WO2021163439A1 - Improved yeasts for brewing - Google Patents

Abstract

The present invention relates to flavor stabilized beers and to methods of making flavor stabilized beers. More specifically, the instant disclosure provides methods and compositions for the production of flavor stabilized beer having low riboflavin using modified yeast to ferment a wort.

Description

IMPROVED YEASTS FOR BREWING

FIELD OF THE INVENTION

Exposure of bottled beer to sun light can result in an off-flavor referred to as skunk beer. The present invention relates to improvements in brewers yeast to prevent or inhibit the occurrence of skunk beer

BACKGROUND OF THE INVENTION

Exposure of beer to sun light can result in the formation of an off-flavor called skunked beer. Brewers refer to this phenomenon as light stmck or sun struck. Formation of skunked flavor in beer is obviously highly undesirable. To prevent the negative interaction between sun light and beer, brewers use glass, dark brown bottles for beer storage. Dark brown bottles partly limit transmission of the visible and UV region of the spectrum. While brown bottles can be used to inhibit development of skunk flavor, brewers frequently use clear or light green bottles for beer storage for reasons related to marketing and product differentiation. Light struck remains a major challenge for beer stored in green or clear bottles.

It is known that the compound giving rise to skunk beer is 3MBT (3-methylbut-ene- thiol, aka “skunky thiol”). Mechanism for Formation of the Lightstruck Flavor in Beer Revealed by Time-Resolved Electron Paramagnetic Resonance, Bums et al. 2001. Chem. Eur. J. 7 (21): 4553-4561. Skunk)' thiol is formed by the ultraviolet light induced reaction of sulfur containing amino acids with iso-humulones. Formation of 3MBT requires the presence of a photosensitizer which produces free radicals.

There is a need to prevent or inhibit the formation of skunky thiol in beer.

SUMMARY OF THE INVENTION

In accordance with an aspect of the present invention, a flavor stabilized beer having low riboflavin is presented wherein the beer has less than 200 μg/L of riboflavin. Without being bound by theory, it is understood that when riboflavin is exposed to light it catalyzes the formation of 3-methyl-but-2-ene-l-thiol (3-MBT). The presence of even minor amounts of 3-MBT in beer causes the beer to have skunked flavor, which is high undesirable. In accordance with an aspect of the present invention, the inventors have discovered the by lowering the amount of riboflavin in beer, formation of 3-MBT is inhibited even though beer is exposed to sunlight. In this regard, beer typically has at least 300 μg/L of riboflavin.

Optionally, the beer has less than 100 μg/L of riboflavin. Optionally, the beer has less than 50 μg/L of riboflavin. Optionally, the beer has less than 10 μg/L of riboflavin. Optionally, the beer has less than 5 μg/L of riboflavin. Optionally, the beer has less than 1 μg/L of riboflavin. Optionally, the beer has less than 0.5 μg/L of riboflavin. Optionally, the beer has less than 0.1 μg/L of riboflavin.

According to an aspect of the present invention the flavor stabilized beer has less than 50 ppt (parts per trillion) 3MBT. Optionally, less 40 ppt 3MBT. Optionally, less than 30 ppt 3MBT. Optionally, less than 20 ppt 3MBT. Optionally, less than 10 ppt 3MBT.

In another aspect of the present invention, the amount of 3MBT in the flavor stabilized beer does not increase more than 20% over 3 months, 6 months or 9 months of storage. Optionally, not more than 10% over 3 months, 6 months or 9 months of storage. Optionally, not more than 5% over 3 months, 6 months or 9 months.

In another aspect of the present invention, the flavor stabilized beer is a 100% malt- based beer.

In another aspect of the present invention, a method is presented for preparing a flavor stabilized beer having low riboflavin comprising fermenting a wort having riboflavin with modified yeast cells, derived from parental yeast cells, the modified yeast cells having disrupted riboflavin biosynthesis, whereby the modified yeast cells deplete the riboflavin in the wort to produce the beer having less than 200 μg/L of riboflavin.

Optionally, the beer has less than 100 μg/L of riboflavin. Optionally, the beer has less than 50 μg/L of riboflavin. Optionally, the beer has less than 10 μg/L of riboflavin. Optionally, the beer has less than 5 μg/L of riboflavin. Optionally, the beer has less than 1 μg/L of riboflavin. Optionally, the beer has less than 0.5 μg/L of riboflavin. Optionally, the beer has less than 0.1 μg/L of riboflavin.

Optionally, the modified yeast cells have a genetic disruption of a gene involved in riboflavin biosynthesis. Optionally, the gene is selected from the group consisting of ribl , rib2, rib3, rib4, rib5 or rib7. Optionally, the gene is rib5. Optionally, the modified yeast cells comprise a heterologous nucleic acid encoding Mch5p, providing for enhanced riboflavin uptake by the yeast cell. Optionally, the nucleic acid coding sequence of Mch5p corresponds to SEQ ID NO: 56. Optionally, the Mch5p coding sequence is under the control of a yeast constitutive promoter. Optionally, the promoter is FBA1

Optionally, the parental yeast cells are selected from the group consisting of Schizosaccharomyces, Brettanomyces, Kluyveromyces, Yarrowia, Pichia, Candida, Hansenula, Issatchenkia, and Saccharomyces. Optionally, the parental yeast cells are Saccharomyces. Optionally, the parental yeast cells are Saccharomyces cerevisiae and Saccharomyces pastorianus.

Optionally, the modified yeast cells have a functionally expressed heterologous riboflavinase. Optionally, the riboflavinase is a riboflavin hydrolase. Optionally, the riboflavin hydrolase is a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to MOXRcaEl (SEQ ID NO:79) or a riboflavin hydrolase active fragment thereof or MOXRcaE2 (SEQ ID NO: 80) or a riboflavin hydrolase active fragment thereof.

Optionally, the riboflavinase is a riboflavin reductase. Optionally, the riboflavin reductase is a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to MOXRcaBl (SEQ ID NO:81) or a riboflavin reductase active fragment thereof or MOXRcaB2 (SEQ ID NO: 82) or a riboflavin reductase active fragment thereof. Optionally, the modified yeast cells have a riboflavin reductase and a riboflavin hydrolase. Optionally, the riboflavin reductase is a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to MOXRcaBl (SEQ ID NO:81) or a riboflavin reductase active fragment thereof or MOXRcaB2 (SEQ ID NO: 82) or a riboflavin reductase active fragment thereof and the riboflavin hydrolase is a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to MOXRcaEl (SEQ ID NO:79) or a riboflavin hydrolase active fragment thereof or MOXRcaE2 (SEQ ID NO: 80) or a riboflavin hydrolase active fragment thereof.

Optionally, the riboflavinase is a riboflavin destructase. Optionally, the riboflavin destructase is a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to SmeBluBl (SEQ ID NO: 83) or a riboflavin destructase active fragment thereof or PspBluBl (SEQ ID NO:84) or a riboflavin destructase active fragment thereof.

In another aspect of the present invention, a beer is presented made according to any of the methods discussed above.

In another aspect of the present invention, a method is presented for preparing a flavor stabilized beer having reduced riboflavin comprising fermenting a wort having riboflavin with modified yeast cells, derived from parental yeast cells, said modified yeast cells having disrupted riboflavin biosynthesis, whereby the modified yeast cells deplete the riboflavin in the wort to produce beer having at least 10% less riboflavin produced than a beer fermented with the parental yeast cells.

Optionally, the beer has at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% less riboflavin than a beer fermented with the parental yeast cells. Optionally, the parental yeast is Saccharomyces pastorianus. Optionally, the strain is W34/70.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 depicts targeted genome integration of a cassette.

FIG. 2 depicts the strain lineage of the RcaBl, RcaEl and BluB expressing W34/70 transformants.

FIG. 3 depicts the riboflavin concentrations in wort after brewing with modified yeast strains.

FIG. 4 depicts the Fermax Gold strain lineage with rib5 deletion and Mch5 overexpression.

FIG. 5 depicts riboflavin concentration in media after growing with modified yeast strains.

BRIEF DESCRIPTION OF THE SEQUENCES

SEQ ID NO: 1 is the ENOl promoter DNA sequence.

SEQ ID NO:2 is the DNA coding sequence for MoxRcaBl riboflavin reductase. SEQ ID NO:3 is the FBA1L2 promoter DNA sequence.

SEQ ID NO:4 is the DNA sequence for MoxRcaEl riboflavin hydrolase. SEQ ID NO:5 is the ADH1 terminator DNA sequence.

SEQ ID NO: 6 is the DNA coding sequence for SmeBluBl riboflavin destructase.

SEQ ID NO:7 is the DNA coding sequence for PspBluBl riboflavin destructase.

SEQ ID NO: 8 is the FBA1 terminator DNA sequence.

SEQ ID NO: 9 is the TEF1 promoter DNA sequence.

SEQ ID NO: 10 is the KanMX marker DNA sequence.

SEQ ID NO: 11 is the TEF1 terminator DNA sequence.

SEQ ID NO: 12 is the 2-micron DNA sequence.

SEQ ID NO: 13 is the RNR2 promoter DNA sequence.

SEQ ID NO: 14 is the Cas9 DNA sequence.

SEQ ID NO: 15 is the RNR2 terminator DNA sequence. SEQ ID NO: 16 is the SNR52 promoter DNA sequence. SEQ ID NO: 17 is the sgRNA DNA sequence.

SEQ ID NO: 18 is the SUP4 terminator DNA sequence.

SEQ ID NO: 19 is the Cas9/sgRNA targeting sequence for CLB5 and THI22 intergenic region DNA sequence.

SEQ ID NO:20 is the Cas9/sgRNA targeting sequence for AAP1 and YHK8 intergenic region DNA sequence.

SEQ ID NO:21 is the Cas9/sgRNA targeting sequence for AAP1 and YHK8 intergenic region DNA sequence.

SEQ ID NO:22 is the Cas9/sgRNA targeting sequence for RIB5 gene DNA sequence. SEQ ID NO:23 is the MoxRcaBl and MoxRcaEl co-expression cassette DNA sequence.

SEQ ID NO:24 is the RH01527 DNA sequence.

SEQ ID NO: 25 is the RH01528 DNA sequence.

SEQ ID NO:26 is the IDT214 DNA sequence.

SEQ ID NO:27 is the IDT215 DNA sequence.

SEQ ID NO:28 is the RH01535 DNA sequence.

SEQ ID NO:29 is the RH01536 DNA sequence.

SEQ ID NO:30 is the RH01537 DNA sequence.

SEQ ID NO:32 is the RH01538 DNA sequence.

SEQ ID NO:33 is the RH01558 DNA sequence. SEQ ID NO:34 is the RH01561 DNA sequence.

SEQ ID NO:35 is the RH01567 DNA sequence.

SEQ ID NO:36 is the RH01559 DNA sequence.

SEQ ID NO:37 is the SmeBluBl cassette DNA sequence.

SEQ ID NO:38 is the PspBluBl cassette DNA sequence.

SEQ ID NO:39 is the RH01531 DNA sequence.

SEQ ID NO:40 is the RH01573 DNA sequence.

SEQ ID N0:41 is the IDT221 DNA sequence.

SEQ ID NO:42 is the IDT222 DNA sequence.

SEQ ID NO:43 is the RH01569 DNA sequence.

SEQ ID NO:44 is the RHO1570 DNA sequence.

SEQ ID NO:45 is the RH01571 DNA sequence.

SEQ ID NO:46 is the RH01572 DNA sequence.

SEQ ID NO:47 is the RH01216 DNA sequence.

SEQ ID NO:48 is the RH01219 DNA sequence.

SEQ ID NO:49 is the S. cerevisiae RIB5 gene sequence.

SEQ ID NO:50 is the RH01515 DNA sequence.

SEQ ID N0:51 is the RH01518 DNA sequence.

SEQ ID NO:52 is the RH01516 DNA sequence.

SEQ ID NO:53 is the RH01517 DNA sequence.

SEQ ID NO:54 is the S. eubayanus Rib5 protein sequence.

SEQ ID NO: 55 is the FBA1 promoter sequence.

SEQ ID NO:56 is the S. cerevisiae MCH5 gene DNA sequence.

SEQ ID NO:57 is the S. cerevisiae MCH5 terminator DNA sequence. SEQ ID NO:58 is the MCH5 expression cassette DNA sequence.

SEQ ID NO:59 is the RH01548 DNA sequence.

SEQ ID NO:60 is the RH01549 DNA sequence.

SEQ ID NO:61 is the IDT216 DNA sequence.

SEQ ID NO:62 is the IDT217 DNA sequence.

SEQ ID NO:63 is the RH01539 DNA sequence.

SEQ ID NO:64 is the RHO1540 DNA sequence.

SEQ ID NO:65 is the RH01541 DNA sequence.

SEQ ID NO:66 is the RH01542 DNA sequence. SEQ ID NO:67 is the RH01558 DNA sequence.

SEQ ID NO:68 is the RH01562 DNA sequence.

SEQ ID NO:69 is the RH01568 DNA sequence.

SEQ ID NO:70 is the RH01567 DNA sequence.

SEQ ID NO:71 is the Cas9/sgRNA targeting sequence of HIS3 gene DNA sequence

SEQ ID NO:72 is the S. cerevisiae HIS3 gene DNA sequence

SEQ ID NO:73 is the RH01614 DNA sequence

SEQ ID NO:74 is the RH01615 DNA sequence

SEQ ID NO:75 is the RH01616 DNA sequence

SEQ ID NO:76 is the RH01617 DNA sequence

SEQ ID NO: 77 is the IDT237 DNA sequence SEQ ID NO: 78 is the IDT238 DNA sequence SEQ ID NO:79 is the MOXRcaEl full length sequence.

SEQ ID NO: 80 is the MOXRcaE2 full length sequence.

SEQ ID NO:81 is the MOXRcaBl full length sequence.

SEQ ID NO: 82 is the MOCRcaB2 full length sequence.

SEQ ID NO:83 is the SmeBluBl full length sequence.

SEQ ID NO: 84 is the PSPBBluBl full length sequence.

DESCRIPTION OF THE INVENTION

The practice of the present teachings will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology cell biology, and biochemistry, which are within the skill of the art. Such techniques are explained fully in the literature, for example, Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al, 1989); Oligonucleotide Synthesis (M. J. Gait, ed., 1984; Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1994); PCR: The Polymerase Chain Reaction (Mullis et al., eds., 1994); Gene Transfer and Expression: A Laboratory Manual (Kriegler. 1990), and The Alcohol Textbook (Ingledew et al., eds., Fifth Edition, 2009), and Essentials of Carbohydrate Chemistry and Biochemistry (Lindhorste, 2007). Cas9-mediated recombination, known as CRISPR, can also be used to delete native chromosomal genes and/ or integrate gene constructs during the development of strains (for example, Journal of Microbiological Methods 127:203-205. 2016).

Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present teachings belong. Singleton, et al., Dictionary of Microbiology and Molecular Biology, second ed., John Wiley and Sons, New York (1994), and Hale & Markham, The Harper Collins Dictionary of Biology. Harper Perennial, NY (1991) provide one of skill with a general dictionary of many of the terms used in this invention. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present teachings.

Numeric ranges provided herein are inclusive of the numbers defining the range.

Definitions and Abbreviations

The terms ‘^"yeast cell”, "yeast cells”, “yeast strains”, or simply "yeast" refer to organisms from the phyla Ascomycota and Basidiomycota. Exemplary yeast is budding yeast from the order Saccharomycetales. Particular examples of yeast are Saccharomyces spp., including but not limited to S. cerevisiae. Y east include organisms used for the production of fuel alcohol as well as organisms used for die production of potable alcohol, including specialty and proprietary yeast strains used to make distinctive-tasting beers, wines, and other fermented beverages.

The terms "engineered yeast cells," "variant yeast cells," "modified yeast cells," “modified yeast cell” or similar phrases, refer to yeast that include genetic modifications and characteristics described herein. Variant/modified yeast do not include naturally occurring yeast.

Functionally and/or structurally similar proteins are considered to be "related proteins”, or "homologs". Such proteins can be derived from organisms of different genera and/or species, or different classes of organisms (e.g., bacteria and fungi), or artificially designed. Related proteins also encompass homologs determined by primary sequence analysis, determined by secondary' or tertiary' structure analysis, or determined by immunological cross-reactivity, or determined by their functions.

"Disruption of a gene" refers broadly to any genetic or chemical manipulation, i.e., mutation, that substantially prevents a cell from producing a function gene product, e.g., a protein, in a host cell. Exemplary methods of disruption include complete or partial deletion of any portion of a gene, including a polypeptide-coding sequence, a promoter, an enhancer, or another regulator}- element, or mutagenesis of the same, where mutagenesis encompasses substitutions, insertions, deletions, inversions, and combinations and variations, thereof, any of which mutations substantially prevent the production of a function gene product. A gene can also be disrupted using RNAi, antisense, or any other method that abolishes gene expression. A gene can be disrupted by deletion or genetic manipulation of non-adjacent control elements. As used herein, "deletion of a gene," refers to its removal from the genome ofa host cell. Where a gene includes control elements (e.g., enhancer elements) that are not located immediately adjacent to the coding sequence of a gene, deletion of a gene refers to the deletion of the coding sequence, and optionally adjacent enhancer elements, including but not limited to, for example, promoter and/or terminator sequences, but does not require the deletion of non-adjacent control elements.

The terms "genetic manipulation" and "genetic alteration" are used interchangeably and refer to the alteration/change of a nucleic acid sequence. The alteration can include hut is not limited to a substitution, deletion, insertion or chemical modification of at least one nucleic acid in the nucleic acid sequence.

The term "functional polypeptide/protein" is a protein that possesses an activity, such as an enzymatic activity, a binding activity, a surface-active property, or the like, and which has not been mutagenized, truncated, or otherwise modified to abolish or reduce that activity. Functional polypeptides can be thermostable or thermolabile, as specified.

The term "a functional gene" means a gene capable of being used by cellular components to produce an active gene product, typically a protein. Functional genes are the antithesis of disrupted genes, which are modified such that they cannot be used by cellular components to produce an active gene product or have areduced ability to be used by cellular components to produce an active gene product.

As used herein, yeast cells have been "modified to prevent the production of a specified protein" if they have been genetically or chemically altered to prevent the production of a functional protein/polypeptide that exhibits an activity characteristic of the wild-type protein. Such modifications include, but are not limited to, deletion or disruption of the gene encoding the protein (as described, herein), modification of the gene such that the encoded polypeptide lacks the aforementioned activity, modification of the gene to affect post- translational processing or stability, and combinations, thereof.

As used herein, "attenuation of a pathway" or "attenuation of the flux through a pathway" i.e., a biochemical pathway, or refers broadly to any genetic or chemical manipulation that reduces or completely stops the flux of biochemical substrates or intermediates through a metabolic pathway. Attenuation of a pathway_' may be achieved by a variety of well-known methods. Such methods include but are not limited to: complete or partial deletion of one or more genes, replacing wild-type alleles of these genes with mutant forms encoding enzymes with reduced catalytic activity or increased Km values, modifying the promoters or other regulatory' elements that control the expression of one or more genes, engineering the enzymes or the mRNA encoding these enzymes for a decreased stability, misdirecting enzymes to cellular compartments where they are less likely to interact with substrate and intermediates, the use of interfering RNA, and the like.

As used herein, “disrupting the biosynthesis of riboflavin” refers broadly to any genetic or chemical manipulation that reduces or lessens the overall levels of riboflavin in a cell.

Disruption of riboflavin biosynthesis may be achieved by a variety' of well-known methods. Such methods include but are not limited to: complete or partial deletion of one or more genes, replacing wild-type alleles of these genes with mutant forms encoding enzymes with reduced catalytic activity or increased Km values, modifying the promoters or other regulatory elements that control the expression of one or more genes, engineering the enzymes or the mRNA encoding these enzymes for a decreased stability, misdirecting enzymes to cellular compartments where they are less likely to interact with substrate and intermediates, the use of interfering RNA, introduction of heterologous genes whose products degrade riboflavin and the like.

The terms, “wild-type,” “parental,” or “reference,” with respect to a polypeptide, refer to a naturally-occurring polypeptide that does not include a man-made substitution, insertion, or deletion at one or more ammo acid positions. Similarly, the terms “wild- type,” “parental,” or “reference,” with respect to a polynucleotide, refer to a naturally- occurring polynucleotide that does not include a man-made nucleoside change. However, note that a polynucleotide encoding a wild-type, parental, or reference polypeptide is not limited to a naturally occurring polynucleotide, and encompasses any polynucleotide encoding the wild-type, parental, or reference polypeptide.

Reference to the wild-type polypeptide is understood to include the mature form of the polypeptide. A “mature” polypeptide or variant, thereof, is one in which a signal sequence is absent, for example, cleaved from an immature form of the polypeptide during or following expression of the polypeptide.

The term “ppt” means parts per trillion.

The term ^"variant. with respect to a polypeptide, refers to a polypeptide that differs from a specified wild-type, parental, or reference polypeptide in that it includes one or more naturally-occurring or man-made substitutions, insertions, or deletions of an ammo acid. Similarly, the term “variant,” with respect to a polynucleotide, refers to a polynucleotide that differs in nucleotide sequence from a specified wild-type, parental, or reference polynucleotide. The identity of the wild-type, parental, or reference polypeptide or polynucleotide will be apparent from context.

The term “recombinant,” when used in reference to a subject cell, nucleic acid, protein or vector, indicates that the subject has been modified from its native state. Thus, for example, recombinant cells express genes that are not found within the native nonrecombinant) form of the cell, or express native genes at different levels or under different conditions than found in nature. Recombinant nucleic acids differ from a native sequence by one or more nucleotides and/or are operably linked to heterologous sequences, e.g., a heterologous promoter in an expression vector. Recombinant proteins may differ from a native sequence by one or more amino acids and/or are fused with heterologous sequences. A vector comprising a nucleic acid encoding a riboflavinase is a recombinant vector.

The terms “recovered,” “isolated,” and “separated,” refer to a compound, protein (polypeptides), cell, nucleic acid, amino acid, or other specified material or component that is removed from at least one other material or component with which it is naturally associated as found in nature. An “isolated” polypeptides, thereof, includes, but is not limited to, a culture broth containing secreted polypeptide expressed in a heterologous host cell.

The term “purified” refers to material (e.g., an isolated polypeptide or polynucleotide) that is in a relatively pure state, e.g., at least about 90% pure, at least about 95% pure, at least about 98% pure, or even at least about 99% pure.

The term “enriched” refers to material (e.g., an isolated polypeptide or polynucleotide) that is in about 50% pure, at least about 60% pure, at least about 70% pure, or even at least about 70% pure.

A “pH range ” with reference to an enzyme, refers to the range of pH values under which the enzyme exhibits catalytic activity.

The terms “pH stable” and “pH stability,” with reference to an enzyme, relate to the ability of the enzyme to retain activity over a wide range of pH values for a predetermined period of time (e.g., 15 min., 30 min., 1 hour).

The term “amino acid sequence” is synonymous with the terms “polypeptide,” “protein,” and “peptide,” and are used interchangeably. Where such amino acid sequences exhibit activity, they may be referred to as an “enzyme.” The conventional one-letter or three- letter codes for amino acid residues are used, with amino acid sequences being presented in the standard amino-to-carboxy terminal orientation (i.e., N®C).

The term “nucleic acid” encompasses DNA, RNA, heteroduplexes, and synthetic molecules capable of encoding a polypeptide. Nucleic acids may be single stranded or double stranded, and may be chemical modifications. The terms “nucleic acid” and “polynucleotide” are used interchangeably. Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid, and the present compositions and methods encompass nucleotide sequences that encode a particular amino acid sequence. Unless otherwise indicated, nucleic acid sequences are presented in 5'-to-3' orientation.

“Hybridization” refers to the process by which one strand of nucleic acid forms a duplex with, i.e., base pairs with, a complementary strand, as occurs during blot hybridization techniques and PCR techniques. Stringent hybndization conditions are exemplified by hybridization under the following conditions: 65°C and 0.1X SSC (where IX SSC = 0.15 M NaCl, 0.015 MNa3 citrate, pH 7.0). Hybridized, duplex nucleic acids are characterized by a melting temperature (Tm), where one half of the hybridized nucleic acids are unpaired with the complementary strand. Mismatched nucleotides within the duplex lower the Tm. Very stringent hybridization conditions involve 68°C and 0. IX SSC.

A “synthetic” molecule is produced by in vitro chemical or enzymatic synthesis rather than by an organism.

The terms “transformed,” “stably transformed,” and “transgenic,” used with reference to a cell means that the cell contains a non-native (e.g., heterologous) nucleic acid sequence integrated into its genome or carried as an episome that is maintained through multiple generations.

The term “introduced” in the context of inserting a nucleic acid sequence into a cell, means “transfection”, “transformation” or “transduction,” as known in the art. A “host strain” or “host cell” is an organism into which an expression vector, phage, virus, or other DNA construct, including a polynucleotide encoding a polypeptide of interest (e.g., an riboflavinase) has been introduced. Exemplary host strains are microorganism cells (e.g., bacteria, filamentous fungi, and yeast) capable of expressing the polypeptide of interest. The term “host cell” includes protoplasts created from cells

The term “heterologous” with reference to a polynucleotide or protein refers to a polynucleotide or protein that does not naturally occur in a host cell.

The term “endogenous” with reference to a polynucleotide or protein refers to a polynucleotide or protein that occurs naturally in the host cell.

The term “expression” refers to the process by which a polypeptide is produced based on a nucleic acid sequence. The process includes both transcription and translation.

A “selective marker” or “selectable marker” refers to a gene capable of being expressed in a host to facilitate selection of host cells carrying the gene. Examples of selectable markers include but are not limited to antimicrobials (e.g., hygromycin, bleomycin, or chloramphenicol) and/ or genes that confer a metabolic advantage, such as a nutritional advantage on the host cell.

A “vector” refers to a polynucleotide sequence designed to introduce nucleic acids into one or more cell types. Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, phage particles, cassettes and the like.

An “expression vector” refers to a DNA construct comprising a DNA sequence encoding a polypeptide of interest, which coding sequence is operably linked to a suitable control sequence capable of effecting expression of the DNA in a suitable host. Such control sequences may include a promoter to effect transcription, an optional operator sequence to control transcription, a sequence encoding suitable ribosome binding sites on the mRNA, enhancers and sequences which control termination of transcription and translation.

The term “operably linked” means that specified components are in a relationship (including but not limited to juxtaposition) permitting them to function in an intended manner. For example, a regulatory sequence is operably linked to a coding sequence such that expression of the coding sequence is under control of the regulatory sequences.

A “signal sequence” is a sequence of amino acids attached to the N-terminal portion of a protein, which facilitates the secretion of the protein outside the cell. The mature form of an extracellular protein lacks the signal sequence, which is cleaved off during the secretion process.

A “prosequence” or “secretory tag” is an amino acid sequence between the signal sequence and mature protein that is necessary for the secretion of the protein. Cleavage of the prosequence will result in a mature active protein.

The term “precursor” form of a protein or peptide refers to a mature form of the protein having a prosequence operably linked to the amino or carbonyl terminus of the protein. The precursor may also have a “signal” sequence operably linked, to the amino terminus of the prosequence. The precursor may also have additional polynucleotides that are involved in post-translational activity (e.g., polynucleotides cleaved therefrom to leave the mature form of a protein or peptide).

“Biologically active” refers to a sequence having a specified biological activity, such as an enzymatic activity.

The term “specific activity” refers to the number of moles of substrate that can be converted to product by an enzyme or enzyme preparation per unit time under specific conditions. Specific activity is generally expressed as units (U)/mg of protein.

As used herein, “percent sequence identity” means that a particular sequence has at least a certain percentage of amino acid residues identical to those in a specified reference sequence, when aligned using the CLUSTAL W algorithm with default parameters. See Thompson et al. (1994) Nucleic Acids Res. 22:4673-4680. Default parameters for the CLUSTAL W algorithm are:

Gap opening penalty: 10.0

Gap extension penalty: 0.05

Protein weight matrix: BLOSUM series

DNA weight matrix: IUB

Delay divergent sequences %: 40

Gap separation distance: 8

DNA transitions weight: 0.50

List hydrophilic residues: GPSNDQEKR Use negative matrix: OFF Toggle Residue specific penalties: ON Toggle hydrophilic penalties: ON Toggle end gap separation penalty OFF.

Deletions are counted as non-identical residues, compared to a reference sequence. Deletions occurring at either terminus are included. For example, a variant with five amino acid deletions of the C-terminus of the mature 617 residue polypeptide would have a percent sequence identity of 99% (612 / 617 identical residues ^c 100, rounded to the nearest whole number) relative to the mature polypeptide. Such a variant would be encompassed by a variant having “at least 99% sequence identity” to a mature polypeptide.

“Fused” polypeptide sequences are connected, i.e., operably linked, via a peptide bond between two subject polypeptide sequences.

The term “filamentous fungi” refers to all filamentous forms of the subdivision Eumycotina, particularly Pezizomycotina species.

The term “about” refers to ± 5% to the referenced value.

As used herein, the term "malt beverage" includes such foam forming fermented malt beverages as full malted beer, ale, dry beer, near beer, light beer, low alcohol beer, low calorie beer, porter, bock beer, stout, malt liquor, non-alcoholic malt liquor and the like. The term "malt beverages" also includes alternative malt beverages such as fruit flavoured malt beverages, e. g. , citrus flavoured, such as lemon-, orange-, lime-, or berry -flavoured malt beverages, liquor flavoured malt beverages, e. g. , vodka-, rum-, or tequila-flavoured malt liquor, or coffee flavoured malt beverages, such as caffeine-flavoured malt liquor, and the like.

Preferably, the malt beverage of the instant invention is selected from the group consisting of a beer, ale, dry beer, near beer, light beer, ultra light beer, low alcohol beer, low calorie beer, porter, bock beer, stout, malt liquor, and non-alcoholic malt liquor. More preferably, the malt beverage is a beer.

As used herein, the term “beer” traditionally refers to an alcoholic beverage denved from malt, which is derived from barley, and optionally adjuncts, such as cereal grains, and flavoured with hops. Beer can be made from a variety of grains by essentially the same process. All grain starches are glucose homopolymers in which the glucose residues are linked by either alpha-1,4- or alpha-1, 6-bonds, with the former predominating. The process of making fermented malt beverages is commonly referred to as brewing. The principal raw materials used in making these beverages are water, hops and malt. In addition, adjuncts such as common com grits, refined com grits, rice, sorghum, refined com starch, barley, barley starch, dehusked barley, wheat, wheat starch, torrified cereal, cereal flakes, rye, oats, potato, tapioca, and syrups, such as com syrup, sugar cane syrup, inverted sugar sy p, barley and/or wheat syrups, and the like may be used as a source of starch or fermentable sugar types. The starch will eventually be converted into dextrins and fermentable sugars. For a number of reasons, the malt, which is produced principally from selected varieties of barley, has the greatest effect on the overall character and quality of the beer. First, the malt is the primary flavouring agent in beer. Second, the malt provides the major portion of the fermentable sugar. Third, the malt provides the proteins, which will contribute to the body and foam character of the beer. Fourth, the malt provides the necessary enzymatic activity during mashing.

As used herein, the “process for making beer” is one that is well known in the art, but briefly, it involves five steps: (a) adjunct cooking and/or mashing (b) wort separation and extraction (c) boiling and hopping of wort (d) cooling, fermentation and storage, and (e) maturation, processing and packaging. In the first step, milled or crushed malt is mixed with water and held for a period of time under controlled temperatures to permit the enzymes present in the malt to, for example, convert the starch present in the malt into fermentable sugars. In the second step, the mash is transferred to a "lauter tun" or mash filter where the liquid is separated from the grain residue. This sweet liquid is called "wort" and the left over grain residue is called “spent grain”. The mash is typically subjected to an extraction during mash separation, which involves adding water to the mash in order to recover the residual soluble extract from the spent grain. In the third step, the wort is boiled vigorously. This sterilizes the wort and helps to develop the color, flavor and odor. Hops are added at some point during the boiling. In the fourth step, the wort is cooled and transferred to a fermenter, which either contains the yeast or to which yeast is added. The yeast converts the sugars by fermentation into alcohol and carbon dioxide gas; at the end of fermentation the fermenter is chilled or the fermenter may be chilled to stop fermentation. The yeast flocculates and is removed. In the last step, the beer is cooled and stored for a period of time, during which the beer clarifies and its flavor develops, and any material that might impair the appearance, flavor and shelf life of the beer settles out. Prior to packaging, the beer is carbonated and, optionally, filtered and pasteurized. After fermentation, a beverage is obtained which usually contains from about 2% to about 10% alcohol by weight. The non-fermentable carbohydrates are not converted during fermentation and form the majority of the dissolved solids in the final beer. This residue remains because of the inability of malt enzymes to hydrolyse the alpha- 1, 6-linkages of the starch and fully degrade the non-starch polysaccharides. The non- fermentable carbohydrates contribute less than 50 kilocalories per 12 ounces of a lager beer.

The “process for making beer” may further be applied in the mashing of any grist.

The term “fermentation” means, in the context of brewing, the transformation of sugars in the wort, by enzymes in the brewing yeast, into ethanol and carbon dioxide with the formation of other fermentation by-products.

The term “malt” is understood as any malted cereal grain, such as barley.

The term “mash” is understood as aqueous starch slurry, e.g. comprising crushed barley malt, crushed barley, and/or other adjunct or a combination hereof, mixed with water later to be separated into wart+spent grains.

The term “wort” refers to the unfermented liquor run-off following extracting the grist during mashing.

The term “spent grains” refers to the drained solids remaining when the grist has been extracted and the wort separated from the mash.

Included within the term “beer” is any fermented wort, produced by the brewing and fermentation of a starch-containing material, mainly derived from cereal grains, such as malted barley. Wheat, maize, and rice may also be used.

As used herein, the term “non-alcoholic beer” or “low-alcohol beer” refers to a beer containing a maximum of 0.1% to 3.5% or 0.1% to 2.5% such as 0.1% to 0.5% alcohol by volume. Non-alcoholic beer is brewed by traditional methods, but during the finishing stages of the brewing process the alcohol is removed by vacuum evaporation, by taking advantage of the different boiling points of water and alcohol.

As used herein, the term “low-calorie beer” or “beer with a low carbohydrate content” is defined as a beer with a carbohydrate content of 1.5 g/100 g or less and with a real degree of fermentation of at least 80%.

The term “riboflavin-like compounds" is defined as compounds containing an isoalloxazine three ring moiety. Examples include riboflavin, riboflavin-5' -phosphate (also known as flavin mononucleotide; FMN), flavin adenine dinucleotide (FAD). Furthermore, these compounds are also known as flavin nucleotides and function as prosthetic groups of oxidation-reduction enzymes.

The term riboflavmase is defined as an enzyme capable of hydrolyzing, converting or rearranging riboflavin or riboflavin-like compounds in such a way that the photo- sensitizing action of riboflavin and riboflavin-like compounds is modified, lessened, reduced, eliminated and/or inhibited.

The term “riboflavin hydrolase” is defined as an enzyme that hydrolyzes riboflavin and riboflavin-like compounds, including without limitation lyases (EC 4.3) and nucleosidases (EC 3.2.2). Under some circumstances, the riboflavin hydrolase may produce lumichrone and ribotol as end products.

The term “riboflavin reductase” is defined as an enzyme the reduces riboflavin and riboflavin-like compounds, including without limitation flavin reductases (EC 1.5.1.30).

The term “riboflavin destructase” or ‘ ‘flavin destructase’ ’ is, for example, an enzyme that catalyzes the conversion of flavin mononucleotide (FMN) to 5,6- dimethylbenzimidazole (DMB). One example of such an enzyme is the BluB enzymes (SmeBluBl (SEQ ID NO:2) and PspBluBl (SEQ ID NO:4)) disclosed herein in accordance with an aspect of the present invention. Under certain conditions, it is possible that the nonphosphorylated counterpart to FNM, being riboflavin, also may be converted by a flavin destructase into DMB.

Furthermore, the riboflavinases of the present invention may include any number of conservative amino acid substitutions. Exemplary conservative amino acid substitutions are listed in the following Table.

Table 1. Conservative amino acid substitutions

The reader will appreciate that some of the above mentioned conservative mutations can be produced by genetic manipulation, while others are produced by introducing synthetic amino acids into a polypeptide by genetic or other means. The present riboflavinases may be “precursor,” “immature,” or “full-length,” in which case they include a signal sequence, or “mature,” in which case they lack a signal sequence. Mature forms of the polypeptides are generally the most useful. Unless otherwise noted, the amino acid residue numbering used herein refers to the mature forms of the respective polypeptides. The present riboflavinases may also be truncated to remove theN or C- termini, so long as the resulting polypeptides retain riboflavinase activity.

In addition, riboflavinases may be active fragments derived from a longer amino acid sequence. Active fragments are characterized by retaining some or all of the activity of the full length enzyme but have deletions from the N-terminus, from the C-terminus or internally or combinations thereof.

The present riboflavinases may be a ‘‘chimeric” or “hybrid” polypeptide, in that it includes at least a portion of a first riboflavinase polypeptide, and at least a portion of a second riboflavinase polypeptide. The present riboflavinase may further include heterologous signal sequence, an epitope to allow tracking or purification, or the like. Exemplary heterologous signal sequences are from B. licheniformis amylase (LAT), B. subtilis (AmyE or AprE), and Streptomyces CelA

Description of the Preferred Embodiments

In accordance with an aspect of the present invention, a flavor stabilized beer having low riboflavin is presented wherein the beer has less than 200 μg/L of riboflavin. Without being bound by theory, it is understood that when riboflavin is exposed to light it catalyzes the formation of 3-methyl-but-2-ene-l-thiol (3-MBT). The presence of even minor amounts of 3-MBT in beer causes the beer to have skunked flavor, which is high undesirable. In accordance with an aspect of the present invention, the inventors have discovered the by lowering the amount of riboflavin in beer, formation of 3-MBT is inhibited. In this regard, beer typically has at least 300 μg/L of riboflavin.

Preferably, the beer has less than 100 μg/L of riboflavin. More preferably, the beer has less than 50 μg/L of riboflavin. Still more preferably, the beer has less than 10 μg/L of riboflavin. In still more preferred embodiments, the beer has less than 5 μg/L of riboflavin. In still other preferred embodiments, the beer has less than 1 μg/L of riboflavin. Still more preferably, the beer has less than 0.5 μg/L of riboflavin. Most preferably, the beer has less than 0.1 μg/L of riboflavin.

According to an aspect of the present invention the flavor stabilized beer has less than 50 ppt (parts per trillion) 3MBT. More preferably, the flavor stabilized beer has less 40 ppt 3MBT. Still more preferably, the flavor stabilized beer has less than 30 ppt 4MBT. Yet more preferably, the flavor stabilized beer has less than 20 ppt 3MBT. In yet a more preferred embodiment, the flavor stabilized beer has less than 10 ppt 3MBT.

In another aspect of the present invention, the amount of 3MBT in the flavor stabilized beer does not increase more than 20% over 3 months, 6 months or 9 months of storage. More preferably, the amount of 3 MBT does not increase more than 10% over 3 months, 6 months or 9 months of storage. Most preferably, the amount of 3MBT does not increase more than 5% over 3 months, 6 months or 9 months. In another aspect of the present invention, the flavor stabilized beer is a 100% malt- based beer. A 100% malt based beer means a beer made from 100% malt with no adjunct.

In another aspect of the present invention, a method is presented for preparing a flavor stabilized beer having low riboflavin comprising fermenting a wort having riboflavin with modified yeast cells, derived from parental yeast cells, the modified yeast cells having disrupted riboflavin biosynthesis, whereby the modified yeast cells deplete the riboflavin in the wort to produce the beer having less than 200 μg/L of riboflavin.

Preferably, the beer has less than 100 μg/L of riboflavin. More preferably, the beer has less than 50 μg/L of riboflavin. Still more preferably, the beer has less than 10 μg/L of riboflavin. In still more preferred embodiments, the beer has less than 5 μg/L of riboflavin. In still other preferred embodiments, the beer has less than 1 μg/L of riboflavin. Still more preferably, the beer has less than 0.5 μg/L of riboflavin. Most preferably, the beer has less than 0.1 μg/L of riboflavin.

Preferably, the modified yeast cells have a genetic disruption of a gene involved in riboflavin biosynthesis. Preferably, the gene is selected from the group consisting of ribl, rib2, rib3, rib4, rib5 or rib7. More preferably, the gene is rib5.

Preferably, the modified yeast cells comprise a heterologous nucleic acid encoding Mch5p, providing for enhanced riboflavin uptake by the yeast cell. Preferably, the nucleic acid coding sequence of Mch5p corresponds to SEQ ID NO: 56. Still more preferably, the Mch5p coding sequence is under the control of a yeast constitutive promoter. Y et more preferably, the promoter is FBA1

Preferably, the parental yeast cells are selected from the group consisting of Schizosaccharomyces, Brettanomyces, Kluyveromyces, Yarrowia, Pichia, Candida, Hansenula, Issatchenkia, and Saccharomyces. More preferably, the parental yeast cells are Saccharomyces. Still more preferably, the parental yeast cells are Saccharomyces cerevisiae and Saccharomyces pastorianus.

Preferably, the modified yeast cells have a functionally expressed heterologous riboflavinase. More preferably, the riboflavinase is a riboflavin hydrolase. Still more preferably, the riboflavin hydrolase is a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to MOXRcaEl (SEQ ID NO:79) or a riboflavin hydrolase active fragment thereof or MOXRcaE2 (SEQ ID NO: 80) or a riboflavin hydrolase active fragment thereof.

In other preferred embodiments, the riboflavinase is a riboflavin reductase. More preferably, the riboflavin reductase is a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to MOXRcaBl (SEQ ID NO:81) or a riboflavin reductase active fragment thereof or MOXRcaB2 (SEQ ID NO:82) or a riboflavin reductase active fragment thereof. In still other preferred embodiments, the modified yeast cells have a riboflavin reductase and a riboflavin hydrolase. Still more preferably, the riboflavin reductase is a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to MOXRcaBl (SEQ ID NO: 81) or a riboflavin reductase active fragment thereof or MOXRcaB2 (SEQ ID NO: 82) or a riboflavin reductase active fragment thereof and the riboflavin hydrolase is a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to MOXRcaEl (SEQ ID NO:79) or a riboflavin hydrolase active fragment thereof or MOXRcaE2 (SEQ ID NO: 80) or a riboflavin hydrolase active fragment thereof.

In other preferred embodiments, the riboflavinase is a riboflavin destructase. More preferably, the riboflavin destructase is a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to SmeBluBl (SEQ ID NO:83) or a riboflavin destructase active fragment thereof or PspBluBl (SEQ ID NO: 84) or a riboflavin destructase active fragment thereof.

In another aspect of the present invention, a beer is presented made according to any of the methods discussed above.

In another aspect of the present invention, a method is presented for preparing a flavor stabilized beer having reduced riboflavin comprising fermenting a wort having riboflavin with modified yeast cells, derived from parental yeast cells, said modified yeast cells having disrupted riboflavin biosynthesis, whereby the modified yeast cells deplete the riboflavin in the wort to produce beer having at least 10% less riboflavin produced than a beer fermented with the parental yeast cells.

Preferably, the beer has at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% less riboflavin than a beer fermented with the parental yeast cells. Preferably, the parental yeast is Saccharomyces pastorianus. Preferably, the strain is W34/70.

The present disclosure is described in further detail in the following examples, which are not in any way intended to limit the scope of the disclosure as claimed. The attached figures are meant to be considered as integral parts of the specification and description of the disclosure. The following examples are offered to illustrate, but not to limit the claimed disclosure. It should be understood that these Examples, while indicating embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various uses and conditions.

EXAMPLES

Materials and methods

Yeast strains used here include a larger brewing yeast Saccharomyces pastorianus Weihenstephan 34/70 (Nakao et al. (2009) DNARes. 16: 115-129) and an industrial fuel ethanol production yeast strain FerMax™ Gold Label Yeast (FG) purchased from Martrex Inc.

Electroporation Transformation of S. pastorianus and S. cerevisiae

Grow cells to an OD₆₀₀ of 1.0 and harvest Cells at top speed for 5 minutes. Resuspend cells in lOmL of 0.1 M Lithium Acetate/10 mM DTT/1 OmM Tris-HCl pH 7.5, 1 mM EDTA. Harvest cells at 700 g for 5 minutes after incubating at room temperature for 45 mm to 1 hour. Wash cells in 1 mL chilled water and then in 1 mL chilled 1 M Sorbitol, harvest cells at 700 g for lmin and remove supernatant. Wash cells in lmL chilled sorbitol for 3 time and finally resuspend cells in 300 μL chilled 1M Sorbitol. Mix up to 10 μL DNA solution and 50 μL in cells in a micro centrifuge tube and incubate on ice for 5 minutes. Electroporation with electric pulse at 1.5kV, 25 pF, and pulse control set at 200. Immediately add lmL YPD media, transfer to a 15mL conical tube and place on a roller drum at 30°C overnight before plating them on YPD plates containing 200 mg/L Geneticin.

Procedure for brewing with a wort or yeast synthetic medium

Weigh out 340 g ofMunton’s malt extract and add 1500 mL of tap water (45°C). Stir for about 10 minutes on a magnetic stirrer until the malt extract is dissolved. Autoclave at

121°C for 20 minutes. Allow the medium to equilibrate to room temperature before use or before storage. Can be stored for several weeks in the refrigerator (5°C). For brewing, seed culture was grown aerobically in malt extract medium at 28°C overnight or 22°C for 3 days with shaking at 250 rpm. Cells from seed culture were inoculated in 300ml fresh malt extract to an OD₆₀₀ of 1.0, and fermentation was performed between 15°C for 10 days in the dark without shaking. Air trap or air-lock was installed to maintain anaerobic conditions but allowed gas release.

When grown in yeast synthetic (SD) medium, composed of 20 g/L glucose, 1.7 g/L YNB without Folic Acid and Riboflavin (MP Biomedicals), 5 g/L ammonium sulfate, cells were first grown overnight in SD medium containing 20 mg/L riboflavin, washed in water once, and resuspended in SD medium without riboflavin for 6 hour to overnight to deplete intracellular riboflavin. Cells were then used to inoculate in SD medium containing 0.5 mg/L of riboflavin at a starting OD₆₀₀ of 0.5 and grown in aerobic condition at 28°C for 24 hours or m anaerobic condition 28°C for 96 hours.

Detection of Riboflavin by UHPLC (Fluorescence detector)

The analysis used a UHPLC (Ultra high-pressure liquid chromatography) equipped with a quaternary pump, autosampler, column heater, and fluorescence detector. The samples were run on aZorbax Eclipse Plus C18 RRHD, particle size 1.8 μm; DxL: 2.1x50 mm column, column temperature was 40°C, flow rate 0.5 mL/min, injection volume: 10 μl and fluorescence detection with excitation at 274 nm and emission read at 520 nm for quantification. Mobile phase A: milli-Q water and mobile phase B: methanol was used with the following gradient min / %B: 0/10; 2/20; 5/21.8; 8/50, 9/50; 10/10 and 12/10. The linearity range for Riboflavin was from 1.3 - 2000 μg/L with a 6-point calibration. A reference standard (Riboflavin) was dissolved in DMSO and then serial dilutions were made in Milli-Q water. The stock solution was made fresh each time and protected from light. The Riboflavin standard was purchased from Alfa Aesar at 98% purity. The DMSO (Dimethyl Sulfoxide, ACS) was purchased from Alfa Aesar at 99.9% purity.

The stock solution concentration was made using 5 mg of Riboflavin standard into 50 mL of DMSO, which was made in a volumetric flask. The serial dilutions were made into approximate concentrations of 2000, 400, 80, 16, 3.2 and 1.3 μg/L. The area count was reported for each standard and plotted on a calibration curve for linearity. The area of the slope was used in reporting the data. The samples tested for Riboflavin used the following preparation. Degassed by soni cation or sample rotation. Prepared lOx dilution of sample in Milli-Q water (lOOμL sample with 900μL water). Samples were filtrated through 10 kDa molecular weight cutoff spin filter at 15,000 rpm for 30 minutes and then immediately transferred into amber glass HPLC vials with inserts. Samples were run on the UHPLC for analysis. Two sets of calibration standards were run as well as two sets of samples, and the average was taken for data delivery. After the samples were run on the UHPLC, the area count for the riboflavin peak was calculated and reported.

Example 1

Yeast plasmid constructs for RcaBl/RcaEl or BluB expression

When beer is subj ected to UV and visible light, generation of the light-struck flavor arise which is associated with the component 3-methyl-but-2-ene-l -thiol (3-MBT), and the formation of 3-MBT from the iso-a-acids present in beer (hop) is catalyzed by riboflavin.

The current example aims to protect beer from generating light-struck flavor by decreasing free flavins in beer. In an aspect of the present invention, and without being bound by any particular theory yeast are modified to produce less riboflavin in the cell and thus consume riboflavin in the media during the brewing fermentation. For this, riboflavin reductase (FR), riboflavin hydrolase / monooxygenase (FMO), and riboflavin destructase (BluB) have been cloned and expressed in yeast cells individually or in combinations).

As described in the literature (Xu et ak, The Journal of Biological Chemistry, 291: 23506-23515, 2016), a gene cluster that is involved in the riboflavin catabolism is identified from Microbacterium maritypicum G10. Within the gene cluster, the Microbacterium maritypicum RcaBl is designated as the flavin-reductase. A homolog (herein named MoxBluBl) was identified from Microbacterium oxydans strain NS234. The nucleotide acid sequence for the full-length MoxRcaBl gene is identified in the NCBI database (NCBI Reference Sequence: NZ_LDRQ01000062.1 from 15504 to 16013). The corresponding protein encoded by the MoxRcaBl gene is available as GenBank reference sequence: KTR74700. Within the gene cluster, Microbacterium maritypicum RcaEl is designated as the Riboflavin hydrolase. Its homolog (herein named MoxRcaEl) was identified from Microbacterium oxydans strain NS234. The nucleotide acid sequence for the full-length MoxRcaEl gene w as identified in the NCBI database (NCBI Reference Sequence: NZ_LDRQ01000062.1 from 12536 to 13915). The corresponding protein encoded by the MoxRcaEl gene is identified in the GenBank reference sequence: KTR74697. As described in the literature (Taga et al., Nature, 446: 449-453, 2007), a protein from Sinorhizobium meliloti 1021 was demonstrated to conduct the oxygen-dependent transformation of flavin mononucleotide (FMN) to 5,6-dimethylbenzimidazole (DMB) and D-erythrose 4-phosphate (E4P). Its full-length gene nucleotide acid sequence (herein named SmeBluBl), as identified in the NCBI database (NCBI Reference Sequence: NC_003047.1 from 1998826-1999509, complementary ). The corresponding protein encoded by the SmeBluBl gene is identified as NCBI reference sequence: WP_010969508.1.

With SmeBluBl as the query, a homolog (herein named PspBluBl) that shares 46% protein sequence identity to SmeBluB 1 , was identified in Paenibacillus sp. The full-length gene nucleotide acid sequence of PspBluBl was identified in the NCBI database (NCBI Reference Sequence: NZ_LMRY01000006.1 from 44623 to 45273). The corresponding protein encoded by the PspBluBl gene is shown in SEQ ID NO:7(NCBI reference sequence: WP_060645852.1). Plasmid pYRH548 includes a co-expression cassette for MoxRcaBl and

MoxRcaEl under constitutive promoters ENOl and modified FBA1 (FBA1L2), respectively. The functional and structural composition of plasmid pYRH548 is described in Table 1. Table 1. Functional and structural elements of plasmid pYRH548.

Plasmids pYRH549 and pYRH550 contain S. cerevisiae codon-optimized SmeBluBl (SEQ ID NO:6) or PspBluBl (SEQ ID NO:7) gene under a constitutive modified FBA1 promoter (FBA1L2; SEQ ID NO:3) and FBA1 terminator (SEQ ID NO:8).

Example 2

Genomic integration of a MoxRcaBl and MoxRcaEl co-expression cassette in W34/70 The larger brewing yeast Saccharomyces pastorianus Weihenstephan 34/70 (herein named W34/70) is an interspecies hybrid between S. cerevisiae and S. eubayanus and allotetraploid containing approximately one full diploid S. cerevisiae and one full diploid S. eubayanus genome (Nakao et al. (2009) DNARes. 16:115-129). Because of its beter utilization of maltose and maltotriose than other larger yeast, W34/70 strain is used predominantly in modem industrial-scale brewing (Gibson et al. (2013) Yeast 30:255- 266).

For targeted genome integration of expression cassettes, S. cerevisiae genome sequences of W34/70 were used (GenBank accession ABP000000000.1). To integrate the MoxRcaBl and MoxRcaEl co-expression cassete at the intergenic region between CLB5 and THI22 genes, pJT915 was used for Cas9/ gRNA- mediated homology directed recombination. The functional and structural composition as well as target sequences for Cas9/ gRNA plasmids, including pJT915, is described in Table 2 and 3.

Table 2. Functional and structural elements of Cas9/gRNA expression plasmids.

SUP4 terminator S. cerevisiae SUP4 terminator (SEQ ID NO: 18)

Table 3. Cas9 targeting sequences used at the 5’ of sgRNA (SEQ ID NO: 17) in Cas9/sgRNA plasmids.

20-nucleotide sequence

MoxRcaBl and MoxRcaEl co-expression cassette (SEQ IDNO:23) was amplified from pYRH548 (Table 1) by standard PCR using primers RH01527 (CACAGCAATAACACAACACAATGGTTAGTAGC; forward; SEQ ID N0 24) and RH01528 (CGTCGATATAGATAATAATGATAATGACAGCAGG; reverse; SEQ ID NO:25). To facilitate more efficient targeted integration, 2 additional DNA fragments were synthesized and amplified to be co-transformed with the expression cassette (illustrated in Figure 1). IDT214 (SEQ ID NO:26) is composed of 500bp of 5’- genomic region of the pJT915 target site (SEQ ID NO:19) and 500bp of 5’-end of MoxRcaBl and MoxRcaEl coexpression cassette (SEQ ID NO:23). IDT215 (SEQ ID NO:27) is composed of331bp of 3’- end of MoxRcaBl and MoxRcaEl co-expression cassette (SEQ ID NO:23) and 669bp of 3’- genomic region of the pJT915 target site (SEQ ID NO: 19). IDT214 was amplified by standard PCR using primers RH01535 (TATTTTGGACATCTATGAAACACC; forward; SEQ ID NO:28) and RH01536 (A ATT AAGT GAGGT GAC AAGGTTT C C ; reverse; SEQ ID NO:29). IDT215 was amplified using primers RH01537

(TTTTTTTGTGGAGACTAAGTCAGAAGTG; forward; SEQ ID NO:30) and RH01538 (TATTTATATTTTGGCTTTACTCTTCATC; reverse; SEQ ID NO:31). The amplified fragment was purified / concentrated using DNA Clean & Concentrator-5 (Zymo Research, Irvine, CA), and co-transformed with pJT915. Transformants were selected on YPD agar plates containing 200 mg/L Geneticin (G418). To confirm correct genomic integration of the expression cassette at the target site, PCR primers RH01558 (TAGTCTAAAAAAGAAAGCTCGCACTCAGG; forward; SEQ ID NO:33) and RH01561 (AT GTT GA AAT C GT GGAGAT CAT GT GT GC ; reverse; SEQ ID

NO:34) were used for 5’- region of the cassette integration confirmation. For the 3’-region of the cassette integration confirmation, primers RH01559

(TGCAGAAATCCGTTAGACAACATGAGGG; forward; SEQ ID NO:36) and RH01567

(GTACAGAAGTTTTACTATTAATCGCACC; reverse; SEQ ID NO:70) were used.

Transformants with correct genomic integration of the expression cassettes were selected for further analysis. Cas9/ sgRNA expression plasmid pJT915 was removed from the transformants by growing cells under non-selective media (YPD) and selected single colonies that could not grow on YPD plates containing 200 mg/L Geneticin. Four independent transformants were selected and named RHY1014, RHY1015, RHY1016, and RHY1017.

Example 3

Genomic integration of SmeBluBl or PspBluBl expression cassette

W34/70 or the strains RHY1016 and RHY1017 expressing the MoxRcaBl and MoxRcaEl were used for additional genomic integration of SmeBluBl or PspBluBl expression cassette. The expression cassette for SmeBluBl (SEQ ID NO:37) or PspBluBl (SEQ ID NO:38) was amplified from pYRH549 or pYRH550 respectively using primers RH01531 (GCCTACTTGGCTTCATATACGTTGCATACG; forward; SEQ ID NO:39) and RH01573 (ACAATTGGGAAGCATTCAAGGATTGGTACG; reverse; SEQ ID NO:40).

To integrate the SmeBluBl or PspBluBl expression cassette at the intergenic region between AAP1 and YHK8 genes of S. cerevisiae, pYRH432 or pYRH433 was used for Cas9/ gRNA- mediated homology directed recombination. The functional and structural composition as well as target sequences for pYRH432 and pYRH433 are described in Table 2 and 3.

To facilitate more efficient targeted integration, 2 additional DNA fragments were synthesized and amplified to be co-transformed with the expression cassette (illustrated in Figure 1). IDT221 (SEQ ID NO:41) is composed of 375bp of 5’-genomic region of the pYRH432 and pYRH433 target sites (Table 3) and a common 358bp sequence of 5’-end of SmeBluBl and PspBluBl expression cassettes (SEQ IDNO:37 and 38, respectively). IDT222 (SEQ ID NO:42) is composed of a common 375bp sequence of 3’-end of SmeBluBl and PspBluBl expression cassettes (SEQ ID NO:37 and 38, respectively) and 375bp of 3’- genomic region of the pYRH432 and pYRH433 target sites (Table 3).

IDT221 was amplified by standard PCR using primers RH01569 (TTGGTCCCGAAATTGATCTC; forward; SEQ ID NO:43) and RHO1570 (_{TTTTTTGTGGAGACTAAGTCAGAAG}; reverse; SEQ ID NO:44). IDT222 (SEQ ID NO:42) was amplified using primers RH01571 (TTAACTTGAATTTATTCTCTAGC; forward; SEQ ID NO:45) and RH01572 (AAT AAATTTTTTGTT GTTCTTT C AGT GC ; reverse; SEQ ID NO:46). The amplified fragment was purified / concentrated using DNA Clean & Concentrator-5 (Zymo Research, Irvine, CA), and co-transformed with pYRH432 or pYRH433.

Transformants were selected on YPD agar plates containing 200 mg/L Geneticin (G418). To confirm correct integration at target site in the genome, primers RH01216 (TCTCATGTATGAGCGAATCTTTTTGTGTTATAGG; forward; SEQ ID NO:47) and RH01219 (GAAGGAAAATCTCAAACAGAAACTTCG; reverse; SEQ ID NO:48) were used to amplify the intergenic region between AAP1 and YHK8 genes from the upstream of 5’- homology arm of IDT221 (SEQ ID NO:41) to the downstream of 3 -homology arm of IDT222 (SEQ ID NO:42). If the expression cassette was integrated correctly, 3.3kb PCR fragment was expected to be amplified, opposed to 1.2 kb PCR fragment when there was no insert (i.e. native gene amplification).

Transformants with correct integration of the expression cassette were selected for further analysis. Cas9/ sgRNA expression plasmid pYRH432 or pYRH433 was removed from the transformants by growing cells under non-selective media (YPD) and screened single colonies that could not grow on YPD plates containing 200 mg/L Geneticin. Independent transformants RHY1012 and RHY1013 contain only the SmeBluBl expression cassette (SEQ ID NO:37). Independent transformants RHY1054, RHY1055, and RHY1058 contain the MoxRcaBl and MoxRcaEl co-expression cassette (SEQ ID NO:23) as well as the SmeBluBl expression cassette (SEQ IDNO:37). Independent transformants RHY1056, RHY1057, RHY1059, and RHY1060 contain the co-expression cassette (SEQ ID NO:23) for MoxRcaBl and MoxRcaEl, and the PspBluBl expression cassettes (SEQ ID NO:38) (Figure 2).

Example 4

Riboflavin concentrations in wort after brewing of W34/70 strains expressing

RcaB1/E1 and/or BluB

The current example describes riboflavin concentration measurements in wort after brewing W34/70 or its derived strains. The brewing procedure was as described in “Materials and Methods”. Briefly, seed cultures were prepared by growing the strains aerobically in 25ml malt extract at 22°C for 3 days in shake flasks. Cells from the seed culture were inoculated in 300ml fresh malt extract to an OD₆₀₀ of 1 .0, and fermentation was done at 15°C for 10 days in the dark without shaking. Samples were collected in 1 ml aliquots and immediately stored at ~80°C until riboflavin assay is performed.

Figure 3 summarizes the results. Strains expressing SmeBluBl alone or together with RcaBl/RcaEl showed about 5% reduction in riboflavin concentrations in wort after brewing, compared to wild type W34/70 control strain. Strains expressing RcaBl/RcaEl with or without PspBluBl showed about 12% lower riboflavin concentrations compared to the wild type control strain.

Example 5

RIB5 gene deletion in diploid ethanologen yeast FerMax™ Gold Label Yeast (FG)

The current example describes protecting beer from generating light-struck flavor by decreasing free flavins in beer. Potential solution is to modify yeast to produce less riboflavin in the cell by disrupting riboflavin biosynthetic pathway to make cells consume riboflavin in the media during the brewing fermentation. Rib5 is riboflavin synthase which catalyzes the last step of the riboflavin biosynthesis pathway, and deletion of RIB5 gene in S. cerevisiae confers riboflavin auxotrophy (Santos MA, et al. (1995) J Biol Chem 270(1):437- 44).

For deletion of S. cerevisiae RIB5 gene (SEQ ID NO:49), Cas9/ gRNA- mediated homology directed recombination method was used. Plasmid pYRH553 was constructed to facilitate the double strain break (DSB) within S. cerevisiae RIB5 gene. Functional and structural composition as well as the target sequence of pYRH553 plasmids is described in Table 2 and 3. The DSB repair DNA is the annealed product of two complementary single strand DNA molecules, RH01515 (SEQ ID NO:50) and RH01518 (SEQ ID NO:51), which contains 45bp upstream and 45bp downstream sequences of the RIB5 coding sequence, so that complete deletion of S. cerevisiae RIB5 gene occurs when DSB is repaired by homology.

Fermax Gold (FG) transformants of the DSB repair DNA and pYRH553 were screened by colony PCR using primers RH01516 (SEQ ID NO:52) and RH01517 (SEQ ID NO:53) by standard PCR. 0.5kb PCR product was expected when 714bp S. cerevisiae RIB5 gene is deleted. If the RIB5 gene is intact, 1.2kb size band was expected. The Cas9/ sgRNA expression plasmid pYRH553 from the rib5 deletion mutants was removed from the transformants by growing cells under non-selective media (YPD) and screened for single colonies that could not grow on YPD plates containing 200 mg/L Geneticin. The rib5 mutant cannot grow without supplement of riboflavin, so 20 mg/L of riboflavin was added to all media. Independent transformants RHY1070, RHY1071, and RHY1072 were chosen and stored for further analyses.

Example 6

Mch5 riboflavin transporter overexpression in rib5 deletion mutants

The current example describes the modification of yeast to promote riboflavin transport into the cells by overexpressing riboflavin transporter Mch5. In combination with the disruption of Rib5 riboflavin biosynthetic pathway, the yeast is facilitated to uptake riboflavin in the medium during the brewing fermentation. Deletion of RIB5 gene in S. cerevisiae confers riboflavin auxotrophy, and overexpression of Mch5 in rib5 mutant suppress the auxotrophic phenotype (Reihl and Stolz (2005) J. Biol. Chem. 280: 39809 - 39817).

Plasmid pYRH554 includes an expression cassette for S. cerevisiae MCH5 gene under constitutive FBA1 promoter. The functional and structural composition of plasmid pYRH554 is described in Table 4.

Table 4. Functional and structural elements of plasmid pYRH554.

To integrate the S. cerevisiae MCH5 expression cassette at the intergenic region between CLB5 and THI22 genes of S. cerevisiae, pJT915 was used for Cas9/ gRNA- mediated homology directed recombination. The functional and structural composition as well as target sequences for Cas9/ gRNA plasmids, including pJT915, is described in Table 2 and 3.

The expression cassette for MCH5 (SEQ ID NO:58) was amplified from pYRH554 using primers RH01548 (TGAACAACAATACCAGCCTTCCAACTTCTG; forward;

SEQ ID NO: 59) and RH01549 (ACGTGTTGAGATGCTGAAAGAGAAGACTGACG; reverse; SEQ ID NO:60) by standard PCR. To facilitate an efficient targeted integration, 2 additional DNA fragments IDT216 and IDT217 were synthesized and co-transformed with the MCH5 expression cassette (illustrated in Figure 1). IDT216 (SEQ ID NO: 61) is composed of 500bp of 5’-genomic region of the pJT915 target site (SEQ ID NO:19) and 500bp of 5’-end of MCH5 expression cassette (SEQ ID NO:57). IDT217 (SEQ ID NO:62) is composed of 184bp of 3’-end of MCH5 expression cassette (SEQ ID NO:57) and 566bp of 3 -genomic region of the pJT915 target site (SEQ ID NO: 19). IDT216 (SEQ ID NO:61) was amplified by standard PCR using primers RH01539 (TATTTTGGACATCTATGAAACACC; forward; SEQ ID NO: 63) and RHO 1540

reverse; SEQ ID NO:64). IDT217 (SEQ ID NO: 62) was amplified using primers RH01541 (TTTTATTTTTCCGAATTAAAGTCAC; forward; SEQ ID NO:65) and RH01542 (TGAATGGAGGCGAATGCAAGACAG; reverse; SEQ ID NO: 66). The amplified fragments were purified and concentrated using DNA Clean & Concentrator-5 (Zymo Research, Irvine, CA), and co-transformed with pJT915.

Transformants were selected on YPD agar plates containing 200 mg/L Geneticin (G418) and 20 mg/L of riboflavin. To confirm correct integration at target site in the genome, primers RH01558 (TAGTCTAAAAAAGAAAGCTCGCACTCAGG; forward; SEQ ID NO:67) and RH01562 (AAGTTTTTGTGAGGGCGTAATTGAAGCG; reverse; SEQ ID NO:68) were used for 5’- region of cassette integration confirmation. For the 3’- region of the cassette integration confirmation, pnmers RH01568 (TGTAAGCGCTGTTTGCTACATAATTTCG; forward; SEQ ID NO:69) and RH01567 (GTACAGAAGTTTTACTATTAATCGCACC; reverse; SEQ ID NO:70) were used.

Transformants with correct genomic integration of the expression cassettes were selected for further analysis. Cas9/ sgRNA expression plasmid pJT915 was removed from the transformants by growing cells under non-selective medium (YPD) and screening single colonies that could not grow on YPD plates containing 200 mg/L Geneticin. Independent transformants RHY1076, RHY1077, RHY1078, and RHY1079 were chosen for further analyses. These strains contain S. cerevisiae rib5 deletion and S. cerevisiae MCH5 overexpression cassette (Figure 4).

Example 7

Mch5 riboflavin transporter overexpression on a multicopy plasmid

The current example describes the modification of yeast to promote riboflavin transport into the cells by overexpressing riboflavin transporter Mch5 on a multicopy plasmid. For this, RHY1076 and RHY1078 were made to ahistidine auxotroph by deleting HIS3 gene for histidine biosynthesis.

For deletion of S. cerevisiae HIS3 gene (SEQ ID NO:72), Cas9/ gRNA- mediated homology directed recombination method was used. Plasmid pYRF1573 was constructed to facilitate the double strain break (DSB) in S. cerevisiae HIS3 gene. Functional and structural composition as well as the target sequence of pYRH573 is described in Table 2 and 3. The DSB repair DNA is the annealed product of two complementar single strand DNA molecules, RH01614 (SEQ ID NO:73) and RH01615 (SEQ ID NO:74), which contains 45bp upstream and 45bp downstream sequences of the HIS3 coding sequence, so that complete deletion of S. cerevisiae HIS3 gene occurs when DSB is repaired by homology.

RHY1076 and RHY1078 transformed with the DSB repair DNA and pYRH573 were screened by colony PCR using primers RH01616 (SEQ ID NO:75) and RH01617 (SEQ ID NO:76) by standard PCR. A 750 bp PCR product was expected when 660bp S. cerevisiae HIS3 gene is deleted. If the RIB5 gene is intact, 1.4kb size band was expected. The Cas9/ sgRNA expression plasmid pYRH573 from the his3 deletion mutants was removed from the mutant by growing cells under non-selective media (YPD) and screening single colonies that could not grow on YPD plates containing 200 mg/L Geneticin. Two resulting independent his3 mutants were named RHY1080 or RHY1081 and used for the transformation of pYRH554 (Table 4), to express MCH5 gene on a multicopy 2-micron plasmid. The pYRH554 transformants were selected on SC-histidine plates and named as RHY1082, RHY1083, RHY1084, and RHY1085.

Example 8

Riboflavin concentrations after growing strains with rib5 deletion with or without

Mch5 overexpression

The current example describes the measurements of riboflavin concentrations after growing yeast strain in synthetic media. Growth procedures were as described in “Materials and Methods”. Figure 5 summarizes the riboflavin analysis results. The reduction in riboflavin concentrations were similar either in aerobic (Figure 5 A) or in anaerobic (Figure 5B) growth condition. The lowest riboflavin concentration was observed with the strain containing rib5 deletion together with multicopy plasmid expression of Mch5, in either growth condition, which showed 14% reduction in riboflavin concentration in the media compared to the parental FG control strain.

Example 9

Construction of a yeast strain containing rib5 deletion and co-expression of Mch5 and RcaBl/RcaEl

The current example describes a genomic integration of the RcaBl/RcaEl co expression cassette in the strain containing rib5 deletion and multicopy MCH5 expression. A strain RHY1083 is used for the transformation.

MoxRcaBl and MoxRcaEl co-expression cassette (SEQ ID NO:23) is amplified from pYRH548 (Table 1) by standard PCR using primers RH01527 (CACAGCAATAACACAACACAATGGTTAGTAGC; forward; SEQ ID N0 24) and RH01528 (CGTCGATATAGATAATAATGATAATGACAGCAGG; reverse; SEQ ID NO:25). To facilitate more efficient targeted integration, 2 additional DNA fragments are synthesized and amplified to be co-transformed with the expression cassette (illustrated in Figure 1).

IDT237 (SEQ ID NO:77) is composed of 375bp of 5’-genomic region of the pYRH433 target site (SEQ ID NO:21) and 500bp of 5’-end of MoxRcaBl and MoxRcaEl co-expression cassette (SEQ ID NO:23). IDT238 is composed of 33 lbp of 3’-end of MoxRcaBl and MoxRcaEl co-expression cassette (SEQ ID NO:23) and 375bp of 3 - genomic region of the pYRH433 target site (Table 3). IDT237 (SEQ ID NO:78) is amplified by standard PCR using primers RH01569 (SEQ ID NO:43) and RH01536 (SEQ ID NO:29). IDT238 is amplified using pnmers RH01537 (SEQ ID NO:30) and RH01572 (SEQ ID

NO:46). The amplified fragment is purified / concentrated using DNA Clean & Concentrator- 5 (Zymo Research, Irvine, CA), and co-transformed with pYRH433.

Transformants are selected on YPD agar plates containing 200 mg/L Geneticin (G418). To confirm correct genomic integration at target site, primers RH01216 (TCTC ATGT AT GAGCGAAT CTTTTT GTGTT AT AGG; forward; SEQ ID NO:47) and RH01561 (ATGTTGAAATCGTGGAGATCATGTGTGC; reverse; SEQ ID NO:34) are used for 5’- region of the cassette integration confirmation. For the 3’-region of the cassette integration confirmation, primers RH01559

(TGCAGAAATCCGTTAGACAACATGAGGG; forward; SEQ ID NO:36) and RH01219 (TGCAGAAATCCGTTAGACAACATGAGGG; reverse; SEQ ID NO:48) are used.

Transformants with correct genomic integration of the expression cassettes are selected for further analysis. Cas9/ sgRNA expression plasmid pYRH433 is removed from the transformants by growing cells under non-selective media (YPD) and screening single colonies that cannot grow on YPD plates containing 200 mg/L Geneticin. Four independent transformants are selected for further analyses and named RHY2000-2003.

While various embodiments of the present invention have been described above, it should be understood that they have been presented by way of example only, and not limitation. It will be apparent to persons skilled in the relevant art that various changes in form and detail can be made therein without departing from the spirit and scope of the invention. Thus, the breadth and scope of the present invention should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents. All publications, patents and patent applications mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains, and are herein incorporated by reference to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference.

Claims

WHAT IS CLAIMED IS:

1. A flavor stabilized beer having low riboflavin wherein said beer has less than 200 gg/L of riboflavin.

2. The beer of claim 1 having less than 100 mg/L of riboflavin.

3. The beer of claim 2 having less than 50 gg/L of riboflavin.

4. The beer of claim 3 having less than 10 gg/L of riboflavin.

5. The beer of claim 4 having less than 5 gg/L of riboflavin.

6. The beer of claim 5 having less than 1 gg/L of riboflavin.

7. The beer of claim 6 having less than 0.5 gg/L of riboflavin.

8. The beer of claim 7 having less than 0.1 gg/L of riboflavin.

9. A method for preparing a flavor stabilized beer having low riboflavin comprising fermenting a wort having riboflavin with modified yeast cells, derived from parental yeast cells, said modified yeast cells having disrupted riboflavin biosynthesis, whereby the modified yeast cells deplete the riboflavin in the wort to produce the beer having less than 200 gg/L of riboflavin.

10. The method of claim 9 wherein the beer has less than 100 gg/L of riboflavin.

11. The method of claim 10 wherein the beer has less than 50 gg/L of riboflavin.

12. The method of claim 11 wherein the beer has less than 10 gg/L of riboflavin.

13. The method of claim 12 wherein the beer has less than 5 gg/L of riboflavin.

14. The method of claim 13 wherein the beer has less than 1 gg/L of riboflavin.

15. The method of claim 14 wherein the beer has less than 0.5 μg/L of riboflavin.

16. The method of claim 15 wherein the beer has less than 0.1 μg/L of riboflavin.

17. The method of any of claims 9 to 16 wherein the modified yeast cells have a genetic disruption of a gene involved in riboflavin biosynthesis.

18. The method of claim 17 wherein the gene is selected from the group consisting of ribl, rib2, rib3, rib4, rib5 or rib7.

19. The method of claim 18 wherein the gene is rib5.

20. The method of any of claims 9 to 19 wherein the modified yeast cells further comprise a heterologous nucleic acid encoding Mch5p, providing for enhanced riboflavin uptake by the yeast cell.

21. The method of claim 20 wherein the nucleic acid coding sequence of Mch5p corresponds to SEQ ID NO: 56.

22. The method of claim 21 wherein the Mch5p coding sequence is under the control of a yeast constitutive promoter.

23. The method of claim 22 wherein the promoter is FBA1.

24. The method of any of claims 9 to 23 wherein the parental yeast cells are selected from the group consisting of Schizosaccharomyces, Brettanomyces, Kluyveromyces, Yarrowia, Pichia, Candida, Hansenula, Issatchenkia, and Saccharomyces.

25. The method of claim 24 wherein the parental yeast cells are Saccharomyces.

26. The method of claim 25 wherein the parental yeast cells are Saccharomyces cerevisiae and Saccharomyces pastorianus.

27. The method of any of claims 9 to 26 wherein the modified yeast cells have a functionally expressed heterologous riboflavinase.

28. The method of claim 27 wherein the riboflavinase is a riboflavin hydrolase.

29. The method of claim 28 wherein the riboflavin hydrolase comprises a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to MOXRcaEl (SEQ ID NO:79) or a riboflavin hydrolase active fragment thereof or MOXRcaE2 (SEQ ID NO: 80) or a riboflavin hydrolase active fragment thereof.

30. The method of claim 27 wherein the riboflavinase is a riboflavin reductase.

31. The method of claim 30 wherein the riboflavin reductase comprises a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to MOXRcaBl (SEQ ID NO: 81) or a riboflavin reductase active fragment thereof or MOXRcaB2 (SEQ ID NO: 82) or a riboflavin reductase active fragment thereof.

32. The method of claims 30 or 31 wherein the modified yeast cells further comprise a riboflavin hydrolase.

33. The method of claim 32 wherein the riboflavin hydrolase wherein the riboflavin hydrolase comprises a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to MOXRcaEl (SEQ ID NO:79) or a riboflavin hydrolase active fragment thereof or MOXRcaE2 (SEQ ID NO: 80) or a riboflavin hydrolase active fragment thereof.

34. The method of claim 27 wherein the riboflavinase is a riboflav in destructase.

35. The method of claim 34 wherein the riboflavin destructase comprises a polypeptide having at least 70%, 80%, 90%, 95%, 99% or 100% sequence identity to SmeBluBl (SEQ or a riboflavin destructase active fragment thereof.

36. A beer made according to any of claims 9 to 35.

37. A flavor stabilized beer according to any of claims 1 to 8 having less than 50 ppt 3MBT.

38. The flavor stabilized beer according to claim 38 having less than 40 ppt 3MBT.

39. The flavor stabilized beer according to claim 39 having less than 30 ppt 3MBT.

40. The flavor stabilized beer according to claim 40 having less than 20 ppt 3MBT.

41. The flavor stabilized beer according to claim 41 having less than 10 ppt 3MBT.

42. A flavor stabilized beer according to any of claims 37-41 wherein the amount of 3MBT does not increase more than 20% over 3 months, 6 months or 9 months of storage.

43. The flavor stabilized beer of claim 42 wherein the amount of 3MBT does not increase more than 10%.

44. The flavor stabilized beer of claim 43 wherein the amount of 3MBT does not increase more than 5%.

45. A flavor stabilized beer according to any of claims 1 to 8 or 37 to 44 wherein the beer is a 100% malt based beer.

46. A method for preparing a flavor stabilized beer having reduced riboflavin comprising fermenting a wort having riboflavin with modified yeast cells, derived from parental yeast cells, said modified yeast cells having disrupted riboflavin biosynthesis, whereby the modified yeast cells deplete the riboflavin in the wort to produce beer having at least 10% less riboflavin produced than by a beer fermented with the parental yeast cells.

47. The method of claim 46 wherein said beer has at least 20% less riboflavin.

48. The method of claim 47 wherein said beer has at least 30% less riboflavin.

49. The method of claim 48 wherein said beer has at least 40% less riboflavin.

50. The method of claim 49 wherein said beer has at least 50% less riboflavin.

51. The method of claim 50 wherein said beer has at least 60% less riboflavin.

52. The method of claim 51 wherein said beer has at least 70% less riboflavin.

53. The method of claim 52 wherein said beer has at least 80% less riboflavin.

54. The method of claim 53 wherein said beer has at least 90% less riboflavin.

55. The method of claim 54 wherein said beer has at least 95% less riboflavin.

56. The method of claim 55 wherein said beer has at least 99% less riboflavin.

57. The method of any of claims 46 to 56 wherein the parental yeast is Saccharomyces pastorianus.

58. The method of claims 57 wherein the Saccharomyces pastorianus is strain W34/70.