WO2021215616A1 - Composition for treating coronavirus infection or infectious disease, comprising polyphosphates - Google Patents

Composition for treating coronavirus infection or infectious disease, comprising polyphosphates Download PDF

Info

Publication number
WO2021215616A1
WO2021215616A1 PCT/KR2020/018981 KR2020018981W WO2021215616A1 WO 2021215616 A1 WO2021215616 A1 WO 2021215616A1 KR 2020018981 W KR2020018981 W KR 2020018981W WO 2021215616 A1 WO2021215616 A1 WO 2021215616A1
Authority
WO
WIPO (PCT)
Prior art keywords
coronavirus
bat
virus
polyphosphate
cov
Prior art date
Application number
PCT/KR2020/018981
Other languages
French (fr)
Korean (ko)
Other versions
WO2021215616A8 (en
Inventor
산학협력단 연세대학교
김홍렬
정재호
윤경섭
공대영
페루시베로니카
Original Assignee
졸로마시모
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020200123355A external-priority patent/KR20210132567A/en
Application filed by 졸로마시모 filed Critical 졸로마시모
Publication of WO2021215616A1 publication Critical patent/WO2021215616A1/en
Publication of WO2021215616A8 publication Critical patent/WO2021215616A8/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/42—Phosphorus; Compounds thereof
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N59/00—Biocides, pest repellants or attractants, or plant growth regulators containing elements or inorganic compounds
    • A01N59/26—Phosphorus; Compounds thereof
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/20—Inorganic substances, e.g. oligoelements
    • A23K20/26—Compounds containing phosphorus
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L29/00—Foods or foodstuffs containing additives; Preparation or treatment thereof
    • A23L29/015—Inorganic compounds
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/16—Inorganic salts, minerals or trace elements
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/19—Cosmetics or similar toiletry preparations characterised by the composition containing inorganic ingredients
    • A61K8/24—Phosphorous; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L2/00—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor
    • A61L2/16—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor using chemical substances
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/10—Washing or bathing preparations
    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/48—Medical, disinfecting agents, disinfecting, antibacterial, germicidal or antimicrobial compositions
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/324—Foods, ingredients or supplements having a functional effect on health having an effect on the immune system
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/15—Inorganic Compounds
    • A23V2250/156—Mineral combination
    • A23V2250/1618—Phosphorus

Definitions

  • the present invention relates to a composition for various uses that can effectively treat a coronavirus infection or a disease caused by the infection.
  • Coronavirus is a representative virus that causes lethal infectious diseases in modern civilization. Middle East Respiratory Syndrome (MERS), also known as MERS, spread from the Middle East to the world, resulting in a death rate of about 36%.
  • MERS Middle East Respiratory Syndrome
  • Coronavirus disease 19 COVID-19
  • Severe acute respiratory syndrome coronavirus 2 Sars
  • -CoV-2 Severe acute respiratory syndrome coronavirus 2
  • Coronavirus Infectious Disease-19 is transmitted when droplets (saliva) of an infected person penetrate the respiratory tract or the mucous membranes of the eyes, nose, and mouth. After infection, after an incubation period of about 2 to 14 days (estimated), the main symptoms are fever (37.5 degrees), respiratory symptoms such as cough or shortness of breath, and pneumonia. reach
  • One object of the present invention is to provide a composition for various uses that can improve or treat infection by coronavirus or various diseases caused by the infection.
  • compositions for improving or treating viral infections or infectious diseases comprising polyphosphate or a pharmaceutically acceptable salt thereof as an active ingredient.
  • it relates to a method for improving or treating a viral infection or an infectious disease, comprising administering the polyphosphate or a pharmaceutically acceptable salt thereof to an individual.
  • polyphosphate (PolyP) of the present invention is a linear polymer of orthophosphate linked by phosphate anhydride bonds. Localized in the lysosomes, granules, mitochondria, and nucleus of mammalian cells. At physiological pH, each internal unit has a monovalent negative charge, so the polymer is highly anionic.
  • the anionicity led to the discovery that polyphosphate can provide a physiological anionic surface for factor XII, particularly through activation of coagulation cascades such as prekallikrein and HMW kininogen. It has been found to accelerate thrombin-mediated activation to induce coagulation and enhance fibrin polymerization.
  • the polyphosphate may have a phosphate unit of 2 or more and 200 or less, preferably 2 or more and 9 or less, or 100 or more and 200 or less, More preferably 100 or more and less than 125, 125 It may be 130 or more, 130 or more and less than 140, 140 or more and 150 or less, 160 or more and 170 or less, or 180 or more and 190 or less, and more preferably 8, 120, 126, 137, 145, 162 or 189, and most preferably It can be 8, 120, 126 or 189, but is not limited thereto.
  • the polyphosphate may be included in the composition at a concentration of 5 ⁇ M or more and 100 ⁇ M or less, preferably 10 ⁇ M or more and 50 ⁇ M or less.
  • concentration of the polyphosphate is less than 5 ⁇ M, the effect of addition of the polyphosphate may be insignificant, and when the concentration exceeds 100 ⁇ M, it is difficult to expect any more synergistic effect according to the addition, and the efficiency of the addition may be reduced.
  • the pharmaceutically acceptable salts are salts generally considered by those skilled in the art to be suitable for medical applications (eg, since such salts are not harmful to the subject to be treated with the salts), or each salts that cause acceptable side effects within the treatment of
  • the pharmaceutically acceptable salts are salts considered acceptable by regulatory authorities such as the United States Food and Drug Administration (FDA), European Medicines Agency (EMA), or the Pharmaceutical and Medical Devices Agency (PMDA) of the Ministry of Health, Labor and Welfare of Japan.
  • FDA United States Food and Drug Administration
  • EMA European Medicines Agency
  • PMDA Pharmaceutical and Medical Devices Agency
  • the present invention in principle provides an intermediate, for example in the preparation of a compound according to the invention or a physiologically functional derivative thereof, or a pharmaceutically acceptable salt of a compound according to the invention or a physiologically functional derivative thereof.
  • salts of the compounds according to the invention which are not themselves pharmaceutically acceptable.
  • Said salts include water-insoluble salts, in particular water-soluble salts.
  • a particular compound according to the invention or a physiologically functional derivative thereof is capable of forming a salt, ie whether said compound according to the invention or a physiologically functional derivative thereof is, for example
  • Exemplary salts of the compounds of the present invention are acid addition salts or salts with bases, particularly pharmaceutically acceptable inorganic and organic acid addition salts and salts with bases commonly used in pharmaceuticals, which are water-insoluble or particularly water-soluble acid addition salts. is salt Depending on the substituents of the compounds of the present invention, salts with bases may also be suitable. Acid addition salts are prepared, for example, by combining a solution of a compound of the present invention with a solution of a pharmaceutically acceptable acid such as hydrochloric acid, sulfuric acid, fumaric acid, maleic acid, succinic acid, acetic acid, benzoic acid, citric acid, tartaric acid, carbonic acid or phosphoric acid. It can be formed by mixing.
  • a pharmaceutically acceptable acid such as hydrochloric acid, sulfuric acid, fumaric acid, maleic acid, succinic acid, acetic acid, benzoic acid, citric acid, tartaric acid, carbonic acid or phosphoric acid. It can be formed by mixing.
  • pharmaceutically acceptable base addition salts include alkali metal salts (eg, sodium or potassium salts); alkaline earth metal salts (eg, calcium or magnesium salts); and salts formed with suitable organic ligands (e.g., ammonium, quaternary ammonium and amines formed with counter anions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyl sulfonates and aryl sulfonates) cations) may be included.
  • suitable organic ligands e.g., ammonium, quaternary ammonium and amines formed with counter anions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyl sulfonates and aryl sulfonates
  • Illustrative examples of pharmaceutically acceptable salts include acetate, adipate, alginate, arginate, ascorbate, aspartate, benzenesulfonate, benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, butyrate, calcium edetate, camphorate, camphorsulfonate, camsylate, carbonate, chloride, citrate, digluconate, dihydrochloride, dodecylsulfate, edetate, edisylate, ethanesulfonate, Formate, fumarate, galactate, galacturonate, gluconate, glutamate, glycerophosphate, hemisulphate, heptanoate, hexanoate, hexylresorcinate, hydrobromide, hydrochloride, hydroiodide , 2-hydroxy-ethanesulfonate, hydroxynaphthoate
  • Salts which are not pharmaceutically acceptable in the present invention and which, for example, can be obtained as process products during the preparation of the compounds according to the invention on an industrial scale, are also included in the invention and, if desired, are known to the person skilled in the art. It can be converted into a pharmaceutically acceptable salt by a method.
  • the virus may be an RNA virus.
  • the "RNA virus” refers to any virus using RNA as a genetic material.
  • the RNA virus is Coronaviridae, Amalgaviridae, Birnaviridae, Chrysoviridae, Cystoviridae, Endornaviridae ( Endornaviridae), Hypoviridae, Megabirnaviridae, Partitiviridae, Picobirnaviridae, Reoviridae, Totiviridae, Quadriviridae, Arteriviridae, Mesoniviridae, Roniviridae, Dicistroviridae, Iflaviridae, Marnaviridae Marnaviridae, Picornaviridae, Secoviridae, Alphaflexiviridae, Betaflexiviridae, Gammaflexiviridae, Tymoviridae ), Bornaviridae, Filoviridae, Paramyx
  • the "coronavirus (Coronavirus)” has four genera (alpha, beta, gamma, delta) in the coronavirus subfamily (Coronavirinae) of the Coronaviridae, and a gene size of 27 to 32kb as an RNA virus. It is known to cause respiratory and digestive system infections in humans and animals. It is easily infected mainly through mucosal transmission and droplet transmission. Humans generally cause mild respiratory infections, but rarely fatal infections. Diarrhea in cattle and pigs, and respiratory diseases in chickens. Among coronaviruses, coronaviruses that host humans are divided into the classifications in Table 1 below (Centers for Disease Control and Prevention, 2020). Among the four genera, alpha and beta infect humans and animals, and gamma and delta are reported to infect only animals.
  • coronaviruses infecting humans in Table 2 below, and types that cause colds (229E, OC43, NL63, HKU1) and types that cause severe pneumonia (SARS-CoV, SARS-CoV2, MERS) -CoV).
  • Virus name Genus host Symptom HCoV-229E Alpha Human mild respiratory symptoms HCoV-NL63 Alpha Human mild respiratory symptoms SARS-CoV Beta Human severe respiratory symptoms MERS-CoV Beta Human severe respiratory symptoms HCoV-OC43 Beta Human mild respiratory symptoms HCoV-HKU1 Beta Human Pneumonia symptoms Sars-CoV-2 Beta Human Mild respiratory symptoms Severe cases can cause shortness of breath
  • beta coronavirus corresponds to a zoonotic infection as one of the four genus coronaviruses of the subfamily Coronavirus.
  • beta coronaviruses include Severe Acute Respiratory Syndrome virus (SARS; SARS-CoV), Severe Acute Respiratory Syndrome virus-2 (Sars-CoV-2), Middle East Respiratory Syndrome virus (SARS-CoV). Middle East Respiratory Syndrome virus (MERS; MERS-CoV), human coronavirus OC43 (HCoV-OC43), or human coronavirus HKU1 (HCoV-HKU1) are known to exist.
  • the "Severe Acute Respiratory Syndrome virus-2 (SARS-CoV-2)" is an enveloped, positive-polar single-stranded RNA beta coronavirus belonging to the Coronaviridae family. .
  • the coronaviruses that historically infect humans are severe common cold viruses, including hCoV-OC43, HKU and 229E5.
  • nucleocapsid protein includes N1, N2 and N3 fragments.
  • the coronavirus includes naturally or artificially mutated variants.
  • the infectious disease caused by the coronavirus is coronavirus enteritis, coronavirus diarrhea, severe acute respiratory syndrome coronavirus (SARS), Middle East respiratory syndrome (MERS), or their It may be a combination, but if it is a disease that can be caused by the coronavirus infection, it may be included without limitation.
  • the "individual” means a subject who has or is suspected of having a virus infection, and needs improvement or treatment for virus infection or a disease caused by the infection by suppressing virus activity, etc., which is already infected or infected with the virus It means any animal, including humans, who can become
  • composition of the present invention may be used as a pharmaceutical composition, a food composition, a food additive composition, a feed composition, or a feed additive composition, but is not particularly limited.
  • treatment and “improvement” refer to any action that improves or beneficially changes viral infection by inhibiting virus infection or proliferation by administering the composition of the present invention.
  • the polyphosphate or pharmaceutical composition may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition may be characterized in that it is for humans. .
  • the pharmaceutical composition of the present invention is not limited thereto, but each can be formulated in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc., for oral administration, and in the case of injections, buffers, preservatives, pain-freezing agents A topical agent, solubilizer, isotonic agent, stabilizer, etc.
  • the dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above.
  • a pharmaceutically acceptable carrier as described above.
  • it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have.
  • it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used.
  • fillers, anti-agglomeration agents, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be further included.
  • the route of administration of the compound or pharmaceutical composition according to the present invention is, but not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal , topical, sublingual or rectal. Oral or parenteral administration is preferred.
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.
  • the compound or pharmaceutical composition of the present invention depends on several factors including the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be treated.
  • the dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, degree of disease, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and 0.0001 to 50 mg/day per day kg or 0.001 to 50 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • the pharmaceutical composition according to the present invention may be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
  • the food composition may be prepared in the form of various foods, for example, beverages, gum, tea, vitamin complexes, powders, granules, tablets, capsules, confectionery, rice cakes, bread, and the like.
  • it may be used as a food additive composition necessary for the preparation of the food composition.
  • the amount may be added in a proportion of 0.1 to 50% of the total weight.
  • the food composition is prepared in the form of a beverage, there is no particular limitation other than containing the food composition in the indicated ratio, and it may contain various flavoring agents or natural carbohydrates as additional ingredients, like a conventional beverage. That is, as natural carbohydrates, monosaccharides such as glucose, disaccharides such as fructose, and polysaccharides such as sucrose, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol are included. can do.
  • flavoring agent examples include natural flavoring agents (taumartin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).
  • the food composition or food composition additive of the present invention includes various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and flavoring agents such as natural flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
  • These components may be used independently or in combination.
  • the proportion of these additives is not so important, but is generally selected in the range of 0.1 to about 50 parts by weight per 100 parts by weight of the food composition of the present invention.
  • the composition may be 20 to 90% highly concentrated or may be prepared in powder or granular form.
  • the feed additives include organic acids such as citric acid, humic acid, adipic acid, lactic acid, and malic acid, phosphates such as sodium phosphate, potassium phosphate, and acid pyrophosphate, polyphenols, catechins, alpha-tocopherol, rosemary extract, vitamin C, green tea extract , licorice extract, chitosan, tannic acid, any one or more of natural antioxidants such as phytic acid may be further included.
  • organic acids such as citric acid, humic acid, adipic acid, lactic acid, and malic acid
  • phosphates such as sodium phosphate, potassium phosphate, and acid pyrophosphate
  • polyphenols catechins
  • alpha-tocopherol rosemary extract
  • vitamin C vitamin C
  • green tea extract licorice extract
  • chitosan tannic acid
  • the composition when used as a feed, the composition may be formulated in a conventional feed form, and may include common feed ingredients together.
  • the feed additive and feed include grains such as milled or crushed wheat, oats, barley, corn and rice; plant protein feeds, such as feeds based on rape, soybean and sunflower; animal protein feeds such as blood meal, meat meal, bone meal and fish meal; Sugar and dairy products, for example, may further include dry ingredients made of various powdered milk and whey powder, and may further include nutritional supplements, digestion and absorption enhancers, growth promoters, and the like.
  • the polyphosphate when used as the feed additive, it may be administered to an animal alone or in combination with other feed additives in an edible carrier.
  • the feed additives can be easily administered to the animal as a top dressing, directly mixing them into the animal feed, or in an oral formulation separate from the feed.
  • a pharmaceutically acceptable edible carrier as is well known in the art to prepare an immediate release or sustained release formulation.
  • Such edible carriers may be solid or liquid, for example corn starch, lactose, sucrose, soy flakes, peanut oil, olive oil, sesame oil and propylene glycol.
  • the feed additive may be a tablet, capsule, powder, troche or sugar-containing tablet or top dressing in microdispersed form.
  • the feed additive may be in the form of a gelatin soft capsule, or a syrup or suspension, emulsion, or solution.
  • the feed may include any protein-containing organic flour commonly used to meet the dietary needs of animals. Such protein-containing flour typically consists of corn, soy flour, or corn/soy flour mix.
  • the feed composition or feed additive composition may contain, for example, a preservative, a stabilizer, a wetting or emulsifying agent, a solution accelerator, and the like.
  • the feed additive composition may be used by immersion, spraying, or mixing to add to animal feed.
  • composition provided in the present invention has a coronavirus inhibitory activity, and can effectively improve or treat an infection caused by a coronavirus or a disease caused by the infection.
  • Figure 2 shows a photograph taken by magnifying the primary cells obtained from the nasal cavity of a healthy person in Preparation Example 2 under a microscope.
  • 5 is a graph showing the inhibitory effect of coronavirus in the case of treatment with the polyphosphate of the unit 120 in Experimental Example 3.
  • FIG. 10 shows the ability of polyphosphate to inhibit ACE2 envelope protein and N protein in Experimental Example 5 through immunofluorescence (IF).
  • FIG. 11 is a graph showing the ability of polyphosphate to inhibit ACE2 envelope protein and N protein in Experimental Example 5 through immunofluorescence (IF) and quantitation.
  • Figure 12 is a graph showing the results of comparing the inhibitory ability of the N1, N2 and N3 genes when the polyphosphate treatment in Vero cells infected in Experimental Example 5.
  • FIG. 13 is a graph showing sgM, sgE, sgN and sgS inhibitory ability when polyphosphate is treated in Vero cells infected in Experimental Example 5;
  • 15 is a graph showing the results of comparing the inhibitory ability of the N1, N2 and N3 genes when the primary cells infected in Experimental Example 6 were treated with polyphosphate.
  • 16 is a graph showing the ability to suppress ACE2, Cov2-N1, RdRp, Spike gene and sub-genomic N transcript when polyphosphate is treated in the primary cells infected in Experimental Example 6.
  • FIG. 17 shows the ACE2 and N protein inhibitory ability when treated with polyphosphate in the primary cells infected in Experimental Example 6 through immunoblotting analysis.
  • One object of the present invention is to provide a composition for various uses that can improve or treat infection by coronavirus or various diseases caused by the infection.
  • Linear polyphosphate was polymerized with sodium phosphate units (NaH 2 PO 4 ⁇ 9.0%; Sigma Aldrich) at 700° C. for 1 hour in an electric furnace (HQ-DMF3; Coretech, Korea). Then, molten sodium polyphosphate was poured into a copper plate and rapidly cooled to pulverize.
  • the process can be represented by the following formula (1).
  • polyphosphates as shown in the chemical formula of FIG. 1 were synthesized.
  • nNaH 2 PO 4 (NaPO 3 ) n + nH 2 O
  • the resulting polymer known as Graham's salt, contains polyphosphate (PolyP) of three mixed molecular structures: linear, cyclic and branched.
  • Polyphosphate PolyP
  • Branched polyphosphates are very unstable, and when dissolved in water, the branching point of these polyphosphates is hydrolyzed regardless of pH, even at room temperature.
  • linear polyphosphates and cyclic polyphosphates (cyclo PolyP) hydrolyze very slowly at neutral pH and room temperature.
  • the hydrolysis half-life for P-O-P bonds of linear polyphosphates at pH 7 at room temperature reaches several years.
  • Synthesized polyphosphates may generally contain very small amounts of cyclic polyphosphates, but cyclic polyphosphates mainly have short chain lengths, so they were not synthesized in this example.
  • the obtained polymers had a wide range of chain lengths to perform fractional precipitation.
  • Sodium polyphosphate powder was dissolved in distilled water (1:10 w/v), the pH was adjusted to 7, and left at 25° C. for 12 hours. Then, acetone was added to the solution for polyphosphate precipitation. The precipitated polyphosphate was partitioned by centrifugation at 4200 rpm for 5 minutes. The fractional precipitation was repeated 25 times, and the obtained polyphosphate fraction was dried for 48 hours.
  • the polyphosphate was fractionated by HPLC system (LC-20AD; Shimadzu, Japan) and multi-angle light scattering detector (miniDawn Treos II; Wyatt Technology, USA).
  • HPLC system was gel permeation chromatography (PL aquagel-OH; 7.5 ⁇ 50 mm; 8 ⁇ m; Agilent Technology, USA) guard column (PL aquagel-OH Mixed-M; 7.5 ⁇ 300 mm; 8 ⁇ m; Agilent Technology, USA).
  • the concentration of the injected polyphosphate sample is 25 mg/mL
  • the injection volume is 50 ⁇ L.
  • the temperature of the column was maintained at 30°C.
  • the chain length (n) of the polyphosphate separated by the above process was determined according to the following formula (2).
  • Mn (average molar mass number) Na n+2 P n O 3n+1
  • the primers used for each target gene are shown in Table 3 below.
  • Vero E6 cells infected with Severe Acute Respiratory Syndrome Coronavirus 2 obtained from Korean patients were treated with different concentrations (ranging from 9.375 to 37.5 ⁇ M) of monomer 120 polyphosphate. (P120 PolyP) and the results are shown as in FIG. 4 .
  • the anti-proliferative effect of Sars-CoV-2 was significantly superior in the polyphosphate-treated group compared to the control group. Specifically, when the polyphosphate (P120 PolyP) of the unit 120 was treated at concentrations of 37.5uM, 18.75uM, and 9.375uM, the Ct value of the Sars-CoV-2 gene was 25 or more, and the Ct of the Sars-CoV-2 gene. It was confirmed that the corona virus inhibitory effect was significantly superior to that of the control group with a value of 20 (p ⁇ 0.000003).
  • RT-real-time PCR analysis was performed. Specifically, in the BSL3 laboratory, 425,000 VERO cells were applied to 24 multi-wells, each 85,000 each. Next, cells were infected with Sars-CoV-2 obtained from frozen swabs taken from Sars-CoV-2 positive patients (MOI 0.09). Uninfected cells were used as negative controls for infection.
  • polyphosphate of unit 120 (P120 PolyP)
  • polyphosphate of unit 126 polyphosphate with phosphate unit 126, P126 PolyP
  • polyphosphate of unit 189 polyphosphate with phosphate unit 189, P189 PolyP
  • Cq values of the targets N1, N2, N3 were normalized to the internal control (Delta Ct) and shown in Table 6.
  • the multiples of the quantitative value for the vehicle-treated control group were calculated and the results are shown in FIG. 7 .
  • polyphosphate of unit 120 (P120 PolyP), polyphosphate of unit 126 (P126 PolyP), and polyphosphate of unit 189 (P189 PolyP) in Vero cells infected with Sars-CoV-2
  • P120 PolyP polyphosphate of unit 120
  • P126 PolyP polyphosphate of unit 126
  • P189 PolyP polyphosphate of unit 189
  • RT-real-time PCR analysis was performed in the same manner.
  • RT-real time expression levels of angiotensin-converting enzyme 2 (ACE2), Cov2-N1, envelope protein gene, RdRp, spike gene, sub-genome N and sub-genomic S transcripts of infected VERO cells PCR analysis was performed to derive a quantitative value, and the multiple of the quantitative value for the vehicle-treated control was calculated and shown as shown in FIG. 8, in which case, from the left on the graph, ACE2, Cov2-N1, envelope protein gene, RdRp, spike Corresponds to the resulting values of the gene, subgenomic N, and subgenomic S transcripts.
  • IF immunofluorescence analysis
  • RT-real-time PCR analysis was performed. Specifically, after applying VERO E6 cells, the cells were infected with Sars-CoV-2 obtained from a frozen swab taken from a Sars-CoV-2 positive patient (0.1 MOI). Uninfected cells were used as negative controls for infection. 24 hours after infection (ie, 60 hours after infection), 37.5 ⁇ M of polyphosphate of monomer 120 (P120 PolyP) was treated, and vehicle-treated cells were used as a negative control. After 36 hours of treatment, VERO cells were lysed and RNA was extracted. Since "CLONIT quantitative COVID-19" [Ref. RT-25] (IVD approved) kit was used for RT-real-time PCR analysis, and the Ct values of the targets (N1, N2, N3) were derived and shown in FIG. 12 .
  • VERO cells were infected with Sars-CoV-2 (0.1 MOI), and uninfected cells were used as negative controls for infection. After 24 hours, the infected Vero cells were treated with 37.5 ⁇ M of polyphosphate 120 (P120 PolyP), and the vehicle-treated cells were used as a negative control. After 36 hours of treatment (ie, 50 hours after infection), VERO cells were lysed and RNA was extracted.
  • IF immunofluorescence analysis
  • RT-real-time PCR analysis was performed. Specifically, nasal primary cells were infected with Sars-CoV-2 at an MOI of 0.002, and uninfected cells were used as a negative control for infection. 24 hours after infection, the monomer 120 polyphosphate (P120 PolyP) was treated with 37.5 ⁇ M, and the vehicle-treated cells were used as a negative control. After 36 hours of treatment (ie, 60 hours after infection), primary cells were lysed and RNA was extracted. Since "CLONIT quantitative COVID-19" [Ref. RT-25] (IVD approved) kit was used to perform RT-real-time PCR analysis, and after deriving the quantitative values of the targets (N1, N2, N3), the multiples of the quantitative values for the vehicle-treated control group were calculated. 15 shows.
  • RT-real-time PCR analysis was performed. Specifically, primary cells were infected with Sars-CoV-2 MOI of 0.002, and uninfected cells were used as negative controls for infection. 24 hours after infection, the monomer 120 polyphosphate (P120 PolyP) was treated with 37.5 ⁇ M, and the vehicle-treated cells were used as a negative control. After 36 hours of treatment (ie, 60 hours after infection), primary cells were lysed and RNA was extracted.
  • RT-real-time PCR analysis was performed using a kit capable of detecting ACE2, Cov2-N1, RdRp, spike gene and sub-genomic N transcript, and targets (ACE2, Cov2-N1, RdRp, spike gene and sub-genome) were performed.
  • the multiple of the quantitative value for the vehicle-treated control group was calculated and shown in FIG. 16 , and in this case, from the left on the graph, ACE2, Cov2-N1, RdRp, Spike gene and sub-genome N It corresponds to the result value of the transcriptome.
  • RT-real-time PCR analysis was performed on the expression level of inflammatory cytokines.
  • Primary cells were infected with Sars-CoV-2 MOI of 0.002, and uninfected cells were used as negative controls for infection.
  • the monomer 120 polyphosphate (P120 PolyP) was treated with 37.5 ⁇ M, and the vehicle-treated cells were used as a negative control. After 36 hours of treatment (ie, 60 hours after infection), primary cells were lysed and RNA was extracted.
  • RT-real-time PCR analysis was performed on the extracted RNA, and after deriving quantitative values of the target (IFN-gamma, IL-10, IL-12, TNF-alpha and IL-6), the vehicle-treated control group was The result of calculating the multiple of the quantitative value is shown in FIG. 18 , and in this case, from the left on the graph, it corresponds to the result value of IFN-gamma, IL-10, IL-12, TNF-alpha and IL-6.
  • the infected primary cells were treated with the polyphosphate of the unit 120 (P120 PolyP), they were infected and compared to the vehicle-treated control group and the non-infected control group IFN-gamma, IL-10, IL-12, TNF- As the expression of alpha and IL-6 was reduced, it was confirmed that the polyphosphate had an excellent effect in inhibiting the cytokine storm caused by the coronavirus.
  • the present invention relates to a composition for various uses that can effectively treat a coronavirus infection or a disease caused by the infection.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Inorganic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Polymers & Plastics (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Food Science & Technology (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Nutrition Science (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Mycology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Husbandry (AREA)
  • Wood Science & Technology (AREA)
  • Plant Pathology (AREA)
  • Pest Control & Pesticides (AREA)
  • Agronomy & Crop Science (AREA)
  • Dentistry (AREA)
  • Dermatology (AREA)
  • Environmental Sciences (AREA)
  • Birds (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention can effectively treat a coronavirus infection or a disease caused by such infection, by using polyphosphates by means of a coronavirus inhibitory activity of compounds thereof.

Description

폴리포스페이트를 포함하는 코로나바이러스 감염 또는 감염 질환의 치료용 조성물Composition for treatment of coronavirus infection or infectious disease comprising polyphosphate
본 발명은 코로나바이러스 감염 또는 상기 감염에 의한 질환을 효과적으로 치료할 수 있는 다양한 용도의 조성물에 관한 것이다. The present invention relates to a composition for various uses that can effectively treat a coronavirus infection or a disease caused by the infection.
코로나바이러스는 현대 문명에서 치명적인 감염병을 일으키는 대표적인 바이러스로 2003년 4월에는 중증급성호흡기증후군(Severe Acute Respiratory Syndrome; SARS), 일명 사스가 유행해 사망률 9.6%를 기록하며 많은 사람이 사망했으며, 2015년에는 중동 호흡기 증후군(Middle East Respiratory Syndrome; MERS), 일명 메르스가 중동에서 전 세계로 퍼지면서 사망률 약 36%로써 사망자가 다수 발생한 바 있다. 또한, 코로나바이러스감염증-19(Coronavirus disease 19; COVID-19)는 2019년 12월 처음 발생하여 전세계로 확산된 새로운 유형의 코로나바이러스인 중증급성호흡기증후군 코로나바이러스 2(Severe acute respiratory syndrome coronavirus 2; Sars-CoV-2)에 의한 호흡기 감염질환이다. 코로나바이러스감염증-19는 감염자의 비말(침방울)이 호흡기나 눈·코·입의 점막으로 침투될 때 전염된다. 감염되면 약 2~14일(추정)의 잠복기를 거친 뒤 발열(37.5도) 및 기침이나 호흡곤란 등 호흡기 증상, 폐렴이 주증상으로 나타나고 치사율도 2020년 3월까지 집계된 자료에 따르면 5.6%에 달한다. Coronavirus is a representative virus that causes lethal infectious diseases in modern civilization. Middle East Respiratory Syndrome (MERS), also known as MERS, spread from the Middle East to the world, resulting in a death rate of about 36%. In addition, Coronavirus disease 19 (COVID-19) is a new type of coronavirus that first occurred in December 2019 and spread worldwide, Severe acute respiratory syndrome coronavirus 2 (Sars). -CoV-2) is a respiratory infection. Coronavirus Infectious Disease-19 is transmitted when droplets (saliva) of an infected person penetrate the respiratory tract or the mucous membranes of the eyes, nose, and mouth. After infection, after an incubation period of about 2 to 14 days (estimated), the main symptoms are fever (37.5 degrees), respiratory symptoms such as cough or shortness of breath, and pneumonia. reach
신변종 바이러스의 유행은 인류에게 크나큰 문제를 야기하고 있으나, 지금까지 코로나바이러스에 대한 치료제 개발이 추진되고 있음에도, 마땅한 치료를 위한 조성물은 완성되지 않은 상황이다. 따라서 코로나바이러스 감염 또는 감염 질환을 효과적으로 치료할 수 있는 조성물이 요구된다.The epidemic of a new strain of virus is causing a huge problem for mankind, but even though the development of a therapeutic agent for the coronavirus is being promoted so far, a composition for a proper treatment has not been completed. Therefore, there is a need for a composition capable of effectively treating a coronavirus infection or infectious disease.
본 발명의 일 목적은 코로나바이러스에 의한 감염 또는 상기 감염에 의해 유발된 다양한 질환을 개선 또는 치료할 수 있는 다양한 용도의 조성물을 제공하자 한다. One object of the present invention is to provide a composition for various uses that can improve or treat infection by coronavirus or various diseases caused by the infection.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the technical task to be achieved by the present invention is not limited to the tasks mentioned above, and other tasks not mentioned will be clearly understood by those of ordinary skill in the art from the following description.
이하, 본원에 기재된 다양한 구체예가 도면을 참조로 기재된다. 하기 설명에서, 본 발명의 완전한 이해를 위해서, 다양한 특이적 상세사항, 예컨대, 특이적 형태, 조성물 및 공정 등이 기재되어 있다. 그러나, 특정의 구체예는 이들 특이적 상세 사항 중 하나 이상 없이, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서, 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서, 특정의 상세사항으로 기재되지 않는다. "한 가지 구체예" 또는 "구체예"에 대한 본 명세서 전체를 통한 참조는 구체예와 결부되어 기재된 특별한 특징, 형태, 조성 또는 특성이 본 발명의 하나 이상의 구체예에 포함됨을 의미한다. 따라서, 본 명세서 전체에 걸친 다양한 위치에서 표현된 "한 가지 구체예에서" 또는 "구체예"의 상황은 반드시 본 발명의 동일한 구체예를 나타내지는 않는다. 추가로, 특별한 특징, 형태, 조성, 또는 특성은 하나 이상의 구체예에서 어떠한 적합한 방법으로 조합될 수 있다.Hereinafter, various embodiments described herein are described with reference to the drawings. In the following description, various specific details are set forth, such as specific forms, compositions and processes, and the like, for a thorough understanding of the present invention. However, certain embodiments may be practiced without one or more of these specific details, or in conjunction with other known methods and forms. In other instances, well-known processes and manufacturing techniques have not been described in specific detail in order not to unnecessarily obscure the present invention. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, form, composition, or characteristic described in connection with the embodiment is included in one or more embodiments of the invention. Thus, references to "in one embodiment" or "an embodiment" in various places throughout this specification do not necessarily refer to the same embodiment of the invention. Additionally, the particular features, forms, compositions, or properties may be combined in any suitable manner in one or more embodiments.
본 발명 내 특별한 정의가 없으면 본 명세서에 사용된 모든 과학적 및 기술적인 용어는 본 발명이 속하는 기술분야에서 당업자에 의하여 통상적으로 이해되는 것과 동일한 의미를 가진다.Unless otherwise defined in the present invention, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
본 발명의 일 구현 예에 따르면, 폴리포스페이트(polyphosphate) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 바이러스 감염 또는 감염 질환의 개선 또는 치료용 조성물에 관한 것이다.According to one embodiment of the present invention, it relates to a composition for improving or treating viral infections or infectious diseases, comprising polyphosphate or a pharmaceutically acceptable salt thereof as an active ingredient.
본 발명의 다른 구현 예에 따르면, 개체에게 상기 폴리포스페이트(polyphosphate) 또는 이의 약학적으로 허용 가능한 염을 투여하는 단계를 포함하는, 바이러스 감염 또는 감염 질환의 개선 또는 치료 방법에 관한 것이다.According to another embodiment of the present invention, it relates to a method for improving or treating a viral infection or an infectious disease, comprising administering the polyphosphate or a pharmaceutically acceptable salt thereof to an individual.
본 발명의 상기 "폴리포스페이트(polyphosphate; PolyP)"는 인산염 무수물 결합에 의해 연결된 정인산염(오르토포스페이트, orthophosphate)의 선형 중합체이다. 포유류 세포의 리소좀, 조밀과립, 미토콘드리아 및 핵에 국한되어 있다. 생리적 pH에서, 각각의 내부 단위는 1가 음전하를 가지며, 따라서 중합체는 높은 음이온성(anion)이다. 상기 음이온성은 폴리포스페이트가 XII 인자(factor XII)의 생리학적 음이온 표면을 제공할 수 있다는 발견으로 이어졌고, 특히 프리칼리크레인(prekallikrein) 및 고분자 키니노겐(HMW kininogen) 등의 응고 케스케이드의 활성화를 통해 트롬빈 매개 활성화를 가속화시켜 응고를 유발하고 피브린 중합을 향상시키는 것으로 밝혀졌다.The "polyphosphate (PolyP)" of the present invention is a linear polymer of orthophosphate linked by phosphate anhydride bonds. Localized in the lysosomes, granules, mitochondria, and nucleus of mammalian cells. At physiological pH, each internal unit has a monovalent negative charge, so the polymer is highly anionic. The anionicity led to the discovery that polyphosphate can provide a physiological anionic surface for factor XII, particularly through activation of coagulation cascades such as prekallikrein and HMW kininogen. It has been found to accelerate thrombin-mediated activation to induce coagulation and enhance fibrin polymerization.
본 발명에서, 상기 폴리포스페이트는 인산염 단위체(phosphate unit)가 2 이상 200 이하인 것일 수 있고, 바람직하게는 2 이상 9 이하, 또는 100 이상 200 이하인 것일 수 있고, 보다 바람직하게는 100 이상 125 미만, 125 이상 130 미만, 130 이상 140 미만, 140 이상 150 이하, 160 이상 170 이하 또는 180 이상 190 이하인 것일 수 있으며, 더욱 바람직하게는 8, 120, 126, 137, 145, 162 또는 189일 수 있고, 가장 바람직하게는 8, 120, 126 또는 189일 수 있으나, 이에 제한되지는 않는다. In the present invention, the polyphosphate may have a phosphate unit of 2 or more and 200 or less, preferably 2 or more and 9 or less, or 100 or more and 200 or less, More preferably 100 or more and less than 125, 125 It may be 130 or more, 130 or more and less than 140, 140 or more and 150 or less, 160 or more and 170 or less, or 180 or more and 190 or less, and more preferably 8, 120, 126, 137, 145, 162 or 189, and most preferably It can be 8, 120, 126 or 189, but is not limited thereto.
본 발명에서, 상기 폴리포스페이트는 상기 조성물 내에 5μM 이상 100μM 이하의 농도로 포함될 수 있고, 바람직하게는 10μM 이상 50μM 이하의 농도로 포함될 수 있다. 상기 폴리포스페이트의 농도가 5μM 미만인 경우 상기 폴리포스페이트의 첨가 효과가 미미할 수 있고, 상기 농도가 100μM을 초과하는 경우 첨가에 따른 더 이상의 상승 효과를 기대하기 어려워 첨가의 효율성이 저하될 수 있다.In the present invention, the polyphosphate may be included in the composition at a concentration of 5 μM or more and 100 μM or less, preferably 10 μM or more and 50 μM or less. When the concentration of the polyphosphate is less than 5 μM, the effect of addition of the polyphosphate may be insignificant, and when the concentration exceeds 100 μM, it is difficult to expect any more synergistic effect according to the addition, and the efficiency of the addition may be reduced.
본 발명에서 상기 약학적으로 허용되는 염은, 의학적 적용에 적합한 것으로 당업자에 의해 일반적으로 간주되는 염(예를 들어 이러한 염이 상기 염으로 치료될 수 있는 대상체에게 유해하지 않기 때문임), 또는 각각의 치료 내에서 허용 가능한 부작용을 야기하는 염이다. 일반적으로, 상기 약학적으로 허용되는 염은 미국 식품 의약국(FDA), 유럽 의약청(EMA), 또는 일본 후생성의 의약품 의료기기 종합기구(PMDA)와 같은 규제 당국에 의해 허용되는 것으로 간주되는 염이다. 그러나, 본 발명은 원칙적으로, 예를 들어 본 발명에 따른 화합물 또는 그의 생리학적으로 작용성인 유도체의 제조에서의 중간체, 또는 본 발명에 따른 화합물의 약학적으로 허용되는 염 또는 그의 생리학적으로 작용성인 유도체의 제조에서의 중간체로서, 그 자체로는 약학적으로 허용되지 않는 본 발명에 따른 화합물의 염을 또한 포함한다. 상기 염은 수불용성 염을 포함하고, 특히, 수용성 염을 포함한다.In the present invention, the pharmaceutically acceptable salts are salts generally considered by those skilled in the art to be suitable for medical applications (eg, since such salts are not harmful to the subject to be treated with the salts), or each salts that cause acceptable side effects within the treatment of In general, the pharmaceutically acceptable salts are salts considered acceptable by regulatory authorities such as the United States Food and Drug Administration (FDA), European Medicines Agency (EMA), or the Pharmaceutical and Medical Devices Agency (PMDA) of the Ministry of Health, Labor and Welfare of Japan. . However, the present invention in principle provides an intermediate, for example in the preparation of a compound according to the invention or a physiologically functional derivative thereof, or a pharmaceutically acceptable salt of a compound according to the invention or a physiologically functional derivative thereof. Also included as intermediates in the preparation of derivatives are salts of the compounds according to the invention which are not themselves pharmaceutically acceptable. Said salts include water-insoluble salts, in particular water-soluble salts.
각각의 경우에, 당업자는 본 발명에 따른 특정 화합물 또는 그의 생리학적으로 작용성인 유도체가 염을 형성할 수 있는지 여부, 즉, 상기 본 발명에 따른 화합물 또는 그의 생리학적으로 작용성인 유도체가, 예를 들어 아미노 기, 카르복실산 기 등과 같은 전하를 띨 수 있는 기를 가지는지 여부를 쉽게 결정할 수 있다.In each case, the person skilled in the art will know whether a particular compound according to the invention or a physiologically functional derivative thereof is capable of forming a salt, ie whether said compound according to the invention or a physiologically functional derivative thereof is, for example For example, it can be easily determined whether or not a group has a chargeable group, such as an amino group, a carboxylic acid group, and the like.
본 발명의 화합물의 예시적인 염은 산 부가 염 또는 염기와의 염, 특히 약학적으로 허용되는 무기산 및 유기산 부가 염 및 약학에서 통상적으로 사용되는 염기와의 염이며, 이는 수불용성 또는 특히 수용성 산 부가 염이다. 본 발명의 화합물의 치환기에 따라 염기와의 염이 또한 적합할 수 있다. 산 부가 염은, 예를 들어, 본 발명의 화합물의 용액을 염산, 황산, 푸마르산, 말레산, 석신산, 아세트산, 벤조산, 시트르산, 타르타르산, 탄산 또는 인산과 같은 약학적으로 허용되는 산의 용액과 혼합함으로써 형성될 수 있다. 마찬가지로, 약학적으로 허용되는 염기 부가 염은 알칼리 금속염(예를 들어, 나트륨 또는 칼륨 염); 알칼리 토금속 염(예를 들어, 칼슘 또는 마그네슘 염); 및 적합한 유기 리간드로 형성된 염(예를 들어, 할라이드, 하이드록사이드, 카복실레이트, 설페이트, 포스페이트, 니트레이트, 알킬 설포네이트 및 아릴 설포네이트와 같은 반대 음이온을 사용하여 형성된 암모늄, 4차 암모늄 및 아민 양이온)을 포함할 수 있다. 약학적으로 허용되는 염의 예시적인 예로는 아세테이트, 아디페이트, 알기네이트, 아르기네이트, 아스코르베이트, 아스파테이트, 벤젠설포네이트, 벤조에이트, 바이카르보네이트, 바이설페이트, 바이타르트레이트, 보레이트, 브로마이드, 부티레이트, 칼슘 에데테이트, 캄포레이트, 캄포설포네이트, 캄실레이트, 카르보네이트, 클로라이드, 시트레이트, 디글루코네이트, 디하이드로클로라이드, 도데실설페이트, 에데테이트, 에디실레이트, 에탄설포네이트, 포르메이트, 푸마레이트, 갈락테이트, 갈락투로네이트, 글루코네이트, 글루타메이트, 글리세로포스페이트, 헤미설페이트, 헵타노에이트, 헥사노에이트, 헥실레소르시네이트, 하이드로브로마이드, 하이드로클로라이드, 하이드로요오다이드, 2-하이드록시-에탄설포네이트, 하이드록시나프토에이트, 요오다이드, 이소부티레이트, 이소티오네이트, 락테이트, 라우레이트, 라우릴 설페이트, 말레이트, 말레에이트, 말로네이트, 만델레이트, 메탄설포네이트(메실레이트), 메틸설페이트, 2-나프탈렌설포네이트, 니코티네이트, 니트레이트, 올레에이트, 옥살레이트, 팔미테이트, 판토테네이트, 펙티네이트, 퍼설페이트, 3-페닐프로피오네이트, 포스페이트/디포스페이트, 프탈레이트, 피크레이트, 피발레이트, 폴리갈락투로네이트, 프로피오네이트, 살리실레이트, 스테아레이트, 설페이트, 수베레이트, 석시네이트, 탄네이트, 타르트레이트, 토실레이트, 운데카노에이트, 발레레이트 등이 포함되지만 이로 한정되지 않는다.Exemplary salts of the compounds of the present invention are acid addition salts or salts with bases, particularly pharmaceutically acceptable inorganic and organic acid addition salts and salts with bases commonly used in pharmaceuticals, which are water-insoluble or particularly water-soluble acid addition salts. is salt Depending on the substituents of the compounds of the present invention, salts with bases may also be suitable. Acid addition salts are prepared, for example, by combining a solution of a compound of the present invention with a solution of a pharmaceutically acceptable acid such as hydrochloric acid, sulfuric acid, fumaric acid, maleic acid, succinic acid, acetic acid, benzoic acid, citric acid, tartaric acid, carbonic acid or phosphoric acid. It can be formed by mixing. Likewise, pharmaceutically acceptable base addition salts include alkali metal salts (eg, sodium or potassium salts); alkaline earth metal salts (eg, calcium or magnesium salts); and salts formed with suitable organic ligands (e.g., ammonium, quaternary ammonium and amines formed with counter anions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyl sulfonates and aryl sulfonates) cations) may be included. Illustrative examples of pharmaceutically acceptable salts include acetate, adipate, alginate, arginate, ascorbate, aspartate, benzenesulfonate, benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, butyrate, calcium edetate, camphorate, camphorsulfonate, camsylate, carbonate, chloride, citrate, digluconate, dihydrochloride, dodecylsulfate, edetate, edisylate, ethanesulfonate, Formate, fumarate, galactate, galacturonate, gluconate, glutamate, glycerophosphate, hemisulphate, heptanoate, hexanoate, hexylresorcinate, hydrobromide, hydrochloride, hydroiodide , 2-hydroxy-ethanesulfonate, hydroxynaphthoate, iodide, isobutyrate, isothionate, lactate, laurate, lauryl sulfate, maleate, maleate, malonate, mandelate, methane Sulfonate (mesylate), methylsulfate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pantothenate, pectinate, persulfate, 3-phenylpropionate, phosphate /diphosphate, phthalate, picrate, pivalate, polygalacturonate, propionate, salicylate, stearate, sulfate, suberate, succinate, tannate, tartrate, tosylate, undecanoate, Valerate, and the like, but are not limited thereto.
본 발명에서 약학적으로 허용되지 않으며, 예를 들어, 산업적 규모로 본 발명에 따른 화합물을 제조하는 동안 공정 생성물로서 수득될 수 있는 염이 또한 본 발명에 포함되고, 요망되는 경우, 이는 당업자에게 알려진 방법에 의해 약학적으로 허용되는 염으로 전환될 수 있다.Salts which are not pharmaceutically acceptable in the present invention and which, for example, can be obtained as process products during the preparation of the compounds according to the invention on an industrial scale, are also included in the invention and, if desired, are known to the person skilled in the art. It can be converted into a pharmaceutically acceptable salt by a method.
본 발명에서 상기 바이러스는 RNA 바이러스일 수 있다. 본 발명에서, 상기 “RNA 바이러스”는 RNA를 유전물질로 사용하는 모든 바이러스를 의미한다. 예를 들어, 상기 RNA 바이러스는 코로나비리대 (Coronaviridae), 아말가비리대 (Amalgaviridae), 비르나비리대 (Birnaviridae), 크리소비리대 (Chrysoviridae), 시스토비리대 (Cystoviridae), 엔도르나비리대 (Endornaviridae), 하이포비리대 (Hypoviridae), 메가비르나비리대 (Megabirnaviridae), 파르티티비리대 (Partitiviridae), 피코비르나비리대 (Picobirnaviridae), 레오비리대 (Reoviridae), 토티비리대 (Totiviridae), 콰드리비리대 (Quadriviridae), 아르테리비리대 (Arteriviridae), 메소니비리대 (Mesoniviridae), 로니비리대 (Roniviridae), 디시스트로비리대 (Dicistroviridae), 이플라비리대 (Iflaviridae), 마르나비리대 (Marnaviridae), 피코르나비리대 (Picornaviridae), 세코비리대 (Secoviridae), 알파플렉시비리대 (Alphaflexiviridae), 베타플렉시비리대 (Betaflexiviridae), 감마플렉시비리대 (Gammaflexiviridae), 티모비리대 (Tymoviridae), 보르나비리대 (Bornaviridae), 필로비리대 (Filoviridae), 파라믹소비리대 (Paramyxoviridae), 랍도비리대 (Rhabdoviridae), 니아미비리대 (Nyamiviridae), 칼리시비리대 (Caliciviridae), 플라비비리대 (Flaviviridae), 루테오비리대 (Luteoviridae), 토가비리대 (Togaviridae), 뉴모바라대 (Pneumoviridae), 아레나비리대 (Arenaviridae), 델타비리대 (Deltavirus), 또는 오르토믹스비리대 (Orthomyxoviridae) 바이러스일 수 있으나, 바람직하게는 코로나비리대일 수 있으며, 보다 바람직하게는 코로나비리대에 속하는 코로나바이러스일 수 있다. In the present invention, the virus may be an RNA virus. In the present invention, the "RNA virus" refers to any virus using RNA as a genetic material. For example, the RNA virus is Coronaviridae, Amalgaviridae, Birnaviridae, Chrysoviridae, Cystoviridae, Endornaviridae ( Endornaviridae), Hypoviridae, Megabirnaviridae, Partitiviridae, Picobirnaviridae, Reoviridae, Totiviridae, Quadriviridae, Arteriviridae, Mesoniviridae, Roniviridae, Dicistroviridae, Iflaviridae, Marnaviridae Marnaviridae, Picornaviridae, Secoviridae, Alphaflexiviridae, Betaflexiviridae, Gammaflexiviridae, Tymoviridae ), Bornaviridae, Filoviridae, Paramyxoviridae, Rhabdoviridae, Nyamiviridae, Caliciviridae, Fla Flaviviridae, Luteoviridae, Togaviridae, Pneumoviridae, Arenaviridae, Deltavirus, or Orthomyxviridae ( Orthomyxoviridae) may be a virus, but preferably may be Coronaviridae, and more preferably Corona belonging to Coronaviridae It could be a virus.
본 발명에서 상기 "코로나바이러스(Coronavirus)"는 코로나비리대(Coronaviridae)의 코로나바이러스아과(Coronavirinae)에 4개의 속(알파, 베타, 감마, 델타)이 있으며, 유전자 크기 27 내지 32kb의 RNA 바이러스로 사람과 동물의 호흡기와 소화기계 감염을 유발하는 것으로 알려져 있다. 주로 점막 전염, 비말 전파로 쉽게 감염되며, 사람은 일반적으로 경미한 호흡기 감염을 일으키지만 드물게 치명적인 감염을 일으키기도 하며, 소와 돼지는 설사, 닭은 호흡기 질환이 발생하기도 한다. 코로나바이러스 중에서 사람을 숙주로 하는 코로나바이러스는 하기 표 1의 분류로 나뉜다(질병관리본부, 2020). 4개의 속 중에서 알파와 베타는 사람과 동물에게 감염이 되며, 감마와 델타는 동물에게만 감염되는 것으로 보고되고 있다.In the present invention, the "coronavirus (Coronavirus)" has four genera (alpha, beta, gamma, delta) in the coronavirus subfamily (Coronavirinae) of the Coronaviridae, and a gene size of 27 to 32kb as an RNA virus. It is known to cause respiratory and digestive system infections in humans and animals. It is easily infected mainly through mucosal transmission and droplet transmission. Humans generally cause mild respiratory infections, but rarely fatal infections. Diarrhea in cattle and pigs, and respiratory diseases in chickens. Among coronaviruses, coronaviruses that host humans are divided into the classifications in Table 1 below (Centers for Disease Control and Prevention, 2020). Among the four genera, alpha and beta infect humans and animals, and gamma and delta are reported to infect only animals.
속(genus)genus 사람-코로나바이러스person-coronavirus 사람 외 감염 코로나바이러스non-human coronavirus
알파 코로나바이러스alpha coronavirus 229, NL63229, NL63 돼지 유행성 설사 바이러스(porcine epidemic diarrhea virus; PEDV), (돼지)전염성 위장염 바이러스 (transmissible gastroenteritis virus; TGEV), 개코로나바이러스(canine coronavirus; CCoV), 고양이 코로나바이러스 (feline coronavirus;FCoV), Miniopterus bat(박쥐) coronavirus1, Miniopterus bat(박쥐) coronavirus HKU8, Rhinolophus bat(박쥐) coronavirus HKU2, Scotophilus bat(박쥐) coronavirus 512porcine epidemic diarrhea virus (PEDV), (porcine) transmissible gastroenteritis virus (TGEV), canine coronavirus (CCoV), feline coronavirus (FCoV), Miniopterus bat ( bat) coronavirus1, Miniopterus bat coronavirus HKU8, Rhinolophus bat coronavirus HKU2, Scotophilus bat coronavirus 512
베타 코로나바이러스beta coronavirus OC43, HKU1, SARS-CoV, SARS-CoV2, MERS-CoVOC43, HKU1, SARS-CoV, SARS-CoV2, MERS-CoV 돼지 혈구 응집성뇌척수염 바이러스(porcine hemagglutinating encephalomyelitis virus; PHEV), 우코로나바이러스(bovine coronavirus; BCoV), 말코로나바이러스(equine coronavirus; EqCoV), 쥐코로나바이러스(murine coronavirus; MuCoV), Tylonycteris bat(박쥐) coronavirus HKU4, Pipistrellus bat(박쥐) coronavirus HKU5, Rousettus bat(박쥐) coronavirus HKU9porcine hemagglutinating encephalomyelitis virus (PHEV), bovine coronavirus (BCoV), equine coronavirus (EqCoV), murine coronavirus (MuCoV), Tylonycteris bat coronavirus HKU4, Pipistrellus bat (bat) coronavirus HKU5, Rousettus bat (bat) coronavirus HKU9
감마 코로나바이러스gamma coronavirus -- 새코로나바이러스(Avian coronavirus), 흰색 돌고래(Beluga whale)-코로나바이러스 SW1Avian coronavirus, Beluga whale - coronavirus SW1
델타 코로나바이러스delta coronavirus -- 제주직박구리(Bulbul)-코로나바이러스 HKU11, 개똥지빠귀(Thrush)-코로나바이러스 HKU12, 킨바라(Munia)-코로나바이러스 HKU13Bulbul-coronavirus HKU11, Thrush-coronavirus HKU12, Kinbara (Munia)-coronavirus HKU13
특히, 현재 사람에 감염력이 있는 코로나바이러스로는 하기 표 2의 7종이 존재하며, 감기를 일으키는 유형(229E, OC43, NL63, HKU1)과 중증 폐렴을 일으키는 유형(SARS-CoV, SARS-CoV2, MERS-CoV)으로 나뉜다. In particular, there are currently 7 types of coronaviruses infecting humans in Table 2 below, and types that cause colds (229E, OC43, NL63, HKU1) and types that cause severe pneumonia (SARS-CoV, SARS-CoV2, MERS) -CoV).
바이러스명Virus name 속(Genus)Genus 숙주(host)host 증상Symptom
HCoV-229EHCoV-229E AlphaAlpha HumanHuman 가벼운 호흡기 증상mild respiratory symptoms
HCoV-NL63HCoV-NL63 AlphaAlpha HumanHuman 가벼운 호흡기 증상mild respiratory symptoms
SARS-CoVSARS-CoV BetaBeta HumanHuman 심각한 호흡기 증상severe respiratory symptoms
MERS-CoVMERS-CoV BetaBeta HumanHuman 심각한 호흡기 증상severe respiratory symptoms
HCoV-OC43HCoV-OC43 BetaBeta HumanHuman 가벼운 호흡기 증상mild respiratory symptoms
HCoV-HKU1HCoV-HKU1 BetaBeta HumanHuman 폐렴 증상Pneumonia symptoms
Sars-CoV-2Sars-CoV-2 BetaBeta HumanHuman 가벼운 호흡기 증상 심한 경우 호흡곤란 유발Mild respiratory symptoms Severe cases can cause shortness of breath
본 발명에서 상기 "베타 코로나바이러스(Beta coronavirus)"는 코로나바이러스아과의 네 속의 코로나바이러스 중 하나로 인수공통 감염증에 해당한다. 베타 코로나바이러스의 예로는 중증 급성 호흡기 증후군 바이러스(Severe Acute Respiratory Syndrome virus; SARS; SARS-CoV), 중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; Sars-CoV-2), 중동 호흡기 증후군 바이러스(Middle East Respiratory Syndrome virus; MERS; MERS-CoV), 인간 코로나바이러스 OC43(HCoV-OC43) 또는 인간 코로나바이러스 HKU1(HCoV-HKU1) 등이 존재하는 것으로 알려져 있다.In the present invention, the "beta coronavirus" corresponds to a zoonotic infection as one of the four genus coronaviruses of the subfamily Coronavirus. Examples of beta coronaviruses include Severe Acute Respiratory Syndrome virus (SARS; SARS-CoV), Severe Acute Respiratory Syndrome virus-2 (Sars-CoV-2), Middle East Respiratory Syndrome virus (SARS-CoV). Middle East Respiratory Syndrome virus (MERS; MERS-CoV), human coronavirus OC43 (HCoV-OC43), or human coronavirus HKU1 (HCoV-HKU1) are known to exist.
본 발명에서 상기 "중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; SARS-CoV-2)"는 코로나비리대 패밀리에 속하는 외피로 둘러싸인, 양성-극성 외가닥 RNA 베타 코로나바이러스에 해당한다. 역사적으로 인간을 감염시키는 코로나바이러스는 중증 공통의 감기 바이러스로, hCoV-OC43, HKU 및 229E5 등을 포함한다. SARS-CoV-2 분리체의 서열을 분석하면, 30-kb 게놈은 14개의 오픈 리딩 프레임(open-reading frames; ORFs)을 코딩하는 것으로 알려져 있고, 바이러스 게놈의 3’말단에서 13개의 ORF는 9개의 예측되는 서브-게놈 RNA로부터 발현되며, 이들은 4개의 구조 단백질인, 스파이크(spike; S), 외피(envelope; E), 막(membrane; M) 및 뉴클레오캡시드(nucleocapsid; N)와, 9개의 추정적 부가 요소로부터 발현된다. 여기서, 상기 뉴클레오캡시드 단백질은 N1, N2 및 N3 절편을 포함한다.In the present invention, the "Severe Acute Respiratory Syndrome virus-2 (SARS-CoV-2)" is an enveloped, positive-polar single-stranded RNA beta coronavirus belonging to the Coronaviridae family. . The coronaviruses that historically infect humans are severe common cold viruses, including hCoV-OC43, HKU and 229E5. Sequence analysis of the SARS-CoV-2 isolate showed that the 30-kb genome is known to encode 14 open-reading frames (ORFs), and 13 ORFs at the 3' end of the viral genome are 9 Expressed from canine predicted sub-genomic RNAs, these are four structural proteins, spike (S), envelope (E), membrane (M) and nucleocapsid (N), 9 It is expressed from putative additional elements of the dog. Here, the nucleocapsid protein includes N1, N2 and N3 fragments.
본 발명에서, 상기 코로나바이러스는 자연적으로 또는 인공적으로 돌연변이가 발생한 변이체를 포함한다. In the present invention, the coronavirus includes naturally or artificially mutated variants.
본 발명에서 상기 코로나바이러스에 의한 감염 질환은 코로나바이러스성 장염, 코로나바이러스성 설사, 중증 급성 호흡기 증후군(severe acute respiratory syndrome coronavirus; SARS), 중동 호흡기 증후군(Middle East respiratory syndrome; MERS), 또는 이들의 조합일 수 있으나, 상기 코로나바이러스 감염에 의해 유발될 수 있는 질환이라면 제한없이 포함될 수 있다.In the present invention, the infectious disease caused by the coronavirus is coronavirus enteritis, coronavirus diarrhea, severe acute respiratory syndrome coronavirus (SARS), Middle East respiratory syndrome (MERS), or their It may be a combination, but if it is a disease that can be caused by the coronavirus infection, it may be included without limitation.
본 발명에서 상기 "개체"란 바이러스 감염 증상이 있거나 의심되어, 바이러스 활성을 억제하는 등으로 바이러스 감염 또는 상기 감염에 기인하여 유발된 질환을 개선 또는 치료가 필요한 대상체로, 상기 바이러스에 이미 감염되었거나 감염될 수 있는 인간을 포함한 모든 동물을 의미한다. In the present invention, the "individual" means a subject who has or is suspected of having a virus infection, and needs improvement or treatment for virus infection or a disease caused by the infection by suppressing virus activity, etc., which is already infected or infected with the virus It means any animal, including humans, who can become
본 발명의 조성물은 약학적 조성물, 식품 조성물, 식품 첨가제 조성물, 사료 조성물 또는 사료 첨가제 조성물의 용도로 사용될 수 있으나, 특별히 제한되지는 않는다. The composition of the present invention may be used as a pharmaceutical composition, a food composition, a food additive composition, a feed composition, or a feed additive composition, but is not particularly limited.
본 발명에서 "치료" 및 "개선"은 본 발명의 조성물의 투여로 바이러스의 감염 또는 증식을 억제하여 바이러스 감염증을 호전 또는 이롭게 변경되는 모든 행위를 의미한다.In the present invention, "treatment" and "improvement" refer to any action that improves or beneficially changes viral infection by inhibiting virus infection or proliferation by administering the composition of the present invention.
본 발명에 있어서, 상기 폴리포스페이트 또는 약학적 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다. In the present invention, the polyphosphate or pharmaceutical composition may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition may be characterized in that it is for humans. .
본 발명의 약학적 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 본 발명의 약학적 조성물은 약제적으로 허용 가능한 담체를 포함할 수 있다. 약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 약학적 조성물의 제형은 상술한 바와 같은 약학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다.The pharmaceutical composition of the present invention is not limited thereto, but each can be formulated in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods. can The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc., for oral administration, and in the case of injections, buffers, preservatives, pain-freezing agents A topical agent, solubilizer, isotonic agent, stabilizer, etc. may be mixed and used, and in the case of topical administration, a base, excipient, lubricant, preservative, etc. may be used. The dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have. In addition, it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.Meanwhile, examples of suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used. In addition, fillers, anti-agglomeration agents, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be further included.
본 발명에 따른 화합물 또는 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥 내, 근육 내, 동맥 내, 골수 내, 경막 내, 심장 내, 경피, 피하, 복강 내, 비강 내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다. The route of administration of the compound or pharmaceutical composition according to the present invention is, but not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal , topical, sublingual or rectal. Oral or parenteral administration is preferred.
본 발명에서, "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.As used herein, "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.
본 발명의 화합물 또는 약학적 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여 시간, 투여 경로, 배출율, 약물 배합 및 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학적 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물 형태, 투여 경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 50mg/kg 또는 0.001 내지 50mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 의약 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형될 수 있다.The compound or pharmaceutical composition of the present invention depends on several factors including the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be treated. The dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, degree of disease, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and 0.0001 to 50 mg/day per day kg or 0.001 to 50 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
본 발명에서 식품 조성물은 각종 식품류, 예를 들어, 음료, 껌, 차, 비타민 복합제, 분말, 과립, 정제, 캡슐, 과자, 떡, 빵 등의 형태로 제조될 수 있다. 또한 상기 식품 조성물의 제조에 필요한 식품 첨가제 조성물로도 이용될 수 있다.In the present invention, the food composition may be prepared in the form of various foods, for example, beverages, gum, tea, vitamin complexes, powders, granules, tablets, capsules, confectionery, rice cakes, bread, and the like. In addition, it may be used as a food additive composition necessary for the preparation of the food composition.
본 발명에서 유효 성분으로 포함되는 상기 폴리포스페이트가 식품 조성물에 포함될 때 그 양은 전체 중량의 0.1 내지 50%의 비율로 첨가할 수 있다. 여기서, 상기 식품 조성물이 음료 형태로 제조되는 경우 지시된 비율로 상기 식품 조성물을 함유하는 것 외에 특별한 제한점은 없으며 통상의 음료와 같이 여러가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 즉, 천연 탄수화물로서 포도당 등의 모노사카라이드, 과당 등의 디사카라이드, 슈크로스 등의 및 폴리사카라이드, 덱스트린, 시클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜 등을 포함할 수 있다. 상기 향미제로서는 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진등) 및 합성 향미제(사카린, 아스파르탐 등) 등을 들 수 있다.When the polyphosphate included as an active ingredient in the present invention is included in the food composition, the amount may be added in a proportion of 0.1 to 50% of the total weight. Here, when the food composition is prepared in the form of a beverage, there is no particular limitation other than containing the food composition in the indicated ratio, and it may contain various flavoring agents or natural carbohydrates as additional ingredients, like a conventional beverage. That is, as natural carbohydrates, monosaccharides such as glucose, disaccharides such as fructose, and polysaccharides such as sucrose, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol are included. can do. Examples of the flavoring agent include natural flavoring agents (taumartin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).
그 외 본 발명의 식품 조성물 또는 식품 조성물 첨가제는 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다.In addition, the food composition or food composition additive of the present invention includes various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and flavoring agents such as natural flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 식품 조성물 100 중량부 당 0.1 내지 약 50 중량부의 범위에서 선택되는 것이 일반적이다.These components may be used independently or in combination. The proportion of these additives is not so important, but is generally selected in the range of 0.1 to about 50 parts by weight per 100 parts by weight of the food composition of the present invention.
본 발명의 상기 폴리포스페이트가 사료 조성물 또는 사료 첨가제 조성물에 함유되어 이용될 경우, 상기 조성물은 20 내지 90% 고농축액이거나 분말 또는 과립형태로 제조될 수 있다. 상기 사료 첨가제는 구연산, 후말산, 아디픽산, 젖산, 사과산 등의 유기산이나 인산나트륨, 인산칼륨, 산성 피로인산염 등의 인산염이나, 폴리페놀, 카테킨, 알파-토코페롤, 로즈마리 추출물, 비타민 C, 녹차 추출물, 감초 추출물, 키토산, 탄닌산, 피틴산 등의 천연 항산화제 중 어느 하나 또는 하나 이상을 추가로 포함할 수 있다. When the polyphosphate of the present invention is used in a feed composition or feed additive composition, the composition may be 20 to 90% highly concentrated or may be prepared in powder or granular form. The feed additives include organic acids such as citric acid, humic acid, adipic acid, lactic acid, and malic acid, phosphates such as sodium phosphate, potassium phosphate, and acid pyrophosphate, polyphenols, catechins, alpha-tocopherol, rosemary extract, vitamin C, green tea extract , licorice extract, chitosan, tannic acid, any one or more of natural antioxidants such as phytic acid may be further included.
본 발명에서, 상기 폴리포스페이트가 사료로 이용될 경우, 상기 조성물은 통상의 사료 형태로 제제화될 수 있으며, 통상의 사료 성분을 함께 포함할 수 있다. 상기 사료 첨가제 및 사료는 곡물, 예를 들면 분쇄 또는 파쇄된 밀, 귀리, 보리, 옥수수 및 쌀; 식물성 단백질 사료, 예를 들면 평지, 콩 및 해바라기를 주성분으로 하는 사료; 동물성 단백질 사료, 예를 들면 혈분, 육분, 골분 및 생선분; 당분 및 유제품, 예를 들면 각종 분유 및 유장 분말로 이루어지는 건조 성분 등을 더 포함할 수 있으며, 이외에도 영양 보충제, 소화 및 흡수 향상제, 성장 촉진제 등을 더 포함할 수 있다. In the present invention, when the polyphosphate is used as a feed, the composition may be formulated in a conventional feed form, and may include common feed ingredients together. The feed additive and feed include grains such as milled or crushed wheat, oats, barley, corn and rice; plant protein feeds, such as feeds based on rape, soybean and sunflower; animal protein feeds such as blood meal, meat meal, bone meal and fish meal; Sugar and dairy products, for example, may further include dry ingredients made of various powdered milk and whey powder, and may further include nutritional supplements, digestion and absorption enhancers, growth promoters, and the like.
본 발명에서, 상기 폴리포스페이트가 상기 사료 첨가제로 사용될 경우에는 동물에게 단독으로 투여하거나 식용 담체 중에서 다른 사료 첨가제와 조합하여 투여할 수도 있다. 또한, 상기 사료 첨가제는 탑 드레싱으로서 또는 이들을 동물 사료에 직접 혼합하거나 또는 사료와 별도의 경구 제형으로 용이하게 동물에게 투여할 수 있다. 상기 사료 첨가제를 동물 사료와 별도로 투여할 경우, 당해 기술분야에 잘 알려진 바와 같이 약제학적으로 허용 가능한 식용 담체와 조합하여, 즉시 방출 또는 서방성 제형으로 제조할 수 있다. 이러한 식용 담체는 고체 또는 액체, 예를 들어 옥수수 전분, 락토오스, 수크로오스, 콩 플레이크, 땅콩유, 올리브유, 참깨유 및 프로필렌글리콜일 수 있다. 고체 담체가 사용될 경우, 사료 첨가제는 정제, 캡슐제, 산제, 트로키제 또는 함당정제 또는 미분산성 형태의 탑 드레싱일 수 있다. 액체 담체가 사용될 경우, 사료 첨가제는 젤라틴 연질 캡슐제, 또는 시럽제나 현탁액, 에멀젼제, 또는 용액제의 제형일 수 있다. 상기 사료는 동물의 식이 욕구를 충족시키는데 통상적으로 사용되는 임의의 단백질-함유 유기 곡분을 포함할 수 있다. 이러한 단백질-함유 곡분은 통상적으로 옥수수, 콩 곡분, 또는 옥수수/콩 곡분 믹스로 구성되어 있다. 또한 사료 조성물 또는 사료 첨가제 조성물은 예를 들어 보존제, 안정화제, 습윤제 또는 유화제, 용액 촉진제 등을 함유할 수 있다. 또한 사료 첨가제 조성물은 침지, 분무 또는 혼합하여 동물의 사료에 첨가하여 이용될 수 있다.In the present invention, when the polyphosphate is used as the feed additive, it may be administered to an animal alone or in combination with other feed additives in an edible carrier. In addition, the feed additives can be easily administered to the animal as a top dressing, directly mixing them into the animal feed, or in an oral formulation separate from the feed. When the feed additive is administered separately from the animal feed, it may be combined with a pharmaceutically acceptable edible carrier as is well known in the art to prepare an immediate release or sustained release formulation. Such edible carriers may be solid or liquid, for example corn starch, lactose, sucrose, soy flakes, peanut oil, olive oil, sesame oil and propylene glycol. When a solid carrier is used, the feed additive may be a tablet, capsule, powder, troche or sugar-containing tablet or top dressing in microdispersed form. When a liquid carrier is used, the feed additive may be in the form of a gelatin soft capsule, or a syrup or suspension, emulsion, or solution. The feed may include any protein-containing organic flour commonly used to meet the dietary needs of animals. Such protein-containing flour typically consists of corn, soy flour, or corn/soy flour mix. In addition, the feed composition or feed additive composition may contain, for example, a preservative, a stabilizer, a wetting or emulsifying agent, a solution accelerator, and the like. In addition, the feed additive composition may be used by immersion, spraying, or mixing to add to animal feed.
본 발명에서 제공하는 조성물은 코로나바이러스 억제 활성을 가져, 코로나바이러스에 의한 감염 또는 상기 감염에 의한 질환을 효과적으로 개선 또는 치료할 수 있다.The composition provided in the present invention has a coronavirus inhibitory activity, and can effectively improve or treat an infection caused by a coronavirus or a disease caused by the infection.
도 1은 준비예 1에서 본 발명의 일실시예에 따른 폴리포스페이트의 화학식을 나타낸 것이다.1 shows the chemical formula of the polyphosphate according to an embodiment of the present invention in Preparation Example 1.
도 2는 준비예 2에서 건강한 사람의 비강으로부터 수득한 일차 세포를 현미경으로 확대하여 촬영한 사진을 나타낸 것이다. Figure 2 shows a photograph taken by magnifying the primary cells obtained from the nasal cavity of a healthy person in Preparation Example 2 under a microscope.
도 3은 실험예 1에서 폴리포스페이트의 처리시 독성을 나타내는 농도를 측정한 결과를 그래프로 나타낸 것이다.3 is a graph showing the results of measuring the concentration indicating toxicity during the treatment of polyphosphate in Experimental Example 1.
도 4는 실험예 2에서 폴리포스페이트의 처리 농도 별 코로나바이러스의 감염 억제 효과를 그래프로 나타낸 것이다.4 is a graph showing the effect of inhibiting the infection of the coronavirus according to the treatment concentration of the polyphosphate in Experimental Example 2.
도 5는 실험예 3에서 단위체 120의 폴리포스페이트를 처리한 경우 코로나바이러스의 억제 효과를 그래프로 나타낸 것이다.5 is a graph showing the inhibitory effect of coronavirus in the case of treatment with the polyphosphate of the unit 120 in Experimental Example 3.
도 6은 실험예 4에서 단위체 8의 폴리포스페이트를 처리한 경우 코로나바이러스의 억제 효과를 그래프로 나타낸 것이다.6 is a graph showing the inhibitory effect of coronavirus when treated with the polyphosphate of the unit 8 in Experimental Example 4.
도 7은 실험예 5에서 폴리포스페이트 단위체에 따른 N1, N2 및 N3 유전자의 억제 능력을 비교한 결과를 그래프로 나타낸 것이다. 7 is a graph showing the results of comparing the inhibitory ability of the N1, N2 and N3 genes according to the polyphosphate unit in Experimental Example 5.
도 8은 실험예 5에서 폴리포스페이트의 ACE2, Cov2-N1, 외피 단백질 유전자, RdRp, 스파이크 유전자, 서브 게놈 N 및 서브 게놈 S 전사체 억제 능력을 그래프로 나타낸 것이다.8 is a graph showing the ability of polyphosphate to inhibit ACE2, Cov2-N1, envelope protein gene, RdRp, spike gene, sub-genomic N, and sub-genomic S transcripts in Experimental Example 5;
도 9는 실험예 5에서 폴리포스페이트의 ACE2 및 N 단백질 억제 능력을 면역 블로팅 분석(Immunoblotting analyses)을 통해 확인한 것이다.9 shows the ACE2 and N protein inhibitory ability of the polyphosphate in Experimental Example 5 was confirmed through immunoblotting analysis.
도 10은 실험예 5에서 폴리포스페이트의 ACE2 외피 단백질 및 N 단백질 억제 능력을 면역 형광 분석(immunofluorescence; IF)을 통해 확인한 것이다.FIG. 10 shows the ability of polyphosphate to inhibit ACE2 envelope protein and N protein in Experimental Example 5 through immunofluorescence (IF).
도 11은 실험예 5에서 폴리포스페이트의 ACE2 외피 단백질 및 N 단백질 억제 능력을 면역 형광 분석(immunofluorescence; IF) 및 정량을 통해 확인한 것이다.11 is a graph showing the ability of polyphosphate to inhibit ACE2 envelope protein and N protein in Experimental Example 5 through immunofluorescence (IF) and quantitation.
도 12는 실험예 5에서 감염된 베로 세포에 폴리포스페이트를 처리한 경우 N1, N2 및 N3 유전자의 억제 능력을 비교한 결과를 그래프로 나타낸 것이다. Figure 12 is a graph showing the results of comparing the inhibitory ability of the N1, N2 and N3 genes when the polyphosphate treatment in Vero cells infected in Experimental Example 5.
도 13은 실험예 5에서 감염된 베로 세포에 폴리포스페이트를 처리한 경우 sgM, sgE, sgN 및 sgS 억제 능력을 그래프로 나타낸 것이다.13 is a graph showing sgM, sgE, sgN and sgS inhibitory ability when polyphosphate is treated in Vero cells infected in Experimental Example 5;
도 14는 실험예 5에서 폴리포스페이트의 RdRP 억제 효과를 면역 형광 분석(immunofluorescence; IF)을 통해 확인한 것이다.14 shows the RdRP inhibitory effect of polyphosphate in Experimental Example 5 was confirmed through immunofluorescence (IF).
도 15는 실험예 6에서 감염된 일차 세포에 폴리포스페이트를 처리한 경우 N1, N2 및 N3 유전자의 억제 능력을 비교한 결과를 그래프로 나타낸 것이다. 15 is a graph showing the results of comparing the inhibitory ability of the N1, N2 and N3 genes when the primary cells infected in Experimental Example 6 were treated with polyphosphate.
도 16은 실험예 6에서 감염된 일차 세포에 폴리포스페이트를 처리한 경우 ACE2, Cov2-N1, RdRp, 스파이크 유전자 및 서브 게놈 N 전사체 억제 능력을 그래프로 나타낸 것이다.16 is a graph showing the ability to suppress ACE2, Cov2-N1, RdRp, Spike gene and sub-genomic N transcript when polyphosphate is treated in the primary cells infected in Experimental Example 6.
도 17은 실험예 6에서 감염된 일차 세포에 폴리포스페이트를 처리한 경우 ACE2 및 N 단백질 억제 능력을 면역 블로팅 분석(Immunoblotting analyses)을 통해 확인한 것이다.FIG. 17 shows the ACE2 and N protein inhibitory ability when treated with polyphosphate in the primary cells infected in Experimental Example 6 through immunoblotting analysis.
도 18은 실험예 6에서 감염된 일차 세포에 폴리포스페이트를 처리한 경우 사이토카인 억제 효과를 나타낸 것을 그래프로 나타낸 것이다.18 is a graph showing the cytokine inhibitory effect when polyphosphate is treated in the primary cells infected in Experimental Example 6.
본 발명의 일 목적은 코로나바이러스에 의한 감염 또는 상기 감염에 의해 유발된 다양한 질환을 개선 또는 치료할 수 있는 다양한 용도의 조성물을 제공하는 것이다.One object of the present invention is to provide a composition for various uses that can improve or treat infection by coronavirus or various diseases caused by the infection.
이하, 본 발명을 하기의 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다. Hereinafter, the present invention will be described in detail by the following examples. However, the following examples are only illustrative of the present invention, and the content of the present invention is not limited by the following examples.
실시예 Example
[준비예 1] 폴리포스페이트 합성[Preparation Example 1] Polyphosphate synthesis
선형 폴리포스페이트를 인산나트륨 단위체(NaH2PO4≥9.0%; Sigma Aldrich)를 700 ℃에서 1시간 동안 전기로(HQ-DMF3; Coretech, Korea)에서 중합시켰다. 이어서, 용융 된 폴리포스페이트 나트륨을 구리판에 부어 급속 냉각시키켜 분쇄하였다. 상기 과정은 하기 화학식 1로 나타낼 수 있다. 그 결과 도 1의 화학식과 같은 폴리포스페이트를 합성하였다.Linear polyphosphate was polymerized with sodium phosphate units (NaH 2 PO 4 ≥9.0%; Sigma Aldrich) at 700° C. for 1 hour in an electric furnace (HQ-DMF3; Coretech, Korea). Then, molten sodium polyphosphate was poured into a copper plate and rapidly cooled to pulverize. The process can be represented by the following formula (1). As a result, polyphosphates as shown in the chemical formula of FIG. 1 were synthesized.
[화학식 1][Formula 1]
nNaH2PO4 = (NaPO3)n + nH2OnNaH 2 PO 4 = (NaPO 3 ) n + nH 2 O
얻어진 중합체는 Graham의 염으로 알려져 있으며, 선형, 고리형 및 분지형의 3 가지 혼합 분자 구조의 폴리포스페이트(PolyP)를 함유하고 있다. 분지형 폴리포스페이트는 매우 불안정하고, 물에 용해될 때, 이들 폴리포스페이트의 분지점은 pH에 상관없이, 심지어 실온에서도 가수 분해된다. 대조적으로, 선형 폴리포스페이트 및 고리형 폴리포스페이트(cyclo PolyP)는 중성 pH 및 실온에서 매우 느리게 가수 분해된다. 상온에서 pH 7의 선형 폴리포스페이트의 P-O-P 결합에 대한 가수분해 반감기는 몇 년에 달한다. 합성된 폴리포스페이트는 일반적으로 매우 소량의 고리형 폴리포스페이트를 함유할 수 있으나, 고리형 폴리포스페이트는 주로 짧은 사슬 길이를 가져, 본 실시예에서는 합성되지 않았다.The resulting polymer, known as Graham's salt, contains polyphosphate (PolyP) of three mixed molecular structures: linear, cyclic and branched. Branched polyphosphates are very unstable, and when dissolved in water, the branching point of these polyphosphates is hydrolyzed regardless of pH, even at room temperature. In contrast, linear polyphosphates and cyclic polyphosphates (cyclo PolyP) hydrolyze very slowly at neutral pH and room temperature. The hydrolysis half-life for P-O-P bonds of linear polyphosphates at pH 7 at room temperature reaches several years. Synthesized polyphosphates may generally contain very small amounts of cyclic polyphosphates, but cyclic polyphosphates mainly have short chain lengths, so they were not synthesized in this example.
또한 얻어진 중합체는 광범위한 사슬 길이를 가져 분별 침전을 수행하였다. 소듐 폴리포스페이트 분말을 증류수(1:10 w/v)에 용해시키고, pH를 7로 조정하고 25℃에서 12시간 동안 방치하였다. 이어서, 폴리포스페이트 침전을 위하여 아세톤을 용액 추가하였다. 침전된 폴리포스페이트를 4200rpm에서 5분 동안 원심 분리를 통하여 나누었다. 상기 분획 침전을 25회 반복하고, 수득된 폴리포스페이트 분획을 48시간 동안 건조시켰다.In addition, the obtained polymers had a wide range of chain lengths to perform fractional precipitation. Sodium polyphosphate powder was dissolved in distilled water (1:10 w/v), the pH was adjusted to 7, and left at 25° C. for 12 hours. Then, acetone was added to the solution for polyphosphate precipitation. The precipitated polyphosphate was partitioned by centrifugation at 4200 rpm for 5 minutes. The fractional precipitation was repeated 25 times, and the obtained polyphosphate fraction was dried for 48 hours.
상기 폴리포스페이트는 HPLC 시스템(LC-20AD; Shimadzu, Japan) 및 다중 각도 광 산란 검출기(miniDawn Treos II; Wyatt Technology, USA)에 의해 분별되었다. 상기 HPLC 시스템은 겔 투과 크로마토그래피(PL aquagel-OH; 7.5 Х 50 mm; 8 μm; Agilent Technology, USA) 가드 칼럼(PL aquagel-OH Mixed-M; 7.5 Х 300 mm; 8 μm; Agilent Technology, USA)을 포함하고, 주입된 폴리포스페이트 샘플의 농도는 25 mg/mL이며, 주입 부피는 50μL이다. 칼럼의 온도는 30℃로 유지되었다. 상기 과정에 의해 분리된 폴리포스페이트의 사슬 길이(n)를 하기 화학식 2에 따라 결정하였다.The polyphosphate was fractionated by HPLC system (LC-20AD; Shimadzu, Japan) and multi-angle light scattering detector (miniDawn Treos II; Wyatt Technology, USA). The HPLC system was gel permeation chromatography (PL aquagel-OH; 7.5 Х 50 mm; 8 μm; Agilent Technology, USA) guard column (PL aquagel-OH Mixed-M; 7.5 Х 300 mm; 8 μm; Agilent Technology, USA). ), the concentration of the injected polyphosphate sample is 25 mg/mL, and the injection volume is 50 μL. The temperature of the column was maintained at 30°C. The chain length (n) of the polyphosphate separated by the above process was determined according to the following formula (2).
[화학식 2][Formula 2]
Mn(평균 몰 질량 수) = Nan+2PnO3n+1 Mn (average molar mass number) = Na n+2 P n O 3n+1
이어서, Astra 소프트웨어, 버전 6.1(Wyatt Technology, USA)을 사용하여, 다 분산 지수(중량 평균 몰 질량/평균 몰 질량 수; Mw/Mn)를 통해 각 분획의 사슬 길이의 범위를 수득 하였다.Then, using Astra software, version 6.1 (Wyatt Technology, USA), the range of chain lengths of each fraction was obtained via the polydispersity index (weight average molar mass/average molar mass number; Mw/Mn).
[준비예 2] 세포의 준비[Preparation Example 2] Preparation of cells
이하의 실험을 위하여, 3 명의 건강한 사람의 비강 브러싱을 통하여 인간 일차 세포(Primary cell)를 수득하였고, 상기 세포를 40배로 관찰한 결과를 도 2와 같이 나타내었다.For the following experiments, human primary cells were obtained through nasal brushing of 3 healthy people, and the results of observing the cells 40 times are shown in FIG. 2 .
[준비예 3] 유전자 증폭을 위한 프라이머 준비[Preparation Example 3] Primer preparation for gene amplification
유전자 증폭을 위하여, 타겟 유전자 별로 사용된 프라이머는 하기 표 3과 같다.For gene amplification, the primers used for each target gene are shown in Table 3 below.
타겟 유전자target gene 프라이머 종류Primer type 프라이머 서열primer sequence 서열번호SEQ ID NO:
ACE2ACE2 포워드 프라이머forward primer GAAATTCCCAAAGACCAGTGGAGAAATTCCCAAAGACCAGTGGA 서열번호 1SEQ ID NO: 1
ACE2ACE2 리버스 프라이머reverse primer CCCCAACTATCTCTCTCGCTTCATCCCCAACTATCTCTCTCGCTTCAT 서열번호 2SEQ ID NO: 2
RdRpRdRp 포워드 프라이머forward primer GTGAAATGGTCATGTGTGGCGGGTGAAATGGTCATGTGTGGCGG 서열번호 3SEQ ID NO: 3
RdRpRdRp 리버스 프라이머reverse primer CAAATGTTAAAAACACTATTAGCATACAAATGTTAAAAACACTATTAGCATA 서열번호 4SEQ ID NO: 4
N1N1 포워드 프라이머forward primer GACCCCAAAATCAGCGAAATGACCCCAAAATCAGCGAAAT 서열번호 5SEQ ID NO: 5
N1N1 리버스 프라이머reverse primer TCTGGTTACTGCCAGTTGAATCTGTCTGGTTACTGCCAGTTGAATCTG 서열번호 6SEQ ID NO: 6
스파이크spike 포워드 프라이머forward primer ATTGCCACTAGTCTCTAGTATTGCCACTAGTCTCTAGT 서열번호 7SEQ ID NO: 7
스파이크spike 리버스 프라이머reverse primer AGGATCTGAAAACTTTGTCAAGGATCTGAAAACTTTGTCA 서열번호 8SEQ ID NO: 8
외피coat 포워드 프라이머forward primer ACAGGTACGTTAATAGTTAATAGCGTACAGGTACGTTAATAGTTAATAGCGT 서열번호 9SEQ ID NO: 9
외피coat 리버스 프라이머reverse primer ATATTGCAGCAGTACGCACACAATATTGCAGCAGTACGCACACA 서열번호 10SEQ ID NO: 10
sgsg 포워드 프라이머forward primer CAAACCAACCAACTTTCGATCTCTTGTACAAACCAACCAACTTTCGATCTCTTGTA 서열번호 11SEQ ID NO: 11
sgSsgS 리버스 프라이머reverse primer TGAAAGAATTAGTGTATGCATGAAAGAATTAGTGTATGCA 서열번호 12SEQ ID NO: 12
sgEsgE 리버스 프라이머reverse primer AGAAGTACGCTATTAACTATTAGAAGTACGCTATTAACTATT 서열번호 13SEQ ID NO: 13
sgMsgM 리버스 프라이머reverse primer TATTACTAGGTTCCATTGTTCAATATTACTAGGTTCCATTGTTCAA 서열번호 14SEQ ID NO: 14
sgNsgN 리버스 프라이머reverse primer TCTGGTTACTGCCAGTTGAATCTCTGGTTACTGCCAGTTGAATC 서열번호 15SEQ ID NO: 15
Interleukin-6Interleukin-6 포워드 프라이머forward primer GCCACTCACCTCTTCAGAACGCCACTCACCTCTTCAGAAC 서열번호 16SEQ ID NO: 16
Interleukin-6Interleukin-6 리버스 프라이머reverse primer AGCATCCATCTTTTTCAGCCAGCATCCATCTTTTTCAGCC 서열번호 17SEQ ID NO: 17
Interleukin-10Interleukin-10 포워드 프라이머forward primer CCTGCCTAACATGCTTCGAGACCTGCCTAACATGCTTCGAGA 서열번호 18SEQ ID NO: 18
Interleukin-10Interleukin-10 리버스 프라이머reverse primer TGTCCAGCTGATCCTTCATTTGTGTCCAGCTGATCCTTCATTTG 서열번호 19SEQ ID NO: 19
Interleukin-12Interleukin-12 포워드 프라이머forward primer TGATGGCCCTGTGCCTTAGTTGATGGCCCTGTGCCTTAGT 서열번호 20SEQ ID NO: 20
Interleukin-12Interleukin-12 리버스 프라이머reverse primer GGATCCATCAGAAGCTTTGCAGGATCCATCAGAAGCTTTGCA 서열번호 21SEQ ID NO: 21
Interferon- gammaInterferon-gamma 포워드 프라이머forward primer AGGCATTTTGAAGAATTGGAAAGAAGGCATTTTGAAGAATTGGAAAGA 서열번호 22SEQ ID NO: 22
Interferon- gammaInterferon-gamma 리버스 프라이머reverse primer AGTAAAAGGAGACAATTTGGCTCTAGTAAAAGGAGACAATTTGGCTCT 서열번호 23SEQ ID NO:23
Tumour necrosis factor- alphaTumor necrosis factor- alpha 포워드 프라이머forward primer TCTCTCTAATCAGCCCTCTGGTCTCTCTAATCAGCCCTCTGG 서열번호 24SEQ ID NO: 24
Tumour necrosis factor- alphaTumor necrosis factor- alpha 리버스 프라이머reverse primer GCTACATGGGCTACAGGCGCTACATGGGCTACAGGC 서열번호 25SEQ ID NO: 25
[실험예 1] 폴리포스페이트의 독성 확인[Experimental Example 1] Confirmation of toxicity of polyphosphate
폴리포스페이트의 농도에 따른 세포 독성 효과를 알아보기 위하여, 세포 지수 접근법(Cell Index approach)을 통한 실시간 세포 증식 분석(Real-Time cell proliferation analyses)을 실시하였다. 인간 일차 세포 8,000개를 도말한 후, 4.16uM, 12.5uM, 37.5uM 및 112uM의 상이한 농도의 단위체 120의 폴리포스페이트(인산염 단위체가 120인 폴리포스페이트, P120 PolyP)로 각각 처리하였고, 음성 대조군으로는 비히클(Vehicle) 처리된 세포를 사용하였다. 이후 36 분 동안 2 분마다 임피던스를 측정하여, 세포 지수를 도출하였고, 그 결과를 도 3과 같이 나타내었다.In order to examine the cytotoxic effect according to the concentration of polyphosphate, real-time cell proliferation analyzes using a Cell Index approach were performed. After plating 8,000 human primary cells, they were treated with different concentrations of 4.16 uM, 12.5 uM, 37.5 uM and 112 uM of monomer 120 polyphosphate (polyphosphate with 120 phosphate monomer, P120 PolyP), respectively, and as a negative control, Vehicle treated cells were used. Thereafter, impedance was measured every 2 minutes for 36 minutes to derive a cell index, and the results are shown in FIG. 3 .
그 결과, 도 3에서 보는 바와 같이, 112uM 농도의 폴리포스페이트로 처리된 세포에서는 세포 독성 효과를 나타낸 것을 확인할 수 있었다.As a result, as shown in FIG. 3 , it was confirmed that cells treated with polyphosphate at a concentration of 112 uM exhibited a cytotoxic effect.
[실험예 2] 폴리포스페이트의 코로나바이러스 억제 효과 확인(1)[Experimental Example 2] Confirmation of the coronavirus inhibitory effect of polyphosphate (1)
폴리포스페이트의 항 바이러스 효과를 알아보기 위하여, 한국인 환자로부터 얻은 중증급성호흡기증후군 코로나바이러스 2(Sars-CoV-2)로 감염된 베로 E6 세포를 상이한 농도(9.375 내지 37.5μM 범위)의 단위체 120의 폴리포스페이트(P120 PolyP)로 처리하여 그 결과를 도 4와 같이 나타내었다.To investigate the antiviral effect of polyphosphate, Vero E6 cells infected with Severe Acute Respiratory Syndrome Coronavirus 2 (Sars-CoV-2) obtained from Korean patients were treated with different concentrations (ranging from 9.375 to 37.5 μM) of monomer 120 polyphosphate. (P120 PolyP) and the results are shown as in FIG. 4 .
도 4와 같이, 낮은 농도의 폴리포스페이트로 처리된 경우를 포함하여 단위체 120의 폴리포스페이트(P120 PolyP)로 처리된 베로 E6 세포에서 N 및 RdRp 및 E 유전자에 대한 증가된 주기 임계값(cycle threshold; Ct)을 보였는 바, 코로나바이러스에 대하여 뛰어난 항 바이러스 효과를 확인할 수 있었다.As shown in FIG. 4 , increased cycle thresholds for N and RdRp and E genes in Vero E6 cells treated with polyphosphate of monomer 120 (P120 PolyP), including when treated with a low concentration of polyphosphate; Ct), it was possible to confirm the excellent antiviral effect against the coronavirus.
[실험예 3] 폴리포스페이트의 코로나바이러스 억제 효과 확인(2)[Experimental Example 3] Confirmation of the coronavirus inhibitory effect of polyphosphate (2)
멸균 처리된 유리 커버슬라이드가 들어 있는 6웰 플레이트에 베로 세포를 분주한 후, 커버슬라이드에 단층으로 세포가 성장하도록 배양하였다. 배양한 세포에 Sars-CoV-2를 0.01 MOI(multiplicity of infection)로 처리하여 2시간 동안 감염시켰다. 이후, 신선한 배지를 첨가하여 24시간 동안 배양하였다. 배양한 세포의 플레이트들에 단위체 120의 폴리포스페이트(P120 PolyP)를 하기 표 4에 나타낸 농도로 처리한 뒤 24 내지 48시간 동안 배양하여, 세척액으로 세포 용해를 진행하였다. 이후 RT-PCR 어쎄이를 진행하여, Sars-CoV-2의 농도를 측정하여 그 결과를 도 5에 나타내었다. 이때 양측검정 T-test를 사용하여 통계적으로 처리하였다.After dispensing Vero cells in a 6-well plate containing a sterilized glass coverslide, the cells were cultured to grow as a monolayer on the coverslip. Cultured cells were treated with Sars-CoV-2 at 0.01 MOI (multiplicity of infection) and infected for 2 hours. Thereafter, fresh medium was added and cultured for 24 hours. Plates of cultured cells were treated with polyphosphate of the unit 120 (P120 PolyP) at the concentrations shown in Table 4 below, and then cultured for 24 to 48 hours, and cell lysis was performed with a washing solution. Thereafter, the RT-PCR assay was performed to measure the concentration of Sars-CoV-2, and the results are shown in FIG. 5 . At this time, statistical treatment was performed using a two-sided T-test.
구분division 폴리포스페이트 인산염 단위체 수Number of polyphosphate phosphate units 농도density
1One Poly P(120-mer)Poly P (120-mer) 37.5uM37.5uM
22 Poly P(120-mer)Poly P (120-mer) 18.75uM18.75uM
33 Poly P(120-mer)Poly P (120-mer) 9.375uM9.375uM
44 대조군(무처리군)Control group (untreated group) --
도 5에서 보는 바와 같이, 대조군에 비하여 폴리포스페이트를 처리한 군에서 Sars-CoV-2의 증식 억제 효과가 현저히 뛰어난 것을 확인할 수 있었다. 상세하게는, 단위체 120의 폴리포스페이트(P120 PolyP)를 37.5uM, 18.75uM, 9.375uM의 농도로 처리한 경우 Sars-CoV-2 유전자의 Ct값은 25 이상으로, Sars-CoV-2 유전자의 Ct값이 20인 대조군에 비하여 코로나바이러스 억제 효과가 현저히 뛰어남을 확인할 수 있었다(p<0.000003).As shown in FIG. 5 , it was confirmed that the anti-proliferative effect of Sars-CoV-2 was significantly superior in the polyphosphate-treated group compared to the control group. Specifically, when the polyphosphate (P120 PolyP) of the unit 120 was treated at concentrations of 37.5uM, 18.75uM, and 9.375uM, the Ct value of the Sars-CoV-2 gene was 25 or more, and the Ct of the Sars-CoV-2 gene. It was confirmed that the corona virus inhibitory effect was significantly superior to that of the control group with a value of 20 (p<0.000003).
[실험예 4] 폴리포스페이트의 코로나바이러스 억제 효과 확인(3)[Experimental Example 4] Confirmation of coronavirus inhibitory effect of polyphosphate (3)
실험예 3과 마찬가지로, 멸균 처리된 유리 커버 슬라이드가 들어 있는 6웰 플레이트에 베로 세포를 분주한 후, 상기 커버 슬라이드에 단층으로 세포가 성장하도록 배양하였다. 배양한 세포에 Sars-CoV-2를 0.01 MOI(multiplicity of infection)로 처리하여 2시간 동안 감염시켰다. 이후, 신선한 배지를 첨가하여 24시간 동안 배양하였다. 배양한 세포의 플레이트들에 단위체 8의 폴리포스페이트(인산염 단위체가 8인 포스페이트, P8 PolyP)를 하기 표 5에 나타낸 농도로 처리한 뒤 24 내지 48시간 동안 배양하여, 세척액으로 세포 용해를 진행하였다. 이후 RT-PCR 어쎄이를 진행하여, Sars-CoV-2의 농도를 측정하여 그 결과를 도 6에 나타내었다. 이때 양측검정 T-test를 사용하여 통계적으로 처리하였다.As in Experimental Example 3, after dispensing Vero cells in a 6-well plate containing a sterilized glass cover slide, the cells were cultured to grow as a monolayer on the cover slide. Cultured cells were treated with Sars-CoV-2 at 0.01 MOI (multiplicity of infection) and infected for 2 hours. Thereafter, fresh medium was added and cultured for 24 hours. Plates of the cultured cells were treated with polyphosphate of unit 8 (phosphate with phosphate unit of 8, P8 PolyP) at the concentrations shown in Table 5 below, and then cultured for 24 to 48 hours, and cell lysis was performed with a washing solution. Thereafter, the RT-PCR assay was performed to measure the concentration of Sars-CoV-2, and the results are shown in FIG. 6 . At this time, statistical treatment was performed using a two-sided T-test.
구분division 폴리포스페이트 인산염 단위체 수Number of polyphosphate phosphate units 농도density
55 Poly P(8-mer)Poly P (8-mer) 300uM 300uM
66 대조군(무처리군)Control group (untreated group) --
도 6에서 보는 바와 같이, 단위체 8의 폴리포스페이트(P8 PolyP)를 300uM의 농도로 처리한 경우 Sars-CoV-2 유전자의 Ct값은 25 이상으로, Sars-CoV-2 유전자의 Ct값이 20인 대조군에 비하여 코로나바이러스 억제 효과가 현저히 뛰어남을 확인할 수 있었다(p<0.00000219).As shown in FIG. 6 , when the polyphosphate of unit 8 (P8 PolyP) was treated at a concentration of 300 μM, the Ct value of the Sars-CoV-2 gene was 25 or more, and the Ct value of the Sars-CoV-2 gene was 20. It was confirmed that the corona virus inhibitory effect was significantly better than that of the control group (p<0.00000219).
[실험예 5] 폴리포스페이트의 코로나 바이러스 억제 효과 확인(4)[Experimental Example 5] Confirmation of corona virus inhibitory effect of polyphosphate (4)
5.1. RT-실시간 PCR 분석5.1. RT-real-time PCR analysis
이하, 폴리포스페이트(PolyP)의 코로나바이러스 억제 효과 확인을 위해, RT-실시간 PCR 분석을 실시하였다. 구체적으로는 BSL3 실험실에서 425,000개의 베로(VERO) 세포를 24개의 다중 웰에 각각 85,000개씩 도포하였다. 다음으로, Sars-CoV-2 양성 환자로부터 채취한 냉동 면봉으로부터 얻은 Sars-CoV-2를 세포에 감염시켰다(0.09 MOI). 감염되지 않은 세포는 감염의 음성 대조군으로 사용하였다. 감염 24시간 후 단위체 120의 폴리포스페이트(P120 PolyP), 단위체 126의 폴리포스페이트(인산염 단위체가 126인 폴리포스페이트, P126 PolyP) 및 단위체 189의 폴리포스페이트(인산염 단위체가 189인 폴리포스페이트, P189 PolyP)을 각 37.5μM씩 처리하고, 비히클 처리된 세포를 음성 대조군으로 사용하였다. 처리 24시간 후(즉, 감염 48시간 후), 베로(VERO) 세포를 용해시키고 RNA를 추출하였다. 이후 "CLONIT quanty COVID-19" [Ref. RT-25](IVD 승인) 키트 및 BioRad CFX96 기기를 사용하여 25℃, 2분; 50℃, 15분; 95℃, 2분; 95℃, 3초; 55℃, 30초의 조건으로 45회 사이클을 수행하였다. RT-실시간 PCR 분석을 통하여 타겟(N1, N2, N3)의 Cq값은 내부 대조군(Delta Ct)으로 정규화 하여 표 6과 같이 나타내었다. 또한 비히클 처리된 대조군에 대한 상기 정량값의 배수를 계산하여 그 결과를 도 7에 나타내었다.Hereinafter, to confirm the coronavirus inhibitory effect of polyphosphate (PolyP), RT-real-time PCR analysis was performed. Specifically, in the BSL3 laboratory, 425,000 VERO cells were applied to 24 multi-wells, each 85,000 each. Next, cells were infected with Sars-CoV-2 obtained from frozen swabs taken from Sars-CoV-2 positive patients (MOI 0.09). Uninfected cells were used as negative controls for infection. 24 hours after infection, polyphosphate of unit 120 (P120 PolyP), polyphosphate of unit 126 (polyphosphate with phosphate unit 126, P126 PolyP) and polyphosphate of unit 189 (polyphosphate with phosphate unit 189, P189 PolyP) Each treated with 37.5 μM, vehicle-treated cells were used as negative controls. After 24 hours of treatment (ie, 48 hours after infection), VERO cells were lysed and RNA was extracted. Since "CLONIT quantitative COVID-19" [Ref. RT-25] (IVD approved) kit and BioRad CFX96 instrument at 25° C., 2 min; 50° C., 15 minutes; 95°C, 2 min; 95°C, 3 seconds; 45 cycles were performed under the conditions of 55° C. and 30 seconds. Through RT-real-time PCR analysis, the Cq values of the targets (N1, N2, N3) were normalized to the internal control (Delta Ct) and shown in Table 6. In addition, the multiples of the quantitative value for the vehicle-treated control group were calculated and the results are shown in FIG. 7 .
도 7과 표 6에서 보는 바와 같이, Sars-CoV-2에 감염된 베로 세포에 단위체 120의 폴리포스페이트(P120 PolyP), 단위체 126의 폴리포스페이트(P126 PolyP) 및 단위체 189의 폴리포스페이트(P189 PolyP)을 처리한 결과, 대조군에 비하여 N1, N2 및 N3 유전자 절편의 발현 수준이 현저히 감소하였는 바, 폴리포스페이트의 코로나바이러스 억제 효과가 현저히 뛰어남을 확인할 수 있었다.7 and Table 6, polyphosphate of unit 120 (P120 PolyP), polyphosphate of unit 126 (P126 PolyP), and polyphosphate of unit 189 (P189 PolyP) in Vero cells infected with Sars-CoV-2 As a result of the treatment, the expression levels of the N1, N2 and N3 gene segments were significantly reduced compared to the control group, and it was confirmed that the coronavirus inhibitory effect of the polyphosphate was remarkably excellent.
시료sample 타겟target Cq(평균)Cq (average)
비감염된 Vero 세포Uninfected Vero cells N1N1 25.7249972425.72499724
N2N2 25.6886650225.68866502
N3N3 25.6385761525.63857615
INT CTRINT CTR 23.8103934423.81039344
비히클 CTR 처리된 Sars-CoV-2 감염 Vero 세포Vehicle CTR-treated Sars-CoV-2 Infected Vero Cells N1N1 9.8272834889.827283488
N2N2 5.7281777845.728177784
N3N3 5.8003942625.800394262
INT CTRINT CTR 18.7245719118.72457191
P120 PolyP 처리된 Sars-CoV-2 감염 Vero 세포Sars-CoV-2 Infected Vero Cells Treated with P120 PolyP N1N1 11.5599942911.55999429
N2N2 6.4395982316.439598231
N3N3 7.7467058927.746705892
INT CTRINT CTR 14.4183194714.41831947
P126 PolyP 처리된 Sars-CoV-2 감염 Vero 세포P126 PolyP-treated Sars-CoV-2 Infected Vero Cells N1N1 15.1121752415.11217524
N2N2 15.1040779115.10407791
N3N3 15.3480534615.34805346
INT CTRINT CTR 19.2362246419.23622464
P189 PolyP 처리된 Sars-CoV-2 감염 Vero 세포P189 PolyP-treated Sars-CoV-2 Infected Vero Cells N1N1 11.2884569211.28845692
N2N2 6.9240569596.924056959
N3N3 6.642574326.64257432
INT CTRINT CTR 14.7340014714.73400147
5.2. RT-실시간 PCR 분석5.2. RT-real-time PCR analysis
폴리포스페이트(PolyP)의 코로나바이러스 억제 효과 확인을 위해, 마찬가지 방법으로 RT-실시간 PCR 분석을 실시하였다. 감염된 베로(VERO) 세포의 안지오텐신 전환효소 2(Angiotensin-converting enzyme 2; ACE2), Cov2-N1, 외피 단백질 유전자, RdRp, 스파이크 유전자, 서브 게놈 N 및 서브 게놈 S 전사체의 발현량을 RT-실시간 PCR 분석을 실시하여 정량값을 도출하였고, 비히클 처리된 대조군에 대한 상기 정량값의 배수를 계산하여 도 8과 같이 나타내었으며, 이때 그래프 상 왼쪽부터 ACE2, Cov2-N1, 외피 단백질 유전자, RdRp, 스파이크 유전자, 서브 게놈 N 및 서브 게놈 S 전사체의 결과 값에 해당한다.To confirm the coronavirus inhibitory effect of polyphosphate (PolyP), RT-real-time PCR analysis was performed in the same manner. RT-real time expression levels of angiotensin-converting enzyme 2 (ACE2), Cov2-N1, envelope protein gene, RdRp, spike gene, sub-genome N and sub-genomic S transcripts of infected VERO cells PCR analysis was performed to derive a quantitative value, and the multiple of the quantitative value for the vehicle-treated control was calculated and shown as shown in FIG. 8, in which case, from the left on the graph, ACE2, Cov2-N1, envelope protein gene, RdRp, spike Corresponds to the resulting values of the gene, subgenomic N, and subgenomic S transcripts.
도 8에서와 같이, Sars-CoV-2에 감염된 베로(VERO) 세포에 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우 ACE2, Cov2-N1, 외피 단백질 유전자, RdRp, 스파이크 유전자, 서브 게놈 N(sgN) 및 서브 게놈 S(sgS) 전사체의 Ct값이 증가하였는 바, 폴리포스페이트의 코로나바이러스 억제 효과가 현저히 뛰어남을 확인하였다.As shown in FIG. 8, when VERO cells infected with Sars-CoV-2 were treated with polyphosphate of unit 120 (P120 PolyP), ACE2, Cov2-N1, envelope protein gene, RdRp, spike gene, sub-genome N As the Ct values of (sgN) and subgenomic S (sgS) transcripts were increased, it was confirmed that the coronavirus inhibitory effect of polyphosphate was remarkably excellent.
5.3. 면역 블로팅 분석5.3. immunoblotting assay
폴리포스페이트(PolyP)의 코로나바이러스 억제 효과 확인을 위해, 면역 블로팅 분석(Immunoblotting analyses)을 실시하였다. 구체적으로는 0.09 MOI Sars-CoV-2에 감염된 베로(VERO) 세포에 단위체 120의 폴리포스페이트(P120 PolyP) 37.5uM을 처리하였다. 대조군으로는 비히클 처리된 세포를 음성 대조군으로 사용하였으며, 감염되지 않은 세포는 감염의 음성 대조군으로 사용하였다. 이후 폴리포스페이트를 처리한 세포들과 대조군에서 ACE2 및 N 단백질의 발현 정도를 항체로 확인하여 도 9에서 나타내었다.To confirm the coronavirus inhibitory effect of polyphosphate (PolyP), immunoblotting analyzes were performed. Specifically, VERO cells infected with 0.09 MOI Sars-CoV-2 were treated with 37.5 uM of the monomer 120 polyphosphate (P120 PolyP). As a control, vehicle-treated cells were used as a negative control, and uninfected cells were used as a negative control of infection. Thereafter, the expression level of ACE2 and N protein in the polyphosphate-treated cells and the control group was confirmed with an antibody, and is shown in FIG. 9 .
도 9에서와 같이, 단위체 120의 폴리포스페이트(P120 PolyP)를 Sars-CoV-2에 감염된 베로(VERO) 세포에 처리한 경우, 비히클 처리된 대조군에 비하여 ACE2 및 Cov2-N 단백질 발현이 감소되었는 바, 폴리포스페이트의 코로나바이러스 억제 효과가 현저히 뛰어남을 확인하였다.As shown in FIG. 9, when the polyphosphate of the monomer 120 (P120 PolyP) was treated with Sars-CoV-2 infected Vero cells, ACE2 and Cov2-N protein expression was reduced compared to the vehicle-treated control group. , It was confirmed that the corona virus inhibitory effect of polyphosphate is remarkably excellent.
5.4. 면역 형광 분석5.4. Immunofluorescence assay
폴리포스페이트(PolyP)의 코로나바이러스 억제 효과 확인을 위해, 면역 형광 분석(immunofluorescence; IF)을 실시하였다. 0.09 MOI Sars-CoV-2에 감염된 베로 세포에 단위체 120의 폴리포스페이트(P120 PolyP) 37.5uM을 처리하였다. 음성 대조군으로는 감염후 비히클 처리된 세포를 사용하였다. 이후 면역 형광 분석(immunofluorescence; IF)을 수행하기 위하여 항-ACE2, 항-Cov2-외피, 항-Cov2-스파이크, 항-Cov2-N 및 RdRp를 사용하여 배율 63x. 라이카 TCS SP8 MP 다 광자 현미경으로 관찰한 결과를 도 10에 나타내었고, 이를 MANTRA 정량적 병리학 워크 스테이션으로 정량하여 도 11에 나타내었다.To confirm the coronavirus inhibitory effect of polyphosphate (PolyP), immunofluorescence analysis (IF) was performed. Vero cells infected with 0.09 MOI Sars-CoV-2 were treated with 37.5 uM of monomer 120 polyphosphate (P120 PolyP). As a negative control, vehicle-treated cells after infection were used. Then use anti-ACE2, anti-Cov2-envelope, anti-Cov2-spike, anti-Cov2-N and RdRp to perform immunofluorescence (IF) magnification 63x. The results of observation with the Leica TCS SP8 MP multi-photon microscope are shown in FIG. 10, which was quantified by the MANTRA quantitative pathology workstation and shown in FIG.
도 10 및 11에서와 같이, 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우 대조군에 비하여 ACE2 외피 단백질 및 N 단백질에 대하여 형광세기가 감소하였는 바, 폴리포스페이트의 코로나바이러스 억제 효과가 현저히 뛰어남을 확인하였다.As shown in FIGS. 10 and 11, when the polyphosphate of the unit 120 (P120 PolyP) was treated, the fluorescence intensity was decreased for the ACE2 envelope protein and the N protein compared to the control. Confirmed.
5.5. RT-실시간 PCR 분석5.5. RT-real-time PCR analysis
폴리포스페이트(PolyP)의 코로나바이러스 억제 효과 확인을 위해, RT-실시간 PCR 분석을 실시하였다. 구체적으로는 베로(VERO) E6 세포를 도포한 뒤, Sars-CoV-2 양성 환자로부터 채취한 냉동 면봉으로부터 얻은 Sars-CoV-2를 세포에 감염시켰다(0.1 MOI). 감염되지 않은 세포는 감염의 음성 대조군으로 사용하였다. 감염 24시간 후(즉, 감염 60시간 후) 단위체 120의 폴리포스페이트(P120 PolyP)을 37.5μM 처리하고, 비히클 처리된 세포를 음성 대조군으로 사용하였다. 처리 36시간 후, 베로(VERO) 세포를 용해시키고 RNA를 추출하였다. 이후 "CLONIT quanty COVID-19" [Ref. RT-25](IVD 승인) 키트를 사용하여 RT-실시간 PCR 분석을 시행하였고, 타겟(N1, N2, N3)의 Ct값을 도출하여 도 12에 나타내었다. To confirm the coronavirus inhibitory effect of polyphosphate (PolyP), RT-real-time PCR analysis was performed. Specifically, after applying VERO E6 cells, the cells were infected with Sars-CoV-2 obtained from a frozen swab taken from a Sars-CoV-2 positive patient (0.1 MOI). Uninfected cells were used as negative controls for infection. 24 hours after infection (ie, 60 hours after infection), 37.5 μM of polyphosphate of monomer 120 (P120 PolyP) was treated, and vehicle-treated cells were used as a negative control. After 36 hours of treatment, VERO cells were lysed and RNA was extracted. Since "CLONIT quantitative COVID-19" [Ref. RT-25] (IVD approved) kit was used for RT-real-time PCR analysis, and the Ct values of the targets (N1, N2, N3) were derived and shown in FIG. 12 .
도 12에서 보는 바와 같이, 단위체 120의 폴리포스페이트(P120 PolyP)로 전처리된 베로 세포에 Sars-Cov2를 감염시킨 결과, 대조군에 비하여 N1, N2 및 N3 유전자 절편의 Ct값이 높아 발현 수준이 현저히 감소한 것을 확인하였는 바, 폴리포스페이트의 코로나바이러스 억제 효과가 현저히 뛰어남을 확인하였다. As shown in FIG. 12, as a result of infecting Sars-Cov2 in Vero cells pretreated with the polyphosphate of the unit 120 (P120 PolyP), the Ct values of the N1, N2 and N3 gene segments were higher than that of the control group, so that the expression level was significantly reduced. As a result, it was confirmed that the corona virus inhibitory effect of polyphosphate was remarkably excellent.
5.6. RT-실시간 PCR 분석5.6. RT-real-time PCR analysis
폴리포스페이트(PolyP)의 코로나바이러스 억제 효과 확인을 위해, RT-실시간 PCR 분석을 실시하였다. 베로(VERO) 세포에 Sars-CoV-2를 감염시켰고(0.1 MOI), 감염되지 않은 세포는 감염의 음성 대조군으로 사용하였다. 24시간 후 상기 감염된 베로 세포에 단위체 120의 폴리포스페이트(P120 PolyP) 37.5μM를 처리하고, 비히클 처리된 세포를 음성 대조군으로 사용하였다. 처리 36시간 후(즉, 감염 50시간 후), 베로(VERO) 세포를 용해시키고 RNA를 추출하였다. 추출된 RNA에 대하여 RT-실시간 PCR 분석을 통하여 서브 게놈 전사체인 sgM, sgE, sgN 및 sgS의 정량값을 계산 후, 비히클 처리된 대조군에 대한 상기 정량값의 배수를 계산하여 그 결과를 도 13과 같이 나타내었다. To confirm the coronavirus inhibitory effect of polyphosphate (PolyP), RT-real-time PCR analysis was performed. VERO cells were infected with Sars-CoV-2 (0.1 MOI), and uninfected cells were used as negative controls for infection. After 24 hours, the infected Vero cells were treated with 37.5 μM of polyphosphate 120 (P120 PolyP), and the vehicle-treated cells were used as a negative control. After 36 hours of treatment (ie, 50 hours after infection), VERO cells were lysed and RNA was extracted. After calculating the quantitative values of sgM, sgE, sgN and sgS sub-genomic transcripts through RT-real-time PCR analysis for the extracted RNA, the multiples of the quantitative values for the vehicle-treated control group are calculated and the results are shown in FIG. 13 shown together.
도 13에서와 같이, 0.1 MOI로 감염된 베로(VERO) 세포에 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우 sgM, sgE, sgN 및 sgS의 발현량이 감소하였는 바, 폴리포스페이트의 코로나바이러스 억제 효과가 현저히 뛰어남을 확인하였다. As shown in FIG. 13, when the polyphosphate (P120 PolyP) of the unit 120 was treated in Vero cells infected with 0.1 MOI, the expression levels of sgM, sgE, sgN and sgS were reduced. As a result, the coronavirus inhibitory effect of polyphosphate was found to be significantly superior.
5.7. 면역 형광 분석5.7. Immunofluorescence assay
폴리포스페이트(PolyP)의 작용 부위 확인 및 코로나바이러스 억제 효과 확인을 위해, 면역 형광 분석(immunofluorescence; IF)을 실시하였다. 베로 세포에 RdRp를 표지하기 위하여 FLAG-RdRp 플라스미드 컨스트럭트를 형질 감염 시킨 후, 단위체 120의 폴리포스페이트(P120 PolyP) 37.5uM을 처리하였고, 비히클 처리된 세포를 음성 대조군으로 사용하였다. 이후 면역 형광 분석(immunofluorescence; IF)을 수행하기 위하여 배율 63x. 라이카 TCS SP8 MP 다 광자 현미경으로 관찰하였고, 그 결과를 도 14에 나타내었다.In order to confirm the site of action of polyphosphate (PolyP) and confirm the effect of suppressing the coronavirus, immunofluorescence analysis (IF) was performed. After transfection of the FLAG-RdRp plasmid construct to label RdRp in Vero cells, 37.5 uM of polyphosphate of unit 120 (P120 PolyP) was treated, and vehicle-treated cells were used as a negative control. Then magnification 63x to perform immunofluorescence (IF). It was observed with a Leica TCS SP8 MP multi-photon microscope, and the results are shown in FIG. 14 .
도 14에서와 같이, 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우 베로 세포에서 단위체 120의 폴리포스페이트(P120 PolyP)와 RdRp의 공동 국소화 현상이 관찰되었고, RdRp 발현이 감소하였는 바, 폴리포스페이트의 코로나바이러스 억제 효과가 현저히 뛰어남을 확인할 수 있었다. As shown in FIG. 14, when the polyphosphate of the unit 120 (P120 PolyP) was treated, a co-localization phenomenon of the polyphosphate of the unit 120 (P120 PolyP) and RdRp was observed in Vero cells, and the RdRp expression was reduced. It was confirmed that the anti-coronavirus effect of
[실험예 6] 폴리포스페이트의 코로나바이러스 억제 효과 확인(5)[Experimental Example 6] Confirmation of the coronavirus inhibitory effect of polyphosphate (5)
6.1. RT-실시간 PCR 분석6.1. RT-real-time PCR analysis
폴리포스페이트(PolyP)의 코로나바이러스 억제 효과 확인을 위해, RT-실시간 PCR 분석을 실시하였다. 구체적으로는 비강 일차 세포에 Sars-CoV-2를 0.002 MOI로 감염시켰고, 감염되지 않은 세포를 감염의 음성 대조군으로 사용하였다. 감염후 24시간 뒤에 단위체 120의 폴리포스페이트(P120 PolyP)를 37.5μM 처리하였고, 비히클 처리된 세포를 음성 대조군으로 사용하였다. 처리 36시간 후(즉, 감염 60시간 후), 일차 세포를 용해시키고 RNA를 추출하였다. 이후 "CLONIT quanty COVID-19" [Ref. RT-25](IVD 승인) 키트를 사용하여 RT-실시간 PCR 분석을 시행하였고, 타겟(N1, N2, N3)의 정량값을 도출한 후 비히클 처리된 대조군에 대한 상기 정량값의 배수를 계산하여 도 15에 나타내었다. To confirm the coronavirus inhibitory effect of polyphosphate (PolyP), RT-real-time PCR analysis was performed. Specifically, nasal primary cells were infected with Sars-CoV-2 at an MOI of 0.002, and uninfected cells were used as a negative control for infection. 24 hours after infection, the monomer 120 polyphosphate (P120 PolyP) was treated with 37.5 μM, and the vehicle-treated cells were used as a negative control. After 36 hours of treatment (ie, 60 hours after infection), primary cells were lysed and RNA was extracted. Since "CLONIT quantitative COVID-19" [Ref. RT-25] (IVD approved) kit was used to perform RT-real-time PCR analysis, and after deriving the quantitative values of the targets (N1, N2, N3), the multiples of the quantitative values for the vehicle-treated control group were calculated. 15 shows.
도 15에서 보는 바와 같이, Sars-CoV-2에 감염된 일차 세포에 단위체 120의 폴리포스페이트(P120 PolyP)을 처리한 결과, 대조군에 비하여 N1, N2 및 N3 유전자 절편의 발현 수준이 현저히 감소하였는 바, 폴리포스페이트의 코로나바이러스 억제 효과가 현저히 뛰어남을 확인할 수 있었다.As shown in FIG. 15 , as a result of treating the primary cells infected with Sars-CoV-2 with the polyphosphate of the unit 120 (P120 PolyP), the expression levels of N1, N2 and N3 gene segments were significantly reduced compared to the control group, It was confirmed that the corona virus inhibitory effect of polyphosphate was remarkably excellent.
6.2. RT-실시간 PCR 분석6.2. RT-real-time PCR analysis
폴리포스페이트(PolyP)의 코로나바이러스 억제 효과 확인을 위해, RT-실시간 PCR 분석을 실시하였다. 구체적으로는 일차 세포에 Sars-CoV-2 0.002 MOI를 감염시켰고, 감염되지 않은 세포를 감염의 음성 대조군으로 사용하였다. 감염후 24시간 뒤에 단위체 120의 폴리포스페이트(P120 PolyP)를 37.5μM 처리하였고, 비히클 처리된 세포를 음성 대조군으로 사용하였다. 처리 36시간 후(즉, 감염 60시간 후), 일차 세포를 용해시키고 RNA를 추출하였다. 이후 ACE2, Cov2-N1, RdRp, 스파이크 유전자 및 서브 게놈 N 전사체를 검출할 수 있는 키트를 사용하여 RT-실시간 PCR 분석을 시행하였고, 타겟(ACE2, Cov2-N1, RdRp, 스파이크 유전자 및 서브 게놈 N 전사체)의 정량값을 도출한 후 비히클 처리된 대조군에 대한 상기 정량값의 배수를 계산하여 도 16에 나타내었으며, 이때 그래프 상 왼쪽부터 ACE2, Cov2-N1, RdRp, 스파이크 유전자 및 서브 게놈 N 전사체의 결과 값에 해당한다. To confirm the coronavirus inhibitory effect of polyphosphate (PolyP), RT-real-time PCR analysis was performed. Specifically, primary cells were infected with Sars-CoV-2 MOI of 0.002, and uninfected cells were used as negative controls for infection. 24 hours after infection, the monomer 120 polyphosphate (P120 PolyP) was treated with 37.5 μM, and the vehicle-treated cells were used as a negative control. After 36 hours of treatment (ie, 60 hours after infection), primary cells were lysed and RNA was extracted. Then, RT-real-time PCR analysis was performed using a kit capable of detecting ACE2, Cov2-N1, RdRp, spike gene and sub-genomic N transcript, and targets (ACE2, Cov2-N1, RdRp, spike gene and sub-genome) were performed. After deriving the quantitative value of N transcript), the multiple of the quantitative value for the vehicle-treated control group was calculated and shown in FIG. 16 , and in this case, from the left on the graph, ACE2, Cov2-N1, RdRp, Spike gene and sub-genome N It corresponds to the result value of the transcriptome.
도 16에서와 같이, 감염된 일차 세포에 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우 ACE2, Cov2-N1, RdRp, 스파이크 유전자 및 서브 게놈 N(sgN) 전사체의 발현이 감소하였는 바, 폴리포스페이트의 코로나바이러스 억제 효과가 현저히 뛰어남을 확인하였다.As shown in FIG. 16, when the polyphosphate of unit 120 (P120 PolyP) was treated in the infected primary cells, the expression of ACE2, Cov2-N1, RdRp, the spike gene and the subgenomic N (sgN) transcript was reduced. It was confirmed that the phosphate inhibitory effect on the coronavirus was remarkably excellent.
6.3. 면역 블로팅 분석6.3. immunoblotting assay
폴리포스페이트(PolyP)의 처리에 따른 코로나바이러스 억제 효과를 확인하기 위하여 면역 블로팅 분석(Immunoblotting analyses)을 수행하였다. 일차 세포에 Sars-CoV-2 0.002 MOI를 감염시켰고, 감염되지 않은 세포를 감염의 음성 대조군으로 사용하였다. 감염후 24시간 뒤에 단위체 120의 폴리포스페이트(P120 PolyP)를 37.5μM 처리하였고, 비히클 처리된 세포를 음성 대조군으로 사용하였다. 이후 폴리포스페이트를 처리한 세포들과 대조군에서 ACE2 및 N 단백질의 발현 정도를 항체로 확인하여 그 결과를 도 17과 같이 나타내었다.Immunoblotting analyzes were performed to confirm the coronavirus inhibitory effect according to the treatment of polyphosphate (PolyP). Primary cells were infected with Sars-CoV-2 MOI of 0.002, and uninfected cells were used as negative controls for infection. 24 hours after infection, the monomer 120 polyphosphate (P120 PolyP) was treated with 37.5 μM, and the vehicle-treated cells were used as a negative control. Thereafter, the expression level of ACE2 and N protein in the polyphosphate-treated cells and the control group was checked with an antibody, and the results are shown in FIG. 17 .
도 17에서와 같이, 폴리포스페이트가 처리된 세포에서 ACE2 및 N 단백질의 감소를 확인하였는 바, 폴리포스페이트의 코로나바이러스 억제 효과가 현저히 뛰어남을 확인하였다.As shown in FIG. 17 , it was confirmed that the reduction of ACE2 and N protein was confirmed in the polyphosphate-treated cells, and it was confirmed that the coronavirus inhibitory effect of polyphosphate was remarkably excellent.
6.4. RT-실시간 PCR 분석6.4. RT-real-time PCR analysis
폴리포스페이트(PolyP)의 코로나바이러스 감염증에 대한 치료적 효과 확인을 위해, 염증성 사이토카인 발현량에 대하여 RT-실시간 PCR 분석을 실시하였다. 일차 세포에 Sars-CoV-2 0.002 MOI를 감염시켰고, 감염되지 않은 세포를 감염의 음성 대조군으로 사용하였다. 감염 후 24시간 뒤에 단위체 120의 폴리포스페이트(P120 PolyP)를 37.5μM 처리하였고, 비히클 처리된 세포를 음성 대조군으로 사용하였다. 처리 36시간 후(즉, 감염 60시간 후), 일차 세포를 용해시키고 RNA를 추출하였다. 추출된 RNA에 대하여 RT-실시간 PCR 분석을 시행하였고, 타겟(IFN-gamma, IL-10, IL-12, TNF-alpha 및 IL-6)의 정량값을 도출한 후 비히클 처리된 대조군에 대한 상기 정량값의 배수를 계산한 결과를 도 18에 나타내었으며, 이때 그래프 상 왼쪽부터 IFN-gamma, IL-10, IL-12, TNF-alpha 및 IL-6의 결과 값에 해당한다. To confirm the therapeutic effect of polyphosphate (PolyP) on coronavirus infection, RT-real-time PCR analysis was performed on the expression level of inflammatory cytokines. Primary cells were infected with Sars-CoV-2 MOI of 0.002, and uninfected cells were used as negative controls for infection. 24 hours after infection, the monomer 120 polyphosphate (P120 PolyP) was treated with 37.5 μM, and the vehicle-treated cells were used as a negative control. After 36 hours of treatment (ie, 60 hours after infection), primary cells were lysed and RNA was extracted. RT-real-time PCR analysis was performed on the extracted RNA, and after deriving quantitative values of the target (IFN-gamma, IL-10, IL-12, TNF-alpha and IL-6), the vehicle-treated control group was The result of calculating the multiple of the quantitative value is shown in FIG. 18 , and in this case, from the left on the graph, it corresponds to the result value of IFN-gamma, IL-10, IL-12, TNF-alpha and IL-6.
도 18에서와 같이, 감염된 일차 세포에 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우 감염되어 비히클 처리된 대조군 및 감염되지 않은 대조군에 비하여 IFN-gamma, IL-10, IL-12, TNF-alpha 및 IL-6의 발현이 감소하였는 바, 폴리포스페이트가 코로나바이러스에 의해 야기된 사이토카인 폭풍을 억제하는 효과가 뛰어남을 확인하였다.As shown in FIG. 18, when the infected primary cells were treated with the polyphosphate of the unit 120 (P120 PolyP), they were infected and compared to the vehicle-treated control group and the non-infected control group IFN-gamma, IL-10, IL-12, TNF- As the expression of alpha and IL-6 was reduced, it was confirmed that the polyphosphate had an excellent effect in inhibiting the cytokine storm caused by the coronavirus.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다. As described above in detail a specific part of the present invention, for those of ordinary skill in the art, this specific description is only a preferred embodiment, and it is clear that the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.
본 발명은 코로나바이러스 감염 또는 상기 감염에 의한 질환을 효과적으로 치료할 수 있는 다양한 용도의 조성물에 관한 것이다. The present invention relates to a composition for various uses that can effectively treat a coronavirus infection or a disease caused by the infection.

Claims (16)

  1. 폴리포스페이트(polyphosphate) 또는 이의 약학적으로 허용 가능한 염을 유효 성분으로 포함하는, 바이러스 감염 또는 감염 질환의 치료용 약학적 조성물.A pharmaceutical composition for the treatment of viral infections or infectious diseases, comprising polyphosphate or a pharmaceutically acceptable salt thereof as an active ingredient.
  2. 제 1항에 있어서,The method of claim 1,
    상기 폴리포스페이트는 인산염 단위체가 2 이상 200 이하인 것인, 약학적 조성물.The polyphosphate is a pharmaceutical composition, wherein the phosphate unit is 2 or more and 200 or less.
  3. 제 2항에 있어서,3. The method of claim 2,
    상기 폴리포스페이트는 인산염 단위체가 100 이상 200 이하인 것인, 약학적 조성물.The polyphosphate is a pharmaceutical composition, wherein the phosphate unit is 100 or more and 200 or less.
  4. 제 2항에 있어서,3. The method of claim 2,
    상기 폴리포스페이트는 인산염 단위체가 2 이상 9 이하, 100 이상 125 미만, 125 이상 130 미만 또는 180 이상 190 이하인 것인, 약학적 조성물.The polyphosphate is a pharmaceutical composition, wherein the phosphate unit is 2 or more and 9 or less, 100 or more and less than 125, 125 or more and less than 130, or 180 or more and 190 or less.
  5. 제 4항에 있어서,5. The method of claim 4,
    상기 폴리포스페이트는 인산염 단위체가 8, 120, 126 또는 189인 것인, 약학적 조성물.The polyphosphate is a phosphate unit of 8, 120, 126 or 189, the pharmaceutical composition.
  6. 제 1항에 있어서,The method of claim 1,
    상기 바이러스는 코로나바이러스(coronavirus)인, 약학적 조성물.The virus is a coronavirus (coronavirus), pharmaceutical composition.
  7. 제 6항에 있어서,7. The method of claim 6,
    상기 코로나바이러스는 인간 코로나바이러스 229E(HCoV-229E), 인간 코로나바이러스 OC43(HCoV-OC43), 인간 코로나바이러스 HKU1(HCoV-HKU1), 인간 코로나바이러스 NL63(HCoV-NL63), 중증 급성 호흡기 증후군 코로나바이러스(SARS-CoV), 중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; Sars-CoV-2), 중동 호흡기 증후군 코로나바이러스(MERS-CoV), 돼지 전염성 설사 바이러스(porcine epidemic diarrhea virus; PEDV), 전염성 위장염 바이러스(transmissible gastroenteritis virus; TGEV), 돼지 혈구 응집성뇌척수염 바이러스(porcine hemagglutinating encephalomyelitis virus; PHEV), 우 코로나바이러스(bovine coronavirus; BCoV), 말 코로나바이러스(equine coronavirus; EqCoV), 쥐 코로나바이러스(murine coronavirus; MuCoV), 개코로나바이러스(canine coronavirus; CCoV), 고양이 코로나바이러스 (feline coronavirus; FCoV), 박쥐 코로나바이러스-1(Miniopterus bat coronavirus1), 박쥐 코로나바이러스 HKU8(Miniopterus bat coronavirus HKU8), 박쥐 코로나바이러스 HKU2(Rhinolophus bat coronavirus HKU2), 박쥐 코로나바이러스 512(Scotophilus bat coronavirus 512), 박쥐 코로나바이러스 HKU4(Tylonycteris bat coronavirus HKU4), 박쥐 코로나바이러스 HKU5(Pipistrellus bat coronavirus HKU5), 박쥐 코로나바이러스 HKU9(Rousettus bat coronavirus HKU9), 새 코로나바이러스(Avian coronavirus), 흰색 돌고래 코로나바이러스 SW1(Beluga whale coronavirus SW1), 제주직박구리 코로나바이러스 HKU11(Bulbul coronavirus HKU11), 개똥지빠귀 코로나바이러스 HKU12(Thrush coronavirus HKU12) 및 킨바라 코로나바이러스 HKU13(Munia coronavirus HKU13)로 이루어진 군에서 선택된 1종 이상인, 약학적 조성물.The coronaviruses include human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), human coronavirus HKU1 (HCoV-HKU1), human coronavirus NL63 (HCoV-NL63), severe acute respiratory syndrome coronavirus (SARS-CoV), Severe Acute Respiratory Syndrome virus-2 (Sars-CoV-2), Middle East Respiratory Syndrome Coronavirus (MERS-CoV), porcine epidemic diarrhea virus; PEDV), transmissible gastroenteritis virus (TGEV), porcine hemagglutinating encephalomyelitis virus (PHEV), bovine coronavirus (BCoV), equine coronavirus (EqCoV), murine coronavirus Virus (murine coronavirus; MuCoV), canine coronavirus (CCoV), feline coronavirus (FCoV), bat coronavirus-1 (Miniopterus bat coronavirus1), bat coronavirus HKU8 (Miniopterus bat coronavirus HKU8), Rhinolophus bat coronavirus HKU2 (HKU2), Scotophilus bat coronavirus 512 (Scotophilus bat coronavirus 512), Tylonycteris bat coronavirus HKU4 (HKU4), Pipistrellus bat coronavirus HKU5 (HKU5), bat coronavirus HKU9 (Rousettus) bat coronavirus HKU9), novel coronavirus (A) vian coronavirus), Beluga whale coronavirus SW1 (SW1), Bulbul coronavirus HKU11 (HKU11), Thrush coronavirus HKU12 (HKU12), and Munia coronavirus HKU13 (HKU13) At least one selected from the group, a pharmaceutical composition.
  8. 폴리포스페이트(polyphosphate) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 바이러스 감염 또는 감염 질환의 개선용 식품 또는 식품 첨가제 조성물.A food or food additive composition for improving viral infection or infectious disease, comprising polyphosphate or a pharmaceutically acceptable salt thereof as an active ingredient.
  9. 제 8항에 있어서,9. The method of claim 8,
    상기 바이러스는 코로나바이러스(coronavirus)인, 식품 또는 식품 첨가제 조성물.The virus is a coronavirus (coronavirus), food or food additive composition.
  10. 제 9항에 있어서,10. The method of claim 9,
    상기 코로나바이러스는 인간 코로나바이러스 229E(HCoV-229E), 인간 코로나바이러스 OC43(HCoV-OC43), 인간 코로나바이러스 HKU1(HCoV-HKU1), 인간 코로나바이러스 NL63(HCoV-NL63), 중증 급성 호흡기 증후군 코로나바이러스(SARS-CoV), 중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; Sars-CoV-2), 중동 호흡기 증후군 코로나바이러스(MERS-CoV), 돼지 전염성 설사 바이러스(porcine epidemic diarrhea virus; PEDV), 전염성 위장염 바이러스(transmissible gastroenteritis virus; TGEV), 돼지 혈구 응집성뇌척수염 바이러스(porcine hemagglutinating encephalomyelitis virus; PHEV), 우 코로나바이러스(bovine coronavirus; BCoV), 말 코로나바이러스(equine coronavirus; EqCoV), 쥐 코로나바이러스(murine coronavirus; MuCoV), 개코로나바이러스(canine coronavirus; CCoV), 고양이 코로나바이러스 (feline coronavirus; FCoV), 박쥐 코로나바이러스-1(Miniopterus bat coronavirus1), 박쥐 코로나바이러스 HKU8(Miniopterus bat coronavirus HKU8), 박쥐 코로나바이러스 HKU2(Rhinolophus bat coronavirus HKU2), 박쥐 코로나바이러스 512(Scotophilus bat coronavirus 512), 박쥐 코로나바이러스 HKU4(Tylonycteris bat coronavirus HKU4), 박쥐 코로나바이러스 HKU5(Pipistrellus bat coronavirus HKU5), 박쥐 코로나바이러스 HKU9(Rousettus bat coronavirus HKU9), 새 코로나바이러스(Avian coronavirus), 흰색 돌고래 코로나바이러스 SW1(Beluga whale coronavirus SW1), 제주직박구리 코로나바이러스 HKU11(Bulbul coronavirus HKU11), 개똥지빠귀 코로나바이러스 HKU12(Thrush coronavirus HKU12) 및 킨바라 코로나바이러스 HKU13(Munia coronavirus HKU13)로 이루어진 군에서 선택된 1종 이상인, 식품 또는 식품 첨가제 조성물.The coronaviruses include human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), human coronavirus HKU1 (HCoV-HKU1), human coronavirus NL63 (HCoV-NL63), severe acute respiratory syndrome coronavirus (SARS-CoV), Severe Acute Respiratory Syndrome virus-2 (Sars-CoV-2), Middle East Respiratory Syndrome Coronavirus (MERS-CoV), porcine epidemic diarrhea virus; PEDV), transmissible gastroenteritis virus (TGEV), porcine hemagglutinating encephalomyelitis virus (PHEV), bovine coronavirus (BCoV), equine coronavirus (EqCoV), murine coronavirus Virus (murine coronavirus; MuCoV), canine coronavirus (CCoV), feline coronavirus (FCoV), bat coronavirus-1 (Miniopterus bat coronavirus1), bat coronavirus HKU8 (Miniopterus bat coronavirus HKU8), Rhinolophus bat coronavirus HKU2 (HKU2), Scotophilus bat coronavirus 512 (Scotophilus bat coronavirus 512), Tylonycteris bat coronavirus HKU4 (HKU4), Pipistrellus bat coronavirus HKU5 (HKU5), bat coronavirus HKU9 (Rousettus) bat coronavirus HKU9), novel coronavirus (A) vian coronavirus), Beluga whale coronavirus SW1 (SW1), Bulbul coronavirus HKU11 (HKU11), Thrush coronavirus HKU12 (HKU12), and Munia coronavirus HKU13 (HKU13) At least one selected from the group, food or food additive composition.
  11. 폴리포스페이트(polyphosphate) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 바이러스 감염 또는 감염 질환의 개선용 사료 또는 사료 첨가제 조성물.A feed or feed additive composition for improving viral infections or infectious diseases, comprising polyphosphate or a pharmaceutically acceptable salt thereof as an active ingredient.
  12. 제 11항에 있어서,12. The method of claim 11,
    상기 바이러스는 코로나바이러스(coronavirus)인, 사료 또는 사료 첨가제 조성물.The virus is a coronavirus (coronavirus), feed or feed additive composition.
  13. 제 12항에 있어서,13. The method of claim 12,
    상기 코로나바이러스는 인간 코로나바이러스 229E(HCoV-229E), 인간 코로나바이러스 OC43(HCoV-OC43), 인간 코로나바이러스 HKU1(HCoV-HKU1), 인간 코로나바이러스 NL63(HCoV-NL63), 중증 급성 호흡기 증후군 코로나바이러스(SARS-CoV), 중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; Sars-CoV-2), 중동 호흡기 증후군 코로나바이러스(MERS-CoV), 돼지 전염성 설사 바이러스(porcine epidemic diarrhea virus; PEDV), 전염성 위장염 바이러스(transmissible gastroenteritis virus; TGEV), 돼지 혈구 응집성뇌척수염 바이러스(porcine hemagglutinating encephalomyelitis virus; PHEV), 우 코로나바이러스(bovine coronavirus; BCoV), 말 코로나바이러스(equine coronavirus; EqCoV), 쥐 코로나바이러스(murine coronavirus; MuCoV), 개코로나바이러스(canine coronavirus; CCoV), 고양이 코로나바이러스 (feline coronavirus; FCoV), 박쥐 코로나바이러스-1(Miniopterus bat coronavirus1), 박쥐 코로나바이러스 HKU8(Miniopterus bat coronavirus HKU8), 박쥐 코로나바이러스 HKU2(Rhinolophus bat coronavirus HKU2), 박쥐 코로나바이러스 512(Scotophilus bat coronavirus 512), 박쥐 코로나바이러스 HKU4(Tylonycteris bat coronavirus HKU4), 박쥐 코로나바이러스 HKU5(Pipistrellus bat coronavirus HKU5), 박쥐 코로나바이러스 HKU9(Rousettus bat coronavirus HKU9), 새 코로나바이러스(Avian coronavirus), 흰색 돌고래 코로나바이러스 SW1(Beluga whale coronavirus SW1), 제주직박구리 코로나바이러스 HKU11(Bulbul coronavirus HKU11), 개똥지빠귀 코로나바이러스 HKU12(Thrush coronavirus HKU12) 및 킨바라 코로나바이러스 HKU13(Munia coronavirus HKU13)로 이루어진 군에서 선택된 1종 이상인, 사료 또는 사료 첨가제 조성물.The coronaviruses include human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), human coronavirus HKU1 (HCoV-HKU1), human coronavirus NL63 (HCoV-NL63), severe acute respiratory syndrome coronavirus (SARS-CoV), Severe Acute Respiratory Syndrome virus-2 (Sars-CoV-2), Middle East Respiratory Syndrome Coronavirus (MERS-CoV), porcine epidemic diarrhea virus; PEDV), transmissible gastroenteritis virus (TGEV), porcine hemagglutinating encephalomyelitis virus (PHEV), bovine coronavirus (BCoV), equine coronavirus (EqCoV), murine coronavirus Virus (murine coronavirus; MuCoV), canine coronavirus (CCoV), feline coronavirus (FCoV), bat coronavirus-1 (Miniopterus bat coronavirus1), bat coronavirus HKU8 (Miniopterus bat coronavirus HKU8), Rhinolophus bat coronavirus HKU2 (HKU2), Scotophilus bat coronavirus 512 (Scotophilus bat coronavirus 512), Tylonycteris bat coronavirus HKU4 (HKU4), Pipistrellus bat coronavirus HKU5 (HKU5), bat coronavirus HKU9 (Rousettus) bat coronavirus HKU9), novel coronavirus (A) vian coronavirus), Beluga whale coronavirus SW1 (SW1), Bulbul coronavirus HKU11 (HKU11), Thrush coronavirus HKU12 (HKU12), and Munia coronavirus HKU13 (HKU13) At least one selected from the group, feed or feed additive composition.
  14. 개체에게 폴리포스페이트; 또는 이의 약학적으로 허용 가능한 염을 투여하는 단계를 포함하는, 바이러스 감염 또는 감염 질환의 치료 방법.polyphosphate to the subject; Or a method of treating a viral infection or infectious disease, comprising administering a pharmaceutically acceptable salt thereof.
  15. 제 14항에 있어서,15. The method of claim 14,
    상기 바이러스는 코로나바이러스(coronavirus)인, 방법.wherein the virus is a coronavirus.
  16. 제 15항에 있어서,16. The method of claim 15,
    상기 코로나바이러스는 인간 코로나바이러스 229E(HCoV-229E), 인간 코로나바이러스 OC43(HCoV-OC43), 인간 코로나바이러스 HKU1(HCoV-HKU1), 인간 코로나바이러스 NL63(HCoV-NL63), 중증 급성 호흡기 증후군 코로나바이러스(SARS-CoV), 중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; Sars-CoV-2), 중동 호흡기 증후군 코로나바이러스(MERS-CoV), 돼지 전염성 설사 바이러스(porcine epidemic diarrhea virus; PEDV), 전염성 위장염 바이러스(transmissible gastroenteritis virus; TGEV), 돼지 혈구 응집성뇌척수염 바이러스(porcine hemagglutinating encephalomyelitis virus; PHEV), 우 코로나바이러스(bovine coronavirus; BCoV), 말 코로나바이러스(equine coronavirus; EqCoV), 쥐 코로나바이러스(murine coronavirus; MuCoV), 개코로나바이러스(canine coronavirus; CCoV), 고양이 코로나바이러스 (feline coronavirus; FCoV), 박쥐 코로나바이러스-1(Miniopterus bat coronavirus1), 박쥐 코로나바이러스 HKU8(Miniopterus bat coronavirus HKU8), 박쥐 코로나바이러스 HKU2(Rhinolophus bat coronavirus HKU2), 박쥐 코로나바이러스 512(Scotophilus bat coronavirus 512), 박쥐 코로나바이러스 HKU4(Tylonycteris bat coronavirus HKU4), 박쥐 코로나바이러스 HKU5(Pipistrellus bat coronavirus HKU5), 박쥐 코로나바이러스 HKU9(Rousettus bat coronavirus HKU9), 새 코로나바이러스(Avian coronavirus), 흰색 돌고래 코로나바이러스 SW1(Beluga whale coronavirus SW1), 제주직박구리 코로나바이러스 HKU11(Bulbul coronavirus HKU11), 개똥지빠귀 코로나바이러스 HKU12(Thrush coronavirus HKU12) 및 킨바라 코로나바이러스 HKU13(Munia coronavirus HKU13)로 이루어진 군에서 선택된 1종 이상인, 방법.The coronaviruses include human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), human coronavirus HKU1 (HCoV-HKU1), human coronavirus NL63 (HCoV-NL63), severe acute respiratory syndrome coronavirus (SARS-CoV), Severe Acute Respiratory Syndrome virus-2 (Sars-CoV-2), Middle East Respiratory Syndrome Coronavirus (MERS-CoV), porcine epidemic diarrhea virus; PEDV), transmissible gastroenteritis virus (TGEV), porcine hemagglutinating encephalomyelitis virus (PHEV), bovine coronavirus (BCoV), equine coronavirus (EqCoV), murine coronavirus Virus (murine coronavirus; MuCoV), canine coronavirus (CCoV), feline coronavirus (FCoV), bat coronavirus-1 (Miniopterus bat coronavirus1), bat coronavirus HKU8 (Miniopterus bat coronavirus HKU8), Rhinolophus bat coronavirus HKU2 (HKU2), Scotophilus bat coronavirus 512 (Scotophilus bat coronavirus 512), Tylonycteris bat coronavirus HKU4 (HKU4), Pipistrellus bat coronavirus HKU5 (HKU5), bat coronavirus HKU9 (Rousettus) bat coronavirus HKU9), novel coronavirus (A) vian coronavirus), Beluga whale coronavirus SW1 (SW1), Bulbul coronavirus HKU11 (HKU11), Thrush coronavirus HKU12 (HKU12), and Munia coronavirus HKU13 (HKU13) At least one selected from the group, the method.
PCT/KR2020/018981 2020-04-24 2020-12-23 Composition for treating coronavirus infection or infectious disease, comprising polyphosphates WO2021215616A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2020-0050184 2020-04-24
KR20200050184 2020-04-24
KR10-2020-0123355 2020-09-23
KR1020200123355A KR20210132567A (en) 2020-04-24 2020-09-23 Composition for treating coronavirus infection or disease casued by coronavirus infection comprising polyphosphate

Publications (2)

Publication Number Publication Date
WO2021215616A1 true WO2021215616A1 (en) 2021-10-28
WO2021215616A8 WO2021215616A8 (en) 2022-10-20

Family

ID=78269415

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/018981 WO2021215616A1 (en) 2020-04-24 2020-12-23 Composition for treating coronavirus infection or infectious disease, comprising polyphosphates

Country Status (2)

Country Link
KR (1) KR20220134489A (en)
WO (1) WO2021215616A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4320597A1 (en) * 1993-06-22 1995-01-05 Heinz C Prof Dr Dr Schroeder Use of polyphosphates for antiviral therapy and as immunomodulators
KR20000013481A (en) * 1998-08-10 2000-03-06 임용빈 Poly phosphate being used for antibacterial agent
WO2006133375A2 (en) * 2005-06-08 2006-12-14 The University Of Miami Dinucleoside polyphosphate inhibitors of reverse transcriptase
KR20090130655A (en) * 2008-06-16 2009-12-24 인제대학교 산학협력단 Complex of calcitonin-polyphosphate and process for preparing the same

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4320597A1 (en) * 1993-06-22 1995-01-05 Heinz C Prof Dr Dr Schroeder Use of polyphosphates for antiviral therapy and as immunomodulators
KR20000013481A (en) * 1998-08-10 2000-03-06 임용빈 Poly phosphate being used for antibacterial agent
WO2006133375A2 (en) * 2005-06-08 2006-12-14 The University Of Miami Dinucleoside polyphosphate inhibitors of reverse transcriptase
KR20090130655A (en) * 2008-06-16 2009-12-24 인제대학교 산학협력단 Complex of calcitonin-polyphosphate and process for preparing the same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LORENZ B, LEUCK J, KÖHL D, MÜLLER W., SCHRÖDER H. C: "Anti-HIV-1 activity of inorganic polyphosphates", JOURNAL OF ACQUIRED IMMUNE DEFICIENCY SYNDROMES AND HUMAN RETROVIROLOGY, vol. 14, no. 2, 1 February 1997 (1997-02-01), US , pages 110 - 118, XP009531387, ISSN: 1077-9450, DOI: 10.1097/00042560-199702010-00003 *
VERONICA FERRUCCI, DAE-YOUNG KONG, FATEMEH ASADZADEH, LAURA MARRONE, ROBERTO SICILIANO, PELLEGRINO CERINO, GIUSEPPINA CRISCUOLO, I: "Long-chain polyphosphates impair SARS-CoV-2 infection and replication: a route for therapy in man", BIORXIV, 18 November 2020 (2020-11-18), pages 1 - 48, XP009531423, DOI: 10.1101/2020.11.18.388413 *

Also Published As

Publication number Publication date
KR20220134489A (en) 2022-10-05
WO2021215616A8 (en) 2022-10-20

Similar Documents

Publication Publication Date Title
KR102234745B1 (en) Compounds that inhibit MERS coronavirus helicase nsP13 and uses thereof
WO2022050516A1 (en) Coronavirus therapeutic agent comprising elaeocarpus sylvestris extract as active ingredient
WO2021015437A1 (en) Composition for preventing, treating, or ameliorating viral infection disease, containing active oxygen production inhibitor and active oxygen scavenger complex as active ingredients
WO2017200192A1 (en) Feed additive composition having anti-viral activity
WO2019225953A2 (en) Composition comprising nut pine tree by-product extract and having effect of controlling helicobacter pyrori
AU2024204161A1 (en) Use of sugar cane extracts in the treatment or prevention of microbial infections and dysbiosis
WO2021215616A1 (en) Composition for treating coronavirus infection or infectious disease, comprising polyphosphates
WO2017196140A2 (en) Aquaculture functional feedstuff additive comprising lactococcus lactis bfe920 strain inducing immunomodulatory t-cell.
WO2022124800A1 (en) Antiviral composition containing fucosyllactose as active ingredient
WO2021215617A1 (en) Composition for disinfecting, or preventing infection by or infectious diseases caused by coronavirus, comprising polyphosphate
WO2022149929A1 (en) Antiviral pharmaceutical composition comprising steroid sulfatase inhibitor
WO2022080576A1 (en) Composition comprising pmca inhibitor for treatment of coronavirus infection or infectious diseases
WO2022080577A1 (en) Composition comprising pmca inhibitor for prevention of coronavirus infection or infectious diseases or for disinfection
KR20220022468A (en) Compounds for preventing or treating virus infection disease, composition comprising the same and use thereof
WO2022215827A1 (en) Sanguisorba officinalis linne extract composition inhibiting 3cl protease and rdrp activity of sars-cov-2
WO2023121362A1 (en) Antiviral composition comprising nucleoside analogues derived from nucleic acid and pharmaceutically acceptable salt thereof
WO2022146070A1 (en) Anti-coronavirus pharmaceutical composition containing hepatitis b virus-derived polypeptide
WO2021210851A1 (en) Antiviral composition comprising placenta extract
WO2021235695A1 (en) Preventive or therapeutic pharmaceutical composition for coronavirus infection comprising tetraarsenic hexoxide
WO2021206498A1 (en) Flavonoid glycoside having anti-coronavirus activity
WO2024144320A1 (en) Antiviral composition comprising nucleoside analogues derived from nucleic acid and pharmaceutically acceptable salts thereof
WO2023200064A1 (en) Composition for inhibiting influenza virus
WO2022131604A1 (en) Antiviral composition containing ramulus-mori-derived compound as active ingredient
WO2021210852A1 (en) Anti-viral composition comprising placenta-derived material
WO2024205087A1 (en) Pharmaceutical composition for preventing or treating viral infections, comprising fucoxanthin

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20932241

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20932241

Country of ref document: EP

Kind code of ref document: A1