WO2021251466A1 - Méthode efficace de production de cellules souches pluripotentes induites - Google Patents

Méthode efficace de production de cellules souches pluripotentes induites Download PDF

Info

Publication number
WO2021251466A1
WO2021251466A1 PCT/JP2021/022154 JP2021022154W WO2021251466A1 WO 2021251466 A1 WO2021251466 A1 WO 2021251466A1 JP 2021022154 W JP2021022154 W JP 2021022154W WO 2021251466 A1 WO2021251466 A1 WO 2021251466A1
Authority
WO
WIPO (PCT)
Prior art keywords
tead3
cells
nucleic acid
gene
inhibitor
Prior art date
Application number
PCT/JP2021/022154
Other languages
English (en)
Japanese (ja)
Inventor
善紀 吉田
カカセ アントニオ ルセナ
Original Assignee
国立大学法人京都大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人京都大学 filed Critical 国立大学法人京都大学
Priority to JP2022530622A priority Critical patent/JPWO2021251466A1/ja
Publication of WO2021251466A1 publication Critical patent/WO2021251466A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material

Definitions

  • the present invention relates to the efficiency of establishment of induced pluripotent stem (iPS) cells by inhibiting the function of transcription enhancer-related domain family member-3 (hereinafter, also referred to as "TEAD3") in the nuclear reprogramming step of somatic cells. And an agent for improving the efficiency of establishment of iPS cells, which comprises a function inhibitor of TEAD3.
  • the present invention also relates to a method for producing iPS cells by introducing a nuclear reprogramming substance and a function inhibitor of TEAD3 into somatic cells.
  • Somatic cell reprogramming driven by nuclear reprogramming factors such as the Yamanaka factor (Oct3 / 4, Sox2, Klf4 (and c-Myc)) reprograms cells and dedifferentiates them to iPS cells.
  • Yamanaka factor Oct3 / 4, Sox2, Klf4 (and c-Myc)
  • the somatic cell reprogramming process can be broadly divided into initiation, stabilization and maturation stages, coupled with the execution of multiple biological programs involving major changes in the transcriptional network.
  • p53 acts as an important barrier to initialization.
  • some point out that downregulation of the p53 pathway causes genomic instability and safety issues, as p53 acts as a defense against uncontrolled cell proliferation in response to DNA damage.
  • Transient p53 suppression with non-integrated plasmids provides a safer way to improve iPS cell establishment efficiency (see, eg, Non-Patent Document 2).
  • Patent Document 2 The present inventors have previously reported that the efficiency of iPS cell establishment can be improved by inhibiting the function of p38 in the nuclear reprogramming step of somatic cells. However, the mechanism is not yet well understood.
  • An object of the present invention is to identify a novel key factor that serves as a somatic cell reprogramming barrier, invalidate the reprogramming barrier by controlling the factor, and improve the efficiency of iPS cell establishment.
  • the present inventors systematically investigated the role of p38 MAPK inhibitors in order to achieve the above-mentioned objectives, and p38 inhibition dramatically improved the efficiency of human iPS cell establishment at both the initiation stage and the stabilization stage of reprogramming. It was found that it could be improved.
  • double inhibition of both the p38 and p53 pathways during the initialization process further increased the efficiency of iPS colony formation compared to inhibition of each pathway alone.
  • TEAD3 was found as a gene capable of exerting the same effect of improving iPS cell establishment efficiency as in the case of double-inhibition by suppressing the expression. The invention was completed.
  • the present invention is as follows.
  • a method for improving the establishment efficiency of induced pluripotent stem (iPS) cells which comprises inhibiting the function of transcription enhancer-related domain family member-3 (TEAD3) in the nuclear reprogramming process of somatic cells.
  • Method. [2] The following (a) to (c): (A) Nucleic acid or precursor having RNAi activity against the transcript of the TEAD3 gene; (B) Antisense nucleic acid for the transcript of the TEAD3 gene; and (c) Inhibits the function of TEAD3 by introducing one of the ribozyme nucleic acids for the transcript of the TEAD3 gene into somatic cells, according to [1]. the method of.
  • the inhibitor is the following (a) to (c): (A) Nucleic acid or precursor having RNAi activity against the transcript of the TEAD3 gene; The agent according to [6], which is either (b) an antisense nucleic acid for a transcript of the TEAD3 gene; or (c) a ribozyme nucleic acid for a transcript of the TEAD3 gene. [8] The agent according to [6], wherein the inhibitor is a dominant negative mutant of TEAD3 or a nucleic acid encoding the same. [9] The agent according to [6], wherein the inhibitor is an inhibitor of a transcriptional conjugate factor of TEAD3.
  • the inhibitor is the lower (a) or (b): (A) Decoy nucleic acid for TEAD3; (B) rrrcwwgyyynnnnnnnnnnnnnnrrcwwgyyy (r stands for a or g, w stands for a or t, y stands for c or t, and n stands independently for a, g, t or c; SEQ ID NO: 3)
  • the agent according to [6] which is an oligonucleic acid containing a nucleotide sequence represented by.
  • a method for producing iPS cells which comprises contacting somatic cells with a nuclear reprogramming substance and a function inhibitor of TEAD3.
  • the inhibitor is the following (a) to (c): (A) Nucleic acid or precursor having RNAi activity against the transcript of the TEAD3 gene; The method according to [11], wherein (b) an antisense nucleic acid for a transcript of the TEAD3 gene; and (c) a ribozyme nucleic acid for a transcript of the TEAD3 gene. [13] The method according to [11], wherein the inhibitor is a dominant negative mutant of TEAD3 or a nucleic acid encoding the same. [14] The method according to [11], wherein the inhibitor is an inhibitor of a transcriptional conjugate factor of TEAD3.
  • the inhibitor is the lower (a) or (b): (A) Decoy nucleic acid for TEAD3; (B) rrrcwwgyyynnnnnnnnnnnnnnrrcwwgyyy (r stands for a or g, w stands for a or t, y stands for c or t, and n stands independently for a, g, t or c; SEQ ID NO: 3)
  • the method according to [11] which is an oligonucleic acid containing a nucleotide sequence represented by.
  • the efficiency of establishing iPS cells from somatic cells can be significantly improved.
  • the protocols for four p38 inhibitor treatments are schematically shown. On the time axis, the day when the four factors are introduced into HDF is set as Day 0, and the period during which each treatment is applied is shown (A: Days 2 to 4, B: Days 6 to 20, C: Days 20 to 32, D: Days 6 to 32). ).
  • B. The iPS cell colonization assay was used to investigate the effect of p38 inhibitors on the efficiency of HDF reprogramming.
  • Primary HDF ectopically expressed with 4 factors (4F; Oct3 / 4, Sox2, Klf4 and c-Myc) was treated with 10 ⁇ M SB202190, SB203580 or SB239063 in period A or period D protocols.
  • Reprogramming efficiency on Day16, Day24, and Day32 was counted as the number of ES cell-like (iPS cell) colonies and compared to HDF (DMSO) reprogrammed only on 4F without treatment with a p38 inhibitor.
  • the graph on the left shows the result of the inhibitor treatment in the period A, and the graph on the right shows the result of the inhibitor treatment in the period D.
  • the results of SB239063, SB203580, SB202190, and DMSO processing are shown in order from the top for each number of days. * P ⁇ 0.05, ** p ⁇ 0.01 C. 4F + SB202190 shows a phase-difference image of human ES cell-like colonies derived from HDF. D.
  • the initialization efficiency on Day24 (bottom) and Day32 (top) was measured as the number of ES cell-like (iPS cell) colonies, and the number of iPS cell colonies induced from HDF by 3F + SB202190 (upper bar in each Days). ) was compared to the number of iPS cell colonies induced by 3F and vehicle (DMSO) (bottom bar at each Days). * P ⁇ 0.05G.
  • the iPS cell colonization assay was used to investigate the effect of the p38 inhibitor (SB202190) on the efficiency of HDF reprogramming by the introduction of reprogramming factors via the episomal vector (pCXLE).
  • the reprogramming efficiency on Day24 (bottom) and Day32 (top) was measured as the number of ES cell-like (iPS cell) colonies, and the number of iPS cell colonies induced from HDF by the reprogramming factor + SB202190 (top on each Day). Bar) was compared to the number of iPS cell colonies induced by reprogramming factors and vehicle (DMSO) (lower bar on each day).
  • * P ⁇ 0.05, *** p ⁇ 0.001 It is a figure which shows pluripotency and genomic stability in human iPS cells established using a small molecule p38 inhibitor.
  • SB1-SB3 Human iPS cell clones induced by SB202190 treatment
  • DM Human iPS cell clones induced only by 4F
  • ES Human ES cells
  • HD HDF.
  • B Karyotype analysis of human iPSC clones induced by SB202190 treatment.
  • C In vitro differentiation assay of human iPSC clones induced by SB202190 treatment. From left to right, differentiation into embryoid body (EB), ectoderm lineage ( ⁇ -III-tubulin positive), mesoderm lineage ( ⁇ -SMA positive) and endoderm lineage (AFP positive) is shown.
  • EB embryoid body
  • ⁇ -III-tubulin positive ectoderm lineage
  • ⁇ -SMA positive mesoderm lineage
  • AFP positive endoderm lineage
  • PCA Principal component analysis
  • the relative expression level of TEAD3 in (shp53 + p382KO) is shown.
  • +100 on the X-axis indicates the expression level of DMSO, and -100 on the X-axis indicates no expression.
  • -75 on the X-axis shows 0.125 times the expression level of DMSO.
  • the dashed arrow indicates that the number of iPS cell colonies increases in that direction.
  • 4F only (4F), 4F and non-specific shRNA (Scr), 4F and 2 types of TEAD3 shRNA (4F-shTEAD3 # 1 and 4F-shTEAD3 # 2) were introduced into 2 types of HDF (HDF1616, HDF1079). The expression of the TEAD3 protein in the case is shown.
  • TEAD3 protein was markedly suppressed by the two TEAD3 shRNAs.
  • C. 4F only (4F), 4F and non-specific shRNA (Scr), 4F and 2 types of TEAD3 shRNA (4F-shTEAD3 # 1 and 4F-shTEAD3 # 2) were introduced into 2 types of HDF (HDF1616, HDF1079).
  • the expression of TEAD3 mRNA in the case is shown.
  • the expression of TEAD3 mRNA was markedly suppressed by the two TEAD3 shRNAs. ** p ⁇ 0.01, *** p ⁇ 0.001D.
  • TEAD3 expression in the early phase (day 2 and day 4), intermediate phase (day 8), late phase (day 18) and iPSC during the MEF initialization process are shown.
  • G Changes in TEAD3 expression in SSEA1-positive and SSEA1-negative cells during the MEF reprogramming process are shown.
  • H The transcription initiation site (TSS) sequence of the TEAD3 gene, which is predicted to bind to KLF4, and its relative binding score are shown.
  • TSS transcription initiation site
  • mice iPS cells The cell number of mouse iPS cells (20D17; initial cell density: 1 ⁇ 10 5 cells / well) 96 hours after treatment with SB202190 is shown ( ** : p ⁇ 0.01; comparison with DMSO).
  • B. It is shown that mouse iPS cells obtained by treatment with SB202190 give rise to a brown coat-colored chimeric mouse.
  • C. It is shown that germline transmission occurred in mice derived from mouse iPS cells obtained by treatment with SB202190. It is shown that p38 inhibition promotes the proliferation of HDF and HDF in the early phase of reprogramming, but does not affect the proliferation of human iPS cells.
  • HDF was seeded in 6-well plates at a density of 1 ⁇ 10 5 cells / well, each of which was added with 3 p38 inhibitors and cultured for 96 hours. Total cell counts were counted on days 2, 4, 6 and 8 after treatment. The results of three independent experiments are shown in mean and standard deviation ( * : p ⁇ 0.05; comparison with DMSO).
  • Human iPS cells (201B7) were seeded on SNL feeder cells at a density of 2 ⁇ 10 5 cells / well, and each of the three p38 inhibitors was added and cultured for 96 hours. The total number of cells was counted on the 4th day after the treatment. The results of three independent experiments are shown in mean and standard deviation. TEAD3 in publicly available datasets: GSE36664 with MEF transcriptome data, GSE45276 with human lung fibroblast (HLF) transcriptome data, and HDF transcriptome data. The correlation between expression and p53 expression is shown (R: Pearson's correlation coefficient).
  • TEAD3 expression The correlation between TEAD3 expression and p38 ⁇ , ERK4, p44-ERK1, CDK4 and CDK6 expression in the publicly available HDF single-cell RNA-Seq dataset is shown (R: Pearson's correlation coefficient). It is a figure which shows the evaluation of the causal role of TEAD3 in tumor reprogramming and cell cycle kinetics in HeLa cells.
  • a daughter cell line plenti / Ubc-Slc7a1 expressing the ecotropic receptor Slc7a1 was prepared to enable retrovirus infection, and shTEAD3 was introduced by the retrovirus. Since clones with downregulated TEAD3 expression promoted cell proliferation and produced more tumor-like masses of larger size, TEAD3 increased the cellular properties that give rise to cancer in cervical cancer.
  • a representative bright-field image of estimated iPS cell colonies (squares) 12 days after introduction of 4F (scr) or 4F + shTEAD3 into HDF1616 is shown.
  • B. A representative bright-field image of the estimated iPS cell colonies (squares) 12 days after the introduction of 4F + shTEAD3 into HDF1079 is shown.
  • C. 4F (Scr), 4F + shTEAD3, or 4F + shTEAD3 + shp53 introduced and shows the growth curve of HDF1616 in the process of initialization ( * : p ⁇ 0.05; comparison with Scr (HDF1616 introduced with 4F + non-specific shRNA)) ).
  • the growth curve of iPS cells established by introducing 4F (Scr), 4F + shTEAD3, or 4F + shTEAD3 + shp53 into HDF1616 is shown).
  • F. The growth curve of iPS cells established by introducing 4F (Scr), 4F + shTEAD3, or 4F + shTEAD3 + shp53 into HDF1079 is shown.
  • the present invention provides a method for improving the efficiency of establishment of iPS cells (hereinafter, also referred to as “the method for improving the present invention”) by inhibiting the function of TEAD3 in the nuclear reprogramming step of somatic cells.
  • the means for inhibiting the function of TEAD3 is not particularly limited, but a method for introducing a function-inhibiting substance for TEAD3 into somatic cells is preferable. Therefore, the present invention also provides an agent for improving the efficiency of establishment of iPS cells (hereinafter, also referred to as “the agent of the present invention”) containing a function inhibitor of TEAD3.
  • the present invention is a method for producing iPS cells by introducing a nuclear reprogramming substance and a function inhibitor of TEAD3 into somatic cells (hereinafter, also referred to as "the production method of the present invention", and “the improvement method of the present invention”. And “the method of the present invention” are collectively referred to as “the method of the present invention”).
  • Somatic cell source The somatic cells that can be used as a starting material for iPS cell production in the present invention are germ cells derived from mammals (for example, humans, mice, monkeys, cows, pigs, rats, dogs, etc.). Any cell other than the above may be used, for example, keratinizing epithelial cells (eg, keratinized epidermal cells), mucosal epithelial cells (eg, tongue superficial epithelial cells), exocrine gland epithelial cells (eg, mammary cells), and the like.
  • mammals for example, humans, mice, monkeys, cows, pigs, rats, dogs, etc.
  • Any cell other than the above may be used, for example, keratinizing epithelial cells (eg, keratinized epidermal cells), mucosal epithelial cells (eg, tongue superficial epithelial cells), exocrine gland epithelial cells (eg, mammary cells), and the like.
  • Hormone-secreting cells eg, adrenal medulla cells
  • metabolic and storage cells eg, hepatocytes
  • luminal epithelial cells that make up the interface eg, type I alveolar cells
  • luminal epithelium of the inner canal Cells eg, vascular endothelial cells
  • ciliated cells with carrying capacity eg, airway epithelial cells
  • extracellular matrix secretory cells eg, fibroblasts
  • contractile cells eg, smooth muscle cells
  • Blood and immune system cells eg, peripheral blood mononuclear cells, umbilical cord blood, T lymphocytes
  • sensory cells eg, rod cells
  • autonomic nervous system neurons eg, cholinergic neurons
  • sensory organs and peripherals Supporting cells of neurons eg, associated cells
  • nerve cells and glia cells of the central nervous system eg, stellate glia cells
  • pigment cells eg, retinal pigment epithelial cells
  • their precursor cells
  • undifferentiated progenitor cells include tissue stem cells (somatic stem cells) such as neural stem cells, hematopoietic stem cells, mesenchymal stem cells, and dental pulp stem cells.
  • the individual mammal that is the source for collecting somatic cells is not particularly limited, but when the obtained iPS cells are used for human regenerative medicine, the patient or HLA type is considered from the viewpoint that rejection does not occur. It is particularly preferred to collect somatic cells from others who are the same or substantially the same.
  • the HLA type is "substantially the same" when the transplanted cells are transplanted into a patient by inducing differentiation from the somatic cell-derived iPS cells by using an immunosuppressive agent or the like. It means that the HLA types match to the extent that they can be engrafted.
  • the main HLA for example, the three loci of HLA-A, HLA-B and HLA-DR
  • the main HLA for example, the three loci of HLA-A, HLA-B and HLA-DR
  • the main HLA for example, the three loci of HLA-A, HLA-B and HLA-DR
  • the patient or the drug sensitivity is also used. It is desirable to collect somatic cells from others with the same gene polymorphism that correlates with side effects.
  • Somatic cells isolated from mammals can be pre-cultured in a medium known per se, which is suitable for the culture, depending on the type of cells, prior to being subjected to the nuclear reprogramming step.
  • media include minimum essential medium (MEM) containing about 5 to 20% fetal bovine serum, Dulbecco's modified Eagle's medium (DMEM), RPMI1640 medium, 199 medium, F12 medium and the like.
  • MEM minimum essential medium
  • DMEM Dulbecco's modified Eagle's medium
  • RPMI1640 medium fetal bovine serum
  • a nuclear reprogramming substance and a function-inhibiting substance of p38 and, if necessary, another substance for improving the efficiency of establishment of iPS cells described later
  • an introduction reagent such as cationic liposome
  • TEAD3 function inhibitor TEAD3 which is the target molecule in the present invention, is one of the members of the transcription enhancer-related domain (TEAD) family, and the transcriptional activation of the target gene by this transcription factor is the Hippo signaling pathway. It occurs by binding to the coactivator YAP or TAZ, whose nuclear transduction is controlled by.
  • TEAD3 is a protein containing an amino acid sequence that is the same as or substantially the same as the amino acid sequence represented by SEQ ID NO: 2.
  • proteins and peptides are described with an N-terminal (amino-terminal) at the left end and a C-terminal (carboxyl-terminal) at the right end according to the convention of peptide notation.
  • Amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 2 means (A) Orthologs of human TEAD3 consisting of the amino acid sequence represented by SEQ ID NO: 2 in other warm-blooded animals (eg, guinea pigs, rats, mice, chickens, rabbits, dogs, pigs, sheep, cows, monkeys, etc.) Amino acid sequence; or (b) means an amino acid sequence in a human TEAD3 consisting of the amino acid sequence represented by SEQ ID NO: 2 or a natural allergen variant or gene polymorphism of the ortholog of (a) above.
  • TEAD3 is a human TEAD3 or a natural allelic variant or gene polymorphism thereof consisting of the amino acid sequence represented by SEQ ID NO: 2.
  • Examples of the gene polymorphism include, but are not limited to, SNPs registered in dbSNP as rs35080860 in which Thr (ACG) at position 254 is replaced with Met (ATG).
  • the "TEAD3 function inhibitor” may be any substance as long as it can inhibit (1) the function of the TEAD3 protein or (2) the expression of the TEAD3 gene. That is, the result is obtained by acting not only on substances that directly act on the TEAD3 protein to inhibit its function and substances that directly act on the TEAD3 gene and inhibit its expression, but also on factors involved in transcriptional activation by TEAD3.
  • a substance that inhibits the function of the TEAD3 protein or the expression of the TEAD3 gene is also included in the "TEAD3 function inhibitor" in the present specification.
  • the "substance that inhibits the expression of the TEAD3 gene” is a substance that acts at any stage such as the transcriptional level of the TEAD3 gene, the level of posttranscriptional regulation, the level of translation into a protein, the level of post-translational modification, and the like. May be good. Therefore, as substances that inhibit the expression of TEAD3, for example, substances that inhibit transcription of the TEAD3 gene (eg, antigene), substances that inhibit the processing of early transcripts to mRNA, and substances that inhibit the transport of mRNA to the cytoplasm.
  • substances that inhibit the expression of TEAD3 gene for example, substances that inhibit transcription of the TEAD3 gene (eg, antigene), substances that inhibit the processing of early transcripts to mRNA, and substances that inhibit the transport of mRNA to the cytoplasm.
  • Translation of substances includes substances that inhibit mRNA-to-protein translation (eg, antisense nucleic acids, miRNAs) or degrade mRNAs (eg, siRNAs, gapmer-type antisense nucleic acids, ribozymes, miRNAs) includes substances that inhibit post-modification. Any substance that acts at any stage can be used, but a substance that complementarily binds to mRNA and inhibits translation into a protein or degrades mRNA is preferable.
  • a nucleic acid containing a nucleotide sequence complementary to the nucleotide sequence of the mRNA or a part thereof can be mentioned.
  • a nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene is complementary to the extent that it can bind to the target sequence of the mRNA and inhibit its translation (or cleave the target sequence) under physiological conditions.
  • nucleotide sequence having, specifically, for example, 90% or more with respect to a region that overlaps with a nucleotide sequence that is completely complementary to the nucleotide sequence of the mRNA (that is, a nucleotide sequence of the complementary strand of the mRNA). It is a nucleotide sequence having a homology of 95% or more, more preferably 97% or more, and particularly preferably 98% or more.
  • the nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene is a nucleotide sequence that hybridizes with the nucleotide sequence represented by SEQ ID NO: 1 under stringent conditions.
  • the “stringent condition” is, for example, the condition described in Current Protocols in Molecular Biology, John Wiley & Sons, 6.3.1-6.3.6, 1999, for example, 6 ⁇ SSC (sodium chloride / sodium citrate). ) / Hybridization at 45 ° C, followed by 0.2 ⁇ SSC / 0.1% SDS / one or more washings at 50-65 ° C. Hybridization conditions can be appropriately selected.
  • mRNA of the TEAD3 gene are human TEAD3 (RefSeq Accession No. NM_003214.4) containing the nucleotide sequence represented by SEQ ID NO: 1, its ortholog in other warm-blooded animals, and their natural alleles.
  • Examples include mRNAs such as mutants or gene polymorphisms.
  • a part of the nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene means that it can specifically bind to the mRNA of the TEAD3 gene and inhibits the translation of the protein from the mRNA (or inhibits the mRNA).
  • its length and position are not particularly limited, but from the viewpoint of sequence specificity, the portion complementary to the target sequence is at least 10 bases or more, preferably 15 bases or more, more preferably 19. It contains more than a base.
  • any of the following (a) to (c) is preferably exemplified as a nucleic acid containing a part of the nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene.
  • Nucleic acid having RNAi activity against mRNA of TEAD3 gene or its precursor (b) Antisense nucleic acid against mRNA of TEAD3 gene (c) Ribozyme nucleic acid for mRNA of TEAD3 gene
  • TEAD3 gene (a) Nucleic acid having RNAi activity against the mRNA of the TEAD3 gene or a precursor thereof
  • TEAD3 gene is defined as being included in a nucleic acid containing a nucleotide sequence complementary to or a part of the nucleotide sequence of mRNA.
  • the siRNA can be designed based on the cDNA sequence information of the target gene, for example, according to the rules proposed by Elbashir et al. (Genes Dev., 15, 188-200 (2001)).
  • Examples of the target sequence of siRNA include, but are not limited to, AA + (N) 19 , AA + (N) 21 or NA + (N) 21 (N is an arbitrary base).
  • the position of the target sequence is also not particularly limited.
  • BLAST http://www.ncbi.nlm.nih.gov/BLAST/
  • BLAST is checked to see if there is homology in the consecutive sequences of 16-17 bases in the non-target mRNA.
  • RNA may be designed as siRNA.
  • siRNA short hairpin RNA
  • linker sequence for example, about 5-25 bases
  • sense strand and antisense strand are selected. It can be designed by concatenating via a linker sequence.
  • SiRNA and / or shRNA sequences can be searched using search software provided free of charge on various websites.
  • Such sites include, for example, siDESIGN Center (https://horizondiscovery.com/en/products/tools/siDESIGN-Center) provided by Horizon Discovery Ltd. and siRNA TargetFinder (https: //) provided by GenScript. www.genscript.com/tools/sirna-target-finder), etc., but not limited to these.
  • siRNAs and shRNAs of the present invention are represented by nucleotide numbers 219 to 247 (AGCAACCAGCACAATAGCGTCCAACAGCT: SEQ ID NO: 4) or 1207 to 1235 (AGCATGACCATCAGCGTCTCCACCAAGGT: SEQ ID NO: 5) in the nucleotide sequence represented by SEQ ID NO: 1.
  • SEQ ID NO: 1 Includes a nucleotide sequence complementary to a sequence consisting of at least 15 contiguous nucleotides in the region shown.
  • microRNAs that target the mRNA of the TEAD3 gene are also defined as being included in nucleic acids containing a nucleotide sequence complementary to or a portion thereof of the nucleotide sequence of the mRNA of the TEAD3 gene.
  • miRNAs are involved in post-transcriptional regulation of gene expression by complementarily binding to target mRNAs and suppressing mRNA translation, or by degrading mRNAs.
  • the primary transcript primary-microRNA (pri-miRNA)
  • pri-miRNA primary-microRNA
  • pre-miRNA approximately 70-base-long precursor-microRNA (pre-miRNA), which has a hairpin structure characteristic of Drosha, is transcribed. )
  • pre-miRNA approximately 70-base-long precursor-microRNA
  • RISC RISC-mediated processing
  • MiRNA can be searched using target prediction software provided free of charge on various websites.
  • target prediction software provided free of charge on various websites.
  • Such sites include, for example, TargetScan (http://www.targetscan.org/vert_72/) published by the Whitehead Institute in the United States, and Alexander Fleming Biomedical Science Research Center in Greece.
  • TarBase http://carolina.imis.athena-innovation.gr
  • a database on miRNAs that have been experimentally proven to act on target mRNAs published by the Pasteur Institute of the University of Chezalley, etc.
  • You can also search for miRNAs that target TEAD3 mRNA using /diana_tools/web/index.php?r tarbasev8/index).
  • those having a high score in the target prediction software include, for example, hsa-miR-106b-5p, hsa-miR-20a-5p and the like.
  • Sequence information of these miRNAs and / or pre-miRNAs can be obtained, for example, using miRBase (http://www.mirbase.org/search.shtml) published by the University of Manchester, England.
  • the nucleotide molecules that make up siRNA and / or shRNA, or miRNA and / or pre-miRNA may be natural RNA or DNA, but are stable (chemical and / or paired) and specific activity (affinity with RNA).
  • Various chemical modifications can be included to improve sex).
  • the phosphate residue (phosphate) of each nucleotide constituting the antisense nucleic acid is chemically modified with, for example, phosphorothioate (PS), methylphosphonate, phosphorodithionate, etc. It can be replaced with a phosphoric acid residue.
  • PS phosphorothioate
  • methylphosphonate methylphosphonate
  • phosphorodithionate etc. It can be replaced with a phosphoric acid residue.
  • the base moiety pyrimidine, purine
  • C2'-endo (S type) and C3'-endo (N type) are dominant in the formation of the sugar part of RNA, and in single-strand RNA, they exist as an equilibrium between the two, but they are double-stranded. Is fixed to N type when it is formed. Therefore, BNA (LNA) (Imanishi), which is an RNA derivative in which the conformation of the sugar moiety is fixed to N type by cross-linking 2'oxygen and 4'carbon in order to impart strong binding ability to the target RNA.
  • LNA LNA
  • ENA ENA
  • the sense strand and antisense strand of the target sequence on mRNA are synthesized by a DNA / RNA automatic synthesizer, respectively, and denatured in an appropriate annealing buffer at about 90 to about 95 ° C. for about 1 minute. It can be prepared by annealing at about 30 to about 70 ° C. for about 1 to about 8 hours. It can also be prepared by synthesizing shRNA as a precursor of siRNA and cleaving it with a dicer. miRNA and pre-miRNA can be synthesized by a DNA / RNA automatic synthesizer based on their sequence information.
  • nucleic acids designed to be capable of producing siRNAs or miRNAs against the mRNA of the TEAD3 gene in vivo are also nucleic acids comprising a nucleotide sequence complementary to or part of the nucleotide sequence of the mRNA of the TEAD3 gene. Defined as contained in. Examples of such nucleic acids include expression vectors constructed to express the above-mentioned shRNA or siRNA or miRNA or pre-miRNA. As shown in the Examples below, TEAD3 expression is at the beginning of the initialization process (eg, within 3 days after the introduction of the nuclear reprogramming material) and at the stabilization stage (eg, 2 after the introduction of the nuclear reprogramming material).
  • TEAD3 Since it increases in both (up to 3 weeks), it is considered desirable that the functional inhibition of TEAD3 is sustained for a long period of time through the nuclear initialization step.
  • the use of an expression vector is preferable in that a nucleic acid that inhibits the expression of TEAD3 can be continuously supplied to somatic cells for a long period of time.
  • shRNA is an oligo containing a nucleotide sequence in which the sense strand and antisense strand of the target sequence on mRNA are linked by inserting a spacer sequence of a length (for example, about 5 to 25 bases) capable of forming an appropriate loop structure. It can be prepared by designing RNA and synthesizing it with an automatic DNA / RNA synthesizer.
  • Vectors expressing shRNA include tandem type and stem loop (hairpin) type. The former is a tandem link between the expression cassette of the sense strand of siRNA and the expression cassette of the antisense strand, and each strand is expressed and annealed in the cell to form double-stranded siRNA (dsRNA). Is.
  • the latter is a vector in which an shRNA expression cassette is inserted, in which the shRNA is expressed intracellularly and processed by a dicer to form dsRNA.
  • a polII-based promoter for example, a pre-CMV early stage promoter
  • a polIII-based promoter in order to allow accurate transcription of short RNA.
  • the polIII promoter include mouse and human U6-snRNA promoters, human H1-RNase PRNA promoters, and human valine-tRNA promoters.
  • a sequence in which four or more Ts are continuous is used as the transcription termination signal.
  • Expression cassettes for miRNA and pre-miRNA can also be prepared in the same manner as shRNA.
  • the siRNA or shRNA or miRNA or pre-miRNA expression cassette constructed in this way is then inserted into a plasmid vector or viral vector.
  • a viral vector such as a retrovirus, a lentivirus, an adenovirus, an adeno-associated virus, a herpes virus, a Sendai virus, an animal cell expression plasmid, or the like is used. Since TEAD3 is deeply involved in gene expression regulation via the Hippo signaling pathway, which is also involved in homeostasis maintenance, the reprogramming barrier is released and somatic cells are rapidly dedifferentiated into iPS cells. It may be preferable to restore function.
  • a non-integrated transient expression vector for example, an adenovirus vector or a plasmid is more preferable.
  • an episomal vector capable of autonomous replication outside the chromosome in that nucleic acids that inhibit TEAD3 expression can be continuously expressed through the nuclear reprogramming step and can be rapidly eliminated from the cells after the establishment of iPS cells.
  • Specific means using an episomal vector are disclosed in Yu et al., Science, 324, 797-801 (2009).
  • the episomal vector examples include a vector containing a sequence required for autonomous replication derived from EBV, SV40, etc. as a vector element.
  • the vector elements required for autonomous replication are a replication origin and a gene encoding a protein that binds to the replication origin and controls replication.
  • the replication origin oriP the replication origin oriP.
  • the EBNA-1 gene and in the case of SV40, the replication origin ori and the SV40 large Tantigen gene can be mentioned.
  • the "antisense nucleic acid against mRNA of TEAD3 gene" in the present invention is a nucleic acid containing or a part of a nucleotide sequence complementary to the nucleotide sequence of the mRNA and is a target. It has a function of suppressing protein synthesis by forming and binding to a specific and stable double chain with mRNA.
  • Antisense nucleic acids include polydeoxyribonucleotides containing 2-deoxy-D-ribose, polyribonucleotides containing D-ribose, and other types of polynucleotides that are N-glycosides of purine or pyrimidine bases.
  • polymers with a non-nucleotide skeleton eg, commercially available protein nucleic acids and synthetic sequence-specific nucleic acid polymers
  • polymers containing special bindings provided that the polymer is a base as found in DNA or RNA.
  • RNA RNA hybrids
  • unmodified polynucleotides or unmodified oligonucleotides, known modifications.
  • Additions such as those with a label known in the art, those with a cap, those that are methylated, those in which one or more natural nucleotides are replaced with an analog, those with intramolecular nucleotide modifications.
  • those with uncharged bonds eg, methylphosphonate, phosphotriester, phosphoramidate, carbamate, etc.
  • charged bonds or sulfur-containing bonds eg, phosphorothioate, phosphorodithioate, etc.
  • Those having side chain groups such as proteins (eg, nucleases, nuclease inhibitors, toxins, antibodies, signal peptides, poly-L-lysine, etc.) and sugars (eg, monosaccharides, etc.), intercurrent.
  • proteins eg, nucleases, nuclease inhibitors, toxins, antibodies, signal peptides, poly-L-lysine, etc.
  • sugars eg, monosaccharides, etc.
  • Those with compounds eg, acridin, solarene, etc.
  • those containing chelate compounds eg, metals, radioactive metals, boron, oxidizing metals, etc.
  • those containing alkylating agents modified. It may have a binding (for example, ⁇ -anomer type nucleic acid).
  • nucleoside may include not only those containing purine and pyrimidine bases but also those having other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. Modified nucleosides and modified nucleotides may also have modified sugar moieties, for example, one or more hydroxyl groups substituted with halogens, aliphatic groups, etc., or functional groups such as ethers, amines, etc. It may have been converted.
  • the antisense nucleic acid may be DNA, RNA, or a DNA / RNA chimera.
  • the antisense nucleic acid is DNA
  • the RNA DNA hybrid formed by the target RNA and the antisense DNA can be recognized by the endogenous RNase H and cause selective degradation of the target RNA. Therefore, in the case of antisense DNA directed to degradation by RNase H, the target sequence may be not only the sequence in mRNA but also the sequence of the intron region in the initial translation product of the TEAD3 gene.
  • the intron sequence can be determined by comparing the genomic sequence with the cDNA nucleotide sequence of the TEAD3 gene using a homology search program such as BLAST or FASTA.
  • the target region of the antisense nucleic acid of the present invention is not particularly limited in length as long as the antisense nucleic acid hybridizes to inhibit translation into a protein, and the mRNA encoding the protein is not particularly limited. It may be a full sequence or a partial sequence of the above, and a short one may be about 10 bases, and a long one may be the whole sequence of mRNA or an early transcript. Considering the ease of synthesis, antigenicity, intracellular transferability, and the like, oligonucleotides consisting of about 10 to about 40 bases, particularly about 15 to about 30 bases are preferable, but the oligonucleotide is not limited thereto.
  • 3'end parindrome regions or 3'end hairpin loops can be selected as preferred target regions for antisense nucleic acids, but are not limited thereto.
  • the target region of the antisense nucleic acid of the present invention similarly to the above siRNA, in the nucleotide sequence represented by SEQ ID NO: 1, within the region represented by nucleotide numbers 219 to 247 or 1207 to 1235. A sequence consisting of at least 15 consecutive nucleotides can be mentioned.
  • TEAD3 mRNA can be degraded by the action of RNase H in the target region, so that the same effect as siRNA can be obtained.
  • TEAD4 a paralog of TEAD3, is known to have a splicing variant that lacks the DNA-binding domain on the N-terminal side, and it is thought that skipping of exon 3 changes the position of the start codon (NatCommun 7: 11840).
  • the DNA-binding regions of the TEAD family are highly conserved, and it is speculated that TEAD3 also has splicing variants that lack the DNA-binding domain.
  • TEAD3 isoforms starting with Met indicated by amino acid number 112 can be produced.
  • the isoform binds to the coactivator YAP / TAZ, but cannot bind to the promoter of the target gene, thus functioning as a dominant negative variant of TEAD3.
  • the antisense nucleic acid of the present invention not only hybridizes with the mRNA and early transcript of the TEAD3 gene to inhibit translation into a protein, but also binds to these genes, which are double-stranded DNA, to form a triple strand (triple strand). It may be one that can form a triplet) and inhibit transcription into RNA (antigene).
  • nucleotide molecules constituting the antisense nucleic acid may also be modified in the same manner as in the case of siRNA and the like described above in order to improve stability, specific activity and the like.
  • the antisense oligonucleotide of the present invention determines the target sequence of mRNA or early transcript based on the cDNA sequence or genomic DNA sequence of the TEAD3 gene, and is a commercially available DNA / RNA automatic synthesizer (Applied Biosystems, Beckman). Etc.) and can be prepared by synthesizing a sequence complementary to this.
  • all of the antisense nucleic acids containing the above-mentioned various modifications can be chemically synthesized by a method known per se.
  • the antisense nucleic acid can be incorporated into an expression vector and introduced into somatic cells in the same manner as in the case of siRNA or the like described above.
  • Ribozyme nucleic acid for the mRNA of the TEAD3 gene As another example of a nucleic acid containing a nucleotide sequence complementary to or a part of the nucleotide sequence of the mRNA of the TEAD3 gene, the mRNA is specifically cleaved inside the coding region. Examples include the ribozyme nucleic acid obtained.
  • the term "ribozyme” is used in a narrow sense as an RNA having an enzymatic activity for cleaving nucleic acid, but is used herein as a concept including DNA as long as it has a sequence-specific nucleic acid cleaving activity.
  • the most versatile ribozyme nucleic acid includes self-splicing RNA found in infectious RNAs such as viroids and virusoids, and hammerhead type and hairpin type are known.
  • the hammer head type exerts enzymatic activity at about 40 bases, and several bases at both ends adjacent to the part having the hammer head structure (about 10 bases in total) are arranged in a sequence complementary to the desired cleavage site of mRNA. By doing so, it is possible to specifically cleave only the target mRNA.
  • This type of ribozyme nucleic acid has the additional advantage of not attacking genomic DNA because it uses only RNA as a substrate.
  • the target sequence is made single-stranded by using a hybrid ribozyme linked with an RNA motif derived from a viral nucleic acid that can specifically bind to RNA helicase.
  • a hybrid ribozyme linked with an RNA motif derived from a viral nucleic acid that can specifically bind to RNA helicase can [Proc. Natl. Acad. Sci. USA, 98 (10): 5572-5577 (2001)].
  • the ribozyme when used in the form of an expression vector containing the DNA encoding it, it should be a hybrid ribozyme in which tRNA-modified sequences are further linked in order to promote the transfer of the transcript to the cytoplasm. You can also [Nucleic Acids Res., 29 (13): 2780-2788 (2001)].
  • Nucleic acids containing a nucleotide sequence complementary to or a part of the nucleotide sequence of the mRNA of the TEAD3 gene may be provided in a special form such as liposomes or microspheres, or may be provided in a form in which other elements are added. Can be possible.
  • polycationic substances such as polylysine, which act to neutralize the charge of the phosphate basal skeleton, and lipids that enhance interaction with cell membranes and increase nucleic acid uptake (eg,). , Phosphoripide, cholesterol, etc.) and other hydrophobic ones.
  • Preferred lipids for addition include cholesterol and its derivatives (eg, cholesteryl chloroformate, cholic acid, etc.).
  • nucleic acids can be attached via bases, sugars, intramolecular nucleoside bonds.
  • Other groups include cap groups specifically located at the 3'or 5'ends of nucleic acids to prevent degradation by nucleases such as exonucleases and RNases. Examples of such groups for caps include, but are not limited to, hydroxyl-protecting groups known in the art, such as glycols such as polyethylene glycol and tetraethylene glycol.
  • the nucleic acid containing a part of the nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene is in the form of RNA, it can be introduced into the body cell by a method such as lipofection or microinjection.
  • the form of an expression vector containing DNA encoding the RNA it can be introduced into cells by a method known per se, depending on the type of vector.
  • the vector is recovered and the cells are infected with the vector by an appropriate method according to each viral vector.
  • specific means of using a retroviral vector as a vector are disclosed in WO2007 / 69666, Cell, 126, 663-676 (2006) and Cell, 131, 861-872 (2007), and the lentiviral vector is used as a vector.
  • the use is disclosed in Science, 318, 1917-1920 (2007).
  • the case of using an adenovirus vector is described in Science, 322, 945-949 (2008).
  • the vector is transferred to cells by using a lipofection method, a liposome method, an electroporation method, a calcium phosphate co-precipitation method, a DEAE dextran method, a microinjection method, a gene gun method, or the like. Can be introduced.
  • a substance that inhibits the expression of the oligonucleic acid TEAD3 gene comprising the consensus binding sequence of p53 is a substance that inhibits the transcriptional activator of the TEAD3 gene from binding to the promoter region of the TEAD3 gene.
  • the consensus binding sequence of p53, rrrcwwgyyynnnnnnnnnnnnnnrrcwwgyyy (r stands for a or g, w stands for a or t, y stands for c or t, n stands independently or does not exist, a, Can be mentioned as an oligonucleic acid comprising g, t or c; SEQ ID NO: 3).
  • the oligonucleic acid is double-stranded DNA.
  • oligonucleic acids containing the consensus binding sequence of p53 are directed to the TEAD3 promoter region of p53. It can inhibit binding and suppress its transcription.
  • the length of the oligonucleic acid is, for example, 20 to 50 nucleotides, preferably 25 to 40 nucleotides.
  • the oligonucleic acid synthesizes a sense strand and an antisense strand using a commercially available DNA / RNA automatic synthesizer (Applied Biosystems, Beckman, etc.) based on the sequence information of SEQ ID NO: 3, and synthesizes them. It can be manufactured by annealing.
  • the oligonucleic acid can be introduced into somatic cells by a method such as lipofection or microinjection.
  • the "substance that suppresses the function of TEAD3” is any substance as long as it suppresses the function of TEAD3 once functionally produced (for example, the transcriptional activation function of a gene cluster that maintains its uniqueness as a somatic cell).
  • examples thereof include substances that bind to TEAD3 and suppress the function, substances that inhibit the binding activity between TEAD3 and a target gene, and substances that inhibit the interaction between TEAD3 and a transcriptional coupling factor.
  • Dominant negative mutant of TEAD3 TEAD3 is a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 in humans, but the region of about 30 to about 100 amino acids from the N-terminal side is highly advanced in the TEAD family. It is a DNA-binding domain conserved in the YAP / TAZ-binding domain and the transcription activation domain after about 200 positions. Therefore, the TEAD3 fragment lacking the DNA-binding domain binds to the transcription coactivator YAP / TAZ competitively with the endogenous full-length TEAD3 and activates transcription of the target gene cluster by the interaction between TEAD3 and YAP / TAZ. It can be suppressed.
  • the TEAD3 fragment lacking the YAP / TAZ binding domain and the transcription activation domain binds to the promoter region of the target gene competitively with the endogenous full-length TEAD3, and is a group of target genes due to the interaction between TEAD3 and YAP / TAZ. Transcription activation can be suppressed.
  • Dominant negative variants of TEAD3 can be obtained by designing an appropriate primer set from a cell / tissue-derived mRNA, cDNA or cDNA library expressing TEAD3 in warm-blooded animals such as humans by the (RT-) PCR method.
  • Clone a nucleic acid encoding a TEAD3 fragment lacking the DNA-binding domain of interest or the YAP / TAZ-binding domain (transcription activation domain) insert it into an appropriate expression vector, introduce the vector into a host cell, and the cell. It can be obtained by recovering the recombinant protein from the culture obtained by culturing.
  • Contact of the dominant negative mutant to somatic cells can be performed using a method for introducing a protein into cells known per se.
  • Such methods include, for example, a method using a protein transfer reagent, a method using a protein transfer domain (PTD) fusion protein, a microinjection method, and the like.
  • Protein transfer reagents include BioPOTER Protein Delivery Reagent (Gene Therapy Systmes) based on cationic lipids, Pro-Ject TM Protein Transfection Reagent (PIERCE) and ProVectin (IMGENEX), and Profect-1 (Targeting Systems) based on lipids.
  • Penetrain Peptide Q biogene
  • Chariot Kit Active Motif based on membrane-permeable peptides
  • the introduction can be performed according to the protocol attached to these reagents, but the general procedure is as follows.
  • the dominant negative variant of p38 is diluted with a suitable solvent (for example, buffer solution of PBS, HEPES, etc.), an introduction reagent is added, and the mixture is incubated at room temperature for about 5-15 minutes to form a complex, which is serum-free. Add to the cells replaced with medium and incubate at 37 ° C. for 1 to several hours. Then, the medium is removed and replaced with a serum-containing medium.
  • a suitable solvent for example, buffer solution of PBS, HEPES, etc.
  • PTDs using cell transit domains of proteins such as Drosophila-derived AntP, HIV-derived TAT, and HSV-derived VP22 have been developed.
  • a fusion protein expression vector incorporating the cDNA of the dominant negative mutant of p38 and the PTD sequence is prepared and recombinantly expressed, and the fusion protein is recovered and used for introduction.
  • the introduction can be carried out in the same manner as described above except that the protein introduction reagent is not added. It is suitable for introducing deletion mutants with relatively small molecular weight such as p38DD.
  • Microinjection is a method in which a protein solution is put into a glass needle with a tip diameter of about 1 ⁇ m and punctured and introduced into cells, and the protein can be reliably introduced into cells.
  • the dominant negative variant of TEAD3 is used in the form of a nucleic acid encoding it rather than as the protein itself. Is rather preferable. Therefore, in another preferred embodiment of the invention, the TEAD3 function inhibitor is a nucleic acid encoding a dominant negative variant of TEAD3.
  • the nucleic acid may be DNA, RNA, or a DNA / RNA chimera, but is preferably DNA. Further, the nucleic acid may be double-stranded or single-stranded.
  • the cDNA encoding the dominant negative variant of TEAD3 can be cloned by the method described above for the production of the variant protein.
  • the isolated cDNA is inserted into a suitable viral or non-viral expression vector and similarly, as is the nucleic acid containing a part of the nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene described above. It can be introduced into somatic cells by the gene transfer method.
  • TEAD3 couples with the coactivator YAP / TAZ to activate transcription of target genes.
  • YAP / TAZ binds to 14-3-3, is localized in the cytoplasm, and is inactivated, but is dephosphorylated. It dissociates with 14-3-3 and translocates into the nucleus, and promotes transcription of the target gene cluster in conjugation with TEAD3. Therefore, by inhibiting YAP / TAZ, which is a transcriptional conjugate factor of TEAD3, the function of TEAD3 can be inhibited as a result.
  • antisense nucleic acid against YAP or TAZ, ribozyme nucleic acid, etc. are introduced into somatic cells to suppress their expression. Examples include a method of promoting the phosphorylation of YAP / TAZ and the formation of a complex with 14-3-3, and suppressing its activation and nuclear translocation.
  • SiRNAs and shRNAs for YAP or TAZ are based on the sequence information of YAP mRNA (eg, NM_001130145 for human YAP1-2 ⁇ isoform) or TAZ mRNA (eg, NM_000116 for human TAZ isoform-1).
  • SIRNA for TEAD3, etc. can be appropriately designed by the same method as described.
  • MiRNAs for YAP or TAZ can be searched using the same database described for miRNAs for TEAD3.
  • examples of miRNAs for YAP1 include, but are not limited to, hsa-miR-204-5p, hsa-miR-506-3p, and the like.
  • examples of miRNAs for TAZ include, but are not limited to, hsa-miR-382-3p and hsa-miR-26b-5p. Sequence information for these miRNAs and / or pre-miRNAs can be obtained using, for example, miRBase (above).
  • the antisense nucleic acid and ribozyme nucleic acid for YAP and TAZ can be designed and used in the same manner as the antisense nucleic acid and ribozyme nucleic acid for TEAD3.
  • 14-3-3 proteins can be used as inhibitors of YAP or TAZ. By enriching the intracellular 14-3-3 protein, it is possible to promote the formation of a complex with YAP / TAZ and suppress the translocation of YAP / TAZ into the nucleus.
  • an activating substance of the Hippo signaling pathway can also be used as an inhibitor of YAP or TAZ. Activation of the Hippo signaling pathway can promote YAP / TAZ phosphorylation and suppress nuclear translocation. Examples of the activator of the Hippo signaling pathway include Lats1 / 2 (and its conjugate factor Mob1A / 1B) and its upstream MST1 / 2 (and its conjugate factor WW45).
  • dominant negative variants of YAP or TAZ can be used.
  • the TEAD-binding domains of YAP and TAZ are 50 to 100 amino acids and 13 to 57 amino acids from the N-terminal, respectively, and the transcription activation domains are positions 276 to 472 and 208 to 381, respectively, and thus include the TEAD binding domain.
  • a YAP or TAZ fragment lacking a transcriptional activation domain when translocated into the nucleus, it binds to TEAD3 competitively with endogenous YAP / TAZ and activates transcription of the target gene by the interaction between TEAD3 and YAP / TAZ. Can be suppressed.
  • a nuclear localization signal sequence known per se may be added.
  • Information on the amino acid sequence and mRNA sequence of these YAP / TAZ inhibitors is known, and sequence information can be obtained from various databases, including the above-mentioned dominant negative variant of TEAD3 and the nucleic acid encoding it.
  • the desired protein or nucleic acid encoding it can be obtained.
  • the obtained protein or nucleic acid can be introduced into somatic cells by the same method as the dominant negative mutant of TEAD3 or the nucleic acid encoding the same.
  • the decoy nucleic acid YAP / TAZ for TEAD3 is coupled not only with TEAD3 but also with other transcription factors. Therefore, in order to selectively suppress the transcriptional activation of the target gene in TEAD3, it is more preferable to use a substance that inhibits the binding of TEAD3 to the target gene promoter region. Examples of such a substance include not only the dominant negative mutant of TEAD3 lacking the YAP / TAZ binding domain (transcription activation domain) described above, but also a decoy nucleic acid containing a consensus binding sequence of TED3. ACATTCCA is mentioned as a consensus binding sequence of TEAD3.
  • the decoy nucleic acid is double-stranded DNA.
  • the length of the decoy nucleic acid is, for example, 8 to 30 nucleotides, preferably 8 to 20 nucleotides.
  • the decoy nucleic acid for TEAD3 can be prepared in the same manner as the oligonucleic acid containing the consensus binding sequence of p53 and introduced into somatic cells.
  • the above TEAD3 function-inhibiting substance needs to be introduced into somatic cells in a manner sufficient to inhibit the function of TEAD3 in the nuclear initialization step of somatic cells.
  • the nuclear reprogramming of somatic cells can be carried out by introducing a nuclear reprogramming substance into somatic cells.
  • nuclear reprogramming substance is a proteinaceous factor or a substance (group) that can induce iPS cells from the somatic cells by introducing them into the somatic cells. It may be composed of any substance such as a nucleic acid encoding it (including a form incorporated in a vector) or a low molecular weight compound.
  • the nuclear reprogramming substance is a proteinaceous factor or a nucleic acid encoding the same, the following combinations are preferably exemplified (in the following, only the name of the proteinaceous factor is described).
  • c-Myc can be replaced with T58A (active mutant), N-Myc, L-Myc.) (3) Oct3 / 4, Klf4, c-Myc, Sox2, Fbx15, Nanog, Eras, ECAT15-2, TclI, ⁇ -catenin (active mutant S33Y) (4) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, SV40 Large T antigen (hereinafter, SV40LT) (5) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, HPV16 E6 (6) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, HPV16 E7 (7) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, HPV6 E6, HPV16 E7 (8) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, Bmil (See WO 2007/069666 (however, in the combination of
  • the combination of the three factors Oct3 / 4, Sox2 and Klf4 (that is, (9) above) is preferable.
  • the three factors Oct3 / 4, Sox2 and Klf4 as well as c-Myc 4 factors including the above can be exemplified.
  • 5 factors that is, (25) above
  • L-Myc and Lin28 obtained by adding L-Myc and Lin28 to 3 factors of Oct3 / 4, Sox2 and Klf4, and Glis1 (that is, (26) above).
  • 6 factors including SV40 Large T can be exemplified.
  • nucleotide sequences of mouse and human cDNAs of each of the above nuclear reprogramming substances and the amino acid sequence information of the protein encoded by the cDNA refer to NCBI accession numbers described in WO 2007/069666, and L-Myc, Lin28. , Lin28b, Esrrb, Esrrg and Glis1 mouse and human cDNA sequences and amino acid sequence information can be obtained by referring to the NCBI accession numbers below, respectively.
  • One of ordinary skill in the art can prepare a desired nuclear reprogramming substance by a conventional method based on the cDNA sequence or amino acid sequence information.
  • the obtained cDNA is inserted into an appropriate expression vector and introduced into a host cell, and the recombinant proteinaceous factor is obtained from the culture obtained by culturing the cells. Can be prepared by recovering.
  • the obtained cDNA can be used as a viral vector, episomal vector or plasmid in the same manner as in the case of the nucleic acid encoding the dominant negative variant of TEAD3. It is inserted into a vector to construct an expression vector and subjected to a nuclear initialization step.
  • each nucleic acid may be supported on a separate vector, or a plurality of nucleic acids may be linked in tandem to form a polycistronic vector. It can also be.
  • polycistronic vector for example, 2A sequence of foot-and-mouth disease virus (PLoS ONE 3, e2532, 2008, Stem Cells 25, 1707, 2007), IRES sequence (US Patent No. A 2A sequence is preferably used, such as 4,937,190).
  • (D) IPS cell establishment efficiency improving substance In addition to the above-mentioned TEAD3 function-inhibiting substance, it can be expected that the establishment efficiency of iPS cells will be further enhanced by contacting somatic cells with other known establishment efficiency improving substances.
  • HDAC histone deacetylase
  • VPA valproic acid
  • tricostatin Nucleic acid expression such as A, sodium butyrate, small molecule inhibitors such as MC 1293, M344, siRNA and shRNA against HDAC (eg, HDAC1 siRNA Smartpool TM (Millipore), HuSH 29mer shRNA Constructs against HDAC1 (OriGene), etc.) Inhibitors, etc.] DNA methyltransferase inhibitors (eg, 5'-azacytidine) (Nat.
  • HDAC histone deacetylase
  • G9a histone methyltransferase inhibitors eg, BIX-01294 (Cell) Small molecule inhibitors such as Stem Cell, 2: 525-528 (2008)
  • nucleic acid expression inhibitors such as siRNA and shRNA against G9a (eg, G9a siRNA (human) (Santa Cruz Biotechnology), etc.], L.
  • -channel nucleic acid agonist eg Bayk8644
  • UTF1 Cell Stem Cell, 3, 475-479 (2008)
  • Wnt Signaling activator eg soluble Wnt3a
  • 2i / LIF 2i is an inhibitor of mitogen-activated protein kinase signaling and glycogen synthase kinase-3, PloS Biology, 6 (10), 2237-2247 (2008)
  • ES cell-specific miRNA eg, miR-302-367 cluster (Mol. Cell. Biol.
  • nucleic acid expression inhibitor described above may be in the form of an expression vector containing DNA encoding siRNA or shRNA.
  • iPS cell establishment efficiency improving substance in that it is not essential for nuclear reprogramming of somatic cells but is an auxiliary factor. It can also be included in the category.
  • auxiliary factors other than the factors essential for nuclear reprogramming as nuclear reprogramming substances or as substances for improving the establishment efficiency of iPS cells? It may be convenient.
  • hypoxic condition means that the oxygen concentration in the atmosphere when culturing cells is significantly lower than that in the atmosphere. Specifically, there are conditions of oxygen concentration lower than the oxygen concentration in the atmosphere of 5-10% CO 2 / 95-90% generally used in normal cell culture, for example, oxygen in the atmosphere. The condition that the concentration is 18% or less is applicable.
  • the oxygen concentration in the atmosphere is 15% or less (eg, 14% or less, 13% or less, 12% or less, 11% or less, etc.), 10% or less (eg, 9% or less, 8% or less, 7% or less). , 6% or less, etc.), or 5% or less (eg, 4% or less, 3% or less, 2% or less, etc.).
  • the oxygen concentration in the atmosphere is preferably 0.1% or more (eg, 0.2% or more, 0.3% or more, 0.4% or more, etc.), 0.5% or more (eg, 0.6% or more, 0.7% or more, 0.8% or more, 0.95). 1% or more (eg, 1.1% or more, 1.2% or more, 1.3% or more, 1.4% or more, etc.).
  • WO 2010/013845 For more detailed culture conditions relating to hypoxic culture, see, for example, WO 2010/013845.
  • the cells After contacting the nuclear reprogramming substance and the TEAD3 function inhibitor, the cells can be cultured under conditions suitable for culturing ES cells, for example.
  • LIF Leukemia Inhibitory Factor
  • bFGF basic fibroblast growth factor
  • SCF stem cell factor
  • cells are usually cultured as feeder cells in the coexistence of mouse embryo-derived fibroblasts (MEF) that have been treated with radiation or antibiotics to stop cell division.
  • MEF mouse embryo-derived fibroblasts
  • STO cells are usually often used, but SNL cells (McMahon, A. P.
  • Co-culture with feeder cells may be initiated prior to contact with the nuclear reprogramming agent and TEAD3 function inhibitor, at the time of the contact, or after the contact (eg, 1-10 days). You may.
  • Selection of candidate colonies for iPS cells includes a method using drug resistance and reporter activity as indicators and a method by visual morphological observation.
  • the former may include, for example, a drug resistance gene and / or at the locus of a gene specifically highly expressed in a pluripotent cell (eg, Fbx15, Nanog, Oct3 / 4, preferably Nanog or Oct3 / 4).
  • a pluripotent cell eg, Fbx15, Nanog, Oct3 / 4, preferably Nanog or Oct3 / 4.
  • Such recombinant cells include, for example, MEF (Takahashi & Yamanaka, Cell, 126, 663) derived from a mouse in which the ⁇ geo (encoding a fusion protein of ⁇ -galactosidase and neomycin phosphotransferase) gene is knocked in at the Fbx15 locus. -676 (2006)) or MEF (Okita et al., Nature, 448, 313-317 (2007)) derived from transgenic mice in which the green fluorescent protein (GFP) gene and the puromycin resistance gene have been integrated into the Nanog locus. And so on.
  • MEF green fluorescent protein
  • the iPS cells established in this way can be used for various purposes.
  • the differentiation induction method reported for ES cells is used to induce differentiation of iPS cells into various cells (for example, cardiomyocytes, blood cells, nerve cells, vascular endothelial cells, insulin secretory cells, etc.). be able to. Therefore, if iPS cells are induced using somatic cells collected from the patient or another person with the same or substantially the same HLA type, the desired cells (that is, the organ in which the patient is affected) can be induced.
  • Stem cell therapy by autologous transplantation is possible, in which cells and cells that exert a therapeutic effect on diseases are differentiated and transplanted to the patient.
  • iPS cells differentiated from iPS cells are considered to more reflect the actual state of the functional cells in vivo than the corresponding existing cell lines, and thus are drug candidates. It can also be suitably used for in vitro screening of the medicinal effect and toxicity of a compound.
  • Method 1 Cell culture Primary culture of mouse embryo fibroblasts (MEFs) was performed according to a previously established method (Okita et al., 2007). MEFs were cultured in Dulbecco's modified Eagle's medium (DMEM, Nacalai Tesque) supplemented with 10% fetal bovine serum (FBS, Invitorogen) under 37 ° C. and 5% CO 2 conditions. DMEM was supplied with 0.5% penicillin and streptomycin (Invitorogen). Human skin fibroblasts (HDF) were cultured under similar conditions.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • HDF Human skin fibroblasts
  • MEF and HDF-derived iPS cells are supplemented with leukemia inhibitory factor (LIF), 15% FBS, 2 mM L-glutamine (Invitorogen), 0.1 mM non-essential amino acid (Invitorogen), 0.1 mM 2-mercaptoethanol (Invitorogen) and 0.5. Incubated in DMEM containing% penicillin and streptomycin.
  • LIF leukemia inhibitory factor
  • FBS FBS
  • Invitorogen 2 mM L-glutamine
  • Invitorogen 0.1 mM non-essential amino acid
  • 2-mercaptoethanol Invitorogen
  • Method 2 Preparation of mouse iPS cells iPS cells were established by a method in which some modifications were made to the previous description (Okita et al., 2007; Takahashi and Yamanaka, 2006). 1 ⁇ 10 5 MEFs of cells per well were seeded and cultured overnight. After 24 hours, four factors (Oct3 / 4, Sox2, Klf4 and c-Myc; sometimes abbreviated as “4F” herein) infect the retrovirus inserted in the Nanog-GFP cassette. Introduced 4F into the MEFs. After 24 hours, the cells were passaged once and seeded on a feeder layer of mitomycin C-treated SNL cells in 2.5 ⁇ 10 3 cells per dish. The next day, the medium was replaced with mouse iPS cell medium and then cultured for 30 days.
  • the feeder layer of SNL cells treated with mitomycin C to subculture the cells to 2.5 ⁇ 10 5 (4 factors) or 5 ⁇ 10 5 (3 factors). Sown on top. The next day, the medium was replaced with primate ES medium (ReproCELL, Japan) supplemented with 4 ng / mL human basic fibroblast growth factor (bFGF), and then cultured for 30 days.
  • primate ES medium ReproCELL, Japan
  • bFGF human basic fibroblast growth factor
  • Electroporation was performed 3 times (3 pulses) at 1650 V, 10 ms. Four days after transduction, the cells were trypsinized and reseeded at a cell density of 2 ⁇ 10 5 cells on a 100 mm dish covered with a feeder layer of mitomycin C treated SNL cells. The next day, the medium was replaced with bFGF-supplemented primate ES cell medium and then cultured for 30 days.
  • Alkaline phosphatase staining and immunocytochemistry Alkaline phosphatase (AP) staining was performed according to the protocol of the Alkaline Phosphatase Detection Kit (Sigma).
  • the cells were treated and fixed in PBS containing 4% paraformaldehyde at room temperature for 20 minutes. After washing with PBS, the cells are treated with blocking solution (PBS containing 5% normal goat serum (Millipore), 1% bovine serum albumin (BSA, Nacalai Tesque) and 0.2% Triton X-100) at room temperature for 45 minutes. did.
  • the primary antibody and dilution are as follows.
  • Anti-OCT4 antibody (1:50, Santa Cruz, sc-5279), anti-SOX2 antibody (1: 100, Abcam, ab75485) and anti-TRA1-60 antibody (1:50, Millipore, MAB4360).
  • Alexa Fluor 488-labeled anti-mouse IgG (1: 500, Invitrogen, A-11001) was used as the secondary antibody.
  • Hoechst 33342 (1 ⁇ g / mL, Invitrogen) was used for nuclear staining.
  • the primary antibodies used are as follows. Anti-Tuj1 antibody (1: 100, Chemicon: MAB1637), anti- ⁇ -smooth muscle actin antibody ( ⁇ -SMA, 1: 500, DAKO: M085101) and anti- ⁇ -fetoprotein antibody (1: 100, R & D: MAB1368). Alexa 488-labeled anti-mouse IgG (1: 500, Invitrogen: A-11001) was used as the secondary antibody.
  • Method 7 Microarray pretreatment and differential gene expression analysis Microarray slides were scanned using a monochromatic Agilet DNA microarray scanner and analyzed using the default parameters. Raw data was loaded into RStudio (R visual script) and gene expression data for reading, exploration and pretreatment was analyzed using the Bioconductor package Limma. Limma's workflow was used for differential gene expression analysis (DEG). The hierarchical cluster phylogenetic tree (Hierachical derived) was created using hclust in the stat package and agnes in the cluster package. Distance was calculated using the Manhattan city-block distance method, and k-means was calculated using the kmeans function.
  • the distance and correlation matrix was visualized using get_dist and fviz_dist included in the factoroextra package.
  • the cluster scatter plot was calculated using the fviz_cluster function.
  • Expression data for DEGs were clustered using an R script to create Heatmaps.
  • Statistical analysis of gene ontology and gene cluster was performed using DOSE and clusterProfiler package.
  • the microarray data acquired in the present application can be used as accession number GSE56167 in Gene Expression Omnibus.
  • Method 9 Teratoma-forming iPS cells were collected using a CTK solution and seeded on a 60 mm dish. After culturing to confluence, cells were harvested and injected into the testis of non-obese diabetic / severe combined immunodeficiency (NOD-SCID) mice (CREA, Japan). Three months after injection, the resulting tumor was incised and fixed with 4% paraformaldehyde in PBS. Sliced sections from paraffin-embedded tissue were stained with hematoxylin and eosin.
  • NOD-SCID non-obese diabetic / severe combined immunodeficiency mice
  • iPSCs were prepared from MEFs according to the promoting effect of p38 inhibition on the reprogramming of mouse embryo fibroblasts (MEF) [Method 2].
  • 7 compounds known to promote the initialization efficiency of DMSO (vehicle, negative control), p38 selective inhibitor (SB202190, Calbiochem, 10 ⁇ M), or MEF 24 hours after the introduction of 4F by retrovirus. was added to the medium and replaced with a medium containing no of them after 98 hours.
  • the seven compounds and their treatment concentrations are as follows; Vitamin C (Sigma, 10 ⁇ g / mL), Valproic acid (Sigma, 1.9 mM), CHIR99021 (Calbiochem, 3 ⁇ M), PD0325901 (Calbiochem, 0.5 ⁇ M), Interleukin-6 (R & D, 0.2 ng / mL), AS601245 (Calbiochem, 5 ⁇ M), Rapamycin (Sigma, 1 ⁇ M).
  • Vitamin C Sigma, 10 ⁇ g / mL
  • Valproic acid Sigma, 1.9 mM
  • CHIR99021 Calbiochem, 3 ⁇ M
  • PD0325901 Calbiochem, 0.5 ⁇ M
  • Interleukin-6 R & D, 0.2 ng / mL
  • AS601245 Calbiochem, 5 ⁇ M
  • Rapamycin Rapamycin
  • the number of GFP-positive colonies was measured 21 days (Day 21) and 28 days (Day 28) after the introduction of 4F, and the initialization efficiency was calculated by comparing with the number of GFP-positive colonies of the 4F introduction negative control. At that time, correction was performed based on the number of GFP-positive colonies obtained by infecting the retrovirus (4F + DsRed) into which the 4F and DsRed genes were inserted (correction based on virus infection efficiency). The results are shown in FIG. 1A. The same correction was made in the subsequent analysis of initialization efficiency, but the explanation is omitted. As shown in FIG.
  • MEFs treated with a p38 selective inhibitor yielded nearly twice as many GFP-positive colonies as DMSO-treated MEFs on both Day 21 and Day 28.
  • the number of GFP-positive colonies is almost the same as the number of GFP-positive colonies obtained by treatment with the most effective antioxidant (VC, vitamin C) and GSK3 ⁇ inhibitor (CH, CHIR99021) among the seven known compounds. It was equivalent.
  • DMSO or SB202190 was added to the medium during the four periods shown in FIG. 1B (A: Days 1 to 4, B: Days 1 to 8, C: Days 8 to 16, D: Days 1 to 16) to form Day 21.
  • the number of GFP-positive colonies was counted on Day 28.
  • FIG. 1C As shown in FIG. 1C, in the experimental group treated with SB202190 in the initial phase (period A), the number of GFP-positive colonies on Day 21 and Day 28 was significantly increased as compared with the control (DMSO treatment during the same period). As shown in FIG.
  • the efficiency calculation method was in accordance with the MEF initialization efficiency calculation method described in 1) above.
  • the results of the experimental group treated with the inhibitor during the period A or D are shown in FIG. 2B.
  • the number of GFP-positive colonies on Day 24 and Day 32 was significantly and significantly higher than that in the control (DMSO treated) experimental group when any of the above three types of inhibitors was used.
  • Fig. 2B left bar graph
  • the number of GFP-positive colonies tended to be significantly higher than that of the control, regardless of the type of the inhibitor (FIG. 2B, right bar graph).
  • SB202190 or SB203580 was added over the entire phase (period D)
  • the number of GFP-positive colonies on Day32 increased more than twice as much as when added only in the initial phase. ..
  • Human iPSCs obtained by treatment with SB202190 maintained ESC-like morphology even after 30 subcultures from Day32 (Fig. 2C) and expressed alkaline phosphatase, which is an ESC-specific marker (Fig. 2C).
  • 2D [Method 5]
  • Fig. 2E [Method 5]
  • SB1 to SB3 Differentiation ability of human iPSC obtained by inhibiting p38
  • the differentiation ability of human iPSC obtained by inhibiting p38 in the initialization step was analyzed.
  • Three clones (SB1 to SB3) were established from HDF-derived iPSCs obtained by treatment with SB202190, and the expression levels of SOX2, OCT4, and NANOG, which are indicators of pluripotency, were analyzed for the clones (Fig. 3A). As shown in FIG. 3A, SB1 to SB3 are comparable to human iPSCs (DM, B7) and ES cells (ES) obtained by reprogramming without inhibiting p38, or to the same extent as HDF (HD).
  • teratoma species were formed from all the analyzed clones and differentiated into three germ layers containing neuroepithelium, cartilage, and various glandular structures. It was confirmed (Fig. 3D). Therefore, it was shown that the human iPSC obtained by inhibiting p38 in the initialization step has the ability to differentiate into three germ layers both in vitro and in vivo.
  • human iPSC obtained by inhibiting p38 in the initialization step is comparable to human iPS cells and ES cells obtained without p38 inhibition, has normal karyotype, and differentiates into three germ layers. It was confirmed that it had the ability.
  • PCA principal component analysis
  • 340 genes 31 were classified as having transcription factor or DNA binding activity (Fig. 5D).
  • tyrosine kinase activity / membrane receptor type kinase activity / membrane receptor type tyrosine kinase activity tyrosine kinase activity / membrane receptor type kinase activity / membrane receptor type tyrosine kinase activity, collagen binding / collagen receptor activity, oligoglycosyltransferase activity, etc. were hit as the main GO terms. (Fig. 5E).
  • TEAD3 as a gene that functions as a strong barrier for somatic cell reprogramming from among the 31 genes. rice field.
  • the relationship between the effect of p53 and / or p38 inhibition on the initialization of HDF by 4F and the expression of endogenous TEAD3 was investigated.
  • the expression of TEAD3 was significantly reduced when p53 or p38 was inhibited alone as compared with the case of 4F introduction alone (vehicle (DMSO) treatment), but when p53 and p38 were double-inhibited, TEAD3 was observed. Expression was further significantly reduced (FIG. 6A).
  • GSE36664 dataset containing MEF transcriptome data (see J Biol Chem 2012 Oct 19; 287 (43): 35825-37.), GSE45276 dataset containing human lung fibroblast transcriptome data (MolCell 2011 Apr) 8; 42 (1): 36-49.)
  • TEAD3 and p53 expression using the HDF transcriptome dataset showed a positive correlation in all cells (Fig. 9). ), It is suggested that p53 positively regulates the expression of TEAD3, which is an initialization barrier.
  • the HDF introduced with shRNA for 4F and TEAD3 had a faster initialization rate than the HDF introduced with only 4F (4F + non-specific shRNA) (Figs. 13A and B). This could be partially explained by the faster cell proliferation in the early phase of reprogramming (FIGS. 13C and E). However, once pluripotency was acquired, the human iPSC obtained by introducing only 4F and the human iPSC obtained by further introducing shRNA for TEAD3 proliferated at a similar rate (FIGS. 13D and F). It was suggested that iPSC clones induced by TEAD3 inhibition by restoration of cell cycle checkpoints are safe.
  • TEAD3 expression was downregulated for pluripotency acquisition only in SSEA1-positive MEF reprogramming intermediates (Fig. 6G). This indicates that only cells that have successfully committed to reprogramming require downregulation of TEAD3 to overcome the cellular mechanism that attempts to block reprogramming.
  • the present inventors searched for a regulatory mechanism of TEAD3 expression.
  • TEAD3 mRNA sequence the sequence of the promoter region 5'upstream from the genomic DNA information was obtained, and the known transcription initiation site (TSS) sequence was used as a query to perform Blast on the promoter sequence.
  • TSS transcription initiation site
  • TEAD3 functions as a strong barrier that inhibits the reprogramming of human cells, and that the reprogramming efficiency of the cells is promoted by inhibiting the expression or activity thereof.
  • the iPS cell establishment efficiency can be significantly improved as much as the double inhibition of the p38 pathway and the p53 pathway. Since the method according to the present invention is effective for initialization by various methods, it is extremely useful in terms of both safety and cost for application of human iPS cells to regenerative medicine.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne les éléments suivants : un procédé permettant d'améliorer l'efficacité de l'établissement de cellules iPS et comprenant, dans une étape de reprogrammation nucléaire de cellules somatiques, l'inhibition de la fonction du membre 3 de la famille du facteur d'amplification de la transcription (TEAD3) ; et un procédé permettant de produire des cellules iPS et comprenant la mise en contact de cellules somatiques avec des substances de reprogrammation nucléaire et une substance permettant d'inhiber la fonction de TEAD3.
PCT/JP2021/022154 2020-06-11 2021-06-10 Méthode efficace de production de cellules souches pluripotentes induites WO2021251466A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2022530622A JPWO2021251466A1 (fr) 2020-06-11 2021-06-10

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2020-101932 2020-06-11
JP2020101932 2020-06-11

Publications (1)

Publication Number Publication Date
WO2021251466A1 true WO2021251466A1 (fr) 2021-12-16

Family

ID=78846108

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2021/022154 WO2021251466A1 (fr) 2020-06-11 2021-06-10 Méthode efficace de production de cellules souches pluripotentes induites

Country Status (2)

Country Link
JP (1) JPWO2021251466A1 (fr)
WO (1) WO2021251466A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116515742A (zh) * 2023-07-04 2023-08-01 夏同生物科技(苏州)有限公司 将人体细胞重编程为诱导性多能干细胞的方法
WO2024212336A1 (fr) * 2023-04-14 2024-10-17 臻赫医药(杭州)有限公司 Système d'expression anti-vieillissement pour facteur de reprogrammation, matériel biologique et utilisation

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014097875A1 (fr) * 2012-12-20 2014-06-26 国立大学法人鳥取大学 Développement de cellules souches pluripotentes à l'aide d'un nouveau procédé d'induction d'une dédifférenciation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014097875A1 (fr) * 2012-12-20 2014-06-26 国立大学法人鳥取大学 Développement de cellules souches pluripotentes à l'aide d'un nouveau procédé d'induction d'une dédifférenciation

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HAN ZHENBO, YU YING, CAI BENZHI, XU ZIHANG, BAO ZHENGYI, ZHANG YING, BAMBA DJIBRIL, MA WENYA, GAO XINLU, YUAN YE, ZHANG LAI, YU ME: "YAP/TEAD3 signal mediates cardiac lineage commitment of human‐induced pluripotent stem cells", JOURNAL OF CELLULAR PHYSIOLOGY, WILEY SUBSCRIPTION SERVICES, INC., US, vol. 235, no. 3, 1 March 2020 (2020-03-01), US , pages 2753 - 2760, XP055885345, ISSN: 0021-9541, DOI: 10.1002/jcp.29179 *
IAN LIAN, KIM JOUNGMOK, OKAZAWA HIDEKI, ZHAO JIAGANG, ZHAO BIN, YU JINDAN, CHINNAIYAN ARUL, ISRAEL MASON A, GOLDSTEIN LAWRENCE S B: "The role of YAP transcription coactivator in regulating stem cell self-renewal and differentiation", GENES & DEVELOPMENT, COLD SPRING HARBOR LABORATORY PRESS, 1 June 2010 (2010-06-01), pages 1106 - 1118, XP055240649, Retrieved from the Internet <URL:http://genesdev.cshlp.org/content/24/11/1106.full.pdf> [retrieved on 20160112], DOI: 10.1101/gad.1903310 *
TAMM CHRISTOFFER, BÖWER NATHALIE, ANNERÉN CECILIA: "Regulation of mouse embryonic stem cell self-renewal by a Yes–YAP–TEAD2 signaling pathway downstream of LIF", JOURNAL OF CELL SCIENCE, COMPANY OF BIOLOGISTS LIMITED, CAMBRIDGE, vol. 124, no. 7, 1 April 2011 (2011-04-01), Cambridge , pages 1136 - 1144, XP055885341, ISSN: 0021-9533, DOI: 10.1242/jcs.075796 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024212336A1 (fr) * 2023-04-14 2024-10-17 臻赫医药(杭州)有限公司 Système d'expression anti-vieillissement pour facteur de reprogrammation, matériel biologique et utilisation
CN116515742A (zh) * 2023-07-04 2023-08-01 夏同生物科技(苏州)有限公司 将人体细胞重编程为诱导性多能干细胞的方法
CN116515742B (zh) * 2023-07-04 2023-09-01 夏同生物科技(苏州)有限公司 将人体细胞重编程为诱导性多能干细胞的方法

Also Published As

Publication number Publication date
JPWO2021251466A1 (fr) 2021-12-16

Similar Documents

Publication Publication Date Title
US12012615B2 (en) Method of making induced pluripotent stem cells using p53 inhibitors
KR101774206B1 (ko) 유도된 다능성 줄기 세포의 효율적인 확립 방법
JP5794588B2 (ja) 効率的な人工多能性幹細胞の樹立方法
JP5553178B2 (ja) 効率的な人工多能性幹細胞の樹立方法
EP2853592B1 (fr) Procédé à haute efficacité pour l&#39;établissement de cellule souche pluripotente artificielle
US20110189137A1 (en) Method for generation and regulation of ips cells and compositions thereof
AU2013274197A1 (en) Methods of preparing pluripotent stem cells
WO2021251466A1 (fr) Méthode efficace de production de cellules souches pluripotentes induites
JP5804280B2 (ja) 多能性幹細胞からの肥満細胞の製造方法
JP5682043B2 (ja) 安全な多能性幹細胞の選択方法
JP6676260B2 (ja) 効率的な人工多能性幹細胞の樹立方法
WO2012151309A1 (fr) Méthodes permettant de réguler la génération de cellules souches pluripotentes induites et compositions associées
WO2011007847A1 (fr) Procédé pour induire une différenciation des cellules nerveuses à partir de cellules souches pluripotentes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21821034

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022530622

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21821034

Country of ref document: EP

Kind code of ref document: A1