WO2021217960A1 - APPLICATION OF HEAT-RESISTANT β-GLUCOSIDASE IN PREPARATION OF GENTIOOLIGOSACCHARIDE - Google Patents

Abstract

An application of heat-resistant β-glucosidase TSBGl in preparation of gentiooligosaccharide. The heat-resistant β-glucosidase TSBGl from Thermotoga sp.KOL6 takes Bacillus subtilis WSH11 as an expression host, so that high-efficiency expression of the tsbgl gene in bacillus subtilis is achieved. The optimum temperature of the β-glucosidase TSBGl is 90℃, the optimum pH is 6.0, and the β-glucosidase TSBGl has relatively high thermostability at 90℃. The β-glucosidase is added to a reaction system employing 1200 g/L of glucose as a substrate, an enzyme reaction is carried out under a pH of 6.0 at 90℃, and the yield of the gentiooligosaccharide reaches 178.2 g/L. The β-glucosidase meets requirements for industrial applications such as foods and can be applied to industrial production of the gentiooligosaccharide.

Description

Application of a kind of heat-resistant β-glucosidase in the preparation of oligogentiose Technical field

The invention relates to the application of a heat-resistant β-glucosidase in the preparation of oligogentiose, which belongs to the fields of genetic engineering and enzyme engineering.

Background technique

β-Glucosidase (EC 3.2.1.21) is a type of glycoside hydrolysase (GH) that can specifically hydrolyze the β-D-glucosidic bond at the non-reducing end to release glucose and the corresponding ligand. β-glucosidase is widely present in the organism and plays an important role in it. According to the difference in its amino acid sequence characteristics, it is mainly distributed in the six families of GH1, GH3, GH5, GH9, GH30 and GH116, most of which are β-glucose Glucosidase belongs to GH1, GH3 family. The β-glucosidase of GH1 and GH3 family has differences in protein folding, physical and chemical properties, catalytic properties and substrate specificity. β-glucosidase can be used in various industries, for example, in the bioethanol industry to degrade cellobiose and eliminate product inhibition; as a flavor enhancer for hydrolyzing the flavor precursor glycosides in fruit juice; part of β-glucosidase is due to its It has the ability of transglycosidase and has certain synthetic activity, which can be a good substitute for traditional chemical methods to synthesize rare oligosaccharides and alkyl glycosides for use in the food and cosmetics industry. Among them, the oligomers produced by β-glucosidase Gentianose can induce the growth of probiotics in the human intestinal tract, which is beneficial to the human body.

Gentianose oligosaccharide is a new functional oligosaccharide composed of two or more β-1.6-glucosidic bonds connected by glucose. The main component is gentiobiose and a small amount of gentiotriose and tetrasaccharide. . Gentian oligosaccharides are low in calories and have a low risk of dental caries when used in foods. In addition, they have the functions of inhibiting tumors and promoting nutrient absorption and metabolism.

There are many methods for preparing oligo-gentianose. The early research was extracted from the roots and stems of Gentian plants. It can also be obtained from the by-products after the reduction of amygdalin method and acid method to hydrolyze starch; but because Restrictions on raw materials and market prices make it difficult for industrial production. Enzymatic preparation is currently the main way for the industrial production of oligo-gentiolanose. The commonly used reaction conditions are to synthesize oligo-gentiolanose using the transglycosidic activity of β-glucosidase under low water activity and high substrate concentration. , The yield of the oligo-gentianose obtained is not high, basically at 50g/L, and the conversion rate is about 8%. The two important factors affecting the production of oligogentianose are the reaction temperature and the transglycosidic activity of the enzyme. The production of oligogentianose will increase with the increase of temperature. The main reason is that the solubility of the substrate glucose will increase at higher temperatures, and at this time, the water molecules as receptors will also decrease correspondingly, which promotes the transformation. The occurrence of glycoside reaction increases the accumulation of oligogentianose. At the same time, high temperature can also prevent contamination by bacteria. From the perspective of industrial production, under long-term continuous production systems, the inactivation of enzymes will be more obvious and serious. affect production. Therefore, β-glucosidase, which is naturally resistant to high temperatures, is very important for industrial production. In addition, most of the current researches on the preparation of oligogentiose mainly use the β-glucosidase of the GH3 family, and there are few studies on the β-glucosidase of the GH1 family. The β-glucosidase of the GH1 family is mainly used in the The application prospects in the preparation have yet to be developed.

Summary of the invention

The present invention provides a gene encoding β-glucosidase TSBG1, and the nucleotide sequence of the gene is shown in SEQ ID NO.1.

In one embodiment of the present invention, the amino acid sequence of the β-glucosidase TSBG1 is shown in SEQ ID NO.2.

The present invention provides a vector which carries a gene encoding β-glucosidase TSBG1.

In one embodiment of the present invention, the starting vector of the vector is the expression vector pBSMμL3, and the vector sequence is described in the patent publication number CN107058205A.

The present invention provides a recombinant bacteria that uses Bacillus subtilis as an expression host and expresses the β-glucosidase TSBG1 whose amino acid sequence is shown in SEQ ID NO.2.

In one embodiment of the present invention, the Bacillus subtilis is Bacillus subtilis WSH11, which is described in the patent publication number CN108102997A.

The present invention provides a method for producing β-glucosidase, the specific steps of the method are:

(1) Culturing the recombinant bacteria at 35-40°C for 2-5 hours to obtain a bacterial solution;

(2) Centrifuge the bacterial solution at 2500～3500rpm for 3～6min, remove 60～90% of the supernatant, spread the remaining 10～40% of the supernatant on the LB plate, and incubate at 35～40℃ for 10 ～16h;

(3) Pick a single colony on the LB plate and culture it in LB liquid medium for 7 to 11 hours, then transfer 2 to 6 mL of culture medium to 100 mL of TB medium, and incubate at 35 to 40°C for 1.5 to 3 hours, and then 30 to Incubate at 34°C for 45-50h;

(4) After culturing, centrifuge the cultured bacteria solution at 7000～9000rpm for 15～25min to collect the bacteria;

(5) Add 45-55 mL of citric acid-disodium hydrogen phosphate buffer to the bacteria to resuspend the bacteria;

(6) Use a high-pressure homogenizer to break the wall, centrifuge at 9000 to 12000 rpm for 15 to 25 minutes, and collect the supernatant from the broken wall to obtain the crude enzyme solution.

In one embodiment of the present invention, the medium in steps (2) and (3) contains 5-15 μg/mL tetracycline.

In one embodiment of the present invention, the concentration of the citric acid-disodium hydrogen phosphate buffer in step (5) is 40-60 mM, and the pH is 5.0-7.0.

The present invention provides a method for increasing the yield of oligogentianose. The method is to react the β-glucosidase obtained by fermentation of the recombinant bacteria in a system using glucose as a substrate to obtain a reaction liquid, and the reaction liquid After purification, gentian oligosaccharides are obtained.

In one embodiment of the present invention, the amount of β-glucosidase added is 300-700 U/g.

In one embodiment of the present invention, the amount of β-glucosidase added is 400-600 U/g.

In one embodiment of the present invention, the glucose concentration is 800-1500 g/L.

In one embodiment of the present invention, the glucose concentration is 1000-1300 g/L.

In one embodiment of the present invention, the method is to conduct the reaction at 60-100°C for 20-30 hours.

In one embodiment of the present invention, the method is to conduct the reaction at 80-100°C for 22-25h.

The invention also protects the application of the gene in the preparation of oligogentiose in the fields of food and cosmetics.

The invention also protects the application of the carrier pBSMμL3-tsbgl in the preparation of products containing gentian oligosaccharides in the field of food and cosmetics.

The invention also protects the application of the method for producing β-glucosidase in the preparation of products containing gentian oligosaccharides in the fields of food and cosmetics.

The present invention also protects the application of the method for increasing the yield of oligogentianose in the preparation of products containing oligogentianose in the field of food and cosmetics.

The invention also protects the application of the recombinant bacteria in the preparation of oligogentiose in the fields of food and cosmetics.

The beneficial effects of the present invention: the present invention provides a high-efficiency expression method of β-glucosidase. The nucleotide sequence encoding the β-glucosidase TSBG1 derived from Thermotoga sp.KOL6 was chemically synthesized, the shuttle plasmid pBSMμL3 was used as the expression vector, and Bacillus subtilis WSH11 was used as the expression host to realize the tsbgl gene in Bacillus subtilis. Efficient expression; the optimum temperature of β-glucosidase TSBG1 is 90-100℃, the optimum pH is 6.0, and it has high thermal stability at 90℃. β-glucosidase TSBG1 can utilize glucose and convert it into oligogentianose, especially under the condition of high concentration of 1200g/L glucose, using glucose for production. At this time, the output of oligogentianose can reach 178.2g/L , Which is the highest yield of β-glucosidase method to synthesize gentio-oligosaccharides. Therefore, this enzyme is suitable for the needs of industrial applications such as food and medicine, and can be produced due to the industrial production of oligogentiose.

Description of the drawings

Figure 1 is the construction process of tsbgl gene expression vector.

Figure 2 is the electrophoresis diagram before and after purification of β-glucosidase; M is marker, lane 1 is the crude β-glucosidase TSBG1 enzyme solution before purification, and lane 2 is the purified β-glucosidase TSBG1 enzyme after purification.

Figure 3 shows the relative enzyme activity of β-glucosidase at different temperatures.

Figure 4 shows the relative enzyme activity of β-glucosidase at different pHs.

Figure 5 shows the enzyme activity stability of β-glucosidase at different temperatures.

Figure 6 shows the conversion rate of oligogentianose at different addition amounts of β-glucosidase.

Fig. 7 is the conversion rate of β-glucosidase to produce gentiooligosaccharides under different substrate concentrations.

Detailed ways

Analysis of β-glucosidase enzyme activity:

(1) Enzyme activity unit definition: The enzyme activity of 1 μmol p-nitrophenol produced by hydrolyzing pNPG per milliliter of enzyme solution per minute is an enzyme activity unit.

Relative enzyme activity calculation method: enzyme activity=(A ₄₀₅ +0.002)*reaction system*dilution multiple/(0.0074*reaction time*adding enzyme amount).

(2) Enzyme activity determination steps

The reaction system is 1mL, 960μL of acetic acid buffer with pH 5.0. Add 20μL of crude enzyme solution that is appropriately diluted (the absorbance value of the reaction solution at 405nm should be in the range of 0.2-1.2 at the end of the reaction), and then add 20μL of 100mmol/L pNPG. React in a constant temperature water bath at 60°C for 10 minutes. After 10 minutes, add 200 μL of 1 mol/L Na ₂ CO ₃ solution to stop the reaction. Take an ice bath for 5 minutes and measure the absorbance at 405 nm. The enzyme solution inactivated by heating is treated in the same way as a blank.

LB medium: yeast powder 5g/L, tryptone 10g/L, NaCl 10g/L.

TB medium: yeast powder 24g/L, glycerol 5g/L, tryptone 12g/L, K ₂ HPO ₄ ·3H ₂ O 16.43 g/L, KH ₂ PO ₄ 2.31 g/L.

RM medium: yeast extract 5.0g/L, tryptone 10.0g/L, NaCl 10.0g/L, sorbitol 90.0g/L, mannitol 70.0g/L.

Purification of β-glucosidase TSBG1:

(1) Add 50mL, 35% solid ammonium sulfate to 500mL of the broken supernatant of the recombinant bacteria to salt out overnight (12h);

(2) Centrifuge the salted-out crude enzyme solution at 4°C and 10,000 rpm for 20 minutes, and dissolve the precipitate in buffer A containing 20 mM sodium phosphate, 0.5 M sodium chloride, 20 mM imidazole, and pH 7.4. After dialysis overnight (12h) in the medium, the sample is prepared after filtration through a 0.22μm membrane;

(3) After the Ni affinity column is equilibrated with buffer A, suck the sample into the Ni column to make it completely adsorbed, and then use 100 mL buffer A, 100 mL buffer A containing 20-480 mM imidazole, and 100 mL containing 480 mM imidazole. Buffer A was eluted with a flow rate of 1 mL/min, and the target protein β-glucosidase was eluted by buffer A containing 480 mM imidazole, and this part of the eluate was collected;

(4) After the above-mentioned protein eluate containing 480 mM imidazole was dialyzed overnight in a pH 6.0, 50 mM sodium phosphate buffer, a purified β-glucosidase enzyme product was obtained.

(5) After purification, the recombinant β-glucosidase is subjected to electrophoresis. The purified electrophoresis diagram is shown in Figure 2.

Example 1: Construction of expression vector containing tsbgl gene

According to the amino acid sequence of Thermotoga sp KOL6 β-glucosidase Tsbgl (WP_101510358) in the Genbank database, the chemically synthesized nucleotide sequence is the gene shown in SEQ ID NO.1.

The synthesized gene fragments were digested with pET-24a (restriction sites: Nde I and EcoR I) to obtain a ligation product; the ligation product was transformed into E. coli. JM109 by heat shock transformation. The transformation product is obtained; the transformation product is spread on LB solid medium (containing 0.05 mg/mL kanamycin), and incubated in a constant temperature incubator at 37° C. for 8-12 hours to obtain transformants.

Heat shock conversion method:

(1) Put E.coli.JM109 competent cells on ice for 5 minutes in advance. After the competent cells are completely melted, add 10 μL of the complete plasmid or PCR product to them, and then gently pipette and suck them evenly, then place them on ice for 45 minutes.

(2) Place the competent state in a 42℃ water bath and heat shock for 90 seconds. After the heat shock is over, place it on ice for 5 minutes.

(3) After the ice bath is over, add 0.8 mL of LB liquid medium to the competent state, mix well, and place it in a shaker at 37°C for shaking for about 60 minutes.

(4) Centrifuge at 3000 rpm for 5 minutes at 3000 rpm for competent competence after culture, discard part of the supernatant, leave about 200 μL of fermentation broth to re-suspend the bacteria by pipetting and resuspending, and spread on the LB solid plate containing 10 μg/mL ampicillin antibiotic at 37°C Leave the incubator to stand for about 10 hours and wait for a single colony to grow on the plate.

Pick a single colony and inoculate it into a 10μg/mL ampicillin-resistant LB liquid medium, culture it in a shake flask at 37°C and 120-180rpm for 8-12h, then extract the plasmid for enzyme digestion verification and sequencing verification, and the verification is correct The recombinant plasmid pET24a-tsbgl was obtained.

Using plasmid pET24a-tsbgl and pBSMμL3 as templates, design the target gene primers and vector primers containing 15bp homology arms in the upstream and downstream respectively, and PCR amplify the target gene fragment tsbgl (primers 1 and 2) and template fragment pBSMμL3( Primers 3 and 4);

Primer 1: TAAGGAGTGTCAAGAATGAGCATGAAAAAGTTTCCGGAAG (SEQ ID NO.3);

Primer 2: TTTATTACCAAGCTTTTAATCTTCCAGGCCGTTATTTTTAATAAC (SEQ ID NO.4);

Primer 3: AAGCTTGTAATAAAAAAACACCTC (SEQ ID NO.5);

Primer 4: CATTCTTGACACTCCTTATTTG (SEQ ID NO.6).

The PCR system is: 2×Super Pfx MasterMix 25μL, two primers each _{1.25μL, ddH 2} O 22μL, template 0.5μL.

The reaction conditions are: ①94℃, 4min, ②94℃, 1min, ③55℃, 1min, ④72℃, 2min, after ②～④ amplify 35 cycles, ⑤72℃, 5min, ⑥4℃ insulation; respectively amplify the target gene Fragment tsbgl and template fragment pBSMμL3.

The amplified fragments are recovered by the (Tiangen Biochemical Technology Co., Ltd.) glue recovery kit for sequencing verification, and the two recovered fragments verified by sequencing are connected through the In-Fusion HD Cloning Plus kit. The connection system is: gene fragments 400ng, vector fragment 200ng, 5×In-Fusion HD Enzyme Premix 2μL, make up to 10μL with water; after the ligation system is reacted at 50°C for 25min, the ligation product is obtained, and the ligation product is transformed into the cloning host JM109 (see above for details) Heat shock transformation method), spread on LB solid medium (containing 10μg/mL ampicillin), culture at 37°C for 8-10h, pick a single colony into LB liquid medium containing 100mg/L ampicillin, 37°C After culturing for 10 hours, the cells were collected to extract plasmids (plasmid extraction kit purchased from Tiangen Biochemical Technology Co., Ltd.) to obtain pBSMμL3-tsbgl plasmid (Figure 1), which was verified by restriction enzyme digestion and sent to the company for sequencing verification.

Example 2: Bacillus subtilis expression host transformation culture and crude enzyme solution extraction

The recombinant plasmid pBSMμL3-tsbgl, which was verified by restriction enzyme digestion and sequenced correctly, was linearized and electrotransformed into Bacillus subtilis WSH11 (Bacillus subtilis WSH11 is described in the patent publication number CN108102997A). Recombinant plasmid pBSMμL3-tsbgl is electroshocked to transform Bacillus subtilis WSH11 competent cells:

(1) Put the competent cells of Bacillus subtilis WSH11 on ice for 5 minutes in advance. After the competent cells are completely melted, add 10 μL of recombinant plasmid to them. After gently pipetting and sucking evenly, place them on ice for 15 minutes;

(2) Turn on the electroporator in advance to preheat for 30 minutes, set the shock voltage to 2400V, slowly add the competence at the end of the ice bath to the extraction and pre-cooled shock cup with a diameter of 2mm, and wipe off the water on the outer wall of the shock cup. Put the electric shock cup in the converter and give an electric shock;

(3) After the electric shock is over, quickly add 1 mL of pre-cooled RM medium to it, then transfer the bacterial solution to a 1.5 mL sterilized EP tube after blowing evenly, place it in a 37°C shaker, and shake at 200 rpm. Cultivate for 3h;

(4) Centrifuge the cultured bacterial solution at 3000 rpm for 5 minutes, discard part of the supernatant, leave about 200 μL of the supernatant, and re-suspend the bacterial cell by pipetting and spreading it on a tetracycline-resistant LB solid plate, and incubate at 37°C Incubate in a box for about 10 hours, and wait for a single colony to grow on the plate;

(5) Pick a single colony and verify by sequencing to obtain a positive transformant containing plasmid pBSM μL3-tsbgl.

The positive transformant containing the recombinant plasmid pBSMμL3-tsbgl was inoculated into LB liquid medium (containing 10μg/mL tetracycline) and cultured for 8-10h, then 5mL of culture broth was transferred to 100mL TB medium and cultured at 37°C for 2h, then Cultured at 33°C for 48 hours, after the fermentation, centrifuged at 8000 rpm for 20 minutes to collect the bacteria. Add 50mL of 50mM pH 6.0 citric acid-disodium hydrogen phosphate buffer to the bacteria. After fully resuspend the bacteria, use a high-pressure homogenizer to break the walls, centrifuge at 10000rpm for 20 minutes, and collect the broken wall supernatant to obtain the crude enzyme. When the OD ₆₀₀ is 5, the enzyme activity of the crude enzyme solution is 10.41 U/mL.

Purify the collected crude enzyme solution and perform electrophoresis. The purified electrophoresis diagram is shown in Figure 2.

Example 3: Determination of application conditions of β-glucosidase TSBG1

(1) Optimal temperature for β-glucosidase TSBG1

Using pNPG as a substrate, the purified β-glucosidase obtained in Example 3 was added to the enzyme activity determination reaction system, pH was 6.0, and the reaction was carried out at different temperatures to determine the enzyme activity and calculate its relative enzyme activity The results are shown in Figure 3, and the specific data are shown in Table 1. It can be seen that the optimal temperature of β-glucosidase is 90°C, and the relative enzyme activity can reach more than 85% at 90-100°C.

Table 1 Relative enzyme activity of β-glucosidase TSBGl at different temperatures

(2) Optimal pH for β-glucosidase TSBG1

Using pNPG as a substrate, the purified β-glucosidase obtained in Example 3 was added to the enzyme activity determination reaction system, and reacted in a constant temperature water bath at 90°C under different pH for 10 minutes. The enzyme activity after the reaction was measured and the relative enzyme activity was calculated. The result is shown in Figure 4, and the specific data is shown in Table 2. It can be seen that the optimal pH of β-glucosidase is 6.0.

Table 2 Relative enzyme activity of β-glucosidase TSBGl at different pH

(3) β-Glucosidase TSBGl is thermostable

Using pNPG as the substrate, the purified β-glucosidase obtained in Example 3 was added to the enzyme activity determination reaction system, and the reaction was carried out at 70°C, 80°C, and 90°C in a warm water bath at a pH of 6.0 for 60 minutes. , Measure the enzyme activity of the enzyme within 60 minutes, and calculate its relative enzyme activity. The results are shown in Figure 5. At the 60th minute, the relative enzyme activities of β-glucosidase TSBGl at 70°C, 80°C, and 90°C are 99.18%, 99.31.35%, 99.81%. The β-glucosidase has higher thermal stability at 90°C.

Table 3 Relative enzyme activity of β-glucosidase TSBGl at different temperatures (%)

Example 4: Application of β-glucosidase TSBG1 in the preparation of gentio-oligosaccharides

Take 800g/L glucose as the substrate, react for 24h at pH 6, 90℃, set different enzyme dosages 300U/g, 400U/g, 500U/g, 600U/g, 700U/g, and explore the use of high-concentration glucose The amount of enzyme added when synthesizing gentian oligosaccharides by using the reverse hydrolysis activity of the substrate.

The experimental results are shown in Figure 6. Within a certain range, the conversion rate of the substrate increases with the increase of the amount of enzyme added. When the amount of enzyme added reaches 500U/g glucose, the substrate conversion rate can reach 10.94%; further increase The amount of enzyme and the conversion rate remain almost unchanged. Comprehensive consideration, choose 500U/g to add enzyme amount, at this time, the substrate conversion rate can reach 10.94%, and the yield of oligogentianose can reach 73g/L.

Example 5: Application of β-glucosidase TSBG1 in the preparation of gentiooligosaccharides under high substrate concentration

Refer to Example 4 for specific implementations. The difference is that the amount of enzyme added is 500 U/g glucose, and the high temperature reaction characteristics of β-glucosidase TSBG1 allow the reverse hydrolysis synthesis reaction to be carried out at high temperatures and higher substrate concentrations, so To explore the effect of glucose substrate concentration (800g/L, 900g/L, 1000g/L, 1100g/L, 1200g/L) on the yield and conversion rate of gentian oligosaccharides synthesized by reverse hydrolysis.

The experimental results are shown in Figure 7. The final concentration of glucose substrate is 800g/L, 900g/L 1000g/L and 1100g/L, and the substrate conversion rate is 10.42%, 12.72%, 14.43%, 14.82%, respectively; glucose substrate The final concentration is 1200g/L. At this time, the yield of oligogentianose can reach 178.2g/L, and the substrate conversion rate is 14.85%, which is the highest yield of oligogentianose synthesized by this method.

Although the present invention has been disclosed as above in preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, The protection scope of the present invention should be defined by the claims.

Claims (12)

1. A method for increasing the production of oligogentianose, which is characterized in that β-glucosidase expressed by a recombinant bacteria is used to catalyze glucose to produce oligogentianose; the recombinant bacteria uses Bacillus subtilis as an expression host to express an amino acid sequence The β-glucosidase shown in SEQ ID NO.2.
2. The method according to claim 1, wherein the enzyme addition amount of the β-glucosidase is 300-800 U/g glucose.
3. The method according to claim 1, wherein the glucose concentration is 800-1500 g/L.
4. The method according to claim 1, wherein the method is a reaction at 60-100°C and pH 5.0-7.0 for 20-30 hours.
5. A gene encoding β-glucosidase, characterized in that the nucleotide sequence of the gene is shown in SEQ ID NO.1.
6. A vector carrying the gene of claim 5.
7. The vector according to claim 6, wherein the vector is pBSMμL3.
8. A recombinant bacterium, characterized in that the recombinant bacterium uses Bacillus subtilis as an expression host and expresses the β-glucosidase whose amino acid sequence is shown in SEQ ID NO.2.
9. A recombinant bacterium, characterized in that it uses Bacillus subtilis as an expression host and contains the vector according to claim 5 or 7.
10. A method for producing β-glucosidase, which is characterized in that the method uses the recombinant bacteria of claim 8 to ferment the enzyme.
11. Application of the method according to any one of claims 1 to 4 or claim 10 in the preparation of products containing gentian oligosaccharides in the field of food and cosmetics.
12. The application of the gene of claim 5, or the vector of claim 6 or 7, or the recombinant bacteria of claim 8 or 9 in the preparation of products containing gentian oligosaccharides in the field of food and cosmetics.

Images