WO2021251466A1

WO2021251466A1 - Efficient method for producing induced pluripotent stem cells

Info

Publication number: WO2021251466A1
Application number: PCT/JP2021/022154
Authority: WO
Inventors: 善紀吉田; カカセアントニオルセナ
Original assignee: 国立大学法人京都大学
Priority date: 2020-06-11
Filing date: 2021-06-10
Publication date: 2021-12-16
Also published as: JPWO2021251466A1

Abstract

The present invention provides: a method that is for improving establishing efficiency of iPS cells and that includes, in a nuclear reprogramming step for somatic cells, inhibiting the function of transcription enhancer factor domain family member-3 (TEAD3); and a method that is for producing iPS cells and that includes bringing somatic cells into contact with nuclear reprogramming substances and a substance for inhibiting the function of TEAD3.

Description

Efficient method for producing induced pluripotent stem cells

The present invention relates to the efficiency of establishment of induced pluripotent stem (iPS) cells by inhibiting the function of transcription enhancer-related domain family member-3 (hereinafter, also referred to as "TEAD3") in the nuclear reprogramming step of somatic cells. And an agent for improving the efficiency of establishment of iPS cells, which comprises a function inhibitor of TEAD3. The present invention also relates to a method for producing iPS cells by introducing a nuclear reprogramming substance and a function inhibitor of TEAD3 into somatic cells.

Somatic cell reprogramming driven by nuclear reprogramming factors such as the Yamanaka factor (Oct3 / 4, Sox2, Klf4 (and c-Myc)) reprograms cells and dedifferentiates them to iPS cells. We must overcome a group of powerful transcription factors that protect their uniqueness as somatic cells. Numerous studies have focused on identifying key factors that play a role in reprogramming barriers to improve iPS cell establishment efficiency. Nevertheless, initialization is still an inefficient process.

The somatic cell reprogramming process can be broadly divided into initiation, stabilization and maturation stages, coupled with the execution of multiple biological programs involving major changes in the transcriptional network. It is widely known that p53 acts as an important barrier to initialization. In fact, it has been found that in mouse and human fibroblasts, downregulation of p53 significantly increases the number of iPS colonies (see, for example, Patent Document 1 and Non-Patent Document 1). However, some point out that downregulation of the p53 pathway causes genomic instability and safety issues, as p53 acts as a defense against uncontrolled cell proliferation in response to DNA damage. Transient p53 suppression with non-integrated plasmids provides a safer way to improve iPS cell establishment efficiency (see, eg, Non-Patent Document 2).

The present inventors have previously reported that the efficiency of iPS cell establishment can be improved by inhibiting the function of p38 in the nuclear reprogramming step of somatic cells (Patent Document 2). However, the mechanism is not yet well understood.

International Publication No. 2009/157593 International Publication No. 2012/036299

An object of the present invention is to identify a novel key factor that serves as a somatic cell reprogramming barrier, invalidate the reprogramming barrier by controlling the factor, and improve the efficiency of iPS cell establishment.

The present inventors systematically investigated the role of p38 MAPK inhibitors in order to achieve the above-mentioned objectives, and p38 inhibition dramatically improved the efficiency of human iPS cell establishment at both the initiation stage and the stabilization stage of reprogramming. It was found that it could be improved.
We also found that double inhibition of both the p38 and p53 pathways during the initialization process further increased the efficiency of iPS colony formation compared to inhibition of each pathway alone. Then, from among the genes whose expression is significantly down-regulated when double-inhibited, TEAD3 was found as a gene capable of exerting the same effect of improving iPS cell establishment efficiency as in the case of double-inhibition by suppressing the expression. The invention was completed.

That is, the present invention is as follows.
[1] A method for improving the establishment efficiency of induced pluripotent stem (iPS) cells, which comprises inhibiting the function of transcription enhancer-related domain family member-3 (TEAD3) in the nuclear reprogramming process of somatic cells. Method.
[2] The following (a) to (c):
(A) Nucleic acid or precursor having RNAi activity against the transcript of the TEAD3 gene;
(B) Antisense nucleic acid for the transcript of the TEAD3 gene; and (c) Inhibits the function of TEAD3 by introducing one of the ribozyme nucleic acids for the transcript of the TEAD3 gene into somatic cells, according to [1]. the method of.
[3] The method according to [1], wherein the function of TEAD3 is inhibited by introducing a dominant negative mutant of TEAD3 or a nucleic acid encoding the same into a somatic cell.
[4] The method according to [1], wherein the function of TEAD3 is inhibited by inhibiting the transcriptional conjugate factor of TEAD3 in somatic cells.
[5] The following (a) or (b):
(A) Decoy nucleic acid for TEAD3;
(B) rrrcwwgyyynnnnnnnnnnnnnrrrcwwgyyy (r stands for a or g, w stands for a or t, y stands for c or t, and n stands independently for a, g, t or c; SEQ ID NO: 3) The method according to [1], wherein the function of TEAD3 is inhibited by introducing an oligonucleic acid containing a nucleotide sequence represented by (1) into a somatic cell.
[6] An iPS cell establishment efficiency improving agent containing a TEAD3 function inhibitor.
[7] The inhibitor is the following (a) to (c):
(A) Nucleic acid or precursor having RNAi activity against the transcript of the TEAD3 gene;
The agent according to [6], which is either (b) an antisense nucleic acid for a transcript of the TEAD3 gene; or (c) a ribozyme nucleic acid for a transcript of the TEAD3 gene.
[8] The agent according to [6], wherein the inhibitor is a dominant negative mutant of TEAD3 or a nucleic acid encoding the same.
[9] The agent according to [6], wherein the inhibitor is an inhibitor of a transcriptional conjugate factor of TEAD3.
[10] The inhibitor is the lower (a) or (b):
(A) Decoy nucleic acid for TEAD3;
(B) rrrcwwgyyynnnnnnnnnnnnnrrrcwwgyyy (r stands for a or g, w stands for a or t, y stands for c or t, and n stands independently for a, g, t or c; SEQ ID NO: 3) The agent according to [6], which is an oligonucleic acid containing a nucleotide sequence represented by.
[11] A method for producing iPS cells, which comprises contacting somatic cells with a nuclear reprogramming substance and a function inhibitor of TEAD3.
[12] The inhibitor is the following (a) to (c):
(A) Nucleic acid or precursor having RNAi activity against the transcript of the TEAD3 gene;
The method according to [11], wherein (b) an antisense nucleic acid for a transcript of the TEAD3 gene; and (c) a ribozyme nucleic acid for a transcript of the TEAD3 gene.
[13] The method according to [11], wherein the inhibitor is a dominant negative mutant of TEAD3 or a nucleic acid encoding the same.
[14] The method according to [11], wherein the inhibitor is an inhibitor of a transcriptional conjugate factor of TEAD3.
[15] The inhibitor is the lower (a) or (b):
(A) Decoy nucleic acid for TEAD3;
(B) rrrcwwgyyynnnnnnnnnnnnnrrrcwwgyyy (r stands for a or g, w stands for a or t, y stands for c or t, and n stands independently for a, g, t or c; SEQ ID NO: 3) The method according to [11], which is an oligonucleic acid containing a nucleotide sequence represented by.
[16] The method according to any one of [11] to [15], wherein the nuclear reprogramming substance is Oct3 / 4, Klf4 and Sox2, or nucleic acids encoding them.
[17] Any of [11] to [15], wherein the nuclear reprogramming substance is Oct3 / 4, Klf4, Sox2, and c-Myc, L-Myc or N-Myc, or a nucleic acid encoding them. The method described in Crab.

According to the present invention, the efficiency of establishing iPS cells from somatic cells can be significantly improved.

It is a figure which shows the effect of a small molecule p38 inhibitor on the establishment of mouse iPS cells. A. Seven compounds (VC-10 μg / mL; VA-1.9 mM; CH-3 μM; PD-0.5 μM; IL-0.2 ng / mL; AS- An iPS cell colonization assay was performed to investigate the effect of the p38 inhibitor (SB202190; 10 μM) on 5 μM; RA-1 μM). The primary ectopic expression of the four factors (4F; Oct3 / 4, Sox2, Klf4 and c-Myc) inserted into the vector with the Nanog-GFP cassette as the ultimate effector, a pluripotent reporter. The induction of reprogramming was individually assayed for MEF. ^{In order to evaluate the initialization efficiency of each compound by single agent treatment, the number of GFP-positive (GFP +} ) colonies was measured after 21 days (Day21) (left bar) and 28 days (Day28) (right bar). It was compared with the number of GFP-positive colonies in the 4F-introduced negative control (DM). B. The four (A to D) SB202190 processing protocols are schematically shown. On the time axis, the day when the four factors are introduced into MEF is set as Day 0, and the period during which each treatment is applied is shown (A: Day1 to 4, B: Day1 to 8, C: Day8 to 16, D: Day1 to 16). ). C. The reprogramming efficiency of each treatment was investigated on Day 21 and Day 28, and the number of iPS cell colonies induced by 4F and p38 inhibitor (SB202190) (lower bar) was treated with vehicle (DMSO) and induced only by 4F. Compared to the number of iPS cell colonies (bar above). D. Fall plot showing the difference in ^{GFP +} colony count between Day 21 and Day 28 for the SB202190 treated experimental group during period A. E. A fall plot showing the difference in the number ^{of GFP +} colonies on Day 21 and Day 28 between the SB202190 treated experimental group during period A and the SB202190 treated experimental group during period D. It is a figure which shows the effect of a small molecule p38 inhibitor on the establishment of human iPS cells. A. The protocols for four p38 inhibitor treatments (periods A to D) are schematically shown. On the time axis, the day when the four factors are introduced into HDF is set as Day 0, and the period during which each treatment is applied is shown (A: Days 2 to 4, B: Days 6 to 20, C: Days 20 to 32, D: Days 6 to 32). ). B. The iPS cell colonization assay was used to investigate the effect of p38 inhibitors on the efficiency of HDF reprogramming. Primary HDF ectopically expressed with 4 factors (4F; Oct3 / 4, Sox2, Klf4 and c-Myc) was treated with 10 μM SB202190, SB203580 or SB239063 in period A or period D protocols. Reprogramming efficiency on Day16, Day24, and Day32 was counted as the number of ES cell-like (iPS cell) colonies and compared to HDF (DMSO) reprogrammed only on 4F without treatment with a p38 inhibitor. The graph on the left shows the result of the inhibitor treatment in the period A, and the graph on the right shows the result of the inhibitor treatment in the period D. The results of SB239063, SB203580, SB202190, and DMSO processing are shown in order from the top for each number of days. ^* P <0.05, ^** p <0.01 C. 4F + SB202190 shows a phase-difference image of human ES cell-like colonies derived from HDF. D. Alkaline phosphatase staining assay in iPS cells derived from HDF by 4F only (DMSO) or 4F + SB202190 (SB202190). E. Representative immunohistochemical staining images of pluripotent markers (OCT4, SOX2 and TRA-1-60) in iPS cell colonies derived from HDF by 4F + SB202190 (right panel). The left panel shows nuclear staining with DAPI. Scale bar: 100 μm F. The iPS cell colonization assay was used to investigate the effect of the p38 inhibitor (SB202190) on the efficiency of HDF reprogramming by introducing three factors (3F; Oct3 / 4, Sox2 and Klf4). The initialization efficiency on Day24 (bottom) and Day32 (top) was measured as the number of ES cell-like (iPS cell) colonies, and the number of iPS cell colonies induced from HDF by 3F + SB202190 (upper bar in each Days). ) Was compared to the number of iPS cell colonies induced by 3F and vehicle (DMSO) (bottom bar at each Days). ^* P <0.05G. The iPS cell colonization assay was used to investigate the effect of the p38 inhibitor (SB202190) on the efficiency of HDF reprogramming by the introduction of reprogramming factors via the episomal vector (pCXLE). The reprogramming efficiency on Day24 (bottom) and Day32 (top) was measured as the number of ES cell-like (iPS cell) colonies, and the number of iPS cell colonies induced from HDF by the reprogramming factor + SB202190 (top on each Day). Bar) was compared to the number of iPS cell colonies induced by reprogramming factors and vehicle (DMSO) (lower bar on each day). ^* P <0.05, ^*** p <0.001 It is a figure which shows pluripotency and genomic stability in human iPS cells established using a small molecule p38 inhibitor. A. QRT-PCR analysis of pluripotent genes (OCT4, SOX2, NANOG) expression, which is an indicator of somatic cell reprogramming. It is shown as a relative value with the expression level in ES cells as 1. SB1-SB3: Human iPS cell clones induced by SB202190 treatment; DM, B7: Human iPS cell clones induced only by 4F; ES: Human ES cells; HD: HDF. B. Karyotype analysis of human iPSC clones induced by SB202190 treatment. C. In vitro differentiation assay of human iPSC clones induced by SB202190 treatment. From left to right, differentiation into embryoid body (EB), ectoderm lineage (β-III-tubulin positive), mesoderm lineage (α-SMA positive) and endoderm lineage (AFP positive) is shown. Nuclei were stained with Hoechst 33342. Scale bar: 100 μm D. Teratoma formation assay of human iPSC clones induced by SB202190 treatment. The figure on the left is a schematic diagram of the trigerm (ectoderm, mesoderm, and endoderm) series. The stained photographs show the differentiation into the ectoderm lineage, the mesoderm lineage, and the endoderm lineage in order from the left. E. Left: Number of iPS cell colonies induced by 4F introduction and p38 inhibitor (SB202190) treatment from HDFs from 4 different donors (HDF1616, HDF1079, HDF1078 and Tig109) (upper bar for each HDF) And the number of iPS cell colonies induced by 4F introduction and vehicle (DMSO) treatment (bottom bar for each HDF) were compared by iPS cell colonization assay. Right figure: Statistical analysis of iPS cell colonization efficiency based on results from 4 donors (by t-test; ^* p <0.05). It is a figure which shows the result of the transcriptome analysis in the human iPS cell established by p38 and / or p53 inhibition. A. Comparison of p53 mRNA levels in HDF (DMSO) initialized with 4F only and clone (shp53) initialized with p53 shRNA introduced with 4F. The former expression level is shown as a relative value of 1. ^*** p <0.001B. The number of iPS cell colonies induced by 4F introduction and p53 inhibition (shp53) and / or p38 inhibition (SB202190) from HDF, and the number of iPS cell colonies induced by 4F introduction and vehicle treatment (DMSO). Was compared by the iPS cell colonization assay. ^** p <0.01, ^*** p <0.001 C. Principal component analysis (PCA) that correlates with increased iPSC colony numbers (△) for over 58,000 genes expressed in the four groups. D. Above: Aggregate hierarchical clustering of samples. For the distance between the samples, the Manhattan distance was applied and a tree diagram was created using the agnes function. Below: Sample correlation matrix showing transcriptome differences obtained by consensus clustering of mRNA data. E. Scatter plot of clustering results using k-means algorithm. F. Heat map for expression variation gene (DEG) analysis. 1147 DEG (left) between clusters A and C and 2185 DEG (right) between clusters A and B are shown. It is a figure which shows the search result of the gene group which the expression level decreases specifically when both the p38 pathway and the p53 pathway are inhibited. A. A gene (DEG) whose expression level was reduced in iPS cells compared to HDF when p53 was inhibited alone (shp53) and when p53 and p38 were double-inhibited (shp53 + SB202190) with the introduction of 4F. Was extracted and compared. We found 651 DEGs whose expression levels were reduced only when double-inhibited (top). Of these, 149 were able to be expressed more than twice as much (bottom). B. A gene (DEG) whose expression level was reduced in iPS cells compared to HDF when p38 was inhibited alone (SB202190) and when p53 and p38 were double inhibited (shp53 + SB202190) with the introduction of 4F. ) Was extracted and compared. 1056 DSNs with reduced expression were found only when double-inhibited (top). Of these, 145 were able to have their expression levels more than doubled (bottom). C. Overlapping between the 651 gene, whose expression was reduced only by p53 / p38 double inhibition compared to p53 single inhibition, and the 1056 gene, whose expression was reduced only by p53 / p38 double inhibition compared to p38 single inhibition. Examined. Duplication of 340 genes was observed. D. Thirty-one of the 340 genes extracted in C were classified as having transcription factor or DNA binding activity. E. Analysis of prominent GO terms for the biological process of DEG, which was commonly reduced in expression with p53 / p38 double inhibition. It is a figure which shows the effect of TEAD3 inhibition on the establishment of human iPS cells, and the transcriptional regulation of TEAD3 gene by Klf4. A. When 4F is introduced into HDF (DMSO), or when p38 is inhibited alone (p382KO) with the introduction of 4F, when p53 is inhibited alone (shp53), and when p53 and p38 are double inhibited. The relative expression level of TEAD3 in (shp53 + p382KO) is shown. +100 on the X-axis indicates the expression level of DMSO, and -100 on the X-axis indicates no expression. For example, -75 on the X-axis shows 0.125 times the expression level of DMSO. The dashed arrow indicates that the number of iPS cell colonies increases in that direction. B. 4F only (4F), 4F and non-specific shRNA (Scr), 4F and 2 types of TEAD3 shRNA (4F-

shTEAD3 #

1 and 4F-shTEAD3 # 2) were introduced into 2 types of HDF (HDF1616, HDF1079). The expression of the TEAD3 protein in the case is shown. In both HDFs, the expression of TEAD3 protein was markedly suppressed by the two TEAD3 shRNAs. C. 4F only (4F), 4F and non-specific shRNA (Scr), 4F and 2 types of TEAD3 shRNA (4F-

shTEAD3 #

1 and 4F-shTEAD3 # 2) were introduced into 2 types of HDF (HDF1616, HDF1079). The expression of TEAD3 mRNA in the case is shown. In both HDFs, the expression of TEAD3 mRNA was markedly suppressed by the two TEAD3 shRNAs. ^** p <0.01, ^*** p <0.001D. 4F only (4F), 4F and non-specific shRNA (Scr), 4F and 2 types of TEAD3 shRNA (4F-

shTEAD3 #

1 and 4F-shTEAD3 # 2) were introduced into 2 types of HDF (HDF1616, HDF1079). The number of iPS cell colonies obtained in the case is shown. ^* P <0.05, ^** p <0.01 E. Obtained iPS cells when 4F only (4F), 4F and non-specific shRNA (Scr), 4F and 2 types of TEAD3 shRNA (4F-

sh #

1 and 4F-sh # 2) were introduced into HDF. An alkaline phosphatase-stained image of the colony (left: entire dish; right: enlarged photograph) is shown. F. Changes in TEAD3 expression in the early phase (day 2 and day 4), intermediate phase (day 8), late phase (day 18) and iPSC during the MEF initialization process are shown. G. Changes in TEAD3 expression in SSEA1-positive and SSEA1-negative cells during the MEF reprogramming process are shown. H. The transcription initiation site (TSS) sequence of the TEAD3 gene, which is predicted to bind to KLF4, and its relative binding score are shown. I. The prediction of the binding consensus sequence of KLF4 by the analysis of the binding cis-element sequence of the target gene cluster known to bind to KLF4 is shown. A. The cell number of mouse iPS cells (20D17; initial cell density: 1 × 10 ⁵ cells / well) 96 hours after treatment with SB202190 is shown ( ^** : p <0.01; comparison with DMSO). B. It is shown that mouse iPS cells obtained by treatment with SB202190 give rise to a brown coat-colored chimeric mouse. C. It is shown that germline transmission occurred in mice derived from mouse iPS cells obtained by treatment with SB202190. It is shown that p38 inhibition promotes the proliferation of HDF and HDF in the early phase of reprogramming, but does not affect the proliferation of human iPS cells. A. HDF was seeded in 6-well plates at a density of 1 × 10 ⁵ cells / well, each of which was added with 3 p38 inhibitors and cultured for 96 hours. Total cell counts were counted on

days

2, 4, 6 and 8 after treatment. The results of three independent experiments are shown in mean and standard deviation ( ^* : p <0.05; comparison with DMSO). B. HDF introduced with 4F was cultured for 96 hours with the addition of each of the three p38 inhibitors. Total cell counts were counted on

days

2, 4, 6 and 8 after treatment. The results of three independent experiments are shown in mean and standard deviation ( ^* : p <0.05; comparison with DMSO). C. Human iPS cells (201B7) were ^{seeded on SNL feeder cells at a density of 2 × 10 5} cells / well, and each of the three p38 inhibitors was added and cultured for 96 hours. The total number of cells was counted on the 4th day after the treatment. The results of three independent experiments are shown in mean and standard deviation. TEAD3 in publicly available datasets: GSE36664 with MEF transcriptome data, GSE45276 with human lung fibroblast (HLF) transcriptome data, and HDF transcriptome data. The correlation between expression and p53 expression is shown (R: Pearson's correlation coefficient). The correlation between TEAD3 expression and p38δ, ERK4, p44-ERK1, CDK4 and CDK6 expression in the publicly available HDF single-cell RNA-Seq dataset is shown (R: Pearson's correlation coefficient). It is a figure which shows the evaluation of the causal role of TEAD3 in tumor reprogramming and cell cycle kinetics in HeLa cells. First, a daughter cell line (plenti / Ubc-Slc7a1) expressing the ecotropic receptor Slc7a1 was prepared to enable retrovirus infection, and shTEAD3 was introduced by the retrovirus. Since clones with downregulated TEAD3 expression promoted cell proliferation and produced more tumor-like masses of larger size, TEAD3 increased the cellular properties that give rise to cancer in cervical cancer. It was suggested to play a causal role in ^{proliferation (*} : p <0.05, ^** : p <0.01; comparison with Scr (HeLa cells introduced with non-specific shRNA)). The TEAD3 expression analysis in the human cervical cancer data set GSE6791 (see Cancer Res 2007 May 15; 67 (10): 4605-19.) Is shown. Left: Corrected TEAD3 mRNA levels in normal (N) and cancer (T) tissue samples are shown in a boxplot. Right: Patients in the GSE691 data shown in the boxplot were individually classified according to increased TEAD3 expression levels. A. A representative bright-field image of estimated iPS cell colonies (squares) 12 days after introduction of 4F (scr) or 4F + shTEAD3 into HDF1616 is shown. B. A representative bright-field image of the estimated iPS cell colonies (squares) 12 days after the introduction of 4F + shTEAD3 into HDF1079 is shown. C. 4F (Scr), 4F + shTEAD3, or 4F + shTEAD3 + shp53 introduced and shows the growth curve of HDF1616 in the process of initialization ( ^* : p <0.05; comparison with Scr (HDF1616 introduced with 4F + non-specific shRNA)) ). D. The growth curve of iPS cells established by introducing 4F (Scr), 4F + shTEAD3, or 4F + shTEAD3 + shp53 into HDF1616 is shown). E. 4F (Scr), 4F + shTEAD3, or 4F + shTEAD3 + shp53 introduced and shows the growth curve of HDF1079 in the process of initialization ( ^** : p <0.01; HDF1079 introduced with 4F + non-specific shRNA). Comparison). F. The growth curve of iPS cells established by introducing 4F (Scr), 4F + shTEAD3, or 4F + shTEAD3 + shp53 into HDF1079 is shown.

The present invention provides a method for improving the efficiency of establishment of iPS cells (hereinafter, also referred to as "the method for improving the present invention") by inhibiting the function of TEAD3 in the nuclear reprogramming step of somatic cells. The means for inhibiting the function of TEAD3 is not particularly limited, but a method for introducing a function-inhibiting substance for TEAD3 into somatic cells is preferable. Therefore, the present invention also provides an agent for improving the efficiency of establishment of iPS cells (hereinafter, also referred to as “the agent of the present invention”) containing a function inhibitor of TEAD3. Further, the present invention is a method for producing iPS cells by introducing a nuclear reprogramming substance and a function inhibitor of TEAD3 into somatic cells (hereinafter, also referred to as "the production method of the present invention", and "the improvement method of the present invention". And "the method of the present invention" are collectively referred to as "the method of the present invention").

(A) Somatic cell source The somatic cells that can be used as a starting material for iPS cell production in the present invention are germ cells derived from mammals (for example, humans, mice, monkeys, cows, pigs, rats, dogs, etc.). Any cell other than the above may be used, for example, keratinizing epithelial cells (eg, keratinized epidermal cells), mucosal epithelial cells (eg, tongue superficial epithelial cells), exocrine gland epithelial cells (eg, mammary cells), and the like. Hormone-secreting cells (eg, adrenal medulla cells), metabolic and storage cells (eg, hepatocytes), luminal epithelial cells that make up the interface (eg, type I alveolar cells), luminal epithelium of the inner canal Cells (eg, vascular endothelial cells), ciliated cells with carrying capacity (eg, airway epithelial cells), extracellular matrix secretory cells (eg, fibroblasts), contractile cells (eg, smooth muscle cells), Blood and immune system cells (eg, peripheral blood mononuclear cells, umbilical cord blood, T lymphocytes), sensory cells (eg, rod cells), autonomic nervous system neurons (eg, cholinergic neurons), sensory organs and peripherals Supporting cells of neurons (eg, associated cells), nerve cells and glia cells of the central nervous system (eg, stellate glia cells), pigment cells (eg, retinal pigment epithelial cells), and their precursor cells (tissue precursor cells) And so on. There are no particular restrictions on the degree of cell differentiation or the age of the animal from which the cells are collected. It can be used as the origin of somatic cells in the invention. Here, examples of undifferentiated progenitor cells include tissue stem cells (somatic stem cells) such as neural stem cells, hematopoietic stem cells, mesenchymal stem cells, and dental pulp stem cells.

The individual mammal that is the source for collecting somatic cells is not particularly limited, but when the obtained iPS cells are used for human regenerative medicine, the patient or HLA type is considered from the viewpoint that rejection does not occur. It is particularly preferred to collect somatic cells from others who are the same or substantially the same. Here, the HLA type is "substantially the same" when the transplanted cells are transplanted into a patient by inducing differentiation from the somatic cell-derived iPS cells by using an immunosuppressive agent or the like. It means that the HLA types match to the extent that they can be engrafted. For example, the case where the main HLA (for example, the three loci of HLA-A, HLA-B and HLA-DR) is the same (the same applies hereinafter) can be mentioned. In addition, when not administered (transplanted) to humans, for example, when iPS cells are used as a source of cells for screening for evaluating the drug sensitivity and the presence or absence of side effects of a patient, the patient or the drug sensitivity is also used. It is desirable to collect somatic cells from others with the same gene polymorphism that correlates with side effects.

Somatic cells isolated from mammals can be pre-cultured in a medium known per se, which is suitable for the culture, depending on the type of cells, prior to being subjected to the nuclear reprogramming step. Examples of such media include minimum essential medium (MEM) containing about 5 to 20% fetal bovine serum, Dulbecco's modified Eagle's medium (DMEM), RPMI1640 medium, 199 medium, F12 medium and the like. Not limited to. When contacting with a nuclear reprogramming substance and a function-inhibiting substance of p38 (and, if necessary, another substance for improving the efficiency of establishment of iPS cells described later), for example, when an introduction reagent such as cationic liposome is used, the introduction efficiency. It may be preferable to replace it with a serum-free medium in order to prevent a decrease in the amount of the substance.

(B) TEAD3 function inhibitor TEAD3, which is the target molecule in the present invention, is one of the members of the transcription enhancer-related domain (TEAD) family, and the transcriptional activation of the target gene by this transcription factor is the Hippo signaling pathway. It occurs by binding to the coactivator YAP or TAZ, whose nuclear transduction is controlled by.

As used herein, "TEAD3" is a protein containing an amino acid sequence that is the same as or substantially the same as the amino acid sequence represented by SEQ ID NO: 2. In the present specification, proteins and peptides are described with an N-terminal (amino-terminal) at the left end and a C-terminal (carboxyl-terminal) at the right end according to the convention of peptide notation.
"Amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 2" means
(A) Orthologs of human TEAD3 consisting of the amino acid sequence represented by SEQ ID NO: 2 in other warm-blooded animals (eg, guinea pigs, rats, mice, chickens, rabbits, dogs, pigs, sheep, cows, monkeys, etc.) Amino acid sequence; or (b) means an amino acid sequence in a human TEAD3 consisting of the amino acid sequence represented by SEQ ID NO: 2 or a natural allergen variant or gene polymorphism of the ortholog of (a) above.
Preferably, TEAD3 is a human TEAD3 or a natural allelic variant or gene polymorphism thereof consisting of the amino acid sequence represented by SEQ ID NO: 2. Examples of the gene polymorphism include, but are not limited to, SNPs registered in dbSNP as rs35080860 in which Thr (ACG) at position 254 is replaced with Met (ATG).

As used herein, the "TEAD3 function inhibitor" may be any substance as long as it can inhibit (1) the function of the TEAD3 protein or (2) the expression of the TEAD3 gene. That is, the result is obtained by acting not only on substances that directly act on the TEAD3 protein to inhibit its function and substances that directly act on the TEAD3 gene and inhibit its expression, but also on factors involved in transcriptional activation by TEAD3. A substance that inhibits the function of the TEAD3 protein or the expression of the TEAD3 gene is also included in the "TEAD3 function inhibitor" in the present specification.

In the present invention, the "substance that inhibits the expression of the TEAD3 gene" is a substance that acts at any stage such as the transcriptional level of the TEAD3 gene, the level of posttranscriptional regulation, the level of translation into a protein, the level of post-translational modification, and the like. May be good. Therefore, as substances that inhibit the expression of TEAD3, for example, substances that inhibit transcription of the TEAD3 gene (eg, antigene), substances that inhibit the processing of early transcripts to mRNA, and substances that inhibit the transport of mRNA to the cytoplasm. Translation of substances, substances that inhibit mRNA-to-protein translation (eg, antisense nucleic acids, miRNAs) or degrade mRNAs (eg, siRNAs, gapmer-type antisense nucleic acids, ribozymes, miRNAs) Includes substances that inhibit post-modification. Any substance that acts at any stage can be used, but a substance that complementarily binds to mRNA and inhibits translation into a protein or degrades mRNA is preferable.

As a substance that specifically inhibits (or degrades) the translation of the TEAD3 gene from mRNA to protein, preferably, a nucleic acid containing a nucleotide sequence complementary to the nucleotide sequence of the mRNA or a part thereof can be mentioned.
A nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene is complementary to the extent that it can bind to the target sequence of the mRNA and inhibit its translation (or cleave the target sequence) under physiological conditions. Means a nucleotide sequence having, specifically, for example, 90% or more with respect to a region that overlaps with a nucleotide sequence that is completely complementary to the nucleotide sequence of the mRNA (that is, a nucleotide sequence of the complementary strand of the mRNA). It is a nucleotide sequence having a homology of 95% or more, more preferably 97% or more, and particularly preferably 98% or more. The "homology of nucleotide sequence" in the present invention uses the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) and the following conditions (expected value = 10; gap is allowed; filtering = ON; It can be calculated by match score = 1; mismatch score = -3).

More specifically, the nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene is a nucleotide sequence that hybridizes with the nucleotide sequence represented by SEQ ID NO: 1 under stringent conditions. Here, the “stringent condition” is, for example, the condition described in Current Protocols in Molecular Biology, John Wiley & Sons, 6.3.1-6.3.6, 1999, for example, 6 × SSC (sodium chloride / sodium citrate). ) / Hybridization at 45 ° C, followed by 0.2 × SSC / 0.1% SDS / one or more washings at 50-65 ° C. Hybridization conditions can be appropriately selected.

Preferred examples of the mRNA of the TEAD3 gene are human TEAD3 (RefSeq Accession No. NM_003214.4) containing the nucleotide sequence represented by SEQ ID NO: 1, its ortholog in other warm-blooded animals, and their natural alleles. Examples include mRNAs such as mutants or gene polymorphisms.

"A part of the nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene" means that it can specifically bind to the mRNA of the TEAD3 gene and inhibits the translation of the protein from the mRNA (or inhibits the mRNA). As long as it can be decomposed), its length and position are not particularly limited, but from the viewpoint of sequence specificity, the portion complementary to the target sequence is at least 10 bases or more, preferably 15 bases or more, more preferably 19. It contains more than a base.

Specifically, any of the following (a) to (c) is preferably exemplified as a nucleic acid containing a part of the nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene.
(a) Nucleic acid having RNAi activity against mRNA of TEAD3 gene or its precursor
(b) Antisense nucleic acid against mRNA of TEAD3 gene
(c) Ribozyme nucleic acid for mRNA of TEAD3 gene

(a) Nucleic acid having RNAi activity against the mRNA of the TEAD3 gene or a precursor thereof In the present specification, a double-stranded RNA consisting of an oligo RNA complementary to the mRNA of the TEAD3 gene and its complementary strand, so-called siRNA, is used. , TEAD3 gene is defined as being included in a nucleic acid containing a nucleotide sequence complementary to or a part of the nucleotide sequence of mRNA.

The siRNA can be designed based on the cDNA sequence information of the target gene, for example, according to the rules proposed by Elbashir et al. (Genes Dev., 15, 188-200 (2001)). Examples of the target sequence of siRNA include, _{but are not limited to, AA + (N) 19} , AA + (N) ₂₁ or NA + (N) ₂₁ (N is an arbitrary base). The position of the target sequence is also not particularly limited. For the selected target sequence candidate group, BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) is checked to see if there is homology in the consecutive sequences of 16-17 bases in the non-target mRNA. ), Etc., and confirm the specificity of the selected target sequence. For example, when the target sequence is AA + (N) ₁₉ , AA + (N) ₂₁ or NA + (N) ₂₁ (N is an arbitrary base), the target sequence whose specificity has been confirmed is AA (or NA) or later. Two strands consisting of a sense strand with a 3'end overhang of TT or UU on the 19-21 base and an antisense strand with a sequence complementary to the 19-21 base and a 3'end overhang of TT or UU. Strand RNA may be designed as siRNA. For short hairpin RNA (shRNA), which is a precursor of siRNA, an arbitrary linker sequence (for example, about 5-25 bases) capable of forming a loop structure is appropriately selected, and the above sense strand and antisense strand are selected. It can be designed by concatenating via a linker sequence.

SiRNA and / or shRNA sequences can be searched using search software provided free of charge on various websites. Such sites include, for example, siDESIGN Center (https://horizondiscovery.com/en/products/tools/siDESIGN-Center) provided by Horizon Discovery Ltd. and siRNA TargetFinder (https: //) provided by GenScript. www.genscript.com/tools/sirna-target-finder), etc., but not limited to these.

In a preferred embodiment, the siRNAs and shRNAs of the present invention are represented by nucleotide numbers 219 to 247 (AGCAACCAGCACAATAGCGTCCAACAGCT: SEQ ID NO: 4) or 1207 to 1235 (AGCATGACCATCAGCGTCTCCACCAAGGT: SEQ ID NO: 5) in the nucleotide sequence represented by SEQ ID NO: 1. Includes a nucleotide sequence complementary to a sequence consisting of at least 15 contiguous nucleotides in the region shown.

As used herein, microRNAs (miRNAs) that target the mRNA of the TEAD3 gene are also defined as being included in nucleic acids containing a nucleotide sequence complementary to or a portion thereof of the nucleotide sequence of the mRNA of the TEAD3 gene. To. miRNAs are involved in post-transcriptional regulation of gene expression by complementarily binding to target mRNAs and suppressing mRNA translation, or by degrading mRNAs.

For miRNA, the primary transcript, primary-microRNA (pri-miRNA), is first transcribed from the gene that encodes it, and then the approximately 70-base-long precursor-microRNA (pre-miRNA), which has a hairpin structure characteristic of Drosha, is transcribed. ), Then transported from the nucleus to the cytoplasm, and further processed by Dicer-mediated processing to become mature miRNA, which is taken up by RISC and acts on the target mRNA. Therefore, pre-miRNA, pri-miRNA, preferably pre-miRNA can also be used as a precursor of miRNA.

MiRNA can be searched using target prediction software provided free of charge on various websites. Such sites include, for example, TargetScan (http://www.targetscan.org/vert_72/) published by the Whitehead Institute in the United States, and Alexander Fleming Biomedical Science Research Center in Greece. DIANA-micro-T-CDS (http://diana.imis.athena-innovation.gr/DianaTools/index.php?r=microT_CDS/index), etc., but are not limited to these. Alternatively, TarBase (http://carolina.imis.athena-innovation.gr), a database on miRNAs that have been experimentally proven to act on target mRNAs, published by the Pasteur Institute of the University of Chezalley, etc. You can also search for miRNAs that target TEAD3 mRNA using /diana_tools/web/index.php?r=tarbasev8/index). For example, among the miRNAs against TEAD3 mRNA hit on the database, those having a high score in the target prediction software include, for example, hsa-miR-106b-5p, hsa-miR-20a-5p and the like. Sequence information of these miRNAs and / or pre-miRNAs can be obtained, for example, using miRBase (http://www.mirbase.org/search.shtml) published by the University of Manchester, England.

The nucleotide molecules that make up siRNA and / or shRNA, or miRNA and / or pre-miRNA may be natural RNA or DNA, but are stable (chemical and / or paired) and specific activity (affinity with RNA). Various chemical modifications can be included to improve sex). For example, in order to prevent degradation by hydrolytic enzymes such as nuclease, the phosphate residue (phosphate) of each nucleotide constituting the antisense nucleic acid is chemically modified with, for example, phosphorothioate (PS), methylphosphonate, phosphorodithionate, etc. It can be replaced with a phosphoric acid residue. In addition, the hydroxyl group at the 2'position of the sugar (ribose) of each nucleotide can be replaced with -OR (R = CH ₃ (2'-O-Me), CH ₂ CH ₂ OCH ₃ (2'-O-MOE), CH ₂ It _{may be replaced with CH 2} NHC (NH) NH ₂ , CH ₂ CONHCH ₃ , CH ₂ CH ₂ CN, etc.). Further, the base moiety (pyrimidine, purine) may be chemically modified, for example, introduction of a methyl group or a cationic functional group at the 5-position of the pyrimidine base, or substitution of the carbonyl group at the 2-position with thiocarbonyl. Can be mentioned.

C2'-endo (S type) and C3'-endo (N type) are dominant in the formation of the sugar part of RNA, and in single-strand RNA, they exist as an equilibrium between the two, but they are double-stranded. Is fixed to N type when it is formed. Therefore, BNA (LNA) (Imanishi), which is an RNA derivative in which the conformation of the sugar moiety is fixed to N type by cross-linking 2'oxygen and 4'carbon in order to impart strong binding ability to the target RNA. , T. et al., Chem. Communi., 1653-9, 2002; Jepsen, JS et al., Oligonucleotides, 14, 130-46, 2004) and ENA (Morita, K. et al., Nucleosides Nucleotides Nucleic Acids , 22, 1619-21, 2003) can also be preferably used.

For siRNA, the sense strand and antisense strand of the target sequence on mRNA are synthesized by a DNA / RNA automatic synthesizer, respectively, and denatured in an appropriate annealing buffer at about 90 to about 95 ° C. for about 1 minute. It can be prepared by annealing at about 30 to about 70 ° C. for about 1 to about 8 hours. It can also be prepared by synthesizing shRNA as a precursor of siRNA and cleaving it with a dicer. miRNA and pre-miRNA can be synthesized by a DNA / RNA automatic synthesizer based on their sequence information.

As used herein, nucleic acids designed to be capable of producing siRNAs or miRNAs against the mRNA of the TEAD3 gene in vivo are also nucleic acids comprising a nucleotide sequence complementary to or part of the nucleotide sequence of the mRNA of the TEAD3 gene. Defined as contained in. Examples of such nucleic acids include expression vectors constructed to express the above-mentioned shRNA or siRNA or miRNA or pre-miRNA. As shown in the Examples below, TEAD3 expression is at the beginning of the initialization process (eg, within 3 days after the introduction of the nuclear reprogramming material) and at the stabilization stage (eg, 2 after the introduction of the nuclear reprogramming material). Since it increases in both (up to 3 weeks), it is considered desirable that the functional inhibition of TEAD3 is sustained for a long period of time through the nuclear initialization step. The use of an expression vector is preferable in that a nucleic acid that inhibits the expression of TEAD3 can be continuously supplied to somatic cells for a long period of time.

shRNA is an oligo containing a nucleotide sequence in which the sense strand and antisense strand of the target sequence on mRNA are linked by inserting a spacer sequence of a length (for example, about 5 to 25 bases) capable of forming an appropriate loop structure. It can be prepared by designing RNA and synthesizing it with an automatic DNA / RNA synthesizer. Vectors expressing shRNA include tandem type and stem loop (hairpin) type. The former is a tandem link between the expression cassette of the sense strand of siRNA and the expression cassette of the antisense strand, and each strand is expressed and annealed in the cell to form double-stranded siRNA (dsRNA). Is. On the other hand, the latter is a vector in which an shRNA expression cassette is inserted, in which the shRNA is expressed intracellularly and processed by a dicer to form dsRNA. As the promoter, a polII-based promoter (for example, a pre-CMV early stage promoter) can be used, but it is common to use a polIII-based promoter in order to allow accurate transcription of short RNA. Examples of the polIII promoter include mouse and human U6-snRNA promoters, human H1-RNase PRNA promoters, and human valine-tRNA promoters. In addition, a sequence in which four or more Ts are continuous is used as the transcription termination signal. Expression cassettes for miRNA and pre-miRNA can also be prepared in the same manner as shRNA.

The siRNA or shRNA or miRNA or pre-miRNA expression cassette constructed in this way is then inserted into a plasmid vector or viral vector. As such a vector, a viral vector such as a retrovirus, a lentivirus, an adenovirus, an adeno-associated virus, a herpes virus, a Sendai virus, an animal cell expression plasmid, or the like is used. Since TEAD3 is deeply involved in gene expression regulation via the Hippo signaling pathway, which is also involved in homeostasis maintenance, the reprogramming barrier is released and somatic cells are rapidly dedifferentiated into iPS cells. It may be preferable to restore function. Therefore, as the expression vector, a non-integrated transient expression vector, for example, an adenovirus vector or a plasmid is more preferable. In particular, the use of an episomal vector capable of autonomous replication outside the chromosome in that nucleic acids that inhibit TEAD3 expression can be continuously expressed through the nuclear reprogramming step and can be rapidly eliminated from the cells after the establishment of iPS cells. Is preferable. Specific means using an episomal vector are disclosed in Yu et al., Science, 324, 797-801 (2009).

Examples of the episomal vector include a vector containing a sequence required for autonomous replication derived from EBV, SV40, etc. as a vector element. Specifically, the vector elements required for autonomous replication are a replication origin and a gene encoding a protein that binds to the replication origin and controls replication. For example, in EBV, the replication origin oriP. And the EBNA-1 gene, and in the case of SV40, the replication origin ori and the SV40 large Tantigen gene can be mentioned.

(b) Antisense Nucleic Acid Against mRNA of TEAD3 Gene The "antisense nucleic acid against mRNA of TEAD3 gene" in the present invention is a nucleic acid containing or a part of a nucleotide sequence complementary to the nucleotide sequence of the mRNA and is a target. It has a function of suppressing protein synthesis by forming and binding to a specific and stable double chain with mRNA.
Antisense nucleic acids include polydeoxyribonucleotides containing 2-deoxy-D-ribose, polyribonucleotides containing D-ribose, and other types of polynucleotides that are N-glycosides of purine or pyrimidine bases. Other polymers with a non-nucleotide skeleton (eg, commercially available protein nucleic acids and synthetic sequence-specific nucleic acid polymers) or other polymers containing special bindings (provided that the polymer is a base as found in DNA or RNA). (Contains a nucleotide having an arrangement that allows the pairing and attachment of a base). They may be double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, DNA: RNA hybrids, as well as unmodified polynucleotides (or unmodified oligonucleotides), known modifications. Additions, such as those with a label known in the art, those with a cap, those that are methylated, those in which one or more natural nucleotides are replaced with an analog, those with intramolecular nucleotide modifications. For example, those with uncharged bonds (eg, methylphosphonate, phosphotriester, phosphoramidate, carbamate, etc.), charged bonds or sulfur-containing bonds (eg, phosphorothioate, phosphorodithioate, etc.). Those having side chain groups such as proteins (eg, nucleases, nuclease inhibitors, toxins, antibodies, signal peptides, poly-L-lysine, etc.) and sugars (eg, monosaccharides, etc.), intercurrent. Those with compounds (eg, acridin, solarene, etc.), those containing chelate compounds (eg, metals, radioactive metals, boron, oxidizing metals, etc.), those containing alkylating agents, modified. It may have a binding (for example, α-anomer type nucleic acid). Here, the "nucleoside", "nucleotide" and "nucleic acid" may include not only those containing purine and pyrimidine bases but also those having other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. Modified nucleosides and modified nucleotides may also have modified sugar moieties, for example, one or more hydroxyl groups substituted with halogens, aliphatic groups, etc., or functional groups such as ethers, amines, etc. It may have been converted.

As described above, the antisense nucleic acid may be DNA, RNA, or a DNA / RNA chimera. When the antisense nucleic acid is DNA, the RNA: DNA hybrid formed by the target RNA and the antisense DNA can be recognized by the endogenous RNase H and cause selective degradation of the target RNA. Therefore, in the case of antisense DNA directed to degradation by RNase H, the target sequence may be not only the sequence in mRNA but also the sequence of the intron region in the initial translation product of the TEAD3 gene. The intron sequence can be determined by comparing the genomic sequence with the cDNA nucleotide sequence of the TEAD3 gene using a homology search program such as BLAST or FASTA.

The target region of the antisense nucleic acid of the present invention is not particularly limited in length as long as the antisense nucleic acid hybridizes to inhibit translation into a protein, and the mRNA encoding the protein is not particularly limited. It may be a full sequence or a partial sequence of the above, and a short one may be about 10 bases, and a long one may be the whole sequence of mRNA or an early transcript. Considering the ease of synthesis, antigenicity, intracellular transferability, and the like, oligonucleotides consisting of about 10 to about 40 bases, particularly about 15 to about 30 bases are preferable, but the oligonucleotide is not limited thereto. Specifically, the 5'end hairpin loop, 5'end 6-base pair repeat, 5'end untranslated region, translation start codon, protein coding region, ORF translation stop codon, 3'end untranslated region of the TEAD3 gene. , 3'end parindrome regions or 3'end hairpin loops can be selected as preferred target regions for antisense nucleic acids, but are not limited thereto.

In one embodiment, as the target region of the antisense nucleic acid of the present invention, similarly to the above siRNA, in the nucleotide sequence represented by SEQ ID NO: 1, within the region represented by nucleotide numbers 219 to 247 or 1207 to 1235. A sequence consisting of at least 15 consecutive nucleotides can be mentioned. When a gapmer-type antisense nucleic acid is used, TEAD3 mRNA can be degraded by the action of RNase H in the target region, so that the same effect as siRNA can be obtained.

TEAD4, a paralog of TEAD3, is known to have a splicing variant that lacks the DNA-binding domain on the N-terminal side, and it is thought that skipping of exon 3 changes the position of the start codon (NatCommun 7: 11840). | DOI: 10.1038 / ncomms11840). The DNA-binding regions of the TEAD family are highly conserved, and it is speculated that TEAD3 also has splicing variants that lack the DNA-binding domain. Therefore, by using an antisense nucleic acid targeting a splicing-promoting sequence existing inside or in an adjacent intron of exon 3, transcription of a splicing variant lacking exon 3 is promoted, and the amino acid sequence represented by SEQ ID NO: 2 is used. Among them, TEAD3 isoforms starting with Met indicated by amino acid number 112 can be produced. The isoform binds to the coactivator YAP / TAZ, but cannot bind to the promoter of the target gene, thus functioning as a dominant negative variant of TEAD3.

Furthermore, the antisense nucleic acid of the present invention not only hybridizes with the mRNA and early transcript of the TEAD3 gene to inhibit translation into a protein, but also binds to these genes, which are double-stranded DNA, to form a triple strand (triple strand). It may be one that can form a triplet) and inhibit transcription into RNA (antigene).

The nucleotide molecules constituting the antisense nucleic acid may also be modified in the same manner as in the case of siRNA and the like described above in order to improve stability, specific activity and the like.

The antisense oligonucleotide of the present invention determines the target sequence of mRNA or early transcript based on the cDNA sequence or genomic DNA sequence of the TEAD3 gene, and is a commercially available DNA / RNA automatic synthesizer (Applied Biosystems, Beckman). Etc.) and can be prepared by synthesizing a sequence complementary to this. In addition, all of the antisense nucleic acids containing the above-mentioned various modifications can be chemically synthesized by a method known per se.

Alternatively, the antisense nucleic acid can be incorporated into an expression vector and introduced into somatic cells in the same manner as in the case of siRNA or the like described above.

(c) Ribozyme nucleic acid for the mRNA of the TEAD3 gene As another example of a nucleic acid containing a nucleotide sequence complementary to or a part of the nucleotide sequence of the mRNA of the TEAD3 gene, the mRNA is specifically cleaved inside the coding region. Examples include the ribozyme nucleic acid obtained. The term "ribozyme" is used in a narrow sense as an RNA having an enzymatic activity for cleaving nucleic acid, but is used herein as a concept including DNA as long as it has a sequence-specific nucleic acid cleaving activity. The most versatile ribozyme nucleic acid includes self-splicing RNA found in infectious RNAs such as viroids and virusoids, and hammerhead type and hairpin type are known. The hammer head type exerts enzymatic activity at about 40 bases, and several bases at both ends adjacent to the part having the hammer head structure (about 10 bases in total) are arranged in a sequence complementary to the desired cleavage site of mRNA. By doing so, it is possible to specifically cleave only the target mRNA. This type of ribozyme nucleic acid has the additional advantage of not attacking genomic DNA because it uses only RNA as a substrate. When the mRNA of the TEAD3 gene has a double-stranded structure by itself, the target sequence is made single-stranded by using a hybrid ribozyme linked with an RNA motif derived from a viral nucleic acid that can specifically bind to RNA helicase. Can [Proc. Natl. Acad. Sci. USA, 98 (10): 5572-5577 (2001)]. Furthermore, when the ribozyme is used in the form of an expression vector containing the DNA encoding it, it should be a hybrid ribozyme in which tRNA-modified sequences are further linked in order to promote the transfer of the transcript to the cytoplasm. You can also [Nucleic Acids Res., 29 (13): 2780-2788 (2001)].

Nucleic acids containing a nucleotide sequence complementary to or a part of the nucleotide sequence of the mRNA of the TEAD3 gene may be provided in a special form such as liposomes or microspheres, or may be provided in a form in which other elements are added. Can be possible. As an additional form, polycationic substances such as polylysine, which act to neutralize the charge of the phosphate basal skeleton, and lipids that enhance interaction with cell membranes and increase nucleic acid uptake (eg,). , Phosphoripide, cholesterol, etc.) and other hydrophobic ones. Preferred lipids for addition include cholesterol and its derivatives (eg, cholesteryl chloroformate, cholic acid, etc.). These can be attached to the 3'or 5'ends of nucleic acids and can be attached via bases, sugars, intramolecular nucleoside bonds. Other groups include cap groups specifically located at the 3'or 5'ends of nucleic acids to prevent degradation by nucleases such as exonucleases and RNases. Examples of such groups for caps include, but are not limited to, hydroxyl-protecting groups known in the art, such as glycols such as polyethylene glycol and tetraethylene glycol.

When the nucleic acid containing a part of the nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene is in the form of RNA, it can be introduced into the body cell by a method such as lipofection or microinjection.
On the other hand, in the case of the form of an expression vector containing DNA encoding the RNA, it can be introduced into cells by a method known per se, depending on the type of vector. For example, in the case of a viral vector, a virus produced in a culture supernatant by introducing a plasmid containing the DNA into an appropriate packaging cell (eg, Plat-E cell) or complementary cell line (eg, 293 cells). The vector is recovered and the cells are infected with the vector by an appropriate method according to each viral vector. For example, specific means of using a retroviral vector as a vector are disclosed in WO2007 / 69666, Cell, 126, 663-676 (2006) and Cell, 131, 861-872 (2007), and the lentiviral vector is used as a vector. The use is disclosed in Science, 318, 1917-1920 (2007). The case of using an adenovirus vector is described in Science, 322, 945-949 (2008).
On the other hand, in the case of a plasmid vector which is a non-viral vector, the vector is transferred to cells by using a lipofection method, a liposome method, an electroporation method, a calcium phosphate co-precipitation method, a DEAE dextran method, a microinjection method, a gene gun method, or the like. Can be introduced.

(d) Another preferred embodiment of a substance that inhibits the expression of the oligonucleic acid TEAD3 gene comprising the consensus binding sequence of p53 is a substance that inhibits the transcriptional activator of the TEAD3 gene from binding to the promoter region of the TEAD3 gene. Can be mentioned. For example, as such a substance, the consensus binding sequence of p53, rrrcwwgyyynnnnnnnnnnnnnrrrcwwgyyy (r stands for a or g, w stands for a or t, y stands for c or t, n stands independently or does not exist, a, Can be mentioned as an oligonucleic acid comprising g, t or c; SEQ ID NO: 3). Preferably, the oligonucleic acid is double-stranded DNA. Since p53 binds to the cis-element sequence present in the TEAD3 promoter region and is thought to positively regulate the transcription of the TEAD3 gene, oligonucleic acids containing the consensus binding sequence of p53 are directed to the TEAD3 promoter region of p53. It can inhibit binding and suppress its transcription. The length of the oligonucleic acid is, for example, 20 to 50 nucleotides, preferably 25 to 40 nucleotides.

The oligonucleic acid synthesizes a sense strand and an antisense strand using a commercially available DNA / RNA automatic synthesizer (Applied Biosystems, Beckman, etc.) based on the sequence information of SEQ ID NO: 3, and synthesizes them. It can be manufactured by annealing.

The oligonucleic acid can be introduced into somatic cells by a method such as lipofection or microinjection.

In the present invention, the "substance that suppresses the function of TEAD3" is any substance as long as it suppresses the function of TEAD3 once functionally produced (for example, the transcriptional activation function of a gene cluster that maintains its uniqueness as a somatic cell). Examples thereof include substances that bind to TEAD3 and suppress the function, substances that inhibit the binding activity between TEAD3 and a target gene, and substances that inhibit the interaction between TEAD3 and a transcriptional coupling factor.

(e) Dominant negative mutant of TEAD3 TEAD3 is a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 in humans, but the region of about 30 to about 100 amino acids from the N-terminal side is highly advanced in the TEAD family. It is a DNA-binding domain conserved in the YAP / TAZ-binding domain and the transcription activation domain after about 200 positions. Therefore, the TEAD3 fragment lacking the DNA-binding domain binds to the transcription coactivator YAP / TAZ competitively with the endogenous full-length TEAD3 and activates transcription of the target gene cluster by the interaction between TEAD3 and YAP / TAZ. It can be suppressed. On the other hand, the TEAD3 fragment lacking the YAP / TAZ binding domain and the transcription activation domain binds to the promoter region of the target gene competitively with the endogenous full-length TEAD3, and is a group of target genes due to the interaction between TEAD3 and YAP / TAZ. Transcription activation can be suppressed.

Dominant negative variants of TEAD3 can be obtained by designing an appropriate primer set from a cell / tissue-derived mRNA, cDNA or cDNA library expressing TEAD3 in warm-blooded animals such as humans by the (RT-) PCR method. Clone a nucleic acid encoding a TEAD3 fragment lacking the DNA-binding domain of interest or the YAP / TAZ-binding domain (transcription activation domain), insert it into an appropriate expression vector, introduce the vector into a host cell, and the cell. It can be obtained by recovering the recombinant protein from the culture obtained by culturing.

Contact of the dominant negative mutant to somatic cells can be performed using a method for introducing a protein into cells known per se. Such methods include, for example, a method using a protein transfer reagent, a method using a protein transfer domain (PTD) fusion protein, a microinjection method, and the like. Protein transfer reagents include BioPOTER Protein Delivery Reagent (Gene Therapy Systmes) based on cationic lipids, Pro-Ject ^TM Protein Transfection Reagent (PIERCE) and ProVectin (IMGENEX), and Profect-1 (Targeting Systems) based on lipids. ), Penetrain Peptide (Q biogene) and Chariot Kit (Active Motif) based on membrane-permeable peptides are commercially available. The introduction can be performed according to the protocol attached to these reagents, but the general procedure is as follows. The dominant negative variant of p38 is diluted with a suitable solvent (for example, buffer solution of PBS, HEPES, etc.), an introduction reagent is added, and the mixture is incubated at room temperature for about 5-15 minutes to form a complex, which is serum-free. Add to the cells replaced with medium and incubate at 37 ° C. for 1 to several hours. Then, the medium is removed and replaced with a serum-containing medium.

PTDs using cell transit domains of proteins such as Drosophila-derived AntP, HIV-derived TAT, and HSV-derived VP22 have been developed. A fusion protein expression vector incorporating the cDNA of the dominant negative mutant of p38 and the PTD sequence is prepared and recombinantly expressed, and the fusion protein is recovered and used for introduction. The introduction can be carried out in the same manner as described above except that the protein introduction reagent is not added. It is suitable for introducing deletion mutants with relatively small molecular weight such as p38DD.

Microinjection is a method in which a protein solution is put into a glass needle with a tip diameter of about 1 μm and punctured and introduced into cells, and the protein can be reliably introduced into cells.

(f) Nucleic acid encoding a dominant negative variant of TEAD3 However, given the ease of introduction into somatic cells, the dominant negative variant of TEAD3 is used in the form of a nucleic acid encoding it rather than as the protein itself. Is rather preferable. Therefore, in another preferred embodiment of the invention, the TEAD3 function inhibitor is a nucleic acid encoding a dominant negative variant of TEAD3. The nucleic acid may be DNA, RNA, or a DNA / RNA chimera, but is preferably DNA. Further, the nucleic acid may be double-stranded or single-stranded. The cDNA encoding the dominant negative variant of TEAD3 can be cloned by the method described above for the production of the variant protein.

The isolated cDNA is inserted into a suitable viral or non-viral expression vector and similarly, as is the nucleic acid containing a part of the nucleotide sequence complementary to the nucleotide sequence of the mRNA of the TEAD3 gene described above. It can be introduced into somatic cells by the gene transfer method.

(g) Inhibitors of Transcription Coupling Factors for TEAD3 As described above, TEAD3 couples with the coactivator YAP / TAZ to activate transcription of target genes. In the phosphorylated state (for example, phosphorylation at the Ser residue at position 127), YAP / TAZ binds to 14-3-3, is localized in the cytoplasm, and is inactivated, but is dephosphorylated. It dissociates with 14-3-3 and translocates into the nucleus, and promotes transcription of the target gene cluster in conjugation with TEAD3. Therefore, by inhibiting YAP / TAZ, which is a transcriptional conjugate factor of TEAD3, the function of TEAD3 can be inhibited as a result.

As a method of inhibiting YAP / TAZ, siRNA or miRNA against YAP or TAZ, or a precursor thereof, antisense nucleic acid against YAP or TAZ, ribozyme nucleic acid, etc. are introduced into somatic cells to suppress their expression. Examples include a method of promoting the phosphorylation of YAP / TAZ and the formation of a complex with 14-3-3, and suppressing its activation and nuclear translocation.

SiRNAs and shRNAs for YAP or TAZ are based on the sequence information of YAP mRNA (eg, NM_001130145 for human YAP1-2γ isoform) or TAZ mRNA (eg, NM_000116 for human TAZ isoform-1). , SIRNA for TEAD3, etc. can be appropriately designed by the same method as described.

MiRNAs for YAP or TAZ can be searched using the same database described for miRNAs for TEAD3. For example, according to TarBase (above), examples of miRNAs for YAP1 include, but are not limited to, hsa-miR-204-5p, hsa-miR-506-3p, and the like. In addition, examples of miRNAs for TAZ include, but are not limited to, hsa-miR-382-3p and hsa-miR-26b-5p. Sequence information for these miRNAs and / or pre-miRNAs can be obtained using, for example, miRBase (above).

The antisense nucleic acid and ribozyme nucleic acid for YAP and TAZ can be designed and used in the same manner as the antisense nucleic acid and ribozyme nucleic acid for TEAD3.

In another embodiment, 14-3-3 proteins can be used as inhibitors of YAP or TAZ. By enriching the intracellular 14-3-3 protein, it is possible to promote the formation of a complex with YAP / TAZ and suppress the translocation of YAP / TAZ into the nucleus.
In another embodiment, an activating substance of the Hippo signaling pathway can also be used as an inhibitor of YAP or TAZ. Activation of the Hippo signaling pathway can promote YAP / TAZ phosphorylation and suppress nuclear translocation. Examples of the activator of the Hippo signaling pathway include Lats1 / 2 (and its conjugate factor Mob1A / 1B) and its upstream MST1 / 2 (and its conjugate factor WW45).
In yet another embodiment, dominant negative variants of YAP or TAZ can be used. The TEAD-binding domains of YAP and TAZ are 50 to 100 amino acids and 13 to 57 amino acids from the N-terminal, respectively, and the transcription activation domains are positions 276 to 472 and 208 to 381, respectively, and thus include the TEAD binding domain. When a YAP or TAZ fragment lacking a transcriptional activation domain, when translocated into the nucleus, it binds to TEAD3 competitively with endogenous YAP / TAZ and activates transcription of the target gene by the interaction between TEAD3 and YAP / TAZ. Can be suppressed. If the deletion of the transcriptional activation domain impairs nuclear localization, a nuclear localization signal sequence known per se may be added.
Information on the amino acid sequence and mRNA sequence of these YAP / TAZ inhibitors is known, and sequence information can be obtained from various databases, including the above-mentioned dominant negative variant of TEAD3 and the nucleic acid encoding it. Similarly, the desired protein or nucleic acid encoding it can be obtained. The obtained protein or nucleic acid can be introduced into somatic cells by the same method as the dominant negative mutant of TEAD3 or the nucleic acid encoding the same.

(h) The decoy nucleic acid YAP / TAZ for TEAD3 is coupled not only with TEAD3 but also with other transcription factors. Therefore, in order to selectively suppress the transcriptional activation of the target gene in TEAD3, it is more preferable to use a substance that inhibits the binding of TEAD3 to the target gene promoter region. Examples of such a substance include not only the dominant negative mutant of TEAD3 lacking the YAP / TAZ binding domain (transcription activation domain) described above, but also a decoy nucleic acid containing a consensus binding sequence of TED3. ACATTCCA is mentioned as a consensus binding sequence of TEAD3. Preferably, the decoy nucleic acid is double-stranded DNA. The length of the decoy nucleic acid is, for example, 8 to 30 nucleotides, preferably 8 to 20 nucleotides.

The decoy nucleic acid for TEAD3 can be prepared in the same manner as the oligonucleic acid containing the consensus binding sequence of p53 and introduced into somatic cells.

The above TEAD3 function-inhibiting substance needs to be introduced into somatic cells in a manner sufficient to inhibit the function of TEAD3 in the nuclear initialization step of somatic cells. Here, the nuclear reprogramming of somatic cells can be carried out by introducing a nuclear reprogramming substance into somatic cells.

(C) Nuclear reprogramming substance In the present invention, the "nuclear reprogramming substance" is a proteinaceous factor or a substance (group) that can induce iPS cells from the somatic cells by introducing them into the somatic cells. It may be composed of any substance such as a nucleic acid encoding it (including a form incorporated in a vector) or a low molecular weight compound. When the nuclear reprogramming substance is a proteinaceous factor or a nucleic acid encoding the same, the following combinations are preferably exemplified (in the following, only the name of the proteinaceous factor is described).
(1) Oct3 / 4, Klf4, c-Myc
(2) Oct3 / 4, Klf4, c-Myc, Sox2 (where Sox2 can be replaced with Sox1, Sox3, Sox15, Sox17 or Sox18, preferably Sox1, Sox3, Sox15 or Sox17, more preferably Sox1 or Sox3. Also, Klf4 can be replaced with Klf1, Klf2 or Klf5, preferably Klf2. Furthermore, c-Myc can be replaced with T58A (active mutant), N-Myc, L-Myc.)
(3) Oct3 / 4, Klf4, c-Myc, Sox2, Fbx15, Nanog, Eras, ECAT15-2, TclI, β-catenin (active mutant S33Y)
(4) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, SV40 Large T antigen (hereinafter, SV40LT)
(5) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, HPV16 E6
(6) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, HPV16 E7
(7) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, HPV6 E6, HPV16 E7
(8) Oct3 / 4, Klf4, c-Myc, Sox2, TERT, Bmil
(See WO 2007/069666 (however, in the combination of (2) above, for the substitution of Sox2 to Sox18 and the substitution of Klf4 to Klf1 or Klf5, see Nature Biotechnology, 26, 101-106 (2008). See). For combinations of "Oct3 / 4, Klf4, c-Myc, Sox2", see also Cell, 126, 663-676 (2006), Cell, 131, 861-872 (2007), etc. "Oct3 / 4" See also Nat. Cell Biol., 11, 197-203 (2009) for the combination of ", Klf2 (or Klf5), c-Myc, Sox2". "Oct3 / 4, Klf4, c-Myc, Sox2, hTERT, See also Nature, 451, 141-146 (2008) for the combination of "SV40LT".)
(9) Oct3 / 4, Klf4, Sox2 (see Nature Biotechnology, 26, 101-106 (2008)) (where Sox2 can be replaced with Sox1, Sox3, Sox15, Sox17 or Sox18, and Klf4 can be replaced. It can be replaced with Klf1, Klf2 or Klf5.)
(10) Oct3 / 4, Sox2, Nanog, Lin28 (see Science, 318, 1917-1920 (2007))
(11) Oct3 / 4, Sox2, Nanog, Lin28, hTERT, SV40LT (see Stem Cells, 26, 1998-2005 (2008))
(12) Oct3 / 4, Klf4, c-Myc, Sox2, Nanog, Lin28 (see Cell Research (2008) 600-603)
(13) Oct3 / 4, Klf4, c-Myc, Sox2, SV40LT (see also Stem Cells, 26, 1998-2005 (2008))
(14) Oct3 / 4, Klf4 (see Nature 454: 646-650 (2008), Cell Stem Cell, 2: 525-528 (2008))
(15) Oct3 / 4, c-Myc (see Nature 454: 646-650 (2008))
(16) Oct3 / 4, Sox2 (see Nature, 451, 141-146 (2008), WO 2008/118820)
(17) Oct3 / 4, Sox2, Nanog (see WO2008 / 118820)
(18) Oct3 / 4, Sox2, Lin28 (see WO2008 / 118820)
(19) Oct3 / 4, Sox2, c-Myc, Esrrb (where Esrrb can be replaced with Esrrg, see Nat. Cell Biol., 11, 197-203 (2009))
(20) Oct3 / 4, Sox2, Esrrb (see Nat. Cell Biol., 11, 197-203 (2009))
(21) Oct3 / 4, Klf4, L-Myc
(22) Oct3 / 4, Nanog
(23) Oct3 / 4 (Cell 136: 411-419 (2009), Nature, 08436, doi: 10.1038 published online (2009))
(24) Oct3 / 4, Klf4, c-Myc, Sox2, Nanog, Lin28, SV40LT (see Science, 324: 797-801 (2009))
(25) Oct3 / 4, Sox2, Klf4, L-Myc, Lin28
(26) Oct3 / 4, Sox2, Klf4, L-Myc, Lin28, Glis1

In (1)-(26) above, other members of the Oct family, such as Oct1A and Oct6, can be used instead of Oct3 / 4. It is also possible to use other members of the Sox family, such as Sox7, in place of Sox2 (or Sox1, Sox3, Sox15, Sox17, Sox18). In addition, a combination that does not fall under (1)-(26) above but contains all the components in any of them and further contains any other substance is also included in the category of "nuclear reprogramming substance" in the present invention. Can be included in. In addition, under the condition that the somatic cell targeted for nuclear reprogramming endogenously expresses some of the components in any of the above (1)-(26) at a sufficient level for nuclear reprogramming. In the present invention, the combination of only the remaining components excluding the component concerned may also be included in the category of "nuclear reprogramming substance" in the present invention.

Among these combinations, at least one selected from Oct3 / 4, Sox2, Klf4, c-Myc or L-Myc, Nanog, Lin28 and SV40LT, preferably two or more, more preferably three or more. Examples are given as preferred nuclear reprogramming materials.

In particular, when considering the use of the obtained iPS cells for therapeutic purposes, the combination of the three factors Oct3 / 4, Sox2 and Klf4 (that is, (9) above) is preferable. On the other hand, if iPS cells are not used for therapeutic purposes (for example, as a research tool for drug discovery screening, etc.), the three factors Oct3 / 4, Sox2 and Klf4, as well as c-Myc 4 factors including the above can be exemplified. Alternatively, regardless of the mode of use of iPS cells, 5 factors (that is, (25) above) obtained by adding L-Myc and Lin28 to 3 factors of Oct3 / 4, Sox2 and Klf4, and Glis1 (that is, (26) above). ) And 6 factors including SV40 Large T can be exemplified.

Furthermore, the combination in which c-Myc is changed to L-Myc in the above is also given as an example of a preferable nuclear reprogramming substance.

For the nucleotide sequences of mouse and human cDNAs of each of the above nuclear reprogramming substances and the amino acid sequence information of the protein encoded by the cDNA, refer to NCBI accession numbers described in WO 2007/069666, and L-Myc, Lin28. , Lin28b, Esrrb, Esrrg and Glis1 mouse and human cDNA sequences and amino acid sequence information can be obtained by referring to the NCBI accession numbers below, respectively. One of ordinary skill in the art can prepare a desired nuclear reprogramming substance by a conventional method based on the cDNA sequence or amino acid sequence information.
Gene name Mouse Human
L-Myc NM_008506 NM_001033081
Lin28 NM_145833 NM_024674
Lin28b NM_001031772 NM_001004317
Esrrb NM_011934 NM_004452
Esrrg NM_011935 NM_001438
Glis1 NM_147221 NM_147193

When the proteinaceous factor itself is used as the nuclear reprogramming substance, the obtained cDNA is inserted into an appropriate expression vector and introduced into a host cell, and the recombinant proteinaceous factor is obtained from the culture obtained by culturing the cells. Can be prepared by recovering. On the other hand, when a nucleic acid encoding a proteinaceous factor is used as the nuclear reprogramming substance, the obtained cDNA can be used as a viral vector, episomal vector or plasmid in the same manner as in the case of the nucleic acid encoding the dominant negative variant of TEAD3. It is inserted into a vector to construct an expression vector and subjected to a nuclear initialization step. If necessary, the above Cre-loxP system and piggyBac transposon system can also be used. When a nucleic acid encoding two or more proteinaceous factors is introduced into a cell as a nuclear reprogramming substance, each nucleic acid may be supported on a separate vector, or a plurality of nucleic acids may be linked in tandem to form a polycistronic vector. It can also be. In the latter case, in order to enable efficient polycistronic expression, for example, 2A sequence of foot-and-mouth disease virus (PLoS ONE 3, e2532, 2008, Stem Cells 25, 1707, 2007), IRES sequence (US Patent No. A 2A sequence is preferably used, such as 4,937,190).

Contact of the nuclear reprogramming substance to somatic cells is as follows: (a) If the substance is a proteinaceous factor, the substance is the proteinaceous factor of (a) in the same manner as the dominant negative variant of TEAD3 above. In the case of the nucleic acid encoding the above, it can be carried out in the same manner as the nucleic acid encoding the dominant negative variant of TEAD3.

(D) IPS cell establishment efficiency improving substance In addition to the above-mentioned TEAD3 function-inhibiting substance, it can be expected that the establishment efficiency of iPS cells will be further enhanced by contacting somatic cells with other known establishment efficiency improving substances.

Examples of substances for improving the efficiency of establishment of iPS cells include histone deacetylase (HDAC) inhibitors [eg, valproic acid (VPA) (Nat. Biotechnol., 26 (7): 795-797 (2008)), tricostatin. Nucleic acid expression such as A, sodium butyrate, small molecule inhibitors such as MC 1293, M344, siRNA and shRNA against HDAC (eg, HDAC1 siRNA Smartpool ™ (Millipore), HuSH 29mer shRNA Constructs against HDAC1 (OriGene), etc.) Inhibitors, etc.], DNA methyltransferase inhibitors (eg, 5'-azacytidine) (Nat. Biotechnol., 26 (7): 795-797 (2008)), G9a histone methyltransferase inhibitors [eg, BIX-01294 (Cell) Small molecule inhibitors such as Stem Cell, 2: 525-528 (2008)), nucleic acid expression inhibitors such as siRNA and shRNA against G9a (eg, G9a siRNA (human) (Santa Cruz Biotechnology), etc.], L. -channel nucleic acid agonist (eg Bayk8644) (Cell Stem Cell, 3, 568-574 (2008)), UTF1 (Cell Stem Cell, 3, 475-479 (2008)), Wnt Signaling activator (eg soluble Wnt3a) ( Cell Stem Cell, 3, 132-135 (2008)), 2i / LIF (2i is an inhibitor of mitogen-activated protein kinase signaling and glycogen synthase kinase-3, PloS Biology, 6 (10), 2237-2247 (2008)) ), ES cell-specific miRNA (eg, miR-302-367 cluster (Mol. Cell. Biol. Doi: 10.1128 / MCB.00398-08), miR-302 (RNA (2008) 14: 1-10), miR -291-3p, miR-294 and miR-295 (above, Nat. Biotechnol. 27: 459-461 (2009))) , 3'-phosphoinositide-dependent kinase-1 (PDK1) acitvator (eg PS48 (Cell Stem Cell, 7: 651-655 (2010)), etc.), Neuropeptide Y (WO 2010/147395), Prostaglandins (eg, PS48 (Cell Stem Cell, 7: 651-655 (2010))) For example, prostaglandin E2 and prostaglandin J2) (WO 2010/068955) and the like can be mentioned, but the present invention is not limited thereto.
The nucleic acid expression inhibitor described above may be in the form of an expression vector containing DNA encoding siRNA or shRNA.

Among the constituent elements of the nuclear reprogramming substance, for example, SV40largeT, etc., is an iPS cell establishment efficiency improving substance in that it is not essential for nuclear reprogramming of somatic cells but is an auxiliary factor. It can also be included in the category. In the current situation where the mechanism of nuclear reprogramming is not clear, whether to position auxiliary factors other than the factors essential for nuclear reprogramming as nuclear reprogramming substances or as substances for improving the establishment efficiency of iPS cells? It may be convenient. That is, since the nuclear reprogramming process of somatic cells is regarded as an overall event caused by the contact of the nuclear reprogramming substance and the iPS cell establishment efficiency improving substance with the somatic cells, it is necessary for those skilled in the art to clearly distinguish between the two. There will be no sex.

Contact of these other iPS cell establishment efficiency improving substances with somatic cells depends on whether the substance is (a) a proteinaceous factor or (b) a nucleic acid encoding the proteinaceous factor, TEAD3. Each of the function-inhibiting substances can be carried out by the same method as described above. When the substance is a low molecular weight compound, the substance may be added to the medium of somatic cells at an appropriate concentration.

(E) Improvement of establishment efficiency by culture conditions By culturing cells under hypoxic conditions in the nuclear initialization step of somatic cells, the establishment efficiency of iPS cells can be further improved. As used herein, the term "hypoxic condition" means that the oxygen concentration in the atmosphere when culturing cells is significantly lower than that in the atmosphere. Specifically, there are conditions of oxygen concentration lower than the oxygen concentration in the atmosphere of _{5-10% CO 2} / 95-90% generally used in normal cell culture, for example, oxygen in the atmosphere. The condition that the concentration is 18% or less is applicable. Preferably, the oxygen concentration in the atmosphere is 15% or less (eg, 14% or less, 13% or less, 12% or less, 11% or less, etc.), 10% or less (eg, 9% or less, 8% or less, 7% or less). , 6% or less, etc.), or 5% or less (eg, 4% or less, 3% or less, 2% or less, etc.). The oxygen concentration in the atmosphere is preferably 0.1% or more (eg, 0.2% or more, 0.3% or more, 0.4% or more, etc.), 0.5% or more (eg, 0.6% or more, 0.7% or more, 0.8% or more, 0.95). 1% or more (eg, 1.1% or more, 1.2% or more, 1.3% or more, 1.4% or more, etc.).
For more detailed culture conditions relating to hypoxic culture, see, for example, WO 2010/013845.

After contacting the nuclear reprogramming substance and the TEAD3 function inhibitor, the cells can be cultured under conditions suitable for culturing ES cells, for example. In the case of mouse cells, Leukemia Inhibitory Factor (LIF) is added as a differentiation inhibitor to a normal medium and cultured. On the other hand, in the case of human cells, it is desirable to add basic fibroblast growth factor (bFGF) and / or stem cell factor (SCF) instead of LIF. In addition, cells are usually cultured as feeder cells in the coexistence of mouse embryo-derived fibroblasts (MEF) that have been treated with radiation or antibiotics to stop cell division. As MEF, STO cells are usually often used, but SNL cells (McMahon, A. P. & Bradley, A. Cell 62, 1073-1085 (1990)) are often used to induce iPS cells. ing. Co-culture with feeder cells may be initiated prior to contact with the nuclear reprogramming agent and TEAD3 function inhibitor, at the time of the contact, or after the contact (eg, 1-10 days). You may.

Selection of candidate colonies for iPS cells includes a method using drug resistance and reporter activity as indicators and a method by visual morphological observation. The former may include, for example, a drug resistance gene and / or at the locus of a gene specifically highly expressed in a pluripotent cell (eg, Fbx15, Nanog, Oct3 / 4, preferably Nanog or Oct3 / 4). Using recombinant cells targeted to the reporter gene, drug-resistant and / or reporter activity-positive colonies are selected. Such recombinant cells include, for example, MEF (Takahashi & Yamanaka, Cell, 126, 663) derived from a mouse in which the βgeo (encoding a fusion protein of β-galactosidase and neomycin phosphotransferase) gene is knocked in at the Fbx15 locus. -676 (2006)) or MEF (Okita et al., Nature, 448, 313-317 (2007)) derived from transgenic mice in which the green fluorescent protein (GFP) gene and the puromycin resistance gene have been integrated into the Nanog locus. And so on. On the other hand, as a method for selecting candidate colonies by visual morphological observation, for example, the method described in Takahashi et al., Cell, 131, 861-872 (2007) can be mentioned. Although the method using reporter cells is simple and efficient, visual colony selection is desirable from the viewpoint of safety when iPS cells are produced for human therapeutic use.

Confirmation that the cells of the selected colony are iPS cells can also be confirmed by the above-mentioned Nanog (or Oct3 / 4) reporter positive (puromycin resistance, GFP positive, etc.) and visual formation of ES cell-like colonies. For more accuracy, tests such as alkaline phosphatase staining, analysis of the expression of various ES cell-specific genes, and transplantation of selected cells into mice to confirm teratoma formation can also be performed. ..

The iPS cells established in this way can be used for various purposes. For example, the differentiation induction method reported for ES cells is used to induce differentiation of iPS cells into various cells (for example, cardiomyocytes, blood cells, nerve cells, vascular endothelial cells, insulin secretory cells, etc.). be able to. Therefore, if iPS cells are induced using somatic cells collected from the patient or another person with the same or substantially the same HLA type, the desired cells (that is, the organ in which the patient is affected) can be induced. Stem cell therapy by autologous transplantation is possible, in which cells and cells that exert a therapeutic effect on diseases are differentiated and transplanted to the patient. Furthermore, functional cells differentiated from iPS cells (eg, hepatocytes) are considered to more reflect the actual state of the functional cells in vivo than the corresponding existing cell lines, and thus are drug candidates. It can also be suitably used for in vitro screening of the medicinal effect and toxicity of a compound.

Hereinafter, the present invention will be further described by way of examples, but the present invention is not limited to the following examples.

Materials and Methods [Method 1] Cell culture Primary culture of mouse embryo fibroblasts (MEFs) was performed according to a previously established method (Okita et al., 2007). MEFs were cultured in Dulbecco's modified Eagle's medium (DMEM, Nacalai Tesque) supplemented with 10% fetal bovine serum (FBS, Invitorogen) under 37 ° C. and 5% CO ₂ conditions. DMEM was supplied with 0.5% penicillin and streptomycin (Invitorogen). Human skin fibroblasts (HDF) were cultured under similar conditions. MEF and HDF-derived iPS cells are supplemented with leukemia inhibitory factor (LIF), 15% FBS, 2 mM L-glutamine (Invitorogen), 0.1 mM non-essential amino acid (Invitorogen), 0.1 mM 2-mercaptoethanol (Invitorogen) and 0.5. Incubated in DMEM containing% penicillin and streptomycin.

[Method 2] Preparation of mouse iPS cells iPS cells were established by a method in which some modifications were made to the previous description (Okita et al., 2007; Takahashi and Yamanaka, 2006). 1 × 10 ⁵ MEFs of cells per well were seeded and cultured overnight. After 24 hours, four factors (Oct3 / 4, Sox2, Klf4 and c-Myc; sometimes abbreviated as “4F” herein) infect the retrovirus inserted in the Nanog-GFP cassette. Introduced 4F into the MEFs. After 24 hours, the cells were passaged once and seeded on a feeder layer of mitomycin C-treated SNL cells in 2.5 × 10 ^{3 cells per dish.} The next day, the medium was replaced with mouse iPS cell medium and then cultured for 30 days.

[Method 3] Preparation of human iPS cells using a retroviral vector iPS cells were established by a method in which some modifications were made to the previous description (Takahashi et al., 2007). HDFs were seeded to 1 × 10 ⁵ cells per well and cultured overnight. 24 hours later, due to retrovirus infection, 4 types of factors (4F: OCT3 / 4, SOX2, KLF4 and c-MYC) or 3 types of factors (4F excluding c-MYC, "3F" in this document. (Sometimes called) was introduced into the HDFs. After 96 hours, the feeder layer of SNL cells treated with mitomycin C to subculture the cells to 2.5 × 10 ⁵ (4 factors) or 5 × 10 ^{5 (3 factors).} Sown on top. The next day, the medium was replaced with primate ES medium (ReproCELL, Japan) supplemented with 4 ng / mL human basic fibroblast growth factor (bFGF), and then cultured for 30 days.

[Method 4] Preparation of human iPS cells using episomal vector iPS cells were established by a method in which some modifications were made to the previous description (Okita et al., 2011). HDFs were cultured in DMEM supplemented with 10% FBS. Follow the instructions of the Neon Transfection System (Invitorogen) with 3 μg of the expression plasmid mixture (pCXLE-hOCT3 / 4-shp53, pCXLE-hSOX2-hKLF4 and pCXLE-hLIN28-hL-MYC) with 100 μL of the kit solution. It was introduced into 6 × 10 ⁵ HDFs by the electroporation method. Electroporation was performed 3 times (3 pulses) at 1650 V, 10 ms. Four days after transduction, the cells were trypsinized and reseeded at a cell density of ^{2 × 10 5} cells on a 100 mm dish covered with a feeder layer of mitomycin C treated SNL cells. The next day, the medium was replaced with bFGF-supplemented primate ES cell medium and then cultured for 30 days.

[Method 5] Alkaline phosphatase staining and immunocytochemistry Alkaline phosphatase (AP) staining was performed according to the protocol of the Alkaline Phosphatase Detection Kit (Sigma). For immunocytochemical analysis, the cells were treated and fixed in PBS containing 4% paraformaldehyde at room temperature for 20 minutes. After washing with PBS, the cells are treated with blocking solution (PBS containing 5% normal goat serum (Millipore), 1% bovine serum albumin (BSA, Nacalai Tesque) and 0.2% Triton X-100) at room temperature for 45 minutes. did. The primary antibody and dilution are as follows.
Anti-OCT4 antibody (1:50, Santa Cruz, sc-5279), anti-SOX2 antibody (1: 100, Abcam, ab75485) and anti-TRA1-60 antibody (1:50, Millipore, MAB4360). Alexa Fluor 488-labeled anti-mouse IgG (1: 500, Invitrogen, A-11001) was used as the secondary antibody. Hoechst 33342 (1 μg / mL, Invitrogen) was used for nuclear staining.

[Method 6] Differentiation-inducing iPS cells were recovered using a CTK solution containing 0.25% trypsin (Invitrogen), 0.1 mg / mL collagenase IV (Invitrogen), 20% KSR and 0.1 mM CaCl _2. The resulting cell mass was suspended in primate ES medium containing 10 μM Y-27632 (Wako) without bFGF and seeded on an ultra-low binding plate (Corning) to form embryoid bodies. To form an embryoid body. The embryoid body was suspended and cultured for 8 days, then seeded on a plate coated with gelatin, and cultured for another 8 days. Then, the cells were subjected to immunocytochemical analysis. The primary antibodies used are as follows.
Anti-Tuj1 antibody (1: 100, Chemicon: MAB1637), anti-α-smooth muscle actin antibody (α-SMA, 1: 500, DAKO: M085101) and anti-α-fetoprotein antibody (1: 100, R & D: MAB1368). Alexa 488-labeled anti-mouse IgG (1: 500, Invitrogen: A-11001) was used as the secondary antibody.

[Method 7] Microarray pretreatment and differential gene expression analysis Microarray slides were scanned using a monochromatic Agilet DNA microarray scanner and analyzed using the default parameters. Raw data was loaded into RStudio (R visual script) and gene expression data for reading, exploration and pretreatment was analyzed using the Bioconductor package Limma. Limma's workflow was used for differential gene expression analysis (DEG). The hierarchical cluster phylogenetic tree (Hierachical derived) was created using hclust in the stat package and agnes in the cluster package. Distance was calculated using the Manhattan city-block distance method, and k-means was calculated using the kmeans function. The distance and correlation matrix was visualized using get_dist and fviz_dist included in the factoroextra package. The cluster scatter plot was calculated using the fviz_cluster function. Expression data for DEGs were clustered using an R script to create Heatmaps. Statistical analysis of gene ontology and gene cluster was performed using DOSE and clusterProfiler package. The microarray data acquired in the present application can be used as accession number GSE56167 in Gene Expression Omnibus.

[Method 8] Gene silencing Continuous knockdown of the p53 gene was performed using short hairpin RNA (shRNA) with some modifications to the previous description (Hong et al., 2009; Masutomi et al., 2003). .. Along with 4F, shRNA (pMKO.1-puro p53 shRNA-2; Addgene plasmid 10672) or simulated vectors (pMXs) for the p53 gene was introduced into MEF or HDF by retroviral infection.
Continuous knockdown of the TEAD3 gene resulted in two shRNAs sh # 1 and sh # 2 for TEAD3 mRNA (target mRNA sequence: sh # 1 5'-AGCATGACCATCAGCGTCTCCACCAAGGT-3' (SEQ ID NO: 5); sh # 2 5 '-AGCAACCAGCACAATAGCGTCCAACAGCT-3' (SEQ ID NO: 4)) was used. HDFs were seeded on 6- ^{well plates at 1 × 10 5} cells / well and cultured overnight. The next day, along with 4F, shRNA or a simulated vector (pSINsi-hH1) was introduced into the HDFs by retrovirus infection. After 4 days, the cells were harvested by trypsin treatment and seeded on a mitomycin C-treated SNL cell feeder layer to form a 2 × 10 ⁵ cell / 100 mm dish.

[Method 9] Teratoma-forming iPS cells were collected using a CTK solution and seeded on a 60 mm dish. After culturing to confluence, cells were harvested and injected into the testis of non-obese diabetic / severe combined immunodeficiency (NOD-SCID) mice (CREA, Japan). Three months after injection, the resulting tumor was incised and fixed with 4% paraformaldehyde in PBS. Sliced sections from paraffin-embedded tissue were stained with hematoxylin and eosin.

Animal Welfare This study was carried out in strict compliance with the recommendations of the Animal Experiment Regulations of Kyoto University.

result
1) iPSCs were prepared from MEFs according to the promoting effect of p38 inhibition on the reprogramming of mouse embryo fibroblasts (MEF) [Method 2]. At that time, 7 compounds known to promote the initialization efficiency of DMSO (vehicle, negative control), p38 selective inhibitor (SB202190, Calbiochem, 10 μM), or MEF 24 hours after the introduction of 4F by retrovirus. Was added to the medium and replaced with a medium containing no of them after 98 hours. The seven compounds and their treatment concentrations are as follows; Vitamin C (Sigma, 10 μg / mL), Valproic acid (Sigma, 1.9 mM), CHIR99021 (Calbiochem, 3 μM), PD0325901 (Calbiochem, 0.5 μM), Interleukin-6 (R & D, 0.2 ng / mL), AS601245 (Calbiochem, 5 μM), Rapamycin (Sigma, 1 μM). As a negative control for the introduction of 4F, cells infected with a retrovirus (empty vector) that does not encode 4F were treated with the same drug. In addition, in order to evaluate the virus infection efficiency, a retrovirus (4F + DsRed) into which the 4F and DsRed genes were inserted was infected, and the same operation was performed.

The number of GFP-positive colonies was measured 21 days (Day 21) and 28 days (Day 28) after the introduction of 4F, and the initialization efficiency was calculated by comparing with the number of GFP-positive colonies of the 4F introduction negative control. At that time, correction was performed based on the number of GFP-positive colonies obtained by infecting the retrovirus (4F + DsRed) into which the 4F and DsRed genes were inserted (correction based on virus infection efficiency). The results are shown in FIG. 1A. The same correction was made in the subsequent analysis of initialization efficiency, but the explanation is omitted.
As shown in FIG. 1A, MEFs treated with a p38 selective inhibitor (SB202190) yielded nearly twice as many GFP-positive colonies as DMSO-treated MEFs on both Day 21 and Day 28. The number of GFP-positive colonies is almost the same as the number of GFP-positive colonies obtained by treatment with the most effective antioxidant (VC, vitamin C) and GSK3β inhibitor (CH, CHIR99021) among the seven known compounds. It was equivalent.

Subsequently, the analysis was performed by changing the period of drug treatment. DMSO or SB202190 was added to the medium during the four periods shown in FIG. 1B (A: Days 1 to 4, B: Days 1 to 8, C: Days 8 to 16, D: Days 1 to 16) to form Day 21. The number of GFP-positive colonies was counted on Day 28. The results are shown in FIG. 1C.
As shown in FIG. 1C, in the experimental group treated with SB202190 in the initial phase (period A), the number of GFP-positive colonies on Day 21 and Day 28 was significantly increased as compared with the control (DMSO treatment during the same period). As shown in FIG. 1D, in the experimental group treated with SB202190 during period A, the number of GFP-positive colonies tended to increase on Day 28 than on Day 21. Furthermore, as shown in FIG. 1E, the number of GFP-positive colonies was significantly higher in the experimental group treated with SB202190 during period A than with the experimental group treated with SB202190 during period D at both Day 21 and Day 28. Interestingly, long-term treatment with SB202190 suppressed iPS cell proliferation (Fig. 7A), suggesting that p38 inhibition in the late phase may impair reprogramming. When chimeric embryos were prepared from mouse iPS cells obtained by treatment with SB202190 in the initial phase (period A) and transplanted into foster mothers, they successfully differentiated into multiple tissues (Fig. 7B), and germline transmission was also confirmed. (Fig. 7C).

From these results, it was clarified that the reprogramming efficiency was significantly increased when p38 was inhibited when the reprogramming factor was expressed in mouse cells and reprogrammed. Furthermore, in mouse cells, inhibition of p38 during the early phase of reprogramming was found to have a very significant reprogramming-promoting effect.

2) Promoting effect of p38 inhibition on reprogramming of human skin fibroblasts (HDF) Whether inhibition of p38 has the same effect on human cells was investigated using multiple P38 selective inhibitors. .. In the step of producing iPSC from HDF ([Method 3]), DMSO (negative control) or p38 selective inhibitor (SB202190, SB203580, SB239063) (SB202190, SB203580, SB239063) during the four periods (A to D) shown in FIG. 2A. One of Calbiochem's final concentration (10 μM) was added to the medium, and the number of GFP-positive colonies was measured 16 days (Day16), 24 days (Day24), and 32 days (Day32) after the introduction of 4F. Initialization. The efficiency calculation method was in accordance with the MEF initialization efficiency calculation method described in 1) above. The results of the experimental group treated with the inhibitor during the period A or D are shown in FIG. 2B. In the experimental group treated with the inhibitor during period A, the number of GFP-positive colonies on Day 24 and Day 32 was significantly and significantly higher than that in the control (DMSO treated) experimental group when any of the above three types of inhibitors was used. (Fig. 2B, left bar graph). Furthermore, even in the experimental group treated with the inhibitor during period D, the number of GFP-positive colonies tended to be significantly higher than that of the control, regardless of the type of the inhibitor (FIG. 2B, right bar graph). In particular, it was shown that when SB202190 or SB203580 was added over the entire phase (period D), the number of GFP-positive colonies on Day32 increased more than twice as much as when added only in the initial phase. ..

Therefore, it was shown that inhibition of p38 in the reprogramming step significantly increases the reprogramming efficiency not only in mouse cells but also in human cells. Furthermore, in the reprogramming of human cells, a very high reprogramming promoting effect (more than twice as much as p38 inhibition only in the reprogramming phase) is obtained when p38 is inhibited not only in the initial phase but also in all phases. It became clear that it would be done.
Furthermore, the above results suggest that there is a difference in the role of p38 in the reprogramming process between mouse cells and human cells, and that p38 may strongly inhibit reprogramming in human cells.

Human iPSCs obtained by treatment with SB202190 maintained ESC-like morphology even after 30 subcultures from Day32 (Fig. 2C) and expressed alkaline phosphatase, which is an ESC-specific marker (Fig. 2C). 2D, [Method 5]). Furthermore, expression of OCT4, SOX2, and TRA-1-60 was observed (Fig. 2E, [Method 5]), confirming that they show a human ESC-like marker profile.

Furthermore, the same analysis was performed when 3F (Oct3 / 4, Sox2 and Klf4) was introduced and expressed with a retroviral vector instead of 4F, or 4F was introduced and expressed with an episomal vector. The results of SB202190 treatment during period A and the measurement of the number of GFP-positive colonies on Day 24 and Day 32 are shown in FIGS. 2F and G.

In both cases of initialization on 3F (Fig. 2F) and expression of 4F with episomal vector (Fig. 2G), the number of GFP-positive colonies finally obtained is significant compared to the control (DMSO) group. And it increased significantly.

Therefore, it was shown that inhibition of p38 during reprogramming of human cells significantly increases the reprogramming efficiency, regardless of the type of reprogramming factor and the method of introducing the reprogramming factor. Although cell proliferation was promoted by treating HDF or HDF introduced with 4F with a p38 inhibitor for 96 hours (FIGS. 8A and B), the proliferation rate of human iPSC changed even if iPSC derived from HDF was treated in the same manner. Did not (Fig. 8C). That is, it was shown that p38 inhibition does not increase the number of iPSCs through the promotion of human iPSC proliferation.

3) Differentiation ability of human iPSC obtained by inhibiting p38 The differentiation ability of human iPSC obtained by inhibiting p38 in the initialization step was analyzed. Three clones (SB1 to SB3) were established from HDF-derived iPSCs obtained by treatment with SB202190, and the expression levels of SOX2, OCT4, and NANOG, which are indicators of pluripotency, were analyzed for the clones (Fig. 3A). As shown in FIG. 3A, SB1 to SB3 are comparable to human iPSCs (DM, B7) and ES cells (ES) obtained by reprogramming without inhibiting p38, or to the same extent as HDF (HD). More than that, the amount of SOX2, OCT4, and NANOG mRNA was increased. In addition, karyotype analysis confirmed that the karyotype was normal (Fig. 3B), indicating that inhibition of p38 in the initialization step does not impair chromosomal stability. Furthermore, when these clones are induced to differentiate into three germ layers via the embryoid body ([Method 6]), the mesoderm expressing smooth muscle actin (A-SMA), β-III tubulin (B-3-TUBULIN) Differentiated into ectoderm expressing α-fetoprotein (AFP) and endoderm expressing α-fetoprotein (AFP) (Fig. 3C). In addition, as a result of analyzing the ability to form teratoma in vivo according to [Method 9], teratoma species were formed from all the analyzed clones and differentiated into three germ layers containing neuroepithelium, cartilage, and various glandular structures. It was confirmed (Fig. 3D). Therefore, it was shown that the human iPSC obtained by inhibiting p38 in the initialization step has the ability to differentiate into three germ layers both in vitro and in vivo.

Furthermore, the effect of p38 inhibition on the initialization efficiency of HDF (HDF1616, HDF1079, HDF1078 and Tig109) derived from four new donors was analyzed. Similar to 2) above, the results of treatment with SB202190 during the initialization step period D and the number of GFP-positive colonies measured on Day 32 are shown in FIG. 3E. When any donor-derived HDF was used, the number of GFP-positive colonies was significantly increased in the SB202190-treated experimental colony compared to the control, that is, the initialization efficiency was significantly promoted by the p38 inhibitor treatment. Was confirmed.

From the above results, human iPSC obtained by inhibiting p38 in the initialization step is comparable to human iPS cells and ES cells obtained without p38 inhibition, has normal karyotype, and differentiates into three germ layers. It was confirmed that it had the ability.

4) Analysis of genes whose expression levels are reduced by both p38 and p53 p53 is a gene that functions as a strong reprogramming barrier in the reprogramming of human and mouse cells. As shown in FIG. 4B, continuous knockdown of p53 using shRNA for p53 mRNA (FIG. 4A) during initialization with 4F ([Method 8]) results in significant and significant iPS cell colony numbers. Increases to (bar of shp53). Surprisingly, in the experimental group (shp53 + SB202190 bars) treated with SB202190 during period A in addition to the continuous knockdown of p53, the number of iPS cell colonies obtained by each single treatment (shp53, SB202190 bars) was controlled. Much more iPS cell colony numbers were obtained than the sum of the increases relative to (DMSO bar) (Fig. 4B). Therefore, it was shown that knockdown of p53 and inhibition of p38 have a synergistic effect (promoting effect) on initialization. This result suggests the existence of transcription factors that are directly or indirectly regulated by p53 and p38.

Transcriptome-based principal component analysis (PCA) of total mRNA to investigate the association between changes caused by P53 knockdown and p38 inhibition and their increased reprogramming efficiency (△ iPS cell colony number). ) Was performed. As a result, three main components (PC1 54.37%, PC2 19.64%, PC3 18.57%) were identified, and each sample was plotted based on the expression levels of these main components, and changes in the expression profile were confirmed (changes in the expression profile). FIG. 4C). Furthermore, these pluripotent transcriptomes were classified into three clusters as a result of hierarchical cluster analysis (Fig. 4D upper panel), and SB202190 processing and shp53 / SB202190 dual processing were classified into the same cluster (cluster C). This suggests the similarity of certain components. However, Sample correlation matrix analysis showed that a large number of genes were regulated separately by the above four treatments, and that the difference between DMSO treatment and double treatment was the largest (Fig. 4D bottom). panel). Similarly, in the k-mean algorithm in the cluster scatter plot, cluster A (DMSO treated group) is most distally mapped from other clusters, and the pluripotent transcriptome controlled by either shp53 or p38 inhibition It was shown to be the most separated along the direction of the first dimension (Fig. 4E). This result is consistent with the above PCA analysis.

In order to identify the factors that are the key to the increase in initialization efficiency, expression level variation gene (DEG) analysis was performed between each cluster. As a result, 1147 genes were found as SB202190-induced DEG and 2185 genes were found as shp53-induced DEG (Fig. 4F), and it was clarified that a very large gene expression change occurred between each cluster. ..

5) Identification of genes that function as an initialization barrier In order to identify genes that function as a strong barrier for initialization, we first analyzed genes whose expression levels decreased in the shp53 treatment group and the shp53 / SB202190 double treatment group. Of these, 651 genes were identified as genes whose expression levels were specifically reduced in the double-treated group (DOWN1 on FIG. 5A). Similarly, genes whose expression levels decreased in the SB202190-treated group and the shp53 / SB202190 double-treated group were analyzed, and among these, 1056 genes were identified as genes whose expression levels decreased specifically in the double-treated group (Fig.). DOWN 2) on 5B. Furthermore, in the analysis of shp53 treatment group and double treatment group, and SB202190 treatment group and double treatment group, those with fold change of 2 or less were excluded and 2-fold cutoff was performed, and 340 genes were common to DOWN1 and DOWN2. Was identified (Fig. 5C).

Of the 340 genes, 31 were classified as having transcription factor or DNA binding activity (Fig. 5D). In the GO enrichment analysis of the 340 genes, tyrosine kinase activity / membrane receptor type kinase activity / membrane receptor type tyrosine kinase activity, collagen binding / collagen receptor activity, oligoglycosyltransferase activity, etc. were hit as the main GO terms. (Fig. 5E).

As a result of various studies on the 31 genes, the present inventors finally found TEAD3 as a gene that functions as a strong barrier for somatic cell reprogramming from among the 31 genes. rice field. First, the relationship between the effect of p53 and / or p38 inhibition on the initialization of HDF by 4F and the expression of endogenous TEAD3 was investigated. As a result, the expression of TEAD3 was significantly reduced when p53 or p38 was inhibited alone as compared with the case of 4F introduction alone (vehicle (DMSO) treatment), but when p53 and p38 were double-inhibited, TEAD3 was observed. Expression was further significantly reduced (FIG. 6A).

6) Increase in initialization efficiency by inhibiting the expression of TEAD3 Next, the role of TEAD3 in initialization was analyzed using specific shRNAs for TEAD3 (4F-shTEAD3 # 1 and # 2, Fig. 6B). .. Expression of these shRNAs during HDF initialization by 4F ([Method 2]) can significantly reduce the expression level of TEAD3 (Fig. 6C) and significantly and significantly increase the number of GFP-positive colonies. Shown (Fig. 6D). It was also confirmed that the colonies obtained by expressing TEAD3 shRNA were positive for alkaline phosphatase (Fig. 6E). Therefore, it was shown that when the expression of TEAD3 was reduced during the initialization of HDF, the initialization efficiency was significantly increased.

GSE36664 dataset containing MEF transcriptome data (see J Biol Chem 2012 Oct 19; 287 (43): 35825-37.), GSE45276 dataset containing human lung fibroblast transcriptome data (MolCell 2011 Apr) 8; 42 (1): 36-49.) And the correlation between TEAD3 and p53 expression using the HDF transcriptome dataset showed a positive correlation in all cells (Fig. 9). ), It is suggested that p53 positively regulates the expression of TEAD3, which is an initialization barrier. From the analysis of the HDF single-cell RNA-Seq dataset, the positive correlation between TEAD3 and MAPK13 (p38δ), ERK4 (MAPK4) and p44-ERK1 (MAPK3), and the progression of the cell cycle of TEAD3 and CDK4, CDK6, etc. A negative correlation with the cyclin-dependent kinase that controls the disease was revealed (Fig. 10).

In order to investigate whether the increase in iPSC colonization ability through the contribution of TEAD3 inhibition to cell cycle kinetics is associated with tumor formation, the ability to form tumor-like masses of HeLa cells with different TEAD3 expression levels was tested. The number and size of cell-derived tumor-like masses whose TEAD3 expression was reduced by the introduction of shRNA were significantly increased as compared with those of control cell-derived tumor-like masses (Fig. 11). In addition, the expression of TEAD3 was lower in the tumor tissue of human cervical cancer than in the normal tissue, confirming the role of TEAD3 in the progression of cancer (Fig. 12).

The HDF introduced with shRNA for 4F and TEAD3 had a faster initialization rate than the HDF introduced with only 4F (4F + non-specific shRNA) (Figs. 13A and B). This could be partially explained by the faster cell proliferation in the early phase of reprogramming (FIGS. 13C and E). However, once pluripotency was acquired, the human iPSC obtained by introducing only 4F and the human iPSC obtained by further introducing shRNA for TEAD3 proliferated at a similar rate (FIGS. 13D and F). It was suggested that iPSC clones induced by TEAD3 inhibition by restoration of cell cycle checkpoints are safe.

Using the GSE116309 dataset (see Stem Cell Reports 2019 Feb 12; 12 (2): 319-332.), We investigated changes in TEAD3 expression during the reprogramming process from MEF to iPS cells, and found that pluripotency was acquired. The expression of TEAD3 decreased sharply immediately before (Fig. 6F). SSEA1 is an early initialization marker in MEF, indicating a successful commitment to initialization. Therefore, using the GSE106835 dataset (see CellStemCell2018Aug2; 23 (2): 289-305.e5.), Changes in TEAD3 expression during the reprogramming process from MEF to iPS cells were examined in SSEA1-positive cells and SSEA1. Each negative cell was examined. As a result, TEAD3 expression was downregulated for pluripotency acquisition only in SSEA1-positive MEF reprogramming intermediates (Fig. 6G). This indicates that only cells that have successfully committed to reprogramming require downregulation of TEAD3 to overcome the cellular mechanism that attempts to block reprogramming.

Furthermore, the present inventors searched for a regulatory mechanism of TEAD3 expression. First, based on the TEAD3 mRNA sequence, the sequence of the promoter region 5'upstream from the genomic DNA information was obtained, and the known transcription initiation site (TSS) sequence was used as a query to perform Blast on the promoter sequence. We found that there is a sequence that matches 100% with AGGGCGGAGC (SEQ ID NO: 6), which is one of the TSS consensus sequences. Therefore, when a transcription factor capable of binding to this TSS sequence was searched, it was presumed that KLF4 could bind to the TSS sequence (FIG. 6H). Furthermore, as a result of analysis of the binding cis-element sequence of the target gene cluster known to bind to KLF4, GGGCGGGGC (SEQ ID NO: 7) was identified as the binding consensus sequence of KLF4, and it has a high homology with the TSS sequence of TEAD3. Confirmed (Fig. 6I). Since it has been suggested that KLF4 is partially regulated by p38, inhibition of p38 may promote pluripotency acquisition by suppressing the transcription of TEAD3.
In addition, as a result of searching the promoter region of TEAD3, the existence of a consensus sequence to which p53 can bind was confirmed.

From these results, it was clarified that TEAD3 functions as a strong barrier that inhibits the reprogramming of human cells, and that the reprogramming efficiency of the cells is promoted by inhibiting the expression or activity thereof.

According to the present invention, by inhibiting the function of TEAD3 in the nuclear initialization step, the iPS cell establishment efficiency can be significantly improved as much as the double inhibition of the p38 pathway and the p53 pathway. Since the method according to the present invention is effective for initialization by various methods, it is extremely useful in terms of both safety and cost for application of human iPS cells to regenerative medicine.

This application is based on Japanese Patent Application No. 2020-101932 filed in Japan on June 11, 2020, the contents of which are all incorporated herein by reference.

Claims

A method for improving the efficiency of establishment of induced pluripotent stem (iPS) cells, which comprises inhibiting the function of transcription enhancer-related domain family member-3 (TEAD3) in the nuclear reprogramming process of somatic cells.
The following (a) to (c):
(A) Nucleic acid or precursor having RNAi activity against the transcript of the TEAD3 gene;
The first aspect of claim 1, wherein the function of TEAD3 is inhibited by introducing one of (b) an antisense nucleic acid against a transcript of the TEAD3 gene; and (c) a ribozyme nucleic acid against a transcript of the TEAD3 gene into a somatic cell. the method of.
The method according to claim 1, wherein the function of TEAD3 is inhibited by introducing a dominant negative mutant of TEAD3 or a nucleic acid encoding the same into a somatic cell.
The method according to claim 1, wherein the function of TEAD3 is inhibited by inhibiting the transcriptional conjugate factor of TEAD3 in somatic cells.
The following (a) or (b):
(A) Decoy nucleic acid for TEAD3;
(B) rrrcwwgyyynnnnnnnnnnnnnrrrcwwgyyy (r stands for a or g, w stands for a or t, y stands for c or t, and n stands independently for a, g, t or c; SEQ ID NO: 3) The method according to claim 1, wherein the function of TEAD3 is inhibited by introducing an oligonucleic acid containing the nucleotide sequence represented by.
An iPS cell establishment efficiency improving agent containing a TEAD3 function inhibitor.
The inhibitor is the following (a) to (c):
(A) Nucleic acid or precursor having RNAi activity against the transcript of the TEAD3 gene;
The agent according to claim 6, wherein (b) an antisense nucleic acid for a transcript of the TEAD3 gene; and (c) a ribozyme nucleic acid for a transcript of the TEAD3 gene.
The agent according to claim 6, wherein the inhibitor is a dominant negative mutant of TEAD3 or a nucleic acid encoding the same.
The agent according to claim 6, wherein the inhibitor is an inhibitor of a transcriptional conjugate factor of TEAD3.
The inhibitor is below (a) or (b):
(A) Decoy nucleic acid for TEAD3;
(B) rrrcwwgyyynnnnnnnnnnnnnrrrcwwgyyy (r stands for a or g, w stands for a or t, y stands for c or t, and n stands independently for a, g, t or c; SEQ ID NO: 3) The agent according to claim 6, which is an oligonucleic acid comprising a nucleotide sequence represented by.
A method for producing iPS cells, which comprises contacting somatic cells with a nuclear reprogramming substance and a function inhibitor of TEAD3.
The inhibitor is the following (a) to (c):
(A) Nucleic acid or precursor having RNAi activity against the transcript of the TEAD3 gene;
The method of claim 11, wherein (b) an antisense nucleic acid for a transcript of the TEAD3 gene; and (c) a ribozyme nucleic acid for a transcript of the TEAD3 gene.
The method according to claim 11, wherein the inhibitor is a dominant negative mutant of TEAD3 or a nucleic acid encoding the same.
The method according to claim 11, wherein the inhibitor is an inhibitor of a transcriptional conjugate factor of TEAD3.
The inhibitor is below (a) or (b):
(A) Decoy nucleic acid for TEAD3;
(B) rrrcwwgyyynnnnnnnnnnnnnrrrcwwgyyy (r stands for a or g, w stands for a or t, y stands for c or t, and n stands independently for a, g, t or c; SEQ ID NO: 3) 11. The method of claim 11, which is an oligonucleic acid comprising a nucleotide sequence represented by.
The method according to any one of claims 11 to 15, wherein the nuclear reprogramming substance is Oct3 / 4, Klf4 and Sox2, or a nucleic acid encoding them.
13. the method of.