WO2021231863A1 - Compositions useful for treatment of pompe disease - Google Patents

Compositions useful for treatment of pompe disease Download PDF

Info

Publication number
WO2021231863A1
WO2021231863A1 PCT/US2021/032451 US2021032451W WO2021231863A1 WO 2021231863 A1 WO2021231863 A1 WO 2021231863A1 US 2021032451 W US2021032451 W US 2021032451W WO 2021231863 A1 WO2021231863 A1 WO 2021231863A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
patient
certain embodiments
muscle
aav
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/032451
Other languages
English (en)
French (fr)
Inventor
James M. Wilson
Juliette HORDEAUX
Hung V. Do
Russell GOTSCHALL
Steven TUSKE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Pennsylvania Penn
Amicus Therapeutics Inc
Original Assignee
University of Pennsylvania Penn
Amicus Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to IL298178A priority Critical patent/IL298178A/en
Priority to CN202180049054.5A priority patent/CN115916334A/zh
Priority to KR1020227043641A priority patent/KR20230010255A/ko
Priority to CA3177954A priority patent/CA3177954A1/en
Priority to JP2022569264A priority patent/JP2023526923A/ja
Priority to BR112022022704A priority patent/BR112022022704A2/pt
Priority to AU2021273273A priority patent/AU2021273273A1/en
Priority to EP21804731.4A priority patent/EP4149519A4/en
Application filed by University of Pennsylvania Penn, Amicus Therapeutics Inc filed Critical University of Pennsylvania Penn
Priority to US17/998,371 priority patent/US20230173108A1/en
Priority to MX2022014255A priority patent/MX2022014255A/es
Publication of WO2021231863A1 publication Critical patent/WO2021231863A1/en
Anticipated expiration legal-status Critical
Priority to CONC2022/0017224A priority patent/CO2022017224A2/es
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18Growth factors; Growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/47Hydrolases (3) acting on glycosyl compounds (3.2), e.g. cellulases, lactases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/65Insulin-like growth factors, i.e. somatomedins, e.g. IGF-1, IGF-2
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/0102Alpha-glucosidase (3.2.1.20)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0306Animal model for genetic diseases
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14171Demonstrated in vivo effect

Definitions

  • ERT enzyme replacement therapy
  • a method for reducing the progression of abnormal muscle pathology and/or reversing abnormal muscle pathology in a patient comprising administering to the patient a recombinant AAV (rAAV) having an AAV capsid and a vector genome packaged therein, wherein the vector genome comprises: (a) a 5’ inverted terminal repeat (ITR); (b) a promoter; (c) a nucleotide sequence encoding a chimeric fusion protein comprising a signal peptide and a vIGF2 peptide fused to a human acid- ⁇ -glucosidase (hGAA), wherein the sequence encoding the chimeric fusion protein is operable linked to regulatory sequences that direct its expression, and comprises SEQ ID NO: 7 or a sequence at least 95% identical thereto that encodes amino acids 1 to 982 of SEQ ID NO
  • the promoter is a constitutive promoter, optionally a CAG promoter or a CB7 promoter.
  • the abnormal muscle pathology is characterized by one or more of i) an elevated percentage of muscle cells with central nuclei; ii) muscle fiber atrophy, iii) anisocytosis in muscle cell fibers, iv) autophagic buildup, v) vacuolation, and vi) weakness.
  • the patient has late- onset Pompe disease. In certain embodiments, the patient has infantile-onset Pompe disease.
  • the vector genome further comprises at least four, at least five, at least six, at least seven, or at least eight miR target sequences, optionally wherein each of the miR target sequences is specific for miR-183.
  • the AAV capsid is an AAVhu68 capsid.
  • the rAAV is administered intravenously and/or intrathecally.
  • the rAAV is administered to the patient via dual routes of administration, optionally wherein the dual routes are intravenous administration and intra-cisterna magna (ICM) administration.
  • ICM intra-cisterna magna
  • a pharmaceutical composition comprising a recombinant AAV (rAAV) having an AAV capsid and a vector genome packaged therein, wherein the vector genome comprises: (a) a 5’ inverted terminal repeat (ITR); (b) a promoter; (c) a nucleotide sequence encoding a chimeric fusion protein comprising a signal peptide and a vIGF2 peptide fused to a human acid- ⁇ -glucosidase (hGAA), wherein the sequence encoding the chimeric fusion protein is operable linked to regulatory sequences that direct its expression, and comprises SEQ ID NO: 7, or a sequence at least 95% identical thereto that encodes amino acids 1 to 982 of SEQ ID NO: 6; (d) a polyA; and (e) a 3’ ITR.
  • ITR inverted terminal repeat
  • hGAA human acid- ⁇ -glucosidase
  • the promoter is a constitutive promoter, optionally a CAG promoter or a CB7 promoter.
  • the vector genome comprises at least four, at least five, at least six, at least seven, or at least eight miR target sequences, optionally wherein each of the miR target sequences is specific for miR-183.
  • the AAV capsid is an AAVhu68 capsid.
  • the composition is formulated for intravenous and/or intrathecal delivery.
  • the abnormal muscle pathology is characterized by one or more of i) an elevated percentage of muscle cells with central nuclei; ii) muscle fiber atrophy, iii) anisocytosis in muscle cell fibers, iv) autophagic buildup, v) vacuolation, and vi) weakness.
  • the patient has late-onset Pompe disease.
  • the patient has infantile-onset Pompe disease.
  • the rAAV is administered to the patient via dual routes of administration, optionally wherein the dual routes are intravenous administration and intra-cisterna magna (ICM) administration.
  • a pharmaceutical composition provided herein is suitable for administration to a post-symptomatic patient has been diagnosed with Pompe disease.
  • the composition is suitable for reversing abnormal muscle pathology in a post-symptomatic patient with Pompe disease.
  • the abnormal muscle pathology is characterized by one or more of i) an elevated percentage of muscle cells with central nuclei; ii) muscle fiber atrophy, iii) anisocytosis in muscle cell fibers, iv) autophagic buildup, v) vacuolation, and vi) weakness.
  • the pharmaceutical composition is suitable for use in a co-therapy, optionally characterized in that the patient further receives treatment with a bronchodilator, an acetylcholinesterase inhibitor, respiratory muscle strength training (RMST), enzyme replacement therapy, and/or diaphragmatic pacing therapy.
  • FIG.1A and FIG.1B show hGAA activity in liver of Pompe (-/-) mice four weeks post intravenous administration of various AAVhu68.hGAA having an engineered coding sequence for hGAAV780I under the direction of a CB6 (third column), CAG (fourth column) or UbC promoter (last column).
  • FIG.1A Low dose (1 x 10 11 GC).
  • FIG.1B High dose (1 x 10 12 ).
  • FIG.2A and FIG.2B show hGAA activity in heart of Pompe (-/-) mice four weeks post intravenous administration of various AAVhu68.hGAA having an engineered coding sequence for hGAAV780I under the direction of a CB6 (third column), CAG (fourth column) or UbC promoter (last column).
  • FIG.2A Low dose (1 x 10 11 GC).
  • FIG.2B High dose (1 x 10 12 ).
  • FIG.3A and FIG.3B show hGAA activity in skeletal muscle (quadriceps) of Pompe (-/-) mice four weeks post intravenous administration of various AAVhu68.hGAA having an engineered coding sequence for a hGAAV780I under the direction of a CB6 (third column), CAG (fourth column) or UbC promoter (last column).
  • FIG.3A Low dose (1 x 10 11 GC).
  • FIG.3B High dose (1 x 10 12 ).
  • FIG.4A and FIG.4B show hGAA activity in brain of Pompe (-/-) mice four weeks post intravenous administration of various AAVhu68.hGAA having an engineered coding sequence for a hGAAV780I under the direction of a CB6 (third column), CAG (fourth column) or UbC promoter (last column).
  • FIG.4A Low dose (1 x 10 11 GC).
  • FIG.4B High dose (1 x 10 12 ).
  • the vector expressing under the CB7 activity has lower activity at both doses, while the vectors expressing under the CAG or UbC promoters have comparable activity at the higher dose.
  • FIG.5A – FIG.5H show histology of the heart in Pompe mice (PAS staining showing glycogen storage) four weeks post-delivery of AAVhu68.hGAA. rAAVhu68 vectors containing five different hGAA expression cassettes were generated and assessed.
  • hGAA refers to the reference natural enzyme (hGAAV780) encoded by the wildtype sequence having the native signal peptide (FIG.5B).
  • BiP- vIGF2.hGAAco refers to an engineered coding sequence for the reference hGAAV780 protein containing a deletion of the first 35 AA, and further having a BiP signal peptide, fusion with IGF2 variant with low affinity to insulin receptor (FIG 5C) (FIG 5D) Image from a vehicle treated control.
  • hGAAcoV780I refers to a hGAAV780I variant encoded by an engineered sequence and containing the native signal peptide (FIG.5E).
  • BiP-vIGF2.hGAAcoV780I refers to the hGAAcoV780I containing a deletion of the first 35 AA, and further having a BiP signal peptide fused with an IGF2 variant with low affinity to insulin receptor and hGAAV780I encoded by the engineered sequence (FIG. 5F).
  • Sp7. ⁇ 8.hGAAcoV780I refers to the hGAAV780I variant with a deletion of the first 35 AA encoded by the same engineered sequence as the previous construct but containing sequences encoding a B2 chymotrypsinogen signal peptide in the place of the native signal peptide (FIG.5G).
  • FIG.5H Blinded histopathology semi-quantitative severity scoring.
  • a board-certified Veterinary Pathologist reviewed the slides in a blinded fashion and established severity scoring based on glycogen storage and autophagy buildup.
  • FIG.6A – FIG.6H show results from histology of quadriceps muscle (PAS stain) in Pompe mice four weeks post-administration of AAVhu68 encoding various hGAA (2.5 x 10 13 GC/kg).
  • Control Pompe (-/-) (FIG.6D) and wildtype (+/+) (FIG.6A) mice received PBS injections.
  • hGAA refers to the reference natural enzyme (hGAAV780) encoded by the wildtype sequence having the native signal peptide (FIG.6B).
  • hGAAcoV780I refers to a hGAAV780I variant encoded by an engineered sequence and containing the native signal peptide (FIG.6E).
  • Sp7. ⁇ 8.hGAAcoV780I refers to the hGAAV780I variant with a deletion of the first 35 AA encoded by the same engineered sequence as the previous construct but containing sequences encoding a B2 chymotrypsinogen signal peptide in the place of the native signal peptide (FIG.6F).
  • BiP-vIGF2.hGAAco refers to the reference hGAAV780 containing a deletion of the first 35 AA, and further having a BiP signal peptide, fusion with IGF2 variant with low affinity to insulin receptor and encoded by an engineered sequence (FIG.6C).
  • BiP- vIGF2.hGAAcoV780I refers to the hGAAV780I containing a deletion of the first 35 AA, and further having a BiP signal peptide fused with an IGF2 variant with low affinity to insulin receptor and hGAAV780I encoded by the engineered sequence (FIG.6G). (FIG.6H) Blinded histopathology semi-quantitative severity scoring.
  • FIG.7A – FIG.7H show results from histology of quadriceps muscle (Periodic acid- Schiff (PAS) stain) from Pompe mice four weeks post-administration of AAVhu68 encoding various hGAA at 2.5 x 10 12 GC/Kg (i.e. a 10-fold lower dose than in FIG.6A – FIG.6H).
  • PAS Periodic acid- Schiff
  • hGAA refers to the reference natural enzyme (hGAAV780) encoded by the wildtype sequence having the native signal peptide (FIG.7B).
  • hGAAcoV780I refers to a hGAAV780I variant encoded by an engineered sequence and containing the native signal peptide (FIG.7E).
  • Sp7. ⁇ 8.hGAAcoV780I refers to the hGAAV780I variant with a deletion of the first 35 AA encoded by the same engineered sequence as the previous construct but containing sequences encoding a B2 chymotrypsinogen signal peptide in the place of the native signal peptide (FIG.7F).
  • BiP-vIGF2.hGAAco refers to the reference hGAAV780 containing a deletion of the first 35 AA, and further having a BiP signal peptide, fusion with IGF2 variant with low affinity to insulin receptor and encoded by an engineered sequence (FIG.7C).
  • BiP-vIGF2.hGAAcoV780I refers to the hGAAV780I containing a deletion of the first 35 AA, and further having a BiP signal peptide fused with an IGF2 variant with low affinity to insulin receptor and hGAAV780I encoded by the engineered sequence (FIG.7G).
  • FIG.7H Blinded histopathology semi- quantitative severity scoring. A board-certified Veterinary Pathologist reviewed the slides in a blinded fashion and established severity scoring based on glycogen storage and autophagy buildup. A score of 0 means no lesion; 1 means less than 9% of muscle fibers affected by storage on average; 2 means 10 to 49%; 3 means 50 to 75% and 4 means 76 to 100%.
  • FIG.8 shows results from histology of the spinal cord (PAS and luxol fast blue stain) from Pompe mice four weeks post administration (2.5 x 10 12 GC/kg) of AAVhu68 having a sequence encoding the native hGAA or an hGAAV780I containing a deletion of the first 35 AA, and further having a BiP signal peptide fused with an IGF2 variant with low affinity to insulin receptor and hGAAV780I encoded by the engineered sequence (“BiP-vIGF2.hGAAcoV780I”). Blinded histopathology semi-quantitative severity scoring was performed on spinal cord sections.
  • FIG.9A – FIG.9C show hGAA activity in plasma and binding to IGF2/CI-MPR.
  • Pompe mice were administered vectors encoding a wildtype hGAA or BiP-vIGF2.hGAA at low dose (2.5 x 10 12 GC).
  • FIG.9A, FIG.9B Four weeks post intravenous administration high levels of wildtype and engineered hGAA activity were detected in plasma.
  • FIG.9C Engineered hGAA binds efficiently to CI-MPR.
  • FIG.10 shows glycogen clearance and resolution of autophagic buildup in Pompe mice four weeks post administration of AAVhu68 constructs at a dose of 2.5 x 10 12 GC/Kg (LD). Paraffin sections of gastrocnemius muscles were stained with DAPI and anti-LC3B antibodies.
  • FIG.11 shows a schematic for a BiP-vIGF2.hGAAcoV780I.4xmiR183 construct.
  • FIG.12 shows glycogen storage (PAS, luxol blue stain) in the brainstem of Pompe mice four weeks post-intravenous administration of AAVhu68.CAG.BiP- vIGF2.hGAAcoV780I.4XmiR183 (containing four copies of a drg-detargeting sequence, miR183) at a high dose (HD: 2.5 x 10 13 GC/kg) or a low dose (LD: 2.5 x 10 12 GC/kg). Arrows show PAS positive storage within neurons.
  • HD 2.5 x 10 13 GC/kg
  • LD low dose
  • FIG.13 shows glycogen storage (PAS, luxol blue stain) in the spinal cord of Pompe mice four weeks post intravenous administration of AAVhu68.CAG.BiP- vIGF2.hGAAcoV780I.4XmiR183 at a high dose (HD: 2.5 x 10 13 GC/kg) or a low dose (LD: 2.5 x 10 12 GC/kg). Arrows show PAS positive storage within neurons.
  • PAS glycogen storage
  • FIG.14 shows glycogen storage (PAS stain) in the quadriceps muscle of Pompe mice four weeks post intravenous administration of AAVhu68.CAG.BiP- vIGF2.hGAAcoV780I.4XmiR183 at a high dose (HD: 2.5 x 10 13 GC/kg) or a low dose (LD: 2.5 x 10 12 GC/kg).
  • AAVhu68.CAG.BiP- vIGF2.hGAAcoV780I.4XmiR183 at a high dose (HD: 2.5 x 10 13 GC/kg) or a low dose (LD: 2.5 x 10 12 GC/kg).
  • FIG.15 shows glycogen storage (PAS stain) in the heart of Pompe mice four weeks post intravenous administration of AAVhu68.CAG.BiP- vIGF2.hGAAcoV780I.4XmiR183 at a high dose (HD: 2.5 x 10 13 GC/kg) or a low dose (LD: 2.5 x 10 12 GC/kg).
  • FIG.16 shows expression the autophagic vacuole marker LC3b in quadriceps muscle of Pompe mice four weeks post intravenous administration of AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I.4XmiR183 at a high dose (HD: 2.5 x 10 13 GC/kg) or a low dose (LD: 2.5 x 10 12 GC/kg).
  • FIG.17 shows representative images of hGAA expression (immunohistochemistry for hGAA) in cervical DRG of rhesus macaques 35 days after the ICM administration of AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I (left) or AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I.4XmiR183 (right) at a high dose of 3x10 13 GC.
  • FIG.18 show representative images of hGAA expression (immunohistochemistry to hGAA) in lumbar DRG of rhesus macaques 35 days after the ICM administration of AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I (left) or AAVhu68.CAG.BiP- vIGF2.hGAAcoV780I.4XmiR183 (right) at a high dose of 3x10 13 GC.
  • FIG.19 shows representative images of hGAA expression (immunohistochemistry to hGAA) in the spinal cord lower motor neurons of rhesus macaques 35 days after the ICM administration of AAVhu68.CAG.BiP- vIGF2.hGAAcoV780I (left) or AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I.4XmiR183 (right) at a high dose of 3x10 13 GC.
  • FIG.20 shows representative images of hGAA expression (immunohistochemistry to hGAA) in the heart of rhesus macaques 35 days after the ICM administration of AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I (left) or AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I.4XmiR183 (right) at a high dose of 3x10 13 GC.
  • FIG.21A – FIG.21C show histopathological scoring of DRG neuronal degeneration and inflammatory cell infiltration in the DRG of cervical segment (FIG.
  • AAVhu68 vectors were delivered in a total volume of 1 mL of sterile artificial CSF (vehicle) injected into the cisterna magna, under fluoroscopic guidance as previously described (Katz et al., Hum Gene Ther. Methods, 2018, 29:212-9).
  • FIG.22A – FIG.22C show AST levels (FIG.22A), ALT levels (FIG.22B), and platelet counts (FIG.22C) for rhesus macaques following ICM administration of AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I or AAVhu68.CAG.BiP- vIGF2.hGAAcoV780I.4XmiR183 at a high dose of 3 x 10 13 GC.
  • FIG.23 shows plasma hGAA activity levels in NHP administered (ICM) AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I or AAVhu68.CAG.BiP- vIGF2.hGAAcoV780I.4XmiR183 at a high dose of 3x10 13 GC at days 0-35 post injection.
  • FIG.24A – FIG.24G show results from nerve conduction velocity tests at baseline and day 35 for NHP administered (ICM, 3 x 10 13 GC) AAVhu68.CAG.BiP- vIGF2.hGAAcoV780I or AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I.4XmiR183.
  • FIG.25A and FIG.25B show body weight longitudinal follow-up from vector injection (day 0) to 180 days post-injection in Pompe mice that were treated at an advanced stage of disease at 7 months of age and were already symptomatic at baseline.
  • FIG.26 and FIG.27 show grip strength relative to body weight longitudinal follow-up from vector injection (day 0) to 180 days post-injection in Pompe mice that were treated at an advanced stage of disease at 7 months of age and were already symptomatic at baseline.
  • Mice received AAVhu68.CAG.BiP- vIGF2.hGAAcoV780I via alternative routes of administration and dose levels: intracerebroventricular (ICV) at high dose (ICV HD: 1x10 11 GC), intravenous (IV) at high dose (IV HD: 5 x 10 13 GC/Kg), and combinations of ICV and IV high doses and ICV and IV low doses.
  • ICV intracerebroventricular
  • IV intravenous
  • Grip strength was measured at various timepoints using a grip strength meter (IITC Life Science).
  • the transducer in the Grip Strength Meter is connected to a wire mesh grid connected to an anodized base plate. The animal is held by its tail and is gently passed over the mesh until it grasps the grid with its four paws Three grip force measures were made, and the average of these readings represents the animal’s grip force at that particular time.
  • FIG.28 shows glycogen storage in the quadriceps, heart, and spinal cord of post- symptomatic Pompe mice following high dose (HD: 1 x 10 11 GC) or low dose (LD: 5 x 10 10 GC) ICV administration of AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I.
  • FIG.29 shows glycogen storage in the quadriceps, heart, and spinal cord of post- symptomatic Pompe mice following high dose (HD: 5 x 10 13 GC/Kg) or low dose (LD: 1 x 10 13 GC/Kg) IV administration of AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I.
  • FIG.30A – FIG.30C show hGAA activity in plasma of Pompe mice administered AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I vector IV, ICV, or IV and ICV (dual route) at day 30 (FIG.30A), day 60 (FIG.30B), and day 90 (FIG.30C).
  • FIG.31 shows a study design for evaluation of single (IV or ICM) and dual routes (IV+ICM) of administration in NHP.
  • FIG.32A – FIG.32H show detection of hGAA (FIG.32A and FIG.32C – plasma; FIG.32B and FIG.32D – CSF) and hGAA activity (FIG.32E and FIG.32G – plasma; FIG.32F and FIG.32H – CSF) following IV or ICM administration of AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I.
  • FIG.33A – FIG.33F show histopathological scoring of DRG neuronal degeneration and inflammatory cell infiltration in cervical segment (FIG.33A), thoracic segment (FIG.33B), and lumbar segment (FIG.33C) and spinal cord axonopathy in cervical segment (FIG.33D), thoracic segment (FIG.33E), and lumbar segment (FIG.
  • FIG.34 shows plasma GAA activity in rhesus macaques following IV (1 x 10 13 GC/Kg or 5 x 10 13 GC/Kg), ICM (1 x 10 13 GC or 3 x 10 13 GC), or IV + ICM (5 x 10 13 GC/Kg IV + 3 x 10 13 GC ICM) administration of AAVhu68.CAG.BiP- vIGF2.hGAAcoV780I.
  • FIG.35A – FIG.35D show measurements of GAA activity in liver and heart (FIG.35A) and diaphragm, triceps, and tibialis anterior (FIG.35B) from rhesus macaques following IV (1 x 10 13 GC/Kg or 5 x 10 13 GC/Kg), ICM (1 x 10 13 GC or 3 x 10 13 GC), or IV + ICM (5 x 10 13 GC/Kg IV + 3 x 10 13 GC ICM) administration of AAVhu68.CAG.BiP-vIGF2.hGAA.coV780I.
  • FIG.36 shows anti-GAA antibody titers in sera from rhesus macaques following IV (1 x 10 13 GC/Kg or 5 x 10 13 GC/Kg), ICM (1 x 10 13 GC or 3 x 10 13 GC), or IV + ICM (5 x 10 13 GC/Kg IV + 3 x 10 13 GC ICM) administration of AAVhu68.CAG.BiP- vIGF2.hGAA.coV780I.
  • FIG.37 shows representative images of hGAA expression (immunohistochemistry to hGAA) in the quadriceps, heart, and spinal cord of rhesus macaques following low dose (IV- 1 x 10 13 GC/Kg, ICM- 1 x 10 13 GC) administration of AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I.
  • FIG.38 shows an analysis of Pompe mice quadriceps muscle and heart GAA activity and glycogen storage (PAS stain) four weeks post intravenous administration of BiP-vIGF2.hGAAcoV780I.4XmiR183 (AAV.hGAAeng) or hGAAV780I encoded by the wildtype sequence having the native signal peptide (AAV.hGAAnat) at a high dose (HD: 2.5 x 10 12 GC/kg).
  • FIG.39 shows an analysis of Pompe mice CNS GAA activity and glycogen storage (PAS stain) four weeks post intravenous administration of BiP- vIGF2.hGAAcoV780I.4XmiR183 (AAV.hGAAeng) or hGAAV780I encoded by the wildtype sequence having the native signal peptide (AAV.hGAAnat) at a high dose (HD: 2.5 x 10 13 GC/kg).
  • FIG.40 shows representative images of hGAA expression (immunohistochemistry to hGAA) in the quadriceps, heart, and spinal cord of Pompe mice four weeks post intravenous administration of BiP- vIGF2.hGAAcoV780I.4XmiR183 (IV 2.5 x 10 13 GC/kg).
  • FIG.41 shows a study overview for as study evaluating treatment of pre- symptomatic (young) Pompe mice which includes IV administration of various doses of AAVhu68.BiP-vIGF2.hGAAcoV780I.4xmir183.
  • FIG.42 shows representative immunofluorescence images of quadriceps muscle sections from young WT, control PBS-treated GAA -/-, and AAVhu68.BiP- vIGF2.hGAAcoV780I.4xmir183 treated GAA -/- mice.
  • WGA cell membrane
  • DAPI nucleus
  • LC3b antibody autophagosome.
  • FIG.43 shows quantification of central nuclei in quadriceps muscle from young Pompe mice that were administered AAVhu68.BiP-vIGF2.hGAAcoV780I.4xmir183.
  • FIG.44 shows quantification of autophagic buildup following LC3b staining in quadriceps muscle from young Pompe mice that were administered AAVhu68.BiP- vIGF2.hGAAcoV780I.4xmir183.
  • FIG.45 shows quantification of muscle fiber diameter in quadriceps muscle from young Pompe mice that were administered AAVhu68.BiP- vIGF2.hGAAcoV780I.4xmir183.
  • FIG.46A – FIG.46F shows semi-quantitative scoring of muscle lysosomal storage pathology (severity of vacuolation) following IV administration of various doses of AAVhu68.BiP-vIGF2.hGAAcoV780I.4xmir183 in soleus (FIG.46A), diaphragm (FIG.46B), quadriceps (FIG.46C), triceps (FIG.46D), gastrocnemius (FIG.46E), and tibialis anterior (FIG.46F).
  • Stats one- way ANOVA (Kruskall Wallis test) followed by post hoc Dunn’s multiple comparison test.
  • FIG.47 provides a study design for evaluation IV, ICV, and IV + ICV routes of administration in Pompe GAA knockout mice.
  • FIG.48 shows representative immunofluorescence images of quadriceps muscle sections from 6–7-month-old WT, control PBS-treated GAA -/-, and AAVhu68.BiP- vIGF2.hGAAcoV780I.4xmir183 treated GAA -/- mice.
  • FIG.49 shows quantification of central nuclei in quadriceps muscle from post- symptomatic Pompe mice that were administered AAVhu68.BiP- vIGF2.hGAAcoV780I.4xmir183.
  • FIG.50 shows quantification of autophagic buildup following LC3b staining of quadriceps muscle tissue from GAA KO mice following IV, ICV, and IV + ICV administration of AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I.rBG.
  • FIG.52 shows quantification of hGAA expressing motor neurons in spinal cord segments following IV, ICM, or IV+ICM administration of AAVhu68.CAG.BiP-IGF2- hGAAcoV780I vector to non-human primates.
  • compositions for delivering a fusion protein comprising a signal peptide and a vIGF2 peptide fused to at least the active portion of a hGAA780I enzyme to patients having Pompe disease. Methods of making and using the same are described herein, including regimens for treating patients with these compositions.
  • the term “Pompe disease,” also referred to as maltase deficiency, glycogen storage disease type II (GSDII), or glycogenosis type II, is intended to refer to a genetic lysosomal storage disorder characterized by a total absence or a partial deficiency in the lysosomal enzyme acid a-glucosidase (GAA) caused by mutations in the GAA gene, which codes for the acid ⁇ -glucosidase.
  • GAA acid a-glucosidase
  • the term includes but is not limited to early and late onset forms of the disease, including but not limited to infantile, juvenile, and adult-onset Pompe disease. It will be understood that the Greek letter “alpha” and the symbol “ ⁇ ” are used interchangeably throughout this specification.
  • the Greek letter “delta” and “ ⁇ ” are used interchangeably throughout this specification.
  • the term “acid ⁇ -glucosidase” or “GAA” refers to a lysosomal enzyme which hydrolyzes ⁇ -1,4 linkages between the D-glucose units of glycogen, maltose and isomaltose
  • Alternative names include but are not limited to lysosomal ⁇ - glucosidase (EC:3.2.1.20); glucoamylase; 1,4- ⁇ -D-glucan glucohydrolase; amyloglucosidase; gamma-amylase and exo-1,4- ⁇ -glucosidase.
  • Human acid ⁇ - glucosidase is encoded by the GAA gene (National Centre for Biotechnology Information (NCBI) Gene ID 2548), which has been mapped to the long arm of chromosome 17 (location 17q25.2-q25.3).
  • the conserved hexapeptide WIDMNE at amino acid residues 516-521 is required for activity of the acid ⁇ -glucosidase protein.
  • the term “hGAA” refers to a coding sequence for a human GAA.
  • a “rAAV.hGAA” refers to a rAAV having an AAV capsid which has packaged therein a vector genome containing, at a minimum, a coding sequence for a GAA enzyme (e.g., a 780I variant, a fusion protein comprising a signal peptide and a vIGF2 peptide fused to at least the active portion of a hGAA780I enzyme).
  • rAAVhu68.hGAA or rAAVhu68.hGAA refers to a rAAV in which the AAV capsid is an AAVhu68 capsid, which is defined herein.
  • the enzyme has been associated with multiple mature proteins, i.e., a mature protein at amino acid positions 70 to 952, a 76 kD mature protein located at amino acid positions 123 to 952, and a 70 kD mature protein at amino acid 204 to amino 952.
  • the “active catalytic site” comprises the hexapeptide WIDMNE (amino acid residues 516-521 of SEQ ID NO: 3). In certain embodiments, a longer fragment may be selected, e.g., positions 516 to 616.
  • ligand binding sites include ligand binding sites, which may be located at one or more of positions 376, 404, 405, 441, 481, 516, 518, 519, 600, 613, 616, 649, 674.
  • hGAA780I or “hGAAV780I” refers to the full-length pre-pro-protein having the amino acid sequence reproduced in SEQ ID NO: 3.
  • hGAAco780I or hGAAcoV780I is used to refer to an engineered sequence encoding hGAA780I.
  • hGAA780I has an isoleucine (Ile or I) at position 780 where the reference hGAA contains a valine (Val or V).
  • This hGAA780I has been unexpectedly found to have a better effect and improved safety profile than the hGAA sequence having a valine at position 780 (hGAAV780), which has been widely described in the literature as the “reference sequence”.
  • the hGAAV780 reference sequence induces toxicity (fibrosing cardiomyositis) not seen as the same dose with the hGAA780I enzyme.
  • hGAA780I may reduce or eliminate fibrosing cardiomyositis in patients receiving therapy with a hGAA.
  • the location of the hGAA signal peptide, mature protein, active catalytic sites, and binding sites may be determined based on the analogous location in the hGAA780I reproduced in SEQ ID NO: 3, i.e., signal peptide at amino acid positions 1 to 27; mature protein at amino acid positions 70 to 952; a 76 kD mature protein located at amino acid positions 123 to 952, and a 70 kD mature protein at amino acid 204 to amino 952; “active catalytic site” comprising hexapeptide WIDMNE (SEQ ID NO: 61) at amino acid residues 516-521; other active sites include ligand binding sites, which may be located at one or more of positions 376, 404..405, 441, 481, 516, 518..519, 600, 613, 616, 649, 674.
  • a hGAA780I may be selected which has a sequence which is at least 95% identical to the hGAA780I, at least 97% identical to the hGAA780I, or at least 99% identical to the hGAA780I of SEQ ID NO: 3. In certain embodiments, provided is sequence which is at least 95%, at least 97%, or at least 99 identity to a mature hGAA780I protein of SEQ ID NO: 3. In certain embodiments, the sequence having at least 95% to at least 99% identity to the hGAA780I has the sequence for the active catalytic site retained without any change.
  • the sequence having at least 95% to at least 99% identity to the hGAA780I to SEQ ID NO: 3 is characterized by having an improved biological effect and better safety profile than the reference hGAAV780 when tested in appropriate animal models.
  • a GAA activity assay may be performed as previously described (see, e.g., J. Hordeaux, et. al., Acta Neuropathological Communications, (2107) 5: 66) or using other suitable methods.
  • the hGAA780I enzyme contains modifications in other positions in the hGAA amino acid sequence.
  • such mutant hGAA780I may retain at a minimum, the active catalytic site: WIDMNE (SEQ ID NO: 61) and amino acids in the region of 780I as described below.
  • a novel hGAA780I fusion protein is provided which comprises a leader peptide other than the native hGAA signal peptide.
  • such an exogenous leader peptide is preferably of human origin and may include, e.g., an IL-2 leader peptide.
  • Particular exogenous signal peptides workable in the certain embodiments include amino acids 1-20 from chymotrypsinogen B2 the signal peptide of human alpha-1-antitrypsin, amino acids 1-25 from iduronate-2- sulphatase, and amino acids 1-23 from protease CI inhibitor. See, e.g., WO2018046774.
  • a chimeric hGAA780I may have the exogenous leader in the place of the entire 27 aa native signal peptide.
  • an N-terminal truncation of the hGAA780I enzyme may lack only a portion of the signal peptide (e.g., a deletion of about 2 to about 25 amino acids, or values therebetween), the entire signal peptide, or a fragment longer than the signal peptide (e.g., up to amino acids 70 based on the numbering of SEQ ID NO: 3.
  • such an enzyme may contain a C-terminal truncation of about 5, 10, 15, or 20 amino acids in length.
  • a novel fusion protein which comprises the mature hGAA780I protein (aa 70 to 952), the mature 70 kD protein (aa 123 to aa 952), or the mature 76 kD protein (aa 204 to 952) bound to a fusion partner.
  • the fusion protein further comprises a signal peptide which is non-native to hGAA.
  • one of these embodiments may further contain a C-terminal truncation of about 5, 10, 15, or 20 amino acids in length.
  • a fusion protein comprising the hGAA780I protein comprises at least amino acids 204 to amino acids 890 of SEQ ID NO: 3 (hGAA780I), or a sequence at least 95% identical thereto which has an Ile at position 780.
  • a hGAA780I protein comprises at least amino acids 204 to amino acids 952 of SEQ ID NO: 3 or a sequence at least 95% identical thereto which has an Ile at position 780.
  • a hGAA780I protein comprises at least amino acids 123 to amino acids 890 of SEQ ID NO: 3 or a sequence at least 95% identical thereto which has an Ile at position 780.
  • the hGAA780I enzyme comprises at least amino acids 70 to amino acids 952 of SEQ ID NO: 3 or a sequence at least 95% identical thereto which has an Ile at position 780.
  • the hGAA780I protein comprises at least amino acids 70 to amino acids 890 of SEQ ID NO: 3, or a sequence at least 95% identical thereto which has an Ile at position 780.
  • the fusion protein comprises the signal and leader sequences and hGAA780I sequence having at least 95% identity, at least 97% identity, or at least 99% identity to SEQ ID NO: 7, has no changes in the active site and/or no changes in the amino acids 3 to 12 amino acids N-terminus and/or C-terminus to the active site.
  • an engineered hGAA expression cassette encodes at least the human hGAA780I fragment of: T - Val(V) - P - Ile (780I) - Glu(E) - Ala(A) - Leu(L) (SEQ ID NO: 62).
  • an engineered hGAA expression cassette encodes a longer human hGAA780I fragment: Gln (Q) - T - V - P - 780I - E - A - L - Gly (G) (SEQ ID NO: 63).
  • an engineered hGAA expression cassette encodes a fragment corresponding to at least: PLGT - Trp (W) - Tyr (Y) - Asp (D) - LQTVP - 780I - EALG - (Ser or S) - L - PPPPAA sequence (SEQ ID NO: 64).
  • a fusion protein comprises a signal peptide, an optional vIGF+2GS extension, an optional ER proteolytic peptide, and the hGAA780I variant with a deletion of first 35 amino acids of hGAA (i.e., lacking the native signal peptide and amino acids 28 to 35).
  • a secreted engineered GAA which comprises a BiP signal peptide, an IGF2+2GS extension and amino acids 61 to 952 of hGAA 780I (with a deletion of amino acids 1 to 60 of hGAA780I).
  • a fusion protein comprising SEQ ID NO: 6, or a sequence at least 95% identical thereto.
  • the fusion protein is encoded by SEQ ID NO: 7, or a sequence at least 95% identical thereto.
  • the fusion protein comprises a sequence of SEQ ID NO: 4, or a sequence at least 95% identical thereto.
  • the fusion protein comprises a sequence of SEQ ID NO: 5, or a sequence at least 95% identical thereto.
  • Components of fusion proteins provided herein are further described below.
  • Peptides that bind CI-MPR Provided herein are peptides that bind CI-MPR (e.g., vIGF2 peptides). Fusion proteins comprising such peptides and a hGAA780I protein, when expressed from a gene therapy vector target the hGAA780I to the cells where it is needed increase cellular uptake by such cells and target the therapeutic protein to a subcellular location (e.g., a lysosome).
  • the peptide is fused to the N-terminus of the hGAA780I protein. In some embodiments, the peptide is fused to the C-terminus of the hGAA780I protein. In some embodiments, the peptide is a vIGF2 peptide. Some vIGF2 peptides maintain high affinity binding to CI-MPR while their affinity for IGF1 receptor, insulin receptor, and IGF binding proteins (IGFBP) is decreased or eliminated. Thus, some variant IGF2 peptides are substantially more selective and have reduced safety risks compared to wildtype IGF2. vIGF2 peptides herein include those having the amino acid sequence of SEQ ID NO: 46.
  • Variant IGF2 peptides further include those with variant amino acids at positions 6, 26, 27, 43, 48, 49, 50, 54, 55, or 65 compared to wildtype IGF2 (SEQ ID NO: 34).
  • the vIGF2 peptide has a sequence having one or more substitutions from the group consisting of E6R, F26S, Y27L, V43L, F48T, R49S, S50I, A54R, L55R, and K65R.
  • the vIGF2 peptide has a sequence having a substitution of E6R.
  • the vIGF2 peptide has a sequence having a substitution of F26S.
  • the vIGF2 peptide has a sequence having a substitution of Y27L. In some embodiments, the vIGF2 peptide has a sequence having a substitution of V43L. In some embodiments, the vIGF2 peptide has a sequence having a substitution of F48T. In some embodiments, the vIGF2 peptide has a sequence having a substitution of R49S. In some embodiments, the vIGF2 peptide has a sequence having a substitution of S50I. In some embodiments, the vIGF2 peptide has a sequence having a substitution of A54R. In some embodiments, the vIGF2 peptide has a sequence having a substitution of L55R.
  • the vIGF2 peptide has a sequence having a substitution of K65R. In some embodiments, the vIGF2 peptide has a sequence having a substitution of E6R, F26S, Y27L, V43L, F48T, R49S, S50I, A54R, and L55R. In some embodiments, the vIGF2 peptide has an N- terminal deletion. In some embodiments, the vIGF2 peptide has an N-terminal deletion of one amino acid. In some embodiments, the vIGF2 peptide has an N-terminal deletion of two amino acids. In some embodiments, the vIGF2 peptide has an N-terminal deletion of three amino acids.
  • the vIGF2 peptide has an N-terminal deletion of four amino acids. In some embodiments, the vIGF2 peptide has an N-terminal deletion of four amino acids and a substitution of E6R, Y27L, and K65R. In some embodiments the vIGF2 peptide has an N-terminal deletion of four amino acids and a substitution of E6R and Y27L. In some embodiments, the vIGF2 peptide has an N- terminal deletion of five amino acids. In some embodiments, the vIGF2 peptide has an N-terminal deletion of six amino acids. In some embodiments, the vIGF2 peptide has an N-terminal deletion of seven amino acids. In some embodiments, the vIGF2 peptide has an N-terminal deletion of seven amino acids and a substitution of Y27L and K65R.
  • Signal Peptides Compositions provided herein further comprise a signal peptide, which improves secretion of hGAA780I from the cell transduced with the gene therapy construct.
  • the signal peptide in some embodiments improves protein processing of therapeutic proteins, and facilitates translocation of the nascent polypeptide-ribosome complex to the ER and ensuring proper co-translational and post-translational modifications.
  • the signal peptide is located (i) in an upstream position of the signal translation initiation sequence, (ii) in between the translation initiation sequence and the therapeutic protein, or (iii) a downstream position of the therapeutic protein.
  • Signal peptides useful in gene therapy constructs include but are not limited to binding immunoglobulin protein (BiP) signal peptide from the family of HSP70 proteins (e.g., HSPA5, heat shock protein family A member 5) and Gaussia signal peptides, and variants thereof. These signal peptides have ultrahigh affinity to the signal recognition particle. Examples of BiP and Gaussia amino acid sequences are provided in the table below.
  • the signal peptide has an amino acid sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID Nos: 49-53.
  • the signal peptide differs from a sequence selected from the group consisting of SEQ ID Nos: 49-53 by 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 amino acid(s).
  • the Gaussia signal peptide is derived from the luciferase from Gaussia princeps and directs increased protein synthesis and secretion of therapeutic proteins fused to this signal peptide.
  • the Gaussia signal peptide has an amino acid sequence that is at least 90% identical to SEQ ID NO: 54.
  • the signal peptide differs from SEQ ID NO: 54 by 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 amino acid(s).
  • Linkers Compositions provided herein comprise a linker between the targeting peptide and the therapeutic protein. Such linkers, in some embodiments, maintain correct spacing and mitigate steric clash between the vIGF2 peptide and the therapeutic protein.
  • Linkers in some embodiments, comprise repeated glycine residues, repeated glycine-serine residues, and combinations thereof.
  • the linker consists of 5-20 amino acids, 5-15 amino acids, 5-10 amino acids, 8-12 amino acids, or about 5, 6, 7, 8, 9, 10, 11, 12 or 13 amino acids.
  • Suitable linkers include but are not limited to those provided in the following table: Throughout this specification, various expression cassettes, vector genomes, vectors, and, compositions, are described as containing a hGAA780I coding sequence or a hGAA780I protein or fusion protein.
  • any of the engineered hGAA780I proteins including N-terminal truncation, C- terminal truncations, and fusion proteins such as those described herein, or coding sequences therefor, may be similarly engineered into expression cassettes, vector genomes, vectors, and compositions.
  • an expression cassette is provided which comprises the nucleic acid sequences described herein.
  • an “expression cassette” refers to a nucleic acid molecule which comprises a nucleic acid sequence encoding a functional gene product operably linked to regulatory sequences which direct its expression in a target cell (e.g., a hGAA780I fusion protein coding sequence) promoter, and may include other regulatory sequences therefor.
  • the regulatory sequences necessary are operably linked to the hGAA780I fusion protein coding sequence in a manner which permits its transcription, translation and/or expression in a target cell.
  • the expression cassette may include one or more miRNA target sequences in the untranslated region(s).
  • the miRNA target sequences are designed to be specifically recognized by miRNA present in cells in which transgene expression is undesirable and/or reduced levels of transgene expression are desired.
  • the expression cassette includes miRNA target sequences that specifically reduce expression of the hGAA780I fusion protein in dorsal root ganglion.
  • the miRNA target sequences are located in the 3’ UTR, 5’ UTR, and/or in both 3’ and 5’ UTR.
  • the expression cassette comprises at least two tandem repeats of dorsal root ganglion (DRG)-specific miRNA target sequences, wherein the at least two tandem repeats comprise at least a first miRNA target sequence and at least a second miRNA target sequence which may be the same or different.
  • DDG dorsal root ganglion
  • the start of the first of the at least two drg-specific miRNA tandem repeats is within 20 nucleotides from the 3’ end of the hGAA780I fusion protein-coding sequence. In certain embodiments, the start of the first of the at least two DRG-specific miRNA tandem repeats is at least 100 nucleotides from the 3’ end of the hGAA780I fusion protein coding sequence. In certain embodiments, the miRNA tandem repeats comprise 200 to 1200 nucleotides in length. In certain embodiment, the inclusion of miR targets does not modify the expression or efficacy of the therapeutic transgene in one or more target tissues, relative to the expression cassette or vector genome lacking the miR target sequences.
  • the vector genome or expression cassette contains at least one miRNA target sequence that is a miR-183 target sequence.
  • the vector genome or expression cassette contains a miR-183 target sequence that includes AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 26), where the sequence complementary to the miR-183 seed sequence is underlined.
  • the vector genome or expression cassette contains more than one copy (e.g. two or three copies) of a sequence that is 100% complementary to the miR-183 seed sequence.
  • a miR-183 target sequence is about 7 nucleotides to about 28 nucleotides in length and includes at least one region that is at least 100% complementary to the miR-183 seed sequence.
  • a miR-183 target sequence contains a sequence with partial complementarity to SEQ ID NO: 26 and, thus, when aligned to SEQ ID NO: 26, there are one or more mismatches.
  • a miR-183 target sequence comprises a sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches when aligned to SEQ ID NO: 26, where the mismatches may be non-contiguous.
  • a miR-183 target sequence includes a region of 100% complementarity which also comprises at least 30% of the length of the miR-183 target sequence. In certain embodiments, the region of 100% complementarity includes a sequence with 100% complementarity to the miR-183 seed sequence.
  • the remainder of a miR-183 target sequence has at least about 80% to about 99% complementarity to miR-183.
  • the expression cassette or vector genome includes a miR-183 target sequence that comprises a truncated SEQ ID NO: 26, i.e., a sequence that lacks at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both the 5’ or 3’ ends of SEQ ID NO: 26.
  • the expression cassette or vector genome comprises a transgene and one miR-183 target sequence
  • the expression cassette or vector genome comprises at least two, three or four miR-183 target sequences.
  • the expression cassette or vector genome comprises at least four, at least five, at least six, at least seven, or at least eight miR-183 target sequences. In certain embodiments, the inclusion of at two, three or four miR-183 target sequences in the expression cassette or vector genome results in increased levels of transgene expression in a target tissue, such as the heart.
  • the vector genome or expression cassette contains at least one miRNA target sequence that is a miR-182 target sequence. In certain embodiments, the vector genome or expression cassette contains an miR-182 target sequence that includes AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 27). In certain embodiments, the vector genome or expression cassette contains more than one copy (e.g.
  • a miR-182 target sequence is about 7 nucleotides to about 28 nucleotides in length and includes at least one region that is at least 100% complementary to the miR-182 seed sequence.
  • a miR-182 target sequence contains a sequence with partial complementarity to SEQ ID NO: 27 and, thus, when aligned to SEQ ID NO: 27, there are one or more mismatches.
  • a miR-183 target sequence comprises a sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches when aligned to SEQ ID NO: 27, where the mismatches may be non-contiguous.
  • a miR-182 target sequence includes a region of 100% complementarity which also comprises at least 30% of the length of the miR-182 target sequence.
  • the region of 100% complementarity includes a sequence with 100% complementarity to the miR-182 seed sequence.
  • the remainder of a miR-182 target sequence has at least about 80% to about 99% complementarity to miR-182.
  • the expression cassette or vector genome includes a miR-182 target sequence that comprises a truncated SEQ ID NO: 27, i.e., a sequence that lacks at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both the 5’ or 3’ ends of SEQ ID NO: 27.
  • the expression cassette or vector genome comprises a transgene and one miR-182 target sequence.
  • the expression cassette or vector genome comprises at least two, three or four miR-182 target sequences.
  • the term “tandem repeats” is used herein to refer to the presence of two or more consecutive miRNA target sequences. These miRNA target sequences may be continuous, i.e., located directly after one another such that the 3’ end of one is directly upstream of the 5’ end of the next with no intervening sequences, or vice versa. In another embodiment, two or more of the miRNA target sequences are separated by a short spacer sequence.
  • spacer is any selected nucleic acid sequence, e.g., of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides in length which is located between two or more consecutive miRNA target sequences.
  • the spacer is 1 to 8 nucleotides in length, 2 to 7 nucleotides in length, 3 to 6 nucleotides in length, four nucleotides in length, 4 to 9 nucleotides, 3 to 7 nucleotides, or values which are longer.
  • a spacer is a non-coding sequence.
  • the spacer may be of four (4) nucleotides.
  • the spacer is GGAT.
  • the spacer is six (6) nucleotides. In certain embodiments, the spacer is CACGTG or GCATGC. In certain embodiments, the tandem repeats contain two, three, four or more of the same miRNA target sequence. In certain embodiments, the tandem repeats contain at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences, etc. In certain embodiments, the tandem repeats may contain two or three of the same miRNA target sequence and a fourth miRNA target sequence which is different.
  • the expression cassette or vector genome includes a combination of at least one, at least two, at least three, or at least four miR183-target sequences and at least one, at least two, at least three, or at least four miR182-target sequences.
  • a 3’ UTR may contain a tandem repeat immediately downstream of the transgene, UTR sequences, and two or more tandem repeats closer to the 3’ end of the UTR.
  • the 5’ UTR may contain one, two or more miRNA target sequences.
  • the 3’ may contain tandem repeats and the 5’ UTR may contain at least one miRNA target sequence.
  • the expression cassette contains two, three, four or more tandem repeats which start within about 0 to 20 nucleotides of the stop codon for the transgene. In other embodiments, the expression cassette contains the miRNA tandem repeats at least 100 to about 4000 nucleotides from the stop codon for the transgene.
  • BiP-vIGF2.hGAAcoV780I.4xmir183 refers to an expression cassette (e.g., as depicted in FIG.11) that contains a engineered coding sequence for a hGAA780I having a modified BiP-vIGF2 signal sequence under the control of the ubiquitous CAG promoter, and four tandem repeats of miR183 target sequences. As illustrated in the Examples provided herein, both the V780I mutation and the BiP-vIGF2 modifications contribute to improved safety and efficacy.
  • the BiP-vIGF2.hGAAcoV780I.4xmir183 includes a sequence encoding a fusion protein of SEQ ID NO: 3, or a sequence at least 95% identical thereto. In certain embodiments, the BiP-vIGF2.hGAAcoV780I.4xmir183 includes the nucleic acid sequence of SEQ ID NO: 7, or a sequence at least 95% to 99% identical thereto. In yet another embodiment, provided herein is a vector genome, wherein BiP-vIGF2.hGAAcoV780I.4xmir183 is flanked by a 5’ ITR and a 3’ ITR. In certain embodiments the vector genome is SEQ ID NO: 30.
  • a vector genome is provided that included a sequence at least 95% identical to SEQ ID NO: 30 and encodes the fusion protein of SEQ ID NO: 6.
  • “operably linked” sequences include both expression control sequences that are contiguous with the hGAA780I coding sequence and expression control sequences that act in trans or at a distance to control the hGAA780I coding sequence.
  • Such regulatory sequences typically include, e.g., one or more of a promoter, an enhancer, an intron, a Kozak sequence, a polyadenylation sequence, and a TATA signal.
  • the regulatory elements direct expression in multiple cells and tissues affected by Pompe disease, in order to permit construction and delivery of a single expression cassette suitable for treating multiple target cells.
  • regulatory elements e.g., a promoter
  • regulatory elements e.g., a promoter
  • the regulatory elements express in CNS, skeletal muscle and heart.
  • the expression cassette permits expression of an encoded hGAA780I in all of liver, skeletal muscle, heart and central nervous system cells.
  • regulatory elements may be selected for targeting specific tissue and avoiding expression in certain cells or tissue (e.g., by use of the drg-detargeting system described herein and/or by selection of a tissue-specific promoter).
  • different expression cassettes provided herein are administered to a patient which preferentially target different tissues.
  • the regulatory sequences comprise a promoter. Suitable promoters may be selected, including but not limited to a promoter which will express an hGAAV780I protein in the targeted cells.
  • a constitutive promoter or an inducible/regulatory promoter is selected.
  • An example of a constitutive promoter is chicken beta-actin promoter.
  • CB7 is a chicken beta-actin promoter with cytomegalovirus enhancer elements; a CAG promoter, which includes the promoter, the first exon and first intron of chicken beta actin, and the splice acceptor of the rabbit beta-globin gene; a CBh promoter, SJ Gray et al, Hu Gene Ther, 2011 Sep; 22(9): 1143- 1153).
  • a regulatable promoter may be selected. See, e.g., WO 2011/126808B2, which is incorporated by reference herein.
  • a tissue-specific promoter may be selected.
  • promoters that are tissue-specific are well known for liver (albumin, Miyatake et al., (1997) J. Virol., 71:5124-32; hepatitis B virus core promoter, Sandig et al., (1996) Gene Ther 3:1002-9; alpha-fetoprotein (AFP) Arbuthnot et al (1996) Hum Gene Ther 7:1503-14), central nervous system, e.g., neuron (such as neuron-specific enolase (NSE) promoter, Andersen et al., (1993) Cell. Mol. Neurobiol., 13:503-15; neurofilament light-chain gene, Piccioli et al., (1991) Proc. Natl.
  • NSE neuron-specific enolase
  • a suitable promoter may include without limitation, an elongation factor 1 alpha (EF1 alpha) promoter (see, e.g., Kim DW et al, Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system.
  • EF1 alpha elongation factor 1 alpha
  • a Synapsin 1 promoter (see, e.g., Riegler S et al, Human synapsin 1 gene promoter confers highly neuron- specific long-term transgene expression from an adenoviral vector in the adult rat brain depending on the transduced area. Gene Ther.2003 Feb;10(4):337-47), a neuron-specific enolase (NSE) promoter (see, e.g., Kim J et al, Involvement of cholesterol-rich lipid rafts in interleukin-6-induced neuroendocrine differentiation of LNCaP prostate cancer cells. Endocrinology.2004 Feb;145(2):613-9.
  • co-therapies may be selected which involve different expression cassettes with tissue-specific promoters which target different cell types.
  • the regulatory sequence further comprises an enhancer.
  • the regulatory sequence comprises one enhancer.
  • the regulatory sequence contains two or more expression enhancers. These enhancers may be the same or may be different.
  • an enhancer may include an Alpha mic/bik enhancer or a CMV enhancer. This enhancer may be present in two copies which are located adjacent to one another. Alternatively, the dual copies of the enhancer may be separated by one or more sequences.
  • the regulatory sequence further comprises an intron.
  • the intron is a chicken beta-actin intron.
  • suitable introns include those known in the art may by a human ⁇ -globulin intron, and/or a commercially available Promega® intron, and those described in WO 2011/126808.
  • the regulatory sequence further comprises a Polyadenylation signal (polyA)
  • polyA is a rabbit globin poly A See e g WO 2014/151341.
  • another polyA e.g., a human growth hormone (hGH) polyadenylation sequence, an SV40 polyA, or a synthetic polyA may be included in an expression cassette.
  • hGH human growth hormone
  • Expression cassettes can be delivered via any suitable delivery system. Suitable non-viral delivery systems are known in the art (see, e.g., Ramamoorth and Narvekar.
  • J Clin Diagn Res.2015 Jan; 9(1):GE01-GE06 which is incorporated herein by reference
  • the vector is a non-viral plasmid that comprises an expression cassette described thereof, e.g., “naked DNA”, “naked plasmid DNA”, RNA, and mRNA; coupled with various compositions and nano particles, including, e.g., micelles, liposomes, cationic lipid - nucleic acid compositions, poly-glycan compositions and other polymers, lipid and/or cholesterol-based - nucleic acid conjugates, and other constructs such as are described herein. See, e.g., X. Su et al, Mol.
  • nucleic acid molecules having sequences encoding a hGAA780I variant, a fusion protein, or a truncated protein, as described herein.
  • the hGAA780I is encoded by the engineered sequence of SEQ ID NO: 4 or a sequence at least 95% identical thereto which encodes the hGAA780I variant.
  • SEQ ID NO: 4 is modified such that the codon encoding the Ile at position 780I is ATT or ATC.
  • a nucleic acid comprising the engineered sequence of SEQ ID NO: 4, or a fragment thereof, is used to express a fusion protein or truncated hGAA780I.
  • the hGAA780I is encoded by SEQ ID NO: 5.
  • the nucleic acid encodes a fusion protein having the amino acid sequence of SEQ ID NO: 6, or a sequence at least 95% identical thereto.
  • a nucleic acid is provided having the sequence of SEQ ID NO: 7 or a sequence at least 95% identical thereto.
  • the nucleic acid molecule is a plasmid.
  • Vectors A “vector” as used herein is a biological or chemical moiety comprising a nucleic acid sequence which can be introduced into an appropriate target cell for replication or expression of the nucleic acid sequence. Examples of a vector include but are not limited to a recombinant virus, a plasmid, Lipoplexes, a Polymersome, Polyplexes, a dendrimer, a cell penetrating peptide (CPP) conjugate, a magnetic particle, or a nanoparticle.
  • CPP cell penetrating peptide
  • a vector is a nucleic acid molecule having an exogenous or heterologous engineered nucleic acid encoding a functional gene product, which can then be introduced into an appropriate target cell.
  • Such vectors preferably have one or more origins of replication, and one or more site into which the recombinant DNA can be inserted.
  • Vectors often have means by which cells with vectors can be selected from those without, e.g., they encode drug resistance genes.
  • Common vectors include plasmids, viral genomes, and “artificial chromosomes”. Conventional methods of generation, production, characterization, or quantification of the vectors are available to one of skill in the art.
  • the vector described herein is a “replication-defective virus” or a “viral vector” which refers to a synthetic or artificial viral particle in which an expression cassette containing a nucleic acid sequence encoding a functional hGAA780I fusion protein packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells.
  • the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be “gutless” - containing only the nucleic acid sequence encoding flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production. Therefore, it is deemed safe for use in gene therapy since replication and infection by progeny virions cannot occur except in the presence of the viral enzyme required for replication.
  • a recombinant viral vector is any suitable viral vector which targets the desired cell(s)
  • a recombinant viral vector preferably targets one or more of the cells and tissues affect affected by Pompe disease, including, central nervous system (e.g., brain), skeletal muscle, heart, and/or liver.
  • the viral vector targets at least the central nervous system (e.g., brain) cells, lung, cardiac cells, or skeletal muscle.
  • the viral vector targets CNS (e.g., brain), skeletal muscle and/or heart.
  • the viral vector targets all of liver, skeletal muscle, heart and central nervous system cells.
  • the examples provide illustrative recombinant adeno-associated viruses (rAAV).
  • viral vectors may include, e.g., a recombinant adenovirus, a recombinant parvovirus such a recombinant bocavirus, a hybrid AAV/bocavirus, a recombinant herpes simplex virus, a recombinant retrovirus, or a recombinant lentivirus.
  • these recombinant viruses are replication-incompetent.
  • the term “host cell” may refer to the packaging cell line in which a vector (e.g., a recombinant AAV) is produced.
  • a host cell may be a prokaryotic or eukaryotic cell (e.g., human, insect, or yeast) that contains exogenous or heterologous DNA that has been introduced into the cell by any means, e.g., electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
  • a prokaryotic or eukaryotic cell e.g., human, insect, or yeast
  • any means e.g., electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
  • host cells may include, but are not limited to an isolated cell, a cell culture, an Escherichia coli cell, a yeast cell, a human cell, a non-human cell, a mammalian cell, a non-mammalian cell, an insect cell, an HEK-293 cell, a liver cell, a kidney cell, a cell of the central nervous system, a neuron, a glial cell, or a stem cell.
  • a host cell contains an expression cassette for production of hGAA780I such that the protein is produced in sufficient quantities in vitro for isolation or purification.
  • the host cell contains an expression cassette encoding hGAAV780I, or a fragment thereof.
  • hGAA780I protein may be included in a pharmaceutical composition administered to a subject as a therapeutic (i.e, enzyme replacement therapy).
  • a therapeutic i.e, enzyme replacement therapy
  • target cell refers to any target cell in which expression of the functional gene product is desired.
  • a “vector genome” refers to the nucleic acid sequence packaged inside a viral vector
  • a “vector genome” contains at a minimum from 5’ to 3’, a vector-specific sequence, a nucleic acid sequence encoding a functional gene product (e.g., a hGAAV780I, a fusion protein hGAAV780I, or another protein) operably linked to regulatory control sequences which direct it expression in a target cell, a vector- specific sequence, and optionally, miRNA target sequences in the untranslated region(s) and a vector-specific sequence.
  • a vector-specific sequence may be a terminal repeat sequence which specifically packages of the vector genome into a viral vector capsid or envelope protein.
  • AAV inverted terminal repeats are utilized for packaging into AAV and certain other parvovirus capsids.
  • Lentivirus long terminal repeats may be utilized where packaging into a lentiviral vector is desired.
  • other terminal repeats e.g., a retroviral long terminal repeat, or the like may be selected.
  • Adeno-associated virus in one aspect, provided herein is a recombinant AAV (rAAV) comprising an AAV capsid and a vector genome packaged therein which encodes an hGAAV780I fusion protein (enzyme) as described herein.
  • the AAV capsid selected targets cells of two or more of liver, muscle, kidney, heart and/or a central nervous system cell type.
  • the AAV capsid selected targets cardiac tissue.
  • the AAV capsid selected to target cardiac tissue is selected from AAV 1, 6, 8, and 9 (see, e.g. Katz et al. Hum Gene Ther Clin Dev.2017 Sep 1; 28(3): 157–164).
  • the AAV capsid selected target cells of the kidney.
  • a capsid for targeting kidney cells is selected from AAV1, 2, 6, 8, 9, and Anc80 (see, e.g., Ikeda Y et al. J Am Soc Nephrol.2018 Sep; 29(9):2287-2297 and Ascio et al. Biochem Biophys Res Commun.2018 Feb 26; 497(1): 19–24).
  • the AAV capsid is a natural or engineered clade F capsid. In certain embodiments, the capsid is an AAV9 capsid or an AAVhu68 capsid.
  • the vector genome comprises an AAV 5’ inverted terminal repeat (ITR) an expression cassette as described herein and an AAV 3’ ITR
  • the vector genome refers to the nucleic acid sequence packaged inside a rAAV capsid forming an rAAV vector. Such a nucleic acid sequence contains AAV inverted terminal repeat sequences (ITRs) flanking an expression cassette.
  • a “vector genome” for packaging into an AAV or bocavirus capsid contains, at a minimum, from 5’ to 3’, an AAV 5’ ITR, a nucleic acid sequence encoding a functional hGAA780I fusion protein as described herein operably linked to regulatory control sequences which direct it expression in a target cell and an AAV 3’ ITR.
  • the ITRs are from AAV2 and the capsid is from a different AAV. Alternatively, other ITRs may be used.
  • the vector genome further comprises miRNA target sequences in the untranslated region(s) which are designed to be specifically recognized by miRNA sequences in cells in which transgene expression is undesirable and/or reduced levels of transgene expression are desired.
  • miR183 target sequences in the vector genome result in increased expression of transgene in the heart.
  • the ITRs are the genetic elements responsible for the replication and packaging of the genome during vector production and are the only viral cis elements required to generate rAAV.
  • the ITRs are from an AAV different than that supplying a capsid.
  • the ITR sequences from AAV2, or the deleted version thereof ( ⁇ ITR), which may be used for convenience and to accelerate regulatory approval.
  • ITRs from other AAV sources may be selected. Where the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped.
  • AAV vector genome comprises an AAV 5’ ITR, the hGAA780I coding sequence and any regulatory sequences, and an AAV 3’ ITR.
  • a shortened version of the 5’ ITR termed ⁇ ITR, has been described in which the D-sequence and terminal resolution site (trs) are deleted. In other embodiments, full-length AAV 5’ ITR and AAV 3’ ITR are used.
  • the vector genome includes a shortened 5’ and/or 3’ AAV2 ITR of 130 base pairs, wherein the external “a” element is deleted.
  • the shortened ITR is reverted back to the wild-type length of 145 base pairs during vector DNA amplification using the internal A element as a template.
  • AAV refers to naturally occurring adeno-associated viruses, adeno-associated viruses available to one of skill in the art and/or in light of the composition(s) and method(s) described herein, as well as artificial AAVs.
  • An adeno- associated virus (AAV) viral vector is an AAV nuclease (e.g., DNase) -resistant particle having an AAV protein capsid into which is packaged expression cassette flanked by AAV inverted terminal repeat sequences (ITRs) for delivery to target cells.
  • a nuclease- resistant recombinant AAV (rAAV) indicates that the AAV capsid has fully assembled and protects these packaged vector genome sequences from degradation (digestion) during nuclease incubation steps designed to remove contaminating nucleic acids which may be present from the production process.
  • the rAAV described herein is DNase resistant.
  • An AAV capsid is composed of 60 capsid (cap) protein subunits, VP1, VP2, and VP3, that are arranged in an icosahedral symmetry in a ratio of approximately 1:1:10 to 1:1:20, depending upon the selected AAV.
  • Various AAVs may be selected as sources for capsids of AAV viral vectors as identified above. See, e.g., US Published Patent Application No.2007-0036760-A1; US Published Patent Application No.2009- 0197338-A1; EP 1310571.
  • the AAV capsid, ITRs, and other selected AAV components described herein may be readily selected from among any AAV, including, without limitation, the AAVs commonly identified as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV8bp, AAVrh10, AAVhu37, AAV7M8 and AAVAnc80, AAVrh90 (PCT/US20/30273, filed April 28, 2020, which is incorporated herein by reference), AAVrh91 (PCT/US20/30266, filed April 28, 2020, which is incorporated herein by reference), and AAVrh92, rh93, and rh91.93 (PCT/US20/30281, filed April 28, 2020, which is incorporated herein by reference) and variants of any of the known or mentioned AAVs or AAVs yet to be discovered or variants or mixtures thereof.
  • AAVrh90 PCT/US20/30273, filed April
  • the AAV capsid is an AAV9 capsid or variant thereof.
  • the capsid protein is designated by a number or a combination of numbers and letters following the term “AAV” in the name of the rAAV vector.
  • the ITRs or other AAV components may be readily isolated or engineered using techniques available to those of skill in the art from an AAV. Such AAV may be isolated, engineered, or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, VA).
  • the AAV sequences may be engineered through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like.
  • AAV viruses may be engineered by conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of nucleic acid sequences, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus, etc.
  • the terms “rAAV” and “artificial AAV” used interchangeably mean, without limitation, a AAV comprising a capsid protein and a vector genome packaged therein, wherein the vector genome comprising a nucleic acid heterologous to the AAV.
  • the capsid protein is a non-naturally occurring capsid.
  • Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vp1 capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV, non- contiguous portions of the same AAV, from a non-AAV viral source, or from a non-viral source.
  • An artificial AAV may be, without limitation, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a “humanized” AAV capsid.
  • AAV2/5 and AAV2/8 are exemplary pseudotyped vectors.
  • the selected genetic element may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
  • the methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering recombinant engineering and synthetic techniques. See, e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).
  • the AAV capsid is selected from among natural and engineered clade F adeno-associated viruses.
  • the clade F adeno-associated virus is AAVhu68. See, WO 2018/160582, which is incorporated by reference herein in its entirety.
  • an AAV capsid is selected from a different clade, e.g., clade A, B, C, D, or E, or from an AAV source outside of any of these clades.
  • the term “clade” as it relates to groups of AAV refers to a group of AAV which are phylogenetically related to one another as determined using a Neighbor-Joining algorithm by a bootstrap value of at least 75% (of at least 1000 replicates) and a Poisson correction distance measurement of no more than 0.05, based on alignment of the AAV vp1 amino acid sequence.
  • the Neighbor-Joining algorithm has been described in the literature. See, e.g., M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000). Computer programs are available that can be used to implement this algorithm.
  • the MEGA v2.1 program implements the modified Nei-Gojobori method.
  • the sequence of an AAV vp1 capsid protein one of skill in the art can readily determine whether a selected AAV is contained in one of the clades identified herein, in another clade, or is outside these clades. See, e.g., G Gao, et al, J Virol, 2004 Jun; 7810: 6381-6388, which identifies Clades A, B, C, D, E and F, and provides nucleic acid sequences of novel AAV, GenBank Accession Numbers AY530553 to AY530629. See, also, WO 2005/033321.
  • AAV9 capsid refers to the AAV9 having the amino acid sequence of (a) GenBank accession: AAS99264, is incorporated by reference herein and the AAV vp1 capsid protein and/or (b) the amino acid sequence encoded by the nucleotide sequence of GenBank Accession: AY530579.1: (nt 1..2211). Some variation from this encoded sequence is encompassed by the present invention, which may include sequences having about 99% identity to the referenced amino acid sequence in GenBank accession: AAS99264 and US7906111 (also WO 2005/033321) (i.e., less than about 1% variation from the referenced sequence).
  • Such AAV may include, e.g., natural isolates (eg hu31 or hu32) or variants of AAV9 having amino acid substitutions deletions or additions, e.g., including but not limited to amino acid substitutions selected from alternate residues “recruited” from the corresponding position in any other AAV capsid aligned with the AAV9 capsid; e.g., such as described in US 9,102,949, US 8,927,514, US2015/349911, WO 2016/049230A1, US 9,623,120, and US 9,585,971.
  • other variants of AAV9, or AAV9 capsids having at least about 95% identity to the above-referenced sequences may be selected.
  • an AAVhu68 capsid is as described in WO 2018/160582, entitled “Novel Adeno-associated virus (AAV) Clade F Vector and Uses Therefor”, which is hereby incorporated by reference.
  • AAVhu68 capsid comprises: AAVhu68 vp1 proteins produced from expression of a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 736 of SEQ ID NO: 2, vp1 proteins produced from SEQ ID NO: 1 or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 1 which encodes the predicted amino acid sequence of 1 to 736 of SEQ ID NO: 2; AAVhu68 vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 1, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO:1 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2
  • the AAVhu68 vp1, vp2 and vp3 proteins are typically expressed as alternative splice variants encoded by the same nucleic acid sequence which encodes the full-length vp1 amino acid sequence of SEQ ID NO: 2 (amino acid 1 to 736).
  • the vp1- encoding sequence is used alone to express the vp1, vp2, and vp3 proteins.
  • this sequence may be co-expressed with one or more of a nucleic acid sequence which encodes the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 2 (about aa 203 to 736) without the vp1-unique region (about aa 1 to about aa 137) and/or vp2-unique regions (about aa 1 to about aa 202), or a strand complementary thereto, the corresponding mRNA (about nt 607 to about nt 2211 of SEQ ID NO: 1), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%) identical to SEQ ID NO: 1 which encodes aa 203 to 736 of SEQ ID NO: 2.
  • a nucleic acid sequence which encodes the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 2 (about aa 203 to 73
  • the vp1-encoding and/or the vp2-encoding sequence may be co-expressed with the nucleic acid sequence which encodes the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 2 (about aa 138 to 736) without the vp1-unique region (about aa 1 to about 137), or a strand complementary thereto, the corresponding mRNA (nt 412 to 2211 of SEQ ID NO: 1), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%) identical to nt 412 to 2211 of SEQ ID NO: 1 which encodes about aa 138 to 736 of SEQ ID NO: 2.
  • a rAAVhu68 has a rAAVhu68 capsid produced in a production system expressing capsids from an AAVhu68 nucleic acid which encodes the vp1 amino acid sequence of SEQ ID NO: 2, and optionally additional nucleic acid sequences, e.g., encoding a vp3 protein free of the vp1 and/or vp2-unique regions.
  • the rAAVhu68 resulting from production using a single nucleic acid sequence vp1 produces the heterogeneous populations of vp1 proteins, vp2 proteins and vp3 proteins.
  • the AAVhu68 capsid contains subpopulations within the vp1 proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues in SEQ ID NO: 2.
  • These subpopulations include, at a minimum, deamidated asparagine (N or Asn) residues.
  • asparagines in asparagine - glycine pairs are highly deamidated.
  • the AAVhu68 vp1 nucleic acid sequence has the sequence of SEQ ID NO: 1, or a strand complementary thereto, e.g., the corresponding mRNA.
  • the vp2 and/or vp3 proteins may be expressed additionally or alternatively from different nucleic acid sequences than the vp1 eg to alter the ratio of the vp proteins in a selected expression system.
  • a nucleic acid sequence which encodes the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 2 (about aa 203 to 736) without the vp1-unique region (about aa 1 to about aa 137) and/or vp2-unique regions (about aa 1 to about aa 202), or a strand complementary thereto, the corresponding mRNA (about nt 607 to about nt 2211 of SEQ ID NO: 2).
  • nucleic acid sequence which encodes the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 2 (about aa 138 to 736) without the vp1-unique region (about aa 1 to about 137), or a strand complementary thereto, the corresponding mRNA (nt 412 to 2211 of SEQ ID NO: 1).
  • nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 2 may be selected for use in producing rAAVhu68 capsids.
  • the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 1 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 1 which encodes SEQ ID NO: 2.
  • the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 1 or a sequence at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to about nt 412 to about nt 2211 of SEQ ID NO: 1 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 2.
  • the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO:1 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to nt 412 to about nt 2211 of SEQ ID NO: 1 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 1. It is within the skill in the art to design nucleic acid sequences encoding this AAVhu68 capsid, including DNA (genomic or cDNA), or RNA (e.g., mRNA).
  • the nucleic acid sequence encoding the AAVhu68 vp1 capsid protein is provided in SEQ ID NO: 2.
  • the AAVhu68 capsid is produced using a nucleic acid sequence of SEQ ID NO: 1 or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% which encodes the vp1 amino acid sequence of SEQ ID NO: 2 with a modification (e.g., deamidated amino acid) as described herein.
  • the vp1 amino acid sequence is reproduced in SEQ ID NO: 2.
  • AAV capsids having reduced capsid deamidation may be selected. See, e.g., PCT/US19/19804 and PCT/US18/19861, both filed Feb 27, 2019 and incorporated by reference in their entireties.
  • the term “heterogeneous” or any grammatical variation thereof refers to a population consisting of elements that are not the same, for example, having vp1, vp2 or vp3 monomers (proteins) with different modified amino acid sequences.
  • SEQ ID NO: 2 provides the encoded amino acid sequence of the AAVhu68 vp1 protein.
  • heterogeneous refers to differences in the amino acid sequence of the vp1, vp2 and vp3 proteins within a capsid.
  • the AAV capsid contains subpopulations within the vp1 proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues. These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues.
  • certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine - glycine pairs and optionally further comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications.
  • a “subpopulation” of vp proteins refers to a group of vp proteins which has at least one defined characteristic in common and which consists of at least one group member to less than all members of the reference group, unless otherwise specified.
  • a “subpopulation” of vp1 proteins is at least one (1) vp1 protein and less than all vp1 proteins in an assembled AAV capsid, unless otherwise specified.
  • a “subpopulation” of vp3 proteins may be one (1) vp3 protein to less than all vp3 proteins in an assembled AAV capsid, unless otherwise specified.
  • vp1 proteins may be a subpopulation of vp proteins;
  • vp2 proteins may be a separate subpopulation of vp proteins, and
  • vp3 are yet a further subpopulation of vp proteins in an assembled AAV capsid.
  • vp1, vp2 and vp3 proteins may contain subpopulations having different modifications, e.g., at least one, two, three or four highly deamidated asparagines, e.g., at asparagine - glycine pairs.
  • highly deamidated refers to at least 45% deamidated, at least 50% deamidated, at least 60% deamidated, at least 65% deamidated, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidated at a referenced amino acid position, as compared to the predicted amino acid sequence at the reference amino acid position (e.g., at least 80% of the asparagines at amino acid 57 based on the numbering of SEQ ID NO: 2 [AAVhu68] may be deamidated based on the total vp1 proteins may be deamidated based on the total vp1, vp2 and vp3 proteins).
  • an rAAV includes subpopulations within the rAAV capsid of vp1, vp2, and/or vp3 proteins with deamidated amino acids, including at a minimum, at least one subpopulation comprising at least one highly deamidated asparagine.
  • other modifications may include isomerization, particularly at selected aspartic acid (D or Asp) residue positions.
  • modifications may include an amidation at an Asp position.
  • an AAV capsid contains subpopulations of vp1, vp2 and vp3 having at least 4 to at least about 25 deamidated amino acid residue positions, of which at least 1 to 10% are deamidated as compared to the encoded amino acid sequence of the vp proteins. The majority of these may be N residues. However, Q residues may also be deamidated.
  • a rAAV has an AAV capsid having vp1, vp2 and vp3 proteins having subpopulations comprising combinations of two, three, four or more deamidated residues at the positions set forth in the table provided in Example 1 and incorporated herein by reference.
  • Deamidation in the rAAV may be determined using 2D gel electrophoresis, and/or mass spectrometry, and/or protein modelling techniques. Online chromatography may be performed with an Acclaim PepMap column and a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF with a NanoFlex source (Thermo Fisher Scientific). MS data is acquired using a data-dependent top-20 method for the Q Exactive HF, dynamically choosing the most abundant not-yet-sequenced precursor ions from the survey scans (200–2000 m/z).
  • Sequencing is performed via higher energy collisional dissociation fragmentation with a target value of 1e5 ions determined with predictive automatic gain control and an isolation of precursors was performed with a window of 4 m/z.
  • Survey scans were acquired at a resolution of 120,000 at m/z 200.
  • Resolution for HCD spectra may be set to 30,000 at m/z200 with a maximum ion injection time of 50 ms and a normalized collision energy of 30.
  • the S-lens RF level may be set at 50, to give optimal transmission of the m/z region occupied by the peptides from the digest.
  • Precursor ions may be excluded with single, unassigned, or six and higher charge states from fragmentation selection.
  • BioPharma Finder 1.0 software may be used for analysis of the data acquired.
  • For peptide mapping searches are performed using a single-entry protein FASTA database with carbamidomethylation set as a fixed modification; and oxidation, deamidation, and phosphorylation set as variable modifications, a 10-ppm mass accuracy, a high protease specificity, and a confidence level of 0.8 for MS/MS spectra.
  • suitable proteases may include, e.g., trypsin or chymotrypsin.
  • Mass spectrometric identification of deamidated peptides is relatively straightforward, as deamidation adds to the mass of intact molecule +0.984 Da (the mass difference between –OH and –NH 2 groups).
  • the percent deamidation of a particular peptide is determined by the mass area of the deamidated peptide divided by the sum of the area of the deamidated and native peptides. Considering the number of possible deamidation sites, isobaric species which are deamidated at different sites may co-migrate in a single peak. Consequently, fragment ions originating from peptides with multiple potential deamidation sites can be used to locate or differentiate multiple sites of deamidation.
  • suitable mass spectrometers may include, e.g., a quadrupole time of flight mass spectrometer (QTOF), such as a Waters Xevo or Agilent 6530 or an orbitrap instrument, such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher).
  • QTOF quadrupole time of flight mass spectrometer
  • Agilent 6530 a Waters Xevo or Agilent 6530
  • orbitrap instrument such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher).
  • liquid chromatography systems include, e.g., Acquity UPLC system from Waters or Agilent systems (1100 or 1200 series).
  • Suitable data analysis software may include, e.g., MassLynx (Waters), Pinpoint and Pepfinder (Thermo Fischer Scientific), Mascot (Matrix Science) Peaks DB (Bioinformatics Solutions)
  • MassLynx Waters
  • Pinpoint and Pepfinder Thermo Fischer Scientific
  • Mascot Metrix Science
  • Peaks DB Bioinformatics Solutions
  • the AAV is modified to change the glycine in an asparagine-glycine pair, to reduce deamidation.
  • the asparagine is altered to a different amino acid, e.g., a glutamine which deamidates at a slower rate; or to an amino acid which lacks amide groups (e.g., glutamine and asparagine contain amide groups); and/or to an amino acid which lacks amine groups (e.g., lysine, arginine and histidine contain amine groups).
  • amino acids lacking amide or amine side groups refer to, e.g., glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine, or tryptophan, and/or proline. Modifications such as described may be in one, two, or three of the asparagine-glycine pairs found in the encoded AAV amino acid sequence. In certain embodiments, such modifications are not made in all four of the asparagine - glycine pairs. Thus, a method for reducing deamidation of AAV and/or engineered AAV variants having lower deamidation rates.
  • a mutant AAV capsid as described herein contains a mutation in an asparagine - glycine pair, such that the glycine is changed to an alanine or a serine.
  • a mutant AAV capsid may contain one, two or three mutants where the reference AAV natively contains four NG pairs.
  • an AAV capsid may contain one, two, three or four such mutants where the reference AAV natively contains five NG pairs.
  • a mutant AAV capsid contains only a single mutation in an NG pair.
  • a mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, a mutant AAV capsid contains mutation is two different NG pairs which are located in structurally separate location in the AAV capsid. In certain embodiments, the mutation is not in the VP1-unique region. In certain embodiments, one of the mutations is in the VP1-unique region.
  • a mutant AAV capsid contains no modifications in the NG pairs, but contains mutations to minimize or eliminate deamidation in one or more asparagines or a glutamine, located outside of an NG pair.
  • AAVhu68 capsid protein 4 residues (N57, N329, N452, N512) routinely display levels of deamidation >70% and it most cases >90% across various lots. Additional asparagine residues (N94, N253, N270, N304, N409, N477, and Q599) also display deamidation levels up to ⁇ 20% across various lots. The deamidation levels were initially identified using a trypsin digest and verified with a chymotrypsin digestion. The AAVhu68 capsid contains subpopulations within the vp1 proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues in SEQ ID NO: 2.
  • subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues.
  • certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine - glycine pairs in SEQ ID NO: 2 and optionally further comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications.
  • N highly deamidated asparagines
  • SEQ ID NO: 2 amino acids
  • the rAAV as described herein is a self-complementary AAV.
  • “Self-complementary AAV” refers a construct in which a coding region carried by a recombinant AAV nucleic acid sequence has been designed to form an intra-molecular double-stranded DNA template. Upon infection, rather than waiting for cell mediated synthesis of the second strand, the two complementary halves of scAAV will associate to form one double stranded DNA (dsDNA) unit that is ready for immediate replication and transcription.
  • dsDNA double stranded DNA
  • AAV adeno-associated virus
  • Such a method involves culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid; a functional rep gene; an expression cassette as described herein flanked by AAV inverted terminal repeats (ITRs); and sufficient helper functions to permit packaging of the expression cassette into the AAV capsid protein.
  • the host cell which contains a nucleic acid sequence encoding an AAV capsid; a functional rep gene; a vector genome as described; and sufficient helper functions to permit packaging of the vector genome into the AAV capsid protein.
  • the host cell is a HEK 293 cell.
  • Suitable methods may include without limitation, baculovirus expression system or production via yeast. See, e.g., Robert M. Kotin, Large-scale recombinant adeno- associated virus production. Hum Mol Genet.2011 Apr 15; 20(R1): R2–R6. Published online 2011 Apr 29. doi: 10.1093/hmg/ddr141; Aucoin MG et al., Production of adeno- associated viral vectors in insect cells using triple infection: optimization of baculovirus concentration ratios. Biotechnol Bioeng.2006 Dec 20;95(6):1081-92; SAMI S.
  • the method for separating rAAV9 particles having packaged genomic sequences from genome-deficient AAV9 intermediates involves subjecting a suspension comprising recombinant AAV9 viral particles and AAV 9 capsid intermediates to fast performance liquid chromatography, wherein the AAV9 viral particles and AAV9 intermediates are bound to a strong anion exchange resin equilibrated at a pH of 10.2, and subjected to a salt gradient while monitoring eluate for ultraviolet absorbance at about 260 and about 280.
  • the pH may be in the range of about 10.0 to 10.4.
  • the AAV9 full capsids are collected from a fraction which is eluted when the ratio of A260/A280 reaches an inflection point.
  • the diafiltered product may be applied to a Capture SelectTM Poros- AAV2/9 affinity resin (Life Technologies) that efficiently captures the AAV2/9 serotype. Under these ionic conditions, a significant percentage of residual cellular DNA and proteins flow through the column, while AAV particles are efficiently captured.
  • Capture SelectTM Poros- AAV2/9 affinity resin Life Technologies
  • the number of particles (pt) per 20 ⁇ L loaded is then multiplied by 50 to give particles (pt) /mL.
  • Pt/mL divided by GC/mL gives the ratio of particles to genome copies (pt/GC).
  • Pt/mL–GC/mL gives empty pt/mL.
  • Empty pt/mL divided by pt/mL and x 100 gives the percentage of empty particles.
  • methods for assaying for empty capsids and AAV vector particles with packaged genomes have been known in the art. See, e.g., Grimm et al., Gene Therapy (1999) 6:1322-1330; Sommer et al., Molec. Ther. (2003) 7:122-128.
  • the methods include subjecting the treated AAV stock to SDS- polyacrylamide gel electrophoresis, consisting of any gel capable of separating the three capsid proteins, for example, a gradient gel containing 3-8% Tris-acetate in the buffer, then running the gel until sample material is separated, and blotting the gel onto nylon or nitrocellulose membranes preferably nylon
  • Anti-AAV capsid antibodies are then used as the primary antibodies that bind to denatured capsid proteins, preferably an anti-AAV capsid monoclonal antibody, most preferably the B1 anti-AAV-2 monoclonal antibody (Wobus et al., J. Viral. (2000) 74:9281-9293).
  • a secondary antibody is then used, one that binds to the primary antibody and contains a means for detecting binding with the primary antibody, more preferably an anti-IgG antibody containing a detection molecule covalently bound to it, most preferably a sheep anti-mouse IgG antibody covalently linked to horseradish peroxidase.
  • a method for detecting binding is used to semi- quantitatively determine binding between the primary and secondary antibodies, preferably a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit.
  • samples from column fractions can be taken and heated in SDS-PAGE loading buffer containing reducing agent (e.g., DTT), and capsid proteins were resolved on pre-cast gradient polyacrylamide gels (e.g., Novex).
  • Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions or other suitable staining method, i.e. SYPRO ruby or Coomassie stains.
  • the concentration of AAV vector genomes (vg) in column fractions can be measured by quantitative real time PCR (Q-PCR). Samples are diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA.
  • the samples are further diluted and amplified using primers and a TaqManTM fluorogenic probe specific for the DNA sequence between the primers.
  • the number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 Sequence Detection System.
  • Plasmid DNA containing identical sequences to that contained in the AAV vector is employed to generate a standard curve in the Q-PCR reaction.
  • the cycle threshold (Ct) values obtained from the samples are used to determine vector genome titer by normalizing it to the Ct value of the plasmid standard curve. End-point assays based on the digital PCR can also be used.
  • an optimized q-PCR method which utilizes a broad- spectrum serine protease, e.g., proteinase K (such as is commercially available from Qiagen). More particularly, the optimized qPCR genome titer assay is similar to a standard assay, except that after the DNase I digestion, samples are diluted with proteinase K buffer and treated with proteinase K followed by heat inactivation Suitably samples are diluted with proteinase K buffer in an amount equal to the sample size.
  • the proteinase K buffer may be concentrated to 2 fold or higher. Typically, proteinase K treatment is about 0.2 mg/mL, but may be varied from 0.1 mg/mL to about 1 mg/mL.
  • the treatment step is generally conducted at about 55 °C for about 15 minutes, but may be performed at a lower temperature (e.g., about 37 °C to about 50 °C) over a longer time period (e.g., about 20 minutes to about 30 minutes), or a higher temperature (e.g., up to about 60 °C) for a shorter time period (e.g., about 5 to 10 minutes).
  • heat inactivation is generally at about 95 °C for about 15 minutes, but the temperature may be lowered (e.g., about 70 to about 90 °C) and the time extended (e.g., about 20 minutes to about 30 minutes).
  • ddPCR droplet digital PCR
  • Methods for determining single-stranded and self-complementary AAV vector genome titers by ddPCR have been described. See, e.g., M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods.2014 Apr;25(2):115-25. doi: 10.1089/hgtb.2013.131. Epub 2014 Feb 14. Methods for determining the ratio among vp1, vp2, and vp3 of capsid protein are also available.
  • compositions in the rAAV described herein are intended to be applied to other compositions, regimens, aspects, embodiments, and methods described across the Specification.
  • Pharmaceutical Composition A pharmaceutical composition comprising an hGAA780I fusion protein or an expression cassette comprising the hGAA780I fusion protein transgene may be a liquid suspension, a lyophilized or frozen composition, or another suitable formulation.
  • the composition comprises hGAA780I fusion protein or an expression cassette and a physiologically compatible liquid (eg a solution diluent carrier) which forms a suspension.
  • Such a liquid is preferably aqueous based and may contain one or more: buffering agent(s), surfactant(s), pH adjuster(s), preservative(s), or other suitable excipients. Suitable components are discussed in more detail below.
  • the pharmaceutical composition comprises the aqueous suspending liquid and any selected excipients, and a hGAA780I fusion protein or the expression cassette.
  • the pharmaceutical composition comprises the expression cassette comprising the transgene and a non-viral delivery system.
  • the pharmaceutical composition is a suspension comprising the expression cassette comprising the transgene engineered in a viral vector system.
  • the pharmaceutical composition comprises a non-replicating viral vector.
  • Suitable viral vectors may include any suitable delivery vector, such as, e.g., a recombinant adenovirus, a recombinant lentivirus, a recombinant bocavirus, a recombinant adeno-associated virus (AAV), or another recombinant parvovirus.
  • the viral vector is a recombinant AAV for delivery of a gene product to a patient in need thereof.
  • the pharmaceutical composition comprises a hGAA780I fusion protein or an expression cassette comprising the coding sequences for the hGAA780I fusion protein and a formulation buffer suitable for delivery via intracerebroventricular (ICV), intrathecal (IT), intracisternal, or intravenous (IV) injection.
  • the expression cassette is part of a vector genome packaged a recombinant viral vector (i.e., an rAAV.hGAA780I carrying a fusion protein).
  • the pharmaceutical composition comprises a hGAA780I fusion protein, or a functional fragment thereof, for delivery to a subject as an enzyme replacement therapy (ERT).
  • ERT enzyme replacement therapy
  • compositions are usually administered intravenously, however intradermal, intramuscular or oral administration is also possible in some circumstances.
  • the compositions can be administered for prophylactic treatment of individuals suffering from, or at risk of, Pompe disease.
  • the pharmaceutical compositions are administered to a patient suffering from established disease in an amount sufficient to reduce the concentration of accumulated metabolite and/or prevent or arrest further accumulation of metabolite.
  • the pharmaceutical compositions are administered prophylactically in an amount sufficient to either prevent or inhibit accumulation of metabolite.
  • the modified GAA compositions described herein are administered in a therapeutically effective amount.
  • a therapeutically effective amount can vary depending on the severity of the medical condition in the subject, as well as the subject's age, general condition, and gender. Dosages can be determined by the physician and can be adjusted as necessary to suit the effect of the observed treatment.
  • a pharmaceutical composition for ERT formulated to contain a unit dosage of a hGAA780I fusion protein, or functional fragment thereof.
  • a composition includes a final formulation suitable for delivery to a subject, e.g., is an aqueous liquid suspension buffered to a physiologically compatible pH and salt concentration.
  • one or more surfactants are present in the formulation.
  • the composition may be transported as a concentrate which is diluted for administration to a subject.
  • the composition may be lyophilized and reconstituted at the time of administration.
  • a composition as provided herein comprises a surfactant, preservative, excipients, and/or buffer dissolved in the aqueous suspending liquid.
  • the buffer is PBS.
  • the buffer is an artificial cerebrospinal fluid (aCSF), e.g., Eliott’s formulation buffer; or Harvard apparatus perfusion fluid (an artificial CSF with final Ion Concentrations (in mM): Na 150; K 3.0; Ca 1.4; Mg 0.8; P 1.0; Cl 155).
  • Suitable solutions include those which include one or more of: buffering saline, a surfactant, and a physiologically compatible salt or mixture of salts adjusted to an ionic strength equivalent to about 100 mM sodium chloride (NaCl) to about 250 mM sodium chloride, or a physiologically compatible salt adjusted to an equivalent ionic concentration.
  • the formulation is adjusted to a physiologically acceptable pH, e.g., in the range of pH 6 to 8, or pH 6.5 to 7.5, pH 7.0 to 7.7, or pH 7.2 to 7.8.
  • a pH within this range may be desired; whereas for intravenous delivery, a pH of 6.8 to about 7.2 may be desired.
  • a suitable surfactant, or combination of surfactants may be selected from among non-ionic surfactants that are nontoxic.
  • a difunctional block copolymer surfactant terminating in primary hydroxyl groups is selected, e.g., such as Pluronic® F68 [BASF], also known as Poloxamer 188, which has a neutral pH, has an average molecular weight of 8400.
  • Poloxamers may be selected, i.e., nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (poly (propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly (ethylene oxide)), SOLUTOL HS 15 (Macrogol-15 Hydroxystearate), LABRASOL (Polyoxy capryllic glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid esters), ethanol and polyethylene glycol.
  • the formulation contains a poloxamer.
  • copolymers are commonly named with the letter “P” (for poloxamer) followed by three digits: the first two digits x 100 give the approximate molecular mass of the polyoxypropylene core, and the last digit x 10 gives the percentage polyoxyethylene content.
  • Poloxamer 188 is selected.
  • the surfactant may be present in an amount up to about 0.0005 % to about 0.001% of the suspension.
  • the formulation may contain, e.g., buffered saline solution comprising one or more of sodium chloride, sodium bicarbonate, dextrose, magnesium sulfate (e.g., magnesium sulfate ⁇ 7H2O), potassium chloride, calcium chloride (e.g., calcium chloride ⁇ 2H2O), dibasic sodium phosphate, and mixtures thereof, in water.
  • the osmolarity is within a range compatible with cerebrospinal fluid (e.g., about 275 to about 290); see, e.g., emedicine.medscape.com/article/2093316-overview.
  • a commercially available diluent may be used as a suspending agent, or in combination with another suspending agent and other optional excipients. See, e.g., Elliotts B® solution [Lukare Medical].
  • the formulation may contain one or more permeation enhancers.
  • suitable permeation enhancers may include, e.g., mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-laurel ether, or EDTA.
  • compositions comprising a pharmaceutically acceptable carrier and a vector comprising a nucleic acid sequence as described herein.
  • carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of described herein into suitable host cells.
  • the rAAV vector may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like.
  • a therapeutically effective amount of the vector is included in the pharmaceutical composition.
  • the selection of the carrier is not a limitation of the present invention.
  • Other conventional pharmaceutically acceptable carrier such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol.
  • Suitable chemical stabilizers include gelatin and albumin.
  • the phrase “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host.
  • the term “dosage” or “amount” can refer to the total dosage or amount delivered to the subject in the course of treatment, or the dosage or amount delivered in a single unit (or multiple unit or split dosage) administration.
  • the aqueous suspension or pharmaceutical compositions described herein are designed for delivery to subjects in need thereof by any suitable route or a combination of different routes.
  • the pharmaceutical composition is formulated for delivery via intracerebroventricular (ICV), intrathecal (IT), or intracisternal injection.
  • the compositions described herein are designed for delivery to subjects in need thereof by intravenous injection.
  • Intrathecal delivery refers to a route of administration for drugs via an injection into the spinal canal, more specifically into the subarachnoid space so that it reaches the cerebrospinal fluid (CSF).
  • Intrathecal delivery may include lumbar puncture, intraventricular, suboccipital/intracisternal, and/or C1-2 puncture.
  • material may be introduced for diffusion throughout the subarachnoid space by means of lumbar puncture.
  • injection may be into the cisterna magna.
  • Intracisternal delivery may increase vector diffusion and/or reduce toxicity and inflammation caused by the administration. See, e.g., Christian Hinderer et al, Widespread gene transfer in the central nervous system of cynomolgus macaques following delivery of AAV9 into the cisterna magna, Mol Ther Methods Clin Dev.2014; 1: 14051. Published online 2014 Dec 10. doi: 10.1038/mtm.2014.51.
  • intracisternal delivery or “intracisternal administration” refer to a route of administration for drugs directly into the cerebrospinal fluid of the brain ventricles or within the cisterna magna cerebellomedularis, more specifically via a suboccipital puncture or by direct injection into the cisterna magna or via permanently positioned tube.
  • a pharmaceutical composition comprising a vector as described herein in a formulation buffer.
  • the replication-defective virus compositions can be formulated in dosage units to contain an amount of replication-defective virus that is in the range of about 1.0 x 10 9 GC to about 1.0 x 10 16 GC (to treat an average subject of 70 kg in body weight) including all integers or fractional amounts within the range, and preferably 1.0 x 10 12 GC to 1.0 x 10 14 GC for a human patient.
  • the compositions are formulated to contain at least 1x10 9 , 2x10 9 , 3x10 9 , 4x10 9 , 5x10 9 , 6x10 9 , 7x10 9 , 8x109, or 9x10 9 GC per dose including all integers or fractional amounts within the range.
  • compositions are formulated to contain at least 1x10 10 , 2x10 10 , 3x10 10 , 4x10 10 , 5x10 10 , 6x10 10 , 7x10 10 , 8x10 10 , or 9x10 10 GC per dose including all integers or fractional amounts within the range.
  • compositions are formulated to contain at least 1x10 11 , 2x10 11 , 3x10 11 , 4x10 11 , 5x10 11 , 6x10 11 , 7x10 11 , 8x10 11 , or 9x10 11 GC per dose including all integers or fractional amounts within the range.
  • compositions are formulated to contain at least 1x10 12 2x10 12 3x10 12 4x10 12 , 5x10 12 , 6x10 12 , 7x10 12 , 8x10 12 , or 9x10 12 GC per dose including all integers or fractional amounts within the range.
  • compositions are formulated to contain at least 1x10 13 , 2x10 13 , 3x10 13 , 4x10 13 , 5x10 13 , 6x10 13 , 7x10 13 , 8x10 13 , or 9x10 13 GC per dose including all integers or fractional amounts within the range.
  • compositions are formulated to contain at least 1x10 14 , 2x10 14 , 3x10 14 , 4x10 14 , 5x10 14 , 6x10 14 , 7x10 14 , 8x10 14 , or 9x10 14 GC per dose including all integers or fractional amounts within the range.
  • compositions are formulated to contain at least 1x10 15 , 2x10 15 , 3x10 15 , 4x10 15 , 5x10 15 , 6x10 15 , 7x10 15 , 8x10 15 , or 9x10 15 GC per dose including all integers or fractional amounts within the range.
  • the dose can range from 1x10 10 to about 1x10 12 GC per dose including all integers or fractional amounts within the range.
  • a pharmaceutical composition comprising a rAAV as described herein in a formulation buffer.
  • the rAAV is formulated at about 1 x 10 9 genome copies (GC)/mL to about 1 x 10 14 GC/mL.
  • the rAAV is formulated at about 3 x 10 9 GC/mL to about 3 x 10 13 GC/mL.
  • the rAAV is formulated at about 1 x 10 9 GC/mL to about 1 x 10 13 GC/mL.
  • the rAAV is formulated at least about 1 x 10 11 GC/mL.
  • the pharmaceutical composition comprising a rAAV as described herein is administrable at a dose of about 1 x 10 9 GC per gram of brain mass to about 1 x 10 14 GC per gram of brain mass. It should be understood that the compositions in the pharmaceutical compositions described herein are intended to be applied to other compositions, regimens, aspects, embodiments, and methods described across the Specification. Method of Treatment A therapeutic regimen for treating a patient having Pompe disease is provided which comprises an expression cassette, an rAAV, and/or hGAA780I fusion protein as described herein, optionally in combination with an immunomodulator.
  • the patient has late onset Pompe disease. In other embodiments, the patient has childhood onset Pompe disease.
  • a co-therapeutic is delivered with the expression cassette rAAV or hGAA780I fusion protein such as an immunomodulatory regimen. Additionally, or alternatively, the co-therapy may include one or more of a bronchodilator, an acetylcholinesterase inhibitor, respiratory muscle strength training (RMST), enzyme replacement therapy, and/or diaphragmatic pacing therapy.
  • the patient receives a single administration of an rAAV. In certain embodiments, the patient receives a single administration of a composition comprising an expression cassette and/or an rAAV as described herein.
  • this single administration of a composition comprising an effective amount of an expression cassette involves at least one co-therapeutic.
  • a patient is administered an expression cassette, rAAV, and/or hGAA780I fusion protein or as described herein via two different routes at substantially the same time.
  • the two different routes of injection are intravenous and intrathecal administration.
  • the composition is a suspension is delivered to the subject intracerebroventricularly, intrathecally, intracisternally, or intravenously.
  • a patient having a deficiency in alpha- glucosidase is administered a composition as provided herein to improve one or more of cardiac, respiratory, and/or skeletal muscle function.
  • an expression cassette, rAAV, viral or non-viral vector is used in preparing a medicament.
  • use of a composition for treating Pompe disease is provided. These compositions may be used in combination with other therapies, including, e.g., immunotherapies, enzyme replacement therapy (e.g., Lumizyme, marketed by Genzyme, a Sanofi Corporation, and as Myozyme outside the United States). Additional treatment of Pompe disease is symptomatic and supportive.
  • respiratory support may be required; physical therapy may be helpful to strengthen respiratory muscles; some patients may need respiratory assistance through mechanical ventilation (i.e. bipap or volume ventilators) during the night and/or periods of the day.
  • mechanical ventilation i.e. bipap or volume ventilators
  • Orthopedic devices including braces may be recommended for some patients.
  • Surgery may be required for certain orthopedic symptoms such as contractures or spinal deformity.
  • Some infants may require the insertion of a feeding tube that is run through the nose down the esophagus and into the stomach (nasogastric tube). In some children, a feeding tube may need to be inserted directly into the stomach through a small surgical opening in the abdominal wall.
  • Some individuals with late onset Pompe disease may require a soft diet, but few require feeding tubes.
  • compositions provided herein are effective to treat and reverse the muscle pathology.
  • autophagosome accumulation was completely resolved in aged Pompe mice with pre-existing pathology at treatment.
  • treatment with vectors provided herein can significantly increase the percentage of large muscle fibers, and a decrease the percentage of small muscle fibers in skeletal muscle.
  • typically treatment-resistant pathologies such as the muscle fiber size and autophagic build-up are responsive to treatment.
  • the patient is pre-symptomatic.
  • the patient is post-symptomatic, including older patients with more advanced stages of the disease and treatment includes improving (or reversing) symptoms of Pompe disease.
  • the abnormal muscle pathology is characterized by one or more i) an elevated percentage of muscle cells with central nuclei; ii) muscle fiber atrophy, iii) anisocytosis in muscle cell fibers, iv) and autophagic buildup, v) vacuolation, and vi) weakness.
  • the methods improve the patient’s breathing and/or movement.
  • the terms “increase” e.g., increasing hGAA levels following treatment with hGAA780I fusion protein as measured in tissue, blood, etc.
  • “Patient” or “subject”, as used herein interchangeably, means a male or female mammalian animal, including a human, a veterinary or farm animal, a domestic animal or pet, and animals normally used for clinical research.
  • the subject of these methods and compositions is a human patient.
  • the subject of these methods and compositions is a male or female human.
  • the suspension has a pH of about 7.28 to about 7.32. Suitable volumes for delivery of these doses and concentrations may be determined by one of skill in the art. For example, volumes of about 1 ⁇ L to 150 mL may be selected, with the higher volumes being selected for adults.
  • a suitable volume is about 0.5 mL to about 10 mL, for older infants, about 0.5 mL to about 15 mL may be selected. For toddlers, a volume of about 0.5 mL to about 20 mL may be selected. For children, volumes of up to about 30 mL may be selected. For pre-teens and teens, volumes up to about 50 mL may be selected. In still other embodiments, a patient may receive an intrathecal administration in a volume of about 5 mL to about 15 mL are selected, or about 7.5 mL to about 10 mL. Other suitable volumes and dosages may be determined.
  • the dosage will be adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed.
  • the composition comprising an rAAV as described herein is administrable at a dose of about 1 x 10 9 GC per gram of brain mass to about 1 x 10 14 GC per gram of brain mass.
  • the rAAV is co-administered systemically at a dose of about 1 x 10 9 GC per kg body weight to about 1 x 10 13 GC per kg body weight.
  • the rAAV is administered or co-administered systemically at a dosage of about 1 x 10 11 GC per kg body weight to about 5 x 10 13 GC per kg body weight.
  • the subject is delivered a therapeutically effective amount of the expression cassette, rAAV or hGAA780I fusion protein described herein.
  • a “therapeutically effective amount” refers to the amount of the expression cassette, rAAV, or hGAA780I fusion protein, or a combination thereof.
  • the method comprises administering to a subject a rAAV or expression cassette for delivery of an hGAA780I fusion protein-encoding nucleic acid sequence in combination with administering a composition comprising an hGAA780I fusion protein enzyme provided herein.
  • the expression cassette is in a vector genome delivered in an amount of about 1 x 10 9 GC per gram of brain mass to about 1 x 10 13 genome copies (GC) per gram (g) of brain mass, including all integers or fractional amounts within the range and the endpoints.
  • the dosage is 1 x 10 10 GC per gram of brain mass to about 1 x 10 13 GC per gram of brain mass.
  • the dose of the vector administered to a patient is at least about 1.0 x 10 9 GC/g, about 1.5 x 10 9 GC/g, about 2.0 x 10 9 GC/g, about 2.5 x 10 9 GC/g, about 3.0 x 10 9 GC/g, about 3.5 x 10 9 GC/g, about 4.0 x 10 9 GC/g, about 4.5 x 10 9 GC/g, about 5.0 x 10 9 GC/g, about 5.5 x 10 9 GC/g, about 6.0 x 10 9 GC/g, about 6.5 x 10 9 GC/g, about 7.0 x 10 9 GC/g, about 7.5 x 10 9 GC/g, about 8.0 x 10 9 GC/g, about 8.5 x 10 9 GC/g, about 9.0 x 10 9 GC/g, about 9.5 x 10 9 GC/g, about 1.0 x 10 10 GC/g, about 1.5 x 10 10 GC/g, about 2.0 x 10
  • the composition comprising an rAAV as described herein is administered systemically at a dosage of about 1 x 10 11 GC per kg of body weight to about 5 x 10 13 GC per kg of body weight.
  • the rAAV is administered via the ICM at a dosage of about 1 x 10 12 GC to about 5 x 10 13 GC.
  • the rAAV is co-administered via intravenous and ICM routes, wherein the patient is administered a dosage of about 1 x 10 11 GC per kg of body weight to about 5 x 10 13 GC per kg of body weight (IV) and a dosage of about 1 x 10 12 GC to about 5 x 10 13 GC (ICM).
  • the method of treatment comprises delivery of the hGAA780I fusion protein as an enzyme replacement therapy.
  • hGAA780I fusion protein is delivered as an ERT in combination with a gene therapy (including but not limited to an expression cassette or an rAAV as provided herein).
  • the method comprises administering to a subject more than one ERT (e.g. a composition comprising hGAA780I fusion protein in combination with another therapeutic protein, such as Lumizyme).
  • a composition comprising a hGAA780I fusion protein described herein may be administered to a subject every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more days.
  • Administration may be by intravenous infusion to an outpatient, prescribed weekly, monthly, or bimonthly administration.
  • Appropriate therapeutically effective dosages of the compounds are selected by the treating clinician and include from about 1 ⁇ g/kg to about 500 mg/kg, from about 10 mg/kg to about 100 mg/kg, from about 20 mg/kg to about 100 mg/kg and approximately 20 mg/kg to approximately 50 mg/kg.
  • a suitable therapeutic dose is selected from, for example, 0.1, 0.25, 0.5, 0.75, 1, 5, 10, 15, 20, 30, 40, 50, 60, 70, and 100 mg/kg.
  • the method comprises administering hGAA780I fusion protein to a subject at a dosage of 10 mg/kg patient body weight or more per week to a patient.
  • Dosages regimes can range from 10 mg/kg per week to at least 1000 mg/kg per week. Typically dosage regimes are 10 mg/kg per week, 15 mg/kg per week, 20 mg/kg per week, 25 mg/kg per week, 30 mg/kg per week, 35 mg/kg per week, 40 mg/kg week, 45 mg/kg per week, 60 mg/kg week 80 mg/kg per week and 120 mg/kg per week In preferred regimes 10 mg/kg 15 mg/kg, 20 mg/kg, 30 mg/kg or 40 mg/kg is administered once, twice, or three times weekly. Treatment is typically continued for at least 4 weeks, sometimes 24 weeks, and sometimes for the life of the patient.
  • hGAA780I is administered at an initially “high” dose (i.e., a “loading dose”), followed by administration of a lower doses (i.e., a “maintenance dose”).
  • a loading dose is at least about 40 mg/kg patient body weight 1 to 3 times per week (e.g., for 1, 2, or 3 weeks).
  • a maintenance dose is at least about 5 to at least about 10 mg/kg patient body weight per week, or more, such as 20 mg/kg per week, 30 mg/kg per week, 40 mg/kg week.
  • a dosage is administered at increasing rate during the dosage period. Such can be achieved by increasing the rate of flow intravenous infusion or by using a gradient of increasing concentration of hGAA780I fusion protein administered at constant rate. Administration in this manner may reduce the risk of immunogenic reaction.
  • the intravenous infusion occurs over a period of several hours (e.g., 1-10 hours and preferably 2-8 hours, more preferably 3-6 hours), and the rate of infusion is increased at intervals during the period of administration.
  • the method further comprises the subject receives an immunosuppressive co-therapy.
  • Immunosuppressants for such co-therapy include, but are not limited to, a glucocorticoid, steroids, antimetabolites, T-cell inhibitors, a macrolide (e.g., a rapamycin or rapalog), and cytostatic agents including an alkylating agent, an anti-metabolite, a cytotoxic antibiotic, an antibody, or an agent active on immunophilin.
  • the immune suppressant may include a nitrogen mustard, nitrosourea, platinum compound, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, an anthracycline, mitomycin C, bleomycin, mithramycin, IL-2 receptor- or CD3-directed antibodies, anti-IL-2 antibodies, ciclosporin, tacrolimus, sirolimus, IFN- ⁇ , IFN- ⁇ , an opioid, or TNF- ⁇ (tumor necrosis factor-alpha) binding agent.
  • the immunosuppressive therapy may be started 0, 1, 2, 7, or more days prior to the gene therapy administration.
  • compositions comprising the expression cassette as described herein are administrated once to the subject in need.
  • the expression cassette is delivered via an rAAV.
  • the compositions and methods provided herein may be used to treat infantile onset-Pompe disease or late-onset Pompe disease and/or the symptoms associated therewith.
  • efficacy can be determined by improvement of one or more symptoms of the disease or a slowing of disease progression.
  • Symptoms of infantile onset-Pompe disease include, but are not limited to, hypotonia, respiratory/breathing problems, hepatomegaly, hypertrophic cardiomyopathy, as well as glycogen storage in heart, muscles, CNS (especially motor neurons).
  • Symptoms of late onset-Pompe disease include, but are not limited to, proximal muscle weakness, respiratory/breathing problems, as well as glycogen storage in muscles and motor neurons.
  • the route of administration may be determined based on a patient’s condition and/or diagnosis.
  • a method for treatment of a patient diagnosed with infantile-onset Pompe disease or late-onset Pompe disease that includes administering a rAAV described herein for delivery of hGAA780I fusion protein via a combination of IV and ICM routes.
  • a patient identified as having late-onset Pompe disease is administered a treatment that includes only systemic delivery of a rAAV (e.g., only IV).
  • delivery of a composition comprising a rAAV can be in combination with enzyme replacement therapy (ERT).
  • ERT enzyme replacement therapy
  • a subject identified as having infantile-onset Pompe disease is administered a rAAV described herein via ICM injection and also receives ERT for treatment of aspects of peripheral disease.
  • a “nucleic acid”, as described herein, can be RNA, DNA, or a modification thereof, and can be single or double stranded, and can be selected, for example, from a group including: nucleic acid encoding a protein of interest, oligonucleotides, nucleic acid analogues for example peptide-nucleic acid (PNA) pseudocomplementary PNA (pc-PNA), locked nucleic acid (LNA) etc.
  • PNA peptide-nucleic acid
  • pc-PNA pseudocomplementary PNA
  • LNA locked nucleic acid
  • nucleic acid sequences include, for example, but are not limited to, nucleic acid sequence encoding proteins, for example that act as transcriptional repressors, antisense molecules, ribozymes, small inhibitory nucleic acid sequences, for example but are not limited to RNAi, shRNAi, siRNA, micro RNAi (mRNAi ), antisense oligonucleotides etc.
  • Methods for “backtranslating” a protein, peptide, or polypeptide are known to those of skill in the art. Once the sequence of a protein is known, there are web-based and commercially available computer programs, as well as service-based companies which back translate the amino acids sequences to nucleic acid coding sequences.
  • RNA and/or cDNA coding sequences are designed for optimal expression in human cells.
  • the term “percent (%) identity”, “sequence identity”, “percent sequence identity”, or “percent identical” in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for correspondence.
  • the length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired. Percent identity may be readily determined for amino acid sequences over the full-length of a protein, polypeptide, about 32 amino acids, about 330 amino acids, or a peptide fragment thereof or the corresponding nucleic acid sequence coding sequences.
  • a suitable amino acid fragment may be at least about 8 amino acids in length, and may be up to about 700 amino acids.
  • identity when referring to “identity”, “homology”, or “similarity” between two different sequences, “identity”, “homology” or “similarity” is determined in reference to “aligned” sequences. “Aligned” sequences or “alignments” refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence. Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs.
  • Sequence alignment programs are available for amino acid sequences, e.g., the “Clustal X”, “Clustal Omega” “MAP”, “PIMA”, “MSA”, “BLOCKMAKER”, “MEME”, and “Match-Box” programs. Generally, any of these programs are used at default settings, although one of skill in the art can alter these settings as needed. Alternatively, one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs. See, e.g., J. D. Thompson et al, Nucl. Acids. Res., 27(13):2682-2690 (1999). Multiple sequence alignment programs are also available for nucleic acid sequences.
  • Such programs include, “Clustal W”, “Clustal Omega”, “CAP Sequence Assembly”, “BLAST”, “MAP”, and “MEME”, which are accessible through Web Servers on the internet. Other sources for such programs are known to those of skill in the art. Alternatively, Vector NTI utilities are also used. There are also a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using FastaTM, a program in GCG Version 6.1. FastaTM provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences.
  • nucleic acid sequences can be determined using FastaTM with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 6.1, herein incorporated by reference.
  • regulatory sequence or “expression control sequence” refers to nucleic acid sequences, such as initiator sequences, enhancer sequences, and promoter sequences, which induce, repress, or otherwise control the transcription of protein encoding nucleic acid sequences to which they are operably linked.
  • exogenous as used to describe a nucleic acid sequence or protein means that the nucleic acid or protein does not naturally occur in the position in which it exists in a chromosome, or host cell.
  • exogenous nucleic acid sequence also refers to a sequence derived from and inserted into the same host cell or subject, but which is present in a non-natural state, e.g. a different copy number, or under the control of different regulatory elements.
  • heterologous as used to describe a nucleic acid sequence or protein means that the nucleic acid or protein was derived from a different organism or a different species of the same organism than the host cell or subject in which it is expressed.
  • heterologous when used with reference to a protein or a nucleic acid in a plasmid, expression cassette, or vector, indicates that the protein or the nucleic acid is present with another sequence or subsequence which with which the protein or nucleic acid in question is not found in the same relationship to each other in nature.
  • “Comprising” is a term meaning inclusive of other components or method steps. When “comprising” is used, it is to be understood that related embodiments include descriptions using the “consisting of” terminology, which excludes other components or method steps, and “consisting essentially of” terminology, which excludes any components or method steps that substantially change the nature of the embodiment or invention.
  • EXAMPLE 1 MATERIALS AND METHODS Vector production The reference GAA sequence with a Val at 780, and the sequence with the V780I mutation were back-translated and the nucleotide sequence was engineered to generate cis-plasmids for AAV production with the expression cassettes under the CAG promoter.
  • the cDNA sequence for the natural hGAA was cloned into the same AAV-cis backbone for comparison with the non-engineered sequence.
  • AAVhu68 vectors were produced and titrated as described before.(Lock, et al.2010, Hum Gene Ther 21(10): 1259-1271). Briefly, HEK293 cells were triple-transfected and the culture supernatant was harvested, concentrated, and purified with an iodixanol gradient. The purified vectors were titrated with droplet digital PCR using primers targeting the rabbit Beta-globin polyA sequence as previously described (Lock, et al. (2014). Hum Gene Ther Methods 25(2): 115-125).
  • Pompe mice (Gaa knock-out (-/-), C57BL/6/129 background) founders were purchased from Jackson Labs (stock#004154, also known as 6neo mice). The breeding colony was maintained at the Gene Therapy Program AAALAC accredited barrier mouse facility, using heterozygote to heterozygote mating in order to produce null and WT controls within the same litters.
  • Gaa knock-out mice are a widely used model for Pompe disease. They exhibit a progressive accumulation of lysosomal glycogen in heart, central nervous system, skeletal muscle, and diaphragm, with reduced mobility and progressive muscle weakness. The small size, reproducible phenotype, and efficient breeding allow for quick studies that are optimal for preclinical candidate in vivo screening.
  • mice were administered a dose of 5x10 11 GCs (approximately 2.5x10 13 GC/kg) or a dose of 5x10 10 GCs (approximately 2.5x10 12 GC/kg) of AAVhu68.CAG.hGAA (various hGAA constructs) in 0.1 mL via the lateral tail vein (IV), were bled on Day 7 and Day 21 post vector dosing for serum isolation, and were terminally bled (for plasma isolation) and euthanized by exsanguination 28 days post-injection. Tissues were promptly collected, starting with the brain. Tissues for histology were formalin-fixed and paraffin embedded using standard methods.
  • luxol fast blue stain kit Abcam ab150675
  • PAS Periodic Acid-Schiff
  • Sections were deparaffinized, boiled in 10 mM citrate buffer (pH 6.0) for antigen retrieval, blocked with 1% donkey serum in PBS + 0.2% Triton for 15 min, and then sequentially incubated with primary (Sigma HPA029126 anti-hGAA antibody) and biotinylated secondary antibodies diluted in blocking buffer; an HRP based colorimetric reaction was used to detect the signal. Slides were reviewed in a blinded fashion by a board-certified Veterinary Pathologist.
  • a semi-quantitative scoring system was established to measure the severity of the Pompe-related histological lesions in muscles (glycogen storage and autophagic buildup), as determined by the total percentage of cells presenting storage and/or vacuoles: Histo scoring storage 0 0 % 1 1 to 9 % 2 10 to 49% 3 50 to 74% 4 75 to 100% Vector related histopathological lesions were also estimated when applicable.
  • Non-human primates For vector administration, rhesus macaques were sedated with intramuscular dexmedetomidine and ketamine, and administered a single intra-cisterna magna (ICM) injection or intravenous injection.
  • ICM intra-cisterna magna
  • Relative fluorescence units RFUs are measured using a Victor3 fluorimeter, ex 355 nm and emission at 460 nm.
  • Activity in units of nmol/mL/hr are calculated by interpolation from a standard curve of 4-MU.
  • Activity levels in individual tissue samples are normalized for total protein content in the homogenate supernatant. Equal volumes are used for plasma samples.
  • GAA Signature Peptide by LC/MS Plasma are precipitated in 100% methanol and centrifuged. Supernatants are discarded. The pellet is spiked with a stable isotope-labeled peptide unique to hGAA as an internal standard and resuspended with trypsin and incubated at 37 °C for one hour.
  • reaction is stopped with 1.0 M glycine, pH 10.5 and RFUs were read by a Spectramax fluorimeter; ex 370, emission 460. RFU’s for each sample and are converted to nmol/mL/hr by interpolation from a standard curve of 4-MU. Nonlinear regression is done using GraphPad Prism.
  • Glycogen – TFA Hydrolysis Tissue homogenate is hydrolyzed with 4N TFA at 100°C for four hours, dried and reconstituted in water. Hydrolyzed material is injected onto a CarboPac PA-10 2x250 mm column for glucose determination by high pH anion exchange chromatography with pulsed amerometric detection (HPAEC-PAD).
  • Example 2 Evaluation of rAAVhu68.hGAA vectors in Pompe mice AAV vectors were diluted in sterile PBS for IV delivery to Pompe mice.
  • Test articles included: AAVhu68.CAG.hGAAco.rBG, AAVhu68.CAG.hGAAcoV780I.rBG, AAVhu68.CAG.BiP-vIGF2.hGAAco.rBG, AAVhu68.CAG.BiP- vIGF2.hGAAcoV780I.rBG, and AAVhu68.CAG.sp7co. ⁇ 8.hGAAcoV780I.rBG. Wildtype and vehicle controls were included in the studies.
  • hGAA protein expression and activity were measured in various tissues collected from treated mice, including liver (FIG.1A, FIG.1B), heart (FIG.2A, FIG.2B), quadricep muscle (FIG.3A, FIG.3B), brain (FIG.4A, FIG.4B), plasma (FIG.9A). All promoters performed equally well in the liver at both low and high doses. Administration of the vector expressing under the UbC promoter resulted in lower activity in skeletal muscle at both doses, and the vector with the CAG promoter had the best overall activity. The vector with the UbC promoter also had lower activity in the heart at both doses.
  • Pompe mice vehicle (PBS) controls displayed marked glycogen storage (dark staining on PAS stained sections) in the heart. Wildtype mice and all vector treated mice had near complete to complete clearance of storage.
  • the two groups that received vectors encoding the hGAA reference sequence (V780), however, displayed moderate to marked fibrosing lymphocytic myocarditis (FIG.5B and FIG.5C), which was present in seven out of eight animals that received the hGAA native transgene and in three out of eight animals that received the engineered hGAA with BiP and vIGF2 modifications.
  • BiP- vIGF2.hGAAcoV780I demonstrated better glycogen reduction in heart and quadriceps muscle than native hGAAV780I (FIG.41). Glycogen levels in brain and spinal cord were near normal with BiP-vIGF2.hGAAcoV780I, even with tissue levels of ⁇ 15%, presumably due to better targeting. In the CNS, potent synergistic effects between the engineered construct and the V780I variant were observed. Only BiP- vIGF2.hGAAcoV780I cleared CNS glycogen.
  • mice treated with AAVhu68.BiP-vIGF2.hGAAcoV780I had near complete to complete clearance of glycogen storage, while mice treated with vectors encoding the reference hGAAV780 enzyme had remaining glycogen storage.
  • Staining of brain and spinal cord sections also revealed correction with BiP-vIGF2.hGAAcoV780I, but not with the native hGAAV780 enzyme (FIG.42). The results demonstrate the contributions of both the V780I mutation and the BiP-vIGF2 modifications.
  • EXAMPLE 3 Effects of DRG-detargeting on hGAA expression in Pompe mice BiP-vIGF2.hGAAcoV780I was modified to include four mir183 target sites (BiP- vIGF2.hGAAcoV780I.4xmir183, SEQ ID NO: 30) (FIG.11), and packaged in an AAVhu68 capsid.
  • the vector genome contains the following sequence elements: Inverted Terminal Repeats (ITRs): The ITRs are identical, reverse complementary sequences derived from AAV2 (130 bp, GenBank: NC_001401) that flank all components of the vector genome.
  • ITRs Inverted Terminal Repeats
  • the ITRs function as both the origin of vector DNA replication and the packaging signal for the vector genome when AAV and adenovirus helper functions are provided in trans. As such, the ITR sequences represent the only cis sequences required for vector genome replication and packaging.
  • CAG Promoter Hybrid construct consisting of the cytomegalovirus (CMV) enhancer, the chicken beta-actin (CB) promoter (282 bp, GenBank: X00182.1), and a rabbit beta-globin intron. Coding sequence: An engineered cDNA (nt 1141 to 4092 of SEQ ID NO: 30) encoding BiP-vIGF2.hGAAcoV780I (SEQ ID NO: 31).
  • miR target sequences Four tandem miR-183 target sequences (SEQ ID NO: 26).
  • Rabbit ⁇ -Globin Polyadenylation Signal (rBG PolyA) The rBG PolyA signal (127 bp) facilitates efficient polyadenylation of the transgene mRNA in cis. This element functions as a signal for transcriptional termination, a specific cleavage event at the 3′ end of the nascent transcript and the addition of a long polyadenylate tail.
  • the effect of introducing miR183 target sites into the BiP-vIGF2-hGAAcoV780I vector genome was evaluated following IV delivery of AAVhu68 to Pompe mice.
  • glycogen storage was corrected in the CNS after high dose intravenous administration of the vector including mir183 target sequences (FIG.12 and FIG.13).
  • Glycogen storage and autophagic buildup in quadriceps were fully corrected after high dose intravenous administration, while glycogen storage correction and a partial correction of autophagic buildup were observed following low dose administration (FIG.14). Correction of glycogen storage was also observed in the heart with both low and high doses (FIG.15).
  • Quadriceps muscle sections were analyzed by immunohistochemistry using staining with WGA (cell membrane; to allow measuring muscle fiber diameter) DAPI (nucleus; to quantify presence of central nuclei), and LC3b antibody (autophagosome; to quantify autophagic buildup). The sections were scanned and automatically digitized, and then analyzed using the Visiopharm software. Central Nuclei Quantification Healthy muscle fibers rarely contain central nuclei (CN) (below 3% in WT muscle) and the presence of CN is indicative of muscle regeneration. The percentage of fibers with CN was significantly different between the WT and KO PBS controls (FIG. 43).
  • KO PBS controls show significant atrophy at 3 months of age. Compared to the KO PBS group, there were significant increases in the percentages of large quadriceps muscle fibers and a decrease in the percentages of small quadriceps muscle fibers (FIG.45). The proportion of small fibers (S) was significantly decreased in GAA -/- mice treated with 2 x 10 11 GC (1 x 10 13 GC/kg) dose and higher, indicating muscle atrophy prevention. Severity of Vacuolation Results showed a dose-dependent correction of lysosomal storage in all muscles evaluated (FIG.46A – FIG.46F).
  • EXAMPLE 4 Route of administration and dose studies in post-symptomatic aged Pompe mice The effects of route of administration and dose were evaluated in Pompe mice (as well as wildtype and vehicle controls) administered hGAA-encoding AAVhu68 vectors (including, e.g., AAVhu68.CAG.BiP-vIGF2.hGAAcoV780I.rBG) intravenously (IV) and/or via intracerebroventricular (ICV) injection.
  • a dual-route of administration approach intravenous and injection into the cerebrospinal fluid
  • mice received two dose levels (low dose or high dose) of vector using either intravenous (IV), intracerebroventricular (ICV), or dual routes of administration.
  • IV intravenous
  • ICV intracerebroventricular
  • the doses used in this study (5x10 10 or 1x10 11 GC ICV and 1x10 13 GC/kg or 5x10 13 GC/kg IV) correspond to the low and high doses used in the NHP study described in Example 6 and doses suitable for administration to humans (1x10 13 GC/kg and 5x10 13 GC/kg).
  • mice were sacrificed approximately 210 days post injection, at 13-14 months of age to collect tissues for analysis.
  • a study design is provided in FIG.47.
  • mice were tested for locomotor activity using rotarod, wirehang, and grip strength evaluations, and plethysmography was performed.
  • hGAA protein expression/activity and glycogen storage was measured in various tissues collected from treated mice, including plasma, quadricep muscle, gastrocnemius, diaphragm and brain Histology was performed to evaluate for example PAS (via Luxol fast blue staining), hGAA expression, and neuroinflammation (astrocytosis).
  • Tissue sections were stained to evaluate autophagic buildup or clearance (for example, using antibodies that label LC3B).
  • Grip strength was significantly improved for mice that received a high dose IV (compared to baseline and compared to PBS controls) (FIG.26). There was no significant benefit for low doses of vector administered ICV and IV or dual route administration (ICV LD + IV LC). However, administration of a combination of high doses IV and ICV rescued strength to wildtype levels as early as day 30 post injection and there was an incremental benefit of the combination at day 180 (FIG.27). Muscle pathology was investigated across different groups to look at Pompe disease relevant findings. Muscles from Pompe disease patients and the 6 neo GAA KO Pompe mouse model are characterized by the presence of structural abnormalities such as fiber atrophy, anisocytosis, autophagic buildup, and central nucleation (FIG.48).
  • HD IV treatment also led to improved pathology with increased proportion of large fibers and a trend to decreased atrophic fibers (FIG.51).
  • the findings support that a dual route of administration is preferable to target all aspects of the disease. Delivery of the vector reversed pre-existing muscle fiber pathology in aged, post-symptomatic Pompe mice, including findings that are typically treatment-resistant such as the atrophy of fibers and autophagic build-up.
  • EXAMPLE 5 Administration of a DRG-detargeting gene therapy vector to non- human primates NHP primate studies were conducted to assess toxicity and to evaluate ICM delivery of CAG.BiP-IGF2-hGAAcoV780I or CAG.BiP-IGF2-hGAAcoV780I-4xmir183 in AAVhu68 capsids.
  • the vectors were injected ICM at 3x10 13 GC/kg and animals were sacrificed at day 35.
  • the addition of four tandem repeats of miR183 suppressed expression of the hGAA transgene in sensory neurons of the cervical DRG (FIG.17).
  • the tandem repeats of miR183 target sequences reduced toxicity in sensory neurons of the DRG from cervical and thoracic segments (FIG 21A and FIG 21B) There was no reduction in toxicity in the lumbar segment at this dose level (FIG.21C), which is likely due to residual protein expression at the lumbar level as depicted in FIG.18.
  • a study design for further evaluating IV delivery of constructs with miR183 target sequences to NHP is provided in the table below. The study includes a rhesus GAA (rhGAA) sequence to evaluate potential effects of the non-self immune response. Further, the safety profile of the CAG.BiP-IGF2-hGAAcoV780I-4xmir183 vector is evaluated using a dose range study.
  • NHP in the dose range study are administered varied doses ICM, including 3x10 12 GC, 6x10 12 GC, and 1x10 13 GC.
  • EXAMPLE 6 Route of administration studies in non-human primates NHP primate studies were conducted to assess toxicity and to evaluate alternative or combined routes of vector administration. AAVhu68.CAG.BiP-IGF2-hGAAcoV780I was administered IV at 5x10 13 GC/kg (high dose) or 1x10 13 GC/kg (low dose) or ICM at 3x10 13 GC (high dose) or 1x10 13 GC (low dose).
  • IV and ICM doses were also evaluated, for example, by administering IV and ICM doses in combination (IV 5x10 13 GC/kg + ICM 3x10 13 GC or IV 1x10 14 GC/kg + ICM 1x10 13 GC/kg).
  • the combination of IV and ICM doses can reveal synergistic effects that will be beneficial in the treatment of Pompe patients.
  • FIG.31 A study design for evaluating routes of administration and dosages is provided in FIG.31. Preliminary studies revealed that low dose IV injected animals had expression of hGAA in quadriceps and heart (FIG.37). IV injected animals also exhibited lower grades of spinal cord axonopathy than ICM injected animals (FIG.33D – FIG.33F).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Diabetes (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
PCT/US2021/032451 2020-05-14 2021-05-14 Compositions useful for treatment of pompe disease Ceased WO2021231863A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
AU2021273273A AU2021273273A1 (en) 2020-05-14 2021-05-14 Compositions useful for treatment of pompe disease
KR1020227043641A KR20230010255A (ko) 2020-05-14 2021-05-14 폼페병의 치료에 유용한 조성물
CA3177954A CA3177954A1 (en) 2020-05-14 2021-05-14 Compositions useful for treatment of pompe disease
JP2022569264A JP2023526923A (ja) 2020-05-14 2021-05-14 ポンペ病の治療に有用な組成物
BR112022022704A BR112022022704A2 (pt) 2020-05-14 2021-05-14 Composições úteis para tratamento da doença de pompe
IL298178A IL298178A (en) 2020-05-14 2021-05-14 Compositions useful for treatment of pompe disease
MX2022014255A MX2022014255A (es) 2020-05-14 2021-05-14 Composiciones utiles para el tratamiento de la enfermedad de pompe.
EP21804731.4A EP4149519A4 (en) 2020-05-14 2021-05-14 COMPOSITIONS FOR THE TREATMENT OF POMPE DISEASE
US17/998,371 US20230173108A1 (en) 2020-05-14 2021-05-14 Compositions useful for treatment of pompe disease
CN202180049054.5A CN115916334A (zh) 2020-05-14 2021-05-14 可用于治疗庞贝病的组合物
CONC2022/0017224A CO2022017224A2 (es) 2020-05-14 2022-11-30 Composiciones útiles para el tratamiento de la enfermedad de pompe

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US202063024941P 2020-05-14 2020-05-14
US63/024,941 2020-05-14
US202063109677P 2020-11-04 2020-11-04
US63/109,677 2020-11-04
US202163180379P 2021-04-27 2021-04-27
US63/180,379 2021-04-27

Publications (1)

Publication Number Publication Date
WO2021231863A1 true WO2021231863A1 (en) 2021-11-18

Family

ID=78525047

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/032451 Ceased WO2021231863A1 (en) 2020-05-14 2021-05-14 Compositions useful for treatment of pompe disease

Country Status (13)

Country Link
US (1) US20230173108A1 (https=)
EP (1) EP4149519A4 (https=)
JP (1) JP2023526923A (https=)
KR (1) KR20230010255A (https=)
CN (1) CN115916334A (https=)
AU (1) AU2021273273A1 (https=)
BR (1) BR112022022704A2 (https=)
CA (1) CA3177954A1 (https=)
CL (1) CL2022003132A1 (https=)
CO (1) CO2022017224A2 (https=)
IL (1) IL298178A (https=)
MX (1) MX2022014255A (https=)
WO (1) WO2021231863A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024003687A1 (en) * 2022-06-28 2024-01-04 Pfizer Inc. Nucleic acids encoding acid alpha-glucosidase (gaa) and vectors for gene therapy
WO2024151982A1 (en) * 2023-01-13 2024-07-18 Amicus Therapeutics, Inc. Gene therapy constructs for the treatment of pompe disease

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140193390A1 (en) * 2012-03-07 2014-07-10 Amicus Therapeutics, Inc. High Concentration Alpha-Glucosidase Compositions for the Treatment of Pompe Disease
US20150196671A1 (en) * 2007-02-23 2015-07-16 University Of Florida Research Foundation, Inc. Compositions and methods for treating diseases
US20170037431A1 (en) * 2014-05-01 2017-02-09 University Of Washington In vivo Gene Engineering with Adenoviral Vectors
US20170275649A1 (en) * 2014-01-21 2017-09-28 Vrije Universiteit Brussel Muscle-Specific Nucleic Acid Regulatory Elements and Methods and Use Thereof
WO2019213180A1 (en) * 2018-04-30 2019-11-07 Amicus Therapeutics, Inc. Gene therapy constructs and methods of use
US20200248205A1 (en) * 2017-09-20 2020-08-06 4D Molecular Therapeutics Inc. Adeno-associated virus variant capsids and methods of use thereof
WO2020223356A1 (en) * 2019-04-30 2020-11-05 The Trustees Of The University Of Pennsylvania Compositions useful for treatment of pompe disease

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2099523A2 (en) * 2006-11-13 2009-09-16 ZyStor Therapeutics , Inc. Methods for treating pompe disease
EP2960336A1 (en) * 2014-06-27 2015-12-30 Genethon Efficient systemic treatment of dystrophic muscle pathologies
WO2018178067A1 (en) * 2017-03-27 2018-10-04 Vrije Universiteit Brussel Diaphragm-specific nucleic acid regulatory elements and methods and use thereof

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150196671A1 (en) * 2007-02-23 2015-07-16 University Of Florida Research Foundation, Inc. Compositions and methods for treating diseases
US20140193390A1 (en) * 2012-03-07 2014-07-10 Amicus Therapeutics, Inc. High Concentration Alpha-Glucosidase Compositions for the Treatment of Pompe Disease
US20170275649A1 (en) * 2014-01-21 2017-09-28 Vrije Universiteit Brussel Muscle-Specific Nucleic Acid Regulatory Elements and Methods and Use Thereof
US20170037431A1 (en) * 2014-05-01 2017-02-09 University Of Washington In vivo Gene Engineering with Adenoviral Vectors
US20200248205A1 (en) * 2017-09-20 2020-08-06 4D Molecular Therapeutics Inc. Adeno-associated virus variant capsids and methods of use thereof
WO2019213180A1 (en) * 2018-04-30 2019-11-07 Amicus Therapeutics, Inc. Gene therapy constructs and methods of use
WO2020223356A1 (en) * 2019-04-30 2020-11-05 The Trustees Of The University Of Pennsylvania Compositions useful for treatment of pompe disease

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4149519A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024003687A1 (en) * 2022-06-28 2024-01-04 Pfizer Inc. Nucleic acids encoding acid alpha-glucosidase (gaa) and vectors for gene therapy
WO2024151982A1 (en) * 2023-01-13 2024-07-18 Amicus Therapeutics, Inc. Gene therapy constructs for the treatment of pompe disease

Also Published As

Publication number Publication date
IL298178A (en) 2023-01-01
MX2022014255A (es) 2022-12-07
CO2022017224A2 (es) 2023-02-16
EP4149519A1 (en) 2023-03-22
CL2022003132A1 (es) 2023-05-19
KR20230010255A (ko) 2023-01-18
JP2023526923A (ja) 2023-06-26
CN115916334A (zh) 2023-04-04
CA3177954A1 (en) 2021-11-18
EP4149519A4 (en) 2024-06-12
US20230173108A1 (en) 2023-06-08
BR112022022704A2 (pt) 2023-03-28
AU2021273273A1 (en) 2023-02-02

Similar Documents

Publication Publication Date Title
JP7585233B2 (ja) ポンペ病の治療のために有用な組成物
US20240009327A1 (en) Gene therapy for mucopolysaccharidosis iiib
US20230365955A1 (en) Compositions and methods for treatment of fabry disease
US20230173108A1 (en) Compositions useful for treatment of pompe disease
US20220370638A1 (en) Compositions and methods for treatment of maple syrup urine disease
US20240408157A1 (en) Compositions and methods for treatment of fabry disease
US20240115733A1 (en) Compositions and methods for treatment of niemann pick type a disease
AU2024320694A1 (en) Compositions and methods for treatment of spinal muscular atrophy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21804731

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3177954

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022569264

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 202217065128

Country of ref document: IN

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022022704

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: NC2022/0017224

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 20227043641

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021804731

Country of ref document: EP

Effective date: 20221214

ENP Entry into the national phase

Ref document number: 2021273273

Country of ref document: AU

Date of ref document: 20210514

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: NC2022/0017224

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 112022022704

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20221108

WWW Wipo information: withdrawn in national office

Ref document number: 202293313

Country of ref document: EA

WWW Wipo information: withdrawn in national office

Ref document number: 1020227043641

Country of ref document: KR

WWW Wipo information: withdrawn in national office

Ref document number: 795489

Country of ref document: NZ

WWW Wipo information: withdrawn in national office

Ref document number: 2021804731

Country of ref document: EP