WO2022003608A1 - Mirna-485 inhibitor for huntington's disease - Google Patents

Mirna-485 inhibitor for huntington's disease Download PDF

Info

Publication number
WO2022003608A1
WO2022003608A1 PCT/IB2021/055890 IB2021055890W WO2022003608A1 WO 2022003608 A1 WO2022003608 A1 WO 2022003608A1 IB 2021055890 W IB2021055890 W IB 2021055890W WO 2022003608 A1 WO2022003608 A1 WO 2022003608A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
aspects
nucleotides
mir
inhibitor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2021/055890
Other languages
English (en)
French (fr)
Inventor
Jin-Hyeob RYU
Han Seok Koh
Dae Hoon Kim
Hyun Su Min
Yu Na Lim
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biorchestra Co Ltd
Original Assignee
Biorchestra Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biorchestra Co Ltd filed Critical Biorchestra Co Ltd
Priority to BR112022027040A priority Critical patent/BR112022027040A2/pt
Priority to KR1020227046418A priority patent/KR20230031852A/ko
Priority to US18/003,982 priority patent/US20230304014A1/en
Priority to AU2021302972A priority patent/AU2021302972A1/en
Priority to CN202180046108.2A priority patent/CN115867290A/zh
Priority to EP21831873.1A priority patent/EP4175675A4/en
Priority to CA3184043A priority patent/CA3184043A1/en
Priority to JP2022581521A priority patent/JP2023532536A/ja
Publication of WO2022003608A1 publication Critical patent/WO2022003608A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
    • A61K47/10—Alcohols; Phenols; Salts thereof, e.g. glycerol; Polyethylene glycols [PEG]; Poloxamers; PEG/POE alkyl ethers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/34—Macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyesters, polyamino acids, polysiloxanes, polyphosphazines, copolymers of polyalkylene glycol or poloxamers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/545—Heterocyclic compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/645—Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
    • A61K47/6455—Polycationic oligopeptides, polypeptides or polyamino acids, e.g. for complexing nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/107—Emulsions ; Emulsion preconcentrates; Micelles
    • A61K9/1075—Microemulsions or submicron emulsions; Preconcentrates or solids thereof; Micelles, e.g. made of phospholipids or block copolymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/313—Phosphorodithioates

Definitions

  • the present disclosure provides the use of a miR-485 inhibitor (e.g, polynucleotide encoding a nucleotide molecule comprising at least one miR-485 binding site) for the treatment of Huntington’s disease.
  • a miR-485 inhibitor e.g, polynucleotide encoding a nucleotide molecule comprising at least one miR-485 binding site
  • Huntington’s disease is a hereditary, progressive, neurodegenerative disorder.
  • the disorder is caused by an expansion of a repeating CAG triplet series in the huntingtin gene, which results in a huntingtin protein with an abnormally long polyglutamine sequence.
  • Huntington’s disease usually manifests in a person’s thirties or forties. In some rare cases, Huntington’s may manifiest in childhood or adolescence. Symptoms include involuntary jerking or twitching of the arms, legs, head, face and upper body (chorea); decline in memory, concentration, judgment, and the ability to plan and organize; and alterations in mood, especially depression, anxiety, and uncharacteristic anger and irritiability. Individuals with Huntington’s disease live about 15 to 20 years after symptoms begin.
  • the present disclosure provides a method of treating Huntington’s disease in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 (miRNA inhibitor).
  • the subject exhibits one or more characteristics of Huntington’s disease comprising irritability, depression, involuntary movements, poor coordination, trouble learning new information or making decisions, uncontrolled movements, emotional problems, and loss of thinking ability (cognition) prior to administration.
  • the subject exhibits, after the administration, an improvement in one or more characteristics of Huntington’s disease.
  • the improvement is at least about 1.5 fold, at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, or at least about 10 fold compared to the characteristics prior to the administration.
  • the Huntington’s disease is associated with a decreased level of a
  • the Huntington’s disease is associated with a decreased level of a CD36 protein and/or a CD36 gene.
  • the subject has a disease or a condition associated with a decreased level of a PGC-Ia protein and/or a PGC-Ia gene.
  • the miRNA inhibitor induces authophagy and/or treats or prevents inflammation.
  • the miRNA inhibitor induces neurogenesis.
  • inducing neurogenesis comprises an increased proliferation, differentiation, migration, and/or survival of neural stem cells and/or progenitor cells.
  • inducing neurogenesis comprises an increased number of neural stem cells and/or progenitor cells.
  • inducing neurogenesis comprises an increased axon, dendrite, and/or synapse development.
  • the miRNA inhibitor induces phagocytosis.
  • the miRNA inhibitor inhibits miR485-3p.
  • the miR485-3p comprises 5'-gucauacacggcucuccucucu-3' (SEQ ID NO: 1).
  • the miRNA inhibitor comprises a nucleotide sequence comprising
  • the miRNA inhibitor increases transcription of an SIRT1 gene and/or expression of a SIRT1 protein.
  • the miRNA inhibitor comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 5' of the nucleotide sequence.
  • the miRNA inhibitor comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence.
  • the miRNA inhibitor has a sequence selected from the group consisting of: 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'-GUGUAUGA-3' (SEQ ID NO: 3), 5'- CGUGUAUGA-3' (SEQ ID NO: 4), 5'-CCGUGUAUGA-3' (SEQ ID NO: 5), 5'- GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'-AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'- GAGCCGUGUAUGA-3 1 (SEQ ID NO: 8), 5'-AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'- GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO:
  • GAGAGGAGAGCCGUGUAUGA-3 1 (SEQ ID NO: 15); 5'-UGUAUGAC-3' (SEQ ID NO: 16), 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'- CCGUGUAUGAC-3' (SEQ ID NO: 19), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'- AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 22), 5'- AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5 '-AGGAGAGCCGUGUAUGAC-3 ' (SEQ ID NO: 26), 5'-GAGGAGAGCCGUGUAUGAC-3
  • the miRNA inhibitor has a sequence selected from the group consisting of: 5'-TGTATGA-3' (SEQ ID NO: 62), 5'-GTGTATGA-3' (SEQ ID NO: 63), 5'- CGTGTATGA-3' (SEQ ID NO: 64), 5'-CCGTGTATGA-3' (SEQ ID NO: 65), 5'- GCCGTGTATGA-3' (SEQ ID NO: 66), 5'-AGCCGTGTATGA-3' (SEQ ID NO: 67), 5'- GAGCCGTGTATGA-3' (SEQ ID NO: 68), 5'-AGAGCCGTGTATGA-3' (SEQ ID NO: 69), 5'- G AG AGC C GT GT AT G A-3 ' (SEQ ID NO: 70), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 71), 5 ' - AGG AG AGC C GT GT AT G A-3 ' (SEQ ID NO: 72), 5'-GA
  • GAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 89).
  • the sequence of the miRNA inhibitor is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% sequence identity to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AG AGG AG AGC C GT GT AT G AC -3' (SEQ ID NO: 88).
  • the miRNA inhibitor has a sequence that has at least 90% similarity to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 88).
  • the miRNA inhibitor comprises the nucleotide sequence 5'-
  • the miRNA inhibitor comprises the nucleotide sequence 5'-
  • miRNA inhibitor comprises the nucleotide sequence 5'-
  • the miRNA inhibitor comprises at least one modified nucleotide.
  • the at least one modified nucleotide is a locked nucleic acid (LNA), an unlocked nucleic acid (UNA), an arabino nucleic acid (ABA), a bridged nucleic acid (BNA), and/or a peptide nucleic acid (PNA).
  • LNA locked nucleic acid
  • UNA unlocked nucleic acid
  • ABA arabino nucleic acid
  • BNA bridged nucleic acid
  • PNA peptide nucleic acid
  • the miRNA inhibitor comprises a backbone modification.
  • the backbone modification is a phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification.
  • PMO phosphorodiamidate morpholino oligomer
  • PS phosphorothioate
  • the miRNA inhibitor is delivered in a delivery agent.
  • the delivery agent is a micelle, an exosome, a lipid nanoparticle, an extracellular vesicle, or a synthetic vesicle.
  • the miRNA inhibitor is delivered by a viral vector.
  • the viral vector is an AAV, an adenovirus, a retrovirus, or a lentivirus.
  • the viral vector is an AAV that has a serotype of AAV2, AAV3,
  • AAV4 AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or any combination thereof.
  • the miRNA inhibitor is delivered with a delivery agent.
  • the delivery agent comprises a lipidoid, a liposome, a lipoplex, a lipid nanoparticle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, or a conjugate.
  • the delivery agent comprises a cationic carrier unit comprising
  • WP is a water-soluble biopolymer moiety
  • CC is a positively charged carrier moiety
  • AM is an adjuvant moiety
  • LI and L2 are independently optional linkers, and wherein when mixed with a nucleic acid at an ionic ratio of about 1:1, the cationic carrier unit forms a micelle.
  • the miRNA inhibitor interacts with the cationic carrier unit via an ionic bond.
  • the water-soluble biopolymer comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefmic alcohol), polyvinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly(a- hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines (“POZ”) poly(N-acryloylmorpholine), or any combinations thereof.
  • the water-soluble biopolymer comprises polyethylene glycol
  • PEG polyglycerol
  • PPG polypropylene glycol
  • water-soluble biopolymer comprises:
  • n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141.
  • the n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, or about 150 to about 160.
  • the water-soluble biopolymer is linear, branched, or dendritic.
  • the cationic carrier moiety comprises one or more basic amino acids. [0044] In some aspects, the cationic carrier moiety comprises at least 3, at least 4, at least
  • the cationic carrier moiety comprises about 30 to about 50 basic amino acids.
  • the basic amino acid comprises arginine, lysine, histidine, or any combination thereof.
  • the cationic carrier moiety comprises about 40 lysine monomers.
  • the adjuvant moiety is capable of modulating an immune response, an inflammatory response, and/or a tissue microenvironment.
  • the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof.
  • the adjuvant moiety comprises: (formula II), wherein each of Gi and G2 is H, an aromatic ring, or 1-10 alkyl, or Gi and G2 together form an aromatic ring, and wherein n is 1-10.
  • the adjuvant moiety comprises nitroimidazole.
  • the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, omidazole, megazol, azanidazole, benznidazole, or any combination thereof.
  • the adjuvant moiety comprises an amino acid.
  • the adjuvant moiety comprises (formula III),
  • Ar wherein Ar is wherein each of Zi and Z2 is H or OH.
  • the adjuvant moiety comprises a vitamin.
  • the vitamin comprises a cyclic ring or cyclic hetero atom ring and a carboxyl group or hydroxyl group.
  • the vitamin comprises: (formula VI), wherein each of Yi and Y2 is C, N, O, or S, and wherein n is 1 or 2.
  • the vitamin is selected from the group consisting of vitamin A, vitamin Bl, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof.
  • the vitamin is vitamin B3.
  • the adjuvant moiety comprises at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3 units.
  • the adjuvant moiety comprises about 10 vitamin B3 units.
  • the delivery agent comprises about a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3 units.
  • the delivery agent is associated with the miRNA inhibitor, thereby forming a micelle.
  • the association is a covalent bond, a non-covalent bond, or an ionic bond.
  • the cationic carrier unit and the miRNA inhibitor in the micelle is mixed in a solution so that the ionic ratio of the positive charges of the cationic carrier unit and the negative charges of the miRNA inhibitor is about 1:1.
  • the cationic carrier unit is capable of protecting the miRNA inhibitor from enzymatic degradation.
  • FIG. 1 shows an exemplary architecture of a carrier unit of the present disclosure.
  • the example presented includes a cationic carrier moiety, which can interact electrostatically with anionic payloads, e.g., nucleic acids such as antisense oligonucleotides targeting a gene, e.g, miRNA (antimirs).
  • anionic payloads e.g., nucleic acids such as antisense oligonucleotides targeting a gene, e.g, miRNA (antimirs).
  • AM can be located between WP and CC.
  • the CC and AM components are portrayed in a linear arrangement for simplicity. However, as described herein, in some aspects, CC and AM can be arranged in a scaffold fashion.
  • FIG. 2A shows a schematic overview for aggregated Htt analysis in NSC 34 cells treated with or without miR485-3p inhibitor.
  • FIG. 2B provides western blot analysis showing a decrease in the level of insoluble, aggregated huntingtin (Htt) in Q74-Htt-transfected NSC-34 cells treated with a miR-485-3p inhibitor.
  • NSC-34 cells were transfected with either GFP-tagged wild- type (Q23) or mutant (Q74) Htt.
  • FIG. 3 A provides western blot analysis showing a decrease in the level of insoluble, aggregated huntingtin (Htt) in Q74-Htt-transfected HEK293T cells treated with a miR-485 inhibitor.
  • FIG. 3B shows a graph quantifying the relative aggregated htt expression level based on the western blot of FIG. 3 A.
  • FIG. 4A provides western blot analysis showing an increase in the level of the autophagy proteins SIRT1, PGC-la, p62 and LC3-II in Q74-Htt-transfected HEK293T cells treated with a miR-485 inhibitor compared to Q-23-Htt-transfected HEK293T cells.
  • FIGs. 4B-4E shows a graph quantifying the relative levels of SIRTl, PGC-la, p62 and LC3-II as determined from the western blot of FIG. 4A, respectively.
  • FIG. 5 provides western blot analysis showing a decrease in the level of insoluble, aggregated huntingtin (Htt) in Q74-Htt-transfected PCD cells treated with a miR-485 inhibitor compared to Q23-Htt-transfected PCD cells.
  • FIG. 6 provides western blot analysis showing an increase in the level of the autophagy proteins SIRT1, PGC-la, p62 and LC3-II and decrease in cleavage of caspase 3 in Q74- Htt-transfected PCD cells treated with a miR-485-3p inhibitor compared to Q23-Htt-transfected PCD cells.
  • FIGs. 7A-7E show images visualizing distribution of GFP-tagged-htt in Q74-Htt- transfected PCD cells (FIGs. 7D and 7E) and GFP -tagged Htt in Q23-Htt-transfected PCD cells (FIGs. 7B and 7C) treated with a miR-485 inhibitor and control cells (FIG. 7A).
  • FIGs. 8A-8D show images visualizing distribution of GFP-tagged-htt in Q74-Htt- transfected (FIGs. 8C and 8D) and Q23-Htt-transfected (FIGs. 8A and 8B) primary cortical neurons treated with a miR-485 inhibitor.
  • the left panels show control treatment and the right panels show miR485-3p inhibitor treatments.
  • FIGs. 9A-9R show miR485-3p enhances degradation of Htt aggregates by regulation of autophagy.
  • Immunofluorescence labeling of Htt protein left panels
  • LC3B middle panels
  • DAPI right panels
  • FIGs. 9A-9I Q23
  • FIGs. 9J-9R Q74
  • a or “an” entity refers to one or more of that entity; for example, "a nucleotide sequence,” is understood to represent one or more nucleotide sequences.
  • the terms “a” (or “an”), “one or more,” and “at least one” can be used interchangeably herein.
  • the claims can be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a negative limitation.
  • Nucleotides are referred to by their commonly accepted single-letter codes. Unless otherwise indicated, nucleotide sequences are written left to right in 5' to 3' orientation. Nucleotides are referred to herein by their commonly known one-letter symbols recommended by the IUPAC- IUB Biochemical Nomenclature Commission. Accordingly, 'a' represents adenine, 'c' represents cytosine, 'g' represents guanine, 'f represents thymine, and 'u' represents uracil.
  • Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
  • the term “about” is used herein to mean approximately, roughly, around, or in the regions of. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” can modify a numerical value above and below the stated value by a variance of, e.g., 10 percent, up or down (higher or lower).
  • AAV adeno-associated virus
  • AAV includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3 A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAVrh.74, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, those AAV serotypes and clades disclosed by Gao et al. ( J . Virol. 75:6381 (2004)) and Moris et al. ⁇ Virol.
  • an "AAV” includes a derivative of a known AAV.
  • an "AAV” includes a modified or an artificial AAV.
  • administration refers to introducing a composition, such as a miRNA inhibitor of the present disclosure, into a subject via a pharmaceutically acceptable route.
  • a composition such as a micelle comprising a miRNA inhibitor of the present disclosure
  • administration includes self-administration and the administration by another.
  • a suitable route of administration allows the composition or the agent to perform its intended function. For example, if a suitable route is intravenous, the composition is administered by introducing the composition or agent into a vein of the subject.
  • the term “approximately,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain aspects, the term “approximately” refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
  • Nucleotides or amino acids that are relatively conserved are those that are conserved amongst more related sequences than nucleotides or amino acids appearing elsewhere in the sequences.
  • two or more sequences are said to be “highly conserved” if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some aspects, two or more sequences are said to be “highly conserved” if they are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98%, or about 99% identical to one another. In some aspects, two or more sequences are said to be "conserved” if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another.
  • two or more sequences are said to be "conserved” if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. Conservation of sequence can apply to the entire length of a polynucleotide or polypeptide or can apply to a portion, region or feature thereof.
  • derived from refers to a component that is isolated from or made using a specified molecule or organism, or information (e.g ., amino acid or nucleic acid sequence) from the specified molecule or organism.
  • a nucleic acid sequence that is derived from a second nucleic acid sequence can include a nucleotide sequence that is identical or substantially similar to the nucleotide sequence of the second nucleic acid sequence.
  • the derived species can be obtained by, for example, naturally occurring mutagenesis, artificial directed mutagenesis or artificial random mutagenesis.
  • the mutagenesis used to derive nucleotides or polypeptides can be intentionally directed or intentionally random, or a mixture of each.
  • the mutagenesis of a nucleotide or polypeptide to create a different nucleotide or polypeptide derived from the first can be a random event (e.g., caused by polymerase infidelity) and the identification of the derived nucleotide or polypeptide can be made by appropriate screening methods, e.g, as discussed herein.
  • a nucleotide or amino acid sequence that is derived from a second nucleotide or amino acid sequence has a sequence identity of at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about
  • a "coding region” or “coding sequence” is a portion of polynucleotide which consists of codons translatable into amino acids.
  • a “stop codon” (TAG, TGA, or TAA) is typically not translated into an amino acid, it can be considered to be part of a coding region, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, and the like, are not part of a coding region.
  • a coding region typically determined by a start codon at the 5' terminus, encoding the amino terminus of the resultant polypeptide, and a translation stop codon at the 3' terminus, encoding the carboxyl terminus of the resulting polypeptide.
  • nucleobase sequence “T-G-A (5'- 3'),” is complementary to the nucleobase sequence "A-C-T (3'- 5').”
  • Complementarity can be "partial,” in which less than all of the nucleobases of a given nucleobase sequence are matched to the other nucleobase sequence according to base pairing rules.
  • complementarity between a given nucleobase sequence and the other nucleobase sequence can be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.
  • the term "complementary” refers to at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% match or complementarity to a target nucleic acid sequence (e.g ., miR-485 nucleic acid sequence). Or, there can be “complete” or “perfect” (100%) complementarity between a given nucleobase sequence and the other nucleobase sequence to continue the example. In some aspects, the degree of complementarity between nucleobase sequences has significant effects on the efficiency and strength of hybridization between the sequences.
  • downstream refers to a nucleotide sequence that is located 3' to a reference nucleotide sequence.
  • downstream nucleotide sequences relate to sequences that follow the starting point of transcription. For example, the translation initiation codon of a gene is located downstream of the start site of transcription.
  • excipient and “carrier” are used interchangeably and refer to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound, e.g., a miRNA inhibitor of the present disclosure.
  • RNA or a polypeptide refers to a process by which a polynucleotide produces a gene product, e.g., RNA or a polypeptide. It includes without limitation transcription of the polynucleotide into micro RNA binding site, small hairpin RNA (shRNA), small interfering RNA (siRNA), or any other RNA product. It includes, without limitation, transcription of the polynucleotide into messenger RNA (mRNA), and the translation of mRNA into a polypeptide. Expression produces a "gene product.”
  • a gene product can be, e.g, a nucleic acid, such as an RNA produced by transcription of a gene.
  • a gene product can be either a nucleic acid, RNA or miRNA produced by the transcription of a gene, or a polypeptide which is translated from a transcript.
  • Gene products described herein further include nucleic acids with post transcriptional modifications, e.g, polyadenylation or splicing, or polypeptides with post translational modifications, e.g, phosphorylation, methylation, glycosylation, the addition of lipids, association with other protein subunits, or proteolytic cleavage.
  • homology refers to the overall relatedness between polymeric molecules, e.g. between nucleic acid molecules. Generally, the term “homology” implies an evolutionary relationship between two molecules. Thus, two molecules that are homologous will have a common evolutionary ancestor. In the context of the present disclosure, the term homology encompasses both to identity and similarity.
  • polymeric molecules are considered to be "homologous" to one another if at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the monomers in the molecule are identical (exactly the same monomer) or are similar (conservative substitutions).
  • the term "homologous” necessarily refers to a comparison between at least two sequences (e.g, polynucleotide sequences).
  • substitutions are conducted at the nucleic acid level, i.e., substituting an amino acid residue with an alternative amino acid residue is conducted by substituting the codon encoding the first amino acid with a codon encoding the second amino acid.
  • identity refers to the overall monomer conservation between polymeric molecules, e.g ., between polynucleotide molecules.
  • Calculation of the percent identity of two polypeptide or polynucleotide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g, gaps can be introduced in one or both of a first and a second polypeptide or polynucleotide sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
  • the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence.
  • the amino acids at corresponding amino acid positions, or bases in the case of polynucleotides, are then compared.
  • Suitable software programs that can be used to align different sequences are available from various sources.
  • One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of program available from the U.S. government's National Center for Biotechnology Information BLAST web site (blast.ncbi.nlm.nih.gov).
  • B12seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm.
  • BLASTN is used to compare nucleic acid sequences
  • BLASTP is used to compare amino acid sequences.
  • MAFFT Clustal (ClustalW, Clustal X or Clustal Omega), MUSCLE, etc.
  • percent sequence identity value is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer.
  • %ID 100 x (Y/Z), where Y is the number of amino acid residues (or nucleobases) scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.
  • sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g, location of mutations), or phylogenetic data.
  • a suitable program that integrates heterogeneous data to generate a multiple sequence alignment is T-Coffee, available at www.tcoffee.org, and alternatively available, e.g, from the EBI. It will also be appreciated that the final alignment used to calculate percent sequence identity can be curated either automatically or manually.
  • isolating or purifying as used herein is the process of removing, partially removing (e.g, a fraction) of a composition of the present disclosure, e.g., a miRNA inhibitor of the present disclosure from a sample containing contaminants.
  • an isolated composition has no detectable undesired activity or, alternatively, the level or amount of the undesired activity is at or below an acceptable level or amount.
  • an isolated composition has an amount and/or concentration of desired composition of the present disclosure, at or above an acceptable amount and/or concentration and/or activity.
  • the isolated composition is enriched as compared to the starting material from which the composition is obtained.
  • This enrichment can be by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99%, at least about 99.999%, at least about 99.9999%, or greater than 99.9999% as compared to the starting material.
  • isolated preparations are substantially free of residual biological products.
  • the isolated preparations are 100% free, at least about 99% free, at least about 98% free, at least about 97% free, at least about 96% free, at least about 95% free, at least about 94% free, at least about 93% free, at least about 92% free, at least about 91% free, or at least about 90% free of any contaminating biological matter.
  • Residual biological products can include abiotic materials (including chemicals) or unwanted nucleic acids, proteins, lipids, or metabolites.
  • the term "linked” as used herein refers to a first amino acid sequence or polynucleotide sequence covalently or non-covalently joined to a second amino acid sequence or polynucleotide sequence, respectively.
  • the first amino acid or polynucleotide sequence can be directly joined or juxtaposed to the second amino acid or polynucleotide sequence or alternatively an intervening sequence can covalently join the first sequence to the second sequence.
  • the term "linked” means not only a fusion of a first polynucleotide sequence to a second polynucleotide sequence at the 5'-end or the 3'-end, but also includes insertion of the whole first polynucleotide sequence (or the second polynucleotide sequence) into any two nucleotides in the second polynucleotide sequence (or the first polynucleotide sequence, respectively).
  • the first polynucleotide sequence can be linked to a second polynucleotide sequence by a phosphodiester bond or a linker.
  • the linker can be, e.g., a polynucleotide.
  • a “miRNA inhibitor,” as used herein, refers to a compound that can decrease, alter, and/or modulate miRNA expression, function, and/or activity.
  • the miRNA inhibitor can be a polynucleotide sequence that is at least partially complementary to the target miRNA nucleic acid sequence, such that the miRNA inhibitor hybridizes to the target miRNA sequence.
  • a miR-485 inhibitor of the present disclosure comprises a nucleotide sequence encoding a nucleotide molecule that is at least partially complementary to the target miR-485 nucleic acid sequence, such that the miR-485 inhibitor hybridizes to the miR-485 sequence.
  • the hybridization of the miR-485 to the miR-485 sequence decreases, alters, and/or modulates the expression, function, and/or activity of miR-485 (e.g ., hybridization results in an increase in the expression of SIRT1 protein and/or SIRT1 gene).
  • miRNA refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation.
  • the term will be used to refer to the single-stranded RNA molecule processed from a precursor.
  • antisense oligomers can also be used to describe the microRNA molecules of the present disclosure. Names of miRNAs and their sequences related to the present disclosure are provided herein.
  • MicroRNAs recognize and bind to target mRNAs through imperfect base pairing leading to destabilization or translational inhibition of the target mRNA and thereby downregulate target gene expression.
  • targeting miRNAs via molecules comprising a miRNA binding site can reduce or inhibit the miRNA-induced translational inhibition leading to an upregulation of the target gene.
  • mismatch refers to one or more nucleobases (whether contiguous or separate) in an oligomer nucleobase sequence (e.g., miR-485 inhibitor) that are not matched to a target nucleic acid sequence (e.g, miR-485) according to base pairing rules. While perfect complementarity is often desired, in some aspects, one or more (e.g, 6, 5, 4, 3, 2, or 1 mismatches) can occur with respect to the target nucleic acid sequence. Variations at any location within the oligomer are included.
  • antisense oligomers of the disclosure include variations in nucleobase sequence near the termini, variations in the interior, and if present are typically within about 6, 5, 4, 3, 2, or 1 subunits of the 5' and/or 3' terminus. In some aspects, one, two, or three nucleobases can be removed and still provide on- target binding.
  • the terms “modulate,” “modify,” and grammatical variants thereof, generally refer when applied to a specific concentration, level, expression, function or behavior, to the ability to alter, by increasing or decreasing, e.g, directly or indirectly promoting/stimulating/up-regulating or interfering with/inhibiting/down-regulating the specific concentration, level, expression, function or behavior, such as, e.g, to act as an antagonist or agonist.
  • a modulator can increase and/or decrease a certain concentration, level, activity or function relative to a control, or relative to the average level of activity that would generally be expected or relative to a control level of activity.
  • a miRNA inhibitor disclosed herein e.g ., a miR-485 inhibitor
  • Nucleic acid refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix.
  • RNA molecules phosphate ester polymeric form of ribonucleosides
  • deoxyribonucleosides deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine
  • DNA molecules or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded
  • Single stranded nucleic acid sequences refer to single-stranded DNA (ssDNA) or single-stranded RNA (ssRNA). Double stranded DNA- DNA, DNA-RNA and RNA-RNA helices are possible.
  • nucleic acid molecule and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double- stranded DNA found, inter alia , in linear or circular DNA molecules (e.g, restriction fragments), plasmids, supercoiled DNA and chromosomes.
  • a "recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
  • DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA.
  • a "nucleic acid composition" of the disclosure comprises one or more nucleic acids as described herein.
  • pharmaceutically acceptable carrier encompass any of the agents approved by a regulatory agency of the U.S. Federal government or listed in the U.S. Pharmacopeia for use in animals, including humans, as well as any carrier or diluent that does not cause the production of undesirable physiological effects to a degree that prohibits administration of the composition to a subject and does not abrogate the biological activity and properties of the administered compound. Included are excipients and carriers that are useful in preparing a pharmaceutical composition and are generally safe, non-toxic, and desirable.
  • the term "pharmaceutical composition” refers to one or more of the compounds described herein, such as, e.g ., a miRNA inhibitor of the present disclosure, mixed or intermingled with, or suspended in one or more other chemical components, such as pharmaceutically acceptable carriers and excipients.
  • a pharmaceutical composition is to facilitate administration of preparations comprising a miRNA inhibitor of the present disclosure to a subject.
  • polynucleotide refers to polymers of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof.
  • the term refers to the primary structure of the molecule.
  • the term includes triple-, double- and single-stranded deoxyribonucleic acid ("DNA”), as well as triple-, double- and single-stranded ribonucleic acid (“RNA”). It also includes modified, for example by alkylation, and/or by capping, and unmodified forms of the polynucleotide.
  • polynucleotide includes polydeoxyribonucleotides
  • polyribonucleotides containing D-ribose
  • D-ribose polyribonucleotides
  • tRNA tRNA
  • rRNA shRNA
  • siRNA siRNA
  • miRNA miRNA
  • mRNA spliced or unspliced
  • other polymers containing normucleotidic backbones for example, polyamide (e.g, peptide nucleic acids "PNAs") and polymorpholino polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA.
  • PNAs peptide nucleic acids
  • a polynucleotide can be, e.g, an oligonucleotide, such as an antisense oligonucleotide.
  • the oligonucleotide is an RNA.
  • the RNA is a synthetic RNA.
  • the synthetic RNA comprises at least one unnatural nucleobase.
  • all nucleobases of a certain class have been replaced with unnatural nucleobases (e.g, all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g, 5-methoxyuridine).
  • polypeptide “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length, e.g. , that are encoded by the SIRT1 gene.
  • the polymer can comprise modified amino acids.
  • the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
  • polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine
  • amino acid including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine
  • polypeptide refers to proteins, polypeptides, and peptides of any size, structure, or function.
  • Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing.
  • a polypeptide can be a single polypeptide or can be a multi -molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multi chain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides.
  • the term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.
  • a "peptide" can be less than or equal to about 50 amino acids long, e.g., about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 amino acids long.
  • prevent refers partially or completely delaying onset of an disease, disorder and/or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular disease, disorder, and/or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular disease, disorder, and/or condition; partially or completely delaying progression from a particular disease, disorder and/or condition; and/or decreasing the risk of developing pathology associated with the disease, disorder, and/or condition. In some aspects, preventing an outcome is achieved through prophylactic treatment.
  • promoter and “promoter sequence” are interchangeable and refer to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
  • a coding sequence is located 3' to a promoter sequence. Promoters can be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions.
  • Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters.” Promoters that cause a gene to be expressed in a specific cell type are commonly referred to as “cell-specific promoters” or “tissue- specific promoters.” Promoters that cause a gene to be expressed at a specific stage of development or cell differentiation are commonly referred to as “developmentally-specific promoters” or “cell differentiation-specific promoters.” Promoters that are induced and cause a gene to be expressed following exposure or treatment of the cell with an agent, biological molecule, chemical, ligand, light, or the like that induces the promoter are commonly referred to as “inducible promoters” or “regulatable promoters.” It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths can have identical promoter activity.
  • the promoter sequence is typically bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site (conveniently defined for example, by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • a promoter that can be used with the present disclosure includes a tissue specific promoter.
  • prophylactic refers to a therapeutic or course of action used to prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition.
  • a “prophylaxis” refers to a measure taken to maintain health and prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition.
  • the term "gene regulatory region” or “regulatory region” refers to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non coding sequences) of a coding region, and which influence the transcription, RNA processing, stability, or translation of the associated coding region. Regulatory regions can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, or stem-loop structures. If a coding region is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
  • a miR-485 inhibitor disclosed herein e.g ., a polynucleotide encoding a RNA comprising one or more miR-485 binding site
  • a promoter and/or other expression (e.g., transcription) control elements operably associated with one or more coding regions.
  • a coding region for a gene product is associated with one or more regulatory regions in such a way as to place expression of the gene product under the influence or control of the regulatory region(s).
  • a coding region and a promoter are "operably associated" if induction of promoter function results in the transcription of mRNA encoding the gene product encoded by the coding region, and if the nature of the linkage between the promoter and the coding region does not interfere with the ability of the promoter to direct the expression of the gene product or interfere with the ability of the DNA template to be transcribed.
  • Other expression control elements besides a promoter, for example enhancers, operators, repressors, and transcription termination signals, can also be operably associated with a coding region to direct gene product expression.
  • similarity refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. miRNA molecules). Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art. It is understood that percentage of similarity is contingent on the comparison scale used, i.e., whether the nucleic acids are compared, e.g, according to their evolutionary proximity, charge, volume, flexibility, polarity, hydrophobicity, aromaticity, isoelectric point, antigenicity, or combinations thereof.
  • subject refers to any mammalian subject, including without limitation, humans, domestic animals (e.g, dogs, cats and the like), farm animals (e.g, cows, sheep, pigs, horses and the like), and laboratory animals (e.g, monkey, rats, mice, rabbits, guinea pigs and the like) for whom diagnosis, treatment, or therapy is desired, particularly humans.
  • domestic animals e.g, dogs, cats and the like
  • farm animals e.g, cows, sheep, pigs, horses and the like
  • laboratory animals e.g, monkey, rats, mice, rabbits, guinea pigs and the like
  • the phrase "subject in need thereof includes subjects, such as mammalian subjects, that would benefit from administration of a miRNA inhibitor of the disclosure (e.g, miR-485 inhibitor), e.g, to increase the expression level of SIRT1 protein and/or SIRTl gene.
  • a miRNA inhibitor of the disclosure e.g, miR-485 inhibitor
  • the term "therapeutically effective amount” is the amount of reagent or pharmaceutical compound comprising a miRNA inhibitor of the present disclosure that is sufficient to a produce a desired therapeutic effect, pharmacologic and/or physiologic effect on a subject in need thereof.
  • a therapeutically effective amount can be a "prophylactically effective amount” as prophylaxis can be considered therapy.
  • treat refers to, e.g., the reduction in severity of a disease or condition; the reduction in the duration of a disease course; the amelioration or elimination of one or more symptoms associated with a disease or condition; the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition.
  • treatment refers to, e.g., the reduction in severity of a disease or condition; the reduction in the duration of a disease course; the amelioration or elimination of one or more symptoms associated with a disease or condition; the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition.
  • treating refers to, e.g., the reduction in severity of a disease or condition; the reduction in the duration of a disease course; the amelioration or elimination of one or more symptoms associated with a disease or condition; the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition.
  • the term also includes prophylaxis or prevention of a disease or condition or its symptoms
  • upstream refers to a nucleotide sequence that is located 5' to a reference nucleotide sequence.
  • a "vector” refers to any vehicle for the cloning of and/or transfer of a nucleic acid into a host cell.
  • a vector can be a replicon to which another nucleic acid segment can be attached so as to bring about the replication of the attached segment.
  • a “replicon” refers to any genetic element (e.g, plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of replication in vivo , i.e., capable of replication under its own control.
  • the term "vector” includes both viral and nonviral vehicles for introducing the nucleic acid into a cell in vitro, ex vivo or in vivo.
  • Plasmids A large number of vectors are known and used in the art including, for example, plasmids, modified eukaryotic viruses, or modified bacterial viruses. Insertion of a polynucleotide into a suitable vector can be accomplished by ligating the appropriate polynucleotide fragments into a chosen vector that has complementary cohesive termini.
  • Vectors can be engineered to encode selectable markers or reporters that provide for the selection or identification of cells that have incorporated the vector. Expression of selectable markers or reporters allows identification and/or selection of host cells that incorporate and express other coding regions contained on the vector.
  • selectable marker genes known and used in the art include: genes providing resistance to ampicillin, streptomycin, gentamycin, kanamycin, hygromycin, bialaphos herbicide, sulfonamide, and the like; and genes that are used as phenotypic markers, i.e., anthocyanin regulatory genes, isopentanyl transferase gene, and the like.
  • reporters known and used in the art include: luciferase (Luc), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), b-galactosidase (LacZ), b-glucuronidase (Gus), and the like. Selectable markers can also be considered to be reporters. II. Methods of Use
  • the present disclosure provides a method of treating Huntington’s disease in a subject in need thereof by administering to the subject a compound that inhibits miR- 485 (miRNA inhibitor).
  • the subject exhibits one or more characteristics of irritability, depression, involuntary movements, poor coordination, trouble learning new information or making decisions, uncontrolled movements, emotional problems, and loss of thinking ability (cognition) before administration.
  • the subject exhibits, after the administration, an improvement in one or more characteristics of Huntington’s disease.
  • the improvement is at least about 1.5 fold, at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, or at least about 10 fold compared to the characteristics prior to the administration.
  • the Huntington’s disease is associated with a decreased level of a
  • the miR-485 inhibitor increases expression of a SIRTl protein and/or a SIRTl gene in the subject.
  • SIRTl also known as NAD-dependent deacetylase sirtuin-1
  • SIRTl gene is located on chromosome 10 in humans (nucleotides 67,884,656 to 67,918,390 of GenBank Accession Number NC_000010.11, plus strand orientation).
  • SIRTl Synonyms of the SIRTl gene, and the encoded protein thereof, are known and include "regulatory protein SIR2 homolog 1,” “silent mating-type information regulation 2 homolog 1,” “SIR2,” “SIR2-Like Protein 1,” “SIR2L1,” “SIR2alpha,” “Sirtuin Type 1,” “hSIRTl,” or “hSIR2.”
  • SIRTl isoform 1 (UniProt identifier: Q96EB6-1) consists of 747 amino acids and has been chosen as the canonical sequence (SEQ ID NO: 31).
  • SIRTl isoform 2 (also known as "delta-exon8) (UniProt identifier: Q96EB6-2) consists of 561 amino acids and differs from the canonical sequence as follows: 454-639: missing (SEQ ID NO: 32). Table 1 below provides the sequences for the two SIRTl isoforms. Table 1.
  • SIRT1 includes any variants or isoforms of SIRT1 which are naturally expressed by cells. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of SIRT1 isoform 1. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of SIRT1 isoform 2. In further aspects, a miR-485 inhibitor disclosed herein can increase the expression of both SIRT1 isoform 1 and isoform 2. Unless indicated otherwise, both isoform 1 and isoform 2 are collectively referred to herein as "SIRTl.”
  • a miR-485 inhibitor of the present disclosure increases the expression of SIRT1 protein and/or SIRTl gene by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, or at least about 300% compared to a reference (e.g. , expression of SIRTl protein and/or SIRTl gene in a corresponding subject that did not receive an administration of the miR- 485 inhibitor).
  • a reference e.g. , expression of SIRTl protein and/or SIRTl gene in a corresponding subject that did not receive an administration of the miR- 485 inhibitor.
  • a miR-485 inhibitor disclosed herein increases the expression of SIRTl protein and/or SIRTl gene by reducing the expression and/or activity of miR-485, e.g., miR-485-3p.
  • a miR-485 inhibitor of the present disclosure can reduce the expression and/or activity of miR-485-3p.
  • a miR-485 inhibitor disclosed herein decreases the expression and/or activity of miR-485-3p by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% compared to a reference (e.g. , miR-485-3p expression in a corresponding subject that did not receive an administration of the miR-485 inhibitor).
  • a reference e.g. , miR-485-3p expression in a corresponding subject that did not receive an administration of the miR-485 inhibitor.
  • a miR-485 inhibitor disclosed herein decreases the expression and/or activity of miR-485-5p by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% compared to a reference (e.g., miR-485-5p expression in a corresponding subject that did not receive an administration of the miR-485 inhibitor).
  • a miR-485 inhibitor disclosed herein decreases the expression and/or activity of both miR- 485-3p and miR-485-5p by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% compared to a reference (e.g, miR-485-3p and miR-485- 5p expression in a corresponding subject that did not receive an administration of the miR-485 inhibitor).
  • the expression of miR-485-3p and/or miR-485-5p is completely inhibited after the administration of the miR-485 inhibitor.
  • a miR-485 inhibitor of the present disclosure can increase the expression of SIRT1 protein and/or SIRTl gene when administered to a subject. Accordingly, in some aspects, the present disclosure provides a method of treating Huntingotn’s disease associated with an abnormal (e.g, reduced) level of a SIRTl protein and/or SIRTl gene in a subject in need thereof.
  • the Huntington’s disease is associated with a decreased level of a
  • the miR-485 inhibitor increases expression of a CD36 protein and/or a CD36 gene in a subject in need thereof.
  • CD36 Cluster determinant 36
  • platelet glycoprotein 4 is a protein that in humans is encoded by the CD36 gene.
  • the CD36 gene is located on chromosome 7 (nucleotides 80,602,656 to 80,679,277 of GenBank Accession Number NC_000007.14, plus strand orientation).
  • CD36 gene and the encoded protein thereof, are known and include "platelet glycoprotein IV,” “fatty acid translocase,” “scavenger receptor class B member 3,” “glycoprotein 88,” “glycoprotein Illb,” “glycoprotein IV,” “thrombospondin receptor,” “GPIIIB,” “PAS IV,” “GP3B,” “GPIV,” “FAT,” “GP4,” “BDPLT10,” “SCARB3,” “CHDS7,” “PASIV,” or “PAS-4.”
  • CD36 isoform 1 (UniProt identifier: P16671-1) consists of 472 amino acids and has been chosen as the canonical sequence (SEQ ID NO: 36).
  • CD36 isoform 2 (also known as "ex8-del") (UniProt identifier: P16671-2) consists of 288 amino acids and differs from the canonical sequence as follows: 274-288: SIYAVFESDVNLKGI ETCVHFTSSFSVCKS; and 289-472: missing (SEQ ID NO: 37).
  • CD36 Isoform 3 (also known as "ex6-7-del") (UniProt identifier: P16671-3) consists of 433 amino acids and differs from the canonical sequence as follows: 234-272: missing (SEQ ID NO: 38).
  • CD36 isoform 4 (also known as "ex4-del” (UniProt identifier: PI 6671-4) consists of 412 amino acids and differs from the canonical sequence as follows: 144-203: missing (SEQ ID NO: 39). Table 2 below provides the sequences for the four CD36 isoforms.
  • CD36 includes any variants or isoforms of CD36 which are naturally expressed by cells. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of CD36 isoform 1. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of CD36 isoform 2. In some aspect, a miR-485 inhibitor disclosed herein can increase the expression of CD36 isoform 3. In some aspects, a miR- 485 inhibitor disclosed herein can increase the expression of CD36 isoform 4.
  • a miR-485 inhibitor disclosed herein can increase the expression of both CD36 isoform 1 and isoform 2, and/or isoform 3 and isoform 4, and/or isoform 1 and isoform 4, and/or isoform 2 and isoform 3.
  • a miR-485 inhibitor disclosed herein can increase the expression of all CD36 isoforms. Unless indicated otherwise, isoform 1, isoform 2, isoform 3, and isoform 4 are collectively referred to herein as "CD36.”
  • a miR-485 inhibitor of the present disclosure increases the expression of CD36 protein and/or CD36 gene by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, or at least about 300% compared to a reference (e.g, expression of CD36 protein and/or CD36 gene in a corresponding subject that did not receive an administration of the miR- 485 inhibitor).
  • a reference e.g, expression of CD36 protein and/or CD36 gene in a corresponding subject that did not receive an administration of the miR- 485 inhibitor.
  • a miR-485 inhibitor disclosed herein increases the expression of CD36 protein and/or CD36 gene by reducing the expression and/or activity of miR-485.
  • miR-485-3p There are two known mature forms of miR-485: miR-485-3p and miR- 485-5p.
  • a miR-485 inhibitor of the present disclosure can reduce the expression and/or activity of miR-485-3p.
  • a miR-485 inhibitor can reduce the expression and/or activity of miR-485-5p.
  • a miR-485 inhibitor disclosed herein can reduce the expression and/or activity of both miR-485-3p and miR-485-5p.
  • the Huntington’s disease is associated with a decreased level of a
  • the miR-485 inhibitor increases expression of a PGC-Ia protein and/or a PGC-Ia gene in a subject in need thereof.
  • PPCl-a Peroxisome proliferator-activated receptor gamma coactivator 1 -alpha
  • PPCl-a also known as PPARG Coactivator 1 Alpha or Ligand Effect Modulator-6
  • the PGCl-a gene is located on chromosome 4 in humans (nucleotides 23,792,021 to 24,472,905 of GenBank Accession Number NC_000004.12, plus strand orientation).
  • PGCl-a gene Synonyms of the PGCl-a gene, and the encoded protein thereof, are known and include “PPARGC1A,” “LEM6,” “PGC1,” “PGC1A,” “PGC-lv,” “PPARGC1, “PGC1 alpha,” or “PGC-l(alpha).”
  • PGCl-a isoform 1 (UniProt identifier: Q9UBK2-1) consists of 798 amino acids and has been chosen as the canonical sequence (SEQ ID NO: 40).
  • PGCl-a isoform 2 (also known as "Isoform NT-7a") (UniProt identifier: Q9UBK2-2) consists of 271 amino acids and differs from the canonical sequence as follows: 269-271: DPK ® LFL; 272-798: Missing (SEQ ID NO: 40).
  • PGCl-a isoform 3 (also known as "Isoform B5") (UniProt identifier: Q9UBK2-3) consists of 803 amino acids and differs from the canonical sequence as follows: 1-18:
  • PGCl-a isoform 4 (also known as "Isoform B4") (UniProt identifier: Q9UBK2-4) consists of 786 amino acids and differs from the canonical sequence as follows: 1-18:
  • PGCl-a isoform 5 (also known as "Isoform B4-8a") (UniProt identifier: Q9UBK2-5) consists of 289 amino acids and differs from the canonical sequence as follows: 1-18: MAWDMCNQDSES VW SDIE ® MDEGYF; 294-301:
  • PGCl-a isoform 6 (also known as "Isoform B5-NT") (UniProt identifier: Q9UBK2-6) consists of 276 amino acids and differs from the canonical sequence as follows: 1-18: MAWDMCNQDSES VWSDIE ®
  • PGCl-a isoform 7 (also known as "B4-3ext") (UniProt identifier: Q9UBK2-7) consists of 138 amino acids and differs from the canonical sequence as follows: 1-18: M AWDMCN QD SE S VW SDIE ® MDEGYF; 144-150: LKKLLLA ® VRTLPTV; 151-798:
  • PGCl-a isoform 8 (also known as "Isoform 8a") (UniProt identifier: Q9UBK2-8) consists of 301 amino acids and differs from the canonical sequence as follows: 294-
  • PGCl-a isoform 9 (also known as "Isoform 9" or "L-PGG-1 alpha") (UniProt identifier: Q9UBK2-9) consists of 671 amino acids and differs from the canonical sequence as follows: 1-127: Missing (SEQ ID NO: 48). Table 3 below provides the sequences for the nine PGCl-a isoforms.
  • PGCl-a includes any variants or isoforms of PGCl-a which are naturally expressed by cells. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGCl-a isoform 1. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGCl-a isoform 2. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGCl-a isoform 1. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGCl-a isoform 2. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGCl-a isoform 3.
  • a miR-485 inhibitor disclosed herein can increase the expression of PGCl-a isoform 4. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGCl-a isoform 5. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGCl-a isoform 6. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGCl-a isoform 7. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGCl-a isoform 8. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGCl-a isoform 9.
  • a miR-485 inhibitor disclosed herein can increase the expression of PGCl-a isoform 1, isoform 2, isoform 3, isoform 4, isoform 5, isoform 6, isoform 7, isoform 8, and isoform 9. Unless indicated otherwise, both isoform 1 and isoform 2 are collectively referred to herein as "PGCl-a.”
  • a miR-485 inhibitor of the present disclosure increases the expression of PGCl-a protein and/or PGCl-a gene by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, or at least about 300% compared to a reference (e.g, expression of PGCl-a protein and/or PGCl-a gene in a corresponding subject that did not receive an administration of the miR-485 inhibitor).
  • a reference e.g, expression of PGCl-a protein and/or PGCl-a gene in a corresponding subject that did not receive an administration of the miR-485 inhibitor.
  • a miR-485 inhibitor disclosed herein increases the expression of PGCl-a protein and/or PGCl-a gene by reducing the expression and/or activity of miR-485.
  • miR-485-3p There are two known mature forms of miR-485: miR-485-3p and miR- 485-5p.
  • a miR-485 inhibitor of the present disclosure can reduce the expression and/or activity of miR-485-3p.
  • a miR-485 inhibitor can reduce the expression and/or activity of miR-485-5p.
  • a miR-485 inhibitor disclosed herein can reduce the expression and/or activity of both miR-485-3p and miR-485-5p.
  • administering a miR-485 inhibitor disclosed herein can improve one or more symptoms of Hungtington’s disease associated with abnormal (e.g, reduced) levels of SIRTl protein and/or SIRT1 gene.
  • administering a miR-485 inhibitor disclosed herein can improve one or more symptoms of Huntington’s disease associated with abnormal (e.g, reduced) levels of CD36 protein and/or CD36 gene.
  • administering a miR-485 inhibitor disclosed herein can improve one or more symptoms of Huntington’s disease associated with abnormal (e.g, reduced) levels of PGCl-a protein and/or PGCl-a gene. Non-limiting examples of such symptoms are described below.
  • administering a miR-485 inhibitor of the present disclosure reduces the occurrence or risk of occurrence of one or more symptoms of Hungtington’s disease in a subj ect by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g, subjects that did not receive an administration of the miR-485 inhibitor).
  • a reference e.g, subjects that did not receive an administration of the miR-485 inhibitor.
  • administering a miR-485 inhibitor of the present disclosure reduces memory loss in a subject suffering from Huntington’s disease compared to a reference (e.g, memory loss in the subject prior to the administering).
  • administering a miR- 485 inhibitor of the present disclosure reduces memory loss or the risk of occurrence of memory loss in a subject suffering from Huntington’s disease by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g, subjects that did not receive an administration of the miR-485 inhibitor).
  • administering a miR-485 inhibitor of the present disclosure improves memory retention in a subject suffering from Huntington’s disease compared to a reference (e.g, memory retention in the subject prior to the administering). In some aspects, administering a miR-485 inhibitor of the present disclosure improves and/or increases memory retention in a subject suffering from Huntington’s disease by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about
  • administering a miR-485 inhibitor of the present disclosure improves spatial working memory in a subject suffering from Huntington’s disease compared to a reference (e.g, spatial working memory in the subject prior to the administering).
  • a reference e.g, spatial working memory in the subject prior to the administering.
  • spatial working memory refers to the ability to keep spatial information activity in working memory over a short period of time.
  • spatial working memory is improved and/or increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g, subjects that did not receive an administration of the miR-485 inhibitor).
  • a reference e.g, subjects that did not receive an administration of the miR-485 inhibitor.
  • administering a miR-485 inhibitor of the present disclosure increases the phagocytic activity of scavenger cells (e.g, glial cells) (e.g, by increasing the expression of CD36 protein and/or CD36 gene) in a subject suffering from Huntington’s disease compared to a reference (e.g. , phagocytic activity in the subject prior to the administering).
  • scavenger cells e.g, glial cells
  • a reference e.g. , phagocytic activity in the subject prior to the administering.
  • administering a miR-485 inhibitor of the present disclosure increases dendritic spine density of a neuron in a subject suffering from Huntington’s disease by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g, subjects that did not receive an administration of the miR-485 inhibitor).
  • administering a miR-485 inhibitor of the present disclosure reduces an amyloid beta (Ab) plaque load in a subject suffering from Huntington’s disease (e.g, by increasing the expression of CD36 protein and/or CD36 gene) compared to a reference (e.g, amyloid beta (Ab) plaque load in the subject prior to the administering).
  • amyloid beta plaque refers to all forms of aberrant deposition of amyloid beta including large aggregates and small associations of a few amyloid beta peptides and can contain any variation of the amyloid beta peptides.
  • Amyloid beta (Ab) plaque is known to cause neuronal changes, e.g., aberrations in synapse composition, synapse shape, synapse density, loss of synaptic conductivity, changes in dendrite diameter, changes in dendrite length, changes in spine density, changes in spine area, changes in spine length, or changes in spine head diameter.
  • neuronal changes e.g., aberrations in synapse composition, synapse shape, synapse density, loss of synaptic conductivity, changes in dendrite diameter, changes in dendrite length, changes in spine density, changes in spine area, changes in spine length, or changes in spine head diameter.
  • administering a miR- 485 inhibitor of the present disclosure reduces an amyloid beta plaque load in a subject suffering from Huntington’s disease by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g. , subjects that did not receive an administration of the miR-485 inhibitor).
  • a reference e.g. , subjects that did not receive an administration of the miR-485 inhibitor.
  • administering a miR-485 inhibitor disclosed herein increases neurogenesis in a subject suffering from Huntington’s disease (e.g, by increasing the expression of CD36 protein and/or CD36 gene) compared to a reference (e.g, neurogenesis in the subject prior to the administering).
  • neurogenesis refers to the process by which neurons are created. Neurogenesis encompasses proliferation of neural stem and progenitor cells, differentiation of these cells into new neural cell types, as well as migration and survival of the new cells. The term is intended to cover neurogenesis as it occurs during normal development, predominantly during pre-natal and peri-natal development, as well as neural cells regeneration that occurs following disease, damage or therapeutic intervention.
  • a miR-485 inhibitor of the present disclosure increases neurogenesis in a subject suffering from Huntington’s disease by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g, subjects that did not receive an administration of the miR-485 inhibitor).
  • increasing and/or inducing neurogenesis is associated with increased proliferation, differentiation, migration, and/or survival of neural stem cells and/or progenitor cells. Accordingly, in some aspects, administering a miR-485 inhibitor of the present disclosure can increase the proliferation of neural stem cells and/or progenitor cells in the subject.
  • the proliferation of neural stem cells and/or progenitor cells is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g ., subjects that did not receive an administration of the miR-485 inhibitor).
  • a reference e.g ., subjects that did not receive an administration of the miR-485 inhibitor.
  • the survival of neural stem cells and/or progenitor cells is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., subjects that did not receive an administration of the miR-485 inhibitor).
  • a reference e.g., subjects that did not receive an administration of the miR-485 inhibitor.
  • increasing and/or inducing neurogenesis is associated with an increased number of neural stem cells and/or progenitor cells.
  • the number of neural stem cells and/or progenitor cells is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g, subjects that did not receive an administration of the miR-485 inhibitor).
  • increasing and/or inducing neurogenesis is associated with increased axon, dendrite, and/or synapse development.
  • axon, dendrite, and/or synapse development is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g, subjects that did not receive an administration of the miR-485 inhibitor).
  • administering a miR-485 inhibitor of the present disclosure increases dendritic spine density of a neuron in a subject suffering from Huntington’s disease compared to a reference (e.g, dendritic spine density of a neuron in the subject prior to the administering).
  • administering a miR-485 inhibitor of the present disclosure increases dendritic spine density of a neuron in a subject suffering from Huntington’s disease by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference ( e.g ., subjects that did not receive an administration of the miR-485 inhibitor).
  • a reference e.g ., subjects that did not receive an administration of the miR-485 inhibitor
  • administering a miR-485 inhibitor disclosed herein decreases the loss of dendritic spines of a neuron in a subject suffering from Huntington’s disease compared to a reference (e.g., loss of dendritic spines of a neuron in the subject prior to the administering).
  • administering a miR-485 inhibitor decreases the loss of dendritic spines of a neuron in a subject suffering from Huntington’s disease by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g, subjects that did not receive an administration of the miR-485 inhibitor).
  • a reference e.g, subjects that did not receive an administration of the miR-485 inhibitor.
  • administering a miR-485 inhibitor of the present disclosure decreases neuroinflammation (e.g, by increasing the expression of SIRTl protein and/or SIRT1 gene) in a subject suffering from Huntington’s disease compared to a reference (e.g, neuroinflammation in the subject prior to the administering).
  • administering a miR-485 inhibitor decreases neuroinflammation in a subject suffering from Huntington’s disease by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g, subjects that did not receive an administration of the miR-485 inhibitor).
  • decreased neuroinflammation comprises glial cells producing decreased amounts of inflammatory mediators.
  • administering a miR-485 inhibitor disclosed herein to a subject suffering from Huntington’s disease decreases the amount of inflammatory mediators produced by glial cells by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., subjects that did not receive an administration of the miR-485 inhibitor).
  • an inflammatory mediator produced by glial cells comprises TNF-a.
  • the inflammatory mediator comprises IL-Ib.
  • an inflammatory mediator produced by glial cells comprises both TNF-a and IL-Ib.
  • administering a miR-485 inhibitor disclosed herein increases autophagy (e.g, by increasing the expression of a SIRT1 protein and/or SIRT1 gene) in a subject suffering from Huntington’s disease.
  • autophagy refers to cellular stress response and a survival pathway that is responsible for the degradation of long-lived proteins, protein aggregates, as well as damaged organelles in order to maintain cellular homeostasis.
  • abnormalities of autophagy have been associated with number of diseases, including many neurodegenerative diseases such as Huntington’s disease.
  • administering a miR-485 inhibitor disclosed herein to a subject suffering from Huntington’s disease increases autophagy by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, or at least about 300% or more, compared to a reference (e.g, subjects that did not receive an administration of the miR-485 inhibitor).
  • a reference e.g, subjects that did not receive an administration of the miR-485 inhibitor
  • Non-limiting examples of motor symptoms associated with Huntington's disease include resting tremor, reduction of spontaneous movement (bradykinesia), involuntary movements (chorea), rigidity, postural instability, freezing of gait, impaired handwriting (micrographia), decreased facial expression, delayed start of movement (akinesia), motor impersistence, slurred speech, swallowing difficulties, and uncontrolled rapid movements.
  • Non-limiting examples of non-motor symptoms associated with Huntington's disease include autonomic dysfunction, neuropsychiatric problems (mood, cognition, behavior, or thought alterations), sensory alterations (especially altered sense of smell), and sleep difficulties.
  • administering a miR-485 inhibitor of the present disclosure improves one or more motor symptoms in a subject suffering from Huntington’s disease compared to a reference (e.g, corresponding motor symptoms in the subject prior to the administering).
  • administering a miR-485 inhibitor of the present disclosure improves one or more motor symptoms in a subject suffering from Huntington’s disease by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference ( e.g ., subjects that did not receive an administration
  • administering a miR-485 inhibitor of the present disclosure improves one or more non-motor symptoms in a subject suffering from Huntington’s disease compared to a reference (e.g., corresponding non-motor symptom in the subject prior to the administering).
  • administering a miR-485 inhibitor disclosed herein improves one or more non-motor symptoms in a subj ect suffering from Huntington’ s disease by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g, subjects that did not receive an administration of the miR-485 inhibitor).
  • a reference e.g, subjects that did not receive an administration of the miR-485 inhibitor
  • administering a miR-485 inhibitor disclosed herein improves synaptic function in a subject suffering from Huntington’s disease compared to a reference (e.g, synaptic function in the subject prior to the administering).
  • a reference e.g, synaptic function in the subject prior to the administering.
  • the term "synaptic function,” refers to the ability of the synapse of a cell (e.g, a neuron) to pass an electrical or chemical signal to another cell (e.g, a neuron).
  • administering a miR-485 inhibitor of the present disclosure improves synaptic function in a subject suffering from Huntington’s disease by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g, subjects that did not receive an administration of the miR- 485 inhibitor).
  • a reference e.g, subjects that did not receive an administration of the miR- 485 inhibitor
  • administering a miR-485 inhibitor of the present disclosure can prevent, delay, and/or ameliorate the loss of synaptic function in a subject suffering from Huntington’s disease compared to a reference (e.g ., loss of synaptic function in the subject prior to the administering).
  • administering a miR-485 inhibitor prevents, delays, and/or ameliorates the loss of synaptic function in a subject suffering from Huntington’s disease by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., subjects that did not receive an administration of the miR-485 inhibitor).
  • a reference e.g., subjects that did not receive an administration of the miR-485 inhibitor.
  • a miR-485 inhibitor disclosed herein can be administered by any suitable route known in the art.
  • a miR-485 inhibitor is administered parenthetically, intramuscularly, subcutaneously, ophthalmic, intravenously, intraperitoneally, intradermally, intraorbitally, intracerebrally, intracranially, intracerebroventricularly, intraspinally, intraventricular, intrathecally, intracistemally, intracapsularly, intratumorally, or any combination thereof.
  • a miR-485 inhibitor of the present disclosure can be used in combination with one or more additional therapeutic agents.
  • the additional therapeutic agent and the miR-485 inhibitor are administered concurrently.
  • the additional therapeutic agent and the miR-485 inhibitor are administered sequentially.
  • the additional therapeutic agent reduces motor or non-motor symptoms.
  • the additional therapeutic agent is a drug to control movement (e.g. tetrabenazine), an antipsychotic drug (e.g. haloperidol, risperidone, olanzapine and quetiapine), an antidepressant (e.g. citalopram, fluoxetine, and sertraline), a mood-stabilizing drug (e.g. divalproex, carbamazepine, and lamotrigine), mantadine, levetiracetam, clonazepam, or combinations thereof.
  • a drug to control movement e.g. tetrabenazine
  • an antipsychotic drug e.g. haloperidol, risperidone, olanzapine and quetiapine
  • an antidepressant e.g. citalopram, fluoxetine, and sertraline
  • a mood-stabilizing drug e.g. di
  • a miR-485 inhibitor of the present disclosure can be used to treat
  • Huntington s disease in a subject who has failed to respond to other treatments (e.g. tetrabenazine, haloperidol, citalopram, divalproex, clonazepam, etc.).
  • other treatments e.g. tetrabenazine, haloperidol, citalopram, divalproex, clonazepam, etc.
  • miR-485 inhibitors disclosed herein do not result in any adverse effects.
  • miR-485 inhibitors of the present disclosure do not adversely affect body weight when administered to a subject.
  • miR-485 inhibitors disclosed herein do not result in increased mortality or cause pathological abnormalities when administered to a subject.
  • a miR-485 inhibitor of the present disclosure comprises a nucleotide sequence encoding a nucleotide molecule that comprises at least one miR-485 binding site, wherein the nucleotide molecule does not encode a protein.
  • the miR- 485 binding site is at least partially complementary to the target miRNA nucleic acid sequence (i.e., miR-485), such that the miR-485 inhibitor hybridizes to the miR-485 nucleic acid sequence.
  • the miR-485 binding site of a miR inhibitor disclosed herein has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence of a miR-485.
  • the miR- 485 binding site is fully complementary to the nucleic acid sequence of a miR-485.
  • the miR-485 hairpin precursor can generate both miR-485-5p and miR-485-3p.
  • miR-485" encompasses both miR-485-5p and miR-485-3p unless specified otherwise.
  • the human mature miR-485-3p has the sequence 5'- GUCAUACACGGCUCUCCUCUCU-3' (SEQ ID NO: 1; miRBase Acc. No. MIMAT0002176).
  • a 5' terminal subsequence of miR-485-3p 5'-UCAUACA-3' is the seed sequence.
  • the human mature miR-485-5p has the sequence 5'-AGAGGCUGGCCGUGAUGAAUUC-3' (SEQ ID NO: 33; miRBase Acc. No. MIMAT0002175).
  • a 5' terminal subsequence of miR-485- 5p 5'-GAGGCUG-3' (SEQ ID NO: 50) is the seed sequence.
  • the human mature miR-485-3p has significant sequence similarity to that of other species.
  • the mouse mature miR-485-3p differs from the human mature miR-485-3p by a single amino acid at each of the 5'- and 3'- ends (i.e., has an extra "A” at the 5'-end and missing "C” at the 3'-end).
  • the mouse mature miR-485-3p has the following sequence: 5'-AGUCAUACACGGCUCUCCUCUC-3' (SEQ ID NO: 34; miRBase Acc. No. MIMAT0003129; underlined portion corresponds to overlap to human mature miR-485-3p).
  • a miR-485 inhibitor disclosed herein is capable of binding to miR-485-3p and/or miR- 485-5p from both human and mouse.
  • the miR-485 binding site is a single-stranded polynucleotide sequence that is complementary (e.g ., fully complementary) to a sequence of a miR-485-3p (or a subsequence thereof).
  • the miR-485-3p subsequence comprises the seed sequence.
  • the miR-485 binding site has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence set forth in SEQ ID NO: 49.
  • the miR-485 binding site is complementary to miR-485-3p except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.
  • the miR-485 binding site is fully complementary to the nucleic acid sequence set forth in SEQ ID NO: 1.
  • the miR-485 binding site is a single-stranded polynucleotide sequence that is complementary (e.g., fully complementary) to a sequence of a miR-485-5p (or a subsequence thereof). In some aspects, the miR-485-5p subsequence comprises the seed sequence.
  • the miR-485 binding site has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence set forth in SEQ ID NO: 50.
  • the miR-485 binding site is complementary to miR-485-5p except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.
  • the miR-485 binding site is fully complementary to the nucleic acid sequence set forth in SEQ ID NO: 35.
  • the seed region of a miRNA forms a tight duplex with the target mRNA.
  • Most miRNAs imperfectly base-pair with the 3' untranslated region (UTR) of target mRNAs, and the 5' proximal "seed" region of miRNAs provides most of the pairing specificity.
  • UTR 3' untranslated region
  • the miRNA ribonucleotides 3' of this region allow for lower sequence specificity and thus tolerate a higher degree of mismatched base pairing, with positions 2-7 being the most important.
  • the miR-485 binding site comprises a subsequence that is fully complementary (i.e., 100% complementary) over the entire length of the seed sequence of miR-485.
  • miRNA sequences and miRNA binding sequences that can be used in the context of the disclosure include, but are not limited to, all or a portion of those sequences in the sequence listing provided herein, as well as the miRNA precursor sequence, or complement of one or more of these miRNAs.
  • any aspects of the disclosure involving specific miRNAs or miRNA binding sites by name is contemplated also to cover miRNAs or complementary sequences thereof whose sequences are at least about at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the mature sequence of the specified miRNA
  • miRNA binding sequences of the present disclosure can include additional nucleotides at the 5', 3', or both 5' and 3' ends of those sequences in the sequence listing provided herein, as long as the modified sequence is still capable of specifically binding to miR- 485.
  • miRNA binding sequences of the present disclosure can differ in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides with respect to those sequences in the sequence listing provided, as long as the modified sequence is still capable of specifically binding to miR-485.
  • any methods and compositions discussed herein with respect to miRNA binding molecules or miRNA can be implemented with respect to synthetic miRNAs binding molecules. It is also understood that the disclosures related to RNA sequences in the present disclosure are equally applicable to corresponding DNA sequences.
  • a miRNA-485 inhibitor of the present disclosure comprises at least
  • nucleotide at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 5' of the nucleotide sequence.
  • a miRNA-485 inhibitor comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence.
  • a miR-485 inhibitor disclosed herein is about 6 to about 30 nucleotides in length. In certain aspects, a miR-485 inhibitor disclosed herein is 7 nucleotides in length. In further aspects, a miR-485 inhibitor disclosed herein is 8 nucleotides in length. In some aspects, a miR-485 inhibitor is 9 nucleotides in length. In some aspects, a miR-485 inhibitor of the present disclosure is 10 nucleotides in length. In certain aspects, a miR-485 inhibitor is 11 nucleotides in length. In further aspects, a miR-485 inhibitor is 12 nucleotides in length. In some aspects, a miR-485 inhibitor disclosed herein is 13 nucleotides in length.
  • a miR- 485 inhibitor disclosed herein is 14 nucleotides in length. In some aspects, a miR-485 inhibitor disclosed herein is 15 nucleotides in length. In further aspects, a miR-485 inhibitor is 16 nucleotides in length. In certain aspects, a miR-485 inhibitor of the present disclosure is 17 nucleotides in length. In some aspects, a miR-485 inhibitor is 18 nucleotides in length. In some aspects, a miR-485 inhibitor is 19 nucleotides in length. In certain aspects, a miR-485 inhibitor is 20 nucleotides in length. In further aspects, a miR-485 inhibitor of the present disclosure is 21 nucleotides in length. In some aspects, a miR-485 inhibitor is 22 nucleotides in length.
  • a miR-485 inhibitor disclosed herein comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from SEQ ID NOs: 2 to 30.
  • a miR- 485 inhibitor comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2 to 30, wherein the nucleotide sequence can optionally comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.
  • a miRNA inhibitor comprises 5'-UGUAUGA-3' (SEQ ID NO: 2),
  • GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 13), 5'-AGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 14), or 5 ' - G AG AGG AG AGC C GU GU AU G A-3 ' (SEQ ID NO: 15).
  • the miRNA inhibitor has 5'-UGUAUGAC-3' (SEQ ID NO: 16),
  • 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'- CCGUGUAUGAC-3' (SEQ ID NO: 19), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'- AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 22), 5'- AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5 '-AGGAGAGCCGUGUAUGAC-3 ' (SEQ ID NO: 26), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 27), 5'-
  • the miRNA inhibitor comprises 5'-TGTATGA-3' (SEQ ID NO:
  • GAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 87), 5'- AGAGGAGAGCCGTGT ATGAC-3' (SEQ ID NO: 88), or 5'-GAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 89).
  • a miRNA inhibitor disclosed herein comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AG AGG AG AGC C GT GT AT G AC -3' (SEQ ID NO: 88).
  • the miRNA inhibitor comprises a nucleotide sequence that has at least 90% similarity to 5 - AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AG AGG AG AGC C GT GT AT G AC -3' (SEQ ID NO: 88). In some aspects, the miRNA inhibitor comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AG AGG AG AGC C GT GT AT G AC -3' (SEQ ID NO: 88) with one substitution or two substitutions.
  • the miRNA inhibitor comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 88).
  • a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 35, or 62 to 89 and at least one, at least two, at least three, at least four or at least five additional nucleic acid at the N terminus, at least one, at least two, at least three, at least four, or at least five additional nucleic acid at the C terminus, or both.
  • a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 35 or 62 to 89, and one additional nucleic acid at the N terminus and/or one additional nucleic acid at the C terminus.
  • a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 35 or 62 to89, and one or two additional nucleic acids at the N terminus and/or one or two additional nucleic acids at the C terminus.
  • a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 35 or 62 to 89, and one to three additional nucleic acids at the N terminus and/or one to three additional nucleic acids at the C terminus.
  • a miR-485 inhibitor comprises 5'- GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 29).
  • a miR-485 inhibitor of the present disclosure comprises one miR-
  • a miR-485 inhibitor disclosed herein comprises at least two miR-485 binding sites. In certain aspects, a miR-485 inhibitor comprises three miR-485 binding sites. In some aspects, a miR-485 inhibitor comprises four miR-485 binding sites. In some aspects, a miR-485 inhibitor comprises five miR-485 binding sites. In certain aspects, a miR-485 inibitor comprises six or more miR-485 binding sites. In some aspects, all the miR-485 binding sites are identical. In some aspects, all the miR-485 binding sites are different. In some aspects, at least one of the miR-485 binding sites is different. In some aspects, all the miR-485 binding sites are miR- 485-3p binding sites. In other aspects, all the miR-485 binding sites are miR-485-5p binding sites. In further aspects, a miR-485 inhibitor comprises at least one miR-485-3p binding site and at least one miR-485-5p binding site.
  • a miR-485 inhibitor disclosed herein comprises a polynucleotide which includes at least one chemically modified nucleoside and/or nucleotide.
  • modified polynucleotides When the polynucleotides of the present disclosure are chemically modified the polynucleotides can be referred to as "modified polynucleotides.”
  • a “nucleoside” refers to a compound containing a sugar molecule (e.g ., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”).
  • a “nucleotide” refers to a nucleoside including a phosphate group. Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides.
  • Polynucleotides can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages.
  • the linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides.
  • modified polynucleotides disclosed herein can comprise various distinct modifications.
  • the modified polynucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications.
  • a modified polynucleotide can exhibit one or more desirable properties, e.g, improved thermal or chemical stability, reduced immunogenicity, reduced degradation, increased binding to the target microRNA, reduced non specific binding to other microRNA or other molecules, as compared to an unmodified polynucleotide.
  • a polynucleotide of the present disclosure is chemically modified.
  • the terms "chemical modification” or, as appropriate, “chemically modified” refer to modification with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribo- or deoxyribonucleosides in one or more of their position, pattern, percent or population, including, but not limited to, its nucleobase, sugar, backbone, or any combination thereof.
  • a polynucleotide of the present disclosure can have a uniform chemical modification of all or any of the same nucleoside type or a population of modifications produced by downward titration of the same starting modification in all or any of the same nucleoside type, or a measured percent of a chemical modification of all any of the same nucleoside type but with random incorporation
  • the polynucleotide of the present disclosure e.g ., a miR-485 inhibitor
  • Modified nucleotide base pairing encompasses not only the standard adenine- thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures.
  • non-standard base pairing is the base pairing between the modified nucleobase inosine and adenine, cytosine or uracil. Any combination of base/sugar or linker can be incorporated into polynucleotides of the present disclosure.
  • TD's of the present disclosure can be administered as RNAs, as DNAs, or as hybrid molecules comprising both RNA and DNA units.
  • the polynucleotide (e.g., a miR-485 inhibitor) includes a combination of at least two (e.g, 2, 3, 4, 5, 6, 7, 8, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20 or more) modified nucleobases.
  • the nucleobases, sugar, backbone linkages, or any combination thereof in a polynucleotide are modified by at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100%.
  • the chemical modification is at nucleobases in a polynucleotide of the present disclosure (e.g, a miR-485 inhibitor).
  • the at least one chemically modified nucleoside is a modified uridine (e.g, pseudouridine (y), 2-thiouridine (s2U), 1 -methyl- pseudouridine (ih ⁇ y), 1 -ethyl-pseudouridine (e ⁇ y), or 5-methoxy-uridine (mo5U)), a modified cytosine (e.g ., 5-methyl-cytidine (m5C)) a modified adenosine (e.g, 1 -methyl-adenosine (mlA), N6-methyl-adenosine (m6A), or 2-methyl-adenine (m2A)), a modified guanosine (e.g., 7-methyl- guanosine (m7G) or 1-methyl-gua
  • a modified uridine e
  • the polynucleotide of the present disclosure is uniformly modified (e.g, fully modified, modified throughout the entire sequence) for a particular modification.
  • a polynucleotide can be uniformly modified with the same type of base modification, e.g, 5-methyl-cytidine (m5C), meaning that all cytosine residues in the polynucleotide sequence are replaced with 5-methyl-cytidine (m5C).
  • m5C 5-methyl-cytidine
  • a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified nucleoside such as any of those set forth above.
  • the polynucleotide of the present disclosure includes a combination of at least two (e.g, 2, 3, 4 or more) of modified nucleobases. In some aspects, at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about
  • nucleobases in a polynucleotide of the present disclosure are modified nucleobases.
  • the polynucleotide of the present disclosure can include any useful linkage between the nucleosides.
  • linkages, including backbone modifications, that are useful in the composition of the present disclosure include, but are not limited to the following: 3'-alkylene phosphonates, 3'-amino phosphoramidate, alkene containing backbones, aminoalkylphosphoramidates, aminoalkylphosphotriesters, boranophosphates, -CH 2 -0-N(CH3)-CH 2 -, -CH 2 -N(CH3)-N(CH 3 )-CH 2 -, -CH 2 -NH-CH 2 -, chiral phosphonates, chiral phosphorothioates, formacetyl and thioformacetyl backbones, methylene (methylimino), methylene formacetyl and thioformacetyl backbones, methyleneimin
  • the presence of a backbone linkage disclosed above increase the stability and resistance to degradation of a polynucleotide of the present disclosure (i.e., miR-485 inhibitor).
  • a backbone modification that can be included in a polynucleotide of the present disclosure comprises phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification.
  • the modified nucleosides and nucleotides which can be incorporated into a polynucleotide of the present disclosure ⁇ i.e., miR-485 inhibitor) can be modified on the sugar of the nucleic acid.
  • the sugar modification increases the affinity of the binding of a miR-485 inhibitor to miR-485 nucleic acid sequence.
  • affinity-enhancing nucleotide analogues in the miR-485 inhibitor such as LNA or 2'-substituted sugars, can allow the length and/or the size of the miR-485 inhibitor to be reduced.
  • nucleotides in a polynucleotide of the present disclosure contain sugar modifications ⁇ e.g, LNA).
  • RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen.
  • modified nucleotides include replacement of the oxygen in ribose ⁇ e.g, with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond ⁇ e.g, to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose ⁇ e.g, to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose ⁇ e.g, to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms ⁇ e.g, tricyclo; and "unlocked" forms, such as glycol nucleic acid (GNA) ⁇ e
  • GAA glyco
  • the sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose.
  • a polynucleotide molecule can include nucleotides containing, e.g., arabinose, as the sugar.
  • the 2' hydroxyl group (OH) of ribose can be modified or replaced with a number of different substituents.
  • Exemplary substitutions at the 2'-position include, but are not limited to, H, halo, optionally substituted Ci-6 alkyl; optionally substituted Ci-6 alkoxy; optionally substituted C6-io aryloxy; optionally substituted C3-8 cycloalkyl; optionally substituted C3-8 cycloalkoxy; optionally substituted C6-10 aryloxy; optionally substituted C6-10 aryl-Ci-6 alkoxy, optionally substituted Ci-12 (heterocyclyl)oxy; a sugar (e.g, ribose, pentose, or any described herein); a polyethyleneglycol (PEG), -0(CH2CH20)nCH2CH20R, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g, from 0 to 4, from
  • nucleotide analogues present in a polynucleotide of the present disclosure comprise, e.g, 2'-0-alkyl-RNA units, 2'-OMe-RNA units, 2'-0- alkyl-SNA, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, arabino nucleic acid (ANA) units, 2'-fluoro-ANA units, HNA units, INA (intercalating nucleic acid) units, 2'MOE units, or any combination thereof.
  • the LNA is, e.g, oxy-LNA (such as beta-D-oxy-LNA, or alpha-L-oxy-LNA), amino-LNA (such as beta-D-amino-LNA or alpha-L-amino-LNA), thio-LNA (such as beta-D-thioO-LNA or alpha-L-thio-LNA), ENA (such a beta-D-ENA or alpha-L-ENA), or any combination thereof.
  • oxy-LNA such as beta-D-oxy-LNA, or alpha-L-oxy-LNA
  • amino-LNA such as beta-D-amino-LNA or alpha-L-amino-LNA
  • thio-LNA such as beta-D-thioO-LNA or alpha-L-thio-LNA
  • ENA such a beta-D-ENA or alpha-L-ENA
  • nucleotide analogues that can be included in a polynucleotide of the present disclosure comprises a locked nucleic acid (LNA), an unlocked nucleic acid (UNA), an arabino nucleic acid (ABA), a bridged nucleic acid (BNA), and/or a peptide nucleic acid (PNA).
  • LNA locked nucleic acid
  • UNA unlocked nucleic acid
  • ABA arabino nucleic acid
  • BNA bridged nucleic acid
  • PNA peptide nucleic acid
  • a polynucleotide of the present disclosure can comprise both modified RNA nucleotide analogues (e.g, LNA) and DNA units.
  • amiR-485 inhibitor is a gapmer. See, e.g, U.S. Pat. Nos. 8,404,649; 8,580,756; 8,163,708; and 9,034,837; all of which are herein incorporated by reference in their entireties.
  • a miR-485 inhibitor is a micromir. See U.S. Pat. Appl. Publ. No. US20180201928, which is herein incorporated by reference in its entirety.
  • a polynucleotide of the present disclosure can include modifications to prevent rapid degradation by endo- and exo-nucleases.
  • Modifications include, but are not limited to, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), (b) base modifications, e.g., replacement with modified bases, stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, as well as (d) internucleoside linkage modifications, including modification or replacement of the phosphodiester linkages.
  • end modifications e.g., 5' end modifications (phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (conjugation
  • the miR-485 inhibitors of the present disclosure can be administered, e.g., to a subject suffering from a disease or condition associated with abnormal (e.g. , reduced) level of a SIRT1 protein and/or SIRT1 gene, using any relevant delivery system known in the art.
  • the delivery system is a vector.
  • the present disclosure provides a vector comprising a miR-485 inhibitor of the present disclosure.
  • the vector is viral vector.
  • the viral vector is an adenoviral vector or an adenoassociated viral vector.
  • the viral vector is an AAV that has a serotype of AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or any combination thereof.
  • the adenoviral vector is a third generation adenoviral vector.
  • ADEASYTM is by far the most popular method for creating adenoviral vector constructs. The system consists of two types of plasmids: shuttle (or transfer) vectors and adenoviral vectors. The transgene of interest is cloned into the shuttle vector, verified, and linearized with the restriction enzyme Pmel. This construct is then transformed into ADEASIER-1 cells, which are BJ5183 E. coli cells containing P ADEASYTM.
  • P ADEASYTM is a -33Kb adenoviral plasmid containing the adenoviral genes necessary for virus production.
  • the shuttle vector and the adenoviral plasmid have matching left and right homology arms which facilitate homologous recombination of the transgene into the adenoviral plasmid.
  • Recombinant adenoviral plasmids are then verified for size and proper restriction digest patterns to determine that the transgene has been inserted into the adenoviral plasmid, and that other patterns of recombination have not occurred. Once verified, the recombinant plasmid is linearized with Pad to create a linear dsDNA construct flanked by ITRs. 293 or 911 cells are transfected with the linearized construct, and virus can be harvested about 7-10 days later.
  • other methods for creating adenoviral vector constructs known in the art at the time the present application was filed can be used to practice the methods disclosed herein.
  • the viral vector is a retroviral vector, e.g., a lentiviral vector (e.g., a third or fourth generation lentiviral vector).
  • Lentiviral vectors are usually created in a transient transfection system in which a cell line is transfected with three separate plasmid expression systems. These include the transfer vector plasmid (portions of the HIV provirus), the packaging plasmid or construct, and a plasmid with the heterologous envelop gene (env) of a different virus.
  • the three plasmid components of the vector are put into a packaging cell which is then inserted into the HIV shell.
  • the virus portions of the vector contain insert sequences so that the virus cannot replicate inside the cell system.
  • AAV vector can comprise a known vector or can comprise a variant, fragment, or fusion thereof.
  • the AAV vector is selected from the group consisting of AAV type 1 (AAV1), AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, bovine AAV, shrimp AAV, snake AAV, and any combination thereof.
  • the AAV vector is derived from an AAV vector selected from the group consisting of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, and any combination thereof.
  • the AAV vector is a chimeric vector derived from at least two
  • AAV vectors selected from the group consisting of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, and any combination thereof.
  • the AAV vector comprises regions of at least two different AAV vectors known in the art.
  • the AAV vector comprises an inverted terminal repeat from a first
  • AAV e.g, AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, or any derivative thereof) and a second inverted terminal repeat from a second AAV (e.g., AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV
  • the AAV vector comprises a portion of an AAV vector selected from the group consisting of AAVl, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, and any combination thereof.
  • the AAV vector comprises AAV2.
  • the AAV vector comprises a splice acceptor site.
  • the AAV vector comprises a promoter. Any promoter known in the art can be used in the AAV vector of the present disclosure.
  • the promoter is an RNA Pol III promoter.
  • the RNA Pol III promoter is selected from the group consisting of the U6 promoter, the HI promoter, the 7SK promoter, the 5S promoter, the adenovirus 2 (Ad2) VAI promoter, and any combination thereof.
  • the promoter is a cytomegalovirus immediate-early gene (CMV) promoter, an EFla promoter, an SV40 promoter, a PGK1 promoter, a Ubc promoter, a human beta actin promoter, a CAG promoter, a TRE promoter, a UAS promoter, a Ac5 promoter, a polyhedrin promoter, a CaMKIIa promoter, a GALl promoter, a GAL 10 promoter, a TEF promoter, a GDS promoter, a ADH1 promoter, a CaMV35S promoter, or a Ubi promoter.
  • the promoter comprises the U6 promoter.
  • the AAV vector comprises a constitutively active promoter
  • the constitutive promoter is selected from the group consisting of hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, beta-actin promoter, cytomegalovirus (CMV), simian virus (e.g, SV40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, a retrovirus long terminal repeat (LTR), Murine stem cell virus (MSCV) and the thymidine kinase promoter of herpes simplex virus.
  • HPRT hypoxanthine phosphoribosyl transferase
  • CMV cytomegalovirus
  • simian virus e.g, SV40
  • papilloma virus adenovirus
  • human immunodeficiency virus HIV
  • Rous sarcoma virus Rous sarcoma virus
  • the promoter is an inducible promoter.
  • the inducible promoter is a tissue specific promoter.
  • the tissue specific promoter drives transcription of the coding region of the AAV vector in a neuron, a glial cell, or in both a neuron and a glial cell.
  • the AAV vector comprises one or more enhancers. In some aspects, the one or more enhancer are present in the AAV alone or together with a promoter disclosed herein. In some aspects, the AAV vector comprises a 3'UTR poly(A) tail sequence. In some aspects, the 3'UTR poly(A) tail sequence is selected from the group consisting of bGH poly(A), actin poly(A), hemoglobin poly(A), and any combination thereof. In some aspects, the 3'UTR poly(A) tail sequence comprises bGH poly(A).
  • a miR-485 inhibitor disclosed herein is administered with a delivery agent.
  • delivery agents include a lipidoid, a liposome, a lipoplex, a lipid nanoparticle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, a micelle, or a conjugate.
  • the present disclosure also provides a composition comprising a miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) and a delivery agent.
  • the delivery agent comprises a cationic carrier unit comprising
  • WP is a water-soluble biopolymer moiety
  • CC is a positively charged carrier moiety
  • AM is an adjuvant moiety
  • LI and L2 are independently optional linkers, and wherein when mixed with a nucleic acid at an ionic ratio of about 1 : 1, the cationic carrier unit forms a micelle.
  • composition comprising a miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) interacts with the cationic carrier unit via an ionic bond.
  • the cationic carrier units of the present disclosure comprise at least one water-soluble biopolymer.
  • water-soluble biopolymer refers to a biocompatible, biologically inert, non-immunogenic, non-toxic, and hydrophilic polymer, e.g., PEG.
  • the water-soluble biopolymer comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefmic alcohol), polyvinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly(a- hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines ("POZ") poly(N-acryloylmorpholine), or any combinations thereof.
  • the water-soluble biopolymer comprises polyethylene glycol (“PEG”), polyglycerol, or polypropylene glycol) (“PPG").
  • the water-soluble polymer comprises:
  • the n is at least about 110, at least about i l l, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141.
  • the n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, about 150 to about 160.
  • the water-soluble polymer is linear, branched, or dendritic.
  • the cationic carrier moiety comprises one or more basic amino acids.
  • the cationic carrier moiety comprises at least three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, at least about 50, at least about 51, at least about 52, at least about 53, at least about 54,
  • the eationie carrier unit comprises at least about 40 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 45 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 50 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 55 basic amino acids, e.g., ly ines. In some aspects, the cationic carrier unit cornpri ses at least about 60 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 65 basic amino acids, e.g., lysines.
  • the cationic carrier unit comprises at least about 70 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 75 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit cornpri ses at least about 80 basic amino acids, e.g, lysines.
  • the number of basic amino acids can be adjusted based on the length of the anionic payload.
  • the term "payload” refers to a biologically active molecule, e.g, a therapeutic agent (e.g., miR485- 3p inhibitor) that can interact by itself or via an adapter with a cationic carrier unit of the present disclosure, and be included within the core of a micelle of the present disclosure.
  • a therapeutic agent e.g., miR485- 3p inhibitor
  • an anionic payload with a longer sequence can be paired with higher number of basic amino acids, e.g, lysines.
  • the number of basic amino acids, e.g, lysines, in the cationic carrier unit can be calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., oligonucleotide, e.g., antimir (N/P ratio) is about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.
  • an anionic payload e.g., oligonucleotide, e.g., antimir
  • the number of basic amino acids, e.g, lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., oligonucleotide, e.g., antimir (N/P ratio) is about 1.3 to about 1.7, e.g., about 1.5.
  • the number of basic amino acids, e.g, lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., oligonucleotide, e.g., antimir (N/P ratio) is about 1.4.
  • the number of basic amino acids, e.g, lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., oligonucleotide, e.g., antimir (N/P ratio) is about 1.6.
  • the number of basic amino acids, e.g, lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., oligonucleotide, e.g., antimir (N/P ratio) is about 1.3.
  • the number of basic amino acids, e.g, lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., oligonucleotide, e.g., antimir (N/P ratio) is about 1.7.
  • a role of the cationic carrier moiety is to neutralize negative charges on the payload (e.g, negative changes in the phosphate backbone of an miRNA inhibitor) via electrostatic interaction, in some aspects (e.g, when the payload is a nucleic acid such as an antimir), the length of the cationic carrier, number of positively charged groups on the cationic carrier, and distribution and orientation of charges present on the cationic carrier will depend on the length and charge distribution on the payload molecule.
  • the cationic carrier comprises between about 5 and about 10, between about 10 and about 15, between about 15 and about 20, between about 20 and about 25, between about 25 and about 30, between about 30 and about 35, between about 35 and about 40, between about 40 and about 45, between about 45 and about 50, between about 50 and about 55, between about 55 and about 60, between about 60 and about 65, between about and about 70, between about 70 and about 75, or between about 75 and about 80 basic amino acids.
  • the positively charged carrier comprises between 30 and about 50 basic amino acids. In some specific aspects, the positively charged carrier comprises between 70 and about 80 basic amino acids.
  • the basic amino acid comprises arginine, lysine, histidine, or any combination thereof.
  • the basic amino acid is a D-amino acid.
  • the basic amino acid is an L-amino acid.
  • the positively charged carrier comprises D- amino acids and L-amino acids.
  • the basic amino acid comprises at least one unnatural amino acid or a derivative thereof.
  • the basic amino acid is arginine, lysine, histidine, L-4-aminomethyl-phenylalanine, L-4-guanidine-phenylalanine, L-4- aminomethyl-N-isopropyl-phenylalanine, L-3-pyridyl-alanine, L-trans-4- aminomethylcyclohexyl-alanine, L-4-piperidinyl-alanine, L-4-aminocyclohexyl-alanine, 4- guanidinobutyric acid, L-2-amino-3-guanidinopropionic acid, DL-5-hydroxylysine, pyrrolysine, 5-hydroxy -L-lysine, methyllysine, hypusine, or any combination thereof.
  • the positively charged carrier comprises about 40 lysines. In a particular aspect, the positively charged carrier comprises about 50 lysines. In a particular aspect, the positively charged carrier comprises about 60 lysines. In a particular aspect, the positively charged carrier comprises about 70 lysines. In a particular aspect, the positively charged carrier comprises about 80 lysines. In a particular aspect, the positively charged carrier comprises about 30 lysines. In a particular aspect, the positively charged carrier comprises about 40 lysines. In a particular aspect, the positively charged carrier comprises about 38 lysines. In a particular aspect, the positively charged carrier comprises about 32 lysines. In a particular aspect, the positively charged carrier comprises about 35 lysines. In a particular aspect, the positively charged carrier comprises about 64 lysines. In a particular aspect, the positively charged carrier comprises about 63 lysines.
  • the cationic carrier moiety binds to a single payload molecule. In other aspects, a cationic carrier moiety can bind to multiple payload molecules, which may be identical or different.
  • the positive charges of the cationic carrier moiety and negative charges of a nucleic acid payload are at an ionic ratio of about 5:1, about 4:1, about 3:1, about 2.9:1, about 2.8:1, about 2.7:1, about 2.6:1, about 2.5:1, about 2.4:1, about 2.3:1, about 2.2:1, about 2:1, about 2:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.6:1, about 1.5:1, about 1.4:1, about 1.3:1, about 1.2:1, about 1.1:1, about 1:1, about 1:1.1, about 1:1.2, about 1:1.3, about 1:1.4, about 1:1.5, about 1:1.6, about 1:1.7, about 1:1.8, about 1:1.9, about 1:2, about 1:2.1, about 1:2.2, about 1:2.3, about 1:2.4, about 1:2.5, about 1:2.6, about 1:2.7, about 1:2.8, about 1:2.9, about 1:3, about 1:4, or about 1:5.
  • the positive charges of the cationic carrier moiety and the negative charged of the nucleic acid payload are at a charge ratio of 1 : 1. In some aspects, the positive charges of the cationic carrier moiety and the negative charges of the nucleic acid payload are at a charge ratio of 3 :2. In some aspects, the positive charges of the cationic carrier moiety and the negative charges of the nucleic acid payload are at a charge ratio of 2:3.
  • the cationic carrier units of the present disclosure can further comprise at least one crosslinking moiety (CM).
  • crosslinking moiety refers to a moiety or portion of a polymer block comprising a plurality of agents that are capable of forming crosslinks.
  • the number of agents that are capable of forming crosslinks comprises an amino acid with a side chain of a crosslinking agent.
  • the CM comprises a biopolymer, e.g., a peptide ( e.g. , a polylysine) linked to a crosslinking agent.
  • the crosslinking moiety comprises one or more amino acids (e.g, lysine, arginine, histidine, or a combination thereof). In some aspects, the crosslinking moiety comprises at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30 amino acids, or at least about 35 amino acids, e.g., lysines, arginines, or combinations thereof, each of which is linked to a crosslinking agent.
  • amino acids e.g, lysine, arginines, or combinations thereof, each of which is linked to a crosslinking agent.
  • the lysines of the crosslinking moeity possess a neutral charge
  • lysines of the crosslinking moiety contain a thiol (e.g., lysine-thiol) and a tertiary amine, such that the lysines possess a neutral charge.
  • the crosslinking moiety forms a crosslink through the tertiary amine.
  • the crosslinking moiety forms a crosslink through the thiol.
  • lysine in the context of the crosslinking moiety, refers to lysines with a neutral charge (e.g., containing a tertiary amine), such that the lysines of the crosslinking moiety do not contribute to the overall charge of the carrier unit.
  • the lysines of the crosslinking moiety are linked to a crosslinking agent through an amide bond.
  • the crosslinking moiety comprises at least about 10 amino acids, e.g, lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 11 amino acids, e.g, lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 12 amino acids, e.g, lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 13 amino acids, e.g, lysines, each of which is linked to a crosslinking agent.
  • the crosslinking moiety comprises at least about 14 amino acids, e.g, lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 15 amino acids, e.g, lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 16 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 17 amino acids, e.g, lysines, each of which is linked to a crosslinking agent.
  • the crosslinking moiety comprises at least about 18 amino acids, e.g, lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 19 amino acids, e.g, lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 20 amino acids, e.g, lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 23 amino acids, e.g, lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 35 amino acids, e.g., lysines, each of which is linked to a crosslinking agent (e.g., lysine-thiol).
  • a crosslinking agent e.g., lysine-thiol
  • a crosslinking agent is a thiol. In some aspects, a crosslinking agent is a thiol derivative.
  • the adjuvant moiety is capable of modulating an immune response, an inflammatory response, and/or a tissue microenvironment.
  • the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof.
  • the adjuvant moiety comprises: (formula IV), wherein each of Gi and G2 is H, an aromatic ring, or 1-10 alkyl, or Gi and G2 together form an aromatic ring, and wherein n is 1-10.
  • the adjuvant moiety comprises nitroimidazole. In some aspects, the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof. In some aspects, the adjuvant moiety comprises an amino acid.
  • the adjuvant moiety comprises (formula V),
  • Ar wherein Ar is wherein each of Zi and Z2 is H or OH.
  • the adjuvant moiety comprises a vitamin.
  • the vitamin comprises a cyclic ring or cyclic hetero atom ring and a carboxyl group or hydroxyl group.
  • the vitamin comprises: (formula VI), wherein each of Yi and Y2 is C, N, O, or S, and wherein n is 1 or 2.
  • the vitamin is selected from the group consisting of vitamin A, vitamin Bl, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof.
  • the vitamin is vitamin B3.
  • the adjuvant moiety comprises at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, or at least about 40 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • amino acids e.g., lysines
  • the adjuvant moiety comprises about 30 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 31 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 32 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 33 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 34 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the adjuvant moiety comprises about 30 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 31 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 32 amino acids
  • the adjuvant moiety comprises about 35 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 36 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 37 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 38 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 39 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 40 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the adjuvant moiety comprises about 40 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the adjuvant moiety comprises from about 20 to about 25 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 25 to about 30 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 30 to about 35 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 35 to about 40 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 40 to about 45 amino acids (e.g., lysines), each of which is linked to vitamin B3, or about 45 to about 50 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • amino acids e.g., lysines
  • lysines amino acids
  • the adjuvant moiety comprises from about 20 to about 25 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 25 to about 30 amino acids (e.g., lysines), each of which is linked to
  • the adjuvant moiety comprises from about 20 to about 30 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 30 to about 40 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 40 to about 50 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 25 to about 35 amino acids (e.g., lysines), each of which is linked to vitamin B3, or about 35 to about 45 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • amino acids e.g., lysines
  • the adjuvant moiety comprises at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3 units.
  • the adjuvant moiety comprises about 10 vitamin B3 units.
  • the cationic carrier unit comprises a targeting moiety, which is linked to the water-soluble polymer optionally via a linker.
  • targeting moiety refers to a biorecognition molecule that binds to a specific biological substance or site.
  • the targeting moiety is specific for a certain target molecule (e.g., a ligand targeting a receptor, or an antibody targeting a surface protein), tissue (e.g ., a molecule that would preferentially carry the micelle to a specific organ or tissue, e.g., liver, brain, or endothelium), or facilitate transport through a physiological barrier (e.g, a peptide or other molecule that may facilitate transport across the brain blood barrier or plasma membrane).
  • a certain target molecule e.g., a ligand targeting a receptor, or an antibody targeting a surface protein
  • tissue e.g a molecule that would preferentially carry the micelle to a specific organ or tissue, e.g., liver, brain, or endothelium
  • a physiological barrier e.g, a peptide or other molecule that may facilitate transport across the brain blood barrier or plasma membrane.
  • a targeting moiety can be coupled to a cationic carrier unit, and therefore, to the external surface of a micelle, whereas the micelle has the payload entrapped within its core.
  • the targeting moiety is a targeting moiety capable of targeting the micelle of the present disclosure to a tissue.
  • the tissue is liver, brain, kidney, lung, ovary, pancreas, thyroid, breast, stomach, or any combination thereof.
  • the tissue is cancer tissue, e.g, liver cancer, brain cancer, kidney cancer, lung cancer, ovary cancer, pancreas cancer, thyroid cancer, breast cancer, stomach cancer, or any combination thereof.
  • the tissue is a tissue in the central nervous system, e.g, neural tissue.
  • the targeting moiety targeting the central nervous system is capable being transported by Large-neutral Amino Acid Transporter 1 (LAT1).
  • LAT1 (SLC7A5) is a transporter for both the uptake of large neutral amino acids and a number of pharmaceutical drugs.
  • LAT1 can transport drugs such as L-dopa or gabapentin.
  • LAT1 is consistently expressed at high levels in brain microvessel endothelial cells. Being a solute carrier located primarily in the BBB, targeting the micelles of the present disclosure to LAT1 allows delivery through the BBB.
  • the targeting moiety targeting a micelle of the present disclosure to the LAT1 transporter is an amino acid, e.g, a branched-chain or aromatic amino acid.
  • the amino acid is valine, leucine, and/or isoleucine.
  • the amino acid is tryptophan and/or tyrosine.
  • the amino acid is tryptophan.
  • the amino acid is tyrosine.
  • the targeting moiety is a LAT1 ligand selected from tryptophan, tyrosine, phenylalanine, tryptophan, methionine, thyroxine, melphalan, L-DOPA, gabapentin, 3,5- I-diiodotyrosine, 3-iodo-I-tyrosine, fenclonine, acivicin, leucine, BCH, methionine, histidine, valine, or any combination thereof.
  • a targeting moiety comprises tyrosine, which can bind to LAT1 and cross BBB.
  • a targeting moiety comprises lysine, which can bind to LAT1 and cross BBB.
  • a targeting moiety comprises glutamine, which can bind to LAT1 and cross BBB.
  • a targeting moiety comprises phenylalanine, which can bind to GABA receptors, LAT1, CNS reverse transcriptase inhibitors, and/or dopamine (DA) receptors and cross BBB.
  • Dopamine receptors are a class of G protein-coupled receptors that are prominent in the vertebrate central nervous system (CNS). Dopamine receptors activate different effectors through not only G-protein coupling, but also signaling through different protein (dopamine receptor-interacting proteins) interactions. The neurotransmitter dopamine is the primary endogenous ligand for dopamine receptors.
  • Dopamine receptors are implicated in many neurological processes, including motivation, pleasure, cognition, memory, learning, and fine motor control, as well as modulation of neuroendocrine signaling. Abnormal dopamine receptor signaling and dopaminergic nerve function is implicated in several neuropsychiatric disorders. Thus, dopamine receptors are common neurologic drug targets; antipsychotics are often dopamine receptor antagonists while psychostimulants are typically indirect agonists of dopamine receptors.
  • a targeting moiety comprises valine, which can bind to CNS reverse transcriptase inhibitors and cross BBB.
  • a targeting moiety comprises tryptophan, which can bind to GABA receptors and/or CNS reverse transcriptase inhibitors and cross BBB.
  • a targeting moiety comprises leucine, which can bind to GABA receptors and/or CNS reverse transcriptase inhibitors and cross BBB.
  • a targeting moiety comprises methionine, which can bind to GABA receptors and/or CNS reverse transcriptase inhibitors and cross BBB.
  • a targeting moiety comprises histidine, which can bind to GABA receptors and cross BBB.
  • a targeting moiety comprises isoleucine, which can bind to CNS reverse transcriptase inhibitors and cross BBB.
  • a targeting moiety comprises Glutathione, which can bind to GSH transporter and cross BBB.
  • a targeting moiety comprises Glutathione-Met, which can bind to GSH transporter and cross BBB.
  • a targeting moiety comprises Urea/Thiourea, which can bind to Nitric oxide synthase (NOS) and bind to BBB.
  • a targeting moiety comprises NAD+/NADH, which is capable of crossing BBB by REDOX mechanism.
  • a targeting moiety comprises purine and can cross BBB.
  • targeting moieties for CNS targeting are shown in Sutera et al. (2016): Small endogenous molecules as moiety to improve targeting of CNS drugs, Expert Opinion on Drug Delivery, DOI: 10.1080/17425247.2016.1208651, which is incorporated herein by reference in its entirety.
  • the composition comprises a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3 units.
  • the present disclosure also provides a micelle comprising a miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) wherein the miRNA inhibitor and the delivery agent are associated with each other.
  • the association is a covalent bond, a non-covalent bond, or an ionic bond.
  • the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form a micelle when mixed with the miR-485 inhibitor disclosed herein in a solution, wherein the overall ionic ratio of the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the miR-485 inhibitor (or vector comprising the inhibitor) in the solution is about 1:1.
  • the cationic carrier unit is capable of protecting the miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) from enzymatic degradation. See WO2020261227A1, which is herein incorporated by reference in its entirety.
  • the cationic carrier unit is associated with a miRNA inhibitor of the present disclosure (e.g., miR485-3p inhibitor).
  • the cationic carrier unit associated with a miRNA inhibitor of the present disclosure comprises 80 lysine residues, wherein 64 lysine residues are unmodifided (e.g., contain a positively charged amine, e.g., -NH3+) and wherein 16 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol).
  • the cationic carrier unit associated with a miRNA inhibitor of the present disclosure comprises 80 lysine residues, wherein 40 lysine residues are unmodifided (e.g, contain positively charged amine) and wherein 35 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol) and wherein 5 lysine residues are modified to contain an adjuvant moiety (e.g., a vitamin).
  • an adjuvant moiety e.g., a vitamin
  • the cationic carrier unit associated with a miRNA inhibitor of the present disclosure comprises 80 lysine residues, wherein 38 lysine residues are unmodifided (e.g, contain positively charged quaternary amine) and wherein 23 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol) and wherein 19 lysine residues are modified to contain an adjuvant moiety (e.g., a vitamin).
  • an adjuvant moiety e.g., a vitamin
  • the cationic carrier unit associated with a miRNA inhibitor of the present disclosure comprises 80 lysine residues, wherein 32 lysine residues are unmodifided (e.g, contain a positively charged amine, e.g., -NH3+) and wherein 16 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol) and wherein 32 lysine residues are modified to contain an adjuvant moiety (e.g., a vitamin). ).
  • 32 lysine residues are unmodifided (e.g, contain a positively charged amine, e.g., -NH3+) and wherein 16 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol) and wherein 32 lysine residues are modified to contain an adjuvant
  • the cationic carrier unit associated with a miRNA inhibitor of the present disclosure comprises 80 lysine residues, wherein 63 lysine residues are unmodifided (e.g., contain positively charged quaternary amine) and wherein 17 lysine residues are modified to contain an adjuvant moiety (e.g., a vitamin).
  • the present disclosure also provides pharmaceutical compositions comprising a miR-485 inhibitor disclosed herein (e.g., a polynucleotide or a vector comprising the miR-485 inhibitor) that are suitable for administration to a subject.
  • the pharmaceutical compositions generally comprise a miR-485 inhibitor described herein (e.g, a polynucleotide or a vector) and a pharmaceutically-acceptable excipient or carrier in a form suitable for administration to a subject.
  • Pharmaceutically acceptable excipients or carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition.
  • compositions comprising a miR-485 inhibitor of the present disclosure.
  • the pharmaceutical compositions are generally formulated sterile and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration.
  • GMP Good Manufacturing Practice
  • kits or products of manufacture comprising a miRNA inhibitor of the present disclosure (e.g., a polynucleotide, vector, or pharmaceutical composition disclosed herein) and optionally instructions for use, e.g., instructions for use according to the methods disclosed herein.
  • the kit or product of manufacture comprises a miR-485 inhibitor (e.g, vector, e.g, an AAV vector, a polynucleotide, or a pharmaceutical composition of the present disclosure) in one or more containers.
  • the kit or product of manufacture comprises miR-485 inhibitor (e.g, a vector, e.g, an AAV vector, a polynucleotide, or a pharmaceutical composition of the present disclosure) and a brochure.
  • miR-485 inhibitors disclosed herein e.g, vectors, polynucleotides, and pharmaceutical compositions of the present disclosure, or combinations thereof
  • a brochure e.g., a brochure, a pharmaceutical composition of the present disclosure.
  • miR-485 inhibitors disclosed herein e.g, vectors, polynucleotides, and pharmaceutical compositions of the present disclosure, or combinations thereof
  • the following examples are offered by way of illustration and not by way of limitation.
  • This synthesis step generated the water-soluble biopolymer (WP) and cationic carrier (CC) of a cationic carrier unit of the present disclosure (see FIG. 1).
  • Azido-poly(ethylene glycol)-6-poly(L-lysine) was synthesized by ring opening polymerization of Lys(TFA)-NCA with azido- PEG (N3-PEG).
  • N3-PEG 300 mg, 0.06 mmol
  • Lys(TFA)-NCA (1287 mg, 4.8 mmol) were separately dissolved in DMF containing 1M thiourea and DMF(or NMP).
  • Lys(TFA)-NCA solution was dropped into the N3-PEG solution by micro syringe and the reaction mixture was stirred at 37 °C for 4 days.
  • the reaction bottles were purged with argon and vacuum. All reactions were conducted in argon atmosphere.
  • N3-PEG-PLL 500 mg was dissolved in methanol (60 mL) and IN NaOH (6 mL) was dropped into the polymer solution with stirring. The mixture was maintained for 1 day with stirring at 37°C. The reaction mixture was dialyzed against 10 mM HEPES for 4 times and distilled water. White powder of N3-PEG-PLL was obtained after lyophilization.
  • N3-PEG-PLL(Nic/SH) was synthesized by chemical modification of N3-PEG-PLL and nicotinic acid in the presence of EDC/NHS.
  • N3-PEG-PLL (372 mg, 25.8 pmol) and nicotinic acid (556.7 mg, 1.02 equiv. toNH2 of PEG-PLL) were separately dissolved in mixture of deionized water and methanol (1:1).
  • EDOHC1 556.7 mg, 1.5 equiv. toNEh of N3-PEG-PLL
  • NHS 334.2 mg, 1.5 equiv. to NH2 of PEG-PLL
  • the reaction mixture was added into the N3-PEG-PLL solution.
  • the reaction mixture was maintained at 37 °C for 16 hours with stirring.
  • 3,3’-dithiodiproponic acid (36.8 mg, 0.1 equiv.) was dissolved in methanol, EDOEICI (40.3 mg, 0.15 equiv.), and NHS (24.2 mg, 0.15 equiv.) were dissolved each in deionized water.
  • NHS and EDOHC1 were added sequentially into 3,3’-dithiodiproponic acid solution.
  • the mixture solution was stirred for 4 hours at 37 °C after adding crude N3-PEG-PLL(Nic) solution.
  • the mixture was dialyzed sequentially methanol, 50 % methanol in deionized water, deionized water.
  • phenyl alanine was introduced by click reaction between N3-PEG-PLL(Nic/SH) and alkyne modified tyrosine in the presence of copper catalyst.
  • N3-PEG-PLL(Nic/SH) 130 mg, 6.5 pmol
  • alkyne modified phenyl alanine 5.7 mg, 4.0 equiv.
  • (e) Polyion Complex (PIC) micelle preparation Once the cationic carrier units of the present disclosure were generated as described above, micelles were produced.
  • the micelles described in the present example comprised cationic carrier units combined with an antisense oligonucleotide payload.
  • Nano sized PIC micelles were prepared by mixing MeO- or Phe-PEG-PLL(Nic) and miRNA. PEG-PLL(Nic) was dissolved in HEPES buffer (10 mM) at 0.5 mg/mL concentration.
  • RNAse free water was mixed with the polymer solution at 2:1 (v/v) ratio of miRNA inhibitor (SEQ ID NOs: 2-30) (e.g ., 5'- AGAGGAGAGCCGUGUAUGAC-3 ' (SEQ ID NO: 28) to polymer.
  • miRNA inhibitor SEQ ID NOs: 2-30
  • the mixing ratio of polymer to anti-miRNA was determined by optimizing micelle forming conditions, i.e., ratio between amine in polymer (carrier of the present disclosure) to phosphate in anti-miRNA (payload).
  • the mixture of polymer (carrier) and anti-miRNA (payload) was vigorously mixed for 90 seconds by multi -vortex at 3000 rpm, and kept at room temperature for 30 min to stabilize the micelles.
  • mice (10 mM of Anti-miRNA concentration) were stored at 4 °C prior to use.
  • MeO- or Phe- micelles were prepared using the same method, and different amounts of Phe- containing micelles (25% -75%) were also prepared by mixing both polymers during micelle preparation.
  • NSC-34 cells were maintained in culture medium (DMEM supplemented with 10% (vol/vol) fetal bovine serum (Gibco), 100 units/ml penicillin, 50 pg/ml streptomycin) and maintained at 37°C in a humidified 5% CO2 incubator.
  • the cell pellet was lysed in insoluble extraction buffer [50mM Tris-HCl (pH 7.5) + 2% SDS] containing protease/phosphatase inhibitor cocktail on ice for 30 minutes.
  • the lysates were centrifuged at 4°C for 15 minutes at 13,000 rpm. Protein was quantified using a bicinchoninic acid (BCA) assay kit (Bio-Rad Laboratories, Cat#5000116) and adjusted to the same final concentration. After denaturation, the lysates were processed for western blotting to measure insoluble Htt.
  • BCA bicinchoninic acid
  • the samples were separated by SDS-polyacrylamide gel electrophoresis, transferred to PVDF membranes and incubated with mouse anti-Htt primary antibody (Merck, Cat# MAB5374, 1:1000). The results were visualized using an enhanced chemiluminescence system.
  • NSC-34 cells (mouse motor neuron like cells) were transfected with GFP-tagged wild-type (Q23) (pEGFP-Q23) or mutant (Q74) (pEGFP-Q74) Htt. After transfection with GFP-tagged wild-type Q23 (pEGFP-Q23) Htt or mutant Q74 (pEGFP-Q74) Htt, miR485-3p inhibitor was co-treated in transfected NSC34. The insoluble fraction was obtained as previously described (after 48 hours) and the level of insoluble, aggregated Htt in Q74-GFP-tagged NSC-34 cells and Q24-GFP -tagged NSC-34 cells was analyzed.
  • Htt decreased significantly in micelle containing miR485-3p inhibitor (5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28)) treated-NSC- 34 cells expressing mutated Htt (FIGs. 2A and 2B).
  • Example 3 Effect of miR-485 inhibitors on Htt degradation in HEK293T, PC12, and primary cortical neurons
  • HEK293T and PC 12 cells were plated in 6-well plates overnight and transfected with 2 pg Q23- EGFP, Q74-EGFP using JETOPTIMUS® Transfection Reagent (polyplus) and treated with miR485-3p ASO (i.e., SEQ ID NO: 28) for 48 hours at a final concentration of 50, 100, and 300 nM.
  • JETOPTIMUS® Transfection Reagent polyplus
  • miR485-3p ASO i.e., SEQ ID NO: 28
  • Htt aggregation (puncta) at 48 hours posttransfection was assessed under fluorescence microscopy on the basis of enhanced green fluorescence gene (EGFP) expression.
  • EGFP enhanced green fluorescence gene
  • RIPA buffer iNtRON Biotechnology
  • protease/phosphatase inhibitor cocktail Cell signaling Technology, Cat#5872
  • the membranes were incubated with secondary antibodies for 1 hour at room temperature, and the bands were detected using Western-blot detection reagents (Thermo Fisher Scientific, Rockford, IL, USA).
  • Western-blot detection reagents Thermo Fisher Scientific, Rockford, IL, USA.
  • the density of each band was measured using a Computer Imaging Device and accompanying software (Fuji Film, Tokyo, Japan), and the levels were quantitatively expressed as the density normalized to the housekeeping protein band for each sample.
  • FIGs. 4A through 4E show that miR485-3p ASO treatment markedly upregulated autophagy stimulators, such as SIRTl, PGC-la, p62 and LC3-II, demonstrating miR485-3p ASO decreased Htt aggregation through autophagic mechanisms. Reduced Htt aggregation was also observed in PC12 cells treated with miR485-3p ASO by stimulating autophagy through increased expression of SIRTl, PGC-la, p62 and LC3. (FIGs. 5 and 6).
  • miR485-3p ASO treatment decreased cleavage of caspase-3, a marker of apoptosis (FIG. 6), demonstrating that Htt induced neuronal apoptosis was blocked by miR485-3p ASO.
  • Cells were filtered through a 70pm cell strainer (SPL, 93070), plated on culture plates and maintained at 37°C in a humidified 5% CO2 incubator. The medium was changed every 3 days and then after 10 days in vitro, cells were used for experiments.
  • SPL 70pm cell strainer
  • PC12 cells obtained from the American Type Culture Collection (Bethesda, MD, USA) were maintained in Dulbecco's Modified Eagle Medium (DMEM; Welgene) with 10% fetal bovine serum, 100 units/mL penicillin, 100 pg/mL streptomycin; and kept at 37 °C in a humidified atmosphere of 5% C02. Cells were cultured in 24-well plates and were transfected after 24 hours of culture with 2 pg of pEGFP HTT (Q23)/mHTT (Q74) plasmid with TransIT-X2TM (Mirus). After transfections and media changes, cells were transfected with miR485-3p ASO.
  • DMEM Dulbecco's Modified Eagle Medium

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Psychology (AREA)
  • Inorganic Chemistry (AREA)
  • Virology (AREA)
  • Dispersion Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/IB2021/055890 2020-07-01 2021-07-01 Mirna-485 inhibitor for huntington's disease Ceased WO2022003608A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
BR112022027040A BR112022027040A2 (pt) 2020-07-01 2021-07-01 Inibidor de mirna-485 para doença de huntington
KR1020227046418A KR20230031852A (ko) 2020-07-01 2021-07-01 헌팅턴병을 위한 mirna-485 억제제
US18/003,982 US20230304014A1 (en) 2020-07-01 2021-07-01 Mirna-485 inhibitor for huntington's disease
AU2021302972A AU2021302972A1 (en) 2020-07-01 2021-07-01 miRNA-485 inhibitor for huntington's disease
CN202180046108.2A CN115867290A (zh) 2020-07-01 2021-07-01 用于亨廷顿病的mirna-485抑制剂
EP21831873.1A EP4175675A4 (en) 2020-07-01 2021-07-01 MIRNA-485 INHIBITOR FOR HUNTINGTON'S DISEASE
CA3184043A CA3184043A1 (en) 2020-07-01 2021-07-01 Mirna-485 inhibitor for huntington's disease
JP2022581521A JP2023532536A (ja) 2020-07-01 2021-07-01 ｍｉＲＮＡ－４８５ハンチントン病の阻害剤

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063047090P 2020-07-01 2020-07-01
US63/047,090 2020-07-01

Publications (1)

Publication Number Publication Date
WO2022003608A1 true WO2022003608A1 (en) 2022-01-06

Family

ID=79315650

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2021/055890 Ceased WO2022003608A1 (en) 2020-07-01 2021-07-01 Mirna-485 inhibitor for huntington's disease

Country Status (9)

Country Link
US (1) US20230304014A1 (https=)
EP (1) EP4175675A4 (https=)
JP (1) JP2023532536A (https=)
KR (1) KR20230031852A (https=)
CN (1) CN115867290A (https=)
AU (1) AU2021302972A1 (https=)
BR (1) BR112022027040A2 (https=)
CA (1) CA3184043A1 (https=)
WO (1) WO2022003608A1 (https=)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240154159A (ko) 2023-04-17 2024-10-25 재단법인 아산사회복지재단 miR-223을 유효성분으로 포함하는 간 손상 예방 또는 치료용 조성물
CN116694562B (zh) * 2023-08-03 2023-11-03 四川大学华西医院 一种BMEC释放的sEV、其制备方法、用途及药物

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018139819A1 (ko) * 2017-01-26 2018-08-02 주식회사 바이오오케스트라 마이크로 rna를 이용한 뇌 질환 예방 또는 치료 용도

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20230099372A1 (en) * 2020-02-07 2023-03-30 Biorchestra Co., Ltd. Use of mirna-485 inhibitors for treating tauopathy

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018139819A1 (ko) * 2017-01-26 2018-08-02 주식회사 바이오오케스트라 마이크로 rna를 이용한 뇌 질환 예방 또는 치료 용도

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HAN SEOK KOH, JANG HANNAH, TAE SOOKIL, LEE MI-SUN, MIN JAE-WOONG, MUN HUI JIN, LEE JI NA, LEE HYO JIN, KIM DAE HOON, CHO HYUN-JEON: "Reducing miR485-3p ameliorates Alzheimer`s disease pathology by regulation of amyloid beta and neuro-inammation", RESEARCH SQUARE, 8 April 2020 (2020-04-08), pages 1 - 18, XP055764242, DOI: 10.21203/rs.3.rs-21918/v1 *
J. E. COHEN, P. R. LEE, S. CHEN, W. LI, R. D. FIELDS: "MicroRNA regulation of homeostatic synaptic plasticity", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, vol. 108, no. 28, 12 July 2011 (2011-07-12), pages 11650 - 11655, XP055534712, ISSN: 0027-8424, DOI: 10.1073/pnas.1017576108 *
LLORET ALEJANDRO; BEAL M. FLINT: "PGC-1α, Sirtuins and PARPs in Huntington’s Disease and Other Neurodegenerative Conditions: NAD+ to Rule Them All", NEUROCHEMICAL RESEARCH, SPRINGER US, NEW YORK, vol. 44, no. 10, 7 May 2019 (2019-05-07), New York, pages 2423 - 2434, XP036898168, ISSN: 0364-3190, DOI: 10.1007/s11064-019-02809-1 *
MARTÍ EULÀLIA, PANTANO LORENA, BAÑEZ-CORONEL MÓNICA, LLORENS FRANC, MIÑONES-MOYANO ELENA, PORTA SÍLVIA, SUMOY LAURO, FERRER ISIDRE: "A myriad of miRNA variants in control and Huntington’s disease brain regions detected by massively parallel sequencing", NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, GB, vol. 38, no. 20, 1 November 2010 (2010-11-01), GB , pages 7219 - 7235, XP055884438, ISSN: 0305-1048, DOI: 10.1093/nar/gkq575 *
See also references of EP4175675A4 *

Also Published As

Publication number Publication date
JP2023532536A (ja) 2023-07-28
EP4175675A1 (en) 2023-05-10
AU2021302972A1 (en) 2023-02-09
KR20230031852A (ko) 2023-03-07
CA3184043A1 (en) 2022-01-06
BR112022027040A2 (pt) 2023-03-07
EP4175675A4 (en) 2025-09-17
CN115867290A (zh) 2023-03-28
US20230304014A1 (en) 2023-09-28

Similar Documents

Publication Publication Date Title
US20230304014A1 (en) Mirna-485 inhibitor for huntington's disease
US20230099372A1 (en) Use of mirna-485 inhibitors for treating tauopathy
US20240050461A1 (en) Use of mirna-485 inhibitors for inducing hair growth
WO2022264038A1 (en) Use of mirna-485 inhibitors for treating inflammasome-related diseases or disorders
US20230131083A1 (en) Use of mirna-485 inhibitors for treating amyotrophic lateral sclerosis (als)
US20240117350A1 (en) Use of mirna-485 inhibitor to regulate psd95, synaptophysin, and caspase-3 expression
US20240294908A1 (en) Use of mirna-485 inhibitors for treating diseases or disorders associated with abnormal nlrp3 expression
WO2024228118A1 (en) Mirna-485 inhibitors
WO2024228119A1 (en) Mirna-485 inhibitors
US20230121720A1 (en) Diagnostic methods using pcg-1a expression
US20230119699A1 (en) Diagnostic methods using sirt1 expression
WO2023079499A1 (en) Use of mir-485 inhibitors to treat age-associated diseases or conditions
WO2024127317A1 (en) Treating mitochondrial dysfunction with mirna-485 inhibitor
WO2022003609A1 (en) Snp diagnostic methods
WO2023089506A1 (en) Amplification-free methods for measuring mirna

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21831873

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3184043

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022581521

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022027040

Country of ref document: BR

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021831873

Country of ref document: EP

Effective date: 20230201

ENP Entry into the national phase

Ref document number: 2021302972

Country of ref document: AU

Date of ref document: 20210701

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112022027040

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20221229