WO2021256473A1 - Anti-coronavirus agent - Google Patents

Abstract

The present invention addresses the problem of providing an anti-coronavirus agent, particularly an anti-coronavirus agent against SARS-CoV-2. The problem is solved by an anti-coronavirus agent containing at least one selected from the group consisting of tea extracts, catechin compounds, and theaflavin compounds.

Description

Anti-coronavirus agent

The present invention relates to an anti-coronavirus agent and the like.

Coronavirus is a species of virus belonging to the subfamily Coronaviridae of the Coronaviridae family, and is a plus-strand RNA virus that infects humans and animals and causes respiratory, digestive, vascular, or neurological disorders. Coronavirus can be transmitted from any infected host animal and cause a large-scale infectious disease in humans. Examples of coronaviruses include SARS coronavirus 1 (SARS-CoV-1), which was prevalent in 2002 and 2003, and Middle East respiratory syndrome coronavirus (MERS-CoV). Recently, a worldwide epidemic of SARS coronavirus 2 (SARS-CoV-2) has occurred, and since the treatment technology has not been established, great damage continues in various fields such as medical treatment and economy.

An object of the present invention is to provide an anti-coronavirus agent, particularly an anti-coronavirus agent against SARS-CoV-2.

As a result of diligent research in view of the above problems, the present inventor has described above if it is an anti-corona virus agent containing at least one selected from the group consisting of tea extract, catechin compound, and theaflavin compound. I found that I could solve the problem. The present inventor has completed the present invention as a result of further research based on this finding. That is, the present invention includes the following aspects.

Item 1. An anti-coronavirus agent containing at least one selected from the group consisting of tea extract, catechin compound, and theaflavin compound.

Item 2. Item 2. The coronavirus agent according to Item 1, wherein the coronavirus is SARS-CoV-2.

Item 3. Item 2. The anti-coronavirus agent according to Item 1 or 2, wherein the tea extract is tea or a concentrate thereof.

Item 4. The tea extract is at least one extract selected from the group consisting of matcha tea leaves, roasted tea leaves, roasted tea leaves, new tea leaves, black tea leaves, pouer tea leaves, and oolong tea leaves. , The anti-corona virus agent according to any one of Items 1 to 3.

Item 5. Item 2. The anti-coronavirus agent according to any one of Items 1 to 4, wherein the tea extract is at least one extract selected from the group consisting of matcha tea leaves, roasted tea leaves, and black tea leaves.

Item 6. Item 2. The anti-coronavirus agent according to any one of Items 1 to 5, which contains epigallocatechin gallate as the catechin compound.

Item 7. Item 6. The anti-coronavirus agent according to any one of Items 1 to 6, which is used for application to a living body.

Item 8. Item 2. The anti-coronavirus agent according to Item 7, which is a pharmaceutical, cosmetics, food composition, food additive, disinfectant or detergent.

Item 9. Item 6. The anti-coronavirus agent according to Item 7 or 8, which is a preventive or therapeutic agent for COVID-19.

Item 10. Item 6. The anti-coronavirus agent according to any one of Items 1 to 6, which is used for applying to articles.

Item 11. Item 2. The anti-coronavirus agent according to Item 10, which is a disinfectant or a cleaning agent.

According to the present invention, it is possible to provide an anti-coronavirus agent, particularly an anti-coronavirus agent against SARS-CoV-2.

The results of Test Example 4 are shown. The vertical axis is the CPE suppression rate. The abbreviations on the horizontal axis are as follows. EC: (-)-Epigallocatechin, ECg: (-)-Epigallocatechin gallate, EGC: (-)-Epigallocatechin, EGCg: (-)-Epigallocatechin gallate. The results of Test Example 5 are shown. The vertical axis is the CPE suppression rate. The results of Test Example 6 are shown. The vertical axis is the cell death suppression rate. The abbreviations on the horizontal axis are as follows. EC: (-)-Epigallocatechin, ECG: (-)-Epigallocatechin gallate, EGC: (-)-Epigallocatechin, EGCG: (-)-Epigallocatechin gallate. The method (a) and the result (b and c) of Test Example 7 are shown. The method (A) and the result (B and C) of Test Example 8 are shown. The method (A) and the result (B) of Test Example 9 are shown. The method (A) and the result (B) of Test Example 10 are shown. The method (a) and the result (b) of Test Example 11 are shown. The results of Test Example 12 are shown.

In the present specification, the expressions "contains" and "contains" include the concepts of "contains", "contains", "substantially consists" and "consists only".

The present invention, in one aspect thereof, is an anti-coronavirus agent containing at least one selected from the group consisting of a tea extract, a catechin compound, and a theaflavin compound (referred to as "the agent of the present invention" in the present invention. It may be shown.). This will be described below.

1. 1. Active ingredient The active ingredient is at least one selected from the group consisting of tea extract, catechin compound, and theaflavin compound.

The tea extract is not particularly limited as long as it is obtained by extracting from a tea plant.

Examples of the tea plant preferably include Camellia plants, and particularly preferably Camellia sinensis.

The part of the tea plant used for extraction is not particularly limited, and examples thereof include leaves and branches. Among these, leaves are preferably mentioned.

The tea plant used for extraction may be, for example, an unfermented one in which the enzyme is inactivated by heat treatment (for example, steaming, frying, roasting on fire, sun-drying, etc.) after harvesting, or the enzyme. It may be fermented (semi-fermented) to some extent by an enzyme by weakening the inactivation intensity of the enzyme or delaying the timing thereof, or it may not weaken the inactivation intensity of the enzyme or inactivate the enzyme. It may be completely fermented by an enzyme or the like, or it may be fermented by adding a microorganism such as lactic acid bacteria.

The tea plant used for extraction is preferably tea leaves. Examples of the tea leaves include matcha tea leaves, roasted tea leaves, roasted tea leaves, new tea leaves, black tea leaves, pouer tea leaves, oolong tea leaves and the like. In addition to these, examples of tea leaves include green tea leaves (for example, Tamaro, Bancha, brown rice tea, etc.), white tea leaves, yellow tea leaves, black tea leaves, flower tea leaves, and the like. Examples of the tea leaves include matcha tea leaves, roasted tea leaves, roasted tea leaves, new tea leaves, tea leaves, pouer tea leaves, oolong tea leaves, and the like, and more preferably matcha tea leaves, roasted tea leaves, and roasted tea leaves. Examples thereof include tea leaves of tea, tea leaves of tea, tea leaves of oolong tea, and particularly preferably tea leaves of matcha, tea leaves of roasted tea, and tea leaves of tea.

It is preferable to cut the tea plants used for extraction as necessary. Further, if necessary, pretreatments such as steaming, rough kneading, kneading, medium kneading, fine kneading, drying, and squeezing can be performed.

The tea plant may be one kind alone or a combination of two or more kinds.

The extraction solvent is not particularly limited. Extraction solvents include water; lower monohydric alcohols such as methanol, ethanol, propanol and butanol; liquid polyhydric alcohols such as glycerin, propylene glycol and 1,3-butylene glycol; ketones such as acetone; ethers such as ethyl ether. Kind: Esters such as methyl acetate, ethyl acetate, propyl acetate, butyl acetate; supercritical carbon dioxide and the like. The extraction solvent may be one kind alone or a combination of two or more kinds. Examples of the extraction solvent include a solvent containing water (for example, 50% by mass or more, 70% by mass or more, 80% by mass or more, 90% by mass or more, or 95% by mass or more), and water is particularly preferable. Be done.

The temperature of the solvent at the time of extraction is not particularly limited, but is, for example, 4 to 100 ° C, preferably 50 to 100 ° C, and more preferably 60 to 100 ° C. The temperature can be appropriately set according to the type of tea plant and the like.

The amount of the extraction solvent used is not particularly limited, but is, for example, 1 to 2000 parts by mass, 5 to 1000 parts by mass, or 10 to 500 parts by mass with respect to 1 part by mass of the tea plant. The amount used can be appropriately set according to the type of tea plant and the like.

The extraction time varies depending on the extraction method, solvent, temperature, etc., and is not particularly limited. The extraction time is, for example, 10 seconds to 1 hour, or 30 seconds to 10 minutes. The extraction time can be appropriately set according to the type of tea plant and the like.

After extraction, the extraction residue can be removed as needed. The method for removing is not particularly limited, and for example, a method such as free fall, centrifugation, or filtration can be adopted by one type or a combination of two or more types.

The properties of the tea extract are not particularly limited and may be, for example, liquid, slurry, paste, solid, powder or the like. The tea extract may be the extract itself, a concentrate of the extract (including a dried product), or a mixture thereof.

The tea extract is preferably tea or a concentrate thereof. Tea is a beverage obtained by extracting a tea plant with a solvent suitable for drinking (usually water), and is not particularly limited as long as this is the case.

The tea extract may be one kind alone or a combination of two or more kinds.

The catechin compound is not particularly limited as long as it is a derivative in which flavan-3-ol is substituted with a plurality of hydroxy groups or an aromatic carboxylic acid (for example, gallic acid) ester thereof. Examples of the catechin compound include catechin (C), epicatechin (EC), gallocatechin (GC) or epigallocatechin (EGC), which is a free catechin, or catechin gallate (CG), which is an ester type (gallate type) catechin. Epigallocatechin gallate (ECG), gallocatechin gallate (GCG), epigallocatechin gallate (EGCG) and the like can be mentioned. As the catechin compound, epigallocatechin gallate is particularly preferable from the viewpoint of antiviral action (particularly, antiviral action against SARS-CoV-2). The catechin compound may be used alone or in combination of two or more. The catechin compound may be obtained from a tea extract and used, or may be obtained from a plant or food other than tea and used. In that case, it may be obtained by adding some processes such as concentration and / or fractionation and / or purification. Moreover, you may synthesize and use a catechin compound.

The theaflavin compound is not particularly limited as long as it is theaflavin and its derivatives. Examples of theaflavin compounds include theaflavin, theaflavin-3-gallate (eg, theaflavin-3-O-galat, theaflavin-3'-O-galat), and theaflavin digalat (teaflavin-3-3'-di-O-gallate). ), 3-Isotheaflavin-3-gallate and the like. The theaflavin compound is preferably theaflavin-3-3'-di-O-galat, theaflavin-3'-O-galat, theaflavin from the viewpoint of antiviral action (particularly, antiviral action against SARS-CoV-2). -3-O-gallate and the like, more preferably theaflavin-3-3'-di-O-gallate, theaflavin-3'-O-gallate and the like, and particularly preferably theaflavin-3-3'- Theaflavin is mentioned. The theaflavin compound may be used alone or in combination of two or more. The theaflavin compound may be obtained from a tea extract and used, or may be obtained from a plant or food other than tea and used. In that case, it may be obtained by adding some processes such as concentration and / or fractionation and / or purification. Moreover, the theaflavin compound may be synthesized and used.

Among the active ingredients, tea extract, catechin compound and the like are preferable, and tea extract is particularly preferable.

The active ingredient may be one kind alone or a combination of two or more kinds.

2. Use The target coronavirus of the agent of the present invention is not particularly limited as long as it is a virus belonging to the subfamily Orthocoronavirus. Examples of the coronavirus include alpha coronavirus genus, beta coronavirus genus, gamma coronavirus genus, delta coronavirus genus, and the like, and among these, beta coronavirus genus is preferable. Examples of the beta coronavirus genus include SARS-related coronavirus (SARSr-CoV), coronavirus HKU1, and MERS coronavirus, and among these, SARSr-CoV is preferable. Examples of SARSr-CoV include SARS-CoV-2 and SARS-CoV-1, and among these, SARS-CoV-2 is preferable. The agent of the present invention can be particularly preferably used for SARS-CoV-2.

According to the agent of the present invention, it can exert an antiviral effect against coronavirus. Specific examples of the antiviral action include a virus infection suppressing action, a virus-induced cell death suppressing action, a virus inactivating action, a virus growth suppressing action, a virus sprouting suppressing action, and a virus resistance-inducing action. In addition, due to this action, it can also be used as a prophylactic or therapeutic agent for coronavirus infections (particularly COVID-19).

The agent of the present invention can be widely used in various fields requiring antiviral properties. The agent of the present invention can be used in various fields such as industry, cleaning, medical care, food, and daily necessities. The use of the agent of the present invention is mainly divided into a use applied to a living body and a use applied to an article described later.

2-1. Applications for living organisms Applications for living organisms include, for example, pharmaceuticals, cosmetics, food compositions (including health foods, health enhancers, dietary supplements (supplements, etc.)), food additives, disinfectants, and cleaning agents. And so on. The application target in this case is not particularly limited, and examples thereof include various mammals such as humans, monkeys, mice, rats, dogs, cats, rabbits, pigs, horses, cows, sheep, goats, and deer.

By applying the agent of the present invention to a living body, it is possible to exert an antiviral effect at a site where the active ingredient comes into contact.

The form of the agent of the present invention is not particularly limited, and the form usually used in each application can be taken depending on the use of the agent of the present invention.

As for the form, when the use is pharmaceutical, for example, an injection, a drip, a mouthwash, an inhalant, a patch (a plaster, a tape such as a plaster (reservoir type, matrix type, etc.), a pap, a patch). Agents, microneedles, etc.), ointments, external liquids (liniment agents, lotions, etc.), sprays (external aerosols, pump sprays, etc., creams, gels, eye drops, eye ointments, nasal drops, etc.) Pharmaceutical form suitable for parenteral ingestion of suppositories, semi-solids for rectal, enema, etc .; tablets (intraoral disintegrating tablets, chewable tablets, effervescent tablets, troches, jelly-like drops, sublingual tablets, etc. Suitable for oral ingestion of (including), rounds, granules, fine granules, powders, hard capsules, soft capsules, dry syrups, liquids (including drinks, suspensions and syrups), jelly, etc. Examples thereof include a formulation form (oral formulation form), a tube nutritional supplement, an enteral nutritional supplement, a nasal catheter preparation, an esophageal fistula catheter preparation, and a gastric fistula catheter preparation.

Examples of the form include liquids, gels, creams, ointments, sprays, sticks, etc. when the use is cosmetics.

In terms of form, when the application is a food composition, liquid, gel or solid foods such as juices, soft drinks, tea, soups, soy milk and other beverages, salad oils, dressings, yogurts, jellies, puddings, sprinkles, etc. Examples include child-rearing powdered milk, cake mixes, dairy products (eg, powder, liquid, gel, solid, etc.), bread, confectionery (eg, cookies, etc.). When the application is a food additive, a health enhancer, a dietary supplement (supplement, etc.), it includes, for example, tablets (intraoral disintegrating tablets, chewable tablets, effervescent tablets, troches, jelly-like drops, etc.). ), Rounds, granules, fine granules, powders, hard capsules, soft capsules, dry syrups, liquids (including suspensions and syrups), jelly and the like.

In terms of form, when the application is a disinfectant or cleaning agent, for example, a liquid (solution, emulsion, suspension, spray, etc.), a semi-solid (gel, cream, paste, etc.), a solid (tablet, particulate agent, etc.) It can take any form such as a capsule, a film, a kneaded product, a molten solid, a waxy solid, an elastic solid, etc.). For example, when applied to the oral cavity, more specifically, dentifrice (dentifrice, liquid dentifrice, liquid dentifrice, powdered dentifrice, etc.), mouthwash, coating agent, patch, mouth refreshing agent, food ( For example, chewing gum, candy, candy, gummies, films, troches, etc.). Further, when applied to the nasal cavity, more specifically, a spray-type nasal drop or the like can be mentioned. When applied to the skin, soaps, body soaps, shampoos, conditioners, sprays and the like can be mentioned.

The agent of the present invention may further contain other components, if necessary. The other components are not particularly limited as long as they are components that can be blended in, for example, pharmaceuticals, cosmetics, disinfectants, detergents, etc., but for example, bases, carriers, solvents, dispersants, emulsifiers, buffers, etc. Examples include stabilizers, excipients, binders, disintegrants, lubricants, thickeners, moisturizers, colorants, fragrances, chelating agents and the like.

The buffering agent is not particularly limited, and an appropriate buffering agent that is acceptable can be adopted depending on the intended use. Preferred examples include a phosphate buffer solution and an acetic acid buffer solution.

The content of the active ingredient of the agent of the present invention depends on the type, use, mode of use, application target, state of application target, etc. of the active ingredient, and is not limited, but is, for example, 0.000001 to 100% by weight. It can be preferably 0.01 to 50% by weight.

The amount of the agent of the present invention applied (for example, administration, ingestion, inoculation, etc.) is not particularly limited as long as it is an effective amount that exerts a desired effect, and is usually 0.1 to 0.1 per day as the weight of the active ingredient. 1000 mg / kg body weight. The above dose is preferably administered once a day or divided into 2 to 3 times, and may be appropriately increased or decreased depending on the age, pathological condition, and symptom.

2-2. Applications applied to articles Examples of applications applied to articles include disinfectants, detergents, and the like. The application target in this case is not particularly limited, and examples thereof include industrial products and raw materials thereof used in various fields.

Specific examples of articles include masks, face masks, gloves and the like. Intratracheal intubation tube, bite block, laryngoscope, electrode, measuring device, drip device, oxygen mask, nasal catheter, tube, catheter, white robe, gown, cap, protective clothing, protective shield, surgical instrument and other medical equipment, surgery Examples include tables, beds, stretchers, wheelchairs, etc. In addition, OA equipment, home appliances, air conditioning equipment, vacuum cleaners, desks, chairs, sofas, benches, windows, leather, handles, seats, automatic ticket gates, automatic ticket vending machines, vending machines, doors, fences, handrails, tableware, Cooking utensils, packaging films, packaging bags, bottles, bottles, packaging packs, sinks, toilet bowls, stationery, books, shelves, toothbrushes, mirrors, air conditioning filters, masks, coats, jackets, trousers, skirts, shirts, knit shirts, blouses, Sweaters, cardigans, nightwear, underwear, underwear, diapers, supporters, socks, tights, stockings, hats, scarves, mufflers, scarves, stalls, gloves, clothes linings, clothes cores, clothes batting, work clothes, Examples include clothing such as uniforms and school children's uniforms, curtains, ami doors, duvets, duvet cotton, duvet covers, pillowcases, sheets, mats, carpets, towels, handkerchiefs, wall cloths, band aids, bandages and the like.

By applying the agent of the present invention to an article, it is possible to exert an antiviral effect at a site where the active ingredient comes into contact. The site where the active ingredient comes into contact is not limited to the site on the article, but also includes the site in the living body when the article is applied to a living body or the like.

The dosage form of the agent of the present invention is not particularly limited and can be appropriately selected according to its intended use. Examples of the dosage form include liquids such as liquids, emulsions, suspensions, dispersants, sprays and aerosols; solid or semi-solids such as wettable powders, powders, granules, fine granules and flowables. Be done. It can be applied or coated on various articles.

The agent of the present invention may further contain other components, if necessary. The other components are not particularly limited as long as they are components that can be blended in, for example, detergents and disinfectants for articles, but for example, bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, etc. , Excipients, binders, disintegrants, lubricants, thickeners, moisturizers, colorants, fragrances, chelating agents and the like.

The buffering agent is not particularly limited, and an appropriate buffering agent that is acceptable can be adopted depending on the intended use. Preferred examples include a phosphate buffer solution and an acetic acid buffer solution.

The content of the active ingredient of the agent of the present invention depends on the type, use, mode of use, application target, state of application target, etc. of the active ingredient, and is not limited, but is, for example, 0.000001 to 100% by weight. It can be preferably 0.001 to 50% by weight.

Hereinafter, the present invention will be described in detail based on examples, but the present invention is not limited to these examples.

The tea in the following reference example was prepared according to the method described on the product packaging.

Reference example 1. Preparation of Matcha Matcha tea leaf powder (Matcha in front, manufactured by Ochanomaru Kosha) was mixed with 1.5 g of hot water at 70 ° C and stirred several times. The tea leaves were removed by filtration through 100 mesh and allowed to stand until the temperature reached room temperature. The supernatant was filtered through a filter having a pore size of 0.22 μm to obtain matcha. It was stored at 4 ° C. until it was used in Test Examples 1 and 2 described later.

Reference example 2. Preparation of green tea 5 g of sencha tea leaves (Uji tea for sencha farmers' private use, manufactured by Tsubo City Chachapo Co., Ltd.) and 100 mL of hot water at 70 ° C were mixed and allowed to stand for 60 seconds. The tea leaves were removed by filtration through 100 mesh and allowed to stand until the temperature reached room temperature. The supernatant was filtered through a filter having a pore size of 0.22 μm to obtain green tea. It was stored at 4 ° C. until it was used in Test Examples 1 and 2 described later.

Reference example 3. Preparation of roasted green tea 5 g of roasted green tea leaves (organic roasted green tea, manufactured by Ocha no Maruyuki Co., Ltd.) and 100 mL of boiling water were mixed and allowed to stand for 60 seconds. The tea leaves were removed by filtration through 100 mesh and allowed to stand until the temperature reached room temperature. The supernatant was filtered through a filter having a pore size of 0.22 μm to obtain roasted green tea. It was stored at 4 ° C until it was used in Test Example 2 described later.

Reference example 4. Preparation of new tea 5 g of tea leaves (made by a tea farmer, picked in April 2nd year of Reiwa, manufactured by Tsubo City Tea Chapo Co., Ltd.) and 100 mL of hot water at 70 ° C were mixed and allowed to stand for 60 seconds. The tea leaves were removed by filtration through 100 mesh and allowed to stand until the temperature reached room temperature. The supernatant was filtered through a filter having a pore size of 0.22 μm to obtain new tea. It was stored at 4 ° C. until it was used in Test Examples 1 and 2 described later.

Reference example 5. Preparation of black tea 2.5 g of black tea leaves (fragrant black tea Darjeeling blend, manufactured by Mitsui Norin Co., Ltd.) and 150 mL of boiling water were mixed and allowed to stand for 3 minutes. The tea leaves were removed by filtration through 100 mesh and allowed to stand until the temperature reached room temperature. The supernatant was filtered through a filter having a pore size of 0.22 μm to obtain black tea. It was stored at 4 ° C. until it was used in Test Examples 1 and 2 described later.

Reference example 6. Preparation of Pu'er tea 3 g of Pu'er tea leaves (black reduced fertilizer tea Pu'er, manufactured by Tsubo City Tea Tea Shop) and 1 L of boiling water were mixed and allowed to stand for 5 minutes. The tea leaves were removed by filtration through 100 mesh and allowed to stand until the temperature reached room temperature. The supernatant was filtered through a filter having a pore size of 0.22 μm to obtain Pu'er tea. It was stored at 4 ° C. until it was used in Test Examples 1 and 2 described later.

Reference example 7. Preparation of oolong tea 4 g of oolong tea leaves (oolong tea tea bar, manufactured by Tsubo City Chachapo Co., Ltd.) and 1 L of boiling water were mixed and allowed to stand for 15 minutes. The tea leaves were removed by filtration through 100 mesh and allowed to stand until the temperature reached room temperature. The supernatant was filtered through a filter having a pore size of 0.22 μm to obtain oolong tea. It was stored at 4 ° C. until it was used in Test Examples 1 and 2 described later.

Reference example 8. Preparation of pot water After boiling purified water for drinking, it was cooled to room temperature. It was stored at 4 ° C. until it was used in Test Examples 1 and 2 described later.

Test example 1. Evaluation test of antiviral effect 1
The antiviral activity of each sample of Reference Examples 1 to 2 and 4 to 8 (storage period at 4 ° C.: 11 days) was evaluated as follows.

Day -1
Vero E6 / TMPRSS2 cells were seeded on a 96-well plate ^{at 5.0 x 10 4 cells / 100 μL.} The medium is DMEM medium supplemented with 5% fetal bovine serum. Incubated for 24 hours at 37 ° C., 5% CO ₂ / 95% air.

Day 0
20 μL of SARS-CoV-2 (5 X 10 ⁵ TCID _50/50 μL) was added to 500 μL of each sample (Reference Examples 1 to 8) and incubated. Immediately after 1 minute of addition, a 10-fold dilution series was prepared using 0.5% FBS DMEM as the diluent. The culture supernatant was discarded from the 96-well plate in which the cells were seeded the day before (Day -1) and the culture was started, and 50 μL of each diluted solution was added (quadruplicate). After adsorbing for 50 minutes (tilting every 10 minutes), 50 μL of 0.5% FBS DMEM was added. The cells were cultured at 37 ° C. and 5% CO ₂ / 95% air for 72 hours.

Day 3
100 μL of glutaraldehyde solution (25% W / V) was added to the cells (96-well plate), and the cells were allowed to stand at room temperature for 30 minutes. The culture solution and glutaraldehyde mixture were discarded, and the wells were washed with tap water. It was allowed to stand at room temperature and dried. 100 μL of 1% crystal violet stain was added to the fixed cells (96-well plate), and the cells were allowed to stand at room temperature for 30 minutes. The stain was discarded and the wells were washed with tap water. After allowing to stand at room temperature and drying, the plate was photographed to observe the presence or absence of staining and the CPE (cytopathic effect). TCID _50/50 μL was calculated by the Reed-Muench method, and the virus reduction rate was calculated based on the obtained values.

The results are shown in Table 1.

Test example 2. Evaluation test of antiviral effect 2
The antiviral effects of Sample O (Reference Examples 1 to 2 and 4 to 8, storage period at 4 ° C: 20 days) and Sample N (Reference Examples 2 to 8, storage period at 4 ° C: 2 hours) were the same as in Test Example 1. Evaluated by method.

The results are shown in Tables 2 and 3.

Reference example 9. Preparation of epicatechin gallate (-)-Epicatechin gallate standard product (Wako, 051-0889) 20 mg was dissolved in 900 μL of ethanol and filtered through a filter with a pore size of 0.22 μm to obtain 50 mM epicatechin gallate. It was stored at -20 ° C until it was used in Test Examples 3 and 4, which will be described later.

Test example 3. Antiviral evaluation test Day -1
Vero E6 / TMPRSS2 cells were seeded on a 96-well plate ^{at 5.0 x 10 4 cells / 100 μL.} The medium is DMEM medium supplemented with 5% fetal bovine serum. Incubated for 24 hours at 37 ° C., 5% CO ₂ / 95% air.

Day 0
Samples (Reference Example 9) was diluted with 0.5% fetal bovine serum-supplemented DMEM medium, its 2μL the SARS-CoV-2 (10 TCID 50 / 100μL) was added to 200 [mu] L, were incubated for 5 min. The final concentration of the sample is 0 μM or 100 μM. The culture supernatant was discarded from the 96-well plate in which the cells were seeded the day before (Day -1) and the culture was started, and 100 μL of each virus solution was added (triplicate). The cells were cultured at 37 ° C. and 5% CO ₂ / 95% air for 72 hours.

Day 3
100 μL of glutaraldehyde solution (25% W / V) was added to the cells (96-well plate), and the cells were allowed to stand at room temperature for 30 minutes. The culture solution and glutaraldehyde mixture were discarded, and the wells were washed with tap water. It was allowed to stand at room temperature and dried. 100 μL of 1% crystal violet stain was added to the fixed cells (96-well plate), and the cells were allowed to stand at room temperature for 30 minutes. The stain was discarded and the wells were washed with tap water. After allowing to stand at room temperature and drying, the plate was photographed to observe the presence or absence of staining and CPE. The results are shown in Table 4.

It was evaluated as + if CPE was recognized for each well in each group and each well performed in triplicate, and-if not.

Reference example 10. (-)-Preparation of epicatechin (-)-Epicatechin standard (Wako, 054-08881) 20 mg was dissolved in 1380 μL of methanol and filtered through a filter with a pore size of 0.22 μm to obtain 50 mM epicatechin. It was stored at -20 ° C until it was used in Test Example 4 described later.

Reference example 11. (-)-Preparation of epigallocatechin gallate (-)-Epigallocatechin gallate standard product (Wako, 056-08961) 50 mg was dissolved in 2180 μL of ethanol, filtered through a filter with a pore size of 0.22 μm, and 50 mM epigallocatechin. I got gallate. It was stored at -20 ° C until it was used in Test Example 4 described later.

Reference example 12. (-)-Preparation of epigallocatechin (-)-Epigallocatechin standard (Wako, 059-08951) 20 mg Wako (50 mM: + EtOH μL) was dissolved in 1310 μL of ethanol and filtered through a filter with a pore size of 0.22 μm. , 50 mM epigallocatechin was obtained. It was stored at -20 ° C until it was used in Test Example 4 described later.

Test example 4. Antiviral evaluation test Day -1
Vero E6 / TMPRSS2 cells were seeded on a 96-well plate ^{at 5.0 x 10 4 cells / 100 μL.} The medium is DMEM medium supplemented with 5% fetal bovine serum. Incubated for 24 hours at 37 ° C., 5% CO ₂ / 95% air.

Day 0
Samples (Reference Example 9-12) was diluted with 0.5% fetal bovine serum-supplemented DMEM medium, its 2μL the SARS-CoV-2 (10 TCID 50 / 100μL) was added to 200 [mu] L, were incubated for 5 min. The final concentration of the sample is 0 μM, 25 μM, 50 μM or 100 μM. The culture supernatant was discarded from the 96-well plate in which the cells were seeded the day before (Day -1) and the culture was started, and 100 μL of each virus solution was added (triplicate). The cells were cultured at 37 ° C. and 5% CO ₂ / 95% air for 72 hours.

Day 3
100 μL of glutaraldehyde solution (25% W / V) was added to the cells (96-well plate), and the cells were allowed to stand at room temperature for 30 minutes. The culture solution and glutaraldehyde mixture were discarded, and the wells were washed with tap water. It was allowed to stand at room temperature and dried. 100 μL of 1% crystal violet stain was added to the fixed cells (96-well plate), and the cells were allowed to stand at room temperature for 30 minutes. The stain was discarded and the wells were washed with tap water. After allowing to stand at room temperature and drying, the plate was photographed to observe the presence or absence of staining and CPE.

A virus infection score was given for each of the three Triplewell wells as shown in Table 5. After that, the average value of the three wells was calculated.

The CPE suppression rate was calculated as follows.

The results are shown in Fig. 1. Both tea catechins were found to suppress SARS-CoV-2 infection.

Test Example 5
Day -1
Vero E6 / TMPRSS2 cells were seeded on a 96-well plate ^{at 5.0 x 10 4 cells / 100 μL.} Incubated for 24 hours at 37 ° C., 5% CO ₂ / 95% air.

Day 0
Theaflavin-3-O-gallate, Theaflavin-3'-O-gallate, Theaflavin-3-3'-di-O-gallate (purchased from Nagara Science) are diluted with 10% FBS-containing medium (Theaflavin-3-O). -gallate is 10mM, 5mM; Theaflavin-3'-O-gallate is 10mM, 5mM, 2.5mM; Theaflavin-3-3'-di-O-gallate is 10mM, 5mM, 2.5mM, 1.25mM), 2 μL _{SARS-CoV-2 (30TCID 50} / 100μL) was added to 200 [mu] L, were incubated for 5 min. The final concentration of each drug is 100 μM, 50 μM for Theaflavin-3-O-gallate; 100 μM, 50 μM, 25 μM for Theaflavin-3'-O-gallate; 100 μM, 50 μM for Theaflavin-3-3'-di-O-gallate. , 25 μM, 12.5 μM. The culture supernatant was discarded from the 96-well plate in which the cells were seeded and cultured on the previous day (Day -1), 100 μL of each virus solution was added (Quadruplicate), and the temperature was 37 ° C., 5% CO ₂ / 95% under air. Incubated for 72 hours.

Day 3
100 μL of glutaraldehyde solution (25% W / V) was added to the cells (96-well plate), and the cells were allowed to stand at room temperature for 30 minutes. The culture solution and glutaraldehyde mixture were discarded, and the wells were washed with tap water. It was allowed to stand at room temperature and dried. 100 μL of 1% crystal violet stain was added to the fixed cells (96-well plate), and the cells were allowed to stand at room temperature for 30 minutes. The stain was discarded and the wells were washed with tap water. After allowing to stand at room temperature and drying, the plate was photographed to observe the presence or absence of staining and CPE.

A virus infection score was given for each of the four Quadruplicate wells as shown in Table 6. After that, the average value of the four wells was calculated.

The CPE suppression rate was calculated as follows.

The results are shown in Fig. 2. Theaflavin-3-O-gallate, Theaflavin-3'-O-gallate, and Theaflavin-3-3'-di-O-gallate were all found to suppress SARS-CoV-2 infection.

Test Example 6
Method Day -1
Vero E6 / TMPRSS2 cells were seeded on a 96-well plate ^{at 5.0 x 10 4 cells / 100 μL.} Incubated for 24 hours at 37 ° C., 5% CO ₂ / 95% air.

Day 0
Day (Day -1) to Discard the culture supernatant from the 96 well plates was started by seeding cells cultured and SARS-CoV-2 a (30 TCID ₅₀ / 100μL) was 100 [mu] L added. Incubated at 37 ° C., 5% CO ₂ / 95% air for 1 hour. After 1 hour, discard the virus solution and add 100 μL of EC, ECG, EGC, EGCG (final concentrations 200 μM, 100 μM, 50 μM, 25 μM) diluted in 0.5% FBS-containing medium (Quadruplicate), 37 ° C, 5%. Incubated for _{72 hours under CO 2} / 95% air.

Day 3
100 μL of glutaraldehyde solution (25% W / V) was added to the cells (96-well plate), and the cells were allowed to stand at room temperature for 30 minutes. The culture solution and glutaraldehyde mixture were discarded, and the wells were washed with tap water. It was allowed to stand at room temperature and dried. 100 μL of 1% crystal violet stain was added to the fixed cells (96-well plate), and the cells were allowed to stand at room temperature for 30 minutes. The stain was discarded and the wells were washed with tap water. After allowing to stand at room temperature and drying, the plate was photographed to observe the presence or absence of staining and CPE. The OD of each well was measured and the% Inhibition of cell death was calculated as follows.

The results are shown in Fig. 3. EC, ECG, EGC, and EGCG were all found to suppress SARS-CoV-2 infection.

Test Example 7
Add an equal amount of serum-free (SF) 2X DMEM to the sample (EGCG or TFDG (theaflavin-3,3'-di-O-gallate)) solution to adjust the osmotic pressure, and then use SF DMEM (MS) in two steps. Diluted and used immediately. 10 μl of SARS-CoV-2 (1.5 X 10 ^ 6/50 μl) was added to 100 μl of Sample solution of each concentration or SF DMEM (MS) (control), and the mixture was allowed to stand at room temperature for 1 minute. The supernatant was removed from a 96-well plate in which Vero E6 / TMPRSS2 cells were sown at 5 X 10 ^ 4/100 μl / well and cultured for 15 hours the day before, and 50 μl of the above virus / sample solution was added (MOI 3). After 1h adsorption, the virus solution was removed and MS was added at 100 μl / well. Incubated for 30 hours. The viability of the cells was quantified by the following method. Medium was removed from the Plate and washed with PBS. 20% of Cell Count Reagent SF (Nacalai) was mixed with phenol red-free medium, 50 μl / well was added to the cells, and the cells were cultured for 50 minutes. As a blank, a well in which only the reagent mixture was added to the well in which the cells were not cultured was also prepared. After completion of the reaction, 20 μl / well of 10% SDS was added to inactivate the virus remaining in the well. The absorbance at a wavelength of 450 nm was measured with a plate reader. The measurement was performed with tetraplicate.

A schematic diagram of the method is shown in FIGS. 4a, and the results (mean value ± standard deviation of A450 values in each group) are shown in FIGS. 4b and c. It can be seen that both EGCG and TFDG acted on the virus in a concentration-dependent manner, reducing the ability to infect and kill cells. EGCG of 500 to 1000 μM or more and TFDG of 60 μM or more completely suppressed cell death due to virus infection. N = 3. * p <0.05, ** p <0.01, *** p <0.001 (between groups) (Student's t test).

Test Example 8
Saliva from 5 healthy subjects was purchased from Lee Biosolutions (Maryland Heights, MO, USA) and sterilized by UV irradiation for 30 minutes. Was added SARS-CoV-2 only _{^{3.0 × 10 5 TCID 50/5}} μL to 45 [mu] L of saliva or distilled water. Green tea or black tea was added to this in a volume of 1: 1 and incubated for 10 seconds. Immediately afterwards, serum-free DMEM medium was used for 1000-fold dilution, followed by MS for 10-fold serial dilution. After cooling with ice, the day before, except for 15 hours culture supernatant from 96-well plate was seeded VeroE6 / TMPRSS2 cells ^{5 X 10 4 / 100μl / well} , and the above-described virus / saliva / sample liquid was added 50 mu l .. After 1h adsorption, the virus solution was removed and MS was added at 100 μl / well. After culturing for 3 days, the supernatant was removed, the cells were fixed, stained with crystal violet solution, and CPE was observed. TCID ₅₀ was calculated by the Reed-Muench method.

A schematic diagram of the method in FIG. 5A, the results (mean ± standard deviation of the TCID _50/50 [mu] L of each group) is shown in FIG. 5B and C. It can be seen that both green tea and black tea reduced the infectivity of SARS-CoV-2 to 1/100 to below the detection sensitivity after 10 seconds of treatment. N = 3.

Test Example 9
Saliva from 5 healthy subjects was purchased from Lee Biosolutions (Maryland Heights, MO, USA) and sterilized by UV irradiation for 30 minutes. Saliva 45 [mu] L of SARS-CoV-2, was added by _{^{3.0 × 10 5 TCID 50/5}} μL. Green tea or black tea was added to this in a volume of 1: 1 and incubated for 10 seconds. Immediately afterwards, serum-free DMEM medium was used for 1000-fold dilution, followed by MS for 10-fold serial dilution. After cooling with ice, the supernatant was removed ^{from a 24-well plate in which VeroE6 / TMPRSS2 cells were sown at 2.5 × 10 5} / well and cultured for 15 hours the day before, and 100 μl of the above virus / saliva / sample solution was added. After 1 hour, the supernatant was discarded, 500 μL of fresh medium was added, and the cells were cultured for 10 hours. The supernatant was collected, diluted 10-fold, and the TCID ₅₀ assay was performed in the same manner as in Test Example 8. TCID ₅₀ was calculated by the Reed-Muench method.

A schematic diagram of the method in FIG. 6A, the results (mean ± standard deviation of the TCID _50/50 [mu] L of each group) is shown in Figure 6B. Treatment of SARS-CoV-2 with green tea or black tea for 10 seconds markedly reduced the intracellular amplification of SARS-CoV-2 to the production of secondary virus after infection of the cells. I understand. N = 3. * p <0.05 (between groups) (Student's t test).

Test Example 10
Saliva from 5 healthy subjects was purchased from Lee Biosolutions (Maryland Heights, MO, USA) and sterilized by UV irradiation for 30 minutes. Saliva 45 [mu] L of SARS-CoV-2, was added by _{^{3.0 × 10 5 TCID 50/5}} μL. Black tea was added to this in a volume of 1: 1 and incubated for 10 seconds. Immediately afterwards, serum-free DMEM medium was used for 1000-fold dilution, followed by MS for 10-fold serial dilution. After cooling with ice, the supernatant was removed ^{from a 24-well plate in which VeroE6 / TMPRSS2 cells were sown at 2.5 × 10 5} / well and cultured for 15 hours the day before, and 100 μl of the above virus / saliva / sample solution was added. After 1 hour, the supernatant was discarded, 500 μL of fresh medium was added, and the cells were cultured for 10 hours. RNA was recovered from the culture supernatant and cells using TRI Reagent LS (Molecular Research Center, Inc., Montgomery Road, Cincinnati, OH, USA). After reverse transcription using ReverTra Ace qPCR RT Master Mix (Toyobo, Shiga, Japan), the cDNA was subjected to real-time PCR. In Real-time PCR, a Step-One Plus Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) was used, and the following primers / probes specific for the N gene of the virus were used: Forward primer, 5'-AAATTTTGGGGACCAGGAAC-3'(SEQ ID NO: 1); reverse primer, 5'-TGG-CAGCTGTGTAGGTCAAC-3' (SEQ ID NO: 2); and probe, 5'-(FAM) ATGTCGCGCATTGGCATGGA (BHQ) -3'(SEQ ID NO: 2) 3).

A schematic diagram of the method is shown in FIG. 7A, and the results (mean ± standard deviation of the culture supernatant of each group and the intracellular relative N gene RNA level) are shown in FIG. 7B. Treatment of SARS-CoV-2 with black tea for 10 seconds markedly reduced intracellular amplification and secondary virus production after SARS-CoV-2 infected the cells. Recognize. N = 3. * p <0.05 (intergroup) (Student's t test), ^† P-values are uncalculable (because one or two of the triplicates are 0).

Test Example 11
A sample of the stated concentration (EGCG or TFDG) and ^{SARS-CoV-2 at a concentration of 1.25 x 10 7} TCID50 / mL were added to 500 μL and allowed to stand at room temperature for 1 minute. The supernatant was removed from a 24-well plate in which Vero E6 / TMPRSS2 cells were ^{sown at 2.5 × 10 5} / well and cultured for 15 hours the day before, and 100 μl of the above virus / saliva / sample solution was added. (MOI 5). After adsorption for 1 hour, the virus solution was removed, washed with PBS, and MS was added at 100 μl / well. After culturing for 10 hours, the supernatant was collected and the virus titer was measured by the TCID50 assay by the same method as in Test Example 8. In addition, RNA was extracted from the culture supernatant and cells by the following method, and viral RNA was quantified by quantitative RT-PCR. RNA was collected by TRI Reagent LS (Molecular Research Center, Inc., Montgomery Road, Cincinnati, OH, USA) and reverse transcribed by ReverTra Ace qPCR RT Master Mix (Toyobo, Shiga, Japan). For quantitative PCR, Step-One Plus Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) and virus N gene-specific primers / probes (Forward primer, 5'-AAATTTTGGGGACCAGGAAC-3' (SEQ ID NO:) 1); reverse primer, 5'-TGG-CAGCTGTGTAGGTCAAC-3'(SEQ ID NO: 2); and probe, 5'-(FAM) ATGTCGCGCATTGGCATGGA (BHQ) -3'(SEQ ID NO: 3)). The Ct value of each sample was analyzed by StepOne Software (ABI, Warrington, UK). Cellular N gene RNA levels were standardized at the 18S rRNA level of each sample. Relative RNA levels (mean ± SD) were untreated. It is a relative value with the control infected with the virus as 1.0.

A schematic diagram of the method is shown in FIG. 8a, and the results are shown in FIG. 8b. Both EGCG and TFDG act on the virus in a concentration-dependent manner to suppress intracellular amplification after infection of the cell (on b), and to produce a secondary virus from the cell (b center). And below) can be seen to have been suppressed. EGCG of 500 to 1000 μM or more and TFDG of 60 μM or more completely suppressed cell death due to virus infection. N = 4. * P <0.05, ** p <0.01, *** p <0.001 vs. Control (Tukey ’s multiple comparison test).

Test Example 12
Whether EGCG and TFDG suppressed the interaction between SARS-CoV-2 spike protein RBD and ACE2 was measured with the SARS-CoV-2 Surrogate Virus Neutralization Test Kit from GenScript (Piscataway, NJ, USA). That is, a sample of the stated concentration (EGCG or TFDG or a control containing neither (0 μM)), or a positive control or negative control included in the kit, with a horseradish peroxidase (HRP) -conjugated recombinant RBD fragment 1: 1 (volume). The ratio) was added and the mixture was incubated at 37 ° C. for 30 minutes. 100 μL of the mixture was added to wells coated with human ACE2 protein. After incubating at 37 ° C. for 15 minutes, the wells were washed and a 3,3', 5,5'-tetramethyl-benzidene (TMB) solution was added. After incubating in the dark at 20-25 ° C for 15 minutes, the absorbance at 459 nm was measured.

The results are shown in Fig. 9. It can be seen that both EGCG and TFDG strongly suppressed the interaction between the SARS-CoV-2 spike protein RBD and ACE2. The value is the average value ± S.D. (n = 3). *** p <0.001 vs. 0 μM (Tukey's multiple comparison test).

Claims (11)

1. An anti-coronavirus agent containing at least one selected from the group consisting of tea extracts, catechin compounds, and theaflavin compounds.
2. The coronavirus agent according to claim 1, wherein the coronavirus is SARS-CoV-2.
3. The anti-coronavirus agent according to claim 1 or 2, wherein the tea extract is tea or a concentrate thereof.
4. The tea extract is at least one extract selected from the group consisting of matcha tea leaves, roasted tea leaves, roasted tea leaves, new tea leaves, black tea leaves, pouer tea leaves, and oolong tea leaves. , The anti-corona virus agent according to any one of claims 1 to 3.
5. The anti-coronavirus agent according to any one of claims 1 to 4, wherein the tea extract is at least one extract selected from the group consisting of matcha tea leaves, roasted tea leaves, and black tea leaves.
6. The anticoronavirus agent according to any one of claims 1 to 5, which contains epigallocatechin gallate as the catechin compound.
7. The anti-coronavirus agent according to any one of claims 1 to 6, which is used for application to a living body.
8. The anti-coronavirus agent according to claim 7, which is a pharmaceutical, cosmetics, food composition, food additive, disinfectant or detergent.
9. The anti-coronavirus agent according to claim 7 or 8, which is a prophylactic or therapeutic agent for COVID-19.
10. The anti-coronavirus agent according to any one of claims 1 to 6, which is used for application to an article.
11. The anti-coronavirus agent according to claim 10, which is a disinfectant or a cleaning agent.

Images