WO2022006134A2 - Compounds and methods for modulating plp1 - Google Patents

Compounds and methods for modulating plp1 Download PDF

Info

Publication number
WO2022006134A2
WO2022006134A2 PCT/US2021/039651 US2021039651W WO2022006134A2 WO 2022006134 A2 WO2022006134 A2 WO 2022006134A2 US 2021039651 W US2021039651 W US 2021039651W WO 2022006134 A2 WO2022006134 A2 WO 2022006134A2
Authority
WO
WIPO (PCT)
Prior art keywords
certain embodiments
seq
modified
nucleobases
oligomeric compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/039651
Other languages
English (en)
French (fr)
Other versions
WO2022006134A3 (en
Inventor
Berit Elissa POWERS
Susan M. Freier
Huynh-Hoa Bui
Frank Rigo
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to IL298530A priority Critical patent/IL298530A/en
Priority to JP2022581012A priority patent/JP7799640B2/ja
Priority to AU2021299290A priority patent/AU2021299290A1/en
Priority to CA3185749A priority patent/CA3185749A1/en
Priority to BR112022024206A priority patent/BR112022024206A2/pt
Priority to EP21833921.6A priority patent/EP4172338A4/en
Priority to MX2022016338A priority patent/MX2022016338A/es
Priority to KR1020237002412A priority patent/KR20230029837A/ko
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Priority to CN202180045669.0A priority patent/CN116096899A/zh
Publication of WO2022006134A2 publication Critical patent/WO2022006134A2/en
Publication of WO2022006134A3 publication Critical patent/WO2022006134A3/en
Anticipated expiration legal-status Critical
Priority to JP2025283671A priority patent/JP2026062868A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/345Spatial arrangement of the modifications having at least two different backbone modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525MOE, methoxyethoxy

Definitions

  • PGP1 proteolipid protein 1
  • Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a leukodystrophy.
  • symptoms and hallmarks include hypotonia, nystagmus, optic atrophy, respiratory distress, motor delays, cognitive dysfunction, speech dysfunction, spasticity, ataxia, seizures, choreiform movements, and death.
  • leukodystrophies include Pelizaeus-Merzbacher disease.
  • PLP1 proteolipid protein 1
  • PLP1 is expressed in myelinating oligodendrocytes and oligodendrocyte progenitor cells (OPCs) in the central nervous system (CNS), where it is responsible for about 50% of the total protein content of myelin and in Schwann cells in the peripheral nervous system (PNS) (Klugman, W., et ah, 1997, Neuron 18, 59-70; Harlow, D.E., et al., 2014, J. Neurosci. 34, 1333-1343; Baumann, N., et al., 2001, Physiol. Rev. 81, 871-927).
  • OPCs oligodendrocyte progenitor cells
  • PMD phenotypes include the transitional form of PMD, associated with PLP 1 overexpression or with PLP1 mutations, which combines clinical features of both the classic and connatal forms.
  • 2’-deoxynucleoside means a nucleoside comprising a 2’-H(H) deoxyfuranosyl sugar moiety.
  • a 2’-deoxynucleoside is a 2 - ⁇ -D-dcoxy nucleoside and comprises a 2 ' - ⁇ -D-dcoxyribosyl sugar moiety, which has the ⁇ -D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA).
  • a 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • 2’-MOE means a 2’-OCH 2 CH 2 OCH 3 group in place of the 2’ -OH group of a furanosyl sugar moiety.
  • a “2’-MOE sugar moiety” means a sugar moiety with a 2’-OCH 2 CH 2 OCH 3 group in place of the 2’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-MOE sugar moiety is in the ⁇ -D-ribosyl configuration. “MOE” means O-methoxyethyl.
  • 2’ -MOE nucleoside means a nucleoside comprising a 2’ -MOE sugar moiety.
  • 2’-OMe means a 2’-OCH 3 group in place of the 2’-OH group of a furanosyl sugar moiety.
  • A“2’-O-methy1 sugar moiety” or “2’-OMe sugar moiety” means a sugar moiety with a 2’-OCH 3 group in place of the 2’ OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-OMe sugar moiety is in the ⁇ -D-ribosyl configuration.
  • 2’-OMe nucleoside means a nucleoside comprising a 2’-OMe sugar moiety.
  • 2’ -substituted nucleoside means a nucleoside comprising a 2’ -substituted sugar moiety.
  • 2’-substituted in reference to a sugar moiety means a sugar moiety comprising at least one 2’-substituent group other than H or OH.
  • “ameliorate” in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment.
  • amelioration is the reduction in the severity or frequency of a symptom or hallmark or the delayed onset or slowing of progression in the severity or frequency of a symptom or hallmark.
  • the symptom or hallmark is one or more of hypotonia, nystagmus, optic atrophy, respiratory distress, motor delays, cognitive dysfunction, speech dysfunction, spasticity, ataxia, seizures, choreiform movements, and death.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
  • intemucleoside linkage means the covalent linkage between contiguous nucleosides in an oligonucleotide.
  • modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
  • Phosphorothioate intemucleoside linkage or “PS intemucleoside linkage” is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom.
  • mismatch or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
  • nucleobase means an unmodified nucleobase or a modified nucleobase.
  • an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
  • a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
  • a “5-methyl cytosine” is a modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • nucleobase sequence means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
  • nucleoside means a compound, or a fragment of a compound, comprising a nucleobase and a sugar moiety.
  • the nucleobase and sugar moiety are each, independently, unmodified or modified.
  • modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
  • Modified nucleosides include abasic nucleosides, which lack a nucleobase.
  • Linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
  • oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
  • a “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
  • oligomeric duplex means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”
  • oligonucleotide means a strand of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
  • modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified.
  • unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
  • a pharmaceutical composition means a mixture of substances suitable for administering to a subject.
  • a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • prodrug means a therapeutic agent in a form outside the body that is converted to a different form within a subject or cells thereof.
  • conversion of a prodrug within the subject is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
  • reducing the amount or activity refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.
  • RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • RNAi compound means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
  • ssRNA single-stranded RNA
  • microRNA including microRNA mimics.
  • an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid.
  • RNAi compound excludes antisense compounds that act through RNase H.
  • oligonucleotide that at least partially hybridizes to itself.
  • standard in vitro assay means the assay described in Example 1 and reasonable variations thereof.
  • standard in vivo assay means the assay described in Example 5 and reasonable variations thereof.
  • stereorandom chiral centra in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration.
  • the number of molecules having the ( S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the ( R ) configuration of the stereorandom chiral center.
  • the stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
  • a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.
  • subject means a human or non-human animal.
  • subject and subject are used interchangeably.
  • sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
  • Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
  • target nucleic acid and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.
  • Target RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
  • terapéuticaally effective amount means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject.
  • a therapeutically effective amount improves a symptom or hallmark of a disease or disorder.
  • Embodiment 2 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20- 2155, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
  • Embodiment 3 Embodiment 3.
  • An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to: an equal length portion of nucleobases 9198-9222 of SEQ ID NO: 2; an equal length portion of nucleobases 13702-13766 of SEQ ID NO: 2; an equal length portion of nucleobases 14037-14062 of SEQ ID NO: 2; an equal length portion of nucleobases 16761-16800 of SEQ ID NO: 2; an equal length portion of nucleobases 17558-17602 of SEQ ID NO: 2; an equal length portion of nucleobases 17615-17667 of SEQ ID NO: 2; an equal length portion of nucleobases 17853-17883 of SEQ ID NO:
  • modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
  • Embodiment 5 The oligomeric compound of any of embodiments 1-4, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2 when measured across the entire nucleobase sequence of the modified oligonucleotide.
  • Embodiment 9 The oligomeric compound of any of embodiments 6-8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.
  • Embodiment 10 The oligomeric compound of embodiment 9, wherein the non-bicyclic modified sugar moiety is a 2’- MOE sugar moiety or a 2’-OMe sugar moiety.
  • Embodiment 16 The oligomeric compound of embodiment 15, wherein the modified oligonucleotide comprises: a 5’ -region consisting of 5 linked 5’ -region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3’ -region consisting of 5 linked 3’ -region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides is a 2’-MOE nucleoside, and each of the central region nucleosides is a 2 - ⁇ -D-dcoxy nucleoside.
  • Embodiment 17 The oligomeric compound of embodiment 15, wherein the modified oligonucleotide comprises: a 5’ -region consisting of 6 linked 5’ -region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3’ -region consisting of 4 linked 3’ -region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides is a 2’-MOE nucleoside, and each of the central region nucleosides is a 2 - ⁇ -D-dcoxy nucleoside.
  • Embodiment 22 The oligomeric compound of any of embodiments 18, 20, or 21, wherein each intemucleoside linkage is either a phosphodiester intemucleoside linkage or a phosphorothioate intemucleoside linkage.
  • Embodiment 27 The oligomeric compound of any of embodiments 1-26, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20,14-18, 14-20, 15-17, 15-25, 16-18, 16-20, 17-20, 18-20 or 18-22 linked nucleosides.
  • Embodiment 28 The oligomeric compound of any of embodiments 1-26, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.
  • Embodiment 32 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: (SEQ ID NO: 2101), wherein:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • Embodiment 33 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: (SEQ ID NO: 682), wherein:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2 - ⁇ -D-dcoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • Embodiment 36 The oligomeric compound of any of embodiments 1-35 wherein the oligomeric compound is a singled-stranded oligomeric compound.
  • Embodiment 37 The oligomeric compound of any of embodiments 1-36, consisting of the modified oligonucleotide.
  • Embodiment 38 The oligomeric compound of any of embodiments 1-36, further comprising a conjugate group.
  • Embodiment 39 The oligomeric compound of embodiment 38, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.
  • Embodiment 40 The oligomeric compound of embodiment 38, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.
  • Embodiment 41 The oligomeric compound of embodiment 38 or embodiment 39, wherein the conjugate linker consists of a single bond.
  • Embodiment 42 The oligomeric compound of and of embodiments 39 or embodiment 41, wherein the conjugate linker is cleavable.
  • Embodiment 43 The oligomeric compound of embodiment 39 or embodiment 42, wherein the conjugate linker comprises 1-3 linker-nucleosides.
  • Embodiment 44 The oligomeric compound of any of embodiments 38-43, wherein the conjugate group is attached to the modified oligonucleotide at the 5’ -end of the modified oligonucleotide.
  • Embodiment 45 The oligomeric compound of any of embodiments 38-43, wherein the conjugate group is attached to the modified oligonucleotide at the 3’ -end of the modified oligonucleotide.
  • Embodiment 46 The oligomeric compound of any of embodiments 1-36 or 38-45 further comprising a terminal group.
  • Embodiment 47 The oligomeric compound of any of embodiments 1-42 or 44-46, wherein the oligomeric compound does not comprise linker-nucleosides.
  • Embodiment 48 The oligomeric compound of any of embodiments 1-47, wherein the modified oligonucleotide of the oligomeric compound is a salt, and wherein the salt is a sodium salt or a potassium salt.
  • Embodiment 49 The oligomeric compound of any of embodiments 1-48, wherein the modified oligonucleotide is an RNAi compound.
  • Embodiment 50 An oligomeric duplex comprising an oligomeric compound of any of embodiments 1-35 or 37-49.
  • Embodiment 51 An antisense compound comprising or consisting of an oligomeric compound of any of embodiments 1-49 or an oligomeric duplex of embodiment 50.
  • Embodiment 55 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 56 The modified oligonucleotide of embodiment 55, which is the sodium salt or the potassium salt.
  • Embodiment 57 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 58 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 64 A pharmaceutical composition comprising the oligomeric compound of any of embodiments 1-49, the oligomeric duplex of embodiment 50, the antisense compound of embodiment 51, or the modified oligonucleotide of any of embodiments 52-63 and a pharmaceutically acceptable diluent or carrier.
  • Embodiment 77 The chirally enriched population of embodiment 76, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (S'p) configuration.
  • Embodiment 78 The chirally enriched population of embodiment 76, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (Rp) configuration.
  • Embodiment 79 The chirally enriched population of embodiment 76, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage.
  • Embodiment 84 A chirally enriched population of oligomeric compounds of any of embodiments 32-35, wherein the population is enriched for oligomeric compounds comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.
  • Embodiment 85 The chirally enriched population of embodiment 84, wherein the population is enriched for oligomeric compounds comprising at least one particular phosphorothioate intemucleoside linkage having the (Sp) configuration.
  • Embodiment 125 The method of embodiment 124, wherein the PMD is any of connatal PMD, classic PMD, transitional PMD.
  • Embodiment 134 The method of embodiment 133, wherein the cell is a human cell.
  • Embodiment 138 The use of any of embodiments 133-137, wherein the cell is an oligodendrocyte or an oligodendrocyte progenitor cell.
  • oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides.
  • Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
  • Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage.
  • modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure.
  • Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 4’, and/or 5’ positions.
  • one or more non-bridging substituent of non- bicyclic modified sugar moieties is branched.
  • a 2’ -substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’ -substituent group selected from: F, OCH 3 , and OCH 2 CH 2 OCH 3 .
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an LNA nucleoside (described herein) may be in the ⁇ -L configuration or in the b-D configuration.
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
  • certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5’ position.
  • F-HNA see e.g. Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S. 8,796,437; and Swayze et al., U.S. 9,005,906; F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of the modified THP nucleosides:
  • modified THP nucleosides are provided wherein q 3 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R 1 and R 2 is F. In certain embodiments, R 1 is F and R 2 is H, in certain embodiments, R 1 is methoxy and R 2 is H, and in certain embodiments, R 1 is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et ah, U.S. 5,698,685; Summertonet al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et ah, U.S. 5,034,506).
  • morpholino means a sugar surrogate having the following structure:
  • modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines.
  • modified nucleobases are selected from: 5-methyl cytosine, 2-aminopropyladenine, 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2- thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-CoC-CH 3 ) uracil, 5-propynylcytosine, 6-azouracil, 6- azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7
  • nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine- 2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2-one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in Merigan et ak, U.S.
  • Modified intemucleoside linkages compared to naturally occurring phosphodiester intemucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
  • intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non- phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
  • Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates.
  • Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate intemucleoside linkages in particular stereochemical configurations.
  • populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom.
  • modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate intemucleoside linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkage in a particular, independently selected stereochemical configuration.
  • the particular configuration of the particular phosphorothioate intemucleoside linkage is present in at least 65% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate intemucleoside linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate intemucleoside linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate intemucleoside linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate intemucleoside linkage is present in at least 99% of the molecules in the population.
  • modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS, 2003, 125, 8307, Wan et al., Nuc. Acid. Res., 2014, 42, 13456, and WO 2017/015555.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (RpJ configuration.
  • modified oligonucleotides comprising (Rp) and or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (see, for example: Carbohydrate Modifications in Antisense Research, Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
  • modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another.
  • a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
  • oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or portion thereof in a defined pattern or sugar motif.
  • sugar motifs include but are not limited to any of the sugar modifications discussed herein.
  • modified oligonucleotides have a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.”
  • the three regions of a gapmer motif (the 5’-wing, the gap, and the 3’ -wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
  • the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
  • the sugar moieties within the gap are the same as one another.
  • the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
  • the sugar motifs of the two wings are the same as one another (symmetric gapmer).
  • the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).
  • the wings of a gapmer comprise 1-6 nucleosides.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least five nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • the gap of a gapmer comprises 7-12 nucleosides.
  • each nucleoside of the gap of a gapmer comprises a 2’-deoxyribosyl sugar moiety.
  • at least six nucleosides of the gap of a gapmer comprise a 2 - ⁇ -D-dcoxyribosyl sugar moiety.
  • each nucleoside of the gap of a gapmer comprises a 2 - ⁇ -D-dcoxvribosvl sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a 2’-OMe sugar moiety.
  • the gapmer is a deoxy gapmer.
  • the nucleosides on the gap side of each wing/gap junction comprise 2’-deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties.
  • at least six nucleosides of the gap of a gapmer comprise a 2 - ⁇ -D-dcoxyribosyl sugar moiety.
  • each nucleoside of the gap of a gapmer comprises a 2’-deoxyribosyl sugar moiety.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2’-deoxyribosyl sugar moiety.
  • modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif.
  • each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety.
  • each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
  • modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
  • a fully modified oligonucleotide is a uniformly modified oligonucleotide.
  • each nucleoside of a uniformly modified oligonucleotide comprises the same 2’ -modification.
  • the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5’-wing] - [# of nucleosides in the gap] - [# of nucleosides in the 3’-wing]
  • a 5- 10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap.
  • that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprises a 2 - ⁇ -D-dcoxyribosyl sugar moiety.
  • a 5-10-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’-wing, 10 linked 2 ‘ - ⁇ -D-dco.xy nucleosides in the gap, and 5 linked 2’-MOE nucleosides in the 3’-wing.
  • a 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5’-wing, 10 linked 2 - ⁇ -D- deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3’-wing.
  • a 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5’-wing, 8 linked a 2 - ⁇ -D-dcoxv nucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3 ’-wing.
  • a mixed wing gapmer has at least two different modified sugar moieties in the 5’ and/or the 3’ wing.
  • a 5-8-5 or 5-8-4 mixed wing gapmer has at least two different modified sugar moieties in the 5 ’ - and/or the 3 ’ -wing.
  • modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-10-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 4-10-6 MOE gapmers. In certain embodiments, modified oligonucleotides are 4-8-6 MOE gapmers. In certain embodiments, modified oligonucleotides are 6-8-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 5-8-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-7 MOE gapmers. In certain embodiments, modified oligonucleotides are 7-10-3 MOE gapmers.
  • modified oligonucleotides are 5-8-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 5-9-5 MOE gapmers. In certain embodiments, modified oligonucleotides are X-Y-Z MOE gapmers, wherein X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2’-MOE nucleosides and Y is selected from 7, 8, 9, 10, or 11 linked deoxynucleosides.
  • modified oligonucleotides have the following sugar motif (5’ to 3’): eeeeeddddddddddddeeeee, eeeeeedddddddddeeee, or eeeeedyddddddddeeeee, wherein ‘d’ represents a 2’-deoxyribosyl sugar moiety, ‘e’ represents a 2’-MOE sugar moiety, and ‘y’ represents a 2’-OMe sugar moiety.
  • oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or portion thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified.
  • each purine or each pyrimidine is modified.
  • each adenine is modified.
  • each guanine is modified.
  • each thymine is modified.
  • each uracil is modified.
  • each cytosine is modified.
  • some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines.
  • all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
  • modified oligonucleotides comprise a block of modified nucleobases.
  • the block is at the 3 ’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 ’-end of the oligonucleotide.
  • oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
  • one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
  • the sugar moiety of the nucleoside is a 2’- deoxyribosyl sugar moiety.
  • the modified nucleobase is selected from: a 2-thiopyrimidine and a 5 -propynepy rimidine .
  • oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or portion thereof in a defined pattern or motif.
  • each intemucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage and phosphodiester intemucleoside linkage.
  • each phosphorothioate intemucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate.
  • the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified.
  • the intemucleoside linkages in the wings are unmodified phosphodiester intemucleoside linkages.
  • the terminal intemucleoside linkages are modified.
  • the sugar motif of a modified oligonucleotide is a gapmer, and the intemucleoside linkage motif comprises at least one phosphodiester intemucleoside linkage in at least one wing, wherein the at least one phosphodiester intemucleoside linkage is not a terminal intemucleoside linkage, and the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages.
  • all of the phosphorothioate intemucleoside linkages are stereorandom.
  • all of the phosphorothioate intemucleoside linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one .S'p. Sp, Rp motif.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such intemucleoside linkage motifs.
  • modified oligonucleotides have an intemucleoside linkage motif of soooossssssssooss or sooooosssssssoss wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • oligonucleotide it is possible to increase or decrease the length of an oligonucleotide without eliminating activity.
  • a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target nucleic acid in an oocyte injection model.
  • Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target nucleic acid, albeit to a lesser extent than the oligonucleotides that contained no mismatches.
  • target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
  • oligonucleotides can have any of a variety of ranges of lengths.
  • oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
  • X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
  • oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to
  • oligonucleotides consist of 16 linked nucleosides. In certain embodiments, oligonucleotides consist of 17 linked nucleosides. In certain embodiments, oligonucleotides consist of 18 linked nucleosides. In certain embodiments, oligonucleotides consist of 19 linked nucleosides. In certain embodiments, oligonucleotides consist of 20 linked nucleosides.
  • modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
  • the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif.
  • sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
  • Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for ⁇ -D ribosyl sugar moieties, and all of the phosphorothioate intemucleoside linkages are stereorandom.
  • the modified oligonucleotides of a chirally enriched population are enriched for both ⁇ -D ribosyl sugar moieties and at least one, particular phosphorothioate intemucleoside linkage in a particular stereochemical configuration.
  • oligonucleotides are further described by their nucleobase sequence.
  • oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • a portion of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • the nucleobase sequence of a portion or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
  • oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
  • Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups.
  • conjugate groups or terminal groups are attached at the 3’ and/or 5’ -end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’ -end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3’ -end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’ -end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’ -end of oligonucleotides.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, abasic nucleosides, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • oligonucleotides are covalently attached to one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
  • conjugate groups impart a new properly on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
  • conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino- carbonyl-oxycholesterol moiety (Crooke et al., ./. Pharmacol. Exp.
  • conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C 5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, Cll alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
  • conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
  • Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
  • a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen.
  • an active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen.
  • carprofen dansylsarcosine, 2,3,5- triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
  • Conjugate moieties are attached to oligonucleotides through conjugate linkers.
  • the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
  • a conjugate moiety is attached to an oligonucleotide via a more complex conjugate linker comprising one or more conjugate linker moieties, which are sub- units making up a conjugate linker.
  • the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
  • a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
  • conjugate linkers are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein.
  • a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
  • bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
  • conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxy late (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • ADO 8-amino-3,6-dioxaoctanoic acid
  • SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxy late
  • AHEX or AHA 6-aminohexanoic acid
  • conjugate linkers include but are not limited to substituted or unsubstituted C 1 -C 10 alkyl, substituted or unsubstituted C 2 -C 10 alkenyl or substituted or unsubstituted C 2 -C 10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
  • conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker- nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker- nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
  • a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N- benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N- isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
  • linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
  • an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
  • the total number of contiguous linked nucleosides in such an oligomeric compound is more than 30.
  • an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
  • conjugate linkers comprise no more than 10 linker-nucleosides.
  • conjugate linkers comprise no more than 5 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
  • a conjugate group it is desirable for a conjugate group to be cleaved from the oligonucleotide.
  • oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
  • certain conjugate linkers may comprise one or more cleavable moieties.
  • a cleavable moiety is a cleavable bond.
  • a cleavable moiety is a group of atoms comprising at least one cleavable bond.
  • a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
  • a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
  • a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide.
  • a cleavable bond is one or both of the esters of a phosphodiester.
  • a cleavable moiety comprises a phosphate or phosphodiester.
  • the cleavable moiety is a phosphate or phosphodiester linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • a cleavable moiety comprises or consists of one or more linker-nucleosides.
  • the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
  • such cleavable bonds are unmodified phosphodiester bonds.
  • a cleavable moiety is 2'-deoxynucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphodiester intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate intemucleoside linkage.
  • the cleavable moiety is 2'-deoxyadenosine.
  • a conjugate group comprises a cell-targeting moiety.
  • a conjugate group has the general formula: wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.
  • n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is O andk is l. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.
  • conjugate groups comprise cell-targeting moieties that have at least one tethered ligand.
  • cell-targeting moieties comprise two tethered ligands covalently attached to a branching group.
  • cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.
  • oligomeric compounds comprise one or more terminal groups.
  • oligomeric compounds comprise a stabilized 5’-phosphate.
  • Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’-vinylphosphonates.
  • terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides.
  • terminal groups comprise one or more 2’ -linked nucleosides. In certain such embodiments, the 2’ -linked nucleoside is an abasic nucleoside.
  • oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid.
  • an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex.
  • Such oligomeric duplexes comprise a first oligomeric compound having a portion complementary to a target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound.
  • the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group.
  • Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group.
  • the oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.
  • oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds.
  • antisense compounds have antisense activity when they reduce the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid.
  • Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
  • hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
  • certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
  • the DNA in such an RNA:DNA duplex need not be unmodified DNA.
  • described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity.
  • one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
  • an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
  • RISC RNA-induced silencing complex
  • certain antisense compounds result in cleavage of the target nucleic acid by Argonaute.
  • Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).
  • hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
  • Antisense activities may be observed directly or indirectly.
  • observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid.
  • the target nucleic acid is an endogenous RNA molecule.
  • the target nucleic acid encodes a protein.
  • the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions.
  • the target nucleic acid is a mature mRNA.
  • the target nucleic acid is a pre- mRNA.
  • the target region is entirely within an intron.
  • the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.
  • Gautschi et al J. Natl. Cancer Inst. 93:463-471, March 2001
  • this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res.
  • oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a portion that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the portion of full complementarity is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleobases in length.
  • oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
  • antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
  • selectivity of the oligonucleotide is improved.
  • the mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
  • the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5’-end of the gap region.
  • the mismatch is at position 1, 2, 3, 4, 5, or 6 from the 5’-end of the 5’ wing region or the 3 ’ wing region.
  • oligomeric compounds comprise or consist of an oligonucleotide that is complementary to a target nucleic acid, wherein the target nucleic acid is a PLP1 nucleic acid.
  • the PLP1 nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NM OOl 128834.2) or SEQ ID NO: 2 (GENBANK Accession No. NC_000023.11 truncated from nucleotides 103773001 to 103795000).
  • contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of PLP1 RNA in a cell, and in certain embodiments reduces the amount of PLP1 protein in a cell.
  • contacting a cell with a modified oligonucleotide complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of PLP1 RNA in a cell, and in certain embodiments reduces the amount of PLP1 protein in a cell.
  • the cell is in vitro. In certain embodiments, the cell is in a subject.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of PLP1 RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard in vitro assay.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of PLP1 protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in the standard in vitro assay.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of PLP1 RNA in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
  • an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of PLP1 protein in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
  • Compound No. 1363235 is represented by the following chemical structure:
  • intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester intemucleoside linkages
  • the intemucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages
  • each cytosine is a 5-methyl cytosine.
  • G a guanine nucleobase
  • Compound No. 1523608 is represented by the following chemical notation: (SEQ ID NO: 2145), wherein:
  • intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages
  • the intemucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages
  • each cytosine is a 5-methyl cytosine.
  • Compound No. 1362445 is represented by the following chemical notation: (SEQ ID NO: 134), wherein:
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2 ' - ⁇ -D-dcoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Compound No. 1362449 is characterized as a 5-10-5 MOE gapmer having a sequence (from 5’ to 3’) of ACACAACTCTTTACAACAAA (SEQ ID NO: 411), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2 ‘ - ⁇ -D-dco.xy nucleosides.
  • Compound No. 1362449 is represented by the following chemical notation: (SEQ ID NO: 411), wherein:
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2 ' - ⁇ -D-dcoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Compound No. 1362458 is represented by the following chemical notation: (SEQ ID NO: 934), wherein:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2 - ⁇ -D-dcoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Compound No. 1362602 is characterized as a 5-10-5 MOE gapmer having a sequence (from 5’ to 3’) of GTGTGTTAAAATTGCAATTC (SEQ ID NO: 1238), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2 ‘ - ⁇ -D-dco.xy nucleosides.
  • G a guanine nucleobase
  • Compound No. 1362842 is characterized as a 5-10-5 MOE gapmer having a sequence (from 5’ to 3’) of ATTGCAATTCTATATCAGAA (SEQ ID NO: 2010), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2 ‘ - ⁇ -D-dco.xy nucleosides.
  • Compound No. 1362842 is represented by the following chemical notation: (SEQ ID NO: 2010), wherein:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2 ' - ⁇ -D-dcoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Compound No. 1363013 is characterized as a 5-10-5 MOE gapmer having a sequence (from 5’ to 3’) of ACCAGAGGGCCATCTCAGGT (SEQ ID NO: 881), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2 ‘ - ⁇ -D-dco.xy nucleosides.
  • intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages
  • the intemucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages
  • each cytosine is a 5-methyl cytosine.
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2 ' - ⁇ -D-dcoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages
  • the intemucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages
  • each cytosine is a 5-methyl cytosine.
  • Compound No. 1363398 is represented by the following chemical notation: (SEQ ID NO: 1050), wherein:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages
  • the intemucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages
  • each cytosine is a 5-methyl cytosine.
  • Compound No. 1363557 is represented by the following chemical notation: (SEQ ID NO: 1449), wherein:
  • A an adenine nucleobase
  • mC a 5-methyl cytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2’-MOE sugar moiety
  • d a 2 - ⁇ -D-dcoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • nucleobases in the ranges specified below comprise a hotspot region of PLP1 nucleic acid.
  • modified oligonucleotides that are complementary to a portion of a hotspot region of PLP1 nucleic acid achieve an average of 50% or greater reduction of PLP1 RNA in vitro in the standard in vitro assay.
  • modified oligonucleotides that are complementary to a portion of a hotspot region of PLP1 nucleic acid achieve an average of 50% or greater reduction of PLP1 RNA in vivo in the standard in vivo assay.
  • nucleobases 9198-9222 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 9198-9222 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length. In certain embodiments, modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 1050, 1124, 2145, 2151, 2152, and 2153 are complementary to a portion of nucleobases 9198-9222 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1363398, 1363516, 1523604, 1523605, 1523606, 1523607, 1523608, and 1523609 are complementary to a portion of nucleobases 9198-9222 of SEQ ID NO: 2.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 ' - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 36, 86, 114, 164, 191, 242, 269, 426, 523, 602, 691, and 780 are complementary to a portion of nucleobases 13702-13766 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1218139, 1218140, 1218141, 1218142, 1218341, 1218342, 1218343, 1362839, 1363565, 1363589, 1363758, and 1364150 are complementary to a portion of nucleobases 13702- 13766 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 13702-13766 of SEQ ID NO: 2 achieve at least 60% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 13702-13766 of SEQ ID NO: 2 achieve an average of 68.6% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 14037-14062 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 14037-14062 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 89, 167, 245, 322, and 323 are complementary to a portion of nucleobases 14037-14062 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1218352, 1218353, 1218354, 1362909, 1362866, 1218355, and 1218356 are complementary to a portion of nucleobases 14037-14062 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 14037-14062 of SEQ ID NO: 2 achieve at least 64% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 14037-14062 of SEQ ID NO: 2 achieve an average of 79.9% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 16761-16800 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 16761-16800 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 720, 808, 904, 937, 1058, 1097, 1184, 1278, and 1340 are complementary to a portion of nucleobases 16761-16800 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1362547, 1362649, 1362825, 1363052, 1363131, 1363205, 1363559, 1363590, and 1363607 are complementary to a portion of nucleobases 16761-16800 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 16761-16800 of SEQ ID NO: 2 achieve at least 60% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 16761-16800 of SEQ ID NO: 2 achieve an average of 70.7% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 17558-17602 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 17558-17602 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 ' - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 40, 41, 117, 118, 195, 196, 273, 274, 588, 690 are complementary to a portion of nucleobases 17558-17602 of SEQ ID NO: 2.
  • nucleobase sequence of Compound Nos.: 1218154, 1218155, 1218156, 1218157, 1218158, 1218159, 1218160, 1218161, 1363257, 1363439, and 1363756 are complementary to a portion of nucleobases 17558-17602 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 17558-17602 of SEQ ID NO: 2 achieve at least 62% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 17558-17602 of SEQ ID NO: 2 achieve an average of 74.6% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 17615-17667 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 17615-17667 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 ' -(l-D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 42, 43, 119, 120, 197, 198, 275, 276, 373, 460, 1431, 1542, 1645, 1850, 1965, and 2109 are complementary to a portion of nucleobases 17615-17667 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1218162, 1218163, 1218164, 1218165, 1218166, 1218167, 1218168, 1218169, 1362484, 1362497, 1362517, 1362591, 1362749, 1362970, 1363246, 1363342, 1363415, 1363474, 1363544, 1363725, and 1363736 are complementary to a portion of nucleobases 17615-17667 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 17615-17667 of SEQ ID NO: 2 achieve at least 28% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 17615-17667 of SEQ ID NO: 2 achieve an average of 74.4% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 17853-17883 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 17853-17883 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 1451, 1499, 1543, 1654, 1733, 2154, and 2155 are complementary to a portion of nucleobases 17853-17883 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1362611, 1363392, 1363557, 1363795, 1364094, 1523610, 1523611, 1523612, and 1523613 are complementary to a portion of nucleobases 17853-17883 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 17853-17883 of SEQ ID NO: 2 achieve at least 65% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 17853-17883 of SEQ ID NO: 2 achieve an average of 73.5% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 18097-18160 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 18097-18160 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 200, 420, 504, 620, 646, 709, 823, 980, 1029, 1149, 1196, 1253, 1323, 1423, 1476, 1605, 1613, 1728, and 1832 are complementary to a portion of nucleobases 18097-18160 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1218175, 1362441, 1362447, 1362750, 1362769, 1362774, 1362926, 1362945, 1362957, 1362963, 1362967, 1363191, 1363253, 1363427, 1363489, 1363691, 1363993, 1364083, 1364097, and 1364099 are complementary to a portion of nucleobases 18097-18160 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 18097-18160 of SEQ ID NO: 2 achieve at least 53% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18097-18160 of SEQ ID NO: 2 achieve an average of 70.1% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 18206-18237 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 18206-18237 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 ' - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of 45, 46, 123, 124, 201, 202, 279, 280, 538, 562, and 2091 are complementary to a portion of nucleobases 18206-18237 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1218177, 1218178, 1218179, 1218180, 1218181, 1218182, 1218183, 1218184, 1362490, 1362584, 1362927, 1363103, 1363121, 1363314, and 1363983 are complementary to a portion of nucleobases 18206-18237 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 18206-18237 of SEQ ID NO: 2 achieve at least 64% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18206-18237 of SEQ ID NO: 2 achieve an average of 81.8% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 18237-18340 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 18237-18340 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 ' - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 48, 49, 50, 51, 52, 53, 125, 126, 127, 128, 129, 130, 131, 203, 204, 205, 206, 207, 208, 281, 282, 283, 284, 285, 286, 414, 459, 485, 503, 579, 580, 693, 724, 840, 873, 911, 1034, 1081, 1125, 1159, 1318, 1413, 1513, 1548, 1672, 1701, 1794, 1868, 1958, and 2002 are complementaiy to a portion of nucleobases 18237-18340 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos. 1218186, 1218187, 1218188, 1218189, 1218190, 1218191, 1218192, 1218193, 1218194, 1218195, 1218196, 1218197, 1218198, 1218199, 1218200, 1218201, 1218202, 1218203,
  • 1363856, 1363872, 1363884, 1364129, 1364227, and 1364246 are complementary to a portion of nucleobases 18237- 18340 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 18237-18340 of SEQ ID NO: 2 achieve at least 44% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18237-18340 of SEQ ID NO: 2 achieve an average of 70.9% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 18350-18387 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 18350-18387 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 -(l-D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 209, 287, 335, 439, 506, 606, 659, 1922, 2033, and 2104 are complementary to a portion of nucleobases 18350-18387 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1218211, 1218212, 1362567, 1362579, 1362987, 1363166, 1363184, 1363310, 1363502, and 1363644 are complementary to a portion of nucleobases 18350-18387 of SEQ ID NO: 2
  • modified oligonucleotides complementary to a portion of nucleobases 18350-18387 of SEQ ID NO: 2 achieve at least 64% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18350-18387 of SEQ ID NO: 2 achieve an average of 76.2% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 18412-18469 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 18412-18469 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 ‘ - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 784, 842, 869, 978, 1082, 1131, 1218, 1250, 1320, 1453, 1529, 1538, 1616, 1712, and 1821 are complementary to a portion of nucleobases 18412-18469 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1362519, 1362535, 1362684, 1362724, 1362885, 1363026, 1363457, 1363648, 1363838, 1363887, 1363933, 1364125, 1364192, 1364197, and 1364255 are complementaiy to a portion of nucleobases 18412-18469 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 18412-18469 of SEQ ID NO: 2 achieve at least 67% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18412-18469 of SEQ ID NO: 2 achieve an average of 75% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 18461-18506 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 18461-18506 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 ‘ - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 54, 55, 132, 133, 210, 288, 419, 499, 564, 665, 764, 800, 881, 993, 1059, 1200, 1295, 1354, 1422, 1465, 1544, 1705, 1802, and 2149 are complementary to a portion of nucleobases 18461- 18506 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1218213, 1218214, 1218215, 1218216, 1218217, 1218218, 1362618, 1362620, 1362632, 1362704, 1362718, 1362815, 1363013, 1363023, 1363128, 1363328, 1363400, 1363431, 1363519, 1363533, 1363570, 1363709, 1363762, 1363975, 1364180, 1523591, 1523592, and 1523593 are complementary to a portion of nucleobases 18461-18506 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 18461-18506 of SEQ ID NO: 2 achieve at least 40% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18461-18506 of SEQ ID NO: 2 achieve an average of 69.7% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 18539-18579 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 18539-18579 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 ‘ - ⁇ -D-dco. ⁇ yribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 338, 438, 525, 604, 658, 758, 813, 887, 977, 1043, 1108, 1199, 1258, 1336, 1395, 1514, 1557, 1668, 1697, and 2089 are complementary to a portion of nucleobases 18539-18579 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1362619, 1362637, 1362652, 1362830, 1362901, 1363079, 1363118, 1363143, 1363145, 1363146, 1363176, 1363193, 1363287, 1363422, 1363451, 1363569, 1363592, 1363611, 1363796, and 1363860 are complementary to a portion of nucleobases 18539-18579 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 18539-18579 of SEQ ID NO: 2 achieve at least 62% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18539-18579 of SEQ ID NO: 2 achieve an average of 68.8% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 18697-18727 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 18697-18727 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 ‘ - ⁇ -D-dco. ⁇ yribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 875, 934, 1047, 1110, 1229, 1243, 1373, 1438, 2146, and 2147 are complementary to a portion of nucleobases 18697-18727 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1362458, 1362696, 1362878, 1363179, 1363351, 1363697, 1364107, 1364147, 1523584, 1523586, and 1523587 are complementary to a portion of nucleobases 18697-18727 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 18697-18727 of SEQ ID NO: 2 achieve at least 66% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18697-18727 of SEQ ID NO: 2 achieve an average of 77.7% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 18755-18793 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 18755-18793 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 ‘ - ⁇ -D-dco. ⁇ yribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 761, 798, 890, 946, 1022, 1120, 1198, 1293, 1358, 1398, and 1463 are complementary to a portion of nucleobases 18755-18793 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1362575, 1362680, 1362689, 1362856, 1363019, 1363172, 1363357, 1363391, 1363591, 1363639, and 1363889 are complementary to a portion of nucleobases 18755-18793 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 18755-18793 of SEQ ID NO: 2 achieve at least 65% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18755-18793 of SEQ ID NO: 2 achieve an average of 77.7% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 18797-18819 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 18797-18819 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 56, 134, 683, and 718 are complementary to a portion of nucleobases 18797-18819 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1218221, 1218222, 1362445, 1362612, 1363487, and 1363656 are complementary to a portion of nucleobases 18797-18819 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 18797-18819 of SEQ ID NO: 2 achieve at least 65% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18797-18819 of SEQ ID NO: 2 achieve an average of 75.4% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 18839-18862 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 18839-18862 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 1610, 1663, 1702, and 1786 are complementary to a portion of nucleobases 18839-18862 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1363076, 1362712, 1363649, and 1364195 are complementary to a portion of nucleobases 18839-18862 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 18839-18862 of SEQ ID NO: 2 achieve at least 66% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18839-18862 of SEQ ID NO: 2 achieve an average of 72.8% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 18974-19021 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 18974-19021 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 212, 1060, 1090, 1181, 1277, 1446, 1510, 1589, 1646, 1693, 1772, and 2148 are complementary to a portion of nucleobases 18974-19021 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1218223, 1362460, 1362600, 1362805, 1362892, 1363007, 1363316, 1363581, 1363642, 1363664, 1363773, 1363984, 1523588, 1523589, and 1523590 are complementaiy to a portion of nucleobases 18974-19021 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 18974-19021 of SEQ ID NO: 2 achieve at least 54% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 18974-19021 of SEQ ID NO: 2 achieve an average of 71.5% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 19028-19080 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 19028-19080 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 -(l-D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 57, 586, 666, 714, 812, 914, 951, 1052, 1138, 1162, 1248, 1363, and 1455 are complementary to a portion of nucleobases 19028-19080 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1218225, 1362492, 1362565, 1362817, 1362846, 1363141, 1363160, 1363346, 1363453, 1363550, 1363765, 1363835, 1363883, and 1364201 are complementary to a portion of nucleobases 19028-19080 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 19028-19080 of SEQ ID NO: 2 achieve at least 58% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19028-19080 of SEQ ID NO: 2 achieve an average of 73.5% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 19146-19173 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 19146-19173 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 385, 416, 545, 621, 682, 1968, 2055, 2101, and 2150 are complementary to a portion of nucleobases 19146-19173 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1362670, 1363235, 1363627, 1363734, 1363940, 1364008, 1364066, 1523601, 1523602, and 1523603 are complementary to a portion of nucleobases 19146-19173 of SEQ ID NO: 2
  • modified oligonucleotides complementary to a portion of nucleobases 19148-19173 of SEQ ID NO: 2 achieve at least 54% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19146-19173 of SEQ ID NO: 2 achieve an average of 77.3% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 19228-19253 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 19228-19253 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 363, 467, 541, 2008, and 2111 are complementary to a portion of nucleobases 19228-19253 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1364015, 1363882, 1363157, 1363485, and 1362808 are complementary to a portion of nucleobases 19228-19253 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 19228-19253 of SEQ ID NO: 2 achieve at least 69% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19228-19253 of SEQ ID NO: 2 achieve an average of 77.4% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 19347-19393 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 19347-19393 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 ‘ - ⁇ -D-dco. ⁇ yribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 58, 59, 136, 213, 214, 291, 292, 383, 417, 519, 612, 671, 730, 900, 986, 1019, 1136, 1353, 1457, 1504, 1546, and 2093 are complementary to a portion of nucleobases 19347-19393 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1218227, 1218228, 1218229, 1218230, 1218231, 1218232, 1218233, 1362526, 1362624, 1362677, 1362685, 1362799, 1362806, 1363094, 1363419, 1363425, 1363472, 1363499, 1363597, 1363628, 1363681, 1363744, 1363759, 1363800, and 1364257 are complementary to a portion of nucleobases 19347-19393 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 19347-19393 of SEQ ID NO: 2 achieve at least 52% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19347-19393 of SEQ ID NO: 2 achieve an average of 71.6% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 19500-19523 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 19500-19523 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 398, 435, 2095, 2010, and 2144 are complementary to a portion of nucleobases 19500-19523 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1362842, 1363110, 1363153, 1363982, 1523594, and 1523595 are complementary to a portion of nucleobases 19500-19523 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 19500-19523 of SEQ ID NO: 2 achieve at least 62% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19500-19523 of SEQ ID NO: 2 achieve an average of 69.5% reduction of PLP1 RNA in the standard in vitro assay.
  • nucleobases 19512-19534 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to a portion of nucleobases 19512-19534 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 16, 17, 18, 19, 20, 21, or 22 nucleobases in length.
  • modified oligonucleotides consist of 17-19 or 21-30 linked nucleosides.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers. In certain embodiments, the gapmers are 5-10-5 MOE gapmers. In certain embodiments, the gapmers are 6-10-4 MOE gapmers. In certain embodiments, the gapmers are 4-10-6 MOE gapmers. In certain embodiments, the gapmers are 4-8-6 MOE gapmers. In certain embodiments, the gapmers are 6-8-4 MOE gapmers. In certain embodiments, the gapmers are 5-8-5 MOE gapmers.
  • the gapmers have the sugar motif in order from 5’ to 3’: eeeeeddddddddddeeeee or eeeeeedddddddddeeee, wherein ‘d’ represents a 2 ‘ - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers comprise a 2’-substituted nucleoside in the gap.
  • the 2’ -substituted nucleoside comprises a 2’-OMe sugar moiety.
  • the 2’ -substituted nucleoside is at position 2 of the gap (5’ to 3’).
  • all of the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages. In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the phosphodiester (“o”) and phosphorothioate (“s”) intemucleoside linkages are arranged in the order from 5’ to 3’: soooosssssssssooss or sooooosssssssoss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 1201, 1238, 1341, and 1435 are complementary to a portion of nucleobases 19512-19534 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos.: 1362602 , 1363268, 1363452, and 1363678 are complementary to a portion of nucleobases 19512-19534 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to a portion of nucleobases 19512-19534 of SEQ ID NO: 2 achieve at least 63% reduction of PLP1 RNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 19512-19534 of SEQ ID NO: 2 achieve an average of 80% reduction of PLP1 RNA in the standard in vitro assay.
  • RNA nucleoside comprising a 2 ’-OH sugar moiety and a thymine base
  • nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.
  • Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as ( R ) or ( S ), as a or b such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
  • Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
  • Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
  • Oligomeric compounds described herein include chirally pure or enriched mixtures as well as racemic mixtures.
  • Oligomeric compounds having a plurality of phosphorothioate intemucleoside linkages include such compounds in which chirality of the phosphorothioate intemucleoside linkages is controlled or is random.
  • compounds described herein are intended to include corresponding salt forms.
  • the compounds described herein include variations in which one or more atoms are replaced with a non- radioactive isotope or radioactive isotope of the indicated element.
  • compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1 H hydrogen atoms.
  • Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 1 H, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 O or 18 O in place of 16 O, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
  • non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
  • radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
  • Example 1 Effect of 5-10-5 MOE gapmer modified oligonucleotides on human PLP1 RNA in vitro, single dose
  • Modified oligonucleotides complementary to human PLP1 nucleic acid were designed and tested for their single dose effects on PLP1 RNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had the same culture conditions, and the results for each experiment are presented in separate tables below.
  • the modified oligonucleotides in the tables below are 5-10-5 MOE gapmers.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2 ’ - ⁇ -D-deoxynucleosides and the 5 ’ and 3 ’ wing segments each consists of five 2’-MOE modified nucleosides.
  • the sugar motif for the gapmers is (from 5’ to 3’): eeeeedddddddddddeeeee; wherein ‘d’ represents a 2 ‘ - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the intemucleoside linkages throughout each modified oligonucleotide are phosphorothioate intemucleoside linkages. Each cytosine residue is a 5-methyl cytosine.
  • “Start site” indicates the 5’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the Tables below is 100% complementary to either human PLP1 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No.
  • NM OOl 128834.2 or to the human PLP1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NC 000023.11 truncated from nucleotides 103773001 to 103795000), or to both.
  • SEQ ID NO: 2 GenBANK Accession No. NC 000023.11 truncated from nucleotides 103773001 to 103795000
  • N/A indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • SK-MEL-28 cells were treated with modified oligonucleotide at a concentration of 7,000 nM using electroporation at a density of 20,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and PLP1 RNA levels were measured by quantitative real-time RTPCR. PLP1 RNA levels were measured by Human PLP1 primer probe set RTS35092 (forward sequence CTGATGCCAGAATGTATGGTGT, designated herein as SEQ ID NO: 11; reverse sequence AGGTGGAAGGTCATTTGGAAC, designated herein as SEQ ID NO: 12; probe sequence TGCAGATGGACAGAAGGTTGGAGC, designated herein as SEQ ID NO: 13).
  • RTS35092 forward sequence CTGATGCCAGAATGTATGGTGT, designated herein as SEQ ID NO: 11
  • reverse sequence AGGTGGAAGGTCATTTGGAAC designated herein as SEQ ID NO: 12
  • probe sequence TGCAGATGGACAGAAGGTTGGAGC designated herein as SEQ
  • PLP1 RNA levels were normalized to total RNA content, as measured by RIBOGREEN ® . Reduction of PLP1 RNA is presented in the tables below as percent PLP1 RNA relative to the amount in untreated control cells (% UTC). Each table represents results from an individual assay plate. The values marked with an “ ⁇ ” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
  • Example 2 Effect of 5-10-5 MOE gapmer modified oligonucleotides on human PLP1 RNA in vitro, single dose
  • Modified oligonucleotides complementary to human PLP1 nucleic acid were designed and tested for their single dose effects on PLP1 RNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had the same culture conditions, and the results for each experiment are presented in separate tables below.
  • the modified oligonucleotides in the tables below are 5-10-5 MOE gapmers.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2’- ⁇ -D-deoxynucleosides and the 5’ and 3’ wing segments each consists of five 2’-MOE modified nucleosides.
  • the sugar motif for the gapmers is (from 5’ to 3’): eeeeedddddddddddeeeee; wherein ‘d’ represents a 2 ‘ - ⁇ -D-dcoxyribosyl sugar moiety, and ‘e’ represents a 2’-MOE sugar moiety.
  • the intemucleoside linkage motif for the gapmers is (from 5’ to 3 ’): “soooossssssssooss”; wherein each ‘o’ represents a phosphodiester intemucleoside linkage and each ‘s’ represents a phosphorothioate intemucleoside linkage.
  • Each cytosine residue is a 5-methyl cytosine.
  • “Start site” indicates the 5’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the Tables below is 100% complementary to either human PLP1 mRNA (SEQ ID NO: 1) or to the human PLP1 genomic sequence ( SEQ ID NO: 2) , or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • SK-MEL-28 cells were treated with modified oligonucleotide at a concentration of 4,000 nM using electroporation at a density of 20,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and PLP1 RNA levels were measured by quantitative real-time RTPCR. PLP1 RNA levels were measured by Human PLP1 primer probe set RTS35092, described in Example 1 above. PLP1 RNA levels were normalized to total RNA content, as measured by RIBOGREEN ® . Reduction of PLP1 RNA is presented in the tables below as percent PLP1 RNA relative to the amount in untreated control cells (% UTC). Each table represents results from an individual assay plate.
  • the values marked with an “ ⁇ ” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
  • Example 3 Effect of modified oligonucleotides on human PLP1 RNA in vitro, multiple doses
  • Modified oligonucleotides selected from the examples above were tested at various doses in SK-MEL-28 cells. Cultured SK-MEL-28 cells at a density of 20,000 cells per well were transfected using electroporation with concentrations of modified oligonucleotides as specified in the tables below. After a treatment period of approximately
  • Human PLP1 primer probe set RTS35092 was used to measure RNA levels, as described above.
  • PLP1 RNA levels were normalized to total RNA content, as measured by RIBOGREEN ® .
  • the modified oligonucleotides were tested in a series of experiments using the same culture conditions, and the results for each experiment are presented in separate tables below. Reduction of PLP1 RNA is presented in the tables below as percent PLP1 RNA relative to the amount in untreated control cells (% UTC).
  • Modified oligonucleotides complementary to a human PLP1 nucleic acid were designed, as described in the table below. “Start site” indicates the 5’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • the modified oligonucleotides in Table 40 are 6-10-4 MOE gapmers.
  • the gapmers are 20 nucleosides in length, wherein the sugar motif for the gapmers is (from 5’ to 3’): eeeeeeddddddddddeeee; wherein each ‘d’ represents a 2 ‘ - ⁇ -D-dco. ⁇ yribosyl sugar moiety, and each ‘e’ represents a 2’-MOE sugar moiety.
  • the gapmers have an intemucleoside linkage motif of (from 5’ to 3’): sooooossssssssoss; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine residue is a 5- methyl cytosine.
  • Example 5 Activity of modified oligonucleotides complementary to human PLP1 in transgenic mice
  • Modified oligonucleotides selected from the examples above were tested in a human BAC wild type PLP1 transgenic mouse model.
  • a bacterial artificial chromosome (BAC) subclone carrying the human Plpl gene, including down- and up-stream regulatory elements was identified.
  • Full gene sequencing confirmed the presence of the human genomic region corresponding to current NCBI refseq assembly GRCh38.pl3, ChrX sequence NC 000023.11 at position 103776506..103792619.
  • the BAC subclone was introduced via pronuclear injection into the Taconic Biosciences C57BL/6N Tac ES cell line. Line C57BL/6NTac-Tg(PLPl)1483Tac-17235 was generated and used in these experiments. Human Plpl mRNA expression was found in the brain and spinal cord.
  • the PLP1 transgenic mice were divided into groups of 2 mice each. Each mouse received a single intracerebroventricular (ICV) bolus of 100 ⁇ g of modified oligonucleotide. A group of 3-5 mice received PBS as a negative control.
  • ICV intracerebroventricular
  • mice Two weeks post treatment, mice were sacrificed and RNA was extracted from cortical brain tissue, spinal cord, and/or cerebellum for RTPCR analysis to measure the amount of PLP1 RNA using human primer probe set RTS48932 (forward sequence TGCACCAGTCATCAGCTATTC, designated herein as SEQ ID NO: 14; reverse sequence AGACTGAAATCTGGGAGCTATTC, designated herein as SEQ ID NO: 15; probe sequence AGGTCTCAAACTCTTTCTGCCTGTCC designated herein as SEQ ID NO: 16). Results are presented as percent human PLP1 RNA relative to PBS control, normalized to mouse GAPDH.
  • GAPDH was amplified using primer probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, designated herein as SEQ ID NO: 17; reverse sequence GGGTCTCGCTCCTGGAAGAT, designated herein as SEQ ID NO: 18; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, designated herein as SEQ ID NO: 19).
  • Example 6 Potency of modified oligonucleotides complementary to human PLP1 in transgenic mice
  • Modified oligonucleotides selected from the examples above were tested in a human BAC wild type PLP1 transgenic mouse model (described herein above).
  • mice were divided into groups of 4 mice each. Each mouse received a single intracerebroventricular (ICV) bolus of modified oligonucleotide at the doses indicated in the table below. A group of 4 mice received PBS as a negative control.
  • ICV intracerebroventricular
  • RNA analysis Two weeks post treatment, mice were sacrificed and RNA was extracted from spinal cord and cortical brain tissue for RTPCR analysis to measure the amount of PLP1 RNA using human primer probe sets RTS48932 (described herein above) and RTS48933 (forward sequence CCCTAACTCAGCCAACCTTAC, designated herein as SEQ ID NO: 5; reverse sequence C ACCCTGTTTCTCTTCCCTA AC, designated herein as SEQ ID NO: 6; probe sequence AGGGAGCGTAGAATCTGTGTAGACGA, designated herein as SEQ ID NO: 7). Results are presented as percent human PLP1 RNA relative to PBS control, normalized to mouse GAPDH. GAPDH was amplified using primer probe set mGapdh_LTS00102 (described herein above).
  • Modified oligonucleotides selected from the examples above were tested at various doses in SK-MEL-28 cells (American Type Culture Collection). Cultured SK-MEL-28 cells at a density of 20,000 cells per well were transfected using electroporation with concentrations of modified oligonucleotides as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and PLP1 RNA levels were measured by quantitative real-time RTPCR. PLP1 RNA levels were measured by quantitative real-time RTPCR using human primer- probe set RTS35092, described in Example 1 above. PLP1 RNA levels were normalized to human GAPDH, amplified using primer probe set RTS 104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO:
  • PLP1 RNA Reduction of PLP1 RNA is presented in the table below as percent PLP1 RNA relative to the amount in untreated control cells (% UTC).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Neurosurgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Neurology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Liquid Crystal Substances (AREA)
  • Saccharide Compounds (AREA)
PCT/US2021/039651 2020-06-29 2021-06-29 Compounds and methods for modulating plp1 Ceased WO2022006134A2 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
MX2022016338A MX2022016338A (es) 2020-06-29 2021-06-29 Compuestos y metodos para modular la plp1.
AU2021299290A AU2021299290A1 (en) 2020-06-29 2021-06-29 Compounds and methods for modulating PLP1
CA3185749A CA3185749A1 (en) 2020-06-29 2021-06-29 Compounds and methods for modulating plp1
BR112022024206A BR112022024206A2 (pt) 2020-06-29 2021-06-29 Compostos e métodos para modular plp1
EP21833921.6A EP4172338A4 (en) 2020-06-29 2021-06-29 COMPOUNDS AND METHODS FOR MODULATING PLP1
IL298530A IL298530A (en) 2020-06-29 2021-06-29 Compounds and methods for modulating plp1
JP2022581012A JP7799640B2 (ja) 2020-06-29 2021-06-29 Plp1を調節するための化合物及び方法
KR1020237002412A KR20230029837A (ko) 2020-06-29 2021-06-29 Plp1을 조절하기 위한 화합물 및 방법
CN202180045669.0A CN116096899A (zh) 2020-06-29 2021-06-29 调节plp1的化合物和方法
JP2025283671A JP2026062868A (ja) 2020-06-29 2025-12-26 Plp1を調節するための化合物及び方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202063045740P 2020-06-29 2020-06-29
US63/045,740 2020-06-29
US202063124476P 2020-12-11 2020-12-11
US63/124,476 2020-12-11

Publications (2)

Publication Number Publication Date
WO2022006134A2 true WO2022006134A2 (en) 2022-01-06
WO2022006134A3 WO2022006134A3 (en) 2022-02-10

Family

ID=79315556

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/039651 Ceased WO2022006134A2 (en) 2020-06-29 2021-06-29 Compounds and methods for modulating plp1

Country Status (12)

Country Link
US (2) US11732263B2 (https=)
EP (1) EP4172338A4 (https=)
JP (2) JP7799640B2 (https=)
KR (1) KR20230029837A (https=)
CN (1) CN116096899A (https=)
AU (1) AU2021299290A1 (https=)
BR (1) BR112022024206A2 (https=)
CA (1) CA3185749A1 (https=)
IL (1) IL298530A (https=)
MX (1) MX2022016338A (https=)
TW (1) TW202216996A (https=)
WO (1) WO2022006134A2 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11732263B2 (en) 2020-06-29 2023-08-22 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating PLP1

Family Cites Families (176)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US5132418A (en) 1980-02-29 1992-07-21 University Patents, Inc. Process for preparing polynucleotides
US4500707A (en) 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4973679A (en) 1981-03-27 1990-11-27 University Patents, Inc. Process for oligonucleo tide synthesis using phosphormidite intermediates
US4415732A (en) 1981-03-27 1983-11-15 University Patents, Inc. Phosphoramidite compounds and processes
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
DE3329892A1 (de) 1983-08-18 1985-03-07 Köster, Hubert, Prof. Dr., 2000 Hamburg Verfahren zur herstellung von oligonucleotiden
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
USRE34036E (en) 1984-06-06 1992-08-18 National Research Development Corporation Data transmission using a transparent tone-in band system
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
FR2567892B1 (fr) 1984-07-19 1989-02-17 Centre Nat Rech Scient Nouveaux oligonucleotides, leur procede de preparation et leurs applications comme mediateurs dans le developpement des effets des interferons
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
FR2575751B1 (fr) 1985-01-08 1987-04-03 Pasteur Institut Nouveaux nucleosides de derives de l'adenosine, leur preparation et leurs applications biologiques
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5506337A (en) 1985-03-15 1996-04-09 Antivirals Inc. Morpholino-subunit combinatorial library and method
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
EP0260032B1 (en) 1986-09-08 1994-01-26 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
EP0366685B1 (en) 1987-06-24 1994-10-19 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US4924624A (en) 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
ATE151467T1 (de) 1987-11-30 1997-04-15 Univ Iowa Res Found Durch modifikationen an der 3'-terminalen phosphodiesterbindung stabilisierte dna moleküle, ihre verwendung als nukleinsäuresonden sowie als therapeutische mittel zur hemmung der expression spezifischer zielgene
US5403711A (en) 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
JPH03503894A (ja) 1988-03-25 1991-08-29 ユニバーシィティ オブ バージニア アランミ パテンツ ファウンデイション オリゴヌクレオチド n‐アルキルホスホラミデート
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
DE69034150T2 (de) 1989-10-24 2005-08-25 Isis Pharmaceuticals, Inc., Carlsbad 2'-Modifizierte Oligonukleotide
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5177198A (en) 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5587470A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. 3-deazapurines
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5457191A (en) 1990-01-11 1995-10-10 Isis Pharmaceuticals, Inc. 3-deazapurines
US5859221A (en) 1990-01-11 1999-01-12 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US6005087A (en) 1995-06-06 1999-12-21 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US7101993B1 (en) 1990-01-11 2006-09-05 Isis Pharmaceuticals, Inc. Oligonucleotides containing 2′-O-modified purines
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
GB9009980D0 (en) 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
ES2116977T3 (es) 1990-05-11 1998-08-01 Microprobe Corp Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente.
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
JPH0874B2 (ja) 1990-07-27 1996-01-10 アイシス・ファーマシューティカルス・インコーポレーテッド 遺伝子発現を検出および変調するヌクレアーゼ耐性、ピリミジン修飾オリゴヌクレオチド
US5386023A (en) 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5223618A (en) 1990-08-13 1993-06-29 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
MY107332A (en) 1990-08-03 1995-11-30 Sterling Drug Inc Compounds and methods for inhibiting gene expression.
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
JPH06505704A (ja) 1990-09-20 1994-06-30 ギリアド サイエンシズ,インコーポレイテッド 改変ヌクレオシド間結合
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5948903A (en) 1991-01-11 1999-09-07 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
US7015315B1 (en) 1991-12-24 2006-03-21 Isis Pharmaceuticals, Inc. Gapped oligonucleotides
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
EP0538194B1 (de) 1991-10-17 1997-06-04 Novartis AG Bicyclische Nukleoside, Oligonukleotide, Verfahren zu deren Herstellung und Zwischenprodukte
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
AU3222793A (en) 1991-11-26 1993-06-28 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
TW393513B (en) 1991-11-26 2000-06-11 Isis Pharmaceuticals Inc Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5792608A (en) 1991-12-12 1998-08-11 Gilead Sciences, Inc. Nuclease stable and binding competent oligomers and methods for their use
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
FR2687679B1 (fr) 1992-02-05 1994-10-28 Centre Nat Rech Scient Oligothionucleotides.
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
EP0577558A2 (de) 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
GB9304620D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Compounds
CA2159631A1 (en) 1993-03-30 1994-10-13 Sanofi Acyclic nucleoside analogs and oligonucleotide sequences containing them
HU9501974D0 (en) 1993-03-31 1995-09-28 Sterling Winthrop Inc Oligonucleotides with amide linkages replacing phosphodiester linkages
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
DE733059T1 (de) 1993-12-09 1997-08-28 Univ Jefferson Verbindungen und verfahren zur ortsspezifischen mutation in eukaryotischen zellen
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5646269A (en) 1994-04-28 1997-07-08 Gilead Sciences, Inc. Method for oligonucleotide analog synthesis
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
CN1120707C (zh) 1995-11-22 2003-09-10 约翰斯·霍普金斯大学 增强生物分子的细胞摄取的配体
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
USRE44779E1 (en) 1997-03-07 2014-02-25 Santaris Pharma A/S Bicyclonucleoside and oligonucleotide analogues
US7572582B2 (en) 1997-09-12 2009-08-11 Exiqon A/S Oligonucleotide analogues
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6300319B1 (en) 1998-06-16 2001-10-09 Isis Pharmaceuticals, Inc. Targeted oligonucleotide conjugates
US6043352A (en) 1998-08-07 2000-03-28 Isis Pharmaceuticals, Inc. 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US7491805B2 (en) 2001-05-18 2009-02-17 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US6426220B1 (en) 2000-10-30 2002-07-30 Isis Pharmaceuticals, Inc. Antisense modulation of calreticulin expression
US6372492B1 (en) * 2000-10-30 2002-04-16 Isis Pharmaceuticals, Inc. Antisense modulation of talin expression
CN100406065C (zh) 2000-12-01 2008-07-30 细胞工厂治疗公司 糖基化/半乳糖基化肽、双官能接头和核苷酸单体/多聚体的缀合物以及相关的组合物和使用方法
US20030158403A1 (en) 2001-07-03 2003-08-21 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US20030175906A1 (en) 2001-07-03 2003-09-18 Muthiah Manoharan Nuclease resistant chimeric oligonucleotides
WO2004041889A2 (en) 2002-11-05 2004-05-21 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
AU2003291755A1 (en) 2002-11-05 2004-06-07 Isis Pharmaceuticals, Inc. Oligomers comprising modified bases for binding cytosine and uracil or thymine and their use
WO2006006948A2 (en) 2002-11-14 2006-01-19 Dharmacon, Inc. METHODS AND COMPOSITIONS FOR SELECTING siRNA OF IMPROVED FUNCTIONALITY
AU2003295600A1 (en) 2002-11-14 2004-06-15 Dharmacon, Inc. Functional and hyperfunctional sirna
US7655785B1 (en) 2002-11-14 2010-02-02 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
US7723509B2 (en) 2003-04-17 2010-05-25 Alnylam Pharmaceuticals IRNA agents with biocleavable tethers
US7888497B2 (en) 2003-08-13 2011-02-15 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
EP1661905B9 (en) 2003-08-28 2012-12-19 IMANISHI, Takeshi Novel artificial nucleic acids of n-o bond crosslinkage type
CA2538252C (en) 2003-09-18 2014-02-25 Isis Pharmaceuticals, Inc. 4'-thionucleosides and oligomeric compounds
WO2005116204A1 (ja) 2004-05-11 2005-12-08 Rnai Co., Ltd. Rna干渉を生じさせるポリヌクレオチド、および、これを用いた遺伝子発現抑制方法
US20060148740A1 (en) 2005-01-05 2006-07-06 Prosensa B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
US7884260B2 (en) 2005-06-14 2011-02-08 University Of Chicago Cell-based screen for agents useful for reducing neuronal demyelination or promoting neuronal remyelination
US7569686B1 (en) 2006-01-27 2009-08-04 Isis Pharmaceuticals, Inc. Compounds and methods for synthesis of bicyclic nucleic acid analogs
WO2007090071A2 (en) 2006-01-27 2007-08-09 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
US8178503B2 (en) 2006-03-03 2012-05-15 International Business Machines Corporation Ribonucleic acid interference molecules and binding sites derived by analyzing intergenic and intronic regions of genomes
AU2007249349B2 (en) 2006-05-11 2012-03-08 Isis Pharmaceuticals, Inc. 5'-Modified bicyclic nucleic acid analogs
US7666854B2 (en) 2006-05-11 2010-02-23 Isis Pharmaceuticals, Inc. Bis-modified bicyclic nucleic acid analogs
WO2008020435A2 (en) 2006-08-15 2008-02-21 Quark Pharmaceuticals, Inc Compositions and methods for treatment of mood disorders
ES2526295T5 (es) 2006-10-18 2021-05-04 Ionis Pharmaceuticals Inc Compuestos antisentido
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom
CA2688321A1 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
DK2173760T4 (en) 2007-06-08 2016-02-08 Isis Pharmaceuticals Inc Carbocyclic bicyclic nukleinsyreanaloge
AU2008272918B2 (en) 2007-07-05 2012-09-13 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
KR101654007B1 (ko) 2007-08-15 2016-09-05 아이오니스 파마수티컬즈, 인코포레이티드 테트라하이드로피란 핵산 유사체
WO2009067647A1 (en) 2007-11-21 2009-05-28 Isis Pharmaceuticals, Inc. Carbocyclic alpha-l-bicyclic nucleic acid analogs
WO2009073809A2 (en) 2007-12-04 2009-06-11 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
WO2009100320A2 (en) 2008-02-07 2009-08-13 Isis Pharmaceuticals, Inc. Bicyclic cyclohexitol nucleic acid analogs
NZ601660A (en) * 2008-08-25 2014-05-30 Excaliard Pharmaceuticals Inc Antisense oligonucleotides directed against connective tissue growth factor and uses thereof
DK2356129T3 (da) 2008-09-24 2013-05-13 Isis Pharmaceuticals Inc Substituerede alpha-L-bicykliske nukleosider
US9012421B2 (en) 2009-08-06 2015-04-21 Isis Pharmaceuticals, Inc. Bicyclic cyclohexose nucleic acid analogs
US10913767B2 (en) 2010-04-22 2021-02-09 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising acyclic and abasic nucleosides and analogs
CA2812046A1 (en) 2010-09-15 2012-03-22 Alnylam Pharmaceuticals, Inc. Modified irna agents
EP2673361B1 (en) 2011-02-08 2016-04-13 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013159108A2 (en) 2012-04-20 2013-10-24 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
US20150141320A1 (en) 2012-05-16 2015-05-21 Rana Therapeutics, Inc. Compositions and methods for modulating gene expression
US9695418B2 (en) 2012-10-11 2017-07-04 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleosides and uses thereof
CN104837996A (zh) 2012-11-15 2015-08-12 罗氏创新中心哥本哈根有限公司 抗apob反义缀合物化合物
DK2992098T3 (da) 2013-05-01 2019-06-17 Ionis Pharmaceuticals Inc Sammensætninger og fremgangsmåder til modulering af hbv- og ttr-ekspression
GB201510684D0 (en) 2015-06-17 2015-08-05 Almac Diagnostics Ltd Gene signatures predictive of metastatic disease
EP3551754B1 (en) * 2016-12-08 2023-08-30 Case Western Reserve University Methods and compositions for enhancing functional myelin production
KR102723989B1 (ko) * 2017-12-01 2024-11-01 더 텍사스 에이 & 엠 유니버시티 시스템 엔젤만 증후군 안티센스 치료
TW201945009A (zh) 2018-02-07 2019-12-01 國立研究開發法人國立精神 神經醫療研究中心 寡樹突細胞專一性啟動子、對PLP1基因具專一性之miRNA、包含該啟動子及/或該miRNA之載體與包含該載體之醫藥組合物
JP2023130528A (ja) * 2020-06-24 2023-09-21 田辺三菱製薬株式会社 Plp1発現を調節するための化合物、方法及び医薬組成物
EP4172338A4 (en) 2020-06-29 2025-06-11 Ionis Pharmaceuticals, Inc. COMPOUNDS AND METHODS FOR MODULATING PLP1
CA3190481A1 (en) 2020-08-04 2022-02-10 Dicerna Pharmaceuticals, Inc. Compositions and methods for inhibiting plp1 expression

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11732263B2 (en) 2020-06-29 2023-08-22 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating PLP1

Also Published As

Publication number Publication date
JP2026062868A (ja) 2026-04-10
BR112022024206A2 (pt) 2023-01-03
JP2023532518A (ja) 2023-07-28
JP7799640B2 (ja) 2026-01-15
TW202216996A (zh) 2022-05-01
MX2022016338A (es) 2023-01-24
WO2022006134A3 (en) 2022-02-10
US20240209364A1 (en) 2024-06-27
EP4172338A2 (en) 2023-05-03
CA3185749A1 (en) 2022-01-06
AU2021299290A1 (en) 2023-01-05
US20220056445A1 (en) 2022-02-24
KR20230029837A (ko) 2023-03-03
IL298530A (en) 2023-01-01
EP4172338A4 (en) 2025-06-11
US11732263B2 (en) 2023-08-22
CN116096899A (zh) 2023-05-09

Similar Documents

Publication Publication Date Title
US11261446B2 (en) Compounds and methods for modulating UBE3A-ATS
US20250270556A1 (en) Compounds and methods for modulating scn2a
EP4189090A1 (en) Compounds and methods for reducing app expression
US20250320505A1 (en) Compounds and Methods for Reducing KCNT1 Expression
WO2023092057A1 (en) Compounds and methods for modulating progranulin expression
US20250297254A1 (en) Compounds and methods for modulating atxn1
WO2022266415A1 (en) Compounds and methods for reducing ifnar1 expression
US12502402B2 (en) Compounds and methods for modulating GFAP
US20220243203A1 (en) Compounds and methods for reducing fus expression
EP4216964A1 (en) Compounds and methods for reducing apoe expression
US11732263B2 (en) Compounds and methods for modulating PLP1
US20240229042A1 (en) Compounds and methods for reducing kcnt1 expression
WO2021178769A1 (en) Compounds and methods for modulating kcnq2
HK40129490A (en) Compounds and methods for modulating ube3a-ats

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21833921

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 3185749

Country of ref document: CA

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022024206

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2022581012

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112022024206

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20221128

ENP Entry into the national phase

Ref document number: 2021299290

Country of ref document: AU

Date of ref document: 20210629

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20237002412

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021833921

Country of ref document: EP

Effective date: 20230130

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21833921

Country of ref document: EP

Kind code of ref document: A2