WO2021259909A1 - Génération de cellules de type trophectoderme et assemblage de vésicules de type trophectoderme et d'embryoïdes synthétiques - Google Patents

Génération de cellules de type trophectoderme et assemblage de vésicules de type trophectoderme et d'embryoïdes synthétiques Download PDF

Info

Publication number
WO2021259909A1
WO2021259909A1 PCT/EP2021/066945 EP2021066945W WO2021259909A1 WO 2021259909 A1 WO2021259909 A1 WO 2021259909A1 EP 2021066945 W EP2021066945 W EP 2021066945W WO 2021259909 A1 WO2021259909 A1 WO 2021259909A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
xte
xen
cell
trophectoderm
Prior art date
Application number
PCT/EP2021/066945
Other languages
English (en)
Inventor
Anusha SATHYANARAYANAN
Ivan BEDZHOV
Original Assignee
MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. filed Critical MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.
Publication of WO2021259909A1 publication Critical patent/WO2021259909A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies
    • C12N5/0605—Cells from extra-embryonic tissues, e.g. placenta, amnion, yolk sac, Wharton's jelly
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/119—Other fibroblast growth factors, e.g. FGF-4, FGF-8, FGF-10
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/155—Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/70—Enzymes
    • C12N2501/72—Transferases [EC 2.]
    • C12N2501/727—Kinases (EC 2.7.)

Definitions

  • the present invention relates to a method for preparing trophectoderm-like cells comprising culturing a blastocyst, extraembryonic endoderm stem (XEN) cells and/or XEN-like cells in a medium comprising a glycogen synthase kinase 3 (GSK-3) inhibitor.
  • XEN extraembryonic endoderm stem
  • GSK-3 glycogen synthase kinase 3
  • the dividing zygote gives rise to a self-organizing entity of early embryonic and extraembryonic tissues that form the blastocyst.
  • the blastocyst consists of an epithelial layer of trophectoderm (TE) cells and an inner cell mass (ICM) positioned on one side of a fluid-filled cavity.
  • the ICM contains pluripotent epiblast cells, which later give rise to all tissues of the foetus, and a surface layer of primitive endoderm (PE) cells, which will form the yolk sac.
  • the first TE cells are specified during the transition from the 8-cell to the 16-cell stage, their fate is not restricted exclusively to the trophoblast lineage until the 32-cell to the 64-cell stage. These cells can divide asymmetrically and give rise to ICM cells, thus exhibiting developmental flexibility within a limited time frame before implantation 1 ⁇ 2 .
  • the TE defines the hollow-shaped architecture of the blastocyst and is subdivided into two compartments: the mural TE, which surrounds the blastocoel cavity, and the polar TE, in direct contact with the ICM.
  • the mural TE mediates the process of implantation by differentiating into invasive trophoblast cells that penetrate the uterine wall.
  • the polar TE maintains its sternness and forms the extraembryonic ectoderm (ExE) of the nascent egg cylinder.
  • ExE is a pool of multipotent trophoblast stem cells that later gives rise to the placental tissues supporting the foetal development to term 3 .
  • stem cell lines have been established from the embryonic and the extraembryonic lineages of blastocyst and egg cylinder stage embryos. For instance, embryonic stem cells (ESC) and epiblast stem cells (EpiSC) capture features of the pre-implantation (naive) and the post-implantation (primed) epiblast, respectively 4 .
  • stem cell lines have also been derived from the trophoblast lineage of pre-implantation (E3.5) and post-implantation (E6.5) embryos.
  • E3.5 and E6.5 trophoblast stem cells are established using an identical Fgf4/Heparin-supplemented medium 5 .
  • the TSC express post-implantation markers such as Sox2 and Elf5 regardless of the embryonic stage of origin and, overall, resemble the multipotent stem cell pool of the ExE 6 .
  • the conventional TSC capture and represent an ExE-like state but not a pre-implantation TE-like state.
  • the present invention aims at closing the gap of knowledge on the pre-implantation TE-like state by providing trophectoderm-like cells and methods for their production, noting that these cells embody key features of the pre-implantation trophoblast.
  • the present invention relates in a first aspect to a method for preparing trophectoderm-like cells comprising culturing a blastocyst, extraembryonic endoderm stem (XEN) cells and/or XEN-like cells in a medium comprising a glycogen synthase kinase 3 (GSK-3) inhibitor.
  • XEN extraembryonic endoderm stem
  • GSK-3 glycogen synthase kinase 3
  • the “trophectoderm cells” are the first cell type that emerges during development and plays pivotal roles in the viviparous mode of reproduction in placental mammals.
  • TE cells adopt typical epithelium morphology to surround a fluid-filled cavity, whose expansion is critical for hatching and efficient interaction with the uterine endometrium for implantation.
  • TE cells thus, in vivo self-organize into a polarized transporting single cell-layer that forms the outer wall of the blastocyst.
  • the blastocyst is a structure formed in the early development of mammals. It possesses an inner cell mass (ICM) which consists of epiblast cells that later give rise to the foetus, and primitive endoderm (PE) cells, which will form the yolk sac .
  • ICM inner cell mass
  • PE primitive endoderm
  • the outer layer of the blastocyst consists of the TE cells.
  • the layer of TE cells surrounds the inner cell mass and a fluid-filled cavity known as the blastocoel.
  • TE cells also differentiates into trophoblast cells to construct the placenta (Marikawa and Alarcon (2013), Results Probl Cell Differ.; 55: 165-184).
  • trophectoderm-like cells also called herein TE-like cells or XTE-cells
  • TE-like cells refers to cells which functionally and structurally resemble trophectoderm cells but are not identical to trophectoderm cells.
  • trophectoderm-like cells are characterized by the capability to self-organize into a vesicle resembling the outer cell-layer or cell wall of the blastocyst. They are also characterized by a unique gene expression profile that will be discussed herein below.
  • a term “vesicle” as used herein is not a lipid bilayer fluid enclosing a fluid but a layer of the trophectoderm-like cells of the invention.
  • the term “vesicle” as used herein designates an outer cell-layer or cell wall of the trophectoderm-like cells of the invention which encloses a fluid and may also enclose other material, such as cells.
  • the vesicle of the invention may, thus, also be referred to as multicellular vesicle.
  • the vesicles are capable of efficiently cavitating and incorporating pluripotent cells. In this case the vesciles then resemble hol!owed-shaped, blastocyst-like etnbryoids, noting that the pluripotent cells in this case resemble the inner cell mass of the blastocyst.
  • trophectoderm-like cells of the invention can be obtained from a (i) blastocyst, (ii) extraembryonic endoderm stem (XEN) cells and/or (iii) XEN-like cells as starting material.
  • the blastocyst is preferably obtained by a method which does not require the destruction on a human embryo. As discussed, a blastocyst is formed in the early development of mammals and in composed of an inner cell mass (ICM) and an outer layer of TE cells.
  • ICM inner cell mass
  • the inner cell mass comprises two lineages: The epiblast (Epi) and the primitive endoderm (PrE).
  • Representative stem cells derived from these two cell lineages can be expanded and maintained indefinitely in vitro as either embryonic stem (ES) or extraembryonic endoderm stem (XEN) cells.
  • Protocols that can be used to establish XEN cell lines are established in the art (e.g. Niakan et al. (2016), Nature Protocols volume 8, pagesl 028-1041 and Lin eat al. (2016), Scientific Reports, Volume 6, Article number: 39457). Also methods for culturing and expanding XEN cells are known in the art.
  • XEN cells are used in the art for the investigation of signaling pathways of cells of the extraembryonic endoderm lineages, and as an in vitro model to identify patterning activities of the extraembryonic endoderm.
  • XEN-like cells refers to cells that were differentiated from progenitor cells, such as embryonic-stem cells (ESCs), induced pluripotent stem cells (iPSCs), fibroblasts and pluripotent cells into cells which functionally and structurally resemble XEN cells but are not identical to XEN cells. Protocols for establishing XEN-like cells from ESCs are known in the art and will be further detailed herein below. Protocol for obtaining XEN-like cells from iPSCs (and for obtaing the iPSC from fibroblasts) are described, for example, in Parenti et al. (2016), Stem Cell Reports, 6(4):447-455 and Zhao et al.
  • Glycogen synthase kinase 3 (GSK-3) is a serine/threonine protein kinase that mediates the addition of phosphate molecules onto serine and threonine amino acid residues.
  • GSK-3 is a kinase for over 100 different target proteins in a variety of different cellular pathways. In mammals GSK-3 is encoded by two paralogous genes, GSK-3 alpha (GSK-3a) and GSK-3 beta (GSK-3 ). GSK-3 has been implicated in a number of diseases, including but not limited to Type II diabetes, Alzheimer's disease, inflammation, cancer, and bipolar disorder.
  • a medium as used herein is a cell culture medium.
  • Means and method for culturing cells as well as the basic ingredients of a cell culture medium for culturing a blastocyst, extraembryonic endoderm stem (XEN) cells and/or XEN-like cells are known in the art (i.e. a medium for culturing a blastocyst, extraembryonic endoderm stem (XEN) cells and/or XEN- like cells are known in the art with the exception of the XTE cells transformation factors as discussed herein).
  • a “medium” as used herein is a liquid or gel designed to support the growth of the cells or cellular material cultured therein.
  • Cell culture media generally comprise an appropriate source of energy and compounds which regulate the cell cycle.
  • An inhibitor of GSK-3 may be a compound that is capable to interfere with the serine/threonine protein kinase activity of GSK-3.
  • the serine/threonine protein kinase activity of GSK-3 is reduced in the presence of the inhibitor by at least 50%, more preferred at least 75% such as at least 90% or 95%, even more preferred at least 98% and most preferred by about 100% (e.g., as compared to the same experimental set up in the absence of the compound).
  • Various kinds of GSK-3 inhibitors are known from the prior art.
  • GSK-3 inhibitors are:
  • Aminopyrimidines such as CHIR99021 , CT98014, CT98023, CT99021 and TWS119.
  • GSK3 Inhibitors commercial sources:
  • the GSK-3 inhibitor may also be an antibody or antibody mimetic or an aptamer against GSK-3.
  • the antibody mimetic is preferably selected from affibodies, adnectins, anticalins, DARPins, avimers, nanofitins, affilins, Kunitz domain peptides, Fynomers®, trispecific binding molecules and probodies.
  • the term “antibody” as used in accordance with the present invention comprises, for example, polyclonal or monoclonal antibodies. Furthermore, also derivatives or fragments thereof, which still retain the binding specificity to the target, i.e. GSK-3, are comprised in the term "antibody".
  • Antibody fragments or derivatives comprise, inter alia, Fab or Fab’ fragments, Fd, F(ab')2, Fv or scFv fragments, single domain VH or V-like domains, such as VhH or V-NAR-domains, as well as multimeric formats such as minibodies, diabodies, tribodies or triplebodies, tetrabodies or chemically conjugated Fab’-multimers (see, for example, Harlow and Lane “Antibodies, A Laboratory Manual”, Cold Spring Harbor Laboratory Press, 1988; Harlow and Lane “Using Antibodies: A Laboratory Manual” Cold Spring Harbor Laboratory Press, 1999; Altshuler EP, Serebryanaya DV, Katrukha AG. 2010, Biochemistry (Mosc)., vol.
  • the multimeric formats in particular comprise bispecific antibodies that can simultaneously bind to two different types of antigen.
  • Bispecific antibodies formats are Biclonics (bispecific, full length human IgG antibodies), DART (Dualaffinity Re-targeting Antibody) and BiTE (consisting of two single-chain variable fragments (scFvs) of different antibodies) molecules (Kontermann and Brinkmann (2015), Drug Discovery Today, 20(7):838-847).
  • antibody also includes embodiments such as chimeric (human constant domain, non-human variable domain), single chain and humanised (human antibody with the exception of non-human CDRs) antibodies.
  • polyclonal antibodies can be obtained from the blood of an animal following immunisation with an antigen in mixture with additives and adjuvants and monoclonal antibodies can be produced by any technique which provides antibodies produced by continuous cell line cultures. Examples for such techniques are described, e.g.
  • Harlow E and Lane D Cold Spring Harbor Laboratory Press, 1988; Harlow E and Lane D, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999 and include the hybridoma technique originally described by Kdhler and Milstein, 1975, the trioma technique, the human B-cell hybridoma technique (see e.g. Kozbor D, 1983, Immunology Today, vol.4, 7; Li J, et al. 2006, PNAS, vol. 103(10), 3557) and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985, Alan R. Liss, Inc, 77-96).
  • recombinant antibodies may be obtained from monoclonal antibodies or can be prepared de novo using various display methods such as phage, ribosomal, mRNA, or cell display.
  • a suitable system for the expression of the recombinant (humanised) antibodies may be selected from, for example, bacteria, yeast, insects, mammalian cell lines or transgenic animals or plants (see, e.g., US patent 6,080,560; Holliger P, Hudson PJ. 2005, Nat Biotechnol., vol. 23(9), 11265).
  • techniques described for the production of single chain antibodies see, inter alia, US Patent 4,946,778) can be adapted to produce single chain antibodies specific for an epitope of GSK-3.
  • Surface plasmon resonance as employed in the BIAcore system can be used to increase the efficiency of phage antibodies.
  • antibody mimetics refers to compounds which, like antibodies, can specifically bind antigens, such as GSK-3 in the present case, but which are not structurally related to antibodies.
  • Antibody mimetics are usually artificial peptides or proteins with a molar mass of about 3 to 20 kDa.
  • an antibody mimetic may be selected from the group consisting of affibodies, adnectins, anticalins, DARPins, avimers, nanofitins, affilins, Kunitz domain peptides, Fynomers®, trispecific binding molecules and prododies. These polypeptides are well known in the art and are described in further detail herein below.
  • affibody refers to a family of antibody mimetics which is derived from the Z-domain of staphylococcal protein A. Structurally, affibody molecules are based on a three-helix bundle domain which can also be incorporated into fusion proteins. In itself, an affibody has a molecular mass of around 6kDa and is stable at high temperatures and under acidic or alkaline conditions. Target specificity is obtained by randomisation of 13 amino acids located in two alpha-helices involved in the binding activity of the parent protein domain (Feldwisch J, Tolmachev V.; (2012) Methods Mol Biol. 899:103-26).
  • adnectin (also referred to as “monobody”), as used herein, relates to a molecule based on the 10th extracellular domain of human fibronectin III (10Fn3), which adopts an Ig- like b-sandwich fold of 94 residues with 2 to 3 exposed loops, but lacks the central disulphide bridge (Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255).
  • Adnectins with the desired target specificity i.e. against GSK-3, can be genetically engineered by introducing modifications in specific loops of the protein.
  • anticalin refers to an engineered protein derived from a lipocalin (Beste G, Schmidt FS, Stibora T, Skerra A. (1999) Proc Natl Acad Sci U S A. 96(5):1898- 903; Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255).
  • Anticalins possess an eight-stranded b-barrel which forms a highly conserved core unit among the lipocalins and naturally forms binding sites for ligands by means of four structurally variable loops at the open end.
  • Anticalins although not homologous to the IgG superfamily, show features that so far have been considered typical for the binding sites of antibodies: (i) high structural plasticity as a consequence of sequence variation and (ii) elevated conformational flexibility, allowing induced fit to targets with differing shape.
  • DARPin refers to a designed ankyrin repeat domain (166 residues), which provides a rigid interface arising from typically three repeated b-turns. DARPins usually carry three repeats corresponding to an artificial consensus sequence, wherein six positions per repeat are randomised. Consequently, DARPins lack structural flexibility (Gebauer and Skerra, 2009).
  • avimer refers to a class of antibody mimetics which consist of two or more peptide sequences of 30 to 35 amino acids each, which are derived from A- domains of various membrane receptors and which are connected by linker peptides. Binding of target molecules occurs via the A-domain and domains with the desired binding specificity, i.e. for GSK-3, can be selected, for example, by phage display techniques. The binding specificity of the different A-domains contained in an avimer may, but does not have to be identical (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4): 155-68).
  • Nanofitin is an antibody mimetic protein that is derived from the DNA binding protein Sac7d of Sulfolobus acidocaldarius. Nanofitins usually have a molecular weight of around 7kDa and are designed to specifically bind a target molecule, in the present case GSK-3, by randomising the amino acids on the binding surface (Mouratou B, Behar G, Paillard-Laurance L, Colinet S, Pecorari F., (2012) Methods Mol Biol.; 805:315-31).
  • affilin refers to antibody mimetics that are developed by using either gamma-B crystalline or ubiquitin as a scaffold and modifying amino-acids on the surface of these proteins by random mutagenesis. Selection of affilins with the desired target specificity, i.e. against GSK-3, is effected, for example, by phage display or ribosome display techniques. Depending on the scaffold, affilins have a molecular weight of approximately 10 or 20kDa. As used herein, the term affilin also refers to di- or multimerised forms of affilins (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4): 155-68).
  • a “Kunitz domain peptide” is derived from the Kunitz domain of a Kunitz-type protease inhibitor such as bovine pancreatic trypsin inhibitor (BPTI), amyloid precursor protein (APP) or tissue factor pathway inhibitor (TFPI).
  • BPTI bovine pancreatic trypsin inhibitor
  • APP amyloid precursor protein
  • TFPI tissue factor pathway inhibitor
  • Kunitz domains have a molecular weight of approximately 6kDA and domains with the required target specificity, i.e. against GSK-3, can be selected by display techniques such as phage display (Weidle et al., (2013), Cancer Genomics Proteomics; 10(4): 155-68).
  • Fynomer® refers to a non-immunoglobulin-derived binding polypeptide derived from the human Fyn SH3 domain.
  • Fyn SH3-derived polypeptides are well-known in the art and have been described e.g. in Grabulovski et al. (2007) JBC, 282, p. 3196-3204, WO 2008/022759, Bertschinger et al (2007) Protein Eng Des Sel 20(2):57-68, Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255, or Schlatter et al. (2012), MAbs 4:4, 1-12).
  • trispecific binding molecule refers to a polypeptide molecule that possesses three binding domains and is thus capable of binding, preferably specifically binding to three different epitopes. At least one of these three epitopes is an epitope of the protein of the fourth aspect of the invention. The two other epitopes may also be epitopes of the protein of the fourth aspect of the invention or may be epitopes of one or two different antigens.
  • the trispecific binding molecule is preferably a TriTac.
  • a TriTac is a T-cell engager for solid tumors which comprised of three binding domains being designed to have an extended serum half-life and be about one-third the size of a monoclonal antibody.
  • probody refers to a protease-activatable antibody prodrug.
  • a probody consists of an authentic IgG heavy chain and a modified light chain.
  • a masking peptide is fused to the light chain through a peptide linker that is cleavable by tumor-specific proteases. The masking peptide prevents the probody binding to healthy tissues, thereby minimizing toxic side effects.
  • Aptamers are nucleic acid molecules or peptide molecules that bind a specific target molecule. Aptamers are usually created by selecting them from a large random sequence pool, but natural aptamers also exist in riboswitches. Aptamers can be used for both basic research and clinical purposes as macromolecular drugs. Aptamers can be combined with ribozymes to self-cleave in the presence of their target molecule. These compound molecules have additional research, industrial and clinical applications (Osborne et. al. (1997), Current Opinion in Chemical Biology, 1 :5-9; Stull & Szoka (1995), Pharmaceutical Research, 12, 4:465-483).
  • Nucleic acid aptamers are nucleic acid species that normally consist of (usually short) strands of oligonucleotides. Typically, they have been engineered through repeated rounds of in vitro selection or equivalently, SELEX (systematic evolution of ligands by exponential enrichment) to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues and organisms.
  • SELEX systematic evolution of ligands by exponential enrichment
  • Peptide aptamers are usually peptides or proteins that are designed to interfere with other protein interactions inside cells. They consist of a variable peptide loop attached at both ends to a protein scaffold. This double structural constraint greatly increases the binding affinity of the peptide aptamer to levels comparable to an antibody's (nanomolar range).
  • the variable peptide loop typically comprises 10 to 20 amino acids, and the scaffold may be any protein having good solubility properties.
  • the bacterial protein Thioredoxin-A is the most commonly used scaffold protein.
  • Aptamers offer the utility for biotechnological and therapeutic applications as they offer molecular recognition properties that rival those of the commonly used biomolecules, in particular antibodies.
  • aptamers offer advantages over antibodies as they can be engineered completely in a test tube, are readily produced by chemical synthesis, possess desirable storage properties, and elicit little or no immunogenicity in therapeutic applications.
  • Non-modified aptamers are cleared rapidly from the bloodstream, with a half-life of minutes to hours, mainly due to nuclease degradation and clearance from the body by the kidneys, a result of the aptamers' inherently low molecular weight.
  • Unmodified aptamer applications currently focus on treating transient conditions such as blood clotting, or treating organs such as the eye where local delivery is possible. This rapid clearance can be an advantage in applications such as in vivo diagnostic imaging.
  • Several modifications, such as 2'-fluorine-substituted pyrimidines, polyethylene glycol (PEG) linkage, fusion to albumin or other half life extending proteins etc. are available to scientists such that the half-life of aptamers can be increased for several days or even weeks.
  • the above examples of inhibitors solely act on the GSK-3 protein, i.e. the Ser/Thr kinase. It is also possible to inhibit the production of GSK-3 by interfering with the transcription and/or translation of GSK-3.
  • the transcription of the nucleic acid molecule and/or the protein of the invention or the translation of the protein of the invention is reduced by at least 50%, more preferred at least 75% such as at least 90% or 95%, even more preferred at least 98% and most preferred by about 100% (e.g., as compared to the same experimental set up in the absence of the compound).
  • the efficiency of inhibition of an inhibitor can be quantified by methods comparing the level of activity in the presence of the inhibitor to that in the absence of the inhibitor. For example, the change in the amount of the nucleic acid molecule and/or the protein of GSK-3 formed may be used in the measurement.
  • the efficiency of several inhibitors may be determined simultaneously in high-throughput formats.
  • High-throughput assays independently of being biochemical, cellular or other assays, generally may be performed in wells of microtiter plates, wherein each plate may contain 96, 384 or 1536 wells. Handling of the plates, including incubation at temperatures other than ambient temperature, and bringing into contact of test compounds with the assay mixture is preferably effected by one or more computer-controlled robotic systems including pipetting devices.
  • mixtures of, for example 10, 20, 30, 40, 50 or 100 test compounds may be added to each well.
  • said mixture of test compounds may be deconvolved to identify the one or more test compounds in said mixture giving rise to said activity.
  • GSK-3 inhibitors interfering with the transcription and/or translation of GSK-3 are an aptamer (as described above), a siRNA, a shRNA, a miRNA, a ribozyme, an antisense nucleic acid molecule, a CRISPR-Cas-based construct (e.g. a CRISPR-Cas9- based construct or a CRISPR-Cpfl -based construct), a meganuclease, a zinc finger nuclease, and a transcription activator-like (TAL) effector (TALE) nuclease.
  • TAL transcription activator-like effector
  • siRNA small interfering RNA
  • siRNA also known as short interfering RNA or silencing RNA
  • siRNA refers to a class of 18 to 30, preferably 19 to 25, most preferred 21 to 23 or even more preferably 21 nucleotide-long double-stranded RNA molecules that play a variety of roles in biology.
  • siRNA is involved in the RNA interference (RNAi) pathway where the siRNA interferes with the expression of a specific gene.
  • RNAi RNA interference
  • siRNAs also act in RNAi-related pathways, e.g. as an antiviral mechanism or in shaping the chromatin structure of a genome.
  • siRNAs naturally found in nature have a well defined structure: a short double-strand of RNA (dsRNA) with 2-nt 3' overhangs on either end. Each strand has a 5' phosphate group and a 3' hydroxyl (-OH) group.
  • dsRNA short double-strand of RNA
  • -OH 3' hydroxyl
  • This structure is the result of processing by dicer, an enzyme that converts either long dsRNAs or small hairpin RNAs into siRNAs.
  • siRNAs can also be exogenously (artificially) introduced into cells to bring about the specific knockdown of a gene of interest. Essentially any gene for which the sequence is known can thus be targeted based on sequence complementarity with an appropriately tailored siRNA.
  • the double- stranded RNA molecule or a metabolic processing product thereof is capable of mediating target-specific nucleic acid modifications, particularly RNA interference and/or DNA methylation.
  • Exogenously introduced siRNAs may be devoid of overhangs at their 3' and 5' ends, however, it is preferred that at least one RNA strand has a 5'- and/or 3'-overhang
  • one end of the double-strand has a 3'-overhang from 1 to 5 nucleotides, more preferably from 1 to 3 nucleotides and most preferably 2 nucleotides.
  • the other end may be blunt-ended or has up to 6 nucleotides 3'-overhang.
  • any RNA molecule suitable to act as siRNA is envisioned in the present invention.
  • the most efficient silencing was so far obtained with siRNA duplexes composed of 21-nt sense and 21-nt antisense strands, paired in a manner to have a 2-nt 3'- overhang.
  • the sequence of the 2-nt 3' overhang makes a small contribution to the specificity of target recognition restricted to the unpaired nucleotide adjacent to the first base pair (Elbashir et al. 2001).
  • 2'-deoxynucleotides in the 3' overhangs are as efficient as ribonucleotides, but are often cheaper to synthesize and probably more nuclease resistant.
  • siRNA Delivery of siRNA may be accomplished using any of the methods known in the art, for example by combining the siRNA with saline and administering the combination intravenously or intranasally or by formulating siRNA in glucose (such as for example 5% glucose) or cationic lipids and polymers can be used for siRNA delivery in vivo through systemic routes either intravenously (IV) or intraperitoneally (IP) (Fougerolles et al. (2008), Current Opinion in Pharmacology, 8:280-285; Lu et al. (2008), Methods in Molecular Biology, vol. 437: Drug Delivery Systems - Chapter 3: Delivering Small Interfering RNA for Novel Therapeutics).
  • IV intravenously
  • IP intraperitoneally
  • shRNA short hairpin RNA
  • RISC RNA-induced silencing complex
  • si/shRNAs to be used in the present invention are preferably chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer.
  • Suppliers of RNA synthesis reagents are Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL, USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK).
  • siRNAs or shRNAs are obtained from commercial RNA oligo synthesis suppliers, which sell RNA-synthesis products of different quality and costs.
  • the RNAs applicable in the present invention are conventionally synthesized and are readily provided in a quality suitable for RNAi.
  • RNAi RNA effecting RNAi
  • Said RNA species are single-stranded RNA molecules.
  • Endogenously present miRNA molecules regulate gene expression by binding to a complementary mRNA transcript and triggering of the degradation of said mRNA transcript through a process similar to RNA interference. Accordingly, exogenous miRNA may be employed as an inhibitor of GSK-3 after introduction into the respective cells.
  • a ribozyme (from ribonucleic acid enzyme, also called RNA enzyme or catalytic RNA) is an RNA molecule that catalyses a chemical reaction. Many natural ribozymes catalyse either their own cleavage or the cleavage of other RNAs, but they have also been found to catalyse the aminotransferase activity of the ribosome.
  • Non-limiting examples of well-characterised small self-cleaving RNAs are the hammerhead, hairpin, hepatitis delta virus, and in vitro- selected lead-dependent ribozymes, whereas the group I intron is an example for larger ribozymes. The principle of catalytic self-cleavage has become well established.
  • the hammerhead ribozymes are characterised best among the RNA molecules with ribozyme activity. Since it was shown that hammerhead structures can be integrated into heterologous RNA sequences and that ribozyme activity can thereby be transferred to these molecules, it appears that catalytic antisense sequences for almost any target sequence can be created, provided the target sequence contains a potential matching cleavage site.
  • the basic principle of constructing hammerhead ribozymes is as follows: A region of interest of the RNA, which contains the GUC (or CUC) triplet, is selected. Two oligonucleotide strands, each usually with 6 to 8 nucleotides, are taken and the catalytic hammerhead sequence is inserted between them. The best results are usually obtained with short ribozymes and target sequences.
  • a more recent development, also useful in accordance with the present invention, is the combination of an aptamer, recognizing a small compound, with a hammerhead ribozyme.
  • the conformational change induced in the aptamer upon binding the target molecule can regulate the catalytic function of the ribozyme.
  • antisense nucleic acid molecule refers to a nucleic acid which is complementary to a target nucleic acid.
  • An antisense molecule in accordance with the invention is capable of interacting with the target nucleic acid, more specifically it is capable of hybridizing with the target nucleic acid. Due to the formation of the hybrid, transcription of the target gene(s) and/or translation of the target mRNA is reduced or blocked. Standard methods relating to antisense technology have been described (see, e.g., Melani et al., Cancer Res. (1991 ) 51 :2897-2901 ).
  • CRISPR/Cas technologies are applicable in nearly all cells/model organisms and can be used for knock out mutations, chromosomal deletions, editing of DNA sequences and regulation of gene expression.
  • the regulation of the gene expression can be manipulated by the use of a catalytically dead Cas9 enzyme (dCas9) that is conjugated with a transcriptional repressor to repress transcription a specific gene, here the GSK-3 gene.
  • dCas9 enzyme catalytically inactive, "dead” Cpf1 nuclease (CRISPR from Prevotella and Francisella-1 ) can be fused to synthetic transcriptional repressors or activators to downregulate endogenous promoters, e.g. the promoter which controls GSK-3 expression.
  • ZFNs zinc finger nucleases
  • TALENs transcription activator-like effector nucleases
  • Inhibitors provided as inhibiting nucleic acid molecules that target the GSK-3 gene or a regulatory molecule involved in GSK-3 expression are also envisaged herein.
  • Such molecules, which reduce or abolish the expression of GSK-3 or a regulatory molecule include, without being limiting, meganucleases, zinc finger nucleases and transcription activator-like (TAL) effector (TALE) nucleases.
  • TAL transcription activator-like effector
  • a blastocyst, extraembryonic endoderm stem (XEN) cells and/or XEN-like cells these starting cells can be transformed into a novel cell-type which is called herein “trophectoderm-like cells” (also called herein TE-like cells or XTE cells).
  • trophectoderm-like cells also called herein TE-like cells or XTE cells.
  • XEN-state extraembryonic endoderm-state
  • the starting cells can be transformed into trophectoderm-like cells by already one exogenous factor, namely a GSK-3 inhibitor.
  • a GSK-3 inhibitor As will be discussed in greater detail herein below further factors increase the transformation efficiency but it is emphasized that already only a GSK-3 inhibitor is sufficient in order obtain trophectoderm-like cells.
  • the GSK-3 inhibitor is a small molecule, preferably a heterocyclic small molecule, more preferably a small molecule comprising an pyrrole, imidazol, pyridine or pyrimidine ring and is most preferably selected from the group consisting of CHIR 99021, CHIR 99021 trihydrochloride, TWS 119, TCS 2002, BlO-acetoxime, Kenpaullone, lndirubin-3’-oxime, SB 216763, SB 415286, NSC 693868, NSC 693868, TC-G 24, 3F8, BIO, TDZD 8, CHIR 98014, MeBIO, lithium carbonate, TCS 21311 , A 1070722 and Alsterpaullone.
  • the "small molecule” as used herein is preferably an organic molecule.
  • Organic molecules relate or belong to the class of chemical compounds having a carbon basis, the carbon atoms linked together by carbon-carbon bonds.
  • the original definition of the term organic related to the source of chemical compounds with organic compounds being those carbon- containing compounds obtained from plant or animal or microbial sources, whereas inorganic compounds were obtained from mineral sources.
  • Organic compounds can be natural or synthetic.
  • the organic molecule is preferably an aromatic molecule and more preferably a heterocyclic small molecule, in particular a heteroaromatic molecule.
  • aromaticity is used to describe a cyclic (ring-shaped), planar (flat) molecule with a ring of resonance bonds that exhibits more stability than other geometric or connective arrangements with the same set of atoms.
  • Aromatic molecules are very stable, and do not break apart easily to react with other substances.
  • a heteroaromatic molecule at least one of the atoms in the aromatic ring is an atom other than carbon, e.g. N, S, or O.
  • the molecular weight is preferably in the range of 200 Da to 2000 Da, more preferably in the range of 300 Da to 1000 Da.
  • the small molecule is preferably a small molecule comprising a pyrrole, imidazol, pyridine or pyrimidine ring.
  • Pyrrole is a heterocyclic aromatic organic compound, a five-membered ring with the formula C4H4NH.
  • Imidazol is an organic compound with the formula C3N2H4.
  • Pyridine is a basic heterocyclic organic compound with the chemical formula C5H5N.
  • Pyrimidine is an aromatic heterocyclic organic compound similar to pyridine.
  • One of the three diazines (six-membered heterocyclics with two nitrogen atoms in the ring) has the nitrogen atoms at positions 1 and 3 in the ring.
  • a small molecule comprising pyridine or pyrimidine ring is preferred and a small molecule comprising a pyrimidine ring is particularly preferred, noting that CHIR 99021 as used in the examples is a pyrimidine, in more detail an aminopyrimidine.
  • CHIR 99021 is 6-((2-((4-(2,4-Dichlorophenyl)-5-(4-methyl-1H-imidazol-2-yl)pyrimidin-2- yl)amino)ethyl)amino)nicotinonitrile (CAS 252917-06-9).
  • TWS 119 is 3-[[6-(3-Aminophenyl)- 7H-pyrrolo[2,3-d]pyrimidin-4-yl]oxyphenol ditrifluoroacetate.
  • TCS 2002 is 2-Methyl-5-[3-[4- (methylsulfinyl)phenyl]-5-benzofuranyl]-1,3,4-oxadiazole.
  • BlO-acetoxime is (2'Z,3’E)-6- Bromoindirubin-3'-acetoxime.
  • Kenpaullone is 9-Bromo-7,12-dihydro-indolo[3,2- c(][1]benzazepin-6(5H)-one.
  • lndirubin-3'-oxime is 3-[1,3-Dihydro-3-(hydroxyimino)-2/-/-indol-2- ylidene]-1,3-dihydro-2H-indol-2-one.
  • SB 216763 is 3-(2,4-DichlorophenyI)-4-(1 -methyl-1 H- indol-3-yl)-1H-pyrrole-2,5-dione.
  • SB 415286 is 3-[(3-Chloro-4-hydroxyphenyl)amino]-4-(2- nitrophenyl)-1H-pyrrole-2,5-dione.
  • NSC 693868 is 1H-Pyrazolo[3,4-b]quinoxalin-3-amine.
  • TC-G 24 is N-(3-Chloro-4-methylphenyl)-5-(4-nitrophenyl)-1,3,4-oxadiazol-2-amine.
  • 3F8 is 5- Ethyl-7,8-dimethoxy-1H-pyrrolo[3,4-c]isoquinoline-1,3(2H)-dione.
  • BIO is 6-bromoindirubin-3- oxime.
  • TDZD 8 2-Methyl-4-(phenylmethyl)-1,2,4-thiadiazolidine-3,5-dione.
  • CHIR 98014 is N6-[2-[[4-(2,4-Dichlorophenyl)-5-(1H-imidazol-1-yl)-2-pyrimidinyl]amino]ethyl]-3-nitro-2,6- pyridinediamine.
  • MeBIO is (2'Z,3'E)-6-Bromo-1-methylindirubin-3'-oxime.
  • TCS 21311 is 3-[5- [4-(2-Hydroxy-2-methyl-1-oxopropyl)-1-piperazinyl]-2-(trifluoromethyl)phenyl]-4-(1H-indol-3- yl)-1H-pyrrole-2,5-dione.
  • a 1070722 is 1-(7-Methoxyquinolin-4-yl)-3-[6- (trifluoromethyl)pyridin-2-yl]urea.
  • Alsterpaullone is 7,12-Dihydro-9-nitroindolo[3,2- d][1]benzazepin-6(5H)-one.
  • the "small molecule" in accordance with the present invention may be an inorganic compound, such as lithium carbonate.
  • Inorganic compounds are derived from mineral sources and include all compounds without carbon atoms (except carbon dioxide, carbon monoxide and carbonates).
  • the small molecule has a molecular weight of less than about 2000 Da, or less than about 1000 Da such as less than about 500 Da, and even more preferably less than about Da amu.
  • the size of a small molecule can be determined by methods well-known in the art, e.g., mass spectrometry.
  • the medium further comprises a bone morphogenetic protein (Bmp), preferably bone morphogenetic protein 4 (Bmp 4) or a nucleic acid molecule expressing a Bmp, preferably Bmp 4.
  • Bmp bone morphogenetic protein
  • Bmp4 bone morphogenetic protein 4
  • nucleic acid molecule expressing a Bmp, preferably Bmp 4.
  • the medium further comprises a fibroblast growth factor (Fgf), preferably fibroblast growth factor 4 (Fgf 4) or a nucleic acid molecule expressing a Fgf, preferably Fgf 4.
  • Fgf fibroblast growth factor
  • Fgf4 fibroblast growth factor 4
  • nucleic acid molecule expressing a Fgf, preferably Fgf 4.
  • the medium further comprises heparin and/or activin.
  • a blastocyst, extraembryonic endoderm stem (XEN) cells and/or XEN- like cells can be transformed into trophectoderm-like cells by a GSK-3 inhibitor.
  • the efficiency of the transformation can be increased by using a GSK- 3 inhibitor and Bmp 4.
  • This transformation efficiency can be further increased by using a GSK-3 inhibitor, Bmp 4, and Fgf 4 or Heparin.
  • the best results were obtained by using a GSK-3 inhibitor, Bmp 4, Fgf 4/Heparin and Activin.
  • Bone morphogenetic proteins are a group of growth factors also known as cytokines and as metabologens. Originally discovered by their ability to induce the formation of bone and cartilage, BMPs are now considered to constitute a group of pivotal morphogenetic signals, orchestrating tissue architecture throughout the body.
  • Bone morphogenetic protein 4 (Bmp 4) is a protein that in humans is encoded by BMP4 gene. BMP4 is a member of the bone morphogenetic protein family which is part of the transforming growth factor-beta superfamily. The superfamily includes large families of growth and differentiation factors. BMP4 is highly conserved evolutionarily. BMP4 is found in early embryonic development in the ventral marginal zone and in the eye, heart blood and otic vesicle. The sequence of human Bmp4 can be retrieved from the gene bank entry ENSG00000125378.
  • the fibroblast growth factors are a family of cell signalling proteins that are involved in a wide variety of processes, most notably as crucial elements for normal development. Any irregularities in their function lead to a range of developmental defects.
  • Fibroblast growth factor 4 is a protein that in humans is encoded by the FGF4 gene. During embryonic development, the 21 -kD protein FGF4 functions as a signaling molecule that is involved in many important processes. Studies using Fgf4 gene knockout mice showed developmental defects in embryos both in vivo and in vitro, revealing that FGF4 facilitates the survival and growth of the inner cell mass during the postimplantation phase of development by acting as an autocrine or paracrine ligand. The sequence of human Fgf4 can be retrieved from the gene bank entry ENSG00000075388.
  • Heparin also known as unfractionated heparin (UFH)
  • UHF unfractionated heparin
  • Activin is a protein complex enhancing follicle-stimulating hormone (FSH) biosynthesis and secretion, and participates in the regulation of the menstrual cycle. Many other functions have been found to be exerted by activin, including roles in cell proliferation, differentiation, apoptosis, metabolism, homeostasis, immune response, wound repair, and endocrine function.
  • FSH follicle-stimulating hormone
  • the nucleic acid molecule expressing Bmp 4 and/or Fgf 4 is preferably an expression vector.
  • An expression vector otherwise known as an expression construct, is usually a plasmid or virus designed for gene expression in cells. The vector is used to introduce a specific gene into a target cell, and the cell's mechanism is used for protein synthesis to produce the protein encoded by the gene.
  • the term “vector” in accordance with the invention means preferably a plasmid, cosmid, virus, bacteriophage or another vector used e.g. conventionally in genetic engineering which carries the nucleic acid molecule of the invention.
  • the nucleic acid molecule expressing Bmp 4 and/or Fgf 4 can be inserted into several commercially available vectors.
  • Non-limiting examples include prokaryotic plasmid vectors, such as of the pUC-series, pBluescript (Stratagene), the pET-series of expression vectors (Novagen) or pCRTOPO (Invitrogen) and vectors compatible with an expression in mammalian cells like pREP (Invitrogen), pcDNA3 (Invitrogen), pCEP4 (Invitrogen), pMCIneo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2neo, pBPV-1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, plZD35, pLXIN, pSIR (Clontech), pIRES-EGFP (Clontech), pEAK-10 (Edge Biosystems) pTriEx-Hygro (Novagen
  • plasmid vectors suitable for Pichia pastoris comprise e.g. the plasmids pA0815, pPIC9K and pPIC3.5K (all Invitrogen).
  • adenoviruses or adeno-associated viruses can be used.
  • Adenoviruses and adeno-associated viruses are small viruses that infect humans and some other primate species. They belong to the genus Dependoparvovirus, which in turn belongs to the family Parvoviridae.
  • AAV are small (20 nm) replication-defective, non-enveloped viruses.
  • the nucleic acid molecules inserted into the vector can e.g. be synthesized by standard methods, or isolated from natural sources.
  • Transcriptional regulatory elements parts of an expression cassette ensuring expression in prokaryotes or eukaryotic cells are well known to those skilled in the art. These elements comprise regulatory sequences ensuring the initiation of transcription (e. g., translation initiation codon, promoters, such as naturally-associated or heterologous promoters and/or insulators; see above), internal ribosomal entry sites (IRES) (Owens, Proc. Natl. Acad. Sci. USA 98 (2001), 1471-1476) and optionally poly-A signals ensuring termination of transcription and stabilization of the transcript.
  • initiation of transcription e. g., translation initiation codon, promoters, such as naturally-associated or heterologous promoters and/or insulators; see above
  • IRS internal ribosomal entry sites
  • poly-A signals ensuring termination of transcription and stabilization of the transcript.
  • Additional regulatory elements may include transcriptional as well as translational enhancers.
  • the polynucleotide encoding the polypeptide/protein or fusion protein of the invention is operatively linked to such expression control sequences allowing expression in prokaryotes or eukaryotic cells.
  • the vector may further comprise nucleic acid sequences encoding secretion signals as further regulatory elements. Such sequences are well known to the person skilled in the art.
  • leader sequences capable of directing the expressed polypeptide to a cellular compartment may be added to the coding sequence of the polynucleotide of the invention. Such leader sequences are well known in the art.
  • the vector comprises a selectable marker.
  • selectable markers include genes encoding resistance to neomycin, ampicillin, hygromycine, and kanamycin.
  • Specifically-designed vectors allow the shuttling of DNA between different hosts, such as bacteria-fungal cells or bacteria-animal cells (e. g. the Gateway system available at Invitrogen).
  • An expression vector according to this invention is capable of directing the replication, and the expression, of the polynucleotide and encoded peptide or fusion protein of this invention.
  • vectors such as phage vectors or viral vectors (e.g.
  • nucleic acid molecules as described herein above may be designed for direct introduction or for introduction via liposomes into a cell.
  • baculoviral systems or systems based on vaccinia virus or Semliki Forest virus can be used as eukaryotic expression systems for the nucleic acid molecules of the invention.
  • a blastocyst, extraembryonic endoderm stem (XEN) cells or XEN-like cells such that a nucleic acid molecule expressing Bmp 4 and/or Fgf 4 is integrated into the genome such that Bmp 4 and/or Fgf 4 are expressed in the blastocyst, extraembryonic endoderm stem (XEN) cells or XEN-like cells.
  • Means and methods for genetically engineering a target cell such that it expressed a gene of interest are known in the art.
  • Most preferred is the CRISPR-Cas technology as discussed herein above, noting that the CRISPR-Cas technology can also be used for a gen knock-in.
  • Modified Cas nucleases, such as modified Cas9 can also be used for gene activation, by recruiting to transcriptional activators to the promotor region, without any modification (deletion, insertions) of the DNA itself.
  • the blastocyst, XEN cells and/or XEN-like cells is/are cultured in the medium for at least 24h, preferably at least 48h, more preferably at least 72h and most preferably at least 96h.
  • XEN cells and/or XEN-like cells in the presence of GSK-3 inhibitor and optionally one or more of Bmp 4, Fgf 4, Heparin and Activin into XTE cells takes some time the culture time is with increasing preference at least 24h, at least 48h, at least 72h and at least 96h. In particular with XEN-like cells XTE cells can already been obtained after 24h.
  • the preferred culturing time for a blastocyst or XEN cells in the presence of GSK-3 inhibitor and optionally one or more of Bmp 4, Fgf 4, Heparin and Activin is between any of the above minimal times and a maximum of about 15 days, preferably about 9 days.
  • the preferred culturing time for XEN-like cells in the presence of GSK-3 inhibitor and optionally one or more of Bmp 4, Fgf 4, Heparin and Activin is between any of the above minimal times and a maximum of about 10 days, preferably about 5 days.
  • the concentration of the GSK-3 inhibitor in the medium is at least 0.3 mM, preferably at least 1.5 mM, more preferably at least 3 pM, and most preferably about 3 pM; and/or the concentration of Bmp 4 if present in the medium is at least 10 ng/mL, preferably at least 25 ng/mL, more preferably at least 50 ng/mL, and most preferably about 50 ng/mL; and/or the concentration of Fgf 4 if present in the medium is at least 5 ng/mL, preferably at least 10 ng/mL, more preferably at least 25 ng/mL, and most preferably about 25 ng/mL; and/or the concentration of heparin if present in the medium is at least 0.1 pg/mL, preferably at least 0.5 pg/mL, more preferably at least 1 pg/mL, and most preferably about 1 pg/mL; and
  • XTE-medium was used for transforming a blastocyst, XEN cells and/or XEN-like cells into XTE cells.
  • the best XTE- medium comprises GSK-3 inhibitor (CHIR 99021), Bmp 4, Fgf 4/Heparin and Activin as the factors favouring the transformation into XTE cells.
  • the concentrations of the above preferred embodiment are preferably used since they resemble the exemplified XTE medium.
  • the most preferred concentrations are essentially the concentrations as used in the appended examples.
  • the medium may be exchanged during the culture time or the same medium may be used during the entire culture time. It is also possible to carry out the method of the invention by exchanging medium continuously at a certain rate or partially at certain points in time. In addition, a fed or a fed-batch culturing method may be employed, wherein one or more transformation factors are fed into the medium at certain points in time.
  • the method of the first aspect further comprises prior to converting XEN-like cells into XTE cells, converting embryonic stem cells into XEN-like cells.
  • the conversion of embryonic stem cells into XEN-like cells comprises contacting the embryonic stem cells with medium comprising at least one GATA transcription factor, preferably Gata 4 and/or Gata 6; and/or the expression of at least one GATA transcription factor, preferably Gata 4 and/or Gata 6 in the embryonic stem cells.
  • the conversion of embryonic stem cells into XEN-like cells comprises contacting the embryonic stem cells with medium comprising at least one GATA transcription factor and/or SOX 17, preferably Gata 4 and/or Gata 6 and/or SOX 17; and/or the expression of at least one GATA transcription factor and/or SOX 17, preferably Gata 4 and/or Gata 6 and/or SOX17 in the embryonic stem cells.
  • medium comprising at least one GATA transcription factor and/or SOX 17, preferably Gata 4 and/or Gata 6 and/or SOX 17
  • the XEN-like are preferably obtained from ESCs by contacting the embryonic stem cells with a medium comprising at least one GATA transcription factor, preferably Gata 4 and/or Gata 6; and/or the expression of at least one GATA transcription factor, preferably Gata 4 and/or Gata 6 in the embryonic stem cells.
  • a medium comprising at least one GATA transcription factor, preferably Gata 4 and/or Gata 6
  • the expression of at least one GATA transcription factor preferably Gata 4 and/or Gata 6 the same method may be used described herein above in connection with the nucleic acid molecule expressing Bmp 4 and/or Fgf 4.
  • the sequences of human Gata 4 and Gata 6 can be retrieved from the gene bank entries ENSG00000136574 and ENSG00000141448, respectively.
  • the XEN-like are obtained from ESCs by contacting the embryonic stem cells with a medium comprising Gata4, Gata6 and PDFGRa and even more preferably by the expression of Gata4, Gata6 and PDFGRa in ESCs that carry a doxycyclin inducible Gata4 transgene and Histione H2B:venus knock-in cassette in the Gata 6 locus.
  • XEN-like cells are characterized by the underexpression of Nanog and the overexpression of the genes Gata6 and Sox'! 7 (McDonald et al. (2014), Cell Rep. 9(2):780-93).
  • GATA transcription factors are a family of transcription factors characterized by their ability to bind to the DNA sequence "GATA".
  • GATA6 is important in the endodermal differentiation of organ tissues. It is also indicated in proper lung development by controlling the late differentiation stages of alveolar epithelium and aquaporin-5 promoter activation. Furthermore, GATA-6 has been linked to the production of LIF, a cytokine that encourages proliferation of endodermal embryonic stem cells and blocks early epiblast differentiation.
  • Transcription factor GATA4 is a critical transcription factor for proper mammalian cardiac development and essential for survival of the embryo. GATA4 works in combination with other essential cardiac transcription factors as well, such as Nkx2-5 and Tbx5. GATA4 is expressed in both embryo and adult cardiomyocytes where it functions as a transcriptional regulator for many cardiac genes, and also regulates hypertrophic growth of the heart.
  • SOX17 is a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. It acts as a transcriptional regulator after forming a protein complex with other proteins.
  • the sequence of human Sox17 can be retrieved from the gene bank entry ENSG00000164736.
  • the present invention relates in a second aspect to a trophectoderm-like cell that has been obtained or is obtainable by the method of the first aspect.
  • XTE cells functionally and structurally resemble trophectoderm cells but are not identical to naturally occurring trophectoderm cells.
  • XTE cells as obtained or as being obtainable by the method of the first aspect are not only distinct from trophectoderm cells but also from any other known cell-type, including in vivo and in vitro cells.
  • XTE cells constitute a novel type of cells.
  • the trophectoderm-like cell expresses Gata 6, Cdx2, Pdgfra and Cd40.
  • the second aspect of the invention further expresses Gata 4, Sox 17 and Cytokeratin 8.
  • the trophectoderm-like cell does not expresses Sox2, Oct4 and Nanog.
  • XTE cells constitute a novel cell type is at least evident from the particular gene expression profile of these cells which is not shared by any other known cell type.
  • Means and methods for determining the gene expression profile of a cell or whether certain genes are expressed in a cell are known in the art.
  • a DNA microarray comprising the required genes or RNA-seq or a PCR-based method may be used, in particular quantitative PCR.
  • Quantitative PCR is used in the appended example and in particular one or more primers pairs as shown in Table 1 may be used in a quantitative PCR to check for the expression profile of XTE cells.
  • Gata 6 is the gene encoding GATA6.
  • the Cdx- gene is a member of the caudal-related homeobox transcription factor family that is expressed in the nuclei of intestinal epithelial cells.
  • Cdx2 is the gene that directs early embryogenesis and is required to form the placenta.
  • Platelet-derived growth factor receptors alpha (PDGFRa) is a cell surface tyrosine kinase receptor for members of the platelet- derived growth factor (PDGF) family.
  • PDGFRa is regulator of cell proliferation, cellular differentiation, cell growth, and development.
  • Cluster of differentiation 40 (CD40) is a costimulatory protein usually found on antigen-presenting cells and is required for their activation.
  • CD154 CD40L
  • the binding of CD154 (CD40L) on TH cells to CD40 usually activates antigen presenting cells and induces a variety of downstream effects.
  • the sequence of human Pdgfra and CD40 can be retrieved from the gene bank entries ENSG00000134853 and ENSG00000101017, respectively.
  • Cytokeratin-8 (also known as keratin, type II cytoskeletal 8, cytokeratin-8 (CK-8) or keratin-8 (K8)) is a keratin protein that is encoded in humans by the KRT8 gene. It is often paired with keratin 18. In normal tissue, it reacts mainly with secretory epithelia, but not with squamous epithelium, such as that found in the skin, cervix, and esophagus. The sequence of human Cytokeratin-8 can be retrieved from the gene bank entry ENSG00000170421.
  • SOX2 (or SRY (sex determining region Y)-box 2) is a transcription factor that is essential for maintaining self-renewal, or pluripotency, of undifferentiated embryonic stem cells. Sox2 gene expression has a critical role in maintenance of embryonic and neural stem cells.
  • Oct-4 octamer-binding transcription factor 4; also known as POU5F1 (POU domain, class 5, transcription factor 1)
  • POU5F1 POU domain, class 5, transcription factor 1
  • Nanog is a transcriptional factor that helps embryonic stem cells (ESCs) maintain pluripotency by suppressing cell determination factors. Therefore, NANOG deletion will trigger differentiation of ESCs.
  • the sequences of human Sox2, Oct4 and Nanog can be retrieved from the gene bank entries ENSG00000181449, ENSG00000204531 and ENSG00000111704, respectively.
  • the present invention relates in a third aspect to a vesicle or synthetic embryoid assembled from the trophectoderm-like cells of the invention.
  • the present invention relates in a fourth aspect to a method for assembling a vesicle or a synthetic embryoid comprising culturing trophectoderm-like cells of the invention under conditions, wherein the trophectoderm-like cells self-assemble into a vesicle or a synthetic embryoid, wherein the method optionally further comprises preparing trophectoderm-like cells according to the method of the first aspect.
  • the synthetic embryoid comprises stem cells as an inner cell mass and outer XTE cells forming a vesicle.
  • the method of the fourth aspect being for assembling a synthetic embryoid preferably comprises culturing trophectoderm-like cells of the invention and stem cells under conditions, wherein the trophectoderm-like cells and the stem cells self-assemble into an embryoid, wherein the trophectoderm-like cells are the outer cell layer of the embryoid and the stem cells are the inner cell mass of the embryoid.
  • first and second aspect apply mutatis mutandis to the third and fourth aspect as far as being applicable to the second aspect and vice versa.
  • XTE cells are characterized by the capability to self-organize into an embryoid or a vesicle, said embryoid or vesicle resembling the outer cell-layer or cell wall of the blastocyst. Since the XTE cells are self-organizing no further differentiation or transformation factors are required in order to assemble a vesicle.
  • a vesicle comprises XTE cells and in particular the XTE cells from the outer layer or surface of the vesicle.
  • the vesicle of the invention encloses stem cells (such as pluripotent embryonic stem cells (ECSs) or induced pluripotent stem cells (iPSCs)) the vesicle is designated herein an embryoid.
  • An embryoid is generally a three-dimensional aggregation of cells comprising cells derived from the blastocyst stage of embryos or cells that resemble cells derived from the blastocyst stage of embryos.
  • the stem cells in the embryoid of the invention resemble the inner cell mass of the blastocyst.
  • the XTE cells simply need to be cultured (in the case of a embryoid preferably along with the stem cells to be incorporated) for a time being sufficient to obtain a vesicle or an embryoid.
  • This time is preferably at least 24h and more preferably at least 48h.
  • the size of the vesicles or embryoids can be adjusted by adjusting the culturing time. While at the minimum time first small vesicles or embryoids appear, vesicles or embryoids having the size of a mouse blastocyst are obtained after a culturing time of about 3 days to about 5 days.
  • vesicles or embryoids having the size of a human blastocyst will be obtained.
  • one or more test compounds may be added in order to check its/their effect on the formation of the vesicles or embryoids. This ex vivo test may be used to test the influence of test compounds on blastocyst formation.
  • cells other then XTE cells e.g.
  • stem cells such as induced pluripotent stem cells, embryonic stem cells or stem cells of another cell linage
  • embryonic stem cells or stem cells of another cell linage may be added in order arrive at embryoids which enclose these other cells as an “inner cell mass”.
  • Such an ex vivo test may be used to arrive at structure which resembles a blastocyst. It also possible to use a test compounds and cells other then XTE cells at the same time.
  • the blastocyst stage is the embryonic stage where the embryo comes into contact with the mother, which is known as implantation.
  • the implantation is critical for the survival and development of the early embryo.
  • the established connection between the mother and the early embryo continues through the remainder of the pregnancy.
  • Implantation is made possible through structural changes in both the blastocyst and endometrial wall of the mother. Many natural pregnancies fail due to an implantation failure and an implantation failure is in particular a problem during IVF (in vitro fertilization).
  • the XTE cells of the invention and the vesicles and embryoids formed by the XTE cells of the invention are an important novel tool for studying the embryonic blastocyst stage and in particular the implantation. This in turn might result in new treatment options for preventing an implantation failure.
  • the XTE cells of the invention and the vesicles and embryoids formed by the XTE cells of the invention allow the reduction of the use blastocysts for scientific research and, hence, the reduction of the use of test animals, such as mice.
  • each embodiment mentioned in a dependent claim is combined with each embodiment of each claim (independent or dependent) said dependent claim depends from.
  • a dependent claim 2 reciting 3 alternatives D, E and F and a claim 3 depending from claims 1 and 2 and reciting 3 alternatives G, H and I
  • the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C,
  • FIG. 1 Schematic representation of the TE-specific Tat-Cre/loxP recombination of the Rosa26 mT/mG locus (top panel); live imaging of mT/mG embryos after Tat-Cre treatment (middle panel) and live imaging of cells derived from the Tat-Cre treated embryos (bottom panel).
  • FIG. B Schematic representation of TE immunosurgery using mT/mG embryos subjected to Tat- Cre mediated recombination (top panel); live images of embryo before and after removal of TE by immunosurgery (middle panel); mTom+ ICM derived TE-like cells stained for Cdx2 and Gata6 (bottom panel).
  • FIG. 1 Schematic representation of ESC reprogramming to XTE cells via an intermediate XEN- like state.
  • the ESC carry a Dox-inducible Gata4 transgene and a Histone H2B:Venus knock- in cassette in the Gata6 locus (Gata6-H2B:Venus).
  • the XEN-like state was induced after 24- h treatment with Dox.
  • the XEN-like cells were sorted for Venus and PDGFRa and cultured in XTE medium to give rise to PDGFRa+/CD40+ XTE cells.
  • Figure 5 Mechanism of XEN-state reprogramming into XTE cells.
  • XTE cells were grown on cell-repellent plates for a period of four days in XTE medium to form multicellular vesicles.
  • the vesicles were fixed at 24-h intervals and stained for Tromal and DAPI.
  • E FACS analysis for expression of PDGFRa and CD40 in XTE cells derived from ES cells. After conversion of ESC into XEN-like cells, they were cultured in XTE medium either for 4 days (Passage 1 , Day 4), 5 days (passage 1 , Day 5) or passaged on day 4 and maintained for 24 h more (Passage 2, Day 1 ) and then analysed by FACS.
  • Figure 9 Mechanism of XEN-state reprogramming to XTE cells, related to Figure 5.
  • G Genotyping PCR for recombination of the conditional Taz allele. GAPDH was used as loading control and 1 Kb ladder was used for determining the size of the PCR products.
  • FIG. 12 Single cell RNA-seq analysis.
  • A UMAP plot of the single cell transcriptomes of E4.5 blastocysts (orange) and XTE/ESC based embryoids (blue).
  • B UMAP plot displaying cells clustering.
  • C UMAP plots of lineage markers expression.
  • D Violin plot of E-cad, Gata6 and Sox2 expression in the different cell clusters.
  • the TE were defined as Cdx2+/Sox2-/Gata6+ and the ExE as Cdx2+/Sox2+/Gata6- cell populations. Similar to the ExE, both blastocyst-derived (E3.5) and egg cylinder-derived (E6.5) TSC co expressed Cdx2 and Sox2 but were Gata6 negative ( Figures 1C and 1D), confirming that TSC capture features of the post-implantation trophoblast. In order to identify factors enabling derivation of TE-like cells directly from blastocyst stage embryos, an array of ligands and small molecules that stimulate key developmental signalling pathways were tested.
  • N2B27 was used as a basal, chemically defined medium that was supplemented with either single or a combination of soluble factors.
  • 8 wells of a 96- well plate were used containing individual Zona pellucida-free E3.5 blastocysts.
  • the embryos were cultured for 4 days on mitotically inactivated mouse embryonic fibroblasts (MEFs), and after that the outgrowths were dissociated and the cells re-plated into fresh wells. Following an additional 4 days of culture, the emerging colonies were fixed and stained for Cdx2 and Gata6 (Figure 1E).
  • Example 2 Origin and developmental potential of the TE-like cells
  • TE-like cells Although the marker signature of the TE-like cells indicated that they most likely originate from the pre-implantation trophoblast, all cell lineages of the early embryo were exposed to the XTE medium. As the TE-like cells’ derivation procedure did not allow for tracing back the lineage of origin, there were two feasible options: either the TE-like cells derived directly from the TE or they arose via reprogramming of the ICM lineages (PE or epiblast). To tackle this distinction, a lineage-tracing approach was established using double-fluorescent reporter embryos expressing membrane-targeted tandem dimer Tomato (mTom) flanked by LoxP sites, followed by membrane-targeted GFP (mGFP) 8 .
  • mTom membrane-targeted tandem dimer Tomato
  • mGFP membrane-targeted GFP
  • Intact embryos express only the mTom cassette, which can be excised via Cre-mediated recombination resulting in de novo expression of mGFP and loss of mTom fluorescence.
  • As the blastocoel cavity is sealed by tight junctions 9 it was hypothesized that treatment with cell-permeant Cre protein (Tat-Cre) would result in Cre uptake only by the directly exposed TE, whereas the ICM will remain out of reach ( Figure 2A).
  • Tat-Cre cell-permeant Cre protein
  • the Tat- Cre mediated labelling strategy did not allow for direct discrimination between epiblast and PE, as the whole ICM was mTom+. Still, it was hypothesized that the TE-like cells may co express epiblast or PE markers that can point to the specific lineage of the ICM. It was found that in contrast to the epiblast-derived ESC, the TE-like cells were positive for the PE surface marker PDGFRa, and almost half of these cells co-expressed the trophoblast marker CD40 ( Figures 2C and 2D). On both the transcriptional and protein levels, the TE-like cells expressed core PE genes, such as Gata4, Gata6 and Sox'!
  • the two extraembryonic developmental programs may co-exist, allowing for re-integration into both extraembryonic lineages of the pre-implantation embryo.
  • the XTE cells (mTom+) with 8-cell- stage morulae were aggregated and generated chimeric embryos.
  • mTom-expressing cells incorporated in both the TE (mural and polar) and the PE ( Figure 2G).
  • XEN cells were cultured in XTE medium and used the cell surface makers PDGFRa and CD40 as a readout for the establishment of XTE cells.
  • the XEN cells were PDGFRa+/CD40- but within 3 to 4 passages in XTE medium they gradually gained CD40 expression, and approximately 30% to 60% of them became PDGFRa+/CD40+ XTE cells ( Figures 3A-3C and 7A).
  • XEN-derived PDGFRa+/CD40+ XTE cells showed extended integration capacity to populate both the TE and PE of pre-implantation embryos, and, similarly, the embryo-derived XTE cells were maintained only in the mural part of the Reichert’s membrane after implantation ( Figures 3F and 3G).
  • ESC were used that carry a doxycycline (Dox)-inducible Gata4 transgene and a Histone H2B:Venus knock-in cassette in the Gata6 locus (Gata6-H2B:Venus) 10 .
  • Dox doxycycline
  • the ESC were converted into XEN-like cells, marked by the upregulation of the Gata6-H2B:Venus reporter and gain of PDGFRa expression ( Figures 3H-3K).
  • the XEN-like cells downregulated Nanog and upregulated Gata6 and Sox'! 7 expression ( Figures 3K and 7C).
  • XTE cells To further characterize the XTE cells, the PDGFRa+/CD40+ cell populations derived from embryos, XEN or ESC/XEN-like cells were collected and analysed their transcriptome using RNA-seq. Principal component analysis (PCA) showed that all XTE cells clustered together, aside from the parental cell lines, namely XEN, ESC and XEN-like cells, indicating that a common transcriptional state is established regardless of the source of XTE cells ( Figures 4A and 8A).
  • PCA Principal component analysis
  • Example 5 Reprogramming to XTE cells follows the in vivo TE specification programme
  • Cdx2 is the master regulator of the TE programme in the early embryo and is both indispensable and sufficient to drive the TE fate 11 .
  • Cdx2 activation was next aimed to determine the mechanism of Cdx2 activation in XTE cells.
  • a previously reported genome-wide screen for promoter methylation identified Elf5 as a gatekeeper of Cdx2 expression. In wild type ESC, the Elf5 promoter is methylated and Elf5 expression is low.
  • the blastomeres of the late 8-cell stage embryo undergo a process of compaction, dependent on E-cadherin (E-cad)-mediated intercellular adhesion 13 .
  • E-cad E-cadherin
  • the epithelial phenotype of the outer cells suppresses the activity of the Hippo signalling pathway, which results in the transcriptional co-activator Yap translocating to the nucleus; there, together with Tead4, Yap triggers Cdx2 expression and subsequent TE fate specification 14 ( Figure 5D).
  • E-cad expression patterns during ESC differentiation into XEN-like cells and subsequent reprogramming into XTE cells were examined. E-cad was downregulated during the transition from ESC to XEN-like cells, and then it was upregulated during the conversion from XEN-like to XTE cells ( Figure 5I). b-catenin, which is another key element of the adherens junctions complex, also followed a similar expression pattern ( Figures 9B and C). To understand whether E-cad mediated adhesion is required for activating Cdx2 expression, E-cad floxed ESC 15 expressing 4-hydroxy tamoxifen (4-OHT)-inducible Cre-ERT2 and a Dox-inducible Gata6 transgene was used.
  • the E-cad floxed CreERT2 ESC were converted into PDGFRa+ XEN-like cells.
  • the XEN-like cells were cultured in XTE medium in the presence of 40HT to induce E-cad deletion ( Figures 5J and 9D).
  • the E-cad deficient cells (+40HT) failed to efficiently accumulate Yap in the nucleus and upregulate Cdx2 expression ( Figure 5K).
  • Example 6 - XTE cells’ self-organization properties enable the assembly of blastocystlike embryoids
  • the TE has two major functions in the pre-implantation embryo: the formation of the blastocoel cavity, which defines the hollow-shaped architecture of the blastocyst, and the subsequent differentiation into invasive trophoblast cells, which mediate the process of implantation. Next it was aimed to determine whether XTE cells capture these key TE features.
  • the vesicles showed proper orientation of the apical-basal polarity axis, with Par6 and cortical actin localized on the outer membrane and E-cad localized on the basolateral membrane, closely mimicking the general architecture of the TE of blastocyst-stage embryos ( Figures 6H).
  • mural TE Since a major feature of the mural TE is the differentiation into the migratory trophoblast that initiates implantation, it was asked whether the XTE vesicles can also give rise to migratory cells.
  • the differentiation process of the mural TE can be induced in vitro by culturing blastocysts in serum-containing medium ( Figures 61 and 10B).
  • XTE vesicles cultured on tissue culture plates in the presence of serum quickly lost their spherical structure and transformed into migratory cells, resembling the invasive trophoblast ( Figures 6I and 10B).
  • Histone H2B-Cerulean+ ESC were added to the XTE clumps and subsequently internalized and positioned at one side of the emerging cavity, assembling blastocyst-like embryoids ( Figures 6K and 6L).
  • Figures 6K and 6L blastocyst-like embryoids
  • Figure 6M embryoids induced uterine decidualization
  • Figures 6N egg cylinder-like structures
  • Example 7 Incorporation of human pluripotent cells into XTE vesicles and generation of blastocyst-like embryoids.
  • XTE cells expressing membrane tdTomato were co-aggregated with human induced pluripotent stem cells, expressing Venus fluorescent protein and cultured on cell repellent plate. Similar to the ESC of Example 6, the human pluripotent cells were incorporated and position on one side of the XTE vesicle, establishing an artificial ICM and together with the XTE cells, forming a blastocyst-like embryoid ( Figure 11).
  • the 16- to 64-cell stage TE has the capacity to generate both epiblast and PE progenitors, and this potential rapidly decreases after E3.5.
  • the pre-implantation TE expresses the PE determinant Gata6.
  • the early TE cells may occupy a state where more than one developmental programme co-exists, enabling developmental flexibility that allows the early embryo to adapt and compensate for alterations in cell position and overall cell number. It was found that the PE-derived XEN cells show analogous developmental flexibility. These cells can upregulate Cdx2, establishing Gata6+/Cdx2+ XTE cells that combine features of both TE and PE lineages. In addition, previous studies showed that the XEN cells can reprogramme into chemically induced pluripotent stem cells (ciPSC) 17 - 18 , acquiring characteristics akin to the pre-implantation epiblast.
  • ciPSC chemically induced pluripotent stem cells
  • ciPSC and XTE cells do not require forced expression of transgenes but depends on the establishment of the XEN state, which enables reprogramming by small molecules and ligands. Moreover, the XEN-like cells can be directly converted into functional neurons and hepatocyte-like cells, bypassing establishment of pluripotency 19 . This shows that the XEN state has a remarkable potential to respond to external signalling cues and adopt embryonic and extraembryonic fates.
  • XEN and XEN-like cells acquire TE properties following similar principles as the TE specification in vivo.
  • Activation of Cdx2 in XTE cells requires epithelialization and accumulation of Yap in the nucleus ( Figure 60).
  • these cells maintain the PE transcriptional circuit, enabling extended integration capacity of the XTE cells in both extraembryonic lineages of the blastocyst.
  • the XTE cells are maintained only in the mural part of the Reichert’s membrane and do not contribute to the ExE and visceral endoderm.
  • the XTE cells are not bona fide stem cells of either trophoblast or PE linages but instead exhibit mural TE characteristics and terminal developmental capacity. This also sets the margin of the XTE-based embryoids “development” up to a blastocyst-like stage but not beyond.
  • the XTE cells showed robust self-organization potential, enabling highly efficient formation of multicellular vesicles that resemble the overall 3D architecture of the TE.
  • Previous reports utilized conventional TSC or extended pluripotent stem (EPS) cells to form similar vesicles with overall much lower efficiency of cavitation in comparison to the XTE cells 20 ⁇ 22 . This low efficiency indicates that the TSC and EPS cells may contain a subpopulation of vesicle- initiating cells that manifest cavitation properties under specific culture conditions.
  • EPS extended pluripotent stem
  • the culture media used for cavity induction in these pioneering studies contains factors such as Bmp4, CHIR99021 , Fgf4 and heparin, a composition that is strikingly similar to our XTE medium, which induces TE-like properties in PE, XEN and XEN-like cells.
  • EPS cells can give rise to XEN cells 20 , and, in addition, TSC are often co-derived together with XEN cells 23 - 24 .
  • TSC are often co-derived together with XEN cells 23 - 24 .
  • a vesicle-initiating subpopulation with the XEN cell identity may exist or emerge in TSC or EPS cell cultures.
  • the PE of the pre-implantation embryo can acquire TE properties.
  • the XEN state activates the pre-implantation TE programme following the trophoblast specification cascade of the first lineage segregation.
  • the resulting XTE cells combine characteristics of the two extraembryonic lineages, enabling integration into both the TE and PE domains.
  • the outer cells of the early embryo also co-express TE and PE markers and may reside in a similar state that enables extended developmental flexibility.
  • the XTE cells can establish a blastocoel-like cavity and integrate pluripotent cells, forming a self-organizing entity.
  • the XTE cells provide a platform for deciphering the processes of cell fate specification, cell-cell recognition, lineage segregation and cavitation of the mouse embryo, as well as a blueprint for the establishment of in vitro models of pre-implantation embryogenesis in other mammalian species.
  • RNA-seq analysis was performed.
  • E4.5 blastocysts were sequenced and analysed.
  • the cells of the E4.5 embryos distributed into three distinct groups - epiblast (Sox2 and Nanog positive), trophectoderm (TE) (Krt8 and Krt18 positive) and primitive endoderm (PE) (Gata4 and Sox17 positive) ( Figures 12A and 12C).
  • TE trophectoderm
  • PE primitive endoderm
  • Figures 12A and 12C the XTE cells positioned between the TE and PE lineages, whereas the ESC clustered together with the epiblast and non-reprogrammed cells (E-cadherin negative) were positioned separately away from all other clusters ( Figures 12A-D).
  • the XTE cells expressed both TE and PE-specific genes, as well as shared markers, such as Dab2 and Gata6 ( Figure 12C), altogether showing that the XTE cells transcriptionally capture features of both PE and TE lineages of the pre-implantation embryo.
  • Figure 12C shared markers
  • mice used in the study were at age from 6 weeks to 5 months. The animals were maintained under a 14-hour light/10-hour dark cycle with free access to food and water. Male mice were kept individually, whereas the female mice were housed in groups of up to 4 per cage. Embryos for experiments were obtained from wild-type and transgenic strains from matings using females with natural ovulation cycle or after superovulation in case of morula aggregations.
  • the mouse strains used in the study are B6C3F1 , CD1 , mT/mG 8 and Yap fl/fl /Taz fl/fl 16 . Animal experiments and husbandry were performed according to the German Animal Welfare guidelines and approved by the Austinamt fur Natur, boom und Melmann Nordrhein-Nonetheless (State Agency for Nature, Environment and Consumer Protection of North Rhine-Westphalia).
  • XEN cells were maintained in DMEM supplemented with 15% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, 50 U/ml penicillin-streptomycin, 0.1 mM 2-mercaptoethanol.
  • the XEN cells were passaged and maintained in N2B27 medium.
  • TSC were grown on mitotically inactivated MEFs in the presence of 25 ng/ml Fgf4 and 1 pg/ml Heparin.
  • ESC were maintained in DMEM medium supplemented with 15% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 0.1 mM non- essential amino acids, 50 U/ml penicillin-streptomycin, 0.1 mM 2-mercaptoethanol, 0.4 mM PD0325901 , 3 mM CHIR99021 and 4 ng/ml Lif on gelatin coated culture plates. All cell types were grown at 37 °C / 5% C0 2 and passaged using 0.05% Trypsin-EDTA. Yap/Taz double- floxed ESC were derived from Yap/Taz double-floxed mouse strain 16 .
  • E3.5 embryos were plated into individual wells of a 96-well plate with inactivated MEFs and grown in ESC medium. After 4 days of culture, the blastocyst outgrowths were trypsinised, transferred into fresh wells and expanded once ESC colonies emerged. Yap/Taz double floxed ESC were stably transfected with Cre-ERT2 and Dox-inducible Gata6 cloned into a plB12-PB-hCMV1- cHA-IRES-Venus plasmid, with lipofectamine 2000 (Invitrogen) using manufacturer’s protocol.
  • Tet-on Gata6 transgene was stimulated using 1 pg/ml of Dox and Cre/loxP recombination was induced using 500 nM of 40HT.
  • Ecad fl/fl ESC were stably transfected with Cre-ERT2 and transiently transfected with Dox-inducible Gata6 cloned into a plB12-PB-hCMV1-cHA-IRES-Venus plasmid using lipofectamine 2000 (Invitrogen) following manufacturer’s protocol.
  • XTE were derived from E3.5 blastocysts by plating embryos into individual wells of 96-well plate coated with mitotically inactivated MEFs in XTE medium (N2B27 supplemented with 3 mM CHIR99021, 50 ng/ml BMP4, 25 ng/ml Fgf4,1 pg/ml Heparin and 20 ng/ml Activin)
  • the blastocyst outgrowths were dissociated after 4 days using 0.05% Trypsin-EDTA and seeded into fresh wells to allow the emergence of XTE colonies.
  • the XTE cells were then sorted by FACS to select for PDGFRa/CD40 double positive population and maintained in XTE medium on fibronectin-coated wells.
  • ESC that carries Dox inducible Gata4 transgene and Histone H2B:Venus knock-in cassette in the Gata6 locus (Gata6-H2B:Venus) 10 or Dox inducible Gata6 were converted to XEN-like cells by a 24 h pulse of Dox.
  • the XEN- like cells were sorted for expression of Venus and PDGFRa and seeded on fibronectin- coated plates either in N2B27 medium (for experiments using XEN-like cells) or in XTE medium (for conversion to XTE cells).
  • the XEN-like cells were cultured in XTE medium for 5 days allowing conversion to XTE cells that were subsequently sorted by FACS for PDGFRa/CD40 expression.
  • XEN cells were grown in XTE medium on fibronectin- coated plates for 3-4 passages followed by sorting for PDGFRa/CD40 double-positive population of XTE cells.
  • Lineage tracing mT/mG reporter mouse strain 8 was used for lineage tracing experiment.
  • This strain harbours membrane-targeted tandem dimer Tomato (mT) cassette flanked by loxP sites, followed by membrane-targeted GFP (mG), integrated in the Rosa26 locus.
  • Zona-free mT/mG blastocysts were incubated with 1.5 mM of recombinant cell-permeant Cre protein (Tat-Cre, Millipore) in pre-warmed KSOM medium (Millipore) for 2h at 37 °C in 5% CO2 atmosphere in air. After that the embryos were washed and cultured in KSOM overnight at 37°C in 5% CO2. The expression of mTom and mGFP was examined on the next day.
  • ICMs of E3.5 mT/mG embryos subjected to Tat-cre treatment were isolated by immunosurgery 25 and the ICM was then placed on inactivated MEFs in XTE medium for derivation of XTE cells.
  • Embryoids were grown by seeding ES cells (10,000 cells) and XTEs (50,000-80,000) in an AggreWellTM400 plates (StemCell Technologies) in 24-well format for 48 h and then the aggregates were transferred to cell repellent plates for 48 h to facilitate cavitation and formation of embryoids.
  • Transcript expression from RNA-seq was quantified using Salmon 26 (version 0.13.0) with parameters "-seqBias -I A" using a transcriptome index created from Mus musculus genome version GRCm38 (Ensembl release 93). Transcript quantifications were imported into R and associated with genes using the tximport package (version 1.13.12, 27 ). Differential expression analysis was performed using DESeq2 (version 1.25.10, 28 ). Genes were considered significantly differentially-expressed between two conditions if the comparison had an absolute log2 fold change of at least 2, and an adjusted p-value less than 0.05.
  • the variance stabilising transformation was applied to data for the purposes of visualisation using PCA or heatmaps.
  • PCA was performed using the "prcomp” R function on the top 500 most variable genes across all samples.
  • Gene expression clustering genes that were significantly differentially expressed in at least one comparison were considered.
  • Gene expression matrices were transformed to row Z-scores and clustered using k-means clustering using the "kmeans" R function. The appropriate number of clusters was assessed using the elbow method ( Figure 8A).
  • RNA-seq data analysis and visualisation were carried out using R (version 3.6.1 31 ).
  • the ggplot2 (version 3.2.1 32 ) and ComplexHeatmap (version 2.1.0, 33 ) R packages were used for data visualisation and the dplyr (version 0.8.3, 34 ) and purrr (version 0.3.2, 35 ) packages were used for general data analysis.
  • the primer sequences are listed in Table 1.
  • PureLink TM Genomic DNA Mini Kit was used to isolate genomic DNA according to the manufacturer’s protocol. PCR was performed using the primers listed in Table 2.
  • genomic DNA was isolated using PureLink TM Genomic DNA Mini Kit and bisulfite conversion was carried out using 2 pg of isolated genomic DNA with EZ DNA methylation kit (Zymo Research) according to the manufacturer's protocol.
  • the bisulfite-converted DNA was amplified by PCR using the previously described primers 12 .
  • the PCR products were cloned using the TOPO- TA kit (Invitrogen) according to the manufacturer's protocol. Individual clones were then sequenced and sequences were analysed using the Quantification Tool for Methylation Analysis (QUMA, http://quma.cdb.riken.jp).
  • the Zona pellucida of E2.5 embryos was removed via brief exposure to Tyrode’s solution (Sigma). After that ESC or XTE cells were aggregated with the zona-free morulae in individual microwells filled with KSOM medium and covered with mineral oil. The embryos were cultured to blastocyst stage in vitro at 37 °C in a humidified atmosphere of 5% CO2. Immunofluorescence labelling and Microscopy
  • the samples were fixed using 4% PFA for 20 min, washed twice with 1% FCS in PBS (wash buffer) and permeabilised with 0.1 M Glycin/0.3% TritonX-100 (3-5 min for cells and preimplantation embryos and 10 mins for post-implantation embryos). After washing, the samples were incubated with primary antibodies diluted in blocking buffer (2% FCS in PBS) for 24h at 4°C. The specimens were then washed twice and incubated with secondary antibody and DAPI overnight at 4°C. On the following day, the samples were washed again twice and kept in the wash buffer for imaging.
  • the embryos were mounted in drops of 1% FCS in PBS on glass-bottom plates and covered with mineral oil, whereas cells were directly grown on the ibidi m-plates coated with fibronectin and processed further for imaging.
  • the antibodies used in the study are listed in Table 3.
  • Conventional epifluorescence microscopy was performed using Leica AF600, confocal microscopy was performed using Leica SP5 and Zeiss LSM780 systems. Images were processed using Fiji, Icy and IMARIS (Bitplane) software.
  • Cells were lysed using buffer containing 10 mM Tris-HCI pH 7.6, 150 mM NaCI, 2 mM MgCh, 2 mM EDTA, 0.1% Triton-X-100, 10% Glycerol and 1x protease inhibitors cocktail (Complete ultra).
  • the lysis buffer was added directly to the culture dish and the cells were scraped off the surface.
  • the lysate was kept on ice for 20 min and then sonicated for 5 min.
  • the total protein concentration was measured using PierceTM BCA Protein Assay Kit. 25 pg of the total protein per sample was run on SDS-Polyacrylamide gel alongside with Precision Plus Protein Kaleidoscope Standard marker and subsequently transferred onto a PVDF membrane.
  • the membrane was incubated in 5% dry milk in PBST for 30 min at room temperature for blocking and then incubated with primary antibodies at 4 °C, overnight. On the next day, the membrane was washed tree times with PBST and incubated with secondary antibodies conjugated to HRP for 2h at room temperature.
  • the proteins were detected using the ECL Prime kit (GE Healthcare) by exposing the membranes to ECL Hyperfilms (GE Healthcare).
  • Gata6 AGACGGCACCGGTCATTACC T CACCCT CAGCATTT CT ACGCC
  • Gata6 (rabbit) Thermo Fisher Scientific PA1-104 1:300
  • Gata4 (rabbit) Santa Cruz Biotechnology SC-9053 1 :300
  • Alexa 594 (donkey Anti- Thermo Fisher Scientific A-21207 1 :200 Rabbit)
  • Alexa 488 (donkey Anti- Thermo Fisher Scientific A-21208 1 :200 Rabbit)
  • Alexa 647 (donkey Anti-Rat) Thermo Fisher Scientific A-21247 1 :200 Alexa 647 (donkey AntiThermo Fisher Scientific A-31571 1:200 mouse)
  • Alexa 488 (donkey Anti-Goat) Thermo Fisher Scientific A-11055 1 :200 Alexa 647 (donkey Anti-Goat ) Thermo Fisher Scientific A-21447 1:200 Alexa 488 (donkey Anti- Thermo Fisher Scientific A-21206 1 :200 Rabbit)
  • CD40 (rabbit, APC-tagged) Thermo Fisher Scientific 17-0401-82 1 :100 a-tubulin (mouse) Sigma T6199 1:500
  • GOSemSim an R package for measuring semantic similarity among

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Gynecology & Obstetrics (AREA)
  • Biotechnology (AREA)
  • Reproductive Health (AREA)
  • Developmental Biology & Embryology (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pregnancy & Childbirth (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne un procédé de préparation de cellules de type trophectoderme consistant à mettre en culture un blastocyste, des cellules souches d'endoderme extra-embryonnaire (XEN) et/ou cellules de type XEN dans un milieu comprenant un inhibiteur de la glycogène synthase kinase 3 (GSK-3).
PCT/EP2021/066945 2020-06-22 2021-06-22 Génération de cellules de type trophectoderme et assemblage de vésicules de type trophectoderme et d'embryoïdes synthétiques WO2021259909A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP20181414.2 2020-06-22
EP20181414 2020-06-22

Publications (1)

Publication Number Publication Date
WO2021259909A1 true WO2021259909A1 (fr) 2021-12-30

Family

ID=71120105

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2021/066945 WO2021259909A1 (fr) 2020-06-22 2021-06-22 Génération de cellules de type trophectoderme et assemblage de vésicules de type trophectoderme et d'embryoïdes synthétiques

Country Status (1)

Country Link
WO (1) WO2021259909A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024050555A1 (fr) * 2022-09-02 2024-03-07 California Institute Of Technology Formation d'embryons dérivés de cellules souches guidée par une adhérence et une tension différentielles

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US6080560A (en) 1994-07-25 2000-06-27 Monsanto Company Method for producing antibodies in plant cells
WO2008022759A2 (fr) 2006-08-21 2008-02-28 Eidgenoessische Technische Hochschule Zürich Protéines de liaison spécifiques et de haute affinité comprenant des domaines sh3 modifiés de kinase fyn

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US6080560A (en) 1994-07-25 2000-06-27 Monsanto Company Method for producing antibodies in plant cells
WO2008022759A2 (fr) 2006-08-21 2008-02-28 Eidgenoessische Technische Hochschule Zürich Protéines de liaison spécifiques et de haute affinité comprenant des domaines sh3 modifiés de kinase fyn

Non-Patent Citations (79)

* Cited by examiner, † Cited by third party
Title
ADACHI, K. ET AL.: "Context-dependent wiring of Sox2 regulatory networks for self-renewal of embryonic and trophoblast stem cells", MOL CELL, vol. 52, 2013, pages 380 - 392, XP028768446, DOI: 10.1016/j.molcel.2013.09.002
ALTSHULER EPSEREBRYANAYA DVKATRUKHA AG, BIOCHEMISTRY (MOSC, vol. 75, no. 13, 2010, pages 1584
ANGELA C.H. MCDONALD ET AL: "Sox17-Mediated XEN Cell Conversion Identifies Dynamic Networks Controlling Cell-Fate Decisions in Embryo-Derived Stem Cells", CELL REPORTS, vol. 9, no. 2, 1 October 2014 (2014-10-01), US, pages 780 - 793, XP055753448, ISSN: 2211-1247, DOI: 10.1016/j.celrep.2014.09.026 *
BERTSCHINGER ET AL., PROTEIN ENG DES SEL, vol. 20, no. 2, 2007, pages 57 - 68
BESTE GSCHMIDT FSSTIBORA TSKERRA A, PROC NATL ACAD SCI USA., vol. 96, no. 5, 1999, pages 1898 - 903
BOUSSADIA, O.KUTSCH, S.HIERHOLZER, A.DELMAS, V.KEMLER, R.: "E-cadherin is a survival factor for the lactating mouse mammary gland", MECH DEVELOP, vol. 115, 2002, pages 53 - 62
CZECHANSKI ET AL., NATURE PROTOCOLS, vol. 9, no. 3, 2014, pages 559 - 574
D. HARRIS ET AL: "INHIBITION OF MAPKK AND GSK3 SIGNALLING PROMOTES DEVELOPMENT AND EPIBLAST-SPECIFIC EXPRESSION OF PLURIPOTENCY MARKERS IN BOVINE BLASTOCYSTS", REPRODUCTION FERTILITY AND DEVELOPMENT, vol. 25, no. 1, 1 January 2013 (2013-01-01), AU, pages 192, XP055754988, ISSN: 1031-3613, DOI: 10.1071/RDv25n1Ab89 *
FLECHON J -E ET AL: "Isolation and characterization of a feeder-dependent, porcine trophectoderm cell line obtained from a 9-day blastocyst", PLACENTA, vol. 16, no. 7, 1995, pages 643 - 658, XP002801286, ISSN: 0143-4004 *
FOUGEROLLES ET AL., CURRENT OPINION IN PHARMACOLOGY, vol. 8, 2008, pages 280 - 285
GARDNER R L ET AL: "An investigation of inner cell mass and trophoblast tissues following their isolation from the mouse blastocyst", JOURNAL OF EMBRYOLOGY AND EXPERIMENTAL MORPHOLOGY, COMPANY OF BIOLOGIST LTD., CAMBRIDGE, GB, vol. 28, no. 2, 1 October 1971 (1971-10-01), pages 279 - 312, XP009102007, ISSN: 0022-0752 *
GEBAUERSKERRA, CURR OPINION IN CHEMICAL BIOLOGY, vol. 13, 2009, pages 245 - 255
GOVINDASAMY, N.DUETHORN, B.OEZGUELDEZ, H. O.KIM, Y. S.BEDZHOV, I.: "Test-tube embryos - mouse and human development in vitro to blastocyst stage and beyond", INT J DEV BIOL, vol. 63, 2019, pages 203 - 215
GRABULOVSKI ET AL., JBC, vol. 282, 2007, pages 3196 - 3204
GU, Z.EILS, R.SCHLESNER, M.: "Complex heatmaps reveal patterns and correlations in multidimensional genomic data", BIOINFORMATICS, vol. 32, 2016, pages 2847 - 2849
HARLOWLANE: "Antibodies, A Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY PRESS
HARRIS ET AL., REPRODUCTION, FERTILITY AND DEVELOPMENT, vol. 25, no. 1, 2013, pages 192
HIMENO, E.TANAKA, S.KUNATH, T.: "Isolation and manipulation of mouse trophoblast stem cells", CURR PROTOC STEM CELL BIOL, 2008, pages 4
HIROKI UMEHARA ET AL: "Efficient Derivation of Embryonic Stem Cells by Inhibition of Glycogen Synthase Kinase-3", STEM CELLS (MIAMISBURG), vol. 25, no. 11, 1 November 2007 (2007-11-01), pages 2705 - 2711, XP055754975, ISSN: 1066-5099, DOI: 10.1634/stemcells.2007-0086 *
HOLLIGER PHUDSON PJ, NAT BIOTECHNOL., vol. 23, no. 9, 2005, pages 11265
HOU, P. ET AL.: "Pluripotent stem cells induced from mouse somatic cells by small-molecule compounds", SCIENCE, vol. 341, 2013, pages 651 - 654, XP055079363, DOI: 10.1126/science.1239278
ILYA CHUYKIN ET AL: "Characterization of Trophoblast and Extraembryonic Endoderm Cell Lineages Derived from Rat Preimplantation Embryos", PLOS ONE, vol. 5, no. 3, 29 March 2010 (2010-03-29), pages e9794, XP055753444, DOI: 10.1371/journal.pone.0009794 *
J. ROSSANT: "Mouse and human blastocyst-derived stem cells: vive les differences", DEVELOPMENT, vol. 142, no. 1, 16 December 2014 (2014-12-16), GB, pages 9 - 12, XP055753442, ISSN: 0950-1991, DOI: 10.1242/dev.115451 *
KAN, N. G. ET AL.: "Gene replacement reveals a specific role for E-cadherin in the formation of a functional trophectoderm", DEVELOPMENT, vol. 134, 2007, pages 31 - 41
KATHY K NIAKAN ET AL: "Derivation of extraembryonic endoderm stem (XEN) cells from mouse embryos and embryonic stem cells", NATURE PROTOCOLS, vol. 8, no. 6, 2 May 2013 (2013-05-02), GB, pages 1028 - 1041, XP055753450, ISSN: 1754-2189, DOI: 10.1038/nprot.2013.049 *
KLUG, ANNUAL REVIEW OF BIOCHEMISTRY, vol. 79, 2010, pages 213 - 231
KONTERMANNBRINKMANN, DRUG DISCOVERY TODAY, vol. 20, no. 7, 2015, pages 838 - 847
KOZBOR D, IMMUNOLOGY TODAY, vol. 4, 1983, pages 7
L. T. Y. CHO ET AL: "Conversion from mouse embryonic to extra-embryonic endoderm stem cells reveals distinct differentiation capacities of pluripotent stem cell states", DEVELOPMENT, vol. 139, no. 16, 12 July 2012 (2012-07-12), GB, pages 2866 - 2877, XP055519102, ISSN: 0950-1991, DOI: 10.1242/dev.078519 *
LI J ET AL., PNAS, vol. 103, no. 10, 2006, pages 3557
LI, R. ET AL.: "Generation of Blastocyst-like Structures from Mouse Embryonic and Adult Cell Cultures", CELL, vol. 179, 2019, pages 687 - 702
LI, X. ET AL.: "Direct Reprogramming of Fibroblasts via a Chemically Induced XEN-like State", CELL STEM CELL, vol. 21, 2017, pages 264 - 273
LIN, SCIENTIFIC REPORTS, vol. 6, 2016
LINNEBERG-AGERHOLM ET AL., DEVELOPMENT, vol. 146, no. 24, 2019, pages dev180620
LOVE, M. I.HUBER, W.ANDERS, S.: "Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2", GENOME BIOL, vol. 15, 2014, pages 550, XP021210395, DOI: 10.1186/s13059-014-0550-8
LU ET AL.: "Drug Delivery Systems", METHODS IN MOLECULAR BIOLOGY, vol. 437, 2008
MARIKAWAALARCON, RESULTS PROBL CELL DIFFER, vol. 55, 2013, pages 165 - 184
MCDONALD ET AL., CELL REP, vol. 9, no. 2, 2014, pages 780 - 93
MELANI ET AL., CANCER RES, vol. 51, 1991, pages 2897 - 2901
MILLER ET AL., NATURE BIOTECHNOLOGY, vol. 29, no. 2, 2011, pages 143 - 148
MORRIS, S. A. ET AL.: "Origin and formation of the first two distinct cell types of the inner cell mass in the mouse embryo", PROC NATL ACAD SCI U S A, vol. 107, 2010, pages 6364 - 6369
MOURATOU BBEHAR GPAILLARD-LAURANCE LCOLINET SPECORARI F: "Generation of trophoblast stem cells", METHODS MOL BIOL, vol. 925, 2012, pages 315 - 59
MUZUMDAR, M. D.TASIC, B.MIYAMICHI, K.LI, L.LUO, L: "A global double-fluorescent Cre reporter mouse", GENESIS, vol. 45, 2007, pages 593 - 605, XP055011399, DOI: 10.1002/dvg.20335
NG, R. K. ET AL.: "Epigenetic restriction of embryonic cell lineage fate by methylation of Elf5", NAT CELL BIOL, vol. 10, 2008, pages 1280 - 1290
NIAKAN ET AL., NATURE PROTOCOLS, vol. 8, 2018, pages 1028 - 1041
NICHOLS, J.SMITH, A.: "Pluripotency in the embryo and in culture", COLD SPRING HARB PERSPECT BIOL, vol. 4, 2012, pages a008128, XP055525530, DOI: 10.1101/cshperspect.a008128
NICHOLSJONES, COLD SPRING HARB PROTOC, 2017, pages 379 - 386
NISHIOKA, N. ET AL.: "The Hippo signaling pathway components Lats and Yap pattern Tead4 activity to distinguish mouse trophectoderm from inner cell mass", DEV CELL, vol. 16, 2009, pages 398 - 410, XP055600484
OSBORNE, CURRENT OPINION IN CHEMICAL BIOLOGY, vol. 1, 1997, pages 5 - 9
OWENS, PROC. NATL. ACAD. SCI. USA, vol. 98, 2001, pages 1471 - 1476
PARENTI ET AL., STEM CELL REPORTS, vol. 6, no. 4, 2016, pages 447 - 455
PATRO, R.DUGGAL, G.LOVE, M. I.IRIZARRY, R. A.KINGSFORD, C: "Salmon provides fast and bias-aware quantification of transcript expression", NAT METHODS, vol. 14, 2017, pages 417 - 419
RAYON, T. ET AL.: "Distinct mechanisms regulate Cdx2 expression in the blastocyst and in trophoblast stem cells", SCI REP, vol. 6, 2016, pages 27139
REGINENSI, A. ET AL.: "Yap- and Cdc42-dependent nephrogenesis and morphogenesis during mouse kidney development", PLOS GENET, vol. 9, 2013, pages e1003380
RIVRON, N. C. ET AL.: "Blastocyst-like structures generated solely from stem cells", NATURE, vol. 557, 2018, pages 106 - 111, XP036900205, DOI: 10.1038/s41586-018-0051-0
ROSSANT JANET: "Stem cells and lineage development in the mammalian blastocyst", REPRODUCTION FERTILITY AND DEVELOPMENT, C S I R O PUBLISHING, AU, vol. 19, no. 1, 1 January 2007 (2007-01-01), pages 111 - 118, XP009162784, ISSN: 1031-3613, DOI: 10.1071/RD06125 *
SAADELDIN ISLAM M ET AL: "Isolation and characterization of the trophectoderm from the Arabian camel (Camelus dromedarius)", PLACENTA, vol. 57, 1 September 2017 (2017-09-01), pages 113 - 122, XP085162112, ISSN: 0143-4004, DOI: 10.1016/J.PLACENTA.2017.06.015 *
SCHLATTER ET AL., MABS, vol. 4, no. 4, 2012, pages 1 - 12
SCHROTER, C.RUE, P.MACKENZIE, J. P.MARTINEZ ARIAS, A.: "FGF/MAPK signaling sets the switching threshold of a bistable circuit controlling cell fate decisions in embryonic stem cells", DEVELOPMENT, vol. 142, 2015, pages 4205 - 4216
SEYEDEH-NAFISEH HASSANI ET AL: "Simultaneous Suppression of TGF-Î2 and ERK Signaling Contributes to the Highly Efficient and Reproducible Generation of Mouse Embryonic Stem Cells from Previously Considered Refractory and Non-permissive Strains", STEM CELL REVIEWS AND REPORTS, HUMANA PRESS INC, NEW YORK, vol. 8, no. 2, 4 August 2011 (2011-08-04), pages 472 - 481, XP035063404, ISSN: 1558-6804, DOI: 10.1007/S12015-011-9306-Y *
SHIMOSATO DAISUKE ET AL: "Extra-embryonic endoderm cells derived from ES cells induced by GATA Factors acquire the character of XEN cells", BMC DEVELOPMENTAL BIOLOGY, BIOMED CENTRAL LTD., LONDON, GB, vol. 7, no. 1, 3 July 2007 (2007-07-03), pages 80, XP021027767, ISSN: 1471-213X, DOI: 10.1186/1471-213X-7-80 *
SILVA ET AL., CURR GENE THER, vol. 11, no. 1, 2011, pages 11 - 27
SOLTER, D.KNOWLES, B. B.: "Immunosurgery of mouse blastocyst", PROC NATL ACAD SCI U S A, vol. 72, 1975, pages 5099 - 5102, XP000886805, DOI: 10.1073/pnas.72.12.5099
SONESON, C., LOVE, M. I. & ROBINSON, M. D.: "Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences", F1000RES, vol. 4, 2015, pages 1521
SOZEN, B. ET AL.: "Self-Organization of Mouse Stem Cells into an Extended Potential Blastoid", DEV CELL, vol. 51, 2019, pages 698 - 712
STRUMPF, D. ET AL.: "Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst", DEVELOPMENT, vol. 132, 2005, pages 2093 - 2102
STULLSZOKA, PHARMACEUTICAL RESEARCH, vol. 12, no. 4, 1995, pages 465 - 483
T. KUNATH: "Imprinted X-inactivation in extra-embryonic endoderm cell lines from mouse blastocysts", DEVELOPMENT, vol. 132, no. 7, 1 January 2005 (2005-01-01), pages 1649 - 1661, XP055038170, ISSN: 0950-1991, DOI: 10.1242/dev.01715 *
TANAKA S ET AL: "PROMOTION OF TROPHOBLAST STEM CELL PROLIFERATION BY FGF4", SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, vol. 282, no. 5396, 1 January 1998 (1998-01-01), pages 2072 - 2075, XP000910115, ISSN: 0036-8075, DOI: 10.1126/SCIENCE.282.5396.2072 *
TANAKA, S.KUNATH, T.HADJANTONAKIS, A. K.NAGY, A.ROSSANT, J.: "Promotion of trophoblast stem cell proliferation by FGF4", SCIENCE, vol. 282, 1998, pages 2072 - 2075, XP000910115, DOI: 10.1126/science.282.5396.2072
TEAM, R. C., R FOUNDATION FOR STATISTICAL COMPUTING, 2019
VESTWEBER, D.KEMLER, R.: "Identification of a putative cell adhesion domain of uvomorulin", EMBO J, vol. 4, 1985, pages 3393 - 3398
WEIDLE UH ET AL., CANCER GENOMICS PROTEOMICS, vol. 10, no. 4, 2013, pages 155 - 68
XI CHEN ET AL: "Stem cell maintenance by manipulating signaling pathways: past, current and future", BMB REPORTS, vol. 48, no. 12, 31 December 2015 (2015-12-31), KR, pages 668 - 676, XP055630544, ISSN: 1976-6696, DOI: 10.5483/BMBRep.2015.48.12.215 *
YAMANAKA, Y.LANNER, F.ROSSANT, J.: "FGF signal-dependent segregation of primitive endoderm and epiblast in the mouse blastocyst", DEVELOPMENT, vol. 137, 2010, pages 715 - 724, XP055247829, DOI: 10.1242/dev.043471
YING ET AL., NATURE, vol. 453, 2008, pages 519 - 524
YU, G. C. ET AL.: "GOSemSim: an R package for measuring semantic similarity among GO terms and gene products", BIOINFORMATICS, vol. 26, 2010, pages 976 - 978
YU, G. C.WANG, L. G.HAN, Y. Y.HE, Q. Y.: "clusterProfiler: an R Package for Comparing Biological Themes Among Gene Clusters", OMICS, vol. 16, 2012, pages 284 - 287
ZHAO, Y. ET AL.: "A XEN-like State Bridges Somatic Cells to Pluripotency during Chemical Reprogramming", CELL, vol. 163, 2015, pages 1678 - 1691, XP029360505, DOI: 10.1016/j.cell.2015.11.017

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024050555A1 (fr) * 2022-09-02 2024-03-07 California Institute Of Technology Formation d'embryons dérivés de cellules souches guidée par une adhérence et une tension différentielles

Similar Documents

Publication Publication Date Title
Liu et al. Reprogramming roadmap reveals route to human induced trophoblast stem cells
Latos et al. From the stem of the placental tree: trophoblast stem cells and their progeny
CA2994192C (fr) Cellules souches pluripotentes etendues et induites, procedes de fabrication et d'utilisation
US11913018B2 (en) In vitro production of expanded potential stem cells
De Paepe et al. Totipotency and lineage segregation in the human embryo
Xu et al. Generation of pig induced pluripotent stem cells using an extended pluripotent stem cell culture system
Pfeffer et al. Trophoblast development
Wu et al. Initiation of trophectoderm lineage specification in mouse embryos is independent of Cdx2
Riveiro et al. From pluripotency to totipotency: an experimentalist's guide to cellular potency
Yang et al. FKBP4 is regulated by HOXA10 during decidualization and in endometriosis
JP5896360B2 (ja) ヒト多能性幹細胞から中間中胚葉細胞への分化誘導方法
JP6090855B2 (ja) 心筋細胞および／または心筋前駆細胞増殖剤ならびに心筋細胞および／または心筋前駆細胞の増殖方法
Krivega et al. CAR expression in human embryos and hESC illustrates its role in pluripotency and tight junctions
Zhang et al. A novel chemically defined serum‐and feeder‐free medium for undifferentiated growth of porcine pluripotent stem cells
WO2021259909A1 (fr) Génération de cellules de type trophectoderme et assemblage de vésicules de type trophectoderme et d'embryoïdes synthétiques
Langkabel et al. Induction of Rosette-to-Lumen stage embryoids using reprogramming paradigms in ESCs
Jana et al. Efficient self-organization of blastoids solely from mouse ESCs is facilitated by transient reactivation of 2C gene network
US20140213482A1 (en) Simple method for detcting pluripotent stem cells genetically modified by homologous recombination
Quan et al. Cnot8 eliminates naïve regulation networks and is essential for naïve-to-formative pluripotency transition
Rathjen The states of pluripotency: pluripotent lineage development in the embryo and in the dish
Zimmerlin et al. Proteogenomic Reprogramming to a Functional Human Totipotent Stem Cell State via a PARP-DUX4 Regulatory Axis
Salazar-Roa et al. Transient exposure to miR-203 expands the differentiation capacity of pluripotent stem cells
Chirathivat Zc3h13: A Master Regulator of Epitranscriptomic Landscape during Early Development
Kumpfmueller Control of embryonic stem cell fate: the role of phosphoinositide 3-kinase signalling and Zscan4
Ross Defining the minimal and context-dependent signalling cascades regulating the maintenance of human naïve embryonic stem cells and early embryo development

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21732347

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21732347

Country of ref document: EP

Kind code of ref document: A1