KR20190092776A - Compounds that inhibit MERS coronavirus helicase nsP13 and uses thereof - Google Patents

Abstract

The present invention relates to a MERS coronavirus helicase nsP13 activity inhibitor comprising a naturally derived compound. An inhibitor of the present invention can be used to effectively and safely prevent and treat viral diseases by efficiently inhibiting dsRNA unwinding activity and/or ATP hydrolytic activity of MERS coronavirus helicase nsP13.

Description

Compounds that inhibit MERS coronavirus helicase nsP13 activity and use thereof

The present invention relates to novel chemical inhibitors of viruses, and more particularly to chemical inhibitors against MERS coronavirus helicase nsP13.

Virus refers to a toxic substance in Latin and refers to a group of infectious pathogenic particles passing through a bacterial filter paper (0.22 μm). Viruses may be classified as bacteriophage, plant viruses, or animal viruses according to host cell types, and may be classified as DNA viruses or RNA viruses according to nucleic acid types. Recently, various viral diseases such as swine flu, AI and foot-and-mouth disease caused social problems, and consequently, anxiety about effective measures for viral diseases has attracted great social attention.

Coronaviruses are divided into four genus: alpha, beta, gamma and delta. MERS coronavirus belongs to beta coronavirus. In the early days of discovery, before the congestion became known, it was treated as a similar virus of SARS coronavirus belonging to the same beta coronavirus, or just a new coronavirus, but on May 23, 2013, the official name of MERS coronavirus was adopted by the International Committee on Virus Classification. The company has a unique official name different from the SARS coronavirus.

Although MERS has not been identified as a clear source of infection and path of infection, it is reported that it is more likely to be infected through contact with camels in the Middle East, and that it can be spread by close contact between people. Mers was first discovered in Saudi Arabia in 2012 and has been intensive in the Middle East, and by May 2015, 1,167 people were infected in 25 countries, of which 479 were reported to have died. Infections occurred mainly in the Middle East, including Saudi Arabia, UAE, Jordan, and Qatar, but since May 2015, more than 100 infections have occurred in Korea. Infection with MERS leads to severe respiratory symptoms, such as high fever, cough, and difficulty breathing, which can be over 7 to 14 days. Digestive symptoms, such as diarrhea and constipation in some cases, chronic disease or immunocompromised, pneumonia, acute renal failure, complications such as death can be accompanied. Mers, in particular, is known to have a six-fold higher mortality rate than SARS. Antiviral agents for the treatment of MERS coronavirus have not been developed, and the treatment is mainly focused on symptoms. In severe cases, a respirator or hemodialysis may be required. The virus that causes MERS is a coronavirus, a single-stranded RNA virus with a gene of 30,119 bases. Coronaviruses belong to the enveloped virus family and replicate in the cytoplasm of animal host cells. When infected with target cells, the genes of the coronavirus produce two large replication-related polymers. The polymerized protein is then separated into several non-structural proteins (nsPs) by proteases, including RNA-dependent-RNA polymerases and helicases. Viral helicases are essential proteins for viral gene replication and are currently considered potential targets for antiviral drug development.

Patent Document 1. Republic of Korea Patent Publication No. 10-2004-0091722

The present inventors have made diligent efforts to find a compound that can effectively prevent or treat Middle East Respiratory Syndrome (MERS) virus disease for which no therapeutic agent is currently developed, without worrying about side effects. As a result, the present invention was completed by confirming that some compounds of various naturally derived compounds inhibited MERS coronavirus helicase nsP13 activity.

Accordingly, it is an object of the present invention to provide a mers coronavirus helicase nsP13 activity inhibitor comprising a compound derived from a natural product or a salt thereof.

Another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of viral diseases comprising the MERS coronavirus helicase nsP13 activity inhibitor.

Still another object of the present invention is to provide a food composition for preventing or ameliorating a viral disease comprising the mers coronavirus helicase nsP13 activity inhibitor.

Still another object of the present invention is to provide an antiviral agent comprising the MERS coronavirus helicase nsP13 activity inhibitor as an active ingredient.

It is another object of the present invention to provide a virus growth inhibitor comprising the MERS coronavirus helicase nsP13 activity inhibitor as an active ingredient.

Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

According to one aspect of the present invention, the present invention provides a mers coronavirus helicase nsP13 activity inhibitor comprising a compound derived from a natural product or a salt thereof.

The present inventors have made efforts to find a compound that can effectively prevent or treat Middle East Respiratory Syndrome (MERS) virus disease for which no therapeutic agent is currently developed, without worrying about side effects. It was confirmed to inhibit helicase nsP13 activity.

According to a preferred embodiment of the present invention, the compound that inhibits the viral helicase nsP13 activity is icarin (icariin), 1-isomangostin (Isovangostin), isovanillyl Catalpol (Isovanillyl Catalpol), Friedel ( friedelin), 24-methyllanosta-9 (11), 25-diene-3-one (24-Methyllanosta-9 (11), 25-dien-3-one), imperatorin, reddebourielol (Ledebouriellol), methoxyeugenol (cinnamomum), taraxerol, sec-O-Glucosylhamaudol, 4'-O-β-D-glucosyl-5- O-methylbisaminol (4'-O-β-D-glucosyl-5-O-methylvisamminol), prim-O-Glucosylcimifugin, galangin, amentoflavones amentoflavone), 24-methyl-5α-lanosta-9 (11), 25-diene-3α-one (24-Methyl-5α-lanosta-9 (11), 25-dien-3α-one), ursolic acid ( Ursolic acid), oleanolic acid, Stigmasterol, β-Sitosterol, Zipenoside X Gypenoside XVII, 5-O-Methylvisamminol, gallic acid, γ-mangostin, spatulenol or mariolide Include.

According to a preferred embodiment of the present invention, the compound inhibits ATP hydrolytic activity of MERS coronavirus nsP13.

According to an embodiment of the present invention, the compound that inhibits the ATP hydrolytic activity of the mers coronavirus nsP13 is Ikari, 1-isomangosteen, isovanylyl catapol, Friedelin, 24-methyllanosta-9 (11), 25-diene-3-one, imperatorin, redvourielol, methoxyeugenol, taraxolol, sec-O-glucosylhamoudol, 4'-O-β-D-glucosyl-5 -O-methylbisaminol or prim-O-glucosilimiminizin.

According to a preferred embodiment of the present invention, the compound inhibits the dsRNA unwinding activity of MERS coronavirus helicase nsP13.

According to one embodiment of the present invention, the compound that inhibits the dsRNA unwinding activity of the mers coronavirus helicase nsP13 is gallangin, amentoflavone, 24-methyl-5α-lanosta-9-9 (11), 25-diene-3α-one, ursolic acid, oleanoic acid, stigmasterol, β-sitosterol, zipenoside XVII, 5-O-methylbisaminol or gallic acid.

According to a preferred embodiment of the present invention, the compound simultaneously inhibits ATP hydrolysis activity and dsRNA unwinding activity of MERS coronavirus nsP13.

According to one embodiment of the present invention, the compound that simultaneously inhibits the ATP hydrolytic activity and dsRNA unwinding activity of the mers coronavirus nsP13 includes γ-mangosteen, spatulenol or marioide.

According to a preferred embodiment of the present invention, the compound that inhibits MERS coronavirus helicase nsP13 activity is selected from the group consisting of the following Chemical Formulas 1 to 18:

[Formula 1] galangin

,

,

[Formula 2] amentoflavone

,

,

Γ-mangostin

,

,

[Formula 4] 24-Methyl-5α-lanosta-9 (11), 25-dien-3α-one

[Formula 5] Ursolic acid

,

,

[Formula 6] oleanolic acid

,

,

Formula 7 stigmasterol

,

,

[Formula 8] spatulenol

,

,

[Formula 9] marliolide

,

,

[Formula 10] icariin

,

,

1-isomangostin

,

,

Isovanillyl catalpol

,

,

[Formula 13] friedelin

,

,

[Formula 14] imperatorin

,

,

[Formula 15] ledebouriellol

,

,

[Formula 16] methoxyeugenol

,

,

[Formula 17] taraxerol

또는

or

4'-o-β-d-glucosyl-5-o-methylvisamminol

.

.

According to one embodiment of the present invention, the compounds have the activity of inhibiting dsRNA unwinding activity and / or ATP hydrolytic activity of viral helicase nsP13 (FIGS. 3 and 4).

As used throughout this specification, the term “compound” is used to mean the compound itself and salts thereof, prodrugs.

According to another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating viral diseases comprising the mers coronavirus helicase nsP13 activity inhibitor.

As used herein, the term “pharmaceutically acceptable salt” refers to a formulation of a compound that does not cause severe irritation to the organism to which the compound is administered and does not impair the biological activity and properties of the compound. The pharmaceutical salts include acids that form non-toxic acid addition salts containing pharmaceutically acceptable anions, for example inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromic acid, hydroiodic acid, and the like, tartaric acid, formic acid, Organic carbon acids such as citric acid, acetic acid, trichloroacetic acid, trifluoroacetic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid, salicylic acid, etc., such as methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, etc. Acid addition salts formed by sulfonic acid or the like. For example, pharmaceutically acceptable carboxylic acid salts include metal salts or alkaline earth metal salts formed by lithium, sodium, potassium, calcium, magnesium, amino acid salts such as lysine, arginine, guanidine, dicyclohexylamine, and N-. Organic salts such as methyl-D-glucamine, tris (hydroxymethyl) methylamine, diethanolamine, choline and triethylamine and the like. The compounds according to the invention can also be converted to their salts by conventional methods.

The term "prodrug" as used throughout this specification refers to pharmacologically acceptable derivatives such as esters, amides and phosphate derivatives, meaning that the biological conversion product of the derivative is the compound. Prodrugs are often used because they are easier to administer than the parent drug. For example, they may not be bioavailable by oral administration whereas the parent drug may not. Goodman and Gilman (The Pharmacological Basis of Therapeutics, 8th ed, McGraw-Hill, Int. Ed. 1992, "Biotransformation of Drugs", p 13-15) describe conventional prodrugs and are incorporated herein by reference. Prodrugs may also have improved solubility in pharmaceutical compositions than the parent drug. For example, prodrugs are esters that facilitate the passage of cell membranes, which are hydrolyzed to carboxylic acids, which are active by metabolism, once the water solubility is detrimental to mobility, but once the water solubility is beneficial (“prodrugs”). ”) Will be administered. Another example of a prodrug may be a short peptide (polyamino acid) that is bound to an acid group that is converted by metabolism to reveal the active site.

The pharmaceutical compositions of the present invention may further comprise suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions.

A "carrier" is defined as a compound that facilitates the addition of a compound into a cell or tissue. For example, dimethyl sulfoxide (DMSO) is a commonly used carrier that facilitates the incorporation of many organic compounds into cells or tissues of an organism.

A "diluent" is defined as a compound that not only stabilizes the biologically active form of a compound of interest, but also is diluted in water to dissolve the compound. Salts dissolved in buffer solutions are used as diluents in the art. A commonly used buffer solution is phosphate buffered saline, because it mimics the salt state of human solutions.

Because buffer salts can control the pH of a solution at low concentrations, buffer diluents rarely modify the biological activity of a compound.

"Subject" or "patient" means any single individual in need of treatment, including humans, cattle, dogs, guinea pigs, rabbits, chickens, insects, and the like. Also included are any subjects who participated in clinical research trials showing no disease clinical findings or subjects who participated in epidemiologic studies or who used as controls.

The pharmaceutical compositions according to the present invention may be used in the form of oral dosage forms, external preparations, suppositories, and sterile injectable solutions, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, respectively, according to conventional methods. Can be.

Carriers, excipients and diluents that may be included in the compositions of the compounds of the present invention, salts or prodrugs thereof include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, Maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate Rate and mineral oil.

When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used.

Solid form preparations for oral administration include tablets, pills, powders, granules, capsules and the like, and such solid form preparations include at least one excipient such as starch, calcium carbonate, sucrose or lactose in the compound. Mixed with gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents, water and liquid paraffin. .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

As used herein, an "effective amount" is an appropriate amount that affects a beneficial or desirable clinical or biochemical result. An effective amount can be administered once or more. For the purposes of the present invention, an effective amount is an amount suitable to temporarily alleviate, ameliorate, stabilize, reverse, slow or slow the progression of a disease state. If the recipient animal can withstand the administration of the composition, or if the administration of the composition to that animal is suitable, the composition indicates "pharmaceutically or physiologically acceptable". If the amount administered is physiologically important, it can be said that the agent has been administered in a "therapeutically effective amount." The agent is physiologically meaningful if the presence of the agent has resulted in a physiologically detectable change in the recipient patient.

The term 'treating' is used to reverse, alleviate, inhibit the progression of, or prevent the disease or condition to which the term applies, or one or more symptoms of the disease or condition, unless otherwise noted. Means that. As used herein, the term 'treatment' refers to the act of treating when 'treating' is defined as above.

The amount of the pharmaceutical composition of the present invention may vary depending on the age, sex, and weight of the patient, but may be administered from 0.0001 to 100 mg / kg, preferably from 0.001 to 10 mg / kg once or several times daily. The dosage may also be increased or decreased depending on the route of administration, the severity of the disease, sex, weight, age, and the like. Therefore, the above dosage does not limit the scope of the present invention in any aspect.

The pharmaceutical composition may be administered to various mammals such as mice, mice, livestock, humans, and the like. All modes of administration can be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or cerebrovascular injections.

Pharmaceutical dosage forms of the compositions of the present invention may be used in the form of their pharmaceutically acceptable salts, and may be used alone or in combination with other pharmaceutically active compounds, as well as in any suitable collection.

According to another aspect of the invention, the present invention provides a food composition for the prevention or improvement of viral diseases comprising the mers coronavirus helicase nsP13 activity inhibitor as an active ingredient.

According to a preferred embodiment of the present invention, the food composition comprises a human food and animal feed or feed additives.

According to a preferred embodiment of the present invention, the human food is a functional food.

"Functional food" means the food which improved the functionality of general food by adding the compound of this invention to general food. Functionality can be roughly classified into physical properties and physiological functions. When the compound of the present invention is added to a general food, the physical and physiological properties of the general food will be improved, and the present invention comprehensively describes the food of such an improved function as a functional food. 'Is defined.

For example, the compounds of the present invention can produce functional foods for the prevention and improvement of Middle East Respiratory Syndrome (MERS). In addition, it will be possible to manufacture functional foods using the same. The compounds of the present invention or food acceptable salts or prodrugs thereof can be used as the main ingredients or additives and auxiliaries of foods in the manufacture of various functional foods and health functional foods.

Foods to which it may be added include various foods, powders, granules, tablets, capsules, syrups, beverages, gums, teas, vitamin complexes, and health functional foods.

In one embodiment, the compounds of the present invention may be added to food or beverages for the purpose of preventing viral diseases. At this time, the amount of the compound in the food or beverage is generally added to the health food composition of the present invention 0.001 to 15% by weight of the total food weight, the health beverage composition is 0.02 to 30 g, preferably based on 100 ml It can be added at a ratio of 0.3 to 10 g.

The health beverage composition of the present invention, in addition to containing the compound as an essential ingredient in the indicated proportions, has no particular limitation on the liquid component and may contain various flavors or natural carbohydrates as additional ingredients, such as ordinary drinks. Examples of the above-mentioned natural carbohydrates are conventional monosaccharides such as disaccharides such as glucose and fructose, such as maltose, sucrose and the like, and polysaccharides such as dextrin, cyclodextrin and the like. Sugars and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those mentioned above, natural flavoring agents (tauumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. The proportion of said natural carbohydrates is generally about 1-20 g, preferably about 5-12 g per 100 ml of the composition of the present invention.

In addition to the above, the composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, coloring and neutralizing agents (such as cheese and chocolate), pectic acid and salts thereof, alginic acid and its Salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.

The compositions of the present invention may also contain pulp for the production of natural fruit juices and fruit juice beverages and vegetable beverages. These components can be used independently or in combination. The proportion of such additives is not so critical but is generally selected from the range of 0 to about 20 parts by weight per 100 parts by weight of the composition of the present invention.

In addition, since the compound of the present invention is a natural compound, there is almost no toxicity and side effects, so that the compound of the present invention can be used with confidence even for long-term use.

According to another aspect of the present invention, the present invention provides an antiviral agent or virus growth inhibitor comprising the MERS coronavirus helicase nsP13 activity inhibitor as an active ingredient.

The antiviral agent (or virus proliferation inhibitor) can effectively block the dsRNA unwinding activity and / or ATP hydrolytic activity of the viral helicase nsP13 to effectively block the replication and proliferation of the virus.

The features and advantages of the present invention are summarized as follows:

(Iii) The present invention provides a mers coronavirus helicase nsP13 activity inhibitor comprising a naturally derived compound.

(Ii) The present invention also provides a composition or an antiviral agent comprising the inhibitor as an active ingredient.

(Iii) The inhibitor of the present invention can be used to effectively and safely prevent and treat viral diseases by efficiently inhibiting dsRNA unwinding activity or ATP hydrolysis activity of MERS coronavirus helicase nsP13.

Figure 1 shows the results of the dsRNA unwinding test (D: energy donor (Fluorescein), A: energy acceptor (TAMRA)).
Figure 2 shows the results of the ATP hydrolysis test.
Figure 3 shows the IC ₅₀ value of compounds for the inhibition of dsRNA unwinding activity of MERS coronavirus helicase.
4 shows the IC ₅₀ values of compounds for inhibition of ATP hydrolytic activity of MERS coronavirus helicase.

Hereinafter, the present invention will be described in more detail with reference to the following examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Experiment method

1) Proteins and Nucleic Acids

MERS coronavirus helicase was expressed in E. coli Rosetta (protein expression cell) and purified as follows. Inoculate the pre-cultured cells into the liquid medium containing Kanamycin and chloramphenicol and incubate at 37 ℃ and 220 rpm until the OD value is 0.6 ~ 0.7. When mature, add Isopropyl β-D-1-thiogalactopyranoside (IPTG) to a final concentration of 1 mM and overexpress the protein overnight at 18 ° C and 150 rpm. The next day, cells are collected by centrifugation at 5000 rpm for 30 minutes. Free the cells in a buffer containing Phenylmethanesulfonylfluoride (PMSF) and break the cells using ultrasound. After centrifugation at 4 ° C. and 12000 rpm for 1 hour, only the supernatant was collected and placed on a nickel column. Wash with 10x column volume buffer. Elute at 50 mM imidazole, 100 mM imidazole, 150 mM imidazole, 200 mM imidazole, 300 mM imidazole. Check by 12% SDS-PAGE, collect clean samples for MERS coronavirus helicase size (approximately 69 kDa) and prepare the next column. Concentrate to 500 μL or less using an ultrafilter and apply a gel filtration column (GE Healthcare, Superdex 200 increase 10/300 GL) at a rate of 0.5 mL / min. Flow buffer and separate by size difference. Check by 12% SDS-PAGE, collect clean samples for MERS coronavirus helicase size (69 kDa), mix with storage buffer and store in -80 ° C freezer. RNAs modified with TAMRA and Fluorescein were purchased from DNA technology, and their concentrations were determined using absorbance at 260 nm and their extinction coefficients. The nucleotide sequences of RNA synthesized by TAMRA and RNA modified by Fluorescein were 5'-20U25Tam (5'-U ₂₀ GAGCGGAUUACUAUACUACAUUAGA (TAMRA) -3 ') and 3'-0U25Flu (5'-(Fluorescein) / UCUAAUGUAGUAUAGUAAUCCGCUC -3 '). The substrate of MERS coronavirus helicase was 95 ° C. for 1 min in 50 μM 5′-20U25Tam and 50 μM 3′-0U25Flu in 5X annealing buffer (300 mM KCl, 30 mM HEPES-pH 7.5, 1.0 mM MgCl ₂ ). After the reaction, the temperature was slowly lowered and double-stranded RNA (dsRNA) was used.

2) RNA unwinding and ATP hydrolysis analysis

In dsRNA annealing activity experiments of MERS coronavirus helicases, 62 compounds were added to a 96 well plate to the final 10 μM, and then 1 μM of helicase per well was diluted in buffer. Shake for 5 minutes at room temperature. The reaction solution is prepared and added to the final 2 mM ATP, 5 mM DTT, 20 nM dsRNA, 5 mM MgCl ₂ . The reaction is carried out at 37 ° C. for 5 minutes. A reaction termination solution is prepared and added to the final 50 mM EDTA, 200 nM Trap RNA, and the fluorescence level of Fluorescein is measured and quantified using a filter capable of emitting 485 nm of light and detecting light of 535 nm. Compounds that inhibit the activity of MERS coronavirus helicase by at least 40% are selected. In the ATP hydrolysis activity experiment of MERS coronavirus helicases, 62 compounds were added to a 96 well plate to a final 10 μM, and then 1 μM of helicase per well was diluted in buffer. Shake for 5 minutes at room temperature. The reaction solution is prepared and added to the final 50 mM NaCl, 2 mM ATP, 2 μM poly U, 5 mM MgCl ₂ . The reaction is carried out at 37 ° C. for 5 minutes. The degree of color development due to malachite green and ammonium molybdate was added to the color developing reagent made from a date to terminate the reaction to generate P _i is quantified by measuring the absorbance at 620 nm. Compounds that inhibit the activity of MERS coronavirus helicase by more than 40% were selected and each was selected by concentration (0.1 μM, 0.3 μM, 0.5 μM, 0.7 μM, 1 μM, 3 μM, 5 μM, 7 μM, 10 μM, 20 μM, 40 μM, 60 μM, 80 μM, 100 μM). The concentration of each compound (IC ₅₀ values) at 50% inhibition of helicase activity is determined using the SigmaPlot program.

Example 1. Preparation of Compound Library

We prepared a total of 62 compound libraries and tested their effect on the activity of MERS coronavirus helicase nsP13. nsP13 releases two strands of RNA by ATP hydrolysis and is reported to migrate well along nucleic acids.

Example 2. Screening for Some Materials in a Compound Library

We first screened several substances in a compound library that might inhibit the activity of releasing the double-stranded RNA of nsP13. The activity of releasing two strands of RNA of nsP13 was determined by quantification using fluorescence based on FRET phenomenon from fluorescence for TAMRA. FRET can be described as an energy transfer process between two fluorescent molecules, where energy is transferred from the donor molecule (the energy-giving side) to the acceptor molecule (the energy-receiving side) and the dynamic interaction between two adjacent molecules. Very useful for determining More specifically, the experimental design was designed with the FRET method generated from Fluorescein to TAMRA, which results in no fluorescence of Fluorescein when two strands of RNA are in base pairs, but when Fluorescein releases two strands by nsP13 helicase, Strong fluorescence occurs because FRET does not occur to TAMRA (FIG. 1, D: energy donor (Fluorescein), A: energy acceptor (TAMRA)).

Example 3 dsRNA-unwinding Reaction

Based on this theory, we added each natural product to the dsRNA-unwinding reaction at a concentration of 10 μM and measured the amount of fluorescence emitted at 535 nm wavelength. As a result, we found a compound that inhibits dsRNA annealing activity of nsP13 helicase.

Example 4. Inhibition of ATP Hydrolysis Activity

Next, we evaluated the existence of a compound capable of inhibiting the ATP hydrolytic activity of nsP13. ATP hydrolysis experiments were performed with nsP13 in the presence of poly U. The occurrence of ATP hydrolysis was assessed by an analytical method to quantify using the color change by measurement of the degraded P _i forming a complex with molybdate (AM) and malachite green (MG) (FIG. 2). Using this experimental design, it was tested whether there was any compound having an inhibitory effect on ATP hydrolysis of nsP13. As a result, we found a compound that inhibits the ATP hydrolytic activity of nsP13 helicase.

Example 5 Determination of Inhibitory Effect on the dsRNA Unwinding Activity of nsP13 Compounds

We were able to obtain their IC ₅₀ values by sequentially measuring the diluted compounds in vitro and measuring their inhibitory effect on the dsRNA unwinding activity of nsP13. As a result, we found that the IC ₅₀ value of amentoflavone was 5.2652 μM, the lowest value (FIG. 3).

Example 6 Determination of Inhibitory Effect of nsP13 on ATP Hydrolytic Activity of Compounds

We were able to obtain their respective IC ₅₀ values by sequentially measuring the diluted compounds in vitro and measuring their inhibitory effect on the ATP hydrolytic activity of nsP13. As a result, we found that the IC ₅₀ value of icarrin was the lowest as 1.7395 μM (FIG. 4).

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

Claims (10)

Icariin, 1-isomangostin, Isovanillyl Catalpol, Friedelin, 24-methyllanosta-9 (11), 25-diene-3- Raw (24-Methyllanosta-9 (11), 25-dien-3-one), imperatorin, impedinin, lesdebouriellol, methoxyeugenol, cinnamomum, taraxerol, sec-O-Glucosylhamaudol, 4'-O-β-D-glucosyl-5-O-methylbisamiminol (4'-O-β-D-glucosyl-5-O -methylvisamminol), prim-O-Glucosylcimifugin, galangin, amentoflavone, 24-methyl-5α-lanosta-9 (11), 25-diene -3α-one (24-Methyl-5α-lanosta-9 (11), 25-dien-3α-one), ursolic acid, oleanolic acid, steigmasterol, β-cytosterol ( β-Sitosterol), gypenoside XVII, 5-O-Methylvisamminol, gallic acid, γ-mangostin, spatula MERS coronavirus helicase nsP13 activity inhibitor comprising lenol (spatulenol) or mariolide or salts thereof.
Mers coronavirus helicase nsP13 activity inhibitor comprising a compound selected from the group consisting of Formulas 1-18 or a salt thereof:
[Formula 1] galangin

,
[Formula 2] amentoflavone

,
Γ-mangostin

,
[Formula 4] 24-Methyl-5α-lanosta-9 (11), 25-dien-3α-one

[Formula 5] Ursolic acid

,
[Formula 6] oleanolic acid

,
Formula 7 stigmasterol

,
[Formula 8] spatulenol

,
[Formula 9] marliolide

,
[Formula 10] icariin

,
1-isomangostin

,
Isovanillyl catalpol

,
[Formula 13] friedelin

,
[Formula 14] imperatorin

,
[Formula 15] ledebouriellol

,
[Formula 16] methoxyeugenol

,
[Formula 17] taraxerol

or
4'-o-β-d-glucosyl-5-o-methylvisamminol

.
The inhibitor according to claim 1 or 2, wherein the compound or a salt thereof inhibits dsRNA unwinding activity or ATP hydrolytic activity of MERS coronavirus helicase nsP13.
According to claim 3, wherein the compound that inhibits the ATP hydrolytic activity of the mers coronavirus helicase nsP13 is 1-isomangosteen, isovanylyl catapol, Friedelin, 24-methyllanosta-9 ( 11), 25-diene-3-one, imperatorin, redvourielol, methoxyeugenol, taraxolol, sec-O-glucosylhamadol, 4'-O-β-D-glucosyl-5- Inhibitors, characterized in that O-methylbisaminol or prim-O-glucosisimipuzzin.
4. The compound according to claim 3, wherein the compound that inhibits the dsRNA unwinding activity of MERS coronavirus helicase nsP13 is galangin, amentoflavone, 24-methyl-5α-lanosta-9 (11), 25-diene. -3α-one, ursolic acid, oleanolic acid, stigmasterol, β-sitosterol, zipenoside XVII, 5-O-methylbisaminol or gallic acid.
4. The inhibitor according to claim 3, wherein the compound which simultaneously inhibits ATP hydrolysis activity and dsRNA unwinding activity of the mers coronavirus nsP13 is γ-mangosteen, spatulenol or marioide.
A pharmaceutical composition for preventing or treating viral diseases comprising the mers coronavirus helicase nsP13 activity inhibitor of claim 1 or 2 as an active ingredient.
A food composition for preventing or ameliorating a viral disease comprising the mers coronavirus helicase nsP13 activity inhibitor of claim 1 or 2 as an active ingredient.
An antiviral agent comprising the mers coronavirus helicase nsP13 activity inhibitor of claim 1 or 2 as an active ingredient.
A virus growth inhibitor comprising the mers coronavirus helicase nsP13 activity inhibitor of claim 1.

Images