CN112980762A

CN112980762A - Aspergillus niger disaccharide phosphorylase and application thereof in preparation of aspergillus niger disaccharide

Info

Publication number: CN112980762A
Application number: CN202110264847.0A
Authority: CN
Inventors: 吴敬; 夏伟; 毕然; 黄燕
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2021-03-05
Filing date: 2021-03-05
Publication date: 2021-06-18

Abstract

The invention discloses an Aspergillus niger disaccharide phosphorylase and application thereof in preparation of Aspergillus niger disaccharide, belonging to the field of genetic engineering and enzyme engineering. The invention provides a novel Aspergillus niger disaccharide phosphorylase AmNP and a high-efficiency expression method thereof. A nucleotide sequence of Aspergillus niger disaccharide phosphorylase AmNP derived from anaerobic Bacillus mobilis (Anaerobacter mobilis DSM 15930) is synthesized and coded by a chemical method, a shuttle plasmid pBSM mu L3 is taken as an expression vector, Bacillus subtilis WSH11 is taken as an expression host, and the high-efficiency expression of the Aspergillus niger disaccharide phosphorylase AmNP gene in the Bacillus subtilis is realized. The Aspergillus niger disaccharide phosphorylase AmNP and the maltose phosphorylase LbMP are subjected to synergistic reaction to catalyze the conversion of maltose into Aspergillus niger disaccharide, the yield reaches 67.75% at most, the yield of Aspergillus niger disaccharide can reach 338.75g/L, and the method is the highest yield reported in the current Aspergillus niger disaccharide enzyme preparation. Therefore, the enzyme is suitable for the requirements of industrial application of food, medicine and the like, and can be used for the industrial production of the aspergillus niger disaccharide.

Description

Aspergillus niger disaccharide phosphorylase and application thereof in preparation of aspergillus niger disaccharide

Technical Field

The invention relates to an Aspergillus niger disaccharide phosphorylase and application thereof in preparation of Aspergillus niger disaccharide, belonging to the field of genetic engineering and enzyme engineering.

Background

Aspergillus niger disaccharide (Nigerose) is alpha-1, 3-bonded glucose disaccharide which is rarely present in nature, naturally exists in fermented foods such as sake and sauce, has excellent taste, and has various effects of low sweetness, freshness enhancement, mellow fragrance, caries prevention, intestinal health regulation and the like. Researches show that aspergillus niger disaccharide plays a role in enhancing immunity in a mouse body and has the potential of serving as a prebiotic; has also been evaluated as an additive in human cell line cryopreservation media with promise as a sustained delivery module for biocompatible nanocarriers.

The chemical synthesis and the enzymatic preparation are main methods for producing the aspergillus niger oligosaccharide, and compared with the enzymatic preparation, the chemical synthesis has high cost and low yield, and the safety of the aspergillus niger oligosaccharide is difficult to ensure due to the participation of heavy metal ions in the reaction process, so that the aspergillus niger oligosaccharide is difficult to be produced in large quantities. The conversion rate of Aspergillus niger oligosaccharide prepared by catalyzing alpha-glucosidase secreted by fungi Acremoun sp.S4G13 in Japan by taking maltose as a substrate is 37 percent, wherein the Aspergillus niger disaccharide component is 23 percent, the whole substrate utilization rate and the production efficiency are low, and the product is a mixture of alpha-1, 3 and alpha-1, 4 bond type oligosaccharides and has low purity. Glycoside phosphorylase (glycoside phosphorylase) is a kind of enzyme that catalyzes the phospholysis of carbohydrates to glucose-1-phosphate and the corresponding residual sugars, and at the same time catalyzes the reverse phospholysis synthesis reaction. Compared with alpha-glucosidase, the glycosyl donor used in the reversible synthesis reaction catalyzed by glucoside phosphorylase is glucose-1-phosphate, the reaction balance is more favorable for the synthesis of glycosidic bonds, and the conversion rate is generally higher. Glucose-1-phosphate is generally obtained by phosphorylation reaction using a relatively inexpensive carbohydrate substrate, and the substrate cost is low, so that the research of phosphorylase in the industry is more extensive. With the discovery and identification of novel aspergillus niger disaccharide phosphorylase, the synergistic reaction of aspergillus niger disaccharide phosphorylase and maltose phosphorylase becomes a novel method for catalyzing aspergillus niger disaccharide synthesis, and the reaction process is shown in fig. 1.

However, the production efficiency of the existing method is still low, and the industrial requirement cannot be realized.

Disclosure of Invention

In view of the problems of low yield and production efficiency of aspergillus niger disaccharide at present, the invention identifies and obtains a novel aspergillus niger disaccharide phosphorylase AmNP, and the yield of aspergillus niger disaccharide can be obviously improved by synergistically catalyzing maltose by the aspergillus niger disaccharide phosphorylase AmNP and maltose phosphorylase.

The invention provides a recombinant bacterium, which expresses Aspergillus niger disaccharide phosphorylase derived from Anaerosporus mobilis DSM 15930.

In one embodiment, the nucleotide sequence encoding the A.niger disaccharide phosphorylase is shown in SEQ ID No. 1.

In one embodiment, Bacillus subtilis is used as the starting strain.

In one embodiment, the Bacillus subtilis is Bacillus subtilis WSH11, described in publication No. CN 108102997A.

In one embodiment, pBSM μ L3 is used as an expression vector, and the vector sequence is described in the patent publication No. CN 107058205A.

The invention provides a method for preparing aspergillus niger disaccharide, which takes maltose or a mixture of maltose and glucose as a substrate, and carries out co-transformation on maltose phosphorylase and aspergillus niger disaccharide phosphorylase expressed by the recombinant bacteria of any one of claims 1-4 or aspergillus niger disaccharide phosphorylase with an amino acid sequence shown in SEQ ID NO.2 to produce aspergillus niger disaccharide.

In one embodiment, the ratio of the addition amount of maltose phosphorylase to the addition amount of Aspergillus niger disaccharide phosphorylase is (1-2.5) to (1-2.5).

In one embodiment, the maltose phosphorylase and aspergillus niger disaccharide phosphorylase are added in a ratio of 1:2.5 or 2.5: 1.

In one embodiment, the maltose phosphorylase is added in an amount of 0.2 to 2.5U/mL

In one embodiment, the maltose phosphorylase is added in an amount of 0.6 to 1.0U/mL.

In one embodiment, the phosphate concentration in the reaction system is 10 to 25 mM.

In one embodiment, the concentration of maltose is 200-500g/L when maltose is used as the substrate.

In one embodiment, when a mixture of maltose and glucose is used as the substrate, the maltose concentration is 200g/L and the glucose concentration is 50-100 g/L.

In one embodiment, the reaction is carried out at a pH of 5.0-7.0 and a temperature of 30-40 ℃ for a reaction time of not less than 24 hours.

In one embodiment, the reaction pH is from 6.0 to 7.0.

The invention has the beneficial effects that: the invention provides a novel Aspergillus niger disaccharide phosphorylase AmNP and a high-efficiency expression method thereof. A nucleotide sequence of Aspergillus niger disaccharide phosphorylase AmNP derived from anaerobic Bacillus mobilis (Anaerobacter mobilis DSM 15930) is synthesized and coded by a chemical method, a shuttle plasmid pBSM mu L3 is taken as an expression vector, Bacillus subtilis WSH11 is taken as an expression host, and the high-efficiency expression of the Aspergillus niger disaccharide phosphorylase AmNP gene in Bacillus subtilis is realized. The Aspergillus niger disaccharide phosphorylase AmNP and the maltose phosphorylase LbMP are subjected to synergistic reaction to catalyze the conversion of maltose into Aspergillus niger disaccharide, when the substrate concentration of maltose is 50%, the yield reaches 67.75% at most, and the yield of Aspergillus niger disaccharide can reach 338.75g/L, which is the highest yield of Aspergillus niger disaccharide enzymatic preparation reported at present. Therefore, the enzyme is suitable for the requirements of industrial application of food, medicine and the like, and can be used for the industrial production of the aspergillus niger disaccharide.

Drawings

FIG. 1 is a flow chart of the synthesis of Aspergillus niger disaccharide by concerted reaction of Aspergillus niger disaccharide phosphorylase and maltose phosphorylase.

FIG. 2 is a graph of a standard glucose content test using a Glucose Oxidase (GOD) kit.

FIG. 3 is an electrophoretogram of Aspergillus niger disaccharide phosphorylase AmNP and maltose phosphorylase LbMP; m is marker, and FS, PS and PC respectively represent extracellular fermentation supernatant, cell wall-broken supernatant and wall-broken sediment pattern of the recombinant bacteria.

FIG. 4 is a graph of the phospholytic activity of Aspergillus niger disaccharide phosphorylase AmNP versus enzyme activity at different temperatures.

FIG. 5 is a graph of the phospholytic activity of Aspergillus niger disaccharide phosphorylase AmNP versus enzyme activity at various pHs.

FIG. 6 is a graph showing the results of ion chromatography detection of the reaction product of Aspergillus niger disaccharide prepared by disaccharide phosphorylase catalysis.

FIG. 7 is a graph showing the effect of enzyme addition on the conversion of Aspergillus niger disaccharide by disaccharide phosphorylase.

FIG. 8 is a graph showing the effect of phosphate concentration on disaccharide phosphorylase phospholytic activity and conversion to disaccharide from A.niger.

FIG. 9 is a graph showing the conversion of Aspergillus niger disaccharide by enzymatic preparation of disaccharide phosphorylase under different substrates.

Detailed Description

Enzymatic Activity analysis of disaccharide phosphorylase:

(1) definition of enzyme activity unit: the enzyme activity of the enzyme solution per milliliter per minute for phosphorylating aspergillus niger disaccharide or maltose to generate 1 mu mol of glucose is one enzyme activity unit.

(2) Enzyme activity determination procedure

The glucose-containing glucose sensor is obtained by measuring the glucose content through a Glucose Oxidase (GOD) kit and calculating, and comprises the following specific reaction steps: mixing 70 μ L of 4mM Aspergillus niger disaccharide phosphate buffer solution with 70 μ L of diluted enzyme solution, reacting at appropriate temperature for 10min, boiling for 5min to terminate the reaction, adding 2.1mL GOD color developing solution, developing for 10min, and measuring OD with spectrophotometer₅₂₀The value is obtained. And (3) preparing a glucose standard curve by a GOD method: 1mM glucose solution was prepared, 2.24mL gradient solution was prepared as shown in Table 1, and the absorbance of OD540 was measured in a 96-well microplate. A standard curve is drawn by using the absorbance as an abscissa and the content of glucose (. mu. mol) as an ordinate, and a linear standard curve (as shown in FIG. 2) is obtained by regression fitting.

TABLE 1 GOD glucose Standard Curve formulation

(II) culture medium:

LB culture medium: 5g/L of yeast powder, 10g/L of tryptone and 10g/L of NaCl.

TB culture medium: 24g/L yeast powder, 5g/L glycerin, 12g/L tryptone and K₂HPO₄·3H₂O 16.43g/L，KH₂PO₄ 2.31g/L。

RM medium: 5.0g/L yeast extract, 10.0g/L tryptone, 10.0g/L NaCl, 90.0g/L sorbitol, 70.0g/L mannitol.

Example 1: construction of aspergillus niger disaccharide phosphorylase AmNP recombinant strain and enzyme production by fermentation

According to the amino acid sequence (SHM33122.1) of Aspergillus niger disaccharide phosphorylase AmNP from anaerobic Bacillus mobilis DSM 15930 (Genbank database), the gene with the nucleotide sequence shown in SEQ ID NO.1 is chemically synthesized.

The synthesized gene fragment is cut by enzyme with pET-24a (the cutting sites are Nde I and EcoR I) to obtain a connection product; the ligation product was transformed into e.coli e.coli.jm109 by heat shock transformation. Obtaining a conversion product; and (3) coating the transformation product on an LB solid medium (containing 0.05mg/mL kanamycin), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant.

Heat shock transformation method:

(1) E.coli.JM109 competent cells were placed on ice in advance for 5min, after competence was completely thawed, 10. mu.L of intact plasmid or PCR product was added thereto, and after being gently aspirated uniformly, the mixture was placed on ice for 45 min.

(2) The competence was placed in a 42 ℃ water bath for 90s with heat shock and after the heat shock was completed, it was placed on ice for 5 min.

(3) After the ice bath is finished, 0.8mL of LB liquid culture medium is added into the competence, and after the mixture is uniformly mixed, the mixture is put into a shaking table at 37 ℃ for shake culture for about 60 min.

(4) Centrifuging at 3000rpm for 5min after finishing the culture, discarding part of supernatant, reserving about 200 μ L of fermentation liquid to suck the thallus again for resuspension, coating the thallus on an LB solid plate containing 10 μ g/mL of ampicillin, statically culturing for about 10h in an incubator at 37 ℃, and waiting for a single colony to grow on the plate.

And (3) selecting a monoclonal colony, inoculating the colony into an LB liquid culture medium containing 10 mu g/mL ampicillin resistance, performing shake flask culture for 8-12 h at 37 ℃ and 120-180 rpm, extracting a plasmid, performing enzyme digestion verification and sequencing verification, and obtaining the recombinant plasmid pET24a-AmNP after the verification is correct.

Respectively designing target gene primers and vector primers with 15bp homology arms at the upstream and downstream by taking plasmids pET24a-AmNP and pBSM mu L3 as templates, and amplifying target gene fragments tsbgl (primers 1 and 2) with the homology arms and template fragments pBSM mu L3 (primers 3 and 4) by PCR;

primer 1: TAAGGAGTGTCAAGAATGAGCATGATCGCCGATCTGAAGAACT, respectively;

primer 2: GCGCAGTGATTAACCTTAATCTTCCAGGCCGTTATTTTTAATAAC, respectively;

primer 3: AAGCTTGGTAATAAAAAAACACCTC, respectively;

primer 4: CATTCTTGACACTCCTTATTTG are provided.

The PCR system is as follows: 2 Xsuper Pfx MasterMix 25. mu.L, two primers each 1.25. mu.L, ddH₂O22. mu.L, template 0.5. mu.L.

The reaction conditions are as follows: amplifying for 35 cycles at 94 deg.C, 4min, 94 deg.C, 1min, 55 deg.C, 1min, 72 deg.C, 2min, and maintaining at 72 deg.C, 5min and 4 deg.C; respectively amplifying to obtain a target gene fragment AmNP and a template fragment pBSM mu L3.

The amplified fragments are recovered by a gel recovery kit (Tiangen Biochemical technology Co., Ltd.) for sequencing verification, and two recovered fragments with correct sequencing verification are connected by an In-Fusion HD Cloning Plus kit, wherein the connecting system is as follows: 400ng of gene fragment, 200ng of vector fragment, 2 μ L of 5 XIn-Fusion HD Enzyme Premix, and water make up to 10 μ L; reacting the connecting system at 50 ℃ for 25min to obtain a connecting product, transforming the connecting product into a clone host JM109 (see the heat shock transformation method in the specific embodiment), coating the connecting product on an LB solid culture medium (containing 10 mu g/mL ampicillin), culturing at 37 ℃ for 8-10h, picking a single colony to an LB liquid culture medium containing 100mg/L ampicillin, culturing at 37 ℃ for 10h, collecting a thallus extraction plasmid (a plasmid extraction kit is purchased from Tiangen Biochemical technology Co., Ltd.), obtaining a pBSM mu L3-AmNP plasmid, carrying out enzyme digestion verification, and carrying out sequencing verification.

The recombinant plasmid pBSM mu L3-AmNP which is verified by enzyme digestion and sequenced correctly is linearized and then electrically transformed into Bacillus subtilis WSH11 (the Bacillus subtilis WSH11 is described in a patent with publication number CN 108102997A). The recombinant plasmid pBSM mu L3-AmNP electric shock transformed Bacillus subtilis WSH11 competent cell:

(1) putting Bacillus subtilis WSH11 competent cells on ice in advance for 5min, adding 10 μ L of recombinant plasmid after competence is completely melted, gently blowing and sucking uniformly, and placing on ice for 15 min;

(2) preheating the electric converter for 30min by opening the electric converter in advance, setting the electric shock voltage to be 2400V, slowly adding the competence after ice bath is finished into an electric shock cup with the diameter of 2mm which is extracted and precooled, wiping water on the outer wall of the electric shock cup clean, and then putting the electric shock cup into the converter for electric shock;

(3) after the electric shock is finished, 1mL of RM culture medium pre-cooled in advance is quickly added into the culture medium, the culture solution is transferred into 1.5mL of sterilized EP tube after the uniform blowing and sucking, the EP tube is placed in a shaking table at 37 ℃, and shaking culture is carried out for 3h at 200 rpm;

(4) centrifuging the cultured bacterial liquid at 3000rpm for 5min, discarding part of supernatant, reserving about 200 mu L of supernatant to suck the thalli again for resuspension, coating the thalli on an LB solid plate containing tetracycline resistance, culturing for about 10h in an incubator at 37 ℃, and waiting for a single bacterial colony to grow on the plate;

(5) single colonies were picked and verified by sequencing to give positive transformants containing plasmid pBSM. mu.L 3-AmNP.

Inoculating the positive transformant containing the recombinant plasmid pBSM mu L3-AmNP into an LB liquid culture medium (containing 10 mu g/mL tetracycline) to culture for 8-10h, taking 5mL of culture solution to transfer into 100mL of TB culture medium, culturing for 2h at 37 ℃, culturing for 48h at 33 ℃, and after the fermentation is finished, centrifuging at 8000rpm for 20min to collect thalli. Adding 50mL 50mM citric acid-disodium hydrogen phosphate buffer solution with pH6.0 into thallus, suspending thallus sufficiently, breaking cell wall with high pressure homogenizer, centrifuging at 10000rpm for 20min, collecting the broken cell wallThe clear liquid is crude enzyme solution, OD₆₀₀The enzyme activity of the crude enzyme solution at 5 is 12.6U/mL.

A recombinant strain Bacillus subtilis WSH 11/pBSM. mu.L 3-LbMP obtained by obtaining Lactobacillus brevis-derived Maltose phosphorylase LbMP (the amino acid sequence is shown in Unit ID Q7SIE1, see Stephan Hu wel et al, Maltose phosphorylase from Lactobacillus brevis: Purification, chromatography, and application in a biosensor for port-phosphate, published in 1997) was constructed by the same procedure as described above, and the crude enzyme solution was obtained by fermentation.

The collected crude enzyme solutions of disaccharide phosphorylase AmNP and maltose phosphorylase LbMP were subjected to SDS-PAGE gel electrophoresis analysis, and the electrophoretogram is shown in FIG. 3.

Example 2: determination of application conditions of Aspergillus niger disaccharide phosphorylase AmNP

(1) Optimum temperature of aspergillus niger disaccharide phosphorylase AmNP

Taking aspergillus niger disaccharide as a substrate, adding the aspergillus niger disaccharide phosphorylase AmNP obtained in the embodiment 1 into an enzyme activity determination reaction system, controlling the pH to be 7.0, carrying out reaction at different temperatures, determining the enzyme activity, and calculating the relative enzyme activity, wherein the result is shown in a figure 4, the specific data is shown in a table 2, and the optimal temperature of the aspergillus niger disaccharide phosphorylase AmNP is 30 ℃.

TABLE 2 relative enzyme Activity of Aspergillus niger disaccharide phosphorylase AmNP at different temperatures

(2) Aspergillus niger disaccharide phosphorylase AmNP optimum pH

Taking aspergillus niger disaccharide as a substrate, adding the aspergillus niger disaccharide phosphorylase AmNP obtained in the embodiment 1 into an enzyme activity determination reaction system, and reacting for 10min in a constant-temperature water bath at 30 ℃ under different pH values. The enzyme activity after the reaction is measured, and the relative enzyme activity is calculated, the result is shown in figure 5, the specific data is shown in table 3, and the optimum pH value of the aspergillus niger disaccharide phosphorylase AmNP is 7.0.

TABLE 3 relative enzyme Activity of Aspergillus niger disaccharide phosphorylase AmNP at different pH

Example 3: influence of enzyme addition on conversion rate of aspergillus niger disaccharide catalyzed by disaccharide phosphorylase

200g/L maltose is used as a substrate, the reaction is carried out for 72h at the temperature of 7.0 and 30 ℃, different enzyme adding amounts are set under the condition of 10mM phosphate concentration, and the influence of the enzyme adding amount on the product conversion rate when the Aspergillus niger disaccharide is generated by the reaction with the maltose as the substrate is researched.

(1)LbMP：AmNP＝1:2.5：

0.2U/mL LbMP+0.5U/mL AmNP；

0.6U/mL LbMP+1.5U/mL AmNP；

1.0U/mL LbMP+2.5U/mL AmNP。

(2)AmNP：LbMP＝1:2.5：

0.2U/mL AmNP+0.5U/mL LbMP；

0.6U/mL AmNP+1.5U/mL LbMP；

1.0U/mL AmNP+2.5U/mL LbMP。

The enzyme conversion product was detected by ion chromatography, and the detection result is shown in FIG. 6. It can be seen that the disaccharide phosphorylase AmNP and the maltose phosphorylase LbMP synergistically react to effectively catalyze the conversion of maltose into Aspergillus niger disaccharide, and the product concentration increases with the increase of the reaction time. The results of the effect of different enzyme addition amounts on the conversion rate of Aspergillus niger disaccharide are shown in FIG. 7, when the enzyme addition ratio is LbMP: when AmNP is 1:2.5, the conversion rate of aspergillus niger disaccharide is higher, and in a certain range, the conversion rate is continuously improved along with the increase of enzyme adding amount, when the enzyme adding amount reaches 1.0U/mL LbMP +2.5U/mL AmNP, the substrate conversion rate can reach 67.75%, and the yield can reach 136.5 g/L.

Example 4: effect of phosphoric acid concentration on the Phosphomonoesterase Activity of disaccharide phosphorylase and conversion to Aspergillus niger disaccharide

200g/L maltose is used as a substrate, the reaction is carried out for 72h at the temperature of 30 ℃ and the pH value is 7.0, the enzyme adding amount is 1.0U/mL LbMP +2.5U/mL AmNP, different phosphate concentrations are set, and the influence of the enzyme adding amount on the product conversion rate when the reaction is carried out to generate the Aspergillus niger disaccharide by using the maltose as the substrate is researched. As shown in FIG. 8, the conversion rate was increased with the increase of the phosphate concentration within a certain range, and reached a maximum of 67.75% when the phosphate concentration was 10mM, and the phosphate concentration was increased further, which was disadvantageous to the progress of the synthesis reaction due to the significant increase of the phosphorolytic activity of the disaccharide phosphorylase AmNP and the maltose phosphorylase LbMP, and resulted in the decrease of the conversion rate of the product Aspergillus niger disaccharide. Therefore, the optimal phosphate concentration is 10 mM.

Example 5: conversion rate of aspergillus niger disaccharide prepared by catalysis of disaccharide phosphorylase under different substrates

The reaction is carried out for 72h at the temperature of 30 ℃ and the pH value of 7.0, the enzyme adding amount is 1.0U/mL LbMP +2.5U/mL AmNP, different substrate compositions and concentrations are set under the condition that the phosphate concentration is 10mM, and the influence of the substrate components on the product conversion rate is researched. As shown in FIG. 9, the conversion rate of Aspergillus niger disaccharide was increased with the increase of maltose concentration when maltose was used as the substrate, and the conversion rate reached a maximum of 67.75% when the substrate was 50% (500g/L) maltose. The addition of glucose as acceptor at concentrations of 5% (50g/L) and 10% (100g/L) to maltose resulted in a decrease in the conversion of the product Aspergillus niger disaccharide due to the increase in substrate amount. Thus, the optimal substrate concentration is 50% maltose.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> Aspergillus niger disaccharide phosphorylase and application thereof in preparation of Aspergillus niger disaccharide

<130> BAA210282A

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 2214

<212> DNA

<213> Artificial sequence

<400> 1

atgatcgccg atctgaagaa ctggaccatt aaggaaagcg gcttcagcga agataaggtt 60

accagcaatg gcaacaagtt cctgtgcggc aatggttatc tgggtattcg cggtacactg 120

gaagaatttg acaaggaata cctgccgagc atcaacctgg caggtattta tgatcaggtg 180

ggtaacggtt ggcgtgaacc gttaaatgcc ccgaatggtc tgtatacccg tattaaaatc 240

gacggcgtgt actacgacct gccgaaaaat gaacctgtta accacgagca ggaggttaat 300

taccgtcatg gcattgtgac ccgcattacc cgttgggaaa cccgtcgtgg taatattacc 360

gttacctgtg agcgcttcgc acattatgat aaggtgcatc tgatctgcat gagatacagc 420

atcctggcag atttccacgc cgatgttgaa attctgaccg gcattgatgg cgatgtgtgg 480

gatattcatg gcccgcatta tgatcagctg ctgtttgaag aggaggacat tttcaccgcc 540

accggcatta cccatgaaaa taaagaccgc gtggccgttg cagaagaaat tagtgtgaac 600

cacccgtacg agcgcaaacg taaaaaagaa ggtcgcaagc tgctgcatcg tatttgtctg 660

attaccgagg caaacaagaa gatcgacctg gataagatgg tggccattta caccagtaag 720

gactgcaaag agccggaaga agccgccaaa aaagaagtgc gtgaagccct gcaacgtggc 780

tatgaagtgt gtaaaagcac ccacatgaac atctgggagg aacattggaa gaccgcagaa 840

atttacatcg agggcgatcc ggaagcaatg gaagccttaa attacagcct gtaccacctg 900

caatgtattg caccgcgcca tagcgatagc ctgagcattg cagcacgcgg tctgagtggt 960

cagacctata aaggcgcagt gttttgggat accgagatgt ttatgctgga ctacttcctg 1020

tatactcagc cggaagttgc aaagaccctg ctgcgttatc gcattgatac cctggaaggc 1080

gcaaaaaaaa aggcagaaag ctacggttac gagggcgcct tttatgcctg ggaaagccag 1140

gaaggtggtt atgatgcctg tagcgattac aacgtgaccg atgtgttcac caagcgcccg 1200

atgcgtaccc attttaaaga taagcagatc cacatcagcg cagccattgt gtatggcatt 1260

atgcgttacg tgaagatcac cggcgatcag cgctttctgg aacagggtgg tattgaaacc 1320

atcctggaat gcgcaaagtt ctacgatttc ctgctggtta agaaggtgca cagcgatcag 1380

tatgagctgc atgatgttat cggcccggat gaatatcacg aacgtgtgaa taacaacggt 1440

tacaccaacc gtatggccaa attcaccttc gaaaccgccg caaaactgct ggatgatctg 1500

atgaaattca gcaaggagac gatcgagaag atcgaagata actacgacgt ggagcgttgt 1560

aagatggatt accgcgaagc cgcagaacgt atttttatcc cgaagccgga tgagaacggt 1620

gttctggaac agtttgacgg ctatggcaaa ctggaagatg caagtgttga ggaagtgaag 1680

ggccgcctgc tgcatgaaaa agaatattgg ggcggtgcct acggtgttgc ctcacagacc 1740

aaagtgatta agcaggccga tgtggttacc tggctgacca tgtttagcga agatttcagc 1800

gaggaggtga tgctgaaaaa ctggcgctat tacgagccgc gcaccgaaca tggtagtagt 1860

ctgagcgcct gtatgtatgc actgctggcc tgccgttgtg gtatgcctca aaaagcctat 1920

agcttcttca tgaagagcgc cagcgccgat ctgctgcctg gtggtaagga atgggccggt 1980

ttagtttata tcggcggcac ccatccggca gctgccggtg gtgcatacat gaccgcaatt 2040

cagggctttg gtggtgtgta tgttgaggat ggcgaactga aagtgaagcc gcagctgcct 2100

gaacagtgga aaaaactgcg ctttaccatc aagtaccaga accagctgta cgaaatcatc 2160

gagacaaagg acagcgcagt gattaacccg ctgcatcatc atcatcacca ctaa 2214

<210> 2

<211> 731

<212> PRT

<213> Anaerosporobacter mobilis

<400> 2

Met Ile Ala Asp Leu Lys Asn Trp Thr Ile Lys Glu Ser Gly Phe Ser

1 5 10 15

Glu Asp Lys Val Thr Ser Asn Gly Asn Lys Phe Leu Cys Gly Asn Gly

20 25 30

Tyr Leu Gly Ile Arg Gly Thr Leu Glu Glu Phe Asp Lys Glu Tyr Leu

35 40 45

Pro Ser Ile Asn Leu Ala Gly Ile Tyr Asp Gln Val Gly Asn Gly Trp

50 55 60

Arg Glu Pro Leu Asn Ala Pro Asn Gly Leu Tyr Thr Arg Ile Lys Ile

65 70 75 80

Asp Gly Val Tyr Tyr Asp Leu Pro Lys Asn Glu Pro Val Asn His Glu

85 90 95

Gln Glu Val Asn Tyr Arg His Gly Ile Val Thr Arg Ile Thr Arg Trp

100 105 110

Glu Thr Arg Arg Gly Asn Ile Thr Val Thr Cys Glu Arg Phe Ala His

115 120 125

Tyr Asp Lys Val His Leu Ile Cys Met Arg Tyr Ser Ile Leu Ala Asp

130 135 140

Phe His Ala Asp Val Glu Ile Leu Thr Gly Ile Asp Gly Asp Val Trp

145 150 155 160

Asp Ile His Gly Pro His Tyr Asp Gln Leu Leu Phe Glu Glu Glu Asp

165 170 175

Ile Phe Thr Ala Thr Gly Ile Thr His Glu Asn Lys Asp Arg Val Ala

180 185 190

Val Ala Glu Glu Ile Ser Val Asn His Pro Tyr Glu Arg Lys Arg Lys

195 200 205

Lys Glu Gly Arg Lys Leu Leu His Arg Ile Cys Leu Ile Thr Glu Ala

210 215 220

Asn Lys Lys Ile Asp Leu Asp Lys Met Val Ala Ile Tyr Thr Ser Lys

225 230 235 240

Asp Cys Lys Glu Pro Glu Glu Ala Ala Lys Lys Glu Val Arg Glu Ala

245 250 255

Leu Gln Arg Gly Tyr Glu Val Cys Lys Ser Thr His Met Asn Ile Trp

260 265 270

Glu Glu His Trp Lys Thr Ala Glu Ile Tyr Ile Glu Gly Asp Pro Glu

275 280 285

Ala Met Glu Ala Leu Asn Tyr Ser Leu Tyr His Leu Gln Cys Ile Ala

290 295 300

Pro Arg His Ser Asp Ser Leu Ser Ile Ala Ala Arg Gly Leu Ser Gly

305 310 315 320

Gln Thr Tyr Lys Gly Ala Val Phe Trp Asp Thr Glu Met Phe Met Leu

325 330 335

Asp Tyr Phe Leu Tyr Thr Gln Pro Glu Val Ala Lys Thr Leu Leu Arg

340 345 350

Tyr Arg Ile Asp Thr Leu Glu Gly Ala Lys Lys Lys Ala Glu Ser Tyr

355 360 365

Gly Tyr Glu Gly Ala Phe Tyr Ala Trp Glu Ser Gln Glu Gly Gly Tyr

370 375 380

Asp Ala Cys Ser Asp Tyr Asn Val Thr Asp Val Phe Thr Lys Arg Pro

385 390 395 400

Met Arg Thr His Phe Lys Asp Lys Gln Ile His Ile Ser Ala Ala Ile

405 410 415

Val Tyr Gly Ile Met Arg Tyr Val Lys Ile Thr Gly Asp Gln Arg Phe

420 425 430

Leu Glu Gln Gly Gly Ile Glu Thr Ile Leu Glu Cys Ala Lys Phe Tyr

435 440 445

Asp Phe Leu Leu Val Lys Lys Val His Ser Asp Gln Tyr Glu Leu His

450 455 460

Asp Val Ile Gly Pro Asp Glu Tyr His Glu Arg Val Asn Asn Asn Gly

465 470 475 480

Tyr Thr Asn Arg Met Ala Lys Phe Thr Phe Glu Thr Ala Ala Lys Leu

485 490 495

Leu Asp Asp Leu Met Lys Phe Ser Lys Glu Thr Ile Glu Lys Ile Glu

500 505 510

Asp Asn Tyr Asp Val Glu Arg Cys Lys Met Asp Tyr Arg Glu Ala Ala

515 520 525

Glu Arg Ile Phe Ile Pro Lys Pro Asp Glu Asn Gly Val Leu Glu Gln

530 535 540

Phe Asp Gly Tyr Gly Lys Leu Glu Asp Ala Ser Val Glu Glu Val Lys

545 550 555 560

Gly Arg Leu Leu His Glu Lys Glu Tyr Trp Gly Gly Ala Tyr Gly Val

565 570 575

Ala Ser Gln Thr Lys Val Ile Lys Gln Ala Asp Val Val Thr Trp Leu

580 585 590

Thr Met Phe Ser Glu Asp Phe Ser Glu Glu Val Met Leu Lys Asn Trp

595 600 605

Arg Tyr Tyr Glu Pro Arg Thr Glu His Gly Ser Ser Leu Ser Ala Cys

610 615 620

Met Tyr Ala Leu Leu Ala Cys Arg Cys Gly Met Pro Gln Lys Ala Tyr

625 630 635 640

Ser Phe Phe Met Lys Ser Ala Ser Ala Asp Leu Leu Pro Gly Gly Lys

645 650 655

Glu Trp Ala Gly Leu Val Tyr Ile Gly Gly Thr His Pro Ala Ala Ala

660 665 670

Gly Gly Ala Tyr Met Thr Ala Ile Gln Gly Phe Gly Gly Val Tyr Val

675 680 685

Glu Asp Gly Glu Leu Lys Val Lys Pro Gln Leu Pro Glu Gln Trp Lys

690 695 700

Lys Leu Arg Phe Thr Ile Lys Tyr Gln Asn Gln Leu Tyr Glu Ile Ile

705 710 715 720

Glu Thr Lys Asp Ser Ala Val Ile Asn Pro Leu

725 730

Claims

1. A recombinant bacterium which expresses Aspergillus niger disaccharide phosphorylase derived from Anaerospobacter mobilis DSM 15930.

2. The recombinant bacterium according to claim 1, wherein the nucleotide sequence encoding the aspergillus niger disaccharide phosphorylase is shown in SEQ ID No. 1.

3. The recombinant strain of claim 2, wherein Bacillus subtilis is used as a starting strain.

4. The recombinant bacterium according to claim 3, wherein pBSM μ L3 is used as an expression vector.

5. A method for preparing Aspergillus niger disaccharide, characterized in that maltose or a mixture of maltose and glucose is used as a substrate, and the Aspergillus niger disaccharide phosphorylase expressed by the recombinant bacterium of any one of claims 1-4 or the Aspergillus niger disaccharide phosphorylase with the amino acid sequence shown in SEQ ID NO.2 is co-transformed with maltose phosphorylase to produce Aspergillus niger disaccharide.

6. The method according to claim 5, wherein the ratio of the addition amount of maltose phosphorylase to the addition amount of Aspergillus niger disaccharide phosphorylase is (1-2.5) to (1-2.5).

7. The method according to claim 6, wherein the maltose phosphorylase is added in an amount of 0.6 to 1.0U/mL.

8. The method according to claim 7, wherein the phosphate concentration in the reaction system is 10 to 25 mM.

9. The method as claimed in claim 8, wherein the concentration of maltose is 200-500g/L when maltose is used as the substrate; when a mixture of maltose and glucose is used as a substrate, the concentration of maltose is 200g/L, and the concentration of glucose is 50-100 g/L.

10. The method of claim 9, wherein the reaction is carried out at a pH of 5.0 to 7.0 at 30 to 40 ℃ for a reaction time of not less than 24 hours.