1,035 of SEQ ID NO: 1), and 315 bp of the right homology arm (base nos. 1,036 - 1,350 of SEQ ID NO: 1). The donor template was synthesized by polymerase cycling assembly and cloned into a vector. LiSSD was produced by enzymatically digesting one strand of DNA from PCR amplified double stranded DNA. First, linear double stranded DNA was amplified by PCR using Q5 High- Fidelity DNA Polymerase (NEB, USA) with forward primer (GGTAGCTAGGAGTTCCAGGAC) (SEQ ID NO: 2) and reverse primer (/ 5Phos/ACGAT GT GGGAGAAGGC AGT C) (SEQ ID NO: 3) (Figure 2A). A phosphorylated strand was degraded by GUIDE-IT Long ssDNA Production System (Takara, USA) to form linear single stranded DNA (Figure 2B). Finally, CiSSD was extracted from M13 phage encoding the sequence of interest represented by SEQ ID NO: 1 and single M13 origin of replication (Figure 1C). The sequence of interest was cloned into a vector between two wild type Ml 3 origin of replication. It was then integrated in the genome of E. coli XL1- Blue at icd gene using CRIM system

(https://www.ncbi.nlm.nih.gov/pmc/articles/PMC100134/), and M13 helper plasmid lacking the Ml 3 packaging signal was transformed. The resulting E. coli produced a clonal population of M13 phages encoding the sequence of interest and single M13 origin of replication. It was grown overnight in 2xYT media at 37 °C, and circular single stranded M13 phage genome was purified from M13 phages as previously described (https://academic.oup.eom/synbio/article/3/l/ysy015/5068535). M13 phage genome purified by ethanol precipitation was dissolved in H2O.

[0061] It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents.

Claims

WHAT IS CLAIMED IS:

1. An isolated nucleic acid comprising: a first sequence from a filamentous bacteriophage, the first sequence having both initiator and terminator functions; a second sequence that is identical to the first sequence; and a single-strand DNA sequence of interest that is located between the first sequence and the second sequence.

2. The isolated nucleic acid of claim 1 further comprising a selectable marker.

3. The isolated nucleic acid of any one of claims 1-2, wherein the isolated nucleic acid is single stranded or double stranded.

4. The isolated nucleic acid of any one of claims 1-3, wherein the isolated nucleic acid is linear or circular.

5. The isolated nucleic acid of any one of claims 1-4, wherein the isolated nucleic acid is circular and double stranded.

6. The isolated nucleic acid of any one of claims 1-5, wherein the first sequence has SEQ ID NO: 1.

7. The isolated nucleic acid of any one of claims 1-5, wherein the first sequence has at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to SEQ ID NO: 1.

8 The isolated nucleic acid of any one of claims 1-7, wherein the single-strand DNA sequence of interest has a length of between 100 and 20,000 nucleotides.

9. A host cell comprising: an isolated nucleic acid that includes: a first sequence from a filamentous bacteriophage, the first sequence having both initiator and terminator functions; a second sequence that is identical to the first sequence; and a single-strand DNA sequence of interest that is located between the first sequence and the second sequence, and a nucleic acid helper plasmid for expressing bacteriophage proteins capable of assembling a single-strand DNA into a bacteriophage.

10. The host cell of claim 9, wherein the host cell is an E. coli cell.

11. The host cell of any one of claims 9-10, wherein the bacteriophage proteins include PI, P2, P3, P4, P5, P6, P7, P8, P9, P10, and PI 1.

12. A method for producing a single-stranded DNA comprising: culturing the host cell of any one of claims 9-11 under conditions suitable for producing the single-stranded DNA from the single-strand DNA sequence of interest in the isolated nucleic acid and producing the bacteriophage proteins from the nucleic acid helper plasmid; allowing the single-stranded DNA and bacteriophage proteins to assemble into an engineered phage; and collecting the engineered phage.

13. The method of claim 12 further comprising extracting the single-stranded DNA from the engineered phage.

14. The method of any one of claims 12-13, wherein at least 90%, at least 95% or at least 99% of the single-stranded DNA is the same length as the DNA sequence of interest.

15. The method of any one of claims 12-14, wherein the single-stranded DNA has a length of between 100 and 20,000 nucleotides.

16. The method of any one of claims 12-15, wherein the single-stranded DNA is circular.