KR102234745B1 - Compounds that inhibit MERS coronavirus helicase nsP13 and uses thereof - Google Patents

Abstract

The present invention relates to an inhibitor of MERS coronavirus helicase nsP13 activity comprising a naturally derived compound. The inhibitor of the present invention effectively inhibits the dsRNA unwinding activity and/or ATP hydrolytic activity of MERS coronavirus helicase nsP13, thereby effectively and safely preventing and treating viral diseases.

Description

Compounds that inhibit MERS coronavirus helicase nsP13 and uses thereof

The present invention relates to novel chemical inhibitors of viruses, and in particular to chemical inhibitors against MERS coronavirus helicase nsP13.

Virus means a toxic substance in Latin and means a group of infectious pathogenic particles that pass through a bacterial filter paper (0.22 ㎛). Viruses can be classified into bacteriophage, plant virus, and animal virus depending on the type of host cell, and can be classified as DNA virus or RNA virus according to the type of nucleic acid. Recently, various viral diseases such as swine flu, AI and foot-and-mouth disease have caused major social problems, and consequently, concerns about effective countermeasures for viral diseases are arousing great social interest.

Coronavirus is divided into four genus: alpha, beta, gamma, and delta, and MERS coronavirus belongs to beta coronavirus. At the beginning of the discovery, before the identity was known, it was treated as a similar virus of the SARS coronavirus, or just a novel coronavirus, belonging to the same beta coronavirus, but on May 23, 2013, the international committee on virus taxonomy adopted the official name MERS coronavirus. In the meantime, it has its own official name different from the SARS coronavirus.

Middle East Respiratory Syndrome (MERS) has not been identified as a clear source and route of infection, but it has been reported that it is highly likely to be infected through contact with camels in the Middle East and can be transmitted through close contact between people. MERS was first discovered in Saudi Arabia in 2012 and then intensively occurred in the Middle East. By May 2015, 1,167 infections occurred in 25 countries, of which 479 were reported to have died. Infections occurred mainly in the Middle East such as Saudi Arabia, the UAE, Jordan, and Qatar, but since May 2015, more than 100 infections have occurred in Korea. When infected with MERS, after an incubation period of 7 to 14 days, severe respiratory symptoms such as a high fever of 38 degrees Celsius or higher, coughing, and shortness of breath appear. Digestive symptoms such as diarrhea and constipation may be seen, and in the case of chronic diseases or immunocompromised, complications such as pneumonia and acute renal failure may accompany death. In particular, MERS is known to have a mortality rate 6 times higher than that of SARS. Antiviral drugs for the treatment of MERS coronavirus have not been developed, and treatment for symptoms is mainly performed, and in severe cases, a respirator or artificial hemodialysis may be required. The virus that causes MERS is a coronavirus, a single-stranded RNA virus with a gene of 30,119 bases. Coronaviruses belong to a population of enveloped viruses and replicate within the cytoplasm of animal host cells. When the target cell is infected, the genes of the coronavirus produce two large replication-related polymeric proteins. Subsequently, polymerized proteins are separated into several non-structural proteins (nsPs) by proteases, among which are RNA-dependent-RNA polymerases and helicases. Viral helicase is a protein essential for viral gene replication and is currently considered a potential target for antiviral drug development.

Patent Document 1. Korean Laid-Open Patent Publication No. 10-2004-0091722

The present inventors made diligent efforts to find a compound that can effectively prevent or treat a Middle East Respiratory Syndrome (MERS) viral disease for which no therapeutic agent is currently developed, without worrying about side effects. As a result, the present invention was completed by confirming that some of the various naturally-derived compounds inhibit the MERS coronavirus helicase nsP13 activity.

Accordingly, an object of the present invention is to provide a MERS coronavirus helicase nsP13 activity inhibitor comprising a compound derived from a natural product or a salt thereof.

Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of viral diseases comprising the MERS coronavirus helicase nsP13 activity inhibitor as an active ingredient.

Another object of the present invention is to provide a food composition for preventing or improving viral diseases comprising the MERS coronavirus helicase nsP13 activity inhibitor as an active ingredient.

Another object of the present invention is to provide an antiviral agent comprising the MERS coronavirus helicase nsP13 activity inhibitor as an active ingredient.

Another object of the present invention is to provide a virus proliferation inhibitor comprising the MERS coronavirus helicase nsP13 activity inhibitor as an active ingredient.

Other objects and advantages of the present invention will become more apparent by the following detailed description, claims and drawings.

According to an aspect of the present invention, the present invention provides a MERS coronavirus helicase nsP13 activity inhibitor comprising a compound derived from a natural product or a salt thereof.

The present inventors made diligent efforts to find a compound that can effectively prevent or treat the Middle East Respiratory Syndrome (MERS) virus disease, which has not yet been developed, without worrying about side effects.As a result, some of the various naturally-derived compounds are MERS coronavirus. It was confirmed that helicase nsP13 activity was inhibited.

According to a preferred embodiment of the present invention, the compound that inhibits viral helicase nsP13 activity is icariin, 1-isomangostin, isovanillyl catalpol, prideline ( friedelin), 24-methyllanosta-9(11),25-dien-3-one (24-Methyllanosta-9(11),25-dien-3-one), imperatorin, ledebowurielol (Ledebouriellol), methoxyeugenol (cinnamomum), taraxerol, sec-O-glucosylhamaudol, 4'-O-β-D-glucosyl-5- O-methylbisaminol (4'-O-β-D-glucosyl-5-O-methylvisamminol), prim-O-glucosylcimifugin, galangin, amentoflavone ( amentoflavone), 24-methyl-5α-lanosta-9(11), 25-diene-3α-one (24-Methyl-5α-lanosta-9(11), 25-dien-3α-one), ursolic acid ( Ursolic acid), Oleanolic acid, Stigmasterol, β-Sitosterol, Zipenoside XVII (gypenoside XVII), 5-O-methylbisamminol, gallic acid (gallic acid), γ-mangostin, spatulenol, or mariolide.

According to a preferred embodiment of the present invention, the compound inhibits the ATP hydrolytic activity of MERS coronavirus nsP13.

According to an embodiment of the present invention, the compound that inhibits the ATP hydrolytic activity of the MERS coronavirus nsP13 is icaariin, 1-isomangostine, isovanilyl catapol, prideline, 24-methyllanosta-9 (11),25-diene-3-one, imperatorin, ledebowurielol, methoxyeugenol, taraxerol, sec-O-glucosylhamaudol, 4'-O-β-D-glucosyl-5 -O-methylbisaminol or prim-O-glucosimifuzin.

According to a preferred embodiment of the present invention, the compound inhibits the dsRNA unwinding activity of MERS coronavirus helicase nsP13.

According to an embodiment of the present invention, the compound that inhibits the dsRNA unwinding activity of the MERS coronavirus helicase nsP13 is galangin, amentoflavone, 24-methyl-5α-lanosta-9 (11), 25-diene-3α-one, ursolic acid, oleanolic acid, stigmasterol, β-sitosterol, zipenoside XVII, 5-O-methylbisaminol or gallic acid.

According to a preferred embodiment of the present invention, the compound simultaneously inhibits ATP hydrolytic activity and dsRNA unwinding activity of MERS coronavirus nsP13.

According to an embodiment of the present invention, a compound that simultaneously inhibits the ATP hydrolytic activity and dsRNA unwinding activity of the MERS coronavirus nsP13 includes γ-mangosteen, spatulenol, or marioride.

According to a preferred embodiment of the present invention, the compound that inhibits the MERS coronavirus helicase nsP13 activity is selected from the group consisting of the following formulas 1 to 18:

[Formula 1] galangin

,

,

[Chemical Formula 2] amentoflavone

,

,

[Chemical Formula 3] γ-mangostin

,

,

[Formula 4] 24-Methyl-5α-lanosta-9(11),25-dien-3α-one

[Chemical Formula 5] Ursolic acid

,

,

[Chemical Formula 6] oleanolic acid

,

,

[Chemical Formula 7] stigmasterol

,

,

[Formula 8] spatulenol

,

,

[Chemical Formula 9] marliolide

,

,

[Chemical Formula 10] icariin

,

,

[Chemical Formula 11] 1-isomangostin

,

,

[Chemical Formula 12] isovanillyl catalpol

,

,

[Chemical Formula 13] friedelin

,

,

[Formula 14] imperatorin

,

,

[Chemical Formula 15] ledebouriellol

,

,

[Chemical Formula 16] methoxyeugenol

,

,

[Chemical Formula 17] taraxerol

또는

or

[Chemical Formula 18] 4'-o-β-d-glucosyl-5-o-methylvisamminol

.

.

According to an embodiment of the present invention, the compounds have an activity of inhibiting dsRNA unwinding activity and/or ATP hydrolytic activity of viral helicase nsP13 (FIGS. 3 and 4 ).

The term "compound" as used throughout the present specification is used as a meaning including the compound itself, salts thereof, and prodrugs.

According to another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating viral diseases comprising the MERS coronavirus helicase nsP13 activity inhibitor as an active ingredient.

The term "pharmaceutically acceptable salt" as used throughout the present specification refers to a formulation of a compound that does not cause serious irritation to the organism to which the compound is administered, and does not impair the biological activity and physical properties of the compound. The pharmaceutical salt is an acid forming a non-toxic acid addition salt containing a pharmaceutically acceptable anion, for example, an inorganic acid such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromic acid, hydroiodic acid, tartaric acid, formic acid, Organic carbon acids such as citric acid, acetic acid, trichloroacetic acid, trifluoroacetic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid, salicylic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, etc. Acid addition salts formed by sulfonic acid and the like are included. For example, pharmaceutically acceptable carboxylate salts include metal salts or alkaline earth metal salts formed of lithium, sodium, potassium, calcium, magnesium, etc., amino acid salts such as lysine, arginine, guanidine, dicyclohexylamine, N- Organic salts such as methyl-D-glucamine, tris(hydroxymethyl)methylamine, diethanolamine, choline and triethylamine, and the like. The compounds according to the invention can also be converted to their salts by conventional methods.

The term "prodrug" as used throughout the present specification means a pharmaceutically acceptable derivative such as an ester, amide and phosphate derivative, and means that the in vivo biological conversion product of the derivative is the compound. Prodrugs are often used because they are easier to administer than the parent drug. For example, they may obtain bioactivity by oral administration, whereas the parent agent may not. Goodman and Gilman (The Pharmacological Basis of Therapeutics, 8th ed, McGraw-Hill, Int. Ed. 1992, "Biotransformation of Drugs", p 13-15) describe common prodrugs, which are incorporated herein by reference. Prodrugs may also have improved solubility in pharmaceutical compositions than parent drugs. For example, in prodrugs, water solubility is detrimental to mobility, but once water solubility is beneficial in cells, esters that facilitate passage through cell membranes are hydrolyzed to active carboxylic acids by metabolism (“prodrugs It will be a compound administered as "). Another example of a prodrug may be a short peptide (polyamino acid) that is bound to an acid group that is metabolized to reveal the active site of the peptide.

The pharmaceutical composition of the present invention may further include suitable carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions.

"Carrier" is defined as a compound that facilitates the addition of the compound into a cell or tissue. For example, dimethyl sulfoxide (DMSO) is a commonly used carrier that facilitates the incorporation of many organic compounds into cells or tissues of an organism.

"Diluent" is defined as a compound that is diluted in water that will dissolve the compound as well as stabilize the biologically active form of the compound of interest. Salts dissolved in buffer solutions are used as diluents in the art. A commonly used buffer solution is phosphate buffered saline, because it mimics the salt state of human solutions.

Because buffer salts can control the pH of a solution at low concentrations, buffer diluents rarely alter the biological activity of a compound.

“Subject” or “patient” means any single individual in need of treatment, including humans, cattle, dogs, guinea pigs, rabbits, chickens, insects, and the like. In addition, the subject includes any subject who participated in a clinical study trial that does not show any disease clinical findings, or who participated in an epidemiological study or a subject used as a control.

The pharmaceutical composition according to the present invention is formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterile injectable solutions, respectively, according to conventional methods. I can.

Carriers, excipients and diluents that may be contained in the composition comprising the compound of the present invention, salts or prodrugs thereof include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, Maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stea Rate and mineral oil.

In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient for the compound, such as starch, calcium carbonate, sucrose or lactose. , Gelatin, etc. are mixed to prepare it. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. .

Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

As used herein, an “effective amount” is an appropriate amount that affects a beneficial or desirable clinical or biochemical outcome. An effective amount may be administered once or more. For the purposes of the present invention, an effective amount is an amount suitable for temporarily alleviating, ameliorating, stabilizing, reversing, slowing or delaying the progression of the disease state. If the recipient animal can tolerate the administration of the composition, or if the administration of the composition to that animal is suitable, the composition indicates “pharmaceutically or physiologically acceptable”. If the amount administered is physiologically important, the agent can be said to have been administered in a "therapeutically effective amount". If the presence of the agent results in a physiologically detectable change in the recipient patient, the agent is physiologically meaningful.

The term'treating', unless otherwise stated, reverses, alleviates, inhibits or prevents the disease or disease to which the term applies, or one or more symptoms of the disease or disease. Means that. As used herein, the term'treatment' refers to the act of treating when'treating' is defined as above.

The amount of the pharmaceutical composition of the present invention may vary depending on the age, sex, and weight of the patient, but may be administered in an amount of 0.0001 to 100 mg/kg, preferably 0.001 to 10 mg/kg, once to several times a day. In addition, the dosage may be increased or decreased depending on the route of administration, the degree of disease, sex, weight, age, and the like. Therefore, the above dosage does not limit the scope of the present invention in any way.

The pharmaceutical composition may be administered to mammals such as rats, mice, livestock, and humans by various routes. All modes of administration can be expected and may be administered, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or cerebrovascular injection.

The pharmaceutical dosage form of the composition of the present invention may be used in the form of a pharmaceutically acceptable salt thereof, and may be used alone or in combination with other pharmaceutically active compounds, as well as in a suitable set.

According to another aspect of the present invention, the present invention provides a food composition for preventing or improving viral diseases comprising the MERS coronavirus helicase nsP13 activity inhibitor as an active ingredient.

According to a preferred embodiment of the present invention, the food composition includes human food and animal feed or feed additives.

According to a preferred embodiment of the present invention, the human food is a functional food.

"Functional food" means a food in which the functionality of a general food is improved by adding the compound of the present invention to a general food. Functionality can be broadly classified into physical properties and physiological functions. When the compound of the present invention is added to a general food, the physical properties and physiological functions of the general food will be improved. It is defined as'.

For example, the compound of the present invention can prepare a functional food for the prevention and improvement of Middle East Respiratory Syndrome (MERS). In addition, it will be possible to manufacture a functional enhanced food and the like using this. The compound of the present invention, or a food physiologically acceptable salt or prodlog thereof, can be used as a main ingredient or additive and auxiliary of food in the manufacture of various functional foods and health functional foods.

Foods to which it can be added include various foods, powders, granules, tablets, capsules, syrups, beverages, gums, teas, vitamin complexes, and health functional foods.

In one embodiment, the compound of the present invention may be added to food or beverage for the purpose of preventing viral diseases. At this time, the amount of the compound in the food or beverage may generally be added to the health food composition of the present invention in 0.001 to 15% by weight of the total food weight, and the health drink composition is 0.02 to 30 g, preferably based on 100 ml It can be added in a ratio of 0.3 to 10 g.

The health beverage composition of the present invention has no particular limitation on the liquid component, in addition to containing the compound as an essential component in the indicated ratio, and may contain various flavoring agents or natural carbohydrates as an additional component, such as a conventional beverage. Examples of the above-described natural carbohydrates are monosaccharides, such as disaccharides such as glucose and fructose, such as maltose, sucrose, and the like, and polysaccharides, such as dextrin, cyclodextrin, and the like. These are sugars and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those described above, natural flavoring agents (taumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. The proportion of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.

In addition to the above, the composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and heavy weight agents (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid and its Salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and the like may be contained.

In addition, the compositions of the present invention may contain natural fruit juice and flesh for the production of fruit juice beverages and vegetable beverages. These components may be used independently or in combination. The proportion of these additives is not so critical, but is generally selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the composition of the present invention.

In addition, since the compound of the present invention is a natural compound, it has almost no toxicity and side effects, so it can be safely used even when taken for a long time for prophylactic purposes.

According to another aspect of the present invention, the present invention provides an antiviral or viral growth inhibitor comprising the MERS coronavirus helicase nsP13 activity inhibitor as an active ingredient.

The antiviral agent (or virus proliferation inhibitor) effectively inhibits the dsRNA unwinding activity and/or ATP hydrolytic activity of virus helicase nsP13, thereby effectively blocking viral replication and proliferation.

The features and advantages of the present invention are summarized as follows:

(I) The present invention provides an inhibitor of MERS coronavirus helicase nsP13 activity comprising a naturally derived compound.

(Ii) In addition, the present invention provides a composition or an antiviral agent comprising the inhibitor as an active ingredient.

(Iii) The inhibitor of the present invention can be used to effectively and safely prevent and treat viral diseases by effectively inhibiting the dsRNA unwinding activity or ATP hydrolytic activity of MERS coronavirus helicase nsP13.

1 shows the dsRNA unwinding test results (D: energy donor (Fluorescein), A: energy acceptor (TAMRA)).
2 shows the results of the ATP hydrolysis test.
_{Figure 3 shows the IC 50} values of compounds for the inhibition of dsRNA unwinding activity of MERS coronavirus helicase.
_{Figure 4 shows the IC 50} values of compounds for the inhibition of ATP hydrolytic activity of MERS coronavirus helicase.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Experiment method

1) Protein and nucleic acid

MERS coronavirus helicase was expressed in E. coli rosetta (protein expression cell) and purified as follows. Inoculate the pre-cultured cells in a liquid medium containing kanamycin and chloramphenicol and incubate at 37°C and 220 rpm until the OD value reaches 0.6~0.7. When mature, Isopropyl β-D-1-thiogalactopyranoside (IPTG) is added to a final concentration of 1 mM, and the protein is overexpressed overnight at 18°C and 150 rpm. The next day, centrifuge at 4°C and 5000 rpm for 30 minutes to collect the cells. Release the cell in a buffer to which Phenylmethanesulfonylfluoride (PMSF) was added, and break the cell using ultrasonic waves. After centrifugation at 4° C. and 12000 rpm for 1 hour, only the supernatant was picked and hung on a nickel column. Wash with buffer as much as 10 times the column volume. Elute at concentrations of 50 mM imidazole, 100 mM imidazole, 150 mM imidazole, 200 mM imidazole, and 300 mM imidazole. Confirm by 12% SDS-PAGE, collect clean samples that fit the MERS coronavirus helicase size (about 69 kDa) to prepare the next column. After concentrating to 500 μL or less using an ultrafilter, it is applied to a gel filtration column (GE Healthcare, Superdex 200 increase 10/300 GL) at a rate of 0.5 mL/min. It is separated by the size difference by flowing the buffer solution. Confirm by 12% SDS-PAGE, collect clean samples that fit the MERS coronavirus helicase size (69 kDa), mix with storage buffer, and store in a -80°C freezer. RNAs modified with TAMRA and Fluorescein were purchased from DNA Technology, and the concentration could be determined using the absorbance at 260 nm and their extinction coefficient. The base sequences of RNA modified by TAMRA and RNA modified by Fluorescein are 5'-20U25Tam (5′-U ₂₀ GAGCGGAUUACUAUACUACAUUAGA(TAMRA)-3′) and 3′-0U25Flu (5′-(Fluorescein) /UCUAAUGUAGUAUAGUAAUGUAGUAUAGUAAUCCGCUC respectively -3'). The substrate of MERS coronavirus Helicase is 50 μM of 5′-20U25Tam and 50 μM of 3′-0U25Flu in 5X annealing buffer (300 mM KCl, 30 mM HEPES-pH 7.5, 1.0 mM MgCl ₂ ) at 95° C., 1 min. After the reaction, the temperature was gradually lowered and double-stranded RNA (dsRNA) was used.

2) RNA unwinding and ATP hydrolysis analysis

In the experiment of dsRNA annealing activity of MERS coronavirus helicase, 62 compounds were added to a 96-well plate to a final 10 μM, and then 1 μM helicase per well was diluted in a buffer and added. Reaction at room temperature for 5 minutes and shake. A reaction solution is prepared and added to the final 2mM ATP, 5mM DTT, 20nM dsRNA, and 5mM MgCl _2. It was reacted at 37° C. for 5 minutes. The reaction termination solution was prepared and added to the final 50 mM EDTA, 200 nM Trap RNA, and the degree of luminescence of Fluorescein was measured and quantified using a filter capable of emitting light of 485 nm and detecting light of 535 nm. Compounds that inhibit the activity of MERS coronavirus helicase are selected by more than 40%. In the ATP hydrolytic activity experiment of MERS coronavirus helicase, 62 compounds were added to a 96 well plate to a final 10 μM, and then 1 μM helicase per well was diluted in buffer and added. React for 5 minutes at room temperature and shake. A reaction solution is prepared and added to a final 50 mM NaCl, 2 mM ATP, 2 μM poly U, and 5 mM MgCl _2. It was reacted at 37° C. for 5 minutes. The reaction was terminated by adding a color developing reagent made of malachite green and ammonium molybdate, and the _{degree of color development by the generated P i} was quantified by measuring the absorbance at 620 nm. Compounds that inhibit the activity of MERS coronavirus helicase by 40% or more were selected and each concentration was selected (0.1 μM, 0.3 μM, 0.5 μM, 0.7 μM, 1 μM, 3 μM, 5 μM, 7 μM, 10 μM, 20 μM, 40 μM, 60 μM, 80 μM, 100 μM). _{The concentration (IC 50} values) of each compound at the time of 50% inhibition of helicase activity was calculated using the SigmaPlot program.

Example 1. Preparation of compound library

The present inventors prepared a total of 62 compound libraries and tested their effect on the activity of MERS coronavirus helicase nsP13. It is reported that nsP13 works to release two RNA strands by ATP hydrolysis and moves well along nucleic acids.

Example 2. Screening for several substances in the compound library

We first screened for several substances in a library of compounds that may inhibit the double-stranded RNA-releasing activity of nsP13. The activity of releasing two RNA strands of nsP13 was measured from fluorescence for TAMRA by an assay that quantifies using fluorescence, based on the FRET phenomenon. FRET can be described as the energy transfer process that occurs between two fluorescent molecules, and energy is transferred from the donor molecule (the side that gives the energy) to the acceptor molecule (the side that receives the energy), and the dynamic interaction between two adjacent molecules. It is very useful for determining. More specifically, the experimental design was devised like the FRET method generated from Fluorescein to TAMRA. As a result, there is no fluorescence of Fluorescein when two RNA strands form a base pair, but when the two strands unwind by nsP13 helicase occurs, Fluorescein Since FRET to TAMRA does not occur, strong fluorescence is generated (Fig. 1, D: energy donor (Fluorescein), A: energy acceptor (TAMRA)).

Example 3. dsRNA-unwinding reaction

Based on the above theory, the present inventors added each of the natural products to the dsRNA-unwinding reaction at a concentration of 10 μM and measured the amount of fluorescence emitted at a wavelength of 535 nm. As a result, we were able to find a compound that inhibits the dsRNA unwinding activity of nsP13 helicase.

Example 4. ATP hydrolytic activity inhibition test

Next, we evaluated whether there is a compound capable of inhibiting the ATP hydrolytic activity of nsP13. ATP hydrolysis experiments were performed with nsP13 in the presence of poly U. The occurrence of ATP hydrolysis was evaluated by a numerical analysis method using the color change by measurement of _{the decomposed P i} forming a complex with molybdate (AM) and malachite green (MG) (FIG. 2). Using this experimental design, it was tested whether there were any compounds with an inhibitory effect on the ATP hydrolysis of nsP13. As a result, we were able to find a compound that inhibits the ATP hydrolytic activity of nsP13 helicase.

Example 5. Measurement of the inhibitory effect of the compound on the dsRNA unwinding activity of nsP13

We were able to obtain _{each IC 50} value by measuring the sequentially diluted compounds in vitro on their inhibitory effect on the dsRNA unwinding activity of nsP13. As a result, we _{were able to obtain the lowest IC 50} value of amentoflavone as 5.2652 μM (Fig. 3).

Example 6. Measurement of the inhibitory effect of the compound on the ATP hydrolytic activity of nsP13

We were able to obtain _{each IC 50} value by measuring the sequentially diluted compounds in vitro on their inhibitory effect on the ATP hydrolytic activity of nsP13. As a result, we _{were able to obtain the lowest IC 50} value of icarrin as 1.7395 μM (Fig. 4).

As the specific parts of the present invention have been described in detail above, it is obvious that these specific techniques are only preferred embodiments for those of ordinary skill in the art, and the scope of the present invention is not limited thereto. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims (10)

Icarin, 1-isomangostin, Isovanillyl Catalpol, friedelin, 24-methyllanosta-9(11),25-diene-3- Won (24-Methyllanosta-9(11),25-dien-3-one), imperatorin, Ledebouriellol, methoxyeugenol, cinnamomum, sec-O-glucosyl Hamaudol (sec-O-Glucosylhamaudol), 4'-O-β-D-glucosyl-5-O-methylbisaminol (4'-O-β-D-glucosyl-5-O-methylvisamminol), galangine (galangin), 24-methyl-5α-lanosta-9(11), 25-diene-3α-one (24-Methyl-5α-lanosta-9(11), 25-dien-3α-one), ursolic acid (Ursolic acid), oleanolic acid, stigmasterol, β-Sitosterol, gypenoside XVII, 5-O-methylbisamminol, MERS coronavirus for the prevention or treatment of MERS coronavirus disease, including gallic acid, γ-mangostin, spatulenol, or Marliolide or a salt thereof Helicase nsP13 activity inhibitor.
MERS coronavirus helicase nsP13 activity inhibitor for the prevention or treatment of MERS coronavirus disease, comprising a compound selected from the group consisting of the following formulas 1, 3 to 16 and 18 or a salt thereof:
[Formula 1] galangin

,
[Chemical Formula 3] γ-mangostin

,
[Formula 4] 24-Methyl-5α-lanosta-9(11),25-dien-3α-one

[Chemical Formula 5] Ursolic acid

,
[Chemical Formula 6] oleanolic acid

,
[Chemical Formula 7] stigmasterol

,
[Formula 8] spatulenol

,
[Chemical Formula 9] marliolide

,
[Chemical Formula 10] icariin

,
[Chemical Formula 11] 1-isomangostin

,
[Chemical Formula 12] isovanillyl catalpol

,
[Chemical Formula 13] friedelin

,
[Formula 14] imperatorin

,
[Chemical Formula 15] ledebouriellol

,
[Chemical Formula 16] methoxyeugenol

or
[Chemical Formula 18] 4'-o-β-d-glucosyl-5-o-methylvisamminol

.
The inhibitor according to claim 1 or 2, wherein the compound or a salt thereof inhibits dsRNA unwinding activity or ATP hydrolytic activity of MERS coronavirus helicase nsP13.
The method of claim 3, wherein the compound that inhibits the ATP hydrolytic activity of the MERS coronavirus helicase nsP13 is icariin, 1-isomangostine, isovanilyl catapol, prideline, 24-methyllanosta-9 ( 11),25-diene-3-one, imperatorin, ledebowurielol, methoxyeugenol, sec-O-glucosylhamadol or 4'-O-β-D-glucosyl-5-O-methyl Inhibitor, characterized in that it is bisaminol.
The method of claim 3, wherein the compound that inhibits the dsRNA unwinding activity of the MERS coronavirus helicase nsP13 is galangin, 24-methyl-5α-lanosta-9(11), 25-diene-3α-one , Ursolic acid, oleanolic acid, stigmasterol, β-sitosterol, zipenoside XVII, 5-O-methylbisaminol or gallic acid.
The inhibitor of claim 3, wherein the compound that simultaneously inhibits the ATP hydrolytic activity and dsRNA unwinding activity of the MERS coronavirus nsP13 is γ-mangosteen, spatulenol, or mariolide.
delete Icarin, 1-isomangostin, Isovanillyl Catalpol, friedelin, 24-methyllanosta-9(11),25-diene-3- Won (24-Methyllanosta-9(11),25-dien-3-one), imperatorin, Ledebouriellol, methoxyeugenol, cinnamomum, sec-O-glucosyl Hamaudol (sec-O-Glucosylhamaudol), 4'-O-β-D-glucosyl-5-O-methylbisaminol (4'-O-β-D-glucosyl-5-O-methylvisamminol), galangine (galangin), 24-methyl-5α-lanosta-9(11), 25-diene-3α-one (24-Methyl-5α-lanosta-9(11), 25-dien-3α-one), ursolic acid (Ursolic acid), oleanolic acid, stigmasterol, β-Sitosterol, gypenoside XVII, 5-O-methylbisamminol, Gallic acid (gallic acid), γ-mangosteen (γ-mangostin), spatulenol (spatulenol) or mariolide (Marliolide) comprising a MERS coronavirus helicase nsP13 activity inhibitor including a salt thereof as an active ingredient, Food composition for preventing or improving MERS coronavirus disease.
Icarin, 1-isomangostin, Isovanillyl Catalpol, friedelin, 24-methyllanosta-9(11),25-diene-3- Won (24-Methyllanosta-9(11),25-dien-3-one), imperatorin, Ledebouriellol, methoxyeugenol, cinnamomum, sec-O-glucosyl Hamaudol (sec-O-Glucosylhamaudol), 4'-O-β-D-glucosyl-5-O-methylbisaminol (4'-O-β-D-glucosyl-5-O-methylvisamminol), galangine (galangin), 24-methyl-5α-lanosta-9(11), 25-diene-3α-one (24-Methyl-5α-lanosta-9(11), 25-dien-3α-one), ursolic acid (Ursolic acid), oleanolic acid, stigmasterol, β-Sitosterol, gypenoside XVII, 5-O-methylbisamminol, Gallic acid (gallic acid), γ-mangosteen (γ-mangostin), spatulenol (spatulenol) or mariolide (Marliolide) comprising a MERS coronavirus helicase nsP13 activity inhibitor including a salt thereof as an active ingredient, Antiviral agent against MERS coronavirus.
Icarin, 1-isomangostin, Isovanillyl Catalpol, friedelin, 24-methyllanosta-9(11),25-diene-3- Won (24-Methyllanosta-9(11),25-dien-3-one), imperatorin, Ledebouriellol, methoxyeugenol, cinnamomum, sec-O-glucosyl Hamaudol (sec-O-Glucosylhamaudol), 4'-O-β-D-glucosyl-5-O-methylbisaminol (4'-O-β-D-glucosyl-5-O-methylvisamminol), galangine (galangin), 24-methyl-5α-lanosta-9(11), 25-diene-3α-one (24-Methyl-5α-lanosta-9(11), 25-dien-3α-one), ursolic acid (Ursolic acid), oleanolic acid, stigmasterol, β-Sitosterol, gypenoside XVII, 5-O-methylbisamminol, MERS coronavirus including gallic acid, γ-mangostin, spatulenol or mariolide or salts thereof, including inhibitors of MERS coronavirus helicase nsP13 activity Inhibitors of viral growth.

Images