WO2021199028A1 - Compositions et méthodes destinées au traitement de la fibrose kystique - Google Patents

Compositions et méthodes destinées au traitement de la fibrose kystique Download PDF

Info

Publication number
WO2021199028A1
WO2021199028A1 PCT/IL2021/050342 IL2021050342W WO2021199028A1 WO 2021199028 A1 WO2021199028 A1 WO 2021199028A1 IL 2021050342 W IL2021050342 W IL 2021050342W WO 2021199028 A1 WO2021199028 A1 WO 2021199028A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
cftr
aso
backbone
exon
Prior art date
Application number
PCT/IL2021/050342
Other languages
English (en)
Inventor
Yifat OREN
Ofra AVITZUR-BARCHAD
Efrat OZERI-GALAI
Original Assignee
Splisense Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Splisense Ltd. filed Critical Splisense Ltd.
Publication of WO2021199028A1 publication Critical patent/WO2021199028A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/33—Alteration of splicing

Definitions

  • the present invention is in the field of antisense oligonucleotides and therapeutic use of the antisense oligonucleotides.
  • Cystic fibrosis is a common, severe autosomal recessive disease caused by mutations in the CFTR gene.
  • the CFTR gene encodes for a chloride channel responsible for chloride transport in epithelial cells.
  • the major manifestations of CF are in the lungs, with more than 90% mortality related to the respiratory disease.
  • the disease in the respiratory tract is linked to the insufficient CFTR function in the airway epithelium.
  • AOs are short synthetic molecules which can anneal to motifs predicted to be involved in the pre-mRNA splicing. The method is based on splice-switching. The AOs binding to selected sites is expected to mask the targeted region and promote either normal splicing or enable specific exclusion or inclusion of selected exons. AOs are highly specific for their targets and do not affect any other sequence in the cells.
  • AO molecules 2'-0-methyl-phosphorothioate (20MP), phosphorodiamidate morpholino oligomer (PMO), peptide nucleic acids (PNAs), 2-methoxyethyl phosphorothioate (MOE), constrained ethyl (cET), Ligand-Conjugated Antisense (LICA) and alternating locked nucleic acids (LNAs).
  • MP 2'-0-methyl-phosphorothioate
  • PMO phosphorodiamidate morpholino oligomer
  • PNAs peptide nucleic acids
  • MOE 2-methoxyethyl phosphorothioate
  • cET constrained ethyl
  • LNAs Ligand-Conjugated Antisense
  • the AOs modifications maintain their stabilization, improve their target affinity, and provide favorable pharmacokinetic properties and biological stability.
  • the potential of ASOs as therapeutics is demonstrated in several human genetic diseases. Among them is spinal muscular atrophy (SMA), in which the inclusion of exon 7 in the gene survival motor neuron 2 (SMN2) leads to full functional protein.
  • SMA spinal muscular atrophy
  • SPINRZA® nusinersen
  • the present invention is directed to a composition and a method of use thereof comprising oligonucleotides capable of binding to a CFTR pre-mRNA, thereby modulating splicing and restoring or enhancing the function of the CFTR gene product.
  • the present invention thus identifies sequences within the CFTR pre-mRNA which are targeted in order to modulate the splicing cascade of the CFTR pre-mRNA.
  • the present invention is based, in part, on the finding that artificial “anti-sense” oligonucleotide (ASO) molecules are able to target and bind predetermined sequences, and this binding can modulate the splicing of the pre-mRNA molecule into a mature mRNA which is subsequently translated into a functional protein in sufficient levels.
  • ASO anti-sense oligonucleotide
  • a method for inducing skipping of exon 23 of the cystic fibrosis transmembrane conductance regulator (CFTR) pre-mRNA in a cell comprising contacting the cell with an effective amount of a synthetic antisense oligonucleotide (ASO) comprising 14-24 contiguous nucleobases having at least 75% complementary to an equal-length portion of a nucleic acid sequence derived from a polynucleotide sequence consisting of: (a)
  • ASO synthetic antisense oligonucleotide
  • a method for treating cystic fibrosis (CF) in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a synthetic antisense oligonucleotide (ASO) comprising 14-24 contiguous nucleobases having at least 75% complementary to an equal-length portion of a nucleic acid sequence derived from a polynucleotide sequence consisting of: (a) UUACCUUAUAGGUGGGCCUUGGGAAGAACUGGAUCAGGGAAGAGUACUU U GUU AU C AGCUUUUU G AG ACU ACU G AAC ACUG A AGG AG A A AU CC AG AU C G AUGGUGU (SEQ ID NO: 1); or (b)
  • ASO synthetic antisense oligonucleotide
  • a pharmaceutical composition comprising an ASO comprising 14 to 24 contiguous nucleobases having at least 80% complementary to an equal-length portion of a nucleic acid sequence derived from a polynucleotide sequence consisting of SEQ ID NO: 1 or SEQ ID NO: 2 and characterized by inducing skipping of exon 23 of said CFTR pre-mRNA, and a pharmaceutically acceptable carrier.
  • kits comprising: (a) at least one ASO; and at least one of: (b) at least one CFTR modifier; or (c) at least one CF drug, wherein the ASO is selected from the group consisting of SEQ ID Nos.: 3-29, and wherein the CFTR modifier is selected from the group consisting of: CFTR potentiator, CFTR corrector, Translational Read-Through agent, and CFTR amplifier.
  • the ASO has at least 75% complementary to an equal- length portion of a nucleic acid sequence derived from a polynucleotide sequence consisting of SEQ ID NO: 1.
  • the ASO has at least 80% complementary to an equal- length portion of a nucleic acid sequence derived from a polynucleotide sequence consisting of SEQ ID NO: 1.
  • the method further comprises administering to the subject a therapeutically effective amount of one or more CFTR modifiers.
  • the CFTR modifier increases the duration of the CFTR gate being open, chloride flow through the CFTR gate, CFTR protein proper folding, the number of CFTR anchored to the cell membrane, or any combination thereof.
  • the CFTR modifier is selected from the group consisting of: potentiator, corrector, and amplifier.
  • the CFTR modifier is ivacaftor, lumacaftor, tezacaftor, elexacaftor, VX-659, VX-152, or VX-440, or any combination thereof.
  • the ASO comprises a chemically modified backbone.
  • the ASO comprises a backbone selected from the group consisting of: a phosphate -ribose backbone, a phosphate-deoxyribose backbone, a phosphorothioate-deoxyribose backbone, a 2'-0-methyl-phosphorothioate backbone, a phosphorodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2- methoxyethyl phosphorothioate backbone, a constrained ethyl backbone, an alternating locked nucleic acid backbone, a phosphorothioate backbone, N3'-P5' phosphoroamidates, 2'-deoxy-2'-fluoro-P-d-arabino nucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclo-DNA (tcDNA) nucleic acid backbone, ligand-conjugated anti
  • the chemically modified backbone comprises: a phosphate-ribose backbone, a phosphate-deoxyribose backbone, a phosphorothioate- deoxyribose backbone, a 2'-0-methyl-phosphorothioate backbone, a phosphorodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2-methoxyethyl phosphorothioate backbone, a constrained ethyl backbone, an alternating locked nucleic acid backbone, a phosphorothioate backbone, N3'-P5' phosphoroamidates, 2'-deoxy-2'-fluoro-P-d-arabino nucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclo-DNA (tcDNA) nucleic acid backbone, ligand-conjugated antisense and a combination thereof.
  • the ASO comprises 17 to 22 bases.
  • the ASO comprises a sequence selected from the group consisting of: SEQ ID Nos.: 3-29.
  • the subject comprises one or more mutations selected from the group consisting of: W1282X, G1244E, T1246I, 3876delA, 3878delG, S 125 IN, L1254X, S1255P, S1255X, 3905insT, D1270N, R1283M, Q1291R, wherein said X denotes translation termination.
  • the subject comprises a mutation in exon 23 of the CFTR pre-mRNA.
  • the subject is heterozygous to a mutation in exon 23 of the CFTR pre-mRNA.
  • the mutation is W1282X, and wherein X denotes translation termination.
  • the ASO comprises a sequence selected from the group consisting of: SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 17, and SEQ ID NO: 23.
  • treating comprises improving at least one clinical parameter of CF selected from the group consisting of: lung function, time to the first pulmonary exacerbation, change in weight, change in height, a change in Body Mass Index (BMI), change in the concentration of sweat chloride, number and/or duration of pulmonary exacerbations, total number of days of hospitalization for pulmonary exacerbations, and the need for antibiotic therapy for sinopulmonary signs or symptoms.
  • CF body Mass Index
  • the ASO has at least 80% complementary to an equal- length portion of a nucleic acid sequence derived from a polynucleotide sequence consisting of SEQ ID NO: 1.
  • the ASO is characterized by inducing the skipping preferentially of a mutated exon 23 of said CFTR pre-mRNA over an exon 23 of said CFTR pre-mRNA being devoid of said mutation, and a pharmaceutically acceptable carrier.
  • the CFTR pre-mRNA devoid of the mutation comprises a wildtype exon 23.
  • the pharmaceutical composition is for use in inducing the skipping of exon 23 of the CFTR pre-mRNA.
  • the pharmaceutical composition is an inhalation composition.
  • the pharmaceutical composition is for use in the treatment of CF in a subject in need thereof.
  • the pharmaceutical composition is for use in the induction of skipping of a mutated exon 23 of the CFTR pre-mRNA in a subject in need thereof, wherein the mutated exon 23 comprises a W1282X mutation, and wherein X denotes translation termination.
  • the CF drug is an antibiotic drug, a bronchodilator, a corticosteroid, or any combination thereof.
  • the kit is for use in the treatment of CF in a subject being heterozygous to a W 1282X mutation in exon 23 of the CFTR pre-mRNA, wherein X denotes translation termination.
  • Figs. 1A-1C include micrographs of gel electrophoresis analyses (1A) and graphs (1B-1C) showing fold change of transcript levels without (IB) or with (1C) exon 23 of the CFTR pre-mRNA.
  • IB White bars - at least 50% skipping; black bars - less than 50% skipping.
  • Figs. 2A-2B include micrographs of gel electrophoresis comparative skipping specificity analyses in a W1282X allele (2A) and a wildtype (WT) allele (2B).
  • Fig. 3 includes a graph showing quantification of the level of exon 23 deleted mature CFTR (Band C) that were produced following treatment with positive ASOs as percentage from WT band C CFTR. Ten to twenty-five (10-25) % of WT CFTR expression levels have been found in individuals that do not have CF lung disease.
  • Figs. 4A-4B include a micrograph of gel electrophoresis analysis (4A) and a vertical bar graph (4B) showing specificity analysis for the positive ASOs identified in the herein disclosed screen.
  • the analysis was performed in F508del, WT and W1282Xcells.
  • SPL23-47 serves as a positive control for a non-specific ASO (corresponds to SEQ ID NO: 24), and SPL23-2 and SPL23-3 (corresponding to SEQ ID Nos.: 34 and 35, respectively), which hybridize to the sequence encoding the W 1282X mutation, served as positive controls for allele specific skipping.
  • SPL23-28 (SEQ ID NO: 5), SPL23-40 (SEQ ID NO: 17), and SPL23-46 (SEQ ID NO: 23) showed at least 73% skipping in W1282X cells and not more than 30% skipping in WT and F508del cells.
  • Figs. 5A-5B include micrographs of western blot analyses in WT cells (5A) and F508del cells (5B) showing specificity analysis at the CFTR protein level.
  • SPL23-47 serves as a positive control for a non-specific ASO (corresponds to SEQ ID NO: 24). Transfection with this ASO leads to the generation of deleted Band B (B’).
  • SPL23-2 and SPL23-3 (corresponding to SEQ ID Nos.: 34 and 35, respectively), which hybridize to the sequence encoding the W1282X mutation, served as positive controls for allele specific skipping.
  • These ASOs lead to the generation of very weak band B’ in WT cells and no B’ band in F508del cells.
  • a method for inducing skipping of exon 23 of the cystic fibrosis transmembrane conductance regulator (CFTR) pre-mRNA in a cell comprising contacting the cell with an effective amount of a synthetic antisense oligonucleotide (ASO) comprising 14-24 contiguous nucleobases having at least 75% complementary to an equal-length portion of a nucleic acid sequence derived from a polynucleotide sequence consisting of: (a)
  • the method comprises contacting a cell with
  • the method comprises contacting a cell with an effective amount of an ASO having at least 75% complementary to an equal-length portion of a nucleic acid sequence derived from a polynucleotide sequence consisting of: UUACCUUAUAGGUGGGCCUCUUGGGAAGAACUGGAUCAGGGAAGAGUACUU U GUU AU C AGCUUUUUU GAG ACU ACU G AAC ACUG A AGG AG A A AU CC AG AU C G AUGGUGU (SEQ ID NO: 1).
  • contacting comprises contacting in vivo, in vitro, or ex vivo.
  • the ASO is introduced into a cell mixed with an
  • a method for treating cystic fibrosis (CF) in a subject in need thereof comprises administering to the subject a therapeutically effective amount of a synthetic ASO comprising 14-24 contiguous nucleobases having at least 75% complementary to an equal- length portion of a nucleic acid sequence derived from a polynucleotide sequence consisting of: (a) SEQ ID NO: 1; or (b) SEQ ID NO: 2, wherein the ASO induces the skipping of exon 23 of the cystic fibrosis transmembrane conductance regulator (CFTR) pre-mRNA, thereby treating CF in the subject.
  • CFTR cystic fibrosis transmembrane conductance regulator
  • the method comprises administering to the subject a therapeutically effective amount of an ASO having at least 75% complementary to an equal- length portion of a nucleic acid sequence derived from a polynucleotide sequence consisting of:
  • the ASO has at least 75% complementary to an equal- length portion of a nucleic acid sequence derived from a polynucleotide sequence consisting of:
  • the method further comprises administering to the subject a therapeutically effective amount of one or more CFTR modifiers.
  • the cell is derived form a subject as described herein.
  • the cell comprises a cell line or a culture thereof.
  • the cell is an epithelial cell.
  • an epithelial cell comprises a respiratory epithelial cell.
  • a respiratory epithelial cell is derived from the upper respiratory system.
  • a respiratory epithelial cell is a ciliated columnar epithelial cell.
  • a respiratory epithelial cell is a ciliated pseudostratified columnar epithelial cell.
  • a respiratory epithelial cell is selected from: a ciliated cell, a goblet cell, a club cell, an airway basal cell, or any combination thereof.
  • the CFTR modifier increases the duration of the CFTR gate being open, chloride flow through the CFTR gate, CFTR protein proper folding, the number of CFTR anchored to the cell membrane, or any combination thereof.
  • the modifier is selected from: potentiator, corrector, and amplifier.
  • the term "potentiator” refers to any agent that increases the probability that a defective CFTR will be open and therefore allows chloride ions to pass through the channel pore.
  • the term “corrector” refers to any agent that assists in proper CFTR channel folding so as to enable its trafficking to the cell membrane.
  • the term "amplifier” refers to any agent that induces a cell to increase its CFTR protein production rates or yields, therefore resulting in an increased amount of the CFTR protein.
  • the modifier is selected from ivacaftor, lumacaftor, tezacaftor, elexacaftor, VX-659, VX-152, or VX-440.
  • the modifier is ivacaftor, lumacaftor, tezacaftor, elexacaftor, VX-659, VX-152, or VX-440, or any combination thereof.
  • the method comprises administering a splicing modulator which is a synthetic antisense oligonucleotide (ASO).
  • a splicing modulator which is a synthetic antisense oligonucleotide (ASO).
  • the ASO is chemically modified.
  • the chemical modification is a modification of a backbone of the ASO.
  • the chemical modification is a modification of a sugar of the ASO.
  • the chemical modification is a modification of a nucleobase of the ASO.
  • the chemical modification increases stability of the ASO in a cell.
  • the chemical modification increases stability of the ASO in vivo.
  • the chemical modification increases the ASO’s ability to modulate splicing.
  • the chemical modification increases the ASO’s ability to induce skipping of exon 23.
  • the chemical modification increases the half-life of the ASO.
  • the chemical modification inhibits polymerase extension from the 3’ end of the ASO. In some embodiments, the chemical modification inhibits recognition of the ASO by a polymerase. In some embodiments, the chemical modification inhibits double-strand trigged degradation. In some embodiments, the chemically modified ASO does not trigger nucleic acid double-stranded degradation upon binding a CFTR pre-mRNA. In some embodiments, the chemical modification inhibits RISC-mediated degradation. In some embodiments, the chemical modification inhibits RISC-mediated degradation or any parallel nucleic acid degradation pathway.
  • the ASO is devoid of a labeling moiety. In some embodiments, the ASO is not labeled. In some embodiments, the ASO does not emit a detectable signal or does not comprise moieties capable of being recognized so as to enable nucleic acid detection (e.g., digoxigenin and fluorescently labeled anti-DIG antibody). In some embodiments, a detectable signal comprises a dye or an emitting energy which provides detection of a compound, e.g., a polynucleotide, in vivo or in vitro. In some embodiments, a detectable signal comprises: a fluorescent signal, a chromatic signal, or a radioactive signal.
  • the ASO is devoid of radioactive nucleobase(s); digoxigenin, streptavidin, biotin, a fluorophore, hapten label, CLICK label, amine label, or thiol label.
  • the chemical modification is selected from: a phosphate- ribose backbone, a phosphate-deoxyribose backbone, a phosphorothioate-deoxyribose backbone, a 2'-0-methyl-phosphorothioate backbone, a phosphorodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2-methoxyethyl phosphorothioate backbone, a constrained ethyl backbone, an alternating locked nucleic acid backbone, a phosphorothioate backbone, N3'-P5' phosphoroamidates, 2 ' - dco x y - 2 ' - fl uo ro - b - d - a ra b i n o nucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclohexene nucleic acid
  • the ASO comprises at least 14 bases, at least 15 bases, at least 16 bases, at least 17 bases, at least 18 bases, at least 19 bases, at least 20 bases, at least 21 bases, at least 22 bases, at least 23 bases, at least 23 bases, or at least 25 bases, or any value and range therebetween.
  • Each possibility represents a separate embodiment of the invention.
  • the ASO comprises 14 to 25 bases, 14 to 23 bases, 14 to 23 bases, 14 to 22 bases, 14 to 21 bases, 14 to 20 bases, 14 to 19 bases, or 14 to 18 bases, or 14 to 17 bases.
  • the ASO comprises 17 to 22 bases.
  • the ASO is complementary to an equal-length portion of a sequence derived from a polynucleotide sequence consisting of: UUACCUUAUAGGUGGGCCUCUUGGGAAGAACUGGAUCAGGGAAGAGUACUU U GUU AU C AGCUUUUU G AG ACU ACU G AAC ACUG A AGG AG A A AU CC AG AU C G AUGGUGU (SEQ ID NO: 1).
  • an ASO complementary to an equal- length portion of a sequence consisting of SEQ ID NO: 1 comprises 14-24 bases.
  • the ASO is complementary to an equal-length portion of a sequence derived from a polynucleotide sequence consisting of: AGGAAAGCCUUU GGAGU GAU ACC AC AGGU GAGC A (SEQ ID NO: 2).
  • an ASO complementary to an equal-length portion of a sequence consisting of SEQ ID NO: 2 comprises 14-26 bases.
  • an ASO complementary to an equal-length portion of a sequence consisting of SEQ ID NO: 2 comprises at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, or at least 26 bases, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.
  • the ASO has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementarity to an equal-length portion of a sequence derived from SEQ ID NO: 1 or SEQ ID NO: 2, or any value and range therebetween.
  • the ASO has 70-80%, 75-85%, 80-90%, 85-95%, 90-99%, or 95-100% complementarity to an equal-length portion of a sequence derived from SEQ ID NO: 1 or SEQ ID NO: 2.
  • Each possibility represents a separate embodiment of the invention.
  • Complementary refers to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes.
  • Watson-Crick manner e.g., A to T, A to U, C to G
  • uracil rather than thymine is the base that is considered to be complementary to adenosine.
  • a U is denoted in the context of the present invention, the ability to substitute a T is implied, unless otherwise stated.
  • the ASO comprises or consists of a sequence selected from: GAGGCCCACCUAUAAGGUAA (SEQ ID NO: 3),
  • UUCUUCCCAAGAGGCCCACCUA (SEQ ID NO: 4), UUCUUCCCAAGAGGCCCA (SEQ ID NO: 5), AUCCAGUUCUUCCCAAGAGG (SEQ ID NO: 6),
  • GAU A AC A A AGU ACU CUU CCCUG (SEQ ID NO: 11), GCU G AU A AC A A AGU ACU CUU C (SEQ ID NO: 12),
  • CUUC AGU GUU C AGU AGU CUC (SEQ ID NO: 19), UCUCCUUCAGUGUUCAGUAG (SEQ ID NO: 20), GAUUUCUCCUUCAGUGUUCAG (SEQ ID NO: 21), UCUGGAUUUCUCCUUCAGUG (SEQ ID NO: 22), GAUCUGGAUUUCUCCUUC (SEQ ID NO: 23), ACCAUCGAUCUGGAUUUCUC (SEQ ID NO: 24), ACACCAUCGAUCUGGAUU (SEQ ID NO: 25), UCACUCCAAAGGCUUUCC (SEQ ID NO: 26), GUGGUAUCACUCCAAAGGC (SEQ ID NO: 27), ACCUGUGGUAUCACUCCA (SEQ ID NO: 28), or UGCUCACCUGUGGUAUCA (SEQ ID NO: 29).
  • the ASO comprises or consists of a sequence selected from: SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 17, or SEQ ID NO: 23.
  • the ASO comprising or consisting of a sequence selected from: SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 17, or SEQ ID NO: 23, are for use in inducing the skipping of a mutated exon 23 comprising the W1282X mutation, wherein X denotes translation termination.
  • the ASO is complementary to a nucleic acid sequence starting at nucleobase at position 4 at the 5’ end of SEQ ID NO: 1 and ending at a nucleobase in a position selected from: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27, from the 5’ end of SEQ ID NO: 1.
  • the ASO is complementary to a nucleic acid sequence starting at nucleobase at position 5 at the 5’ end of SEQ ID NO: 1 and ending at a nucleobase in a position selected from: 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28, from the 5’ end of SEQ ID NO: 1.
  • the ASO is complementary to a nucleic acid sequence starting at nucleobase at position 30 at the 5’ end of SEQ ID NO: 1 and ending at a nucleobase in a position selected from: 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53, from the 5’ end of SEQ ID NO: 1.
  • the ASO is complementary to a nucleic acid sequence starting at nucleobase at position 31 at the 5’ end of SEQ ID NO: 1 and ending at a nucleobase in a position selected from: 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 or 54, from the 5’ end of SEQ ID NO: 1.
  • the ASO does not consist of a sequence selected from: AUCCAGUUCUUCCCAAGAGGCCCAC (SEQ ID NO: 30),
  • the ASO does not consist a sequence selected from: UCCUCCACUGUUGCA (SEQ ID NO: 36), UUCCUCCACUGUUGC (SEQ ID NO: 37), UUUCCUCCACUGUUG (SEQ ID NO: 38), CUUUCCUCCACUGUU (SEQ ID NO: 39), GCUUUCCUCCACUGU (SEQ ID NO: 40), GGCUUUCCUCCACUG (SEQ ID NO: 41), AGGCUUUCCUCCACU (SEQ ID NO: 42), AAGGCUUUCCUCCAC (SEQ ID NO: 43), AAAGGCUUUCCUCCA (SEQ ID NO: 44), CAAAGGCUUUCCUCC (SEQ ID NO: 45), CCAAAGGCUUUCCUC (SEQ ID NO: 46), UCCAAAGGCUUUCCU (SEQ ID NO: 47), CUCCAAAGGCUUUCC (SEQ ID NO: 48), ACUCCAAAGGCUUUC (SEQ ID NO: 49
  • the ASO is complementary to the CFTR pre-mRNA (Accession number NM_000492).
  • the pre-mRNA is a wildtype pre- mRNA.
  • the pre-mRNA is a mutated pre-mRNA.
  • the CFTR pre-mRNA comprises any one of: SEQ ID NO: 1 and SEQ ID NO:
  • a mutated pre-mRNA comprises at least one mutation in exon 23 of the CFTR pre-mRNA. In some embodiments, a mutated pre-mRNA comprises at least one nonsense mutation in exon 23 of the CFTR pre-mRNA. In some embodiments, the at least one mutation in exon 23 of the CFTR pre-mRNA is or comprises W1282X, wherein X denotes translation termination.
  • the ASO is specific to a CFTR pre-mRNA. As used herein, the term “specific” refers to both base pair specificity and also gene specificity. In some embodiments, the ASO is specific to the CFTR gene.
  • the ASO is specific to a splice enhancing motif in CFTR. In some embodiments, the ASO is specific to a splice enhancing sequence is CFTR. In some embodiments, the ASO is specific to a splice enhancing region of CFTR. In some embodiments, the splice silencing is splice silencing of exon 23 of CFTR. In some embodiments, the binding of an ASO to a splicing enhancer induces exon skipping, e.g., exon 23 as described herein. In some embodiments, the binding of an ASO to a splicing enhancer results in splice silencing of an exon, e.g., exon 23 as described herein.
  • the ASO binds the CFTR pre-mRNA with perfect complementarity .
  • the ASO does not bind any gene product other than CFTR with perfect complementarity. In some embodiments, the ASO does not bind any gene other than CFTR with a complementarity of greater than 70, 75, 80, 85, 90, 95, 97, 99 or 100%. Each possibility represents a separate embodiment of the invention. In some embodiments, the ASO does not bind any gene other than CFTR with a complementarity of greater than 90%. In some embodiments, the ASO binds to: SEQ ID NO: 1 or SEQ ID NO: 2 with perfect complementarity. In some embodiments, the ASO does not bind to any sequence other than SEQ ID NO: 1 or SEQ ID NO: 2 with perfect complementarity.
  • the ASO does not bind to any sequence other than SEQ ID NO: 1 or SEQ ID NO: 2 with complementarity of greater than 70, 75, 80, 85, 90, 95, 97, 99 or 100%.
  • each possibility represents a separate embodiment of the invention.
  • the ASO does not bind to any sequence other than SEQ ID NO: 1 or SEQ ID NO: 2 with a complementarity of greater than 90%.
  • the ASO does not bind with perfect complementarity to anywhere in the genome of a cell other than within CFTR.
  • the ASO does not bind with complementarity of greater than 70, 75, 80, 85, 90, 95, 97, 99 or 100% to anywhere in the genome of a cell other than within CFTR.
  • the cell is a mammalian cell.
  • the mammal is a human.
  • the ASO may bind to an intronic sequence in the CFTR pre-mRNA.
  • the binding of an ASO to an intronic sequence in the CFTR pre-mRNA does not induce skipping of exon 23.
  • the ASO may partially or fully bind (e.g., complement) to an intronic sequence within a gene other than CFTR.
  • an ASO partially or fully binding to an intronic sequence within a gene other than CFTR does not induce splicing or modifies transcription. In some embodiments, an ASO partially or fully binding to an intronic sequence within a gene other than CFTR binds to an intronic sequence being distant from an exon, an intro-exon junction, or both.
  • distant comprises at least 50 base pairs (bp), at least 100 bp, at least 200 bp, at least 350 bp, at least 500 bp, at least 750 bp, at least 1,000 bp, at least 2,000 bp, at least 3,500 bp, at least 5,000 bp, at least 7,500 bp, or at least 10,000 bp upstream to an exon, an intro-exon junction, or both, or downstream to an exon, an intro-exon junction, or both, or any value and range therebetween.
  • bp base pairs
  • the ASO modulates expression of CFTR. In some embodiments, the ASO modulates splicing of CFTR. In some embodiments, the ASO modulates splicing of exon 23 of CFTR. In some embodiments, the ASO does not cause an off-target effect. In some embodiments, off-target is a target other than CFTR. In some embodiments, off-target is a target other than splicing of exon 23 of CFTR. In some embodiments, the ASO does not substantially or significantly modulate expression of a gene other than CFTR. In some embodiments, the ASO does not substantially or significantly modulate splicing of a gene other than CFTR.
  • the ASO does not substantially or significantly modulate splicing of an exon other than exon 23 of CFTR.
  • substantial modulation of expression is a change in expression of at least 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50%. Each possibility represents a separate embodiment of the invention. In some embodiments, substantial modulation of expression is a change in expression of at least 20%.
  • the ASO comprises an active fragment of any one of SEQ ID Nos: 3-29.
  • the term “active fragment” refers to a fragment that is 100% identical to a contiguous portion of the full nucleotide sequence of the ASO, providing that at least: 30%, 40%, 50%, 60%, 70%, 80% or 90% of the activity of the original ASO nucleotide sequence is retained, or any value and range therebetween. Each possibility represents a separate embodiment of the present invention.
  • the subject comprises a mutation. In some embodiments, the subject comprises a missense mutation. In some embodiments, the subject comprises a nonsense mutation. In some embodiments, the subject comprises a substitution mutation in the CFTR encoding gene, pre-mRNA encoded therefrom, or protein product thereof.
  • the subject comprises one or more mutations selected from: W1282X, G1244E, T1246I, 3876delA, 3878delG, S 125 IN, L1254X, S1255P, S1255X, 3905insT, D1270N, R1283M, Q1291R, wherein said X denotes translation termination.
  • the subject comprises a wild type (i.e., not mutated) exon 23.
  • the subject comprises at least one CF-inducing mutation residing in the CFTR gene, or mRNA transcribed therefrom, wherein the mutation does not reside in exon 23, affect exon 23 inclusion or exclusion from the mature mRNA, or both.
  • the subject comprises both a wildtype exon 23, and at least one CF-inducing mutation residing in the CFTR gene, or mRNA transcribed therefrom, wherein the mutation does not reside in exon 23, affect exon 23 inclusion or exclusion from the mature mRNA, or both.
  • the subject is homozygous to one or more of the aforementioned mutations. In some embodiments, the subject is heterozygous to one or more of the aforementioned mutations.
  • a subject treated according to the method of the invention comprises, or is characterized by having a mixture of a wild type full-length and fully functional CFTR protein encoded from the wild type allele and a deleterious CFTR protein encoded from the pre-mRNA from which exon 23 was excluded using the ASO of the invention.
  • the subject is further heterozygous to additional one or more mutations, wherein the additional one or more mutations is located in the CFTR pre-mRNA in an exon other than exon 23.
  • the subject is homozygous or heterozygous to the one or more CF-conferring mutations disclosed herein, e.g., W1282X, and is further heterozygous to an additional one or more mutations located in any exon of the CFTR pre-mRNA other than exon 23.
  • the method comprises treating CF in a subject being heterozygous to a mutation in exon 23 of the CFTR pre-mRNA with an effective amount of an ASO comprising a sequence selected from: SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 17, or SEQ ID NO: 23.
  • the method comprises treating CF in a subject being heterozygous to the W 1282X mutation in exon 23 of the CFTR pre-mRNA with an effective amount of an ASO comprising a sequence selected from: SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 17, or SEQ ID NO: 23, wherein X denotes translation termination.
  • a mutation refers to any nucleotide substitution or modification which renders a partially or fully non-functional CFTR protein.
  • a mutation refers to a nucleotide substitution or modification which induces or results in a "Cystic fibrosis phenotype" in a subject harboring or comprising the mutation.
  • a modification comprises insertion, deletion, inversion, or a combination thereof, as long as the modification results in a Cystic fibrosis phenotype in a subject harboring or comprising the modification.
  • Cystic fibrosis phenotype encompasses any symptom or manifestation related to Cystic fibrosis. Methods for diagnosing Cystic fibrosis and/or symptoms associated therewith are common and would be apparent to one of ordinary skill in the art.
  • the subject comprises a Tryptophan substituted with a translation termination codon in the CFTR protein.
  • the subject comprises a substitution in position 1282 of the CFTR protein.
  • the subject comprises a W1282X substitution in the CFTR protein, wherein the X denotes translation termination.
  • the subject is afflicted with Cystic fibrosis.
  • the method is directed to improving at least one clinical parameter of CF in the subject, selected from: lung function, time to the first pulmonary exacerbation, change in weight, change in height, a change in Body Mass Index (BMI), change in the concentration of sweat chloride, number and/or duration of pulmonary exacerbations, total number of days of hospitalization for pulmonary exacerbations, or the need for antibiotic therapy for sinopulmonary signs or symptoms.
  • at least one clinical parameter of CF in the subject selected from: lung function, time to the first pulmonary exacerbation, change in weight, change in height, a change in Body Mass Index (BMI), change in the concentration of sweat chloride, number and/or duration of pulmonary exacerbations, total number of days of hospitalization for pulmonary exacerbations, or the need for antibiotic therapy for sinopulmonary signs or symptoms.
  • BMI Body Mass Index
  • treatment encompasses alleviation of at least one symptom thereof, a reduction in the severity thereof, or inhibition of the progression thereof. Treatment need not mean that the disease, disorder, or condition is totally cured.
  • a useful composition herein needs only to reduce the severity of a disease, disorder, or condition, reduce the severity of symptoms associated therewith, or provide improvement to a patient or subject’s quality of life.
  • condition includes anatomic and physiological deviations from the normal that constitute an impairment of the normal state of the living animal or one of its parts, that interrupts or modifies the performance of the bodily functions.
  • the terms “subject” or “individual” or “animal” or “patient” or “mammal,” refers to any subject, particularly a mammalian subject, for whom therapy is desired, for example, a human.
  • composition comprising the herein disclosed ASO.
  • the composition further comprises a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier refers to any of the standard pharmaceutical carriers known in the field such as sterile solutions, tablets, coated tablets, and capsules. Typically, such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acids, or salts thereof, magnesium or calcium stearate, talc, vegetable fats or oils, gums, glycols, or other known excipients. Such carriers may also include flavor and color additives or other ingredients. Examples of pharmaceutically acceptable carriers include, but are not limited to, the following: water, saline, buffers, inert, nontoxic solids (e.g., mannitol, talc).
  • compositions comprising such carriers are formulated by well-known conventional methods.
  • the compositions may be in the form of solid, semi-solid, or liquid dosage forms, such, for example, as powders, granules, crystals, liquids, suspensions, liposomes, nanoparticles, nano-emulsions, pastes, creams, salves, etc., and may be in unit-dosage forms suitable for administration of relatively precise dosages.
  • the pharmaceutical composition is formulated for oral, administration. In some embodiments, the pharmaceutical composition is formulated for nasal administration. In some embodiments, the pharmaceutical composition is formulated for administration by inhalation. In some embodiments, the pharmaceutical composition is formulated for abdominal administration. In some embodiments, the pharmaceutical composition is formulated for subcutaneous administration. In some embodiments, the pharmaceutical composition is formulated for intra-peritoneal administration. In some embodiments, the pharmaceutical composition is formulated for intravenous administration.
  • the pharmaceutical composition is formulated for systemic administration. In some embodiments, the pharmaceutical composition is formulated for administration to a subject. In some embodiments, the subject is a human subject. It will be understood by a skilled artisan that a pharmaceutical composition intended to administration to a subject should not have off-target effects, e.g., effects other than the intended therapeutic ones. In some embodiments, the pharmaceutical composition is devoid of a substantial effect on a gene other than CFTR. In some embodiments, the pharmaceutical composition is devoid of a substantial effect on splicing of an exon other than exon 23 of CFTR. In some embodiments, a substantial effect is one with a phenotypic result. In some embodiments, a substantial effect is a deleterious effect. In some embodiments, deleterious is with respect to the health and/or wellbeing of the subject.
  • the composition administered by inhalation is an inhalation composition in some embodiments, the composition is a pharmaceutical composition.
  • the composition further comprises at least one additional anti-Cystic-Fibrosis agent (i.e., CF drug).
  • the additional anti-Cystic - Fibrosis agent is selected from: a CFTR-splicing-modulator (e.g., an ASO as disclosed and as described herein), Translational Read-Through agent, sodium epithelial channel (ENaC) inhibitor, a CFTR amplifier, a CFTR potentiator, or a CFTR corrector.
  • the CFTR-splicing-modulator has capability to induce or promote exon 23 exclusion from the mature CFTR mRNA;
  • the Translational Read-Through agent is selected from 3-[5-(2-fluorophenyl)-l,2,4-oxadiazol-3-yl]benzoic acid (Ataluren), or ELX-02;
  • the ENaC inhibitor is selected from: VX-371 (P-1037) or IONIS-ENAC-2.5Rx;
  • the CFTR amplifier is PTI-428;
  • the CFTR potentiator is selected from: N-(2,4-Di-tert-butyl-5- hydroxyphenyl)-4-oxo-l,4-dihydroquinoline-3-carboxamide (Ivacaftor), QBW251, PTI- 808, or VX-561 (deuterated ivacaftor);
  • the CFTR potentiator is N-(2,4-Di-tert-butyl-5
  • the pharmaceutical composition comprises the synthetic ASO of the invention.
  • the composition comprises at the ASO in an amount of at least 1 nM, at least 2.5 nM, at least 10 nM, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.
  • the composition comprises at the ASO in an amount of 2.5 nM to 10 nM, 1 nM to 100 nM, 1 nM to 0.5 mM, or 1 nM to 1 mM. Each possibility represents a separate embodiment of the invention.
  • an ASO as disclosed and as described hereinabove, or a pharmaceutical composition comprising thereof is used in the modulation of splicing of a CFTR pre-mRNA transcribed from a CFTR gene.
  • modulation of splicing refers to affecting a change in the level of any RNA or mRNA variant produced by the CFTR native pre-mRNA.
  • modulation may mean e.g., causing an increase or decrease in the level of abnormal CFTR mRNA, causing an increase or decrease in the level of normal, full-length CFTR mRNA, causing an increase or decrease in the level of abnormal CFTR RNA or mRNA comprising a missense codon, and/or causing an increase or decrease in the level of abnormal CFTR RNA or mRNA comprising a premature termination codon (non-sense codon).
  • modulation means decreasing the level of abnormal CFTR mRNA.
  • the abnormal CFTR mRNA comprises a mutated exon 23.
  • modulation means decreasing the level of an abnormal CFTR mRNA comprising a mutated exon 23.
  • modulation means decreasing the level of an abnormal CFTR mRNA comprising a W1282X mutation, wherein the X denotes translation termination.
  • the use is for reducing the level of an mRNA molecule comprising the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the use is for increasing the level of CFTR mRNA lacking exon 23. In some embodiments, the use is for correcting or improving chloride transport through the CFTR channel. In some embodiments, the use is for increasing the production of functional CFTR protein. In some embodiments, the use is for increasing the duration of the CFTR gate being open. In some embodiments, the use is for increasing the chloride flow through the CFTR gate. In some embodiments, the use is for increasing the CFTR protein proper folding. In some embodiments, the use is for increasing the number of CFTR anchored to the cell membrane.
  • an ASO as disclosed and as described hereinabove, or a pharmaceutical composition comprising thereof is used for improving at least one clinical parameter of Cystic Fibrosis.
  • an ASO as disclosed and as described hereinabove, or a pharmaceutical composition comprising thereof is used in treating of CF.
  • the pharmaceutical composition comprises an ASO being characterized by inducing the skipping preferentially of a mutated exon 23 of the CFTR pre-mRNA over an exon 23 of the CFTR pre-mRNA being devoid of the mutation.
  • preferentially comprises by at least 5% more, at least 10% more, at least 20% more, at least 40% more, at least 50% more, at least 70% more, at least 90% more, at least 100% more, at least 200% more, at least 300% more, at least 450% more, at least 500% more, at least 650% more, at least 750% more, at least 850% more, at least 900% more, at least 950% more, at least 970% more, or at least 1,000% more, or any value and range therebetween.
  • Each possibility represents a separate embodiment of the invention.
  • the CFTR pre-mRNA is devoid of a mutation. In some embodiments, the CFTR pre-mRNA is devoid of the W1282X mutation. In some embodiments, the CFTR pre-mRNA is a wildtype CFTR pre-mRNA.
  • composition comprising an ASO comprising a sequence selected from: SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 17, or SEQ ID NO: 23.
  • a pharmaceutical composition comprising an ASO comprising a sequence selected from: SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 17, or SEQ ID NO: 23 for use in the induction of skipping of a mutated exon 23 of the CFTR pre-mRNA in a subject in need thereof.
  • the subject is characterized by having or comprising a mutated exon 23. In some embodiments, the subject is characterized by having or comprising a mutated exon 23 comprising a W1282X mutation.
  • a pharmaceutical composition comprising an ASO comprising a sequence selected from: SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 17, or SEQ ID NO: 23 for use in the induction of skipping of a mutated exon 23 of the CFTR pre-mRNA in a subject being heterozygous to the W 1282X mutation in exon 23 of the CFTR pre-mRNA.
  • the present invention provides combined preparations.
  • a combined preparation defines especially a “kit of parts” in the sense that the combination partners as defined above can be dosed independently or by use of different fixed combinations with distinguished amounts of the combination partners i.e., simultaneously, concurrently, separately, or sequentially.
  • the parts of the kit of parts can then, e.g., be administered simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts.
  • the ratio of the total amounts of the combination partners in some embodiments, can be administered in the combined preparation.
  • the kit of the invention comprises: at least one ASO; and at least one of: at least one CFTR modifier; or at least one CF drug, wherein the ASO is selected from SEQ ID Nos.: 3-29, and wherein the CFTR modifier is selected from: CFTR potentiator, CFTR corrector, and CFTR amplifier.
  • the CF drug is an antibiotic drug, a bronchodilator, a corticosteroid, or any combination thereof.
  • CF drugs such as an antibiotic, a bronchodilator, and a corticosteroid
  • CF drugs such as antibiotics include, but are not limited to, cloxacillin, dicloxacillin, cephalosporin, trimethoprim, sulfamethoxazole, erythromycin, amoxicillin, clavulanate, ampicillin, tetracycline, linezolid, tobramycin or aztreonam lysine, fluoroquinolone, gentamicin, and monobactam with antipseudomonal activity.
  • the components of the kit disclosed above are sterile.
  • sterile refers to a state of being free from biological contaminants. Any method of sterilization is applicable and would be apparent to one of ordinary skill in the art.
  • the components of the kit are packaged within a container.
  • the container is made of a material selected from the group consisting of thin-walled film or plastic (transparent or opaque), paperboard -based, foil, rigid plastic, metal (e.g., aluminum), glass, etc.
  • the content of the kit is packaged, as described below, to allow for storage of the components until they are needed.
  • kits may be packaged in suitable packaging to maintain sterility.
  • the components of the kit are stored in separate containers within the main kit containment element e.g., box or analogous structure, may or may not be an airtight container, e.g., to further preserve the sterility of some or all of the components of the kit.
  • the instructions may be recorded on a suitable recording medium or substrate.
  • the instructions may be printed on a substrate, such as paper or plastic, etc.
  • the instructions may be present in the kit as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or sub-packaging) etc.
  • the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g., CD-ROM, diskette, etc.
  • the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g., via the internet, are provided.
  • An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.
  • the method comprises obtaining a compound that binds to exon 23 of the CFTR pre-mRNA. In some embodiments, the method comprises assaying the skipping of exon 23 of the CFTR pre-mRNA in the presence of the obtained compound. In some embodiments, the method comprises selecting at least one compound that induces the exclusion of exon 23 from the CFTR pre-mRNA.
  • the method comprises obtaining a compound that binds to exon 23 of the CFTR pre-mRNA, and assaying the skipping of exon 23 of the CFTR pre- mRNA in the presence of the obtained compound, and selecting at least one compound that induces the exclusion of exon 23 from the CFTR pre-mRNA, thereby producing a compound suitable for treating CF.
  • the method comprises obtaining a compound that binds to SEQ ID NO: 1 or SEQ ID NO: 2.
  • the compound is an ASO.
  • the ASO is an ASO as disclosed and as described herein.
  • Methods of assaying exon skipping are common. Non-limiting examples of such methods include, but are not limited to, PCR, qPCR, gene sequencing, northem-blot, dot-blot, in situ hybridization, or others all of which would be apparent to one of ordinary skill in the art.
  • adjectives such as “substantially” and “about” modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention are understood to mean that the condition or characteristic is defined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended.
  • the word “or” in the specification and claims is considered to be the inclusive “or” rather than the exclusive or, and indicates at least one of, or any combination of items it conjoins.
  • each of the verbs, “comprise”, “include” and “have” and conjugates thereof, are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject or subjects of the verb.
  • the terms “comprises”, “comprising”, “containing”, “having” and the like can mean “includes”, “including”, and the like; “consisting essentially of or “consists essentially” likewise has the meaning ascribed in U.S. patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.
  • the terms “comprises”, “comprising”, “having” are/is interchangeable with “consisting of”.
  • the inventors used a cellular system that was developed in the CFFT lab, 16HBEge W1282X.
  • the cellular system is based on an immortalized bronchial epithelial cell line which has endogenous WT CFTR containing all exonic and intronic sequences (16HBE14o-) (Cozens et al.,).
  • 16HBE14o- are genetically engineered using CRISPR-based gene editing to establish an isogenic cell line homozygous for the CFTR W1282X mutation (16HBEge W1282X) (Valley et al.,).
  • Each ASO is transfected into 16HBEge W1282X cells using Lipofecatmine 2000 transfection reagent (Invitrogen) according to the lipofectamine 2000 reagent protocol. In each experiment the effect of different ASOs is analyzed in comparison to cells treated with a control ASO.
  • RNA concentration is determined using a nanodrop.
  • Complementary DNA (cDNA) synthesis is performed using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems). The cDNA is analyzed by PCR.
  • PCR is performed using the PlatinumTM SuperFiTM Green PCR Master Mix 12359-10 (Invitrogen). PCR products are then separated on an agarose gel for detection of the correctly and aberrantly spliced transcripts. The gels are exposed to UV light for visualization and the PCR products are recorded.
  • ASOs complementary to SEQ ID NO: 1 or SEQ ID NO: 2 were found to be more effective in inducing exon 23 skipping (Fig. 1), compared to neighboring sequences flanking SEQ ID Nos.: 1 and 2 on the CFTR pre-mRNA.
  • ASOs induce skipping of exon 23 preferentially from mutated allele over a wildtype allele
  • SPL-23-28, SPL-23-40, and SPL-23-46 (corresponding to SEQ ID Nos.: 5, 17, and 23, respectively) which are not on the mutation, (e.g., do not hybridize to a nucleotide encoding the W182X mutation) showed specificity to the W1282X allele (Figs. 2A and 4A-4B) over the WT allele (e.g., induced very low level of skipping of the WT allele; Figs.2B and 4A-4B).
  • SPL23-34 and SPL23-35 (corresponding to SEQ ID Nos.: 11 and 12, respectively) show some specificity.
  • SPL23-2 and SPL23-3 (corresponding to SEQ ID Nos.: 34 and 35, respectively), which hybridize to the sequence encoding the W1282X mutation, served as positive controls.
  • the inventors further showed that the specific skipping induced the production of deleterious CFTR proteins primarily in W1282X cells and to a substantially less extent in WT and F508del cells (Figs. 5A-5B).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pulmonology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne une méthode pour induire le saut de l'exon 23 du pré-ARNm régulateur de la conductance transmembranaire de la fibrose kystique (CFTR). L'invention concerne en outre une méthode de traitement d'un sujet atteint de fibrose kystique (CF) à l'aide d'un modulateur d'épissage, tel qu'un oligonucléotide antisens, caractérisé en ce qu'il est susceptible d'induire le saut de l'exon 23 du pré-ARNm de CFTR. L'invention concerne également une composition et un kit comprenant le modulateur d'épissage.
PCT/IL2021/050342 2020-03-29 2021-03-25 Compositions et méthodes destinées au traitement de la fibrose kystique WO2021199028A1 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US202063001375P 2020-03-29 2020-03-29
US63/001,375 2020-03-29
US202063083941P 2020-09-27 2020-09-27
US63/083,941 2020-09-27
US202063120789P 2020-12-03 2020-12-03
US63/120,789 2020-12-03

Publications (1)

Publication Number Publication Date
WO2021199028A1 true WO2021199028A1 (fr) 2021-10-07

Family

ID=77927167

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2021/050342 WO2021199028A1 (fr) 2020-03-29 2021-03-25 Compositions et méthodes destinées au traitement de la fibrose kystique

Country Status (1)

Country Link
WO (1) WO2021199028A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016134021A1 (fr) * 2015-02-20 2016-08-25 Rosalind Franklin University Of Medicine And Science Composés antisens ciblant des gènes associés à la fibrose kystique
WO2018134301A1 (fr) * 2017-01-19 2018-07-26 Proqr Therapeutics Ii B.V. Complexes oligonucléotidiques destinés à être utilisés dans l'édition d'arn
WO2020194321A1 (fr) * 2019-03-28 2020-10-01 Splisense Ltd. Compositions et procédés de traitement de la fibrose kystique
WO2020194320A1 (fr) * 2019-03-28 2020-10-01 Splisense Ltd. Compositions et procédés destinés au traitement de la fibrose kystique

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016134021A1 (fr) * 2015-02-20 2016-08-25 Rosalind Franklin University Of Medicine And Science Composés antisens ciblant des gènes associés à la fibrose kystique
WO2018134301A1 (fr) * 2017-01-19 2018-07-26 Proqr Therapeutics Ii B.V. Complexes oligonucléotidiques destinés à être utilisés dans l'édition d'arn
WO2020194321A1 (fr) * 2019-03-28 2020-10-01 Splisense Ltd. Compositions et procédés de traitement de la fibrose kystique
WO2020194320A1 (fr) * 2019-03-28 2020-10-01 Splisense Ltd. Compositions et procédés destinés au traitement de la fibrose kystique

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BUKIS K., WISON, CONTE, CHENG, ALLAIRE, SIVACHENKO, COOTE, BIHLER, THOMAS, VALLEY, MENSE: "418. FUNCTIONAL CORRECTION OF W1282X-CFTR THROUGH EXON 23 SKIPPING AND PHARMACOLOGICAL MODULATION.", THE 34TH ANNUAL NORTH AMERICAN CXSTIC FIBROSIS CONFERENCE, vol. 55, no. S2, 6 October 2020 (2020-10-06) - 23 October 2020 (2020-10-23), pages S201 - S202, XP055925878 *

Similar Documents

Publication Publication Date Title
US20220064647A1 (en) Compositions and methods for treating cystic fibrosis
US20220040219A1 (en) Compositions and methods for treating cystic fibrosis
Jacobs et al. piRNA-8041 is downregulated in human glioblastoma and suppresses tumor growth in vitro and in vivo
WO2013059606A1 (fr) Composés et méthodes pour le traitement d'une maladie musculaire, et procédés de dépistage associés
US9206426B2 (en) Inhibitory RNAs to RNA binding proteins hnRNPA1, hnRNPA2 and PTB and uses thereof
JP2012125240A (ja) 細胞内でのｃａｇ伸長遺伝子産物の発現および凝集を調節するための方法ならびに同様に調節するために有用である薬剤を特定するための方法
US20230142669A1 (en) Compositions and methods for treating cystic fibrosis
Weng et al. Improvement of muscular atrophy by AAV–SaCas9-mediated myostatin gene editing in aged mice
EP3966320A1 (fr) Traitement et détection de neuropathies héréditaires et de troubles associés
US20220220486A1 (en) Combination treatments for cystic fibrosis characterized by a 3849 + 10kb c-to-t cftr mutation
WO2021199028A1 (fr) Compositions et méthodes destinées au traitement de la fibrose kystique
WO2022216804A2 (fr) Translecture programmée par un oligonucléotide spécifique de codons non-sens
EP4262762A1 (fr) Agent de ciblage jmjd6 pour traiter le cancer de la prostate
US20220213479A1 (en) Restoration of the cftr function by splicing modulation
WO2023017512A1 (fr) Oligonucléotides antisens pour moduler le saut d'exon dans un régulateur de conductance transmembranaire de fibrose kystique (cftr)
WO2024009306A1 (fr) Compositions et procédés de traitement de la dyskinésie ciliaire primitive
JP2021028297A (ja) マイクロｒｎａ及びその誘導体を有効成分とするがん治療剤
CA2690732A1 (fr) Neutralisation induite par arni de la proteine numa pour la therapie du cancer
US20220196660A1 (en) Methods for Modulation of Acetyltransferase Activity and Applications Thereof Including Treatments
Zhao et al. Glioblastoma cell-derived extracellular vesicle miR-27a-3p facilitates M2 macrophage polarization
WO2023105527A1 (fr) Oligonucléotides antisens ciblant muc5 et procédés associés pour moduler l'expression de muc5ac et muc5b
WO2022241165A2 (fr) Compositions et méthodes d'utilisation de hotair muté dans le traitement de cancers
WO2005002498A2 (fr) Methodes de traitement des troubles causes par la formation de transcrits portant des mutations non-sens

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21782036

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21782036

Country of ref document: EP

Kind code of ref document: A1