JP2012157270A - Yeast exhibiting resistance to glycolaldehyde - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide yeast exhibiting resistance to glycolaldehyde, and a breeding method for the same.SOLUTION: This invention provides the yeast exhibiting resistance to glycolaldehyde with a gene encoding alcohol dehydrogenase introduced into a host. The yeast belonging to a genus selected from a group consisting of the genus Saccharomyces, the genus Schizosaccharomyces, the genus Kluyberomyces, the genus Pichia, and the genus Schizosaccharomyces or genus Candida is used.

Description

   The present invention relates to a yeast exhibiting resistance to glycolaldehyde and a breeding method thereof.

Conventionally, when bioethanol is produced by pressurized hot water treatment, lignocellulose was treated with pressurized hot water and then yeast was added to produce bioethanol. This solution had a fermentation inhibitory effect. . The present inventor recently found that this expression inhibitory effect is due to glycolaldehyde (Non-patent Document 1).
On the other hand, it has been reported that the alcohol dehydrogenase gene of sake yeast is highly expressed and the enzyme activity is enhanced accordingly, improving the ability of the yeast to produce ethyl alcohol (Non-patent Document 2).
Under such circumstances, development of a method for efficiently producing alcohol while avoiding the action of glycolaldehyde is desired.

Lahiru N. J., et al., Biotechnol Lett. 2011 Feb; 33 (2): 285-92 Journal of Japan Brewing Association: Vol.99 No.5, Page. 365-373 (2004)

  An object of this invention is to provide the yeast which is tolerance to glycolaldehyde, and its breeding method.

As a result of intensive studies to solve the above problems, the present inventor has found that when ADH1 encoding alcohol dehydrogenase is destroyed, it becomes more sensitive to glycolaldehyde than the parent strain. And it discovered that yeast highly resistant to glycolaldehyde was produced by highly expressing ADH1 which codes alcohol dehydrogenase in yeast, and came to complete this invention.
That is, the present invention is as follows.
(1) Yeast showing resistance to glycolaldehyde.
(2) A yeast resistant to glycolaldehyde, wherein a gene encoding alcohol dehydrogenase has been introduced into the host yeast.
(3) The yeast according to (1) or (2), wherein the yeast belongs to the genus Saccharomyces, Schizosaccharomyces, Kluberomyces, Pichia, Schizosaccharomyces or Candida.
(4) The yeast according to (2), wherein the gene encoding alcohol dehydrogenase encodes the following protein (a) or (b):
(a) a protein comprising the amino acid sequence represented by SEQ ID NO: 2
(b) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and having alcohol dehydrogenase activity (5) a gene encoding alcohol dehydrogenase The yeast according to (2), which comprises the following DNA (a) or (b):
(a) DNA consisting of the base sequence represented by SEQ ID NO: 1
(b) DNA that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 1 and encodes a protein having alcohol dehydrogenase activity
(6) The yeast according to (2), wherein the receipt number is NITE AP-1052.
(7) A method for producing a yeast exhibiting resistance to glycolaldehyde, which comprises introducing a gene encoding an alcohol dehydrogenase into a host yeast.
(8) Alcohol fermentation using the yeast of any one of said (1)-(6), The manufacturing method of the alcohol characterized by the above-mentioned.

The present invention provides yeast resistant to glycolaldehyde. The yeast of the present invention is resistant even in the presence of glycolaldehyde and can efficiently perform alcoholic fermentation.
There have been reports on the relationship between the ability to produce ethyl alcohol and high expression of the alcohol dehydrogenase gene (literature name: Overexpression of ADH1 and HXT1 genes in the yeast Saccharomyces cerevisiae improves the fermentative efficiency during tequila elaboration. Gutierrez-Lomeli M , Torres-Guzman JC, Gonzalez-Hernandez GA, Cira-Chavez LA, Pelayo-Ortiz C, Ramirez-Cordova Jde J. Antonie Van Leeuwenhoek. 2008 May; 93 (4): 363-71.), Expression of alcohol dehydrogenase gene There is no suggestion of a relationship between glycolaldehyde and resistance to glycolaldehyde, and there is no case of selecting yeasts that highly express the alcohol dehydrogenase gene. According to the present invention, yeast becomes resistant to glycolaldehyde, and ethanol can be produced efficiently.
Therefore, the yeast of the present invention is extremely useful for production of bioethanol and the like.

It is a figure which shows that the yeast of this invention is resistant to glycol aldehyde. It is a figure which shows the bioethanol production characteristic of a breeding strain.

Hereinafter, the present invention will be described in detail.
1. Overview The present invention is a yeast exhibiting resistance to glycolaldehyde and a breeding method thereof. The yeast of the present invention is more resistant to glycolaldehyde than wild-type yeast, and can produce alcohol efficiently.
The inventor has shown in previous studies that when the gene encoding alcohol dehydrogenase (ADH1) in yeast (ADH1 gene) is disrupted, the disrupted yeast is more sensitive to glycolaldehyde than the parent strain. It was. Since glycol aldehyde (GA) inhibits alcohol fermentation, it was considered that alcohol fermentation can be efficiently performed by breeding yeast resistant to GA.
Therefore, the wild type strain (parent strain) was cultured in the presence of GA, and the yeast resistant to GA was successfully selected. The selected yeast had high expression of the ADH1 gene. In addition, when a transgenic yeast was prepared by introducing the ADH1 gene into a yeast host using a genetic engineering technique, the yeast expressed the ADH1 gene at a high level and became resistant to GA.
The present invention has been completed based on the above findings.

2. Acquisition of Glycolaldehyde-Resistant Strain from Wild-type Parent Strain Yeast The present invention is characterized by culturing a parent strain yeast in the presence of glycolaldehyde (GA) and selecting a yeast resistant to the GA. The yeast selected and selected in this way highly expresses the ADH1 gene, is resistant to GA, and can efficiently perform alcoholic fermentation.
In the present invention, the yeast used as the parent strain is not particularly limited, and belongs to the genus Saccharomyces, Pichia, Candida, Schizosaccharomyces or Kluyveromyces, for example. A yeast is mentioned. Examples of yeast belonging to each genus include the following yeasts.

Saccharomyces genus: Saccharomyces cerevisiae, Saccharomyces bayanus, Saccharomyces fermentati, Saccharomyces oviformis, Saccharomyces rouxii, Saccharomyces chevalieri, etc.
Pichia pasteurianus
Candida glabrata
The yeast used in the present invention is preferably a yeast belonging to the genus Saccharomyces, and more preferably Saccharomyces cerevisiae.
GA is not particularly limited, and commercially available products (for example, Sigma-Aldrich) can be used.

  In the present invention, yeast is cultured in the presence of GA. The culture conditions are not particularly limited, and can be appropriately set depending on the yeast used. For example, GA is added to a normal yeast culture medium to obtain a GA-containing medium, and this medium is used for culture. The concentration of GA is, for example, 0.1 mM to 50 mM, preferably 1 mM to 20 mM. The culture time is, for example, 1 day to 20 days, and preferably 2 days to 5 days. The culture temperature is, for example, 15 ° C to 50 ° C, preferably 25 ° C to 40 ° C.

  After culturing, strains resistant to GA are selected and isolated. “Tolerance” means a property capable of growing even in the presence of GA, and a yeast that can survive and proliferate is said to be “resistant” when cultured under the above culture conditions using the above-mentioned GA-containing medium. The index of “growth” for determining resistance is that the growth rate is 1.2 times or more faster than that of the parent strain. In order to construct a strain that highly expresses the ADH1 gene in a GA-resistant strain, the expression level of the ADH1 gene or the enzyme activity of ADH1 is determined by a real time PCR test on the surviving strain after culturing in the presence of GA. A strain having a higher expression level or enzymatic activity of the ADH1 gene than the parent strain or wild type yeast may be finally selected as the target strain.

  “High expression” or “high expression level” means that the expression level of the ADH1 gene is high compared to the parent strain or the wild strain, and is 120% or more, preferably 300% compared to the parent strain or the wild strain. It means having the above ADH activity.

3. Breeding by genetic engineering technique In the present invention, a yeast resistant to GA can be obtained by genetic engineering by introducing the ADH1 gene into a parent strain (host yeast). Details thereof will be described below.
(1) Alcohol dehydrogenase and its gene
For the ADH1 gene, genomic DNA is extracted from yeast, a primer or probe is prepared based on the base sequence of the ADH1 gene, and the target ADH1 gene can be screened.

The ADH1 gene used in the present invention encodes the following protein (a) or (b).
(a) a protein comprising the amino acid sequence represented by SEQ ID NO: 2
(b) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and having alcohol dehydrogenase activity; amino acid sequence represented by SEQ ID NO: 2 In the amino acid sequence in which one or several amino acids are deleted, substituted, added, or mutated by a combination thereof, for example,
(i) an amino acid sequence in which 1 to 9 (for example, 1 to 5, preferably 1 to 3, more preferably 1 to 2) amino acids in the amino acid sequence represented by SEQ ID NO: 2 have been deleted;
(ii) 1 to 9 (for example, 1 to 5, preferably 1 to 3, more preferably 1 to 2) amino acids in the amino acid sequence represented by SEQ ID NO: 2 are substituted with other amino acids Amino acid sequence,
(iii) an amino acid sequence obtained by adding 1 to 9 (for example, 1 to 5, preferably 1 to 3, more preferably 1 to 2) amino acids to the amino acid sequence represented by SEQ ID NO: 2;
(iv) Amino acid sequences mutated by the combinations (i) to (iii) above.

  Here, the “alcohol dehydrogenase activity” means a catalytic activity that acts specifically on alcohol and generates aldehyde. The enzyme activity can be measured by a known method, for example, an activity measurement method using gas chromatography, an activity measurement method using a spectroscopic method, or a method for measuring the activity of converting aldehyde to alcohol. Further, “having alcohol dehydrogenase activity” means 40% or more, 50% or more, 70% or more, compared to when the alcohol dehydrogenase enzyme activity of the protein having the amino acid sequence represented by SEQ ID NO: 2 is taken as 100, It means having an activity of 80% or more, preferably 90% or more, more preferably 95% or more.

In addition, the ADH1 gene used in the present invention has an amino acid sequence having a homology of about 90% or more, preferably about 95% or more, more preferably about 98% or more with the amino acid sequence represented by SEQ ID NO: 2. Also included is a gene that has an alcohol dehydrogenase activity (amino acid sequence substantially equivalent to the amino acid sequence represented by SEQ ID NO: 2).
Therefore, in the present invention, a gene encoding the following protein (c) can also be used.

(c) a protein comprising an amino acid sequence having 90% or more homology with the amino acid sequence represented by SEQ ID NO: 2 and having alcohol dehydrogenase activity

For homology, homology search such as FASTA, BLAST, PSI-BLAST, etc. can be used on a homology search site using the Internet, for example, Japan DNA Data Bank (DDBJ). In addition, a search using BLAST can be performed in the National Center for Biotechnology Information (NCBI).

  Here, in the amino acid sequence represented by SEQ ID NO: 2, a DNA (polynucleotide) encoding an amino acid sequence having a mutation such as deletion, substitution or addition in one or several amino acids is “Molecular Cloning, A Laboratory”. Manual 3rd ed. "(Cold Spring Harbor Laboratory Press (2001))," Current Protocols in Molecular Biology "(John Wiley & Sons (1987-1997)), Kunkel, Method. Enzymol. 85: 2763-6 (1988), etc. It can be prepared according to a method such as the site-directed mutagenesis method described in 1.

To introduce mutations into the ADH1 gene, mutation introduction kits using site-directed mutagenesis methods such as Kunkel method and Gapped duplex method, such as QuikChange ^TM Site-Directed Mutagenesis Kit (Stratagene), GeneTailor ^TM Site-Directed Mutagenesis System (manufactured by Invitrogen), TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km, etc. (manufactured by Takara Bio Inc.)) and the like can be used.

  In addition, the ADH1 gene used in the present invention includes a nucleotide sequence represented by SEQ ID NO: 1, or a DNA comprising a nucleotide sequence complementary to the nucleotide sequence represented by SEQ ID NO: 1, and stringent conditions. Also included is DNA that hybridizes underneath and that encodes a protein having alcohol dehydrogenase activity.

  Such DNA can be obtained using the above-mentioned site-directed mutagenesis method, or colony hybridization, plaque high using the polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 1 or a fragment thereof as a probe. It can also be obtained from cDNA libraries and genomic libraries by known hybridization methods such as hybridization and Southern blot. For the method for preparing the library, “Molecular Cloning, A Laboratory Manual 3rd ed.” (Cold Spring Harbor Laboratory Press (2001)) and the like can be referred to. Commercially available cDNA libraries and genomic libraries may also be used.

  “Stringent conditions” can be determined based on the melting temperature (Tm) of the nucleic acid that binds to the probe. For example, as washing conditions after hybridization (so-called “stringent conditions”), 6 × SSC (composition of 1 × SSC: 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0), 0.5% SDS, 5X Denhart and 100 mg / Conditions include incubation with a probe in a solution containing ml herring sperm DNA at 65 ° C. for 8 to 16 hours for hybridization (Molecular Cloning, A Loboratory Mannual, 3rd ed.).

  In addition to the above conditions, in the present invention, washing conditions after hybridization include, for example, “2 × SSC, 0.1% SDS, 42 ° C.”, “1 × SSC, 0.1% SDS, 37 ° C.”, and more stringent. As conditions, for example, conditions such as “1 × SSC, 0.1% SDS, 65 ° C.”, “0.5 × SSC, 0.1% SDS, 50 ° C.”, and the like may be employed.

  Hybridization can be performed by a known method. Hybridization methods include, for example, “Molecular Cloning, A Laboratory Manual 3rd ed.” (Cold Spring Harbor Laboratory Press (2001)), “Current Protocols in Molecular Biology” (John Wiley & Sons (1987-1997)) and the like. You can refer to it.

(2) Production of transformed yeast
In order to introduce the ADH1 gene into host yeast, in the present invention, the ADH1 gene is cloned from a PCR product or the like, and the plasmid used for the cloning is digested with a restriction enzyme. If there is an appropriate restriction enzyme cleavage site in the base sequence of the ADH1 gene, the corresponding restriction enzyme may be used. The DNA fragment after restriction enzyme digestion can be purified by agarose gel electrophoresis or the like, and the purified DNA fragment can be incorporated into an expression vector using a known method to obtain an ADH1 gene expression vector. This expression vector is introduced into a host yeast to produce a transformed yeast that highly expresses the ADH1 gene.

The host yeast is not limited, and for example, yeast belonging to the genus Saccharomyces, Pichia, Candida, Schizosaccharomyces or Kluyveromyces is used. be able to. The types of these yeasts are the same as those described in the above section “2. Acquisition of glycolaldehyde-resistant strains from wild-type parent yeast”. A preferred host yeast is Saccharomyces cerevisiae.
Examples of expression vectors include pRS, YEp13, YCp50, pAUR123, and the like. Examples of the promoter include gal1 promoter, gal10 promoter, HSP promoter, MFα1 promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, AOX1 promoter, TDH3 promoter and the like.

In order to highly express the ADH1 gene, the vector of the present invention includes a promoter, an ADH1 gene, a cis element such as an enhancer, a splicing signal, a poly A addition signal, a selection marker, a ribosome binding sequence (SD sequence), etc. Can be connected.
Examples of the method for introducing a recombinant vector into yeast include an electroporation method, a spheroplast method, and a lithium acetate method.
The transformed yeast prepared in this way highly expresses the ADH1 gene and exhibits resistance to GA. The alcohol dehydrogenase activity in the transformed yeast can be measured by the method described in the section “(1) Alcohol dehydrogenase and its gene” in this section, and the confirmation of GA resistance can be carried out according to “2. Wild-type parent yeast”. A technique similar to the technique described in the section “Acquisition of Glycolaldehyde-Resistant Strain from” can be employed.

  One of the yeasts of the present invention is referred to as “pRS426ADH1” and, as of January 26, 2011, is the Patent Microorganism Depositary Center of the National Institute of Technology and Evaluation, 2-5 Kazusa Kamashi, Kisarazu City, Chiba Prefecture 292-0818. -8 Deposited at NITE Biotechnology Headquarters Patent Microorganism Depositary Center). The receipt number (described in the receipt) is “NITE AP-1052”. “NITE AP-1052” is a strain established in Example 1.

4). Production of alcohol By performing alcohol fermentation using the yeast of the present invention, alcohol (alcohol) can be obtained efficiently.
Alcohol fermentation can be performed according to a conventional method. For example, a desired saccharified solution is obtained by mixing cereals (for example, rice) and rice bran and saccharifying in the presence of alcohol, or saccharifying malt at an appropriate temperature between 40-100 ° C. When making wine, prepare grape juice. Next, the yeast of the present invention is added to the saccharified solution or juice, and alcohol fermentation is performed at an appropriate temperature between 4 ° C. and 40 ° C. for an appropriate period of 4 days to 70 days. What is necessary is just to distill the fermented liquor (fermented rice cake) after alcoholic fermentation when manufacturing distilled liquor.
Liquors are not particularly limited, and examples include sake, shochu, wine, beer, whiskey, brandy and the like.

Moreover, in order to produce industrial bioethanol, fermenting in a medium containing 1% to 35%, preferably 5-25% of a sugar source such as glucose together with a nitrogen source such as Yeast nitrogen base and a mineral source. Good.
Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

Acquisition of GA-resistant yeast that highly expresses ADH1 In this example, the parental yeast and yeast that highly expressed ADH1 were grown in the presence of glucose aldehyde (GA) (three experiments independent of preculture). It was.
PCR was performed using the following primers and genomic DNA extracted from yeast BY4743.
Forward primer: CCCCTCGAGACTGTAGCCCTAGACTTGATA (SEQ ID NO: 3)
Reverse primer: CCCGAATTCGGTAGAGGTGTGGTCAATAA (SEQ ID NO: 4)

PCR conditions were KOD + (Toyobo). After 94 ° C for 2 minutes, a cycle of 94 ° C for 15 seconds, 47 ° C for 30 seconds, and 68 ° C for 1 minute was repeated 35 times. This was further purified with Qiagen PCR Qiaquick and then cleaved with XhoI and EcoRI. The digested fragment was reacted with pRS426 (ATCC 77107) cleaved with the same restriction enzyme in Toyobo ligation high at 15 ° C. overnight and transformed into E. coli DH5α. The obtained transformant was applied to a medium containing Ampicillin and cultured at 37 ° C. The grown Escherichia coli was miniprepped and a plasmid inserted with a PCR fragment was selected and purified with Qiagen miniprep.
Yeast BY4743 was transformed with this plasmid and selected to grow on -URA selective medium.
Glycolaldehyde 5 mM was added to the minimal medium, and the transformed yeast prepared as described above was cultured for 24 hours in static culture, and then OD600 was measured.
The results are shown in FIG.
From Fig. 1, the strain that highly expressed ADH1 ("WT + pRS426ADH1 (GA)") increased significantly with a 5% risk in the presence of glycolaldehyde. It has been shown to confer resistance.

Production of alcohol The yeast prepared in Example 1 was inoculated in a medium of 2% yeast extract, 1% bactopeptone, and 10% glucose at a concentration of 1 × 10 ⁶ cells / ml, followed by stationary culture. The culture was sampled over time and chromatographed on Shimadzu Gas Chromatography GC-17A using 1% acetone as an internal standard and DB-WAX as a column. The initial temperature was held at 55 ° C. for 5 minutes, and then the temperature was raised to 170 ° C. for 1 minute at 10 ° C., and the amount of ethanol was measured.
The results are shown in FIG.
As shown in FIG. 2, in the strain that highly expressed ADH1, the production of bioethanol in the presence of glycolaldehyde was significantly increased at a risk rate of 0.1%. Therefore, high expression of ADH1 was observed in the presence of glycolaldehyde. It proved advantageous for bioethanol production.

  The yeast of the present invention is useful for bioethanol production and the like.

  NITE AP-1052: On January 26, 2011, the National Institute for Product Evaluation Technology Patent Microorganism Depositary Center (2-5-8 Kazusa Kamashi, Kisarazu City, Chiba Prefecture, 292-0818, Japan) ). Identification display: pRS426ADH1.

Sequence number 3: Synthetic DNA
Sequence number 4: Synthetic DNA

Claims (8)

Yeast resistant to glycolaldehyde. A yeast resistant to glycolaldehyde, wherein a gene encoding alcohol dehydrogenase is introduced into a host yeast. The yeast according to claim 1 or 2, wherein the yeast belongs to the genus Saccharomyces, Schizosaccharomyces, Kluberomyces, Pichia, Schizosaccharomyces or Candida. The yeast according to claim 2, wherein the gene encoding alcohol dehydrogenase encodes the following protein (a) or (b):
(a) a protein comprising the amino acid sequence represented by SEQ ID NO: 2
(b) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and having alcohol dehydrogenase activity The yeast according to claim 2, wherein the gene encoding alcohol dehydrogenase comprises the following DNA (a) or (b):
(a) DNA consisting of the base sequence represented by SEQ ID NO: 1
(b) DNA that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 1 and encodes a protein having alcohol dehydrogenase activity The yeast according to claim 2, wherein the receipt number is NITE AP-1052. A method for producing a yeast exhibiting resistance to glycolaldehyde, which comprises introducing a gene encoding alcohol dehydrogenase into a host yeast. Alcohol fermentation is performed using the yeast of any one of Claims 1-6, The manufacturing method of the alcohol characterized by the above-mentioned.