Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
  • C12N15/90—Stable introduction of foreign DNA into chromosome
  • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
  • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
  • C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
  • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
  • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
  • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
  • C12N9/6472—Cysteine endopeptidases (3.4.22)
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide
  • C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14145—Special targeting system for viral vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2800/00—Nucleic acids vectors
  • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Definitions

• AS Angelman syndrome
• Characteristic symptoms include delayed development, intellectual disability, severe speech impairment, problems with movement and balance (ataxia) and often early-onset recurrent seizures (epilepsy).
• epilepsy early-onset recurrent seizures
• UBE3A Ubiquitin-protein ligase E3 A, also known as E6AP ubiquitin-protein ligase
• AS results from the lack of UBE3A (Ubiquitin-protein ligase E3 A, also known as E6AP ubiquitin-protein ligase) protein expression in neurons.
• UBE3 A is only expressed monoallelically from the maternally inherited allele in neurons, whereas the paternally inherited UBE3 A allele is silenced in neurons.
• Individuals affected by AS have large deletions or loss-of-function mutations within the UBE3 A gene located on the maternally inherited allele, resulting in complete loss of UBE3A expression in neurons.
• an expression cassette comprising a nucleic acid sequence encoding one or more elements of a gene editing system that targets UBE3 A-ATS (UBE3 A antisense transcript) on a paternal allele in a neuron of a patient having Angelman syndrome and regulatory elements that direct expression thereof in a target cell. Editing of UBE3A-ATS results in unsilencing of the paternal UBE3A allele and permits expression of the UBE3 A gene product.
• the gene editing system may be CRISPR/Cas, a meganuclease, a zinc-finger nuclease, or a TALEN.
• the expression cassette encodes a CRISPR-associated nuclease, optionally Cas9 (e.g., SaCas9), and an sgRNA having a sequence that specifically binds a UBE3 A- ATS target sequence.
• the sgRNA comprises any of SEQ ID NOs: 1-32.
• the UBE3 A-ATS target sequence is downstream of the UBE3A 3’UTR.
• the target sequence is located at chrl5: 25,278,409-25,333,728 (hg38 genome assembly) and/or in a sequence of UBE3 A-ATS complementary to the region between the UBE3A 3’UTR and SNORD109B ORF on chromosome 15.
• an expression cassete provided herein may be included in a non-viral or viral vector.
• the viral vector is an adeno-associated virus (AAV), bocavirus, an adenovirus, a lentivirus, or a retrovirus.
• AAV adeno-associated virus
• bocavirus an adenovirus
• a lentivirus a retrovirus
• a recombinant adeno-associated virus useful as a CNS-directed therapeutic for treatment of Angelman syndrome (AS).
• the rAAV comprises an AAV capsid, and a vector genome packaged therein, where the vector genome comprises: (a) an AAV 5’ inverted terminal repeat (ITR); (b) a nucleic acid sequence encoding one or more elements of a gene editing system that targets UBE3 A- ATS; (c) regulatory elements that direct expression of the one or more elements of the gene editing system; and (d) an AAV 3’ ITR.
• the gene targeting system comprises a CRISPR endonuclease and a sgRNA that specifically binds a UBE3 A- ATS target sequence.
• the CRISPR endonuclease may be Cas9, optionally SaCas9.
• the capsid is an AAV9 capsid or variant thereof or an AAVhu68 capsid or variant thereof.
• a pharmaceutical composition comprising at least an expression cassette, a vector, or an rAAV for delivery of a gene editing system described herein and a physiologically compatible carrier, buffer, adjuvant, and/or diluent.
• a method of treating AS by administering to a subject in need thereof an expression cassette, a vector, or a rAAV to deliver a gene-editing system, wherein editing of UBE3A-ATS results in enhanced expression of UBE3A from a paternal allele in a neuron.
• a method for treating one or more symptoms of Angelman syndrome (AS) in a patient having deficient UBE3 A expression in neurons wherein the method comprises delivering a nucleic acid sequence that encodes one or more elements of a gene editing system that targets a sequence in UBE3A-ATS downstream of the UBE3A 3’UTR to modify the UBE3A-ATS coding sequence.
• AS Angelman syndrome
• Editing of UBE3A-ATS results in unsilencing UBE3A expression on a paternal allele of a patient having a deficiency in UBE3 A expression from a maternal allele and provides for expression of the UBE3 A gene product from the paternal allele.
• the method provides for improve symptoms of Angelman disease, including one or more of delayed development, intellectual disability, severe speech impairment, ataxia and/or epilepsy.
• AS Angelman syndrome
• FIG. 1 shows an overview of a strategy to unsilence the paternal Ube3a allele.
• Ube3a shows bi-allelic expression in healthy cells but mono-allelic expression in healthy neurons, where UBE3A-ATS inhibits paternal UBE3A expression.
• AS subjects lack the maternal Ube3a locus, which prevents UBE3A expression in neurons. Interference with UBE3 A-ATS leads to paternal UBE3 A allele expression, thus restoring UBE3 A protein expression in neurons.
• FIG. 2A - FIG. 21 show in vivo gene editing of Ube3a-ATS causes indel formation and expression of Ube3a-YFP reporter.
• FIG. 2 A Schematic mouse Ube3a genomic locus [adapted from Meng L et al. Nature. 2015;518(7539):409-12] The region targeted in this study by sgRNAs is indicated. IC, imprinting center; 3’UTR, 3’ untranslated region; snoRNA, small-nucleolar RNA.
• FIG. 2B In vitro indel frequencies for screened sgRNAs.
• FIG. 2C Ube3a m+/pYFP mice were injected with ATS-GE vector at indicted timepoints.
• FIG. 2F Representative Western blots for cortices from (FIG. 2C) demonstrate robust expression of paternal Ube3a-YFP when probed with YFP antibodies (FIG. 2E) or Ube3a antibodies (FIG. 2F). Relative quantifications normalized to actin are shown below each lane, green arrow in (FIG. 2F) demarcates the quantified Ube3a-YFP bands. NT, non-targeting.
• FIG. 3 A - FIG. 3G show in vivo gene editing of Ube3a-ATS in a Ube3a-KO mouse model.
• FIG. 3A Brains of Ube3a m ⁇ /p+ mice injected with lxlO 11 gc ATS-GE vector were harvested four months later. We detected persistent paternal Ube3a expression in the cerebral cortex by Western blotting with Ube3a antibodies. Relative quantifications of the respective Ube3a band normalized to actin are shown below each lane.
• FIG. 3B Immunohistochemistry (IHC) staining of the brains from FIG. 3 A with Ube3a antibodies shows paternal Ubea3a expression throughout the brain.
• IHC Immunohistochemistry
• FIG. 3C A representative cortical section is shown here (scale bar: 1 mm).
• FIG. 3D Magnified cortical IHC images from Ube3a m+/p+
• FIG. 3D A representative cortical section is shown here (scale bar: 1 mm).
• FIG. 3E Magnified cortical IHC images from Ube3a m+/p+
• FIG. 3D A representative cortical section is shown here (scale bar: 1 mm).
• FIG. 3D A representative cortical IHC images from Ube3a m+/p+
• FIG. 3E A representative cortical section is shown here (scale bar: 10 pm).
• FIG. 3F Amplicon-Seq analysis from the same cohort as shown in FIG. 3 A revealed an average of 19.4% of cells with indels in injected pups. Injection of non targeting CRISRP/Cas9 resulted in indel formation of 0.2% (5 mice /group).
• FIG. 3G RNA extracted from cortices of the same
• FIG. 4A - FIG. 4E show phenotypic improvement in an AS mouse model after gene editing.
• Ube3a m ⁇ /p+ and Ube3a m+/p+ littermates received a neonatal injection of lxlO 11 gc ATS-GE or control vector.
• FIG. 4B At 8 weeks of age, we tested motor function with a rotarod apparatus over three consecutive days.
• FIG. 5 A - FIG. 5D shows in vivo gene editing of Ube3a-ATS causes indel formation and expression of Ube3a.
• FIG. 5 A We quantified vector genomes in brains from Ube3a m+/pYFP mice treated with an AAV-PHP.B vector encoding CRISPR/Cas9, which was either injected at birth (day 0) into the lateral brain ventricles (ICV) or IV injected at an age of 14, 21, or 28 days.
• the vector genome copies per diploid genome in the cerebral cortex were 12- to 59-fold higher for ICV injection compared with IV injection at later time points (three mice per group, one-way ANOVA with Tukey’s pairwise comparison, ** p ⁇ 0.001).
• FIG. 5 A We quantified vector genomes in brains from Ube3a m+/pYFP mice treated with an AAV-PHP.B vector encoding CRISPR/Cas9, which was either injected at birth (day 0) into the lateral
• Ube3a m+/pYFP (paternal Ube3a-YFP) mice were injected with an AAV vector encoding CRISPR/Cas9 at birth (day 0), and the cerebral cortices were harvested 21 days later.
• a nontargeted CRISPR/Cas9 construct had an overall rate of 0.4% in the same experiment. Insertion, deletions and integrations were each significantly increased compared to the NT control (three mice per group, two-way ANOVA with Sidak’s pairwise comparison, p > 0.001).
• FIG. 5C Ube3a m+/pYFP mice were injected with an AAV vector encoding CRISPR/dCas9 (nuclease-deficient Cas9) at birth (day 0), and the cerebral cortices were harvested 21 days later.
• FIG. 5C We did not detect any paternal UBE3A-YFP protein by Western blot with UBE3A antibodies (Ube3a-YFP bands demarcated by green arrow, relative quantity of each Ube3a-YFP band normalize to actin is annotated under each lane);
• FIG. 5D We did not detect any paternal Ube3a-YFP protein by immunofluorescence staining with GFP antibodies (representative images from cortex, scale bar: 100 pm).
• FIG. 6 A - FIG. 6C shows in vivo gene editing of Ube3a-ATS leads to expression of Ube3a.
• Brains were harvested from Ube3a-ko mice injected neonatal with ATS-GE vector or untreated wildtype littermates at age 4 months, fixed and processed for immunohistochemistry with Ube3a antibodies.
• FIG. 6A and FIG. 6B Sagittal overview sections.
• FIG. 6C magnifications of FIG. 6B of the annotated brain regions (scale bars: (FIG. 6A), FIG. 6B) - 3mm; (FIG. 6C) - 300um)
• FIG. 7A - FIG. 7C shows in vivo gene editing of Ube3a-ATS in AS mouse model Ube3a m+/p ⁇ mice were injected with an AAV vector encoding CRISPR/dCas9 (nuclease- deficient Cas9) at birth (day 0), and the cerebral cortices were harvested 4 months later.
• FIG. 7A We did not detect any significant paternal Ube3a protein expression by Western blot with Ube3a antibodies (relative quantity normalized to actin annotated to each lane).
• FIG. 7B Likewise, immunohistochemistry staining with Ube3a antibodies did not show any Ube3aexpression (representative images, scale bar: 500 pm).
• Ube3a m+/p ⁇ mice were injected with an AAV vector encoding CRISPR/Cas9 with a targeted or non- targeted (NT) sgRNA at birth (day 0), and the cerebral cortices were harvested four months later.
• AMP-seq was used to quantify frequency of deletions, insertions or ITR integrations, which amounted to 22% for the edited and 0.5% for the control (NT) group. Insertion, deletions, and integrations were each significantly increased (five mice per group, two-way ANOVA with Sidak’s pairwise comparison, p>0.001).
• FIG. 8 shows an AAV vector genome and results from screening of sgRNAs for efficiency in targeting the Ube3a-ATS coding region downstream of Ube3a in vitro.
• FIG. 9 provides a list of sgRNA sequences and their target locations in a region of human UBE3 A-ATS (SEQ ID NOs: 1 - 32, top to bottom).
• the methods and compositions described herein are useful for the treatment of Angelman syndrome (AS), a condition that results from a deletion or mutation in a maternal Ube3a allele and a lack of UBE3A expression in neurons.
• AS Angelman syndrome
• the loss of UBE3A expression in AS patients is the result of a combination of a mutation, defect, in the maternally inherited UBE3 A allele and silencing of the paternally inherited UBE3A allele, resulting in complete loss of UBE3A expression in neurons.
• One approach to reinstate UBE3 A expression in neurons is to unsilence the paternal UBE3 A gene that is fully functional but not expressing.
• Paternal UBE3 A-silencing is achieved by expression of an antisense transcript (ATS) that is thought to suppress extension of UBE3A mRNA past the transcriptional start site.
• ATS antisense transcript
• AAV adeno-associated virus
• Ube3a-ATS gene editing in mice selectively reduced the abundance of full-length Ube3a-ATS transcript without unsilencing other genes regulated by Ube3a-ATS (including Snrpn, Snordll5, Snordll6).
• UBE3A protein expression in AS mice persisted for at least three months.
• Treated AS model mice also had improved performance in a neurobehavior test battery.
• the findings demonstrate that reactivation of Ube3a by gene editing in a limited number of neurons is sufficient to improve disease symptoms in an AS mouse model.
• Current treatments for AS are symptomatic, including pharmaceutical treatments for seizures and behavioral aspects of the disease. Compared to other approaches that would require periodic re-administration, a gene editing approach for treatment of AS has the potential to be a long-lasting therapy.
• compositions and methods described herein involve expression cassettes, vectors, and recombinant viruses for delivery of a gene-editing system for treatment of AS.
• disease As used herein, “disease”, “disorder”, and “condition” are used interchangeably, to indicate an abnormal state in a subject.
• the disease is Angelman syndrome (AS).
• “Patient” or “subject”, as used herein interchangeably, means a male or female mammalian animal, including a human, a veterinary or farm animal, a domestic animal or pet, and animals normally used for clinical research.
• the subject of these methods and compositions is a human patient.
• the subject of these methods and compositions is a male or female human.
• a neuron refers to one or more, for example, “a neuron”, is understood to represent one or more neuron(s).
• the terms “a” (or “an”), “one or more,” and “at least one” is used interchangeably herein.
• UBE3 A- ATS refers to UBE3 A antisense transcript.
• UBE3 A-ATS is also known as small nucleolar RNA host gene 14 (SNHG14); NCBI Gene ID: 104472715, NCBI Reference Sequence: NR_146177.1) (see, e.g., Runte M., et al. Hum. Mol. Genet. 2001; 10:2687-2700, which is incorporated herein by reference).
• UBE3 A-ATS extends into the UBE3 A gene on the paternal chromosome in neuronal cells and interferes with transcription of UBE3A.
• UBE3A-ATS In non-neuronal cells, transcription of UBE3A-ATS does not extend to UBE3A and UBE3A remains biallelically expressed (see FIG. 1).
• Mouse and human UBE3 A-ATS are located on different chromosomes (7 and 15, respectively); however the transcript is located in a region (known as the Prader-Willi syndrome (PWS)/Angelman syndrome (AS) region) that is highly conserved between mouse and human.
• PWS Prader-Willi syndrome
• AS Angelman syndrome
• the target sequence for gene editing is in human UBE3 A-ATS in a region downstream of the UBE3A 3’UTR.
• the target sequence in human UBE3A-ATS is located at chrl5: 25,278,409-25,333,728 (hg38 genome assembly). In yet another embodiment, the target sequence in human UBE3 A-ATS in a region between the 3’ UTR of UBE3A and SNORD109B (NCBI Reference Sequence: NR 001289.1). In one aspect, provided herein are compositions and methods for editing UBE3 A-ATS in a manner that enhances UBE3 A expression of a paternal allele without altering expression of other genes regulated by Ube3a-ATS. In certain embodiments, editing of human Ube3a-ATS does not alter expression of SNORD109B.
• Nucleic acid sequences described herein can be cloned using routine molecular biology techniques, or generated de novo by DNA synthesis, which can be performed using routine procedures by service companies having business in the field of DNA synthesis and/or molecular cloning (e.g. GeneArt, GenScript, Life Technologies,
• the nucleic acid sequences encoding aspects of a UBE3 A-ATS editing system described herein are assembled and placed into any suitable genetic element, e.g., naked DNA, phage, transposon, cosmid, episome, etc., which transfers the sequences carried thereon to a host cell, e.g. , for generating non-viral delivery systems (e.g, RNA-based systems, naked DNA, or the like), or for generating viral vectors in a packaging host cell, and/or for delivery to a host cells in a subject.
• the genetic element is a vector.
• the genetic element is a plasmid.
• engineered constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g, Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).
• an “expression cassette” refers to a nucleic acid molecule which encodes one or more elements of a gene editing system, e.g. an endonuclease and targeting sequence (e.g. crRNA sequence of a CRISPR/Cas system).
• An expression cassette also contains a promoter and may contain additional regulatory elements that control expression of the gene editing system in a host cell.
• the expression cassette may be packaged into the capsid of a viral vector (e.g, a viral particle).
• such an expression cassette for generating a viral vector as described herein is flanked by packaging signals of the viral genome and other expression control sequences such as those described herein.
• the packaging signals are a 5’ AAV inverted terminal repeat (ITR) and a 3’ AAV ITR.
• operably linked refers to both expression control sequences or regulatory elements that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
• regulatory elements comprise but not limited to: promoter; enhancer; transcription factor; transcription terminator; efficient RNA processing signals such as splicing and polyadenylation signals (poly A); sequences that stabilize cytoplasmic mRNA, for example Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE); sequences that enhance translation efficiency (i.e., Kozak consensus sequence).
• the expression cassette comprises regulatory elements that direct expression of a sequence encoding one or more elements of a gene editing system for targeting UBE3 A-ATS.
• the regulatory elements comprise one or more promoters.
• the expression cassette includes a CMV promoter.
• the promoter is a neuron specific promoter.
• a suitable promoter may include without limitation, an elongation factor 1 alpha (EF1 alpha) promoter (see, e.g., Kim DW et al, Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene.
• EF1 alpha elongation factor 1 alpha
• a Synapsin 1 promoter see, e.g., Kiigler S et al, Human synapsin 1 gene promoter confers highly neuron-specific long-term transgene expression from an adenoviral vector in the adult rat brain depending on the transduced area. Gene Ther. 2003 Feb;10(4):337-47
• a neuron-specific enolase (NSE) promoter see, e.g., Kim J et al, Involvement of cholesterol-rich lipid rafts in interleukin-6-induced neuroendocrine differentiation of LNCaP prostate cancer cells. Endocrinology. 2004 Feb;145(2):613-9.
• CB6 promoter see, e.g., Large-Scale Production of Adeno- Associated Viral Vector Serotype-9 Carrying the Human Survival Motor Neuron Gene, Mol Biotechnol. 2016 Jan;58(l):30-6. doi: 10.1007/sl2033-015-9899-5).
• Other suitable promoters include CAG promoter, which comprises (C) the cytomegalovirus (CMV) early enhancer element, (A) the promoter, the first exon and the first intron of chicken beta-actin gene, and (G) the splice acceptor of the rabbit beta-globin gene. See, e.g., Alexopoulou, Annika N., et al.
• the expression cassette includes an U6 promoter.
• the regulatory elements comprise an enhancer.
• the enhancer(s) is selected from one or more of an APB enhancer, an ABPS enhancer, an alpha mic/bik enhancer, a TTR enhancer, an en34 enhancer, an ApoE enhancer, a CMV enhancer, or an RSV enhancer.
• the regulatory elements comprise an intron.
• the intron is selected from CBA, human beta globin, IVS2, SV40, bGH, alpha-globulin, beta-globulin, collagen, ovalbumin, or p53.
• the regulatory elements comprise a polyA.
• the polyA is a synthetic polyA or from bovine growth hormone (bGH), human growth hormone (hGH), SV40, rabbit b-globin (RGB), or modified RGB (mRGB).
• the regulatory elements may comprise a WPRE sequence.
• the regulatory elements comprise a Kozak sequence.
• an expression cassette that includes a U6 promoter operably linked to sequence encoding a sgRNA.
• the expression cassette includes at a minimum a U6 promoter operably linked to a sgRNA coding sequence and a neuron specific promoter (e.g. human synapsin promoter) operably linked to a Cas9 coding sequence.
• a neuron specific promoter e.g. human synapsin promoter
• RNA Ribonucleic acid
• expression is used herein in its broadest meaning and comprises the production of RNA, of protein, or of both RNA and protein.
• expression or “translation” relates in particular to the production of peptides or proteins. Expression may be transient or may be stable.
• Expression cassettes can be delivered via any suitable delivery system.
• Suitable non-viral delivery systems are known in the art (see, e.g., Ramamoorth and Narvekar. J Clin Diagn Res. 2015 Jan; 9(1):GE01-GE06, which is incorporated herein by reference) and can be readily selected by one of skill in the art and may include, e.g., naked DNA, naked RNA, dendrimers, PLGA, polymethacrylate, an inorganic particle, a lipid particle (e.g., a lipid nanoparticle or LNP), or a chitosan-based formulation.
• the vector is a non-viral plasmid that comprises an expression cassette described thereof, e.g., “naked DNA”, “naked plasmid DNA”, RNA, and mRNA; coupled with various compositions and nano particles, including, e.g., micelles, liposomes, cationic lipid - nucleic acid compositions, poly-glycan compositions and other polymers, lipid and/or cholesterol-based - nucleic acid conjugates, and other constructs such as are described herein. See, e.g., X. Su et al, Mol. Pharmaceutics, 2011, 8 (3), pp 774-787; web publication: March 21, 2011; WO2013/182683, WO 2010/053572 and WO 2012/170930, all of which are incorporated herein by reference.
• an expression cassette described thereof e.g., “naked DNA”, “naked plasmid DNA”, RNA, and mRNA
• various compositions and nano particles including, e.g.,
• compositions comprising a nucleic acid sequence encoding one or more elements of a gene editing system and methods of use thereof for editing UBE3A-ATS.
• gene editing system refers to technologies or molecular machinery for modifying genetic material, typically with specificity for a particular gene or nucleic acid sequence (including, e.g., target sequences or motifs). Such gene editing systems are designed to modify a target site in the genome or introduce a mutation.
• a “mutation” or “modification”, unless otherwise stated can refer to any alteration of a genomic sequence, including but not limited to small nucleotide insertions or deletions (indels) or a larger deletion, insertion, or inversion.
• the introduction a mutation or modification is referred to as “editing” or “gene editing”.
• sgRNA includes a sequence that binds (i.e. is complementary to) a target site or target sequence in the genome.
• the gene editing system is a Clustered Regulatory Interspaced Short Palindromic Repeats (CRISPR) system for modifying UBE3A-ATS.
• CRISPR Clustered Regulatory Interspaced Short Palindromic Repeats
• a suitable gene editing system includes a zinc-finger nuclease (ZFN) to induce DNA double-strand breaks, which may or may not be in conjunction with delivery of an exogenous DNA donor substrate (See, e.g., Ellis et al, Gene Therapy (epub January 2012) 20:35-42 which is incorporated herein by reference).
• a suitable gene editing system includes a meganuclease (see, e.g., in US Patent 8,445,251; US 9,340,777; US 9,434,931; US 9,683,257, and WO 2018/195449, each of which is incorporated herein by reference) or transcription activator-like (TAL) effector nucleases (TALENs).
• TAL transcription activator-like effector nucleases
• a suitable CRISPR gene editing system includes, at a minimum, a Cas9 enzyme and a sgRNA specific for a target site in the Ube3a-ATS coding sequence.
• the gene editing vector comprises a Cas9 gene as the editing enzyme and an sgRNA which is at least 20 nucleotides in length and specifically binds to a selected site in Ube3a-ATS 5 ' to a protospacer- adjacent motif (PAM) which is specifically recognized by the Cas9.
• the expression cassette or vector genome includes a nucleic acid sequence encoding the sgRNA molecule and a nucleic acid sequence encoding a Cas9 enzyme (see, e.g. FIG. 8).
• the gene editing system also includes a donor or repair template.
• the expression cassette providing the donor template may be the same as the expression cassettes encoding the sgRNA and Cas9, or a different expression cassette.
• a dual-vector system as described for example in WO 2016/176191 is provided, wherein the gene editing system includes an expression cassette comprising a Cas9 gene under control of regulatory sequences which direct its expression and a second expression cassette comprising a sgRNA and a donor template.
• Cas9 CRISPR associated protein 9 refers to family of RNA-guided DNA endonucleases which is characterized by two signature nuclease domains, RuvC (cleaves non-coding strand) and HNH (coding strand).
• Suitable bacterial sources of Cas9 include Staphylococcus aureus (SaCas9), Stapylococcus pyogenes (SpCas9), and Neisseria meningitides (KM Estelt et al, Nat Meth, 10:1116-21 (2013)).
• the wild-type coding sequences may be utilized in the constructs described herein.
• bacterial codons are optimized for expression in humans, e.g.
• CRISPR/Cas9 gene targeting requires a single guide RNA (sgRNA) that contains a targeting sequence (crRNA sequence) and a Cas9 nuclease-recruiting sequence (tracrRNA).
• sgRNA single guide RNA
• crRNA sequence targeting sequence
• tracrRNA Cas9 nuclease-recruiting sequence
• the expression cassette comprises a sequence encoding an sgRNA comprising any of SEQ ID NOs: 1-32.
• the CRISPR gene editing system may be Cpfl (CRISPR from Prevotella and Francisella).
• Cpfl does not require a tracrRNA; allowing use of shorter guide RNAs (about 42 nucleotides) as compared to Cas9. Plasmids may be obtained from Addgene, a public plasmid database.
• a gene editing system is utilized to introduce a mutation in a paternal Ube3a-ATS allele in target cell.
• the target polynucleotide sequence i.e. a Ube3a-ATS sequence
• the target polynucleotide sequence is cleaved such that a double-strand break results.
• the target polynucleotide sequence is cleaved such that a single strand break results.
• the alteration is an insertion or deletion (indel), which can result in random insertion/deletion mutations at the site of junction as a result of non-homologous end joining.
• Indel mutations occurring within the coding region of a gene can result in frame-shift and a premature stop codon, and disrupt transcription.
• a repair template in the form of a plasmid or single-stranded oligodeoxynucleotides can be supplied to leverage the homology-directed repair (HDR) pathway, which allows high fidelity and precise editing.
• a viral vector is used to deliver one more elements of the gene editing system. While the examples below describe use of AAV vectors and the following discussion focuses on AAV vectors, it will be understood that a different, partially or wholly integrating vector or virus may be used in the system in place of the gene editing vector and/or the vector carrying template. See, e.g., Jinek, M.; Chilynksi, K.; Fonfara, I.,; Hauer, M.,; Doudna, J.,; Charpentier, E., (August 17, 2012). “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity”. Science. 337 (6069): 816-821.
• the vector delivers one or more components (e.g ., the guide RNA and the endonuclease) of the genome editing system, such as CRISPR/Cas9.
• a combination or dual AAV vector system is provided to deliver the components of the CRISPR system when co-administered to a subject (see, e.g. WO 2016/176191, which is incorporated by reference herein in its entirety).
• the vectors may be formulated together or separately and delivered essentially simultaneously, preferably by the same route.
• one or more mutations may be introduced into a target sequence (e.g, UBE3A-ATS) using a gene editing system described herein.
• a vector is provided to deliver a donor or repair template, which is sequence designed such that when it is introduced into the target sequence there is disruption of transcription of UBE3A-ATS, including e.g., early termination.
• a variety of conventional vector elements may be used to enhance gene editing activity in a target cell.
• a system designed for treatment of to treat AS may be designed such that a CRISPR enzyme is expressed under the control of a neuron-specific promoter (e.g, human synapsin 1).
• the expression cassette may include miRNA target sequences in the untranslated region(s).
• the miRNA target sequences are designed to be specifically recognized by miRNA present in cells in which transgene expression is undesirable and/or reduced levels of transgene expression are desired.
• the expression cassette includes miRNA target sequences that specifically reduce expression of the nuclease in dorsal root ganglion (DRG).
• the miRNA target sequences are located in the 3’ UTR, 5’ UTR, and/or in both 3’ and 5’ UTR, In some embodiments, the miRNA target sequences are operably linked to the regulatory sequences in the expression cassette.
• the expression cassette comprises at least two tandem repeats of DRG-specific miRNA target sequences, wherein the at least two tandem repeats comprise at least a first miRNA target sequence and at least a second miRNA target sequence which may be the same or different.
• the tandem miRNA target sequences are continuous or are separated by a spacer of 1 to 10 nucleic acids, wherein said spacer is not an miRNA target sequence.
• the vector genome or expression cassette contains at least one miRNA target sequence that is a miR-183 target sequence.
• the vector genome or expression cassette contains an miR-183 target sequence that includes AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 33), where the sequence complementary to the miR-183 seed sequence is underlined.
• the vector genome or expression cassette contains more than one copy (e.g. two or three copies) of a sequence that is 100% complementary to the miR-183 seed sequence.
• a miR-183 target sequence is about 7 nucleotides to about 28 nucleotides in length and includes at least one region that is at least 100% complementary to the miR-183 seed sequence.
• a miR-183 target sequence contains a sequence with partial complementarity to SEQ ID NO: 33 and, thus, when aligned to SEQ ID NO: 33, there are one or more mismatches.
• a miR-183 target sequence comprises a sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches when aligned to SEQ ID NO: 33, where the mismatches may be non contiguous.
• a miR-183 target sequence includes a region of 100% complementarity which also comprises at least 30% of the length of the miR-183 target sequence. In certain embodiments, the region of 100% complementarity includes a sequence with 100% complementarity to the miR-183 seed sequence.
• the remainder of a miR-183 target sequence has at least about 80% to about 99% complementarity to miR-183.
• the expression cassette or vector genome includes a miR-183 target sequence that comprises a truncated SEQ ID NO: 33, i.e., a sequence that lacks at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both the 5’ or 3’ ends of SEQ ID NO: 33.
• the expression cassette or vector genome comprises a transgene and one miR-183 target sequence.
• the expression cassette or vector genome comprises at least two, three or four miR-183 target sequences.
• the vector genome or expression cassette contains at least one miRNA target sequence that is a miR-182 target sequence.
• the vector genome or expression cassette contains an miR-182 target sequence that includes AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 34).
• the vector genome or expression cassette contains more than one copy (e.g. two or three copies) of a sequence that is 100% complementary to the miR-182 seed sequence.
• a miR-182 target sequence is about 7 nucleotides to about 28 nucleotides in length and includes at least one region that is at least 100% complementary to the miR-182 seed sequence.
• a miR-182 target sequence contains a sequence with partial complementarity to SEQ ID NO: 34 and, thus, when aligned to SEQ ID NO: 34, there are one or more mismatches.
• a miR-183 target sequence comprises a sequence having at least 1, 2, 3, 4,
• a miR-182 target sequence includes a region of 100% complementarity which also comprises at least 30% of the length of the miR-182 target sequence. In certain embodiments, the region of 100% complementarity includes a sequence with 100% complementarity to the miR-182 seed sequence. In certain embodiments, the remainder of a miR-182 target sequence has at least about 80% to about 99% complementarity to miR-182.
• the expression cassette or vector genome includes a miR-182 target sequence that comprises a truncated SEQ ID NO: 34, i.e., a sequence that lacks at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either or both the 5’ or 3’ ends of SEQ ID NO: 34.
• the expression cassette or vector genome comprises a transgene and one miR-182 target sequence.
• the expression cassette or vector genome comprises at least two, three or four miR-182 target sequences.
• tandem repeats is used herein to refer to the presence of two or more consecutive miRNA target sequences. These miRNA target sequences may be continuous, i.e., located directly after one another such that the 3’ end of one is directly upstream of the 5’ end of the next with no intervening sequences, or vice versa. In another embodiment, two or more of the miRNA target sequences are separated by a short spacer sequence.
• spacer is any selected nucleic acid sequence, e.g., of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides in length which is located between two or more consecutive miRNA target sequences.
• the spacer is 1 to 8 nucleotides in length, 2 to 7 nucleotides in length, 3 to 6 nucleotides in length, four nucleotides in length, 4 to 9 nucleotides, 3 to 7 nucleotides, or values which are longer.
• a spacer is a non-coding sequence.
• the spacer may be of four (4) nucleotides.
• the spacer is GGAT.
• the spacer is six (6) nucleotides.
• the spacer is CACGTG or GCATGC.
• the tandem repeats contain two, three, four or more of the same miRNA target sequence. In certain embodiments, the tandem repeats contain at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences, etc. In certain embodiments, the tandem repeats may contain two or three of the same miRNA target sequence and a fourth miRNA target sequence which is different.
• a 3’ UTR may contain a tandem repeat immediately downstream of the transgene, UTR sequences, and two or more tandem repeats closer to the 3’ end of the UTR.
• the 5’ UTR may contain one, two or more miRNA target sequences.
• the 3’ may contain tandem repeats and the 5’ UTR may contain at least one miRNA target sequence.
• the expression cassette contains two, three, four or more tandem repeats which start within about 0 to 20 nucleotides of the stop codon for the transgene. In other embodiments, the expression cassette contains the miRNA tandem repeats at least 100 to about 4000 nucleotides from the stop codon for the transgene.
• compositions in the expression cassettes described herein are intended to be applied to the compositions and methods described across the Specification.
• one or more elements of gene editing system are encoded by nucleic acid sequence that is delivered to neurons by a vector or a viral vector, of which many are known and available in the art.
• a vector comprising the UBE3 A-ATS targeting gene editing system as described herein.
• a vector comprising an expression cassette as described herein.
• the vector is a non-viral vector.
• the non-viral vector is a plasmid.
• the vector is a viral vector.
• Viral vectors include any virus suitable for gene therapy, including but not limited to a bocavirus, adenovirus, adeno-associated virus (AAV), herpes virus, lentivirus, retrovirus, or parvovirus.
• AAV adeno-associated virus
• the adeno-associated virus is referenced herein as an exemplary virus vector.
• an adeno-associated viral vector comprising a nucleic acid sequence one or more elements of gene editing system operatively linked to regulatory elements therefor is provided.
• a “vector” as used herein is a biological or chemical moiety comprising a nucleic acid sequence which can be introduced into an appropriate target cell for replication or expression of a nucleic acid sequence.
• a vector include but are not limited to a recombinant virus, a plasmid, Lipoplexes, a Polymersome, Polyplexes, a dendrimer, a cell penetrating peptide (CPP) conjugate, a magnetic particle, or a nanoparticle.
• a vector is a nucleic acid molecule having an exogenous or heterologous engineered nucleic acid encoding a functional gene product, which can then be introduced into an appropriate target cell.
• Such vectors preferably have one or more origins of replication, and one or more site into which the recombinant DNA can be inserted.
• Vectors often have means by which cells with vectors can be selected from those without, e.g., they encode drug resistance genes.
• Common vectors include plasmids, viral genomes, and “artificial chromosomes”. Conventional methods of generation, production, characterization, or quantification of the vectors are available to one of skill in the art.
• a recombinant viral vector is any suitable viral vector which targets the desired cell(s).
• the recombinant viral vectors described herein preferably target one or more of the cells and tissues affected by Angelman syndrome, including cells of the central nervous system (e.g., brain).
• the examples provide illustrative recombinant adeno- associated viruses (rAAV).
• viral vectors may include, e.g., a recombinant adenovirus, a recombinant parvovirus such a recombinant bocavirus, a hybrid AAV/bocavirus, a recombinant herpes simplex virus, a recombinant retrovirus, or a recombinant lentivirus.
• these recombinant viruses are replication-defective.
• a “replication-defective” virus or viral vector refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells.
• the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be “gutless” - containing only the gene of interest flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production.
• replication-defective viruses may be adeno- associated viruses (AAV), adenoviruses, lentiviruses (integrating or non-integrating), or another suitable virus source.
• AAV adeno- associated viruses
• adenoviruses adenoviruses
• lentiviruses integrating or non-integrating
• Plasmid or “plasmid vector” generally is designated herein by a lower-case p preceded and/or followed by a vector name. Plasmids, other cloning and expression vectors, properties thereof, and constructing/manipulating methods thereof that can be used in accordance with the present invention are readily apparent to those of skill in the art.
• the elements of a gene editing system as described herein or the expression cassette as described herein are engineered into a suitable genetic element (a vector) useful for generating viral vectors and/or for delivery to a host cell, e.g ., naked DNA, phage, transposon, cosmid, episome, etc., which transfers the sequences carried thereon.
• the selected vector may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
• suitable method including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
• the methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g, Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY.
• transgene or “gene of interest” as used interchangeably herein means an exogenous and/or engineered protein-encoding nucleic acid sequence that is under the control of a promoter and/or other regulatory elements in an expression cassette, rAAV genome, recombinant plasmid or production plasmid, vector, or host cell described in this specification.
• heterologous as used to describe a nucleic acid sequence or protein means that the nucleic acid or protein was derived from a different organism or a different species of the same organism than the host cell or subject in which it is expressed.
• heterologous when used with reference to a protein or a nucleic acid in a plasmid, expression cassette, or vector, indicates that the protein or the nucleic acid is present with another sequence or subsequence with which the protein or nucleic acid in question is not found in the same relationship to each other in nature.
• the term “host cell” may refer to the packaging cell line in which a vector (e.g ., a recombinant AAV) is produced from a production plasmid.
• the term “host cell” may refer to any target cell in which expression of a gene editing system described herein is desired.
• a “host cell,” refers to a prokaryotic or eukaryotic cell that contains exogenous or heterologous DNA that has been introduced into the cell by any means, e.g., electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
• the term “host cell” refers to cultures of cells of various mammalian species for in vitro assessment of the compositions described herein.
• the term “host cell” refers to the cells employed to generate and package the viral vector or recombinant virus.
• the term “host cell” is intended to reference a target cell of the subject being treated in vivo for AS.
• the term “host cell” is a neuron, e.g. a neuron of the CNS.
• target cell refers to any target cell in which expression of a heterologous nucleic acid sequence or protein is desired.
• the target cell is a neuron of the CNS, in particular a neuron with a mutated or defective maternal UBE3 A allele or a neuron that lacks UBE3 A expression.
• a “vector genome” refers to the nucleic acid sequence packaged inside a viral vector.
• a “vector genome” contains, at a minimum, from 5’ to 3’, a vector-specific sequence, a nucleic acid sequence encoding one or more elements of a gene editing system (e.g., a CRISPR/Cas enzyme and sgRNA operably linked to regulatory control sequences which direct their expression in a target cell), where the vector-specific sequence may be a terminal repeat sequence which specifically packages the vector genome into a viral vector capsid or envelope protein.
• AAV inverted terminal repeats are utilized for packaging into AAV and certain other parvovirus capsids.
• Lentivirus long terminal repeats may be utilized where packaging into a lentiviral vector is desired.
• other terminal repeats e.g., a retroviral long terminal repeat, or the like may be selected.
• AAV adeno-associated virus
• An adeno-associated virus (AAV) viral vector is an AAV nuclease (e.g., DNase)-resistant particle having an AAV protein capsid into which is packaged expression cassette flanked by AAV inverted terminal repeat sequences (ITRs) for delivery to target cells.
• AAV nuclease e.g., DNase
• ITRs AAV inverted terminal repeat sequences
• a nuclease- resistant recombinant AAV indicates that the AAV capsid has fully assembled and protects these packaged vector genome sequences from degradation (digestion) during nuclease incubation steps designed to remove contaminating nucleic acids which may be present from the production process.
• the rAAV described herein is DNase resistant.
• the source of the AAV capsid may be one of any of the dozens of naturally occurring and available adeno-associated viruses, as well as engineered AAVs.
• An AAV capsid is composed of 60 capsid (cap) protein subunits, VP1, VP2, and VP3, that are arranged in an icosahedral symmetry in a ratio of approximately 1 : 1 : 10 to 1:1 :20, depending upon the selected AAV.
• Various AAVs may be selected as sources for capsids of AAV viral vectors as identified above. See, e.g., US Published Patent Application No. 2007-0036760-A1; US Published Patent Application No. 2009-0197338-A1; EP 1310571.
• the AAV capsid, ITRs, and other selected AAV components described herein may be readily selected from among any AAV, including, without limitation, the AAVs commonly identified as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8 and AAVAnc80.
• the AAV capsid is an AAV9 capsid or variant thereof.
• the capsid protein is designated by a number or a combination of numbers and letters following the term “AAV” in the name of the rAAV vector. See, also PCT/US 19/ 169004 and PCT/US 19/198961, each entitled “Novel Adeno- Associated Virus (AAV) Vectors, AAV Vectors Having Reduced Capsid Deamidation And Uses Therefor”, which are incorporated by reference herein in their entireties.
• a “stock” of rAAV refers to a population of rAAV. Despite heterogeneity in their capsid proteins due to deamidation, rAAV in a stock are expected to share an identical vector genome.
• a stock can include rAAV having capsids with, for example, heterogeneous deamidation patterns characteristic of the selected AAV capsid proteins and a selected production system. The stock may be produced from a single production system or pooled from multiple runs of the production system. A variety of production systems, including but not limited to those described herein, may be selected.
• the term “variant” means any AAV sequence which is derived from a known AAV sequence, including those sharing at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% or greater sequence identity over the amino acid or nucleic acid sequence.
• the AAV capsid includes variants which may include up to about 10% variation from any described or known AAV capsid sequence. That is, the AAV capsid shares about 90% identity to about 99.9 % identity, about 95% to about 99% identity or about 97% to about 98% identity to an AAV capsid provided herein and/or known in the art.
• the AAV capsid shares at least 95% identity with an AAV capsid.
• the comparison may be made over any of the variable proteins (e.g., vpl, vp2, or vp3).
• the AAV capsid shares at least 95% identity with the AAV8 vp3.
• a self complementary AAV is used.
• the ITRs or other AAV components may be readily isolated or engineered using techniques available to those of skill in the art from an AAV.
• AAV may be isolated, engineered, or obtained from academic, commercial, or public sources (e.g ., the American Type Culture Collection, Manassas, VA).
• the AAV sequences may be engineered through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like.
• AAV viruses may be engineered by conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of nucleic acid sequences, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus, etc.
• the capsid protein is a non-naturally occurring capsid.
• Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vpl capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV, non-contiguous portions of the same AAV, from a non-AAV viral source, or from a non-viral source.
• An artificial AAV may be, without limitation, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a “humanized” AAV capsid.
• Pseudotyped vectors wherein the capsid of one AAV is replaced with a heterologous capsid protein, are useful in the invention.
• AAV2/5 and AAV2/8 are exemplary pseudotyped vectors.
• the selected genetic element may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion.
• the methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).
• the AAV capsid is selected from among natural and engineered clade F adeno-associated viruses.
• the clade F adeno- associated virus is AAVhu68. See, WO 2018/160582, which is incorporated by reference herein in its entirety.
• another AAV capsid is selected from a different clade, e.g., clade A, B, C, D, or E, or from an AAV source outside of any of these clades.
• another suitable capsid is AAVrh91. See WO 2020/223231, published November 5, 2020, US Patent Application No. 63/065,616, fded August 14, 2020, and US Patent Application No. 63/109,734, filed November 4, 2020, which are incorporated herein by reference.
• AAV9 capsid refers to the AAV9 having the amino acid sequence of (a) GenBank accession: AAS99264, is incorporated by reference herein and the AAV vpl capsid protein and/or (b) the amino acid sequence encoded by the nucleotide sequence of GenBank Accession: AY530579.1: (nt 1..2211). Some variation from this encoded sequence is encompassed by the present invention, which may include sequences having about 99% identity to the referenced amino acid sequence in GenBank accession: AAS99264 and US7906111 (also WO 2005/033321) (i.e., less than about 1% variation from the referenced sequence).
• Such AAV may include, e.g., natural isolates (e.g., hu31 or hu32), or variants of AAV9 having amino acid substitutions, deletions or additions, e.g., including but not limited to amino acid substitutions selected from alternate residues “recruited” from the corresponding position in any other AAV capsid aligned with the AAV9 capsid; e.g., such as described in US 9,102,949, US 8,927,514, US2015/349911, WO 2016/049230A1, US 9,623,120, and US 9,585,971.
• AAV9, or AAV9 capsids having at least about 95% identity to the above- referenced sequences may be selected. See, e.g., US 2015/0079038. Methods of generating the capsid, coding sequences therefore, and methods for production of rAAV viral vectors have been described. See, e.g., Gao, et al, Proc. Natl. Acad. Sci. U.S.A. 100 (10), 6081- 6086 (2003) and US 2013/0045186A1.
• an AAVhu68 capsid is as described in WO 2018/160582, entitled “Novel Adeno-associated virus (AAV) Clade F Vector and Uses Therefor”, which is hereby incorporated by reference.
• AAVhu68 capsid proteins comprise: AAVhu68 vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of 1 to 736 of SEQ ID NO: 55, vpl proteins produced from SEQ ID NO: 54 or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 54 which encodes the predicted amino acid sequence of 1 to 736 of SEQ ID NO: 55; AAVhu68 vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 55, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 54
• the AAVhu68 vpl, vp2 and vp3 proteins are typically expressed as alternative splice variants encoded by the same nucleic acid sequence which encodes the full-length vpl amino acid sequence of SEQ ID NO: 55 (amino acid 1 to 736).
• the vpl- encoding sequence is used alone to express the vpl, vp2, and vp3 proteins.
• this sequence may be co-expressed with one or more of a nucleic acid sequence which encodes the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 55 (about aa 203 to 736) without the vpl-unique region (about aa 1 to about aa 137) and/or vp2-unique regions (about aa 1 to about aa 202), or a strand complementary thereto, the corresponding mRNA (about nt 607 to about nt 2211 of SEQ ID NO: 54), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%) identical to SEQ ID NO: 54 which encodes aa 203 to 736 of SEQ ID NO: 55.
• a nucleic acid sequence which encodes the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 55 (about aa 203 to
• the vpl-encoding and/or the vp2-encoding sequence may be co-expressed with the nucleic acid sequence which encodes the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 55 (about aa 138 to 736) without the vpl-unique region (about aa 1 to about 137), or a strand complementary thereto, the corresponding mRNA (nt 412 to 2211 of SEQ ID NO: 54), or a sequence at least 70% to at least 99% (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%) identical to nt 412 to 2211 of SEQ ID NO: 54 which encodes about aa 138 to 736 of SEQ ID NO: 55.
• a rAAVhu68 has a rAAVhu68 capsid produced in a production system expressing capsids from an AAVhu68 nucleic acid which encodes the vpl amino acid sequence of SEQ ID NO: 55, and optionally additional nucleic acid sequences, e.g., encoding a vp3 protein free of the vpl and/or vp2-unique regions.
• the rAAVhu68 resulting from production using a single nucleic acid sequence vpl produces the heterogenous populations of vpl proteins, vp2 proteins and vp3 proteins.
• the AAVhu68 capsid contains subpopulations within the vpl proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues in SEQ ID NO: 55.
• These subpopulations include, at a minimum, deamidated asparagine (N or Asn) residues.
• asparagines in asparagine - glycine pairs are highly deamidated.
• the AAVhu68 vpl nucleic acid sequence has the sequence of SEQ ID NO: 54, or a strand complementary thereto, e.g., the corresponding mRNA.
• the vp2 and/or vp3 proteins may be expressed additionally or alternatively from different nucleic acid sequences than the vpl, e.g., to alter the ratio of the vp proteins in a selected expression system.
• nucleic acid sequence which encodes the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 55 (about aa 203 to 736) without the vpl -unique region (about aa 1 to about aa 137) and/or vp2-unique regions (about aa 1 to about aa 202), or a strand complementary thereto, the corresponding mRNA (about nt 607 to about nt 2211 of SEQ ID NO: 54).
• nucleic acid sequence which encodes the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 55 (about aa 138 to 736) without the vpl -unique region (about aa 1 to about 137), or a strand complementary thereto, the corresponding mRNA (nt 412 to 2211 of SEQ ID NO: 54).
• nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 55 may be selected for use in producing rAAVhu68 capsids.
• the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 54 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 54 which encodes SEQ ID NO: 55.
• the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 54 or a sequence at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to about nt 412 to about nt 2211 of SEQ ID NO: 54 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 55.
• the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 54 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to nt 412 to about nt 2211 of SEQ ID NO: 54 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 55.
• nucleic acid sequences encoding this AAVhu68 capsid including DNA (genomic or cDNA), or RNA (e.g, mRNA).
• the nucleic acid sequence encoding the AAVhu68 vpl capsid protein is provided in SEQ ID NO: 55.
• the AAVhu68 capsid is produced using a nucleic acid sequence of SEQ ID NO: 54 or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% which encodes the vpl amino acid sequence of SEQ ID NO: 55 with a modification (e.g., deamidated amino acid) as described herein.
• the vpl amino acid sequence is reproduced in SEQ ID NO: 55.
• AAV capsids having reduced capsid deamidation may be selected. See, e.g., PCT/US 19/19804 and PCT/US 18/19861, both filed Feb 27, 2019 and incorporated by reference in their entireties.
• heterogenous refers to a population consisting of elements that are not the same, for example, having vpl, vp2 or vp3 monomers (proteins) with different modified amino acid sequences.
• SEQ ID NO: 55 provides the encoded amino acid sequence of the AAVhu68 vpl protein.
• heterogenous as used in connection with vpl, vp2 and vp3 proteins (alternatively termed isoforms), refers to differences in the amino acid sequence of the vpl, vp2 and vp3 proteins within a capsid.
• the AAV capsid contains subpopulations within the vpl proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues. These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues.
• certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine - glycine pairs and optionally further comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications.
• a “subpopulation” of vp proteins refers to a group of vp proteins which has at least one defined characteristic in common and which consists of at least one group member to less than all members of the reference group, unless otherwise specified.
• a “subpopulation” of vpl proteins is at least one (1) vpl protein and less than all vpl proteins in an assembled AAV capsid, unless otherwise specified.
• a “subpopulation” of vp3 proteins may be one (1) vp3 protein to less than all vp3 proteins in an assembled AAV capsid, unless otherwise specified.
• vpl proteins may be a subpopulation of vp proteins; vp2 proteins may be a separate subpopulation of vp proteins, and vp3 are yet a further subpopulation of vp proteins in an assembled AAV capsid.
• vpl, vp2 and vp3 proteins may contain subpopulations having different modifications, e.g., at least one, two, three or four highly deamidated asparagines, e.g., at asparagine - glycine pairs.
• highly deamidated refers to at least 45% deamidated, at least 50% deamidated, at least 60% deamidated, at least 65% deamidated, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidated at a referenced amino acid position, as compared to the predicted amino acid sequence at the reference amino acid position (e.g., at least 80% of the asparagines at amino acid 57 based on the numbering of SEQ ID NO: 55 [AAVhu68] may be deamidated based on the total vpl proteins may be deamidated based on the total vpl, vp2 and vp3 proteins). Such percentages may be determined using 2D- gel, mass spectrometry techniques, or other suitable techniques.
• an rAAV includes subpopulations within the rAAV capsid of vpl, vp2, and/or vp3 proteins with deamidated amino acids, including at a minimum, at least one subpopulation comprising at least one highly deamidated asparagine.
• other modifications may include isomerization, particularly at selected aspartic acid (D or Asp) residue positions.
• modifications may include an amidation at an Asp position.
• an AAV capsid contains subpopulations of vpl, vp2 and vp3 having at least 4 to at least about 25 deamidated amino acid residue positions, of which at least 1 to 10% are deamidated as compared to the encoded amino acid sequence of the vp proteins. The majority of these may be N residues. However, Q residues may also be deamidated.
• a rAAV has an AAV capsid having vpl, vp2 and vp3 proteins having subpopulations comprising combinations of two, three, four or more deamidated residues.
• Deamidation in the rAAV may be determined using 2D gel electrophoresis, and/or mass spectrometry, and/or protein modelling techniques. Online chromatography may be performed with an Acclaim PepMap column and a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF with a NanoFlex source (Thermo Fisher Scientific).
• MS data is acquired using a data-dependent top-20 method for the Q Exactive HF, dynamically choosing the most abundant not-yet- sequenced precursor ions from the survey scans (200-2000 m/z). Sequencing is performed via higher energy collisional dissociation fragmentation with a target value of le5 ions determined with predictive automatic gain control and an isolation of precursors was performed with a window of 4 m/z. Survey scans were acquired at a resolution of 120,000 at m/z 200. Resolution for HCD spectra may be set to 30,000 at m/z200 with a maximum ion injection time of 50 ms and a normalized collision energy of 30.
• the S-lens RF level may be set at 50, to give optimal transmission of the m/z region occupied by the peptides from the digest.
• Precursor ions may be excluded with single, unassigned, or six and higher charge states from fragmentation selection.
• BioPharma Finder 1.0 software (Thermo Fischer Scientific) may be used for analysis of the data acquired. For peptide mapping, searches are performed using a single-entry protein FASTA database with carbamidomethylation set as a fixed modification; and oxidation, deamidation, and phosphorylation set as variable modifications, a 10-ppm mass accuracy, a high protease specificity, and a confidence level of 0.8 for MS/MS spectra.
• proteases may include, e.g., trypsin or chymotrypsin.
• Mass spectrometric identification of deamidated peptides is relatively straightforward, as deamidation adds to the mass of intact molecule +0.984 Da (the mass difference between -OH and -NH2 groups).
• the percent deamidation of a particular peptide is determined by the mass area of the deamidated peptide divided by the sum of the area of the deamidated and native peptides. Considering the number of possible deamidation sites, isobaric species which are deamidated at different sites may co-migrate in a single peak.
• fragment ions originating from peptides with multiple potential deamidation sites can be used to locate or differentiate multiple sites of deamidation.
• the relative intensities within the observed isotope patterns can be used to specifically determine the relative abundance of the different deamidated peptide isomers. This method assumes that the fragmentation efficiency for all isomeric species is the same and independent on the site of deamidation.
• suitable mass spectrometers may include, e.g., a quadrupole time of flight mass spectrometer (QTOF), such as a Waters Xevo or Agilent 6530 or an orbitrap instrument, such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher).
• QTOF quadrupole time of flight mass spectrometer
• orbitrap instrument such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher).
• liquid chromatography systems include, e.g. , Acquity UPLC system from Waters or Agilent systems (1100 or 1200 series).
• Suitable data analysis software may include, e.g, MassLynx (Waters), Pinpoint and Pepfmder (Thermo Fischer Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics Solutions). Still other techniques may be described, e.g., in X. Jin et al, Hu Gene Therapy Methods, Vol. 28, No. 5, pp. 255-267, published online June 16, 2017.
• modifications may occur do not result in conversion of one amino acid to a different amino acid residue.
• modifications may include acetylated residues, isomerizations, phosphorylations, or oxidations.
• the AAV is modified to change the glycine in an asparagine-glycine pair, to reduce deamidation.
• the asparagine is altered to a different amino acid, e.g., a glutamine which deamidates at a slower rate; or to an amino acid which lacks amide groups (e.g., glutamine and asparagine contain amide groups); and/or to an amino acid which lacks amine groups (e.g., lysine, arginine and histidine contain amine groups).
• amino acids lacking amide or amine side groups refer to, e.g., glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine, or tryptophan, and/or proline. Modifications such as described may be in one, two, or three of the asparagine- glycine pairs found in the encoded AAV amino acid sequence. In certain embodiments, such modifications are not made in all four of the asparagine - glycine pairs. Thus, a method for reducing deamidation of AAV and/or engineered AAV variants having lower deamidation rates.
• a mutant AAV capsid as described herein contains a mutation in an asparagine - glycine pair, such that the glycine is changed to an alanine or a serine.
• a mutant AAV capsid may contain one, two or three mutants where the reference AAV natively contains four NG pairs.
• an AAV capsid may contain one, two, three or four such mutants where the reference AAV natively contains five NG pairs.
• a mutant AAV capsid contains only a single mutation in an NG pair.
• a mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, a mutant AAV capsid contains mutation is two different NG pairs which are located in structurally separate location in the AAV capsid. In certain embodiments, the mutation is not in the VP 1 -unique region. In certain embodiments, one of the mutations is in the VPl-unique region.
• a mutant AAV capsid contains no modifications in the NG pairs, but contains mutations to minimize or eliminate deamidation in one or more asparagines, or a glutamine, located outside of an NG pair.
• the AAVhu68 capsid contains subpopulations within the vpl proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues in SEQ ID NO: 55.
• These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues.
• certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine - glycine pairs in SEQ ID NO: 55 and optionally further comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications.
• N deamidated asparagine
• AAV vector which comprises an AAV capsid and an expression cassette, wherein the expression cassette comprises a nucleic acid sequence encoding one more elements of a UBE3 A-ATS gene editing system and regulatory elements that direct expression of the elements of the UBE3 A-ATS gene editing in a host cell.
• the AAV vector also comprises AAV ITR sequences.
• the ITRs are the genetic elements responsible for the replication and packaging of the genome during vector production and are the only viral cis elements required to generate rAAV.
• the ITRs are from an AAV different than that supplying a capsid.
• ITRs from other AAV sources may be selected. Where the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped.
• AAV vector genome comprises an AAV 5’ ITR, the nucleic acid sequences encoding the gene product(s) and any regulatory sequences, and an AAV 3’ ITR.
• a shortened version of the 5’ ITR termed AITR, has been described in which the D-sequence and terminal resolution site (trs) are deleted.
• the vector genome includes a shortened AAV2 ITR of 130 base pairs, wherein the external “a” element is deleted. The shortened ITR is reverted back to the wild-type length of 145 base pairs during vector DNA amplification using the internal A element as a template.
• the full-length AAV 5’ and 3’ ITRs are used.
• the regulatory sequences are selected such that the total rAAV vector genome is about 2.0 to about 5.5 kilobases in size. In one embodiment, the regulatory sequences are selected such that the total rAAV vector genome is about 2.9 to about 5.5 kilobases in size. In one embodiment, the regulatory sequences are selected such that the total rAAV vector genome is about 2.9 kb in size. In one embodiment, it is desirable that the rAAV vector genome approximate the size of the native AAV genome. Thus, in one embodiment, the regulatory sequences are selected such that the total rAAV vector genome is about 4.7 kb in size. In another embodiment, the total rAAV vector genome is less about 5.2 kb in size.
• the size of the vector genome may be manipulated based on the size of the regulatory sequences including the promoter, enhancer, intron, poly A, etc. See, Wu et ah, Mol Ther , Jan 2010, 18(l):80-6, which is incorporated herein by reference.
• the rAAV has a tropism for a cell of the CNS (e.g ., an rAAV bearing an AAVhu68 capsid), and/or contains a neuron-specific expression control elements (e.g., a synapsin promoter).
• a construct is provided which is a vector (e.g, a plasmid) useful for generating viral vectors.
• the AAV 5’ ITR is an AAV2 ITR and the AAV 3 ’ITR is an AAV2 ITR.
• the rAAV comprises an AAV capsid as described herein.
• the rAAV comprises an AAVhu68 capsid.
• the rAAV comprises an AAV capsid provided that is not AAVhu68.
• the recombinant adeno-associated virus (AAV) described herein may be generated using techniques which are known. See, e.g., WO 2003/042397; WO 2005/033321, WO 2006/110689; US 7588772 B2.
• AAV adeno-associated virus
• Such a method involves culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid; a functional rep gene; an expression cassette as described herein flanked by AAV inverted terminal repeats (ITRs); and sufficient helper functions to permit packaging of the expression cassette into the AAV capsid protein.
• the host cell which contains a nucleic acid sequence encoding an AAV capsid; a functional rep gene; a vector genome as described; and sufficient helper functions to permit packaging of the vector genome into the AAV capsid protein.
• the host cell is a HEK 293 cell.
• Suitable methods may include without limitation, baculovirus expression system or production via yeast. See, e.g ., Robert M. Kotin, Large-scale recombinant adeno- associated virus production. Hum Mol Genet. 2011 Apr 15; 20(R1): R2-R6. Published online 2011 Apr 29. doi: 10.1093/hmg/ddrl41; Aucoin MG et al., Production of adeno- associated viral vectors in insect cells using triple infection: optimization of baculovirus concentration ratios. Biotechnol Bioeng. 2006 Dec 20;95(6): 1081-92; SAMI S.
• a two-step affinity chromatography purification at high salt concentration followed by anion exchange resin chromatography are used to purify the vector drug product and to remove empty capsids. These methods are described in more detail in WO 2017/160360 entitled “Scalable Purification Method for AAV9”, which is incorporated by reference herein.
• the method for separating rAAV9 particles having packaged genomic sequences from genome-deficient AAV9 intermediates involves subjecting a suspension comprising recombinant AAV9 viral particles and AAV 9 capsid intermediates to fast performance liquid chromatography, wherein the AAV9 viral particles and AAV9 intermediates are bound to a strong anion exchange resin equilibrated at a pH of 10.2, and subjected to a salt gradient while monitoring eluate for ultraviolet absorbance at about 260 and about 280.
• the pH may be in the range of about 10.0 to 10.4.
• the AAV9 full capsids are collected from a fraction which is eluted when the ratio of A260/A280 reaches an inflection point.
• the diafiltered product may be applied to a Capture SelectTM Poros- AAV2/9 affinity resin (Life Technologies) that efficiently captures the AAV2/9 serotype. Under these ionic conditions, a significant percentage of residual cellular DNA and proteins flow through the column, while AAV particles are efficiently captured.
• the number of particles (pt) per 20 pL loaded is then multiplied by 50 to give particles (pt) /mL.
• Pt/mL divided by GC/mL gives the ratio of particles to genome copies (pt/GC).
• Pt/mL-GC/mL gives empty pt/mL.
• Empty pt/mL divided by pt/mL and x 100 gives the percentage of empty particles.
• methods for assaying for empty capsids and AAV vector particles with packaged genomes have been known in the art. See, e.g., Grimm et ah, Gene Therapy (1999) 6:1322-1330; Sommer et ah, Molec. Ther. (2003) 7:122-128.
• the methods include subjecting the treated AAV stock to SDS-polyacrylamide gel electrophoresis, consisting of any gel capable of separating the three capsid proteins, for example, a gradient gel containing 3- 8% Tris-acetate in the buffer, then running the gel until sample material is separated, and blotting the gel onto nylon or nitrocellulose membranes, preferably nylon.
• Anti-AAV capsid antibodies are then used as the primary antibodies that bind to denatured capsid proteins, preferably an anti-AAV capsid monoclonal antibody, most preferably the B1 anti-AAV-2 monoclonal antibody (Wobus et ah, J. Viral. (2000) 74:9281-9293).
• a secondary antibody is then used, one that binds to the primary antibody and contains a means for detecting binding with the primary antibody, more preferably an anti-IgG antibody containing a detection molecule covalently bound to it, most preferably a sheep anti-mouse IgG antibody covalently linked to horseradish peroxidase.
• a method for detecting binding is used to semi-quantitatively determine binding between the primary and secondary antibodies, preferably a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit.
• samples from column fractions can be taken and heated in SDS-PAGE loading buffer containing reducing agent (e.g., DTT), and capsid proteins were resolved on pre-cast gradient polyacrylamide gels (e.g., Novex).
• reducing agent e.g., DTT
• capsid proteins were resolved on pre-cast gradient polyacrylamide gels (e.g., Novex).
• Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions or other suitable staining method, i.e. SYPRO ruby or Coomassie stains.
• the concentration of AAV vector genomes (vg) in column fractions can be measured by quantitative real time PCR (Q-PCR).
• Samples are diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the samples are further diluted and amplified using primers and a TaqManTM fluorogenic probe specific for the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 Sequence Detection System. Plasmid DNA containing identical sequences to that contained in the AAV vector is employed to generate a standard curve in the Q-PCR reaction. The cycle threshold (Ct) values obtained from the samples are used to determine vector genome titer by normalizing it to the Ct value of the plasmid standard curve. End point assays based on the digital PCR can also be used.
• DNase I or another suitable nuclease
• an optimized q-PCR method which utilizes a broad-spectrum serine protease, e.g., proteinase K (such as is commercially available from Qiagen). More particularly, the optimized qPCR genome titer assay is similar to a standard assay, except that after the DNase I digestion, samples are diluted with proteinase K buffer and treated with proteinase K followed by heat inactivation. Suitably samples are diluted with proteinase K buffer in an amount equal to the sample size.
• the proteinase K buffer may be concentrated to 2-fold or higher. Typically, proteinase K treatment is about 0.2 mg/mL, but may be varied from 0.1 mg/mL to about 1 mg/mL.
• the treatment step is generally conducted at about 55 °C for about 15 minutes, but may be performed at a lower temperature (e.g., about 37 °C to about 50 °C) over a longer time period (e.g., about 20 minutes to about 30 minutes), or a higher temperature (e.g., up to about 60 °C) for a shorter time period (e.g., about 5 to 10 minutes).
• heat inactivation is generally at about 95 °C for about 15 minutes, but the temperature may be lowered (e.g., about 70 to about 90 °C) and the time extended (e.g., about 20 minutes to about 30 minutes). Samples are then diluted (e.g., 1000 fold) and subjected to TaqMan analysis as described in the standard assay.
• droplet digital PCR may be used.
• ddPCR droplet digital PCR
• methods for determining single-stranded and self-complementary AAV vector genome titers by ddPCR have been described. See, e.g., M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr;25(2): 115-25. doi: 10.1089/hgtb.2013.131. Epub 2014 Feb 14.
• compositions in the vectors described herein are intended to be applied to other compositions and methods described across the Specification.
• an aqueous suspension suitable for administration to treat AS in a subject in need thereof, said suspension comprising an aqueous suspending liquid and vector comprising a nucleic acid sequence encoding one or more elements of a gene editing system operatively linked to regulatory elements therefor as described herein.
• a therapeutically effective amount of said vector is included in the suspension.
• the pharmaceutical composition comprises an expression cassette comprising the components of gene editing system and a non-viral delivery system.
• This may include, e.g., naked DNA, naked RNA, an inorganic particle, a lipid or lipid-like particle, a chitosan-based formulation and others known in the art and described for example by Ramamoorth and Narvekar, as cited above).
• the pharmaceutical composition is a suspension comprising the expression cassette comprising the gene editing system in a viral vector system.
• the pharmaceutical composition comprises a non-replicating viral vector.
• Suitable viral vectors may include any suitable delivery vector, such as, e.g., a recombinant adenovirus, a recombinant lentivirus, a recombinant bocavirus, a recombinant adeno-associated virus (AAV), or another recombinant parvovirus.
• the viral vector is a recombinant AAV for delivery of a gene editing system for targeting UBE3 A-ATS to a patient in need thereof.
• a composition in one embodiment, includes a final formulation suitable for delivery to a subject, e.g., is an aqueous liquid suspension buffered to a physiologically compatible pH and salt concentration.
• a final formulation suitable for delivery to a subject e.g., is an aqueous liquid suspension buffered to a physiologically compatible pH and salt concentration.
• one or more surfactants are present in the formulation.
• the composition may be transported as a concentrate which is diluted for administration to a subject.
• the composition may be lyophilized and reconstituted at the time of administration.
• the suspension further comprises a surfactant, preservative, excipients, and/or buffer dissolved in the aqueous suspending liquid.
• the buffer is PBS.
• suitable solutions include one or more of: buffering saline, a surfactant, and a physiologically compatible salt or mixture of salts adjusted to an ionic strength equivalent to about 100 mM sodium chloride (NaCl) to about 250 mM sodium chloride, or a physiologically compatible salt adjusted to an equivalent ionic concentration.
• a suitable surfactant, or combination of surfactants may be selected from among Poloxamers, i.e., nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (polypropylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (Macrogol-15 Hydroxy stearate), LABRASOL (Polyoxy capryllic glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid esters), ethanol and polyethylene glycol.
• the formulation contains a poloxamer.
• the pH may be in the range of 6.5 to 8.5, or 7 to 8.5, or 7.5 to 8.
• a pH within this range may be desired; whereas for intravenous delivery, a pH of 6.8 to about 7.2 may be desired.
• other pHs within the broadest ranges and these subranges may be selected for other routes of delivery.
• compositions comprising a pharmaceutically acceptable carrier and a vector comprising a nucleic acid sequence encoding one or more components of a gene-editing system operatively linked to regulatory elements therefor as described herein.
• carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions.
• compositions of the present invention may be used for the introduction of the compositions of the present invention into suitable host cells.
• rAAV vector delivered trangenes or rAAV vectors for delivery of one or more components of a CRISPR/Cas9 or other gene editing system may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like.
• a therapeutically effective amount of said vector is included in the pharmaceutical composition.
• suitable carriers may be readily selected by one of skill in the art in view of the indication for which the vector is directed.
• one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g ., phosphate buffered saline).
• Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water.
• the selection of the carrier is not a limitation of the present invention.
• Other conventional pharmaceutically acceptable carrier such as preservatives, or chemical stabilizers.
• Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol.
• Suitable chemical stabilizers include gelatin and albumin.
• phrases “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host.
• the term “dosage” or “amount” can refer to the total dosage or amount delivered to the subject in the course of treatment, or the dosage or amount delivered in a single unit (or multiple unit or split dosage) administration.
• aqueous suspension or pharmaceutical compositions described herein are designed for delivery to subjects in need thereof by any suitable route or a combination of different routes.
• the pharmaceutical composition comprises an expression cassette or vector described herein in a formulation buffer suitable for delivery via intracerebroventricular (ICV), intrathecal (IT), intracisternal, or intravenous (IV) routes of administration.
• ICV intracerebroventricular
• IT intrathecal
• IV intravenous
• other routes of administration may be selected (e.g ., oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intramuscular, and other parenteral routes).
• Intrathecal delivery or “intrathecal administration” refer to a route of administration for drugs via an injection into the spinal canal, more specifically into the subarachnoid space so that it reaches the cerebrospinal fluid (CSF).
• Intrathecal delivery may include lumbar puncture, intraventricular, suboccipital/intracisternal, and/or Cl-2 puncture.
• material may be introduced for diffusion throughout the subarachnoid space by means of lumbar puncture.
• injection may be into the cistema magna.
• Intracisternal delivery may increase vector diffusion and/or reduce toxicity and inflammation caused by the administration.
• tracisternal delivery or “intracisternal administration” refer to a route of administration for drugs directly into the cerebrospinal fluid of the brain ventricles or within the cisterna magna cerebellomedularis, more specifically via a suboccipital puncture or by direct injection into the cisterna magna or via permanently positioned tube.
• a pharmaceutical composition comprising a vector as described herein in a formulation buffer.
• the replication- defective virus compositions can be formulated in dosage units to contain an amount of replication-defective virus that is in the range of about 1.0 x 10 9 GC to about 1.0 x 10 16 GC (to treat an average subject of 70 kg in body weight) including all integers or fractional amounts within the range, and preferably 1.0 x 10 12 GC to 1.0 x 10 14 GC for a human patient.
• the compositions are formulated to contain at least lxlO 9 , 2xl0 9 , 3xl0 9 , 4xl0 9 , 5xl0 9 , 6xl0 9 , 7xl0 9 , 8xl0 9 , or 9xl0 9 GC per dose including all integers or fractional amounts within the range.
• the compositions are formulated to contain at least lxlO 10 , 2xl0 10 , 3xl0 10 , 4xl0 10 , 5xl0 10 , 6xl0 10 , 7xl0 10 , 8xl0 10 , or 9xl0 10 GC per dose including all integers or fractional amounts within the range.
• compositions are formulated to contain at least lxlO 11 , 2xlO u , 3xl0 u , 4xlO u , 5xl0 u , 6xlO u , 7xlO u , 8xl0 u , or 9xlO u GC per dose including all integers or fractional amounts within the range.
• compositions are formulated to contain at least lxlO 12 , 2xl0 12 , 3xl0 12 , 4xl0 12 , 5xl0 12 , 6xl0 12 , 7xl0 12 , 8xl0 12 , or 9xl0 12 GC per dose including all integers or fractional amounts within the range.
• the compositions are formulated to contain at least lxlO 13 , 2xl0 13 , 3xl0 13 , 4xl0 13 , 5xl0 13 , 6xl0 13 , 7xl0 13 , 8xl0 13 , or 9xl0 13 GC per dose including all integers or fractional amounts within the range.
• compositions are formulated to contain at least lxlO 14 , 2xl0 14 , 3xl0 14 , 4xl0 14 , 5xl0 14 , 6xl0 14 , 7xl0 14 , 8xl0 14 , or 9x10 14 GC per dose including all integers or fractional amounts within the range.
• the compositions are formulated to contain at least lxlO 15 , 2xl0 15 , 3xl0 15 , 4xl0 15 , 5xl0 15 , 6xl0 15 , 7xl0 15 , 8xl0 15 , or 9xl0 15 GC per dose including all integers or fractional amounts within the range.
• the dose can range from lxlO 10 to about lxlO 12 GC per dose including all integers or fractional amounts within the range.
• a pharmaceutical composition comprising a rAAV as described herein in a formulation buffer.
• the rAAV is formulated at about l x lO 9 genome copies (GC)/mL to about l x lO 14 GC/mL.
• the rAAV is formulated at about 3 x 10 9 GC/mL to about 3 x 10 13 GC/mL.
• the rAAV is formulated at about 1 x 10 9 GC/mL to about 1 x 10 13 GC/mL. In one embodiment, the rAAV is formulated at least about 1 x 10 11 GC/mL.
• Suitable volumes for delivery of these doses and concentrations may be determined by one of skill in the art. For example, volumes of about 1 pL to 150 mL may be selected, with the higher volumes being selected for adults. Typically, for newborn infants a suitable volume is about 0.5 mL to about 10 mL, for older infants, about 0.5 mL to about 15 mL may be selected. For toddlers, a volume of about 0.5 mL to about 20 mL may be selected. For children, volumes of up to about 30 mL may be selected. For pre-teens and teens, volumes up to about 50 mL may be selected.
• a patient may receive an intrathecal administration in a volume of about 5 mL to about 15 mL are selected, or about 7.5 mL to about 10 mL.
• Other suitable volumes and dosages may be determined. The dosage will be adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed.
• GC genome copy
• Any method known in the art can be used to determine the genome copy (GC) number of the replication-defective virus compositions of the invention.
• One method for performing AAV GC number titration is as follows: Purified AAV vector samples are first treated with DNase to eliminate un-encapsidated AAV genome DNA or contaminating plasmid DNA from the production process. The DNase resistant particles are then subjected to heat treatment to release the genome from the capsid. The released genomes are then quantitated by real-time PCR or quantitative PCR using primer/probe sets targeting specific region of the viral genome (usually poly A signal).
• the replication- defective virus compositions can be formulated in dosage units to contain an amount of replication-defective virus that is in the range of about 1.0 x 10 9 GC to about 1.0 x 10 15 GC, and preferably 1.0 x 10 12 GC to 1.0 x 10 14 GC for a human patient.
• the concentration of replication-defective virus in the formulation is about 1.0 x 10 9 GC, about 5.0 x 10 9 GC, about 1.0 x 10 10 GC, about 5.0 x 10 10 GC, about 1.0 x 10 11 GC, about 5.0 x 10 11 GC, about 1.0 x 10 12 GC, about 5.0 x 10 12 GC, about 1.0 x 10 13 GC, about 5.0 x 10 13 GC, about 1.0 x 10 14 GC, about 5.0 x 10 14 GC, or about 1.0 x 10 15 GC.
• Alternative or additional method for performing AAV GC number titration is via oqPCR or digital droplet PCR (ddPCR) as described in, e.g, M. Lock et al, Hum Gene Ther Methods. 2014 Apr;25(2): 115-25. doi: 10.1089/hgtb.2013.131. Epub 2014 Feb 14, which is incorporated herein by reference.
• compositions in the pharmaceutical compositions described herein are intended to be applied to other compositions, regimens, aspects, embodiments, and methods described across the Specification
• an expression cassette, nucleic acid, or a viral or non-viral vector is used in preparing a medicament.
• uses of the same for treatment of Angelman syndrome in a subject in need thereof are provided.
• treatment is defined encompassing administering to a subject one or more compounds or compositions described herein for the purposes of amelioration of one or more symptoms of UBE3A deficiency or Angelman syndrome (AS).
• Treatment can thus include one or more of reducing onset or progression of AS, preventing disease, reducing the severity of the disease symptoms, retarding their progression, removing the disease symptoms, delaying progression of disease, or increasing efficacy of therapy in a given subject.
• a goal of therapies described herein is to enhance UBE3 A expression to achieve a desired result, i.e., treatment of Angelman syndrome (AS) or one or more symptoms thereof.
• Such symptoms may include but are not limited to one of more of the following: intellectual disability, speech impairment, ataxia, epilepsy, seizure disorder, microcephaly, psychomotor delay, and muscular hypotonia with hyperreflexia (See e.g., K. Buiting, et al., Nature reviews. Neurology , (2016), which is incorporated herein by reference).
• a desired result may include reducing or eliminating neurophysical complications including delayed development, intellectual disability, severe speech impairment, and problems with movement and balance.
• a “therapeutically effective amount” of a composition provided herein is delivered to a subject to achieve a desired result or to reach a therapeutic goal.
• a therapeutic goal for treating AS is to restore UBE3 A expression in a neuron, or in a population of neurons, to the functional level in a patient that is in the normal range or to the non-AS level.
• therapeutic goal for treatment of AS is to increase the UBE3 A expression to at least about 99%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55%, about 50%, about 45%, about 40%, about 45%, about 40%, about 35%, about 30% about 25%, about 20%, about 15%, about 10%, about 5%, about 2%, about 1% of the normal or non-AS level, or as compared to levels of UBE3A expression before treatment. Patients rescued by delivering UBE3A function to less than 100% activity levels may optionally be subject to further treatment.
• therapeutic goals for treatment of AS are to increase the UBE3 A expression in a percentage of target neurons, including about 60%, about 55%, about 50%, about 45%, about 40%, about 45%, about 40%, about 35%, about 30% about 25%, about 20%, about 15%, about 10%, about 5%, about 2%, or about 1% of neurons in a selected population.
• provided herein is a method of treating AS by administering to a subject in need thereof an expression cassette, vector, or rAAV that provides one or more elements of a gene editing system editing, wherein editing of UBE3A-ATS results in enhanced expression of UBE3A from a paternal allele in a neuron.
• the method includes delivering a nucleic acid sequence which expresses a nuclease which binds to a sequence in UBE3 A-ATS downstream of the UBE3A 3’UTR.
• editing of the UBE3 A-ATS coding sequence unsilences UBE3 A expression on a paternal allele of a patient having a deficiency in UBE3 A expression from a maternal allele and provided for expression of the UBE3 A gene product from the paternal allele.
• the gene editing system introduces a mutation or modification that is an indel, deletion, insertion, inversion, or other disruption that interferes with transcription of the UBE3 A-ATS coding sequence.
• the method includes introducing a mutation in the human UBE3A-ATS in the region spanning the UBE3A 3’UTR and SNORD109B.
• the mutation is introduced in a target sequence located at chrl5: 25,278,409-25,333,728 (hg38 genome assembly) and/or in a sequence of UBE3 A-ATS complementary to the region between the UBE3A 3’UTR and SNORD109B ORE on chromosome 15.
• the gene therapy described herein may be used in conjunction with other treatments (secondary therapy), i.e., the standard of care for the subject’s (patient’s) diagnosis and condition.
• secondary therapy refers to the therapy that could be combined with the gene therapy described herein for the treatment of AS.
• the gene therapy described herein is administered in combination with one or more secondary therapies for the treatment of AS, such as administering an anticonvulsant or dietary restriction (e.g., ketogenic and low glycemic).
• the secondary therapy may be any therapy which helps prevent, arrest or ameliorate these symptoms of AS.
• the secondary therapy can be administered before, concurrent with, or after administration of the compositions described above.
• Subjects may be permitted to continue their standard of care treatment(s) prior to and concurrently with the gene therapy treatment at the discretion of their caring physician.
• the physician may prefer to stop standard of care therapies prior to administering the gene therapy treatment and, optionally, resume standard of care treatments as a co-therapy after administration of the gene therapy.
• the gene therapy described herein may be combined with genotypic analysis or genetic screening, which is routine in the art and may include the use of PCR to identify one or more mutations in the nucleic acid sequence of the UBE3 A gene.
• genotypic analysis or genetic screening which is routine in the art and may include the use of PCR to identify one or more mutations in the nucleic acid sequence of the UBE3 A gene.
• administering or “route of administration” is delivery of composition described herein, with or without a pharmaceutical carrier or excipient, of the subject. Routes of administration may be combined, if desired. In some embodiments, the administration is repeated periodically. Sequential administration may imply a time gap of multi-administration from intervals of days, weeks, months or years. In one embodiment, the compositions described herein are administered to a subject in need for one or more times. In one embodiment, the administrations are days, weeks, months or years apart. In one embodiment, two, three or more re-administrations are permitted. Such re administration may be with the same type of vector, or a different vector.
• the vectors described herein may be used alone, or in combination with the standard of care for the patient’s diagnosis and condition.
• the nucleic acid molecules and/or vectors described herein may be delivered in a single composition or multiple compositions.
• two or more different AAV may be delivered, or multiple viruses [see, e.g., WO 2011/126808 and WO 2013/049493]
• the expression cassette, vector, or other composition described herein for gene therapy is delivered as a single dose per patient.
• the subject is delivered a therapeutically effective amount of a composition described herein.
• a “therapeutically effective amount” refers to the amount of the expression cassette or vector, or a combination thereof.
• the expression cassette is in a vector genome delivered in an amount of about 1 x 10 9 GC per gram of brain mass to about 1 x 10 13 genome copies (GC) per gram (g) of brain mass, including all integers or fractional amounts within the range and the endpoints.
• the dosage is 1 x 10 10 GC per gram of brain mass to about 1 x 10 13 GC per gram of brain mass.
• the dose of the vector administered to a patient is at least about 1.0 x 10 9 GC/g, about 1.5 x 10 9 GC/g, about 2.0 x 10 9 GC/g, about 2.5 x 10 9 GC/g, about 3.0 x 10 9 GC/g, about 3.5 x 10 9 GC/g, about 4.0 x 10 9 GC/g, about 4.5 x 10 9 GC/g, about 5.0 x 10 9 GC/g, about 5.5 x 10 9 GC/g, about 6.0 x 10 9 GC/g, about 6.5 x 10 9 GC/g, about 7.0 x 10 9 GC/g, about 7.5 x 10 9 GC/g, about 8.0 x 10 9 GC/g, about 8.5 x 10 9 GC/g, about 9.0 x 10 9 GC/g, about 9.5 x 10 9 GC/g, about 1.0 x 10 10 GC/g, about 1.5 x 10 10 GC/g, about 2.0 x 10
• treatment of a subject having AS with a composition described herein to introduce mutation (e.g., indel) in UBE3A-ATS may not require readministration.
• a second or subsequent additional treatment that includes a composition comprising a gene editing system provided herein may be pursued.
• Such subsequent treatment may utilize vectors having different capsids than were utilized for the initial treatment. Still other combinations of AAV capsids may be selected by one skilled in the art.
• the lowest effective concentration of virus or other delivery vehicle be utilized in order to reduce the risk of undesirable effects, such as toxicity.
• Still other dosages in these ranges may be selected by the attending physician, taking into account the physical state of the subject, preferably human, being treated, the age of the subject, and the degree to which the disorder, if progressive, has developed.
• the methods include administering to a mammalian subject in need thereof, a pharmaceutically effective amount of a composition comprising a recombinant adeno-associated virus (AAV) carrying a nucleic acid sequence encoding one or more elements of a UBE3 A-ATS gene editing system under the control of regulatory sequences, and a pharmaceutically acceptable carrier.
• AAV adeno-associated virus
• such a method is designed for treating, retarding or halting progression of AS in a mammalian subject.
• a rAAV is delivered about 1 x 10 10 to about 1 x 10 15 genome copies (GC)/kg body weight.
• the subject is human.
• the rAAV is administered more than one time.
• the rAAV is administered days, weeks, months or years apart.
• the target sequences sampled a 12-kbp region downstream of the Ube3a 3’UTR (chr7:59, 341, 000-59, 353, 000, GRCm38/mml0 genome assembly).
• the nontargeted sequence consisted of a scrambled 20-bp sequence (5’-GAGACGGTCTTCGACGTCTC- 3’, SED ID NO: 56).
• the nuclease-deficient dCas9 mutant was generated by point mutagenesis (D10A and H840A).
• gRNA #7 After isolating gDNA (QiaAmp DNA Mini kit, Qiagen, Waltham, MA), we amplified the respective target regions by PCR and quantified indel frequencies by Amplicon-Seq. We selected the following target sequence for in vivo studies (sgRNA #7):
• Table 1 In vivo off-target analysis for gene editing with selected sgRNA for aged mice Ube3am+/p- (maternal Ube3a-ko) mice were injected with an AAV vector encoding CRISPR/Cas9 at birth (day 0), and the cerebral cortices were harvested four months later. We conducted ITR-seq to detect off-target gene editing (5 mice per group). Genes or predicted genes at the off-target location were identified using the USCD genome browser (mm 10 genome assembly). Both introns and exons were queried.
• AMP-Seq We performed anchored multiplexed PCR sequencing (AMP-Seq) analysis as follows: A sample of 500 ng of genomic DNA was sheared using a Covaris ME220 instrument, and the DNA was end-repaired, A-tailed, and ligated to adapters as previously reported (Wang L, et al. Nat Biotechnol. 2018;36(8):717-25; Zheng Z, et al.
• ITR-Seq Off-target editing mediated by the sgRNA + SaCas9 complex was determined by inverted terminal repeat sequencing (ITR-Seq) (Breton C, et al. BMC Genomics. 2020;21(1):239). Briefly, the DNA was sheared, end-repaired, A-tailed, and ligated to adapters containing unique molecular barcodes. The DNA was then amplified by two rounds of PCR using an AAV-ITR-specific primer and adapter-specific primers, resulting in NGS-compatible libraries, which were subsequently sequenced on MiSeq (Illumina). We used a custom script to identify the genomic locations (including intronic and exonic locations) of AAV integration sites that resulted from double-strand breaks (Breton C, et al. BMC Genomics. 2020;21(1):239).
• ITR-Seq inverted terminal repeat sequencing
• mice We purchased C56BL/6J (stock no. 000664), 6A29Sl-Ube3a tmlAlb A (016590), and B6.129S7-C3 ⁇ 4e3a im243 ⁇ 4 /J (017765) mice from the Jackson Laboratory and maintained the animals at the University of Pennsylvania. Experimental cohorts were generated by crossing female C56BL/6J mice with male B6.129S7-C3 ⁇ 4e3a im24ft /J mice or male C56BL/6J mice with female B6.129S7-C3 ⁇ 4e3a im 43 ⁇ 4 /J mice.
• mice were anesthetized and terminally perfused with DPBS, and the whole brain was promptly collected.
• One half of a sagittally sectioned brain was immersion-fixed in 10% neutral -buffered formalin for approximately 24 h, washed briefly in PBS, and equilibrated in 70% ethanol before being embedded in paraffin and cut into 10-pm-thick sections.
• the sections were deparaffmized, boiled for 6 min in 10 mM citrate buffer (pH 6.0) for antigen retrieval, blocked with 1% donkey serum in PBS + 0.2% Triton for 15 min, and then incubated with anti-GFP antibodies (A-l 1122, Invitrogen, Thermo Fisher Scientific, Waltham, MA) and anti-NeuN antibodies (ABN90, Sigma-Aldrich, St. Louis, MI) at 1 :500 dilution for 1 h.
• anti-GFP antibodies A-l 1122, Invitrogen, Thermo Fisher Scientific, Waltham, MA
• anti-NeuN antibodies A-l 1122, Invitrogen, Thermo Fisher Scientific, Waltham, MA
• ABS90 Sigma-Aldrich, St. Louis, MI
• the samples were incubated for 45 min with fluorescence-labeled secondary antibodies (anti-rabbit IgG-Alexa488 and anti-guinea pig IgG-Cy5 conjugates at a 1:200 dilution [Jackson ImmunoResearch, West Grove, PA]).
• fluorescence-labeled secondary antibodies anti-rabbit IgG-Alexa488 and anti-guinea pig IgG-Cy5 conjugates at a 1:200 dilution [Jackson ImmunoResearch, West Grove, PA]
• the sections were deparaffmized, boiled for 6 min in 10 mM citrate buffer (pH 6.0) for antigen retrieval, and sequentially treated with 2% H2O2 (15 min), avidin and biotin blocking reagents (15 min each; Vector Laboratories, Burlingame, CA), and blocking buffer (1% donkey serum in PBS with 0.2% Triton for 10 min).
• SYBR green qPCR Thermo Fisher
• primers listed in Table 1 according to the manufacturer’s instructions for an ABI7500 thermocycler (Thermo Fisher).
• mice The behavioral phenotype of maternal Ube3a-KO mice has been well characterized (12-16) and can be improved by genetically restoring maternal Ube3a expression (Sonzogni M, et al. Molecular autism. 2018;9:47).
• the mice were group-housed after weaning, mixed by genotype and treatment. We determined the weight of each animal a few days before starting the behavioral analysis. Prior to each test, the mice were acclimatized to the testing room in their home cage for 30 min. All behavioral experiments were performed during the afternoon light period of the light/dark cycle. We used both male and female mice aged 8-10 weeks for the experiments. After testing, the mice were promptly returned to the holding room.
• the housing cages were composed of clear polycarbonate plastic (7.75 x 12 x 5 inches). Data presented is based on accumulating results from three independent experimental cohorts. The same set of breeders was used to generate those experimental cohorts.
• Accelerating rotarod We tested motor function using an accelerating rotarod (4- 40 rpm in 5 min; model 7650, Ugo Basile Biological Research Apparatus, Varese, Italy). The mice were subjected to three trials per day with a 15-min intertrial interval for three consecutive days (same time each day). For each day, we calculated the average time spent by the mouse on the rotarod until falling off (latency in seconds). If a mouse achieved three consecutive wrapping/passive rotations on the rotarod, the time after the third rotation was recorded as the latency, and the mouse was removed.
• Open-field activity test To test locomotor activity, we individually placed mice in a new housing cage with a minimal amount of bedding covering the bottom. The cage was placed in an array of infrared cross beams (Med Associates, Inc., Fairfax, VT). We allowed the mice to freely explore for 30 min, with the number of beam breaks automatically recorded as a measure of activity. The numbers of beam breaks were summed in bins with a duration of 5 min for analysis.
• Marble burying test Housing cages were filled with 5 cm of bedding material (Alpha-Dri, Lab Supply, Fort Worth, TX). On top of the bedding material, we arranged 12 blue glass marbles arranged in an equidistant 3 x 4 grid. We gave the animals access to the marbles for 30 min. After the test, the mice were removed from the cage, and the marbles that were more than 50% covered by bedding were scored as buried. The outcome measured for this test was the number of buried marbles.
• bedding material Alpha-Dri, Lab Supply, Fort Worth, TX
• mice were singly housed in a new cage and provided with a pre-weighed square nestlet (2 x 2 x 0.25 inches). After 24 h, the mice were returned to their original home cage, and the quality of the nest was scored on a scale of 1 to 5, as previously described (Deacon RM. Nature protocols.
• Manipulation of the genomic sequence by gene editing is a powerful tool to correct genetic mutations but has largely been inaccessible for the in vivo use in post-mitotic cells such as neurons.
• gene editing can also be used as a cell-type independent tool to disrupt the genetic code by base pair deletion and insertion, termed indel formation.
• indel formation within the Ube3a-ATS sequence downstream of the Ube3a gene locus is able to prevent extension of murine Ube3a-ATS across the Ube3 gene locus, to cause paternal Ube3a expression and to improve the Angelman phenotype in maternal Ube3a-deficient mice.
• AAV gene editing vector which we refer to as ATS-GE — to the neonatal mouse brain via intracerebroventricular (ICV) injection resulted in the formation of genomic indels in 14.7% (8.6-21.7%) of all brain cells (FIG. 2C).
• ICV intracerebroventricular
• NT non-targeting
• dCas9 nuclease-deficient Cas9
• Indel formation was highest after neonatal ICV vector delivery.
• the PHP.B capsid facilitates very efficient transduction of the mouse brain via intravenous (IV) delivery at any age (15).
• Table 2 Sequences and indel frequencies for in vitro screened sgRNA. Indel% were determined by Amplicon-seq at the 12 target sites using either a non -targeting (NT) sgRNA or the respective sgRNA. sgRNA #7 was chosen for in vivo follow-up.
• NT non -targeting
• Cas9 vector 5001 reads 66 reads chr8: 116314485 chr9: 3024429 chr9:112134613
• Ube3a-ATS interferes with the extension of the Ube3a transcript on the paternal allele, blocking Ube3a expression from the paternal allele.
• a promising therapeutic approach for AS relies on abrogating the extension of Ube3a-ATS across the Ube3a gene locus on the paternal allele to allow for full-length Ube3a transcript formation and thus protein expression.
• To unambiguously detect Ube3a expression from the paternal allele we crossed wild-type females with male mice harboring an sn fusion gene (16).
• Newborn pups ICV injected with the ATS-GE vector showed expression of the Ube3a-YFP fusion protein 21 days later (FIG. 2E, FIG. 2F).
• the targeting sgRNA in the ATS- GE vector with a non-targeting sgRNA, or replaced Cas9 with dCas9, we observed no Ube3a-YFP expression (FIG. 5D and FIG. 5D).
• mice that received the control AAV vector did not show Ube3a expression from the paternal allele (FIG. 7A and FIG. 7B).
• Molecular analysis by Amplicon-seq revealed that indel frequencies occurred at an average of 19.4% (FIG. 3F), which is comparable to observations from the previous short-term study (FIG. 2C).
• Vector integrations at the gene-editing site were low (AMP-seq, 2.1%, FIG. 7C) as previously observed (FIG. 5A).
• ITR- seq did not show an increased rate of off-target effects (Table 1) compared to the previous short-term study (Table 3).
• ATS-Ube3a transcript levels were significantly reduced in Ube3a-KO mouse brains after gene editing (FIG. 3G). The transcript levels were found to have normalized about 4kb from the gene-editing site towards the imprinting center.
• the behavioral phenotype of maternal Ube3a-KO mice has been well characterized and can be improved by genetically restoring maternal Ube3a expression.
• Treatment with ASOs transiently suppresses the extension of Ube3a-ATS across the Ube3a locus, leading to paternal Ube3a expression in neurons throughout the brain and the subsequent improvement of the behavioral phenotype.
• This approach restores Ube3a expression in a much larger number of neurons throughout the mouse brain, so we were wondering whether gene editing of Ube3a-ATS in a limited number of neurons could improve the maternal Ube3a-KO phenotype.
• Ube3a-ATS gene editing was tolerated well with no treatment-related mortalities. As expected, weight gain was significantly higher in AS mice and showed a trend to reduction after ATS-GE treatment during the observation period (FIG 4A). At two months of age, the mice were subjected to a sequence of behavioral tests that have been widely used with this mouse model (17). Maternal Ube3a- KO mice showed the expected significant deficits in motor function in comparison to their wild-type littermates when tested with a rotarod (FIG. 4B). Gene-edited maternal Ube3a- KO mice showed a significant improvement of motor function on testing days two and three (FIG. 4B).
• CRISPR/Cas9 has been recognized as promising target for therapeutic genome editing, particularly since disruption of a pathological allele holds promise for curative treatment of genetic disorders (18-20).
• Recent studies for therapeutic CNS gene editing have achieved promising results via focal delivery of CRISPR/Cas9 complex, e.g., into the striatum of a Huntington’s disease mouse model (21), into the spinal cord of an amyotrophic lateral sclerosis mouse model (22), or into the hippocampus of a mouse model of familial Alzheimer’s disease (23).
• CRISPR/Cas9 can successfully edit a sufficient number of neurons to achieve a therapeutic benefit in human patients if editing throughout different brain regions needs to be achieved.
• Another possible mechanism of action includes the ability of S. aureus Cas9 to cleave RNA transcripts (25), which likely would require constitutive expression of Cas9 to maintain Ube3a expression; we did not, however, observe sustained Cas9 expression in all Ube3a-expressing AS mouse brains (data not shown).
• integration of AAV vector sequence could lead to premature termination of Ube3a-ATS , as observed in a recent study (24). Given that total detected integrations remained at 2-3% over 4 months, this mechanism could contribute to, but unlikely be solely responsible for all, detected Ube3a expression.
• Topoisomerase inhibitors unsilence the dormant allele of Ube3a in neurons.
• Human synapsin 1 gene promoter confers highly neuron-specific long-term transgene expression from an adenoviral vector in the adult rat brain depending on the transduced area. Gene Therapy. 2003;10(4):337- 47. Thiel G, Greengard P, and Sudhof TC. Characterization of tissue-specific transcription by the human synapsin I gene promoter. Proc Natl Acad Sci USA.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Biomedical Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Biotechnology (AREA)
• Molecular Biology (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Microbiology (AREA)
• Biochemistry (AREA)
• Plant Pathology (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Medicinal Chemistry (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Pharmacology & Pharmacy (AREA)
• Neurology (AREA)
• Mycology (AREA)
• Cell Biology (AREA)
• Neurosurgery (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Virology (AREA)
• Epidemiology (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Priority Applications (3)

Applications Claiming Priority (4)

Publications (1)

Family

ID=78332167

Family Applications (1)

Country Status (4)

Cited By (1)

Citations (4)

Family Cites Families (4)

• 2021
  • 2021-04-27 WO PCT/US2021/029378 patent/WO2021222232A1/en not_active Ceased
  • 2021-04-27 EP EP21797195.1A patent/EP4142802A4/en active Pending
  • 2021-04-27 US US17/997,004 patent/US20230167438A1/en active Pending
  • 2021-04-27 JP JP2022566154A patent/JP2023524247A/ja active Pending

Patent Citations (4)

Non-Patent Citations (5)

Also Published As

Similar Documents

Legal Events