WO2021159985A1 - Vaccine agent for treating or preventing coronavirus disease - Google Patents

Vaccine agent for treating or preventing coronavirus disease Download PDF

Info

Publication number
WO2021159985A1
WO2021159985A1 PCT/CN2021/074670 CN2021074670W WO2021159985A1 WO 2021159985 A1 WO2021159985 A1 WO 2021159985A1 CN 2021074670 W CN2021074670 W CN 2021074670W WO 2021159985 A1 WO2021159985 A1 WO 2021159985A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
seq
mrna
utr
homology
Prior art date
Application number
PCT/CN2021/074670
Other languages
French (fr)
Inventor
Hang Wen LI
Lu Yao ZHANG
Xiao Pin MA
Shi Qiang LI
Bo Yu
Ang LIN
Jing Zhang
Wei Guo YAO
Yu Jian ZHANG
Lei Huang
Na LIU
Wu WU
Jun Jie LIU
Ming Yun SHENG
Original Assignee
Stemirna Therapeutics Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Stemirna Therapeutics Co., Ltd. filed Critical Stemirna Therapeutics Co., Ltd.
Publication of WO2021159985A1 publication Critical patent/WO2021159985A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/24—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing atoms other than carbon, hydrogen, oxygen, halogen, nitrogen or sulfur, e.g. cyclomethicone or phospholipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55555—Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/572—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 cytotoxic response
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/575—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3235—Chemical structure of the sugar modified ring structure having the O of the ribose replaced by another atom
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/333—Modified A
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/335—Modified T or U
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/336—Modified G
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the invention belongs to the field of biotechnology, and specifically relates to a vaccine or vaccine agent for treating and preventing coronavirus infection.
  • Coronavirus infections are distributed in many parts of the world, and has been identified in China, the United Kingdom, the United States, Germany, Japan, Russia, Finland, India and other countries. Infections caused by the virus mainly occur in winter and early spring. Human diseases caused by coronavirus are mainly respiratory infections. The virus is sensitive to temperature, specially grows well at 33°C but is inhibited at 35°C, Due to such characteristic; winter and early spring are the epidemic seasons of the virus disease. Coronavirus is one of the main pathogens of the common cold in adults, and it is also an important pathogen of acute exacerbation in adult patients with chronic bronchitis.
  • Human coronavirus can cause the common cold, severe acute respiratory syndrome (SARS) , Middle East respiratory syndrome (MERS) and new coronary pneumonia (COVID-19) , but they have certain differences in epidemiological characteristics. Globally, 10% ⁇ 30%of upper respiratory tract infections are caused by four types of coronaviruses: HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1, which are the second cause of the common cold, second only to the nose virus. The infection shows seasonal epidemic, with high incidence of the disease in each spring and winter. The incubation period is 2-5 days, and the population is generally susceptible, mainly transmitting through human-to-human contact.
  • SARS severe acute respiratory syndrome
  • MERS Middle East respiratory syndrome
  • COVID-19 new coronary pneumonia
  • SARS is caused by human infection with SARS-CoV, which first appears in parts of Guangdong province in China, and then spread to 24 provinces, autonomous regions and municipalities in China and 28 other countries and regions around the world. During the first SARS epidemic in the world from November 2002 to July 2003, a total of 8096 cases diagnosed clinically and 774 deaths were reported globally, with a mortality of 9.6%.
  • the incubation period of SARS is usually limited to 2 weeks, usually about 2 to 10 days.
  • the population is generally susceptible to SARS, the main source of infection of which is SARS patients, especially patients with obvious symptoms that are highly infectious, while patients in the incubation period or cured are not infectious.
  • MERS is a viral respiratory disease caused by MERS-CoV, which is first confirmed in Saudi Arabia in 2012. Since 2012, MERS has spread to 27 countries and regions such as the Middle East, Asia, Europe, etc., and 80%of cases are from Saudi Arabia, with a mortality of about 35%. The incubation period is up to 14 days, and the population is generally susceptible. Dromedary camel is a major host of MERS-CoV and is the main source of infections across humans, with limited human-to-human transmission.
  • the present invention provides a coronavirus vaccine agent with preventive and therapeutic effects, which can not only prevent the coronavirus disease, but also can treat the disease.
  • the present invention provides a vaccine agent, comprising an mRNA fragment of a coronavirus antigen, wherein the mRNA fragment contains one or more of antigen sequences such as S, S1, RBD, N, E, M and the like, and a combination thereof. In some embodiments, these fragments are artificially optimized or modified.
  • the coronavirus here is a human or mammalian coronavirus.
  • the coronavirus is one of severe acute respiratory syndrome (SARS) , Middle East respiratory syndrome (MERS) and coronavirus disease 2019 (COVID-19) .
  • the coronavirus virus is one or more of HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1.
  • the mRNA sequence is selected from one or more of SEQ NO: 1.1-1.9. In some embodiments, the sequence is SEQ NO: 1.1. In some embodiments, the mRNA sequence has been subjected to nucleic acid modification with the modification ratio of 20-100%. In some embodiments, the modification is that uridine is modified by 1-methylpseudouracil.
  • the structure of 1-methylpseudouracil is as follows:
  • the modification is that uridine is modified by 1-methylpseudouracil with the modification ratio of 50%.
  • the nucleic acid further comprises a cap structure.
  • the cap structure is as follows:
  • the cap is added at the 5’-terminal. In some embodiments, the cap can be also added at the 3’-terminal.
  • the nucleic acid is encapsulated, and the encapsulated structure comprises a core structure formed by mixing nucleic acid and polymer or protein.
  • the core structure further comprises a shell structure, such as a shell structure formed by phospholipids.
  • the present invention provides a DNA sequence, being one or more of sequences shown in SEQ NO: 1, SEQ NO: 2, SEQ NO: 3, SEQ NO: 4, SEQ NO: 5, SEQ NO: 6, SEQ NO: 7, SEQ NO: 8 or SEQ NO: 9, or a sequence having a homology of 60%-100%or identical functions with any one of the sequences.
  • these sequences are complementary sequences.
  • the sequence is one or more of sequences shown in SEQ NO: 1, SEQ NO: 2, SEQ NO: 4, SEQ NO: 5, SEQ NO: 8 or SEQ NO: 9; or a sequence having identical functions with any one of the sequences.
  • the sequence is a sequence shown in SEQ NO: 1.
  • the sequence further comprises a sequence shown in SEQ NO: 11 at a 5'-terminal thereof.
  • the sequence further comprises a sequence shown in SEQ NO: 12 at a 5'-terminal thereof.
  • the sequence further comprises a sequence shown in SEQ NO: 13 at a 3'-terminal thereof.
  • the sequence further comprises a sequence shown in SEQ NO: 14 at a 3'-terminal thereof.
  • a tail sequence is also included.
  • the tail sequence is a sequence shown in SEQ NO: 15.
  • the homology is 65-100%. In some embodiments, the homology is 70-100%. In some embodiments, the homology is 71-100%. In some embodiments, the homology is 73-100%. In some embodiments, the homology is 74-100%. In some embodiments, the homology is 100%.
  • the sequence is a sequence having a homology of 70-100%with the sequence shown in SEQ NO: 1; a sequence having a homology of 74-100%with the sequence shown in SEQ NO: 3; a sequence having a homology of 70-100%with the sequence shown in SEQ NO: 5; a sequence having a homology of 65-100%with the sequence shown in SEQ NO: 6; a sequence having a homology of 65-100%with the sequence shown in SEQ NO: 7; a sequence having a homology of 70-100%with the sequence shown in SEQ NO: 8; or a sequence having a homology of 70-100%with the sequence shown in SEQ NO: 9.
  • the present invention provides an RNA sequence, being one or more of RNA sequences shown in SEQ NO: 1.1, SEQ NO: 2.2, SEQ NO: 3.3, SEQ NO: 4.4, SEQ NO: 5.5, SEQ NO: 6.6, SEQ NO: 7.7, SEQ NO: 8.8 or SEQ NO: 9.9, or a sequence having a homology of 60%-100%or identical functions with one of the sequences, or a sequence complementary to the above sequence.
  • the sequence is one or more of sequences shown in SEQ NO: 1.1, SEQ NO: 2.2, SEQ NO: 4.4, SEQ NO: 5.5, SEQ NO: 8.8 or SEQ NO: 9.9; or a sequence having a homology of 60%-100%with one of the sequences.
  • the sequence is a sequence shown in SEQ NO: 1 or has a homology of 60%-100%with the sequence.
  • the homology is 65-100%. In some preferred embodiments, the homology is 75-100%. In some preferred embodiments, the homology is 85-100%. In some preferred embodiments, the homology is 95-100%. In some preferred embodiments, the homology is 98-100%. In some preferred embodiments, wherein the homology is 99-100%. In some preferred embodiments, the homology is 100%.
  • the sequence further comprises UTR sequence at the 5'-terminal and/or the 3'-terminal thereof.
  • a promoter region is further comprised at the 5'-terminal.
  • a tail structure is further comprised at the 3'-terminal.
  • the sequence further comprises one of the sequences shown in SEQ NO: 36-1 to SEQ NO: 36-12 at a 5'-terminal thereof.
  • the sequence further comprises one of the sequences shown in SEQ NO: 36-11 to SEQ NO: 36-12 at a 5'-terminal thereof.
  • the sequence further comprises one of the sequences shown in SEQ NO: 37-1 to SEQ NO: 37-12 at a 3'-terminal thereof. In some preferred embodiments, the sequence further comprises one of the sequences shown in SEQ NO: 37-11 to SEQ NO: 37-12 at a 3'-terminal thereof. In some embodiments, the 5'-terminal of the sequence can also be the sequence shown in SEQ NO: 11. In some embodiments, the 5'-terminal of the sequence can also be the sequence shown in SEQ NO: 12. In some embodiments, the 3'-terminal of the sequence can also be the sequence shown in SEQ NO: 13.
  • the sequence further comprises a sequence shown in SEQ NO: 14 at a 3'-terminal thereof.
  • a tail sequence that is the sequence described in SEQ NO: 15 is further included at the 3'-terminal.
  • a promoter is further included at the 5'-terminal, and in some embodiments, the sequence of the promoter is a sequence shown in SEQ ID NO: 12.
  • the sequence further comprises an additional sequence shown in SEQ ID NO: 38 or SEQ ID NO: 39. In some embodiments, these sequences are inserted behind AUG nucleotides. In some embodiments, the additional sequence is located at the 5'-terminal.
  • the RNA sequence comprises ORF sequence, promoter sequence, UTR sequence at the 5'-terminal and/or UTR sequence at the 3'-terminal.
  • the ORF sequence comprises the additional sequence.
  • the sequence in the order from the 5'-terminal to the 3'-terminal, is as follows: promoter sequence -UTR sequence at the 5'-terminal -ORF sequence -UTR sequence at the 3'-terminal -tail sequence.
  • the present invention provides a coronavirus mRNA vaccine agent, comprising the mRNA sequence of any one of the preceding embodiments, or an mRNA sequence obtained by reverse transcription in vitro from the DNA sequence of the preceding embodiments.
  • the mRNA comprises a modified nucleotide, wherein the modified nucleotide is selected from one or more of the following nucleotides: 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O (6) -methylguanine, pseudouridine, N-1-methyl-pse
  • modified nucleotides described in PCT/CN2020/074825, PCT/CN2020/106696 are modified.
  • the mRNA comprises a modified nucleotide, and the modified nucleotide is N-1-methyl-pseudouridine.
  • the modification ratio is 0.1%-100%. In some embodiments, the modification ratio is 2%-90%. In some embodiments, the modification ratio is 5%-80%. In some embodiments, the modification ratio is 20%-80%. In some embodiments, the modification ratio is 40%-70%. In some embodiments, the modification ratio is 50%.
  • the agent further comprises a polymer that forms a nanoparticle with the nucleotide, wherein the polymer is selected from one or more of the following polymers: polyacrylate, polyalkylcyanoacrylate, polylactide, polylactide-polyglycolide copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, polyethyleneimine, polyethyleneimine (PEI) , or branched PEI.
  • polymers polyacrylate, polyalkylcyanoacrylate, polylactide, polylactide-polyglycolide copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, polyethyleneimine, polyethyleneimine (PEI) , or branched PEI.
  • the agent further comprises a liposome, wherein a core structure comprising the nucleotide and a polymer is encapsulated in the liposome to form nanoparticles.
  • the agent further comprises a liposome, wherein the nucleotide is encapsulated by the liposome to form nanoparticles.
  • the liposome is selected from one or more of the following: cationic liposome, non-cationic liposome, sterol-based liposome, and/or PEG-modified liposome.
  • the cationic liposome comprises: C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazolyl) , HGT5000, HGT5001, OF-02, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA and HGT4003, or combinations thereof.
  • non-limiting examples of the non-cationic liposome may include ceramide, cephalin, cerebroside, diacylglycerol, 1, 2-dipalmitoyl-sn-glyceryl-3-phosphorylglycerol sodium salt (DPPG) , 1, 2-distearoyl-sn-glyceryl-3-phosphoethanolamine (DSPE) , 1, 2-distearoyl-sn-glyceryl-3-phosphocholine (DSPC) , 1, 2-dipalmitoyl-sn-glyceryl-3-phosphocholine (DPPC) , 1, 2-dioleyl-sn-glyceryl-3-phosphoethanolamine (DOPE) , 1, 2-dioleyl-sn-glyceryl-3-phosphatidylcholine (DOPC) , 1, 2-dipalmitoyl-sn-glyceryl-3-phosphoethanolamine (DPPE) , 1, 2-dimyristoyl-sn-glyceryl-3-phosphoethanolamine (DP
  • the sterol-based cationic liposome can constitute no more than 70%of the total liposome in liposomal nanoparticles.
  • the sterol-based cationic liposome comprises phosphatidyl compound, phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipid, cerebroside, and ganglioside, or combinations thereof.
  • a PEG-modified liposome such as DMG-PEG, DMG-PEG2K, C8-PEG, DOGPEG, ceramide PEG and DSPE-PEG, or combinations thereof, is further comprised.
  • the vaccine agent further comprises protamine sulfate, DOPE, DSPE-mPEG2000 and M5, wherein a structure of the M5 is:
  • the M5: DOPE: DSPE-mPEG2000 49: 49: 2 (mass ratio) .
  • the present invention provides a DNA vaccine agent, comprising the DNA sequence described in any of the preceding embodiments. In some embodiments, the sequence is selected from one or more of SEQ NO: 1-9.
  • the present invention provides a UTR sequence, comprising one or more of 5'UTR sequences shown in SEQ NO: 36-1 to 36-12, or 3'UTR sequences shown in SEQ NO: 37-1 to 37-12.
  • the 5'UTR sequence is a sequence shown in SEQ NO: 36-11
  • the 3'UTR sequence is a sequence shown in SEQ NO: 37-11
  • the 5'UTR sequence is a sequence shown in SEQ NO: 36-12
  • the 3'UTR sequence is a sequence shown in SEQ NO: 37-12.
  • the present invention provides a UTR sequence at 3’-terminal, comprising a sequence shown in SEQ NO: 37-11 or SEQ NO: 37-12.
  • an additional sequence of RNA for ORF is provided, and the additional sequence is a sequence shown in SEQ NO: 38 or SEQ NO: 39. In some embodiments, the additional sequence is located at the 5'-terminal. In some embodiments, the additional sequence is inserted from the AUG sequence. In some embodiments, the ORF sequence of the RNA is the sequence in any of the preceding embodiments.
  • FIG. 1 is a schematic diagram of the structure of the DNA template in the plasmid, showing that the DNA sequence comprises T1 promoter, UTR sequence and DNAORF sequence.
  • FIG. 2 is a structure diagram of the RNA sequence obtained by transcription from the DNA template, and also contains the T7, UTR sequence and PolyA sequence obtained by transcription from the DNA sequence.
  • FIG. 3 is a graph showing the antigen expression results of 9 RNA sequences at the cellular level using liposomes.
  • FIG. 4 is a comparison of the immunogenicity of 9 mRNA vaccines in mice, wherein PBS is the blank control, and others are the comparison of the immunogenicity of the core-shell structured nanoparticles containing different RNA sequences (ORF) in mice. It is found that some are higher than the blank control, some are lower than the blank control, and some are not immunogenic, that is, they cannot cause mammals to produce antibodies or the amount or titer of antibodies is low.
  • FIG. 5 shows the effect of the selected vaccine agents on the body weight of mice (experiments on immunizing C57BL/6 mice with different concentrations of COVID-19-LPP-mRNA) .
  • FIG. 6 is the dilution curve of BALB/c mouse antibody detection (for different doses of vaccine agents)
  • FIG. 7 is the dilution curve of C57BL/6 mouse antibody detection (for different doses of vaccine agents) .
  • FIG. 8 is a comparison chart of specific IgG titers (for different doses of vaccine agents) .
  • FIG. 9 is a neutralizing antibody titer curve for BALB/c mice (for different doses of vaccine agents) .
  • FIG. 10 is a neutralizing antibody titer curve for C57BL/6 mice (for different doses of vaccine agents) .
  • FIG. 11 is a summary of titers of the neutralizing antibody against pseudovirus in two mice (for different doses of vaccine agents) .
  • IFG. 12 is a neutralizing antibody titer curve for BALB/c mice (for different doses of vaccine agents) .
  • IFG. 13 is a neutralizing antibody titer curve for C57BL/6 mice (for different doses of vaccine agents) .
  • FIG. 14 is a summary chart of antibody titers (for different doses of vaccine agents) .
  • FIG. 15 is a graph showing antibody titers of different antibody subtypes (for vaccine agents of different concentrations or doses) .
  • FIG. 15A is for IgM
  • FIG. 15B is for IgG
  • FIG. 15C is for IgM.
  • FIG. 16A is a graph showing the evaluation results of antigen-specific T cell response levels in mice after immunization with different doses of COVID-LPP-mRNA.
  • FIG. 16B is a plot (dot plot) showing the evaluation results of serum neutralizing antibody levels in mice after immunization with different doses of COVID-LPP-mRNA.
  • FIG. 17 is a graph showing the evaluation results of serum neutralizing antibody levels in mice after immunization with different doses of COVID-LPP-mRNA.
  • FIG. 18 shows the evaluation results of the protective effect of mice against SARS-CoV-2 infection after immunization with COVID-19-LPP-mRNA (weight changes of Balb/C mice) .
  • FIG. 19 shows the evaluation results of the protective effect of mice against SARS-CoV-2 infection after immunization with COVID-19-LPP-mRNA (weight changes of C57 mice) .
  • FIG. 20 shows the viral load in the lung tissue of Balb/C mice on Day 4 after challenge, wherein FIG. 20A shows the RNA copy number, and FIG. 20B shows the comparison of TCID50 titer data.
  • FIG. 21 shows the viral load in the lung tissue of C57BL/6 mice on Day 4 after challenge, wherein FIG. 21A shows the RNA copy number, and FIG. 21B shows the comparison of TCID50 titer data.
  • FIG. 22 shows the pathological section of the lung tissue of Balb/C mice on Day 4 after challenge (with different experimental treatments, HD is for high dose (upper) , LD is for low dose (middle) , and comparation with coronavirus (lower) ) .
  • FIG. 23 shows the pathological section of lung tissue of C57BL/6 mice on Day 4 after challenge (with different experimental treatments, HD is for high dose (double-injection DD -upper) , HD is for high dose (single-injection SD -middle-upper) ; LD is for double-injection (DD) and single-injection (SD) in low dose, and comparation with coronavirus (lower) ) .
  • FIG. 24 shows the results of gRNA detection in lung tissue, trachea, and bronchus of experimental monkeys infected with SARS-CoV-2.
  • FIG. 25 shows the results of gRNA detection in the lung lavage fluid from experimental monkeys infected with SARS-CoV-2.
  • FIG. 26 shows the results of gRNA detection in nasal swabs from experimental monkeys infected with SARS-CoV-2.
  • FIG. 27 shows the results of gRNA detection in throat swabs from experimental monkeys infected with SARS-CoV-2.
  • FIG. 28 shows the lung tissue section of the animal numbered 16139 in PBS control group. It can be seen that the pulmonary septum is locally thickened with slight hemorrhage, accompanied with lymphocyte nodules, local blood vessel wall thickening, thrombosis seen in the lumen, and blood cell-like exudate seen in the tracheal lumen.
  • FIG. 29 is the lung tissue section of the animal numbered 16113 in PBS control group. It can be seen slight hemorrhage in the pulmonary septum, accompanied with inflammatory cell infiltration, pigmentation, local blood vessel wall thickening, and thrombosis in the lumen.
  • FIG. 30 is the lung tissue section of the animal numbered 16217 in PBS control group. It can be seen that most of the lung septum is thickened with slight to moderate hemorrhage, accompanied with lymphocyte nodules, local blood vessel wall thickening, thrombosis seen in the lumen of the blood vessel, exfoliated tissues and cells seen in the tracheal lumen, and local carbon deposition.
  • FIG. 31 is the lung tissue section of the animal numbered 16145 in the vaccine group. It can be seen that the alveolar structure is relatively intact, accompanied with slight to moderate hemorrhage in the pulmonary septum and inflammatory cell infiltration.
  • FIG. 32 is the lung tissue section of the animal numbered 16045 in the vaccine group. It can be seen that the alveolar structure is relatively intact, accompanied with the lung septum thickening slightly and a small amount of inflammatory cells infiltration.
  • FIG. 33 is the lung tissue section of the animal numbered 16175 in the vaccine group. It can be seen that the alveolar structure is relatively intact, accompanied with the lung septum thickening slightly, bleeding, and lymphocyte nodules.
  • FIG. 34 is the lung tissue section of the animal numbered 16249 in the vaccine group. It can be seen that the pulmonary septum is slightly thickened with slight hemorrhage, accompanied with focal dust cells distribution, vascular congestion, and inflammatory cells infiltration.
  • FIG. 35 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 1-1-1 and the optimized sequence shown in SEQ NO: 1.1.
  • FIG. 36 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 2-2-2 and the optimized sequence shown in SEQ NO: 2.2.
  • FIG. 37 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 3-3-3 and the optimized sequence shown in SEQ NO: 3.3.
  • FIG. 38 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 4-4-4 and the optimized sequence shown in SEQ NO: 4.4.
  • FIG. 39 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 5-5-5 and the optimized sequence shown in SEQ NO: 5.5.
  • FIG. 40 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 6-6-6 and the optimized sequence shown in SEQ NO: 7.7.
  • FIG. 41 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 7-7-7 and the optimized sequence shown in SEQ NO: 7.7.
  • FIG. 42 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 8-8-8 and the optimized sequence shown in SEQ NO: 8.8.
  • FIG. 43 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 9-9-9 and the optimized sequence shown in SEQ NO: 9.1.
  • an "antigenic polypeptide” or “immunogenic polypeptide” is a polypeptide that reacts with molecules of the vertebrate immune system when introduced into a vertebrate, that is, it is antigenic, and/or induces an immune response in the vertebrate, that is, it is immunogenic.
  • Biocompatible refers to a substance that, when exposed to living cells, will support proper activities of cells without causing undesired effects in cells such as changes in cell life cycle, changes in cell proliferation rate, or cytotoxicity effects.
  • biofunctionally equivalent is well known in the art and is defined in further detail herein. Therefore, a sequence having about 85%to about 90%, or more preferably about 91%to about 95%, or even more preferably about 96%to about 99%identity or functional equivalence with one or more nucleotide sequences provided herein are specifically considered useful in the practice of the methods and compositions described in this application.
  • buffer includes one or more compositions or their aqueous solution, which resists fluctuations in pH when an acid or base is added to a solution or composition containing the buffer. This resistance to pH changes is due to the buffering property of this solution, and may be a function of one or more specific compounds included in the composition. Therefore, the solution or another composition that exhibits buffering activity is called buffer or buffer solution. Buffers generally do not have unlimited ability to maintain the pH of a solution or composition; instead, they are generally capable of maintaining the pH within a certain range, such as a pH of about 5 to 7.
  • carrier is intended to include any solvent, dispersion medium, coating, diluent, buffer, isotonic agent, solution, suspension, colloid, inert body, etc., or combinations thereof, which is pharmaceutically acceptable for administration to the relevant animal or, if applicable, for therapeutic or diagnostic purposes.
  • DNA fragment refers to a DNA molecule that has been separated from the total genomic DNA of a specific species. Therefore, the DNA fragment obtained from a biological sample using one of the compositions disclosed herein refers to one or more DNA fragments that have been separated or purified from the total genomic DNA of the specific species from which they are obtained.
  • DNA fragment includes the DNA fragment and smaller fragments thereof, as well as a recombinant vector, including such as a plasmid, cosmid, phage, virus and the like.
  • the term "effective amount” refers to an amount capable of treating or ameliorating a disease or condition or capable of producing the desired therapeutic effect.
  • epitope refers to a part of a given immunogenic substance, determined by any method known in the art, and the part is the target of an antibody or cell surface receptor in the host immune system that has elicits an immune response to the given immunogenic substance, that is, it binds to the antibody or cell surface receptor.
  • the epitope can be defined as a part of an immunogenic substance, as determined by any method available in the art (see, for example, Geysen et al., 1984) , which elicits an antibody response or induces T cell response.
  • the epitope can be part of any immunogenic substance, such as a protein, polynucleotide, polysaccharide, organic or inorganic chemical substance, or any combinations thereof.
  • immunogenic substance such as a protein, polynucleotide, polysaccharide, organic or inorganic chemical substance, or any combinations thereof.
  • epitope can also be used interchangeably with “antigenic determinant” or “antigenic determinant site” .
  • heterologous is defined relative to a predefined reference nucleic acid sequence.
  • a heterologous promoter is defined as a naturally occurring promoter that does not adjacent to the reference structural gene, but is placed through laboratory operations.
  • a heterologous gene or nucleic acid fragment is defined as a naturally occurring gene or fragment that does not adjacent to a reference promoter and/or enhancer element.
  • homologous refers to sequences that have identical or substantially identical nucleotide sequence despite being from different sources. Generally, homologous nucleic acid sequences are derived from closely related genes or organisms that have one or more substantially similar genomic sequences. On the contrary, “analogous” polynucleotides are polynucleotides sharing identical function with polynucleotides from different species or organisms with possible significantly different primary nucleotide sequences, which encode one or more proteins or polypeptides that achieve similar functions or have similar biological activities. Analogous polynucleotides can often be derived from two or more (e.g., genetically or phylogenetically) organisms that are not closely related.
  • the term "homology” refers to the degree of complementarity between two or more polynucleotide or polypeptide sequences.
  • first nucleic acid or amino acid sequence has the same primary sequence as second nucleic acid or amino acid sequence
  • the word "identity” can replace the word “homology” .
  • Sequence homology and sequence identity can be determined by analyzing two or more sequences using algorithms and computer programs known in the art. Such methods can be used to assess whether a given sequence has identity or homology with another selected sequence.
  • nucleic acid or polypeptide sequences refers to two or more sequences or subsequences are identical or have a specific percentage of identical amino acid residues or nucleotides, when using one of the sequence alignment algorithms described below (or other algorithms available to the ordinary skilled person) or by visual inspection measurement for comparison and blast for maximum correspondence.
  • the phrase "in need of treatment” means that the patient needs (alternatively, in one or more ways, will benefit from) treatment based on the judgment by a carer such as a doctor or veterinarian. Such judgment can be made based on various factors in the field of expertise of the carer, and can include the recognition that the patient has a disease state that can be treated with one or more compounds or pharmaceutical compositions, such as those described herein.
  • isolated or “biologically pure” refers to a substance that is substantially or essentially free of components that normally accompany the substance in its natural state. Therefore, isolated polynucleotides or polypeptides according to the present disclosure are preferably free of substances that are normally associated with those polynucleotides or polypeptides in their natural or in situ environment.
  • kit can be used to describe a variant of a portable self-contained package that includes at least one set of agents, components or pharmaceutically formulated compositions of the present invention.
  • kit may include one or more sets of instructions regarding, for example, the use of the enclosed composition in a laboratory or clinical application.
  • Linking refers to any method known in the art for functionally linking one or more proteins, peptides, nucleic acids or polynucleotides, including but not limited to recombinant fusion, covalent bonding, disulfide bonding, ionic bonding, hydrogen bonding, electrostatic bonding, etc.
  • naturally occurring when applied to an object refers to the fact that an object can exist in nature.
  • polypeptides or polynucleotide sequences present in organisms (including viruses) which can be isolated from sources in nature and have not been subjected to intentionally artificial modification in the laboratory, are naturally occurring.
  • laboratory rodent species that have been selectively bred according to classical genetics are considered to be naturally occurring animals.
  • nucleic acid includes one or more of the following types: polydeoxyribonucleotide (containing 2-deoxy-D-ribose) , polyribonucleotide (containing D-ribose) , and any other types of polynucleotides, which are N-glycosides of purine or pyrimidine bases or modified thereof (including abasic sites) .
  • nucleic acid also includes the covalently bonded polymer of ribonucleosides or deoxyribonucleosides.
  • Nucleic acid includes single-stranded and double-stranded DNA, as well as single-stranded and double-stranded RNA.
  • Exemplary nucleic acids include, but are not limited to, gDNA; hnRNA; mRNA; rRNA, tRNA, microRNA (miRNA) , small interfering RNA (siRNA) , small nucleolar RNA (snoRNA) , small nuclear RNA (snRNA) and small temporal RNA (stRNA) ) , etc., and any combinations thereof.
  • operably link means that the linked nucleic acid sequences are usually adjacent or substantially adjacent, and in the case where two protein coding regions need to be binded, are adjacent and within reading frame.
  • enhancers generally function when separated from the promoter by several thousand bases, and intron sequences can have variable lengths, some polynucleotide elements can be operably linked but not adjacent.
  • the term "patient” refers to any host that can be a recipient of one or more of the vascular access devices discussed herein.
  • the recipient will be a vertebrate, which is intended to represent any animal species (and preferably, a mammalian species, such as humans) .
  • patient refers to any animal hosts, including but not limited to human and non-human primates, avians, reptiles, amphibians, cattles, dogs, caprines, cavines, crows, epines, equines, cats, hircines, rabbits, leporines, lupines, murines, sheep, pigs, racines, foxes, etc., including but not limited to domestic livestocks, grazing or migrating animals or birds, foreign or zoo samples and companion animals, pets, and any animals under the care of a licensed veterinarian.
  • phrases "pharmaceutically acceptable” refers to a molecular entity and composition that does not produce allergy or similar adverse reaction when administered to humans, especially to human eyes.
  • the preparation of an aqueous composition containing protein as an active ingredient is well known in the art. Generally, such composition is prepared as an injection, or as liquid solution or suspension. Alternatively, they can be prepared in a solid form suitable for dissolution or suspension in a liquid prior to injection.
  • salts refers to a salt that retains the desired biological activity of the parent compound and does not produce any undesired toxicological effects.
  • examples of such salts include, but are not limited to, acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, etc.; and salts formed with organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, pamoic acid (methylene pamoic acid) , alginic acid, naphthoic acid, polyglutamic acid, naphthalenesulfonic acid, naphthalene disulfonic acid, polygalacturonic acid, etc.; salts formed with polyvalent metal cations such as zinc, calcium, bismuth, bar
  • plasmid refers to a genetic construct composed of genetic materials (i.e., nucleic acids) .
  • a plasmid or vector contains an origin of replication that is functional in a bacterial host cell, such as E. coli, and a selective marker for detecting the bacterial host cell containing the plasmid.
  • the plasmid and vector of the present invention can comprise one or more genetic elements as described herein, which are arranged so that the inserted coding sequence can be transcribed and translated in a suitable expression cell.
  • the plasmid or vector can comprise one or more nucleic acid fragments, genes, promoters, enhancers, activators, polyclonal regions or any combinations thereof, including fragments obtained or derived from one or more natural and/or artificial sources.
  • polypeptide is intended to encompass “a polypeptide” as well as “polypeptides” , and includes any chain of two or more amino acids. Therefore, as used herein, terms including but not limited to “peptide” , “dipeptide” , “tripeptide” , “protein” , “enzyme” , “amino acid chain” and “contiguous amino acid sequence” are all included in the definition of “polypeptide” , and the term “polypeptide” may replace or be used interchangeably with any of these terms.
  • the term also includes polypeptides that have undergone one or more post-translational modifications or modified by one or more non-naturally occurring amino acids, and the post-translational modification includes, for example, but not limited to, glycation, acetylation, phosphorylation, amidation, derivatization, proteolytic cleavage, and post-translational processing.
  • post-translational modification includes, for example, but not limited to, glycation, acetylation, phosphorylation, amidation, derivatization, proteolytic cleavage, and post-translational processing.
  • amino acids Alanine (A; Ala) , Arginine (R; Arg) , Asparagine (N; Asn) , Aspartic acid (D; Asp) , Cysteine (C; Cys) , Glutamine (Q; Gln) , Glutamic acid (E; Glu) , Glycine (G; Gly) , Histidine (H; His) , Isoleucine (I; Ile) , Leucine (L; Leu) , Methionine (M; Met) , Phenylalanine (F; Phe) , Proline (P; Pro) , Serine (S; Ser) , Threonine (T; Thr) , Tryptophan (W; Trp) , Tyrosine (Y; Tyr) , Valine (V; Val) , and Lysine (K; Lys) .
  • the amino acid residue described herein is Arginine (R; Arg) , Asparagine (N
  • prevention and inhibition refer to administration of a compound alone or contained in a pharmaceutical composition before the onset of the clinical symptoms of the disease state, in order to prevent any symptoms, aspects or features of the disease state. Such prevention and inhibition need not be absolutely considered to be medically useful.
  • Protein is used interchangeably with “peptide” and “polypeptide” herein, and includes both synthetic, recombinant, or in vitro produced peptides and polypeptides, and peptides and polypeptides that are expressed in vivo after the nucleic acid sequence is administered to a host animal or human subject.
  • polypeptide preferably means a short peptide having a length of any amino acid chain, including a length of from about 2 to about 20 amino acid residues, an oligopeptide having a length of from about 10 to about 100 amino acid residues, and a longer polypeptide comprising a length of 100 amino acid residues or more.
  • polypeptide and protein of the present invention also include a polypeptide and protein that are post-translationally modified or have been post-translationally modified, and include any glycosides or other derivatives or conjugates added to the main chain amino acid chain.
  • “Purify” means separation from many other compounds or entities.
  • the compound or entity may be partially purified, substantially purified or pure. When a compound or entity is removed from substantially all other compounds or entities, it is considered pure, that is, preferably at least about 90%, more preferably at least about 91%, 92%, 93%, 94%, 95%, 96%%, 97%, 98%, 99%, or more than 99%pure.
  • a partially or substantially purified compound or entity can remove at least 50%, at least 60%, at least 70%, or at least 80%of materials naturally present with it, for example, cellular materials such as cellular proteins and/or nucleic acids.
  • recombinant refers to a substance (e.g., a polynucleotide or polypeptide) that is artificially or (non-naturally) synthetically altered by human intervention.
  • the alteration can be made to a substances in its natural environment or natural state, or to a substance removed from its natural environment or natural state.
  • a promoter sequence is "recombinant” when it is produced by expressing an artificially engineered nucleic acid fragment.
  • recombinant nucleic acid is produced by nucleic acid recombination during cloning, DNA shuffling or other procedures, or by chemical or other mutagenesis
  • recombinant polypeptide or “recombinant protein” is produced by expression of a recombinant nucleic acid polypeptide or protein
  • recombinant virus such as recombinant AAV virus, is produced by expression of a recombinant nucleic acid.
  • regulatory element refers to a region of a nucleic acid sequence that regulates transcription.
  • exemplary regulatory element includes, but is not limited to, a enhancer, post-transcriptional element, transcription control sequence, and the like.
  • RNA fragment refers to an RNA molecule that has been isolated from total cellular RNA of a specific species. Therefore, RNA fragment can refer to one or more RNA fragments (natural or synthetic sources) that have been isolated or purified from other RNA.
  • RNA fragment includes the RNA fragment and smaller fragments thereof.
  • sequence involves to all or part of the linear N-terminal to C-terminal sequence of amino acids in a given amino acid chain, such as a polypeptide or protein; “subsequence” means any consecutive amino acid fragments within the sequence, for example, at least 3 consecutive amino acids within a given protein or polypeptide sequence.
  • sequence and “subsequence” have similar meanings related to the nucleotide sequence from 5’ to 3’.
  • sequence substantially as shown in SEQ ID NO: X means that the sequence substantially corresponds to a part of SEQ ID NO: X and has relatively few nucleotides (or amino acids in the case of a polypeptide sequence) inconsistent with the nucleotide (or amino acid) of SEQ ID NO: X or is the biological functional equivalent of the nucleotide (or amino acid) of SEQ ID NO: X.
  • biologically functional equivalent is well known in the art and is defined in further detail herein.
  • a sequence having about 65%to about 90%, or more preferably about 85%to about 95%, or even more preferably about 96%to about 99%identity or functional equivalence with one or more nucleotide sequences provided herein are specifically considered useful in the practice of the present invention.
  • a sequence complementary to the sequence is also included.
  • the sequence shown in SEQ ID NO: X not only includes the sequence feature of the sequence itself, but also naturally includes the sequence features complementary to the sequence, and "complementary" herein means that substantially all sequences are in a one-to-one correspondence according to the complementary sequence under the basic common sense of biology.
  • the DNA sequence shown in SEQ ID NO: X is a DNA sequence
  • another DNA sequence complementary to the sequence is naturally included, unless the other sequence is specifically excluded.
  • Suitable standard nucleic acid hybridization conditions for the present invention include, for example, hybridization in 50%formamide, 5 ⁇ Denhardt's solution, 5 ⁇ SSC, 25mM sodium phosphate, 0.1%SDS and 100 ⁇ g/mL denatured salmon sperm DNA at 42°C for 16 hours, followed by washing continuously with 0.1 ⁇ SSC, 0.1%SDS solution at 60°C for 1 hour to remove the required amount of background signal.
  • the hybridization conditions of the present invention with lower stringency include, for example, hybridization in 35%formamide, 5 ⁇ Dunport’ s solution, 5 ⁇ SSC, 25mM sodium phosphate, 0.1%SDS and 100 ⁇ g/mL denatured salmon sperm DNA or E.
  • structural gene is intended to generally describe a polynucleotide, such as a gene, which is expressed to produce the encoded peptide, polypeptide, protein, ribozyme, catalytic RNA molecule or antisense molecule.
  • object describes an organism, including mammals such as primates, for which treatment using the composition of the invention can be provided.
  • Mammal species that can benefit from the disclosed treatment methods include, but are not limited to, ape; chimpanzee; orangutan; human; monkey; domestic animal such as dog and cat; livestock such as horse, cow, pig, sheep, goat, and chicken; and other animals, such as mouse, rat, guinea pig, and hamster.
  • substantially complementary when used to define an amino acid or nucleic acid sequence, means that a specific target sequence, such as an oligonucleotide sequence, is substantially complementary to all or a part of a selected sequence, and therefore will specifically bind to a part of the mRNA encoding the selected sequence. Therefore, generally the sequence will be highly complementary to the mRNA "target" sequence, and will have no more than about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10 base mismatches and the like in the complementary portion of the sequence.
  • sequence it may be desirable for the sequence to be an exact match, that is, to be completely complementary to the sequence to which the oligonucleotide specifically binds, and therefore have no mismatch along the complementary strand. Therefore, highly complementary sequences will generally bind fairly specifically to the target sequence region of the mRNA, and therefore will effectively reduce and/or even inhibit the translation of the target mRNA sequence into a polypeptide product.
  • the substantially complementary nucleic acid sequence will be more than about 80%and preferabley more than 85%complementary (or "%exact match” ) to the corresponding nucleic acid target sequence that specifically binds to the nucleic acid.
  • the nucleic acid sequence will be more than about 90% (and more than about 95%in some embodiments) complementary to the corresponding target sequence that specifically binds to the nucleic acid, and will be exactly matched and complementary to all or even up to (and including) about 96%, about 97%, about 98%, about 99%, and even about 100%of the target sequence that specifically binds to the designed nucleic acid.
  • the percent similarity or percent complementarity of any disclosed nucleic acid sequence can, for example, be determined by comparing sequence information using the GAP computer program version 6.0 available from the University of Wisconsin Genetics Computer Group (UWGCG) .
  • the GAP program uses the blast method of Needleman and Wunsch (1970) .
  • the GAP program defines similarity as the number of similar blast symbols (i.e., nucleotides or amino acids) divided by the total number of symbols in the shorter sequence of the two sequences.
  • the preferred default parameters of the GAP program include: (1) the unary comparison matrix of nucleotides (including the value 1 for identity and the value 0 for non-identity) , and the weighted comparison matrix of Gribskov and Burgess (1986) , (2) The penalty for each gap is 3.0 and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps.
  • nucleic acid fragments that are complementary, essentially complementary, and/or substantially complementary to at least one or more specific nucleotide sequences specifically described herein.
  • a “complementary" nucleic acid sequence is a nucleic acid sequence capable of base pairing according to the standard Watson-Crick complementation rule.
  • the term “complementary sequence” refers to a nucleic acid sequence that is substantially complementary, which can be assessed by the nucleotide comparison as above, or defined as being able to hybridize with one or more specific nucleic acid fragments disclosed herein under relatively stringent conditions, such as those just described above.
  • the term "essentially free” or “essentially free” in relation to the amount of components preferably means that the composition contains less than about 10%by weight, preferably less than about 5%by weight, more preferably less than about 1%by weight of a certain compound. In preferred embodiments, these terms refer to less than about 0.5%by weight, less than about 0.1%by weight, or less than about 0.01%by weight.
  • the probes and primers used in the present invention can have any suitable length.
  • an algorithm can be proposed to limit all probes or primers contained in a given sequence: n to n + y, wherein n is an integer from 1 to the last number of the sequence, y is the length of the probe or primer minus 1, wherein n + y does not exceed the last number of the sequence. Therefore, for a probe or primer with 25 base pairs (i.e., "25mer" ) , the set of probes or primers has an entire length of the sequence corresponding to bases 1 to 25, bases 2 to 26, bases 3 to 27, bases 4 to 28, and so on.
  • exemplary primer or probe sequences include, but are not limited to, the sequences have an entire length corresponding to bases 1 to 35, bases 2 to 36, bases 3 to 37, bases 4 to 38, and so on.
  • probe or primer can correspond to the nucleotide from the first base pair to bp 40, from the second bp of the sequence to bp 41, from the third bp to bp 42, etc.
  • such probe or primer can correspond to the nucleotide sequence extended from bp 1 to bp 50, from bp 2 to bp 51, from bp 3 to bp 52, from bp 4 to bp 53, etc.
  • the term "substantially correspond to” refers to the features of a nucleic acid or amino acid sequence, wherein the selected nucleic acid or amino acid sequence has at least about 70 or about 75%sequence identity compared to the selected reference nucleic acid or amino acid sequence. More generally, the selected sequence and the reference sequence will have at least about 76, 77, 78, 79, 80, 81, 82, 83, 84 or even 85%sequence identity, more preferably at least about 86, 87 , 88, 89, 90, 91, 92, 93, 94 or 95%sequence identity. Still more preferably, highly homologous sequences often share greater than at least about 96, 97, 98, or 99%sequence identity between the selected sequence and the reference sequence with which it is compared.
  • synthetic shall mean that the substance does not origin from the human or animal.
  • treatment practice period refers to the period of time necessary for one or more active agents to be effective for treatment.
  • therapeutically effective refers to reducing the severity and/or frequency of one or more symptoms, eliminating one or more symptoms and/or underlying causes, preventing the occurrence of symptoms and/or their underlying causes, and improving or repairing injury.
  • the "therapeutic agent” can be any physiologically or pharmacologically active substance, which can produce the desired biological effect at the target site of an object.
  • the therapeutic agent can be a chemotherapeutic agent, an immunosuppressant, a cytokine, a cytotoxic agent, a nuclear lytic compound, a radioisotope, a receptor, and a prodrug activating enzyme, which can be naturally occurring or produced by synthetic or recombinant methods or any combinations thereof.
  • Drugs affected by classic multidrug resistance such as vinblastine alkaloid (such as vinblastine and vincristine) , anthracycline (such as doxorubicin and daunorubicin) , a RNA transcription inhibitor (such as actinomycin) Bacteriocin-D) and a microtubule stabilizing drug (such as paclitaxel) may have specific uses as therapeutic agents.
  • Cytokines can also be used as therapeutic agents. Examples of such cytokines are lymphokines, monocytes, and traditional polypeptide hormones. Cancer chemotherapeutic agents may be the preferred therapeutic agents.
  • anticancer agents and other therapeutic agents can refer to various instruction manuals, including but not limited to, Physician's Desk Reference and Goodman and Gilman's "Pharmacological Basis of Therapeutics” Basis of Therapeutics” , Edition 10, Hardman et al. (ed. ) (2001) .
  • transcription factor recognition site and “transcription factor binding site” refer to a polynucleotide sequence or sequence motif, which is identified as a sequence-specific interaction site of one or more transcription factors, often in the form of direct protein-DNA binding.
  • the transcription factor binding site can be identified by DNA footprinting, gel mobility variation analysis, etc., and/or can be predicted based on known consensus sequence motifs or by other methods known to those of ordinary skill in the art.
  • Transcription regulatory element refers to a polynucleotide sequence that activates transcription alone or in combination with one or more other nucleic acid sequences.
  • the transcriptional regulatory element may, for example, comprise one or more promoters, one or more response elements, one or more negative regulatory elements, and/or one or more enhancers.
  • Transcription unit refers to a polynucleotide sequence comprising at least a first structural gene that is operably linked to at least a first cis-acting promoter sequence and is optionally operably linked to one or more other cis-acting nucleic acid sequences necessary for the effective transcription of the structural gene sequence, as well as if possible, the first structural gene is at least a first distal regulatory element required to operably place the appropriate tissue-specific and developmental transcription of the structural gene sequence under the control of the promoter and/or enhancer element, and any additional cis sequences necessary for effective transcription and translation (e.g., polyadenylation sites, mRNA stability control sequences, etc. ) .
  • transformation is intended to generally describe a method of introducing an exogenous polynucleotide sequence (for example, a viral vector, plasmid, or recombinant DNA or RNA molecule) into a host cell or protoplast, in which the host The exogenous polynucleotide in the cell or protoplast is incorporated into at least the first chromosome or is capable of autonomous replication in the transformed host cell.
  • Transfection, electroporation, and "naked" nucleic acid uptake all represent examples of techniques used to transform host cells with one or more polynucleotides.
  • transformed cell means a host cell whose nucleic acid complementarity has been altered by introducing one or more exogenous polynucleotides into the cell.
  • Treatment refers to providing any type of medical or surgical management to an object.
  • Treatment may include, but is not limited to, administration of a composition comprising a therapeutic agent to an object.
  • Treatment includes administration or application of the compound or composition of the present invention to an object for purposes such as curing, reversing, alleviating, reducing the severity of, inhibiting the progression of, or reducing the possibility of a disease, disorder or condition or one or more symptoms or manifestations thereof.
  • the composition of the invention may also be administered prophylactically, that is, before any symptoms or manifestations of the condition develop, where such prevention is guaranteed.
  • the object will be diagnosed as "at risk” develop such a disease or condition due to family history, medical history, or completion of one or more indications for subsequent diagnosis or prognostic testing of such disease or condition.
  • vector refers to a nucleic acid molecule (usually composed of DNA) that can replicate in a host cell and/or can be operatively linked to another nucleic acid fragment to cause replication of the connected fragment.
  • Exemplary vector is a plasmid, cosmid or virus.
  • zero order or near zero order as applied to the release kinetics of the active agent from the disclosed vaccine delivery composition is intended to include the rate at which the active agent is released in a controlled manner during the therapeutic practice period after administration of the composition to achieve the therapeutically effective plasma concentration of the active agent.
  • one or more nucleic acid fragments of the present invention in combination with a suitable detectable label (i.e., "marker” ) , for example, in the case of hybridization analysis using a labeled polynucleotide probe to determine the presence of a given target sequence.
  • a suitable detectable label i.e., "marker”
  • a variety of appropriate indicator compounds and compositions are known in the art for labeling oligonucleotide probes, including but not limited to a fluorescent ligand, a radioligand, an enzyme ligand or other ligands such as avidin/biotin and the like, which can be detected in a suitable analysis.
  • one or more fluorescent labels or enzyme tags can also be used instead of radioactive or other environmentally less ideal reagents.
  • enzyme tags known colorimetric, color-developing or fluorescent indicator substrates can be used to provide a method that is visible to the human eyes or is detected by analytical methods such as scintillation scanning, fluorometry, spectrophotometry, etc., to identify specific hybridization to a sample containing one or more complementary or substantially complementary nucleic acid sequences.
  • first oligonucleotide probe by using a first marker having a first detection property or parameter (for example, emission and/or excitation spectrum maximum) , which also labels a second oligonucleotide by a second marker having a second detection property or parameter that is different (i.e., irrelevant or distinguishable from the first marker) .
  • first detection property or parameter for example, emission and/or excitation spectrum maximum
  • nucleic acid includes any compounds and/or substances that can or can be incorporated into an oligonucleotide chain.
  • exemplary nucleic acids used in accordance with this application include but are not limited to DNA, RNA including messenger mRNA (mRNA) , its hybrid, RNAi inducer, RNAi agent, siRNA, shRNA, miRNA, antisense RNA, ribozyme, catalytic DNA, RNA inducing triple helix formation, aptamer, vector, etc., which are described in detail in this application.
  • DNA deoxyribonucleic acid
  • DNA DNA or DNA molecule
  • Nucleotides are linked to each other in the chain by a covalent bond between a glycosyl of one nucleotide and a phosphate group of the next nucleotide, creating an alternating glycosyl-phosphate group backbone.
  • the nitrogenous bases of two separate polynucleotide chains are hydrogen bonded together to produce double-stranded DNA.
  • RNA refers to a chain composed of at least 2 base-glycosyl-phosphate groups.
  • the term includes a compound composed of nucleotides, wherein the glycosyl moiety is ribose.
  • the terminal includes RNA and RNA derivative in which the backbone is modified.
  • RNA may be present in the form of tRNA (transfer RNA) , snRNA (small nuclear RNA) , rRNA (ribosomal RNA) , mRNA (messenger RNA) , antisense RNA, small inhibitory RNA (siRNA) , microRNA (miRNA) and ribozyme.
  • RNA can be single-stranded, double-stranded, triple-stranded, or four-stranded.
  • the term also includes artificial nucleic acids having other types of backbones but with the same base.
  • the artificial nucleic acid is PNA (Peptide Nucleic Acid) .
  • PNA contains a peptide backbone and nucleotide bases, and can bind to DNA and RNA molecules in another example.
  • the nucleotide is a modified oxetane.
  • the nucleotide is modified by replacing one or more phosphodiester bonds with phosphorothioate bonds.
  • the modified nucleic acid includes any other variants of the phosphate backbone of natural nucleic acids known in the art. Those of ordinary skill in the art are familiar with the use of the phosphorothioate nucleic acid and PNA, which are described in, for example, Neilsen PE, CurrOpinStructBiol 9: 353-57; [0280] and Raz N Ket al BiochemBiophys Res Commun. 297: 1075-84.
  • nucleic acids are well known to those skilled in the art, which are described in Molecular Cloning, (2001) , Sambrook and Russell, eds. and Methods in Enzymology: Methodsformolecular cloning in eukaryotic cells (2003) Purchio and GC Fareed, wherein each of the nucleic acid derivatives represents a separate example of the present invention.
  • nucleic acid such as mRNA and synthesis method thereof.
  • the nucleic acid used in accordance with the present application may be based on any existing technologies, including but not limited to chemical synthesis, enzymatic synthesis, usually in vitro transcription of the terminal of a longer precursor, enzymatic or chemical cleavage, etc.
  • Methods of synthesizing RNA are well known in the art (see, for example, Gait, MJ (ed. ) Oligonucleotide synthesis: a practical approach, Oxford [Oxfordshire] , Washington, District of Columbia: IRL Press, 1984; and Herdewijn, P. (ed.
  • RNA polymerase reaction buffer e.g., nucleotides such as ribonucleotides
  • RNA polymerase reaction buffer generally includes salts/buffering agents such as Tris, HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, sodium phosphate, sodium chloride, and magnesium chloride.
  • the reaction mixture may have a pH of about 6 to 8.5, 6.5 to 8.0, 7.0 to 7.5, and in some example, the pH of 7.5.
  • the reaction mixture includes NTP in a concentration range of 1-10 mM, DNA template in a concentration range of 0.01-0.5 mg/ml, and RNA polymerase in a concentration range of 0.01-0.1 mg/ml, for example, the reaction mixture includes NTP at a concentration of 5 mM, DNA template at a concentration of 0.1 mg/ml, and RNA polymerase at a concentration of 0.05 mg/ml.
  • the DNA template is optimized or modified, which is different from natural DNA, and this difference is reflected in the difference in homology analysis. This modified DNA is reverse transcribed in vitro to form an optimized sequence.
  • the optimized DNA sequence is double-stranded, or it can be a single-stranded sequence synthesized in vitro.
  • the homology between this optimized or improved DNA sequence and the natural sequence is less than 40%, or less than 45%, less than 50%, less than 55%, less than 58%, less than 60%, less than 65%, less than 70%, less than 69 %, less than 75%, less than 77%, less than 78%, less than 80%, less than 90%or less than 95%. It can even be considered that although the homology between the optimized DNA sequence and the natural sequence is only less than 95-99.9%, with a change of 1-2 nucleotides, there are indeed differences in function, which is also an embodiment of the present invention.
  • the homology between the RNA sequence translated or transcribed by optimized or modified DNA and the natural RNA sequence is less than 40%, or less than 45%, less than 50%, less than 55%, less than 58%, and less than 60%, less than 65%, less than 70%, less than 69%, less than 75%, less than 77%, less than 78%, less than 80%, less than 90%or less than 95%. It can even be considered that although the homology between the optimized RNA sequence and the natural sequence is only less than 95-99.9%, with a change of 1-2 nucleotides, there are indeed functional differences, which is also an embodiment of the present invention.
  • modified nucleic acids such as modified mRNA
  • modified mRNA may include one or more natural nucleosides (for example, adenosine, guanosine, cytidine, uridine) ; modified nucleosides (for example, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine
  • RNA molecule can include at least two nucleotides. Nucleotides can be naturally occurring nucleotides or modified nucleotides. In some examples, the RNA molecule includes about 5 nucleotides to about 5,000 nucleotides. In some examples, the RNA molecule includes at least about 5 nucleotides. In some examples, the RNA molecule include up to about 5,000 nucleotides.
  • the RNA molecule includes about 5 nucleotides to about 20 nucleotides, about 5 nucleotides to about 40 nucleotides, about 5 nucleotides to about 60 nucleotides , about 5 nucleotides to about 80 nucleotides, about 5 nucleotides to about 100 nucleotides, about 5 nucleotides to about 200 nucleotides, about 5 nucleotides to about 500 nucleotides, about 5 nucleotides to about 1,000 nucleotides, about 5 nucleotides to about 2,000 nucleotides, about 5 nucleotides to about 5,000 nucleotides, about 20 nucleotides to about 40 nucleotides, about 20 nucleotides to about 60 nucleotides, about 20 nucleotides to about 80 nucleotides, about 20 nucleotides to about 100 nucleotides, about 20 nucleotides to about 200 nucleotides, about 20
  • the RNA molecule includes about 5 nucleotides, about 20 nucleotides, about 40 nucleotides, about 60 nucleotides, about 80 nucleotides, about 100 nucleotides , about 200 nucleotides, about 500 nucleotides, about 1,000 nucleotides, about 2000 nucleotides, or about 5000 nucleotides.
  • RNA molecules may include at least one modified nucleotide as described in this application.
  • the RNA molecule includes about 1 modified nucleotide to about 100 modified nucleotides.
  • the RNA molecule includes at least about 1 modified nucleotide.
  • the RNA molecule includes up to about 100 modified nucleotides.
  • the RNA molecule includes about 1 modified nucleotide to about 2 modified nucleotides, about 1 modified nucleotide to about 3 modified nucleotides, about 1 modified nucleotide to about 4 modified nucleotides, about 1 modified nucleotides to about 5 modified nucleotides, about 1 modified nucleotides to about 10 modified nucleotides, about 1 modified nucleotides to about 20 modified nucleotides, about 1 modified nucleotides to about 100 modified nucleotides, about 2 modified nucleotides to about 3 modified nucleotides, about 2 modified nucleotides to about 4 modified nucleotides, about 2 modified nucleotides to about 5 modified nucleotides, about 2 modified nucleotides to about 10 modified nucleotides, about 2 modified nucleotides to about 20 modified nucleotides, about 2 modified nucleotides to about 100 modified nucleotides, about 3 modified nucleotides to about 4 modified nucle
  • the RNA molecule includes about 1 modified nucleotide, about 2 modified nucleotides, about 3 modified nucleotides, about 4 modified nucleotides, about 5 modified nucleotides, about 10 kinds of modified nucleotides, about 20 kinds of modified nucleotides, or about 100 kinds of modified nucleotides.
  • RNA molecules can include at least 0.1%modified nucleotides.
  • the fraction of modified nucleotides can be calculated as: number of modified nucleotides/total number of nucleotides*100%.
  • the RNA molecule includes about 0.1%modified nucleotides to about 100%modified nucleotides.
  • the RNA molecule includes at least about 0.1%modified nucleotides.
  • the RNA molecule includes up to about 100%modified nucleotides.
  • the RNA molecule includes about 0.1%modified nucleotides to about 0.2%modified nucleotides, about 0.1%modified nucleotides to about 0.5%modified nucleotides, about 0.1%modified nucleotides to about about 1%modified nucleotides, about 0.1%modified nucleotides to about 2%modified nucleotides, about 0.1%modified nucleotides to about 5%modified nucleotides, about 0.1%modified nucleotides to about 10%modified nucleotides, about 0.1%modified nucleotides to about 20%modified nucleotides, about 0.1%modified nucleotides to about 50%modified nucleotides, about 0.1%modified nucleotides to about 100%modified nucleotides, about 0.2%modified nucleotides to about 0.5%modified nucleotides, about 0.2%modified nucleotides to about 1%modified nucleotides, about 0.2%modified nucleot
  • the RNA molecule includes about 0.1%modified nucleotides, about 0.2%modified nucleotides, about 0.5%modified nucleotides, about 1%modified nucleotides, about 2%modified nucleotides, about 5%modified nucleotides, about 10%modified nucleotides, about 20%modified nucleotides, about 50%modified nucleotides, or about 100%modified nucleotides.
  • Nucleotides such as ribonucleotides are used at a total concentration of between 0.5 mM and about 500 mM in the reaction. In some examples, the total concentration of nucleotides is about 0.5 mM to about 500 mM. In some examples, the total concentration of nucleotides is at least about 0.5 mM. In some examples, the total concentration of nucleotides is up to about 500 mM.
  • the total concentration of nucleotides is about 0.5 mM to about 1 mM, about 0.5 mM to about 5 mM, about 0.5 mM to about 10 mM, about 0.5 mM to about 50 mM, about 0.5 mM to about 100 mM, about 0.5 mM to about 200 mM, about 0.5 mM to about 300 mM, about 0.5 mM to about 500 mM, about 1 mM to about 5 mM, about 1 mM to about 10 mM, about 1 mM to about 50 mM, about 1 mM to about 100 mM, about 1 mM to about 200 mM, about 1 mM to about 300 mM, about 1 mM to about 500 mM, about 5 mM to about 10 mM, about 5 mM to about 50 mM, about 5 mM to about 100 mM, about 5 mM to about 200 mM, about 5 mM to about 300
  • the total concentration of nucleotides is about 0.5 mM, about 1 mM, about 5 mM, about 10 mM, about 50 mM, about 100 mM, about 200 mM, about 300 mM, or about 500 mM.
  • 5'-cap and/or 3'-tail can be added.
  • the presence of the cap can provide resistance to nucleases found in most eukaryotic cells.
  • the presence of "tail” can be used to protect mRNA from exonuclease degradation and/or to regulate protein expression levels.
  • 5'-cap can be added as follows: firstly, one terminal phosphate group is removed from the 5'-nucleotide by RNA terminal phosphatase, leaving two terminal phosphate groups; then guanosine triphosphate (GTP) is added to the terminal phosphate group by guanylyltransferase to produce 5', 5', 5'-triphosphate bond; then the 7-nitrogen of guanine is methylated by methyltransferase.
  • GTP guanosine triphosphate
  • examples of the cap structure include, but are not limited to, m7G (5') ppp (5' (A, G (5') ppp (5') A and G (5') ppp (5') G. More cap structures are described in the published U.S. Application No.
  • the tail structure may include poly (A) and/or poly (C) tails.
  • the poly-A tail on the 3'-terminal of the mRNA (for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides at the 3'-terminal) may include at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%or 99%adenosine nucleotides.
  • the poly-A tail on the 3'-terminal of the mRNA may include at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%or 99%cytosine nucleotides.
  • 5'-cap and/or 3'-tail can help to detect invalid transcripts produced during in vitro synthesis, because the size of those mRNA transcripts that are terminated prematurely may be too small to be detected without capping and/or tailing. Therefore, in some examples, 5'-cap and/or 3'-tail are added to the synthetic mRNA before testing for mRNA purity (e.g., the level of invalid transcripts present in the mRNA) . In some examples, 5'-cap and/or 3'-tail are added to the synthesized mRNA before purifying the mRNA as described in this application. In other examples, 5'-cap and/or 3'-tail are added to the synthesized mRNA after purifying the mRNA as described in this application.
  • mRNA synthesized according to the present invention can be used without further purification.
  • mRNA synthesized according to the present invention can be used without a step of removing short polymers.
  • mRNA synthesized according to the present invention can be further purified.
  • synthesized mRNA can be purified by various methods. For example, mRNA can by purified by centrifugation, filtration, and/or chromatography. In some examples, the synthesized mRNA is purified by ethanol precipitation or filtration or chromatography, or gel purification, or any other suitable methods. In some examples, mRNA is purified by HPLC.
  • mRNA is extracted in standard solution of phenol: chloroform: isoamyl alcohol, which is well known to those skilled in the art.
  • mRNA is purified by tangential flow filtration. Suitable purification methods include methods described in US 2016/0040154, US 2015/0376220, PCT application PCT/US18/19954 filed on February 27, 2018, entitled “Method for Purifying Messenger RNA” , and PCT application PCT/US18/19978 filed on Febrary 27, 2018, entitled “Method for Purifying Messenger RNA” , all of which are incorporated into this application by reference and can be used to implement the present invention.
  • mRNA is purified before capping and tailing. In some examples, mRNA is purified after capping and tailing. In some examples, mRNA is purified both before and after capping and tailing. In some examples, mRNA is purified by centrifugation before or after capping and tailing, or both. In some examples, mRNA is purified by filtration before or after capping and tailing, or both. In some examples, mRNA is purified by tangential flow filtration (TFF) before or after capping and tailing, or both. In some examples, mRNA is purified by chromatography before or after capping and tailing, or both.
  • TMF tangential flow filtration
  • tailing is accompanied by transcription. Therefore, the nucleic acid can also be purified after completion of the tailing and capping steps.
  • the purification method is as described above. Therefore, in some embodiments, the purification step should be performed after tailing.
  • mRNA can also be purified before capping. Of course, it can also be purified after transcription.
  • the full-length or null transcript of mRNA can be detected and quantified by any methods available in the art.
  • the synthetic mRNA molecules are detected using blotting, capillary electrophoresis, chromatography, fluorescence, gel electrophoresis, HPLC, silver staining, spectroscopy, ultraviolet (UV) or UPLC, or combinations thereof. Other detection methods known in the art are included in the present invention.
  • the synthesized mRNA molecules are detected by capillary electrophoresis separation using UV absorption spectroscopy.
  • the mRNA is denatured with glyoxal dye before gel electrophoresis ( "glyoxal gel electrophoresis" ) .
  • the synthetic mRNA is characterized before capping or tailing.
  • the synthetic mRNA is characterized after capping and tail sealing.
  • the mRNA produced by the methods disclosed herein includes less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, Less than 1%, less than 0.5%, less than 0.1%of impurities other than full-length mRNA.
  • Impurities include IVT contaminants, such as proteins, enzymes, free nucleotides and/or short polymers.
  • the mRNA prepared according to the invention is substantially free of short polymers or null transcripts.
  • the mRNA prepared according to the present invention includes undetectable levels of short polymers or invalid transcripts by capillary electrophoresis or glyoxal gel electrophoresis.
  • the term "short polymer” or “null transcript” refers to any transcripts that are less than full length.
  • “short polymer” or “null transcript” has a length of less than 100, less than 90, less than 80, less than 70, less than 60, less than 50, less than 40, less than 30, less than 20, or less than 10 nucleotides.
  • the short polymers is detected or quantified after addition of 5'-cap and/or 3'-poly A tail.
  • 3'-untranslated region 3'-UTR
  • the term “3'-UTR” refers to a part of an artificial nucleic acid molecule that is located at 3' (i.e., "downstream” ) of the open reading frame, and it is not translated as protein.
  • the 3'-UTR is a part of the mRNA between the protein coding region (open reading frame (ORF) or coding sequence (CDS) ) of the mRNA and the polyadenylation sequence.
  • ORF open reading frame
  • CDS coding sequence
  • the term 3'-UTR may also comprises an element that is not encoded in the template, from which RNA is transcribed, but are added after transcription during the maturation process, such as polyadenylic acid sequence.
  • the 3'-UTR of mRNA is not translated into an amino acid sequence.
  • the 3'-UTR sequence is usually encoded by the gene that is transcribed into the respective mRNA during gene expression.
  • the genomic sequence is first transcribed into premature mRNA containing optional introns.
  • the prematuration mRNA is then further processed into mature mRNA during the maturation process.
  • the maturation process includes the following steps: 5′ capping, splicing of premature mRNA to excise optional introns and modification at 3′-terminal (such as polyadenylation at 3′-terminal of premature mRNA and optional endonuclease/or exonuclease cutting, etc. ) .
  • 3'-UTR corresponds to a stop codon located in the protein coding region, preferably between the 3'-terminal of the stop codon of the protein coding region and the polyadenylation sequence of the mRNA.
  • the term "corresponding to” means that the 3'-UTR sequence can be RNA sequence as used to define the 3'-UTR sequence in an mRNA sequence, or in a DNA sequence corresponding to this RNA sequence.
  • the term "3'-UTR of a gene” refers to a sequence corresponding to the 3'-UTR of a mature mRNA derived from the gene, which is obtained through gene transcription and maturation of pre-mRNA.
  • 3'-UTR of a gene includes the DNA sequence and the RNA sequence of the 3'-UTR (both sense and antisense strands and both mature and immature) .
  • the 3'UTR has a length of more than 20, 30, 40 or 50 nucleotides.
  • 3'-untranslated region (3'UTR) 3'UTR is typically a part of the mRNA, which is located between the protein coding region (i.e., reading frame) of the mRNA and the polyadenylation sequence. The 3'UTR of mRNA is not translated into an amino acid sequence.
  • 3'UTR corresponds to the 3'-terminal of the stop codon in the protein coding region, preferably immediately to 3'-terminal of the stop codon in the protein coding region, and in direction to the 5'-terminal of the polyadenylic acid sequence, preferably, the mature mRNA sequence extends to the nucleotides immediately to 5’-terminal of the polyadenylic acid sequence.
  • the term "corresponding to" means that the 3'UTR sequence can be RNA sequence as used to define the 3'UTR sequence in an mRNA sequence, or in a DNA sequence corresponding to this RNA sequence.
  • the term "3'UTR of a gene” refers to a sequence corresponding to the 3'UTR of a mature mRNA derived from the gene, which is obtained through gene transcription and maturation of pre-mRNA.
  • the term "3'UTR of a gene” includes the DNA sequence and the RNA sequence of the 3'UTR.
  • 5'-untranslated region 5'-UTR
  • 5'-UTR refers to a part of an artificial nucleic acid molecule that is located at 5' (i.e., "upstream” ) of the open reading frame, and it is not translated as protein.
  • 5'-UTR is generally understood as a specific fragment of messenger RNA (mRNA) that is located 5'-terminal of the open reading frame of the mRNA.
  • mRNA messenger RNA
  • the 5'-UTR starts at the transcription start site and terminates at one nucleotide before the start codon of the open reading frame.
  • the 5'UTR has a length of more than 20, 30, 40 or 50 nucleotides.
  • 5'-UTR may contain elements for controlling gene expression, also called regulatory elements.
  • the regulatory element may be, for example, a ribosome binding site.
  • 5'-UTR can be modified post-transcriptionally, for example by addition of 5'-cap modification.
  • the 5'-UTR of mRNA is not translated into an amino acid sequence.
  • the 5'-UTR sequence is usually encoded by the gene that is transcribed into the respective mRNA during gene expression.
  • the genomic sequence is first transcribed into pre-mRNA, which contains optional introns.
  • the pre-mature mRNA is then further processed into mature mRNA during the maturation process.
  • the maturation process includes the following steps: 5′ capping, splicing of premature mRNA to excise optional introns and modification at 3′-terminal (such as polyadenylation at 3′-terminal of premature mRNA and optional endonuclease/or exonuclease cutting, etc. ) .
  • 5'-UTR corresponds to a mature mRNA sequence located between the start codon and, for example, the 5'-cap.
  • the 5′-UTR corresponds to the sequence extends from the nucleotide located on the 3′ side of the 5′-cap, more preferably from the nucleotideat 3′ side immediately adjacent to the 5′-cap, to the 5′ side of the start codon of the protein coding region, preferably, to the nucleotide at 5’ side immediately to the start codon of the protein coding region.
  • the nucleotide at 3’ side immediately to the 5'-cap of the mature mRNA typically corresponds to the transcription start site.
  • the term "corresponding to" means that the 5'-UTR sequence can be RNA sequence as used to define the 5'-UTR sequence in an mRNA sequence, or in a DNA sequence corresponding to this RNA sequence.
  • the term "5'-UTR of a gene” refers to a sequence corresponding to the 5'-UTR of a mature mRNA derived from the gene, which is obtained through gene transcription and maturation of pre-mRNA.
  • the term "5'-UTR of a gene” includes the DNA sequence and the RNA sequence of the 5'-UTR (both sense and antisense strands and both mature and immature) .
  • the present invention relates to an artificial nucleic acid molecule, which comprises an open reading frame ORF, 3'-untranslated region elements (3'-UTR elements) and/or 5'-untranslated region elements (5'-UTR elements) and optionally polyadenylation sequence and/or polyadenylation-signal.
  • the present invention also relates to a vector containing a 3'-UTR element and/or a 5'-UTR element, to a cell containing the artificial nucleic acid molecule or the vector, and to a pharmaceutical composition containing the artificial nucleic acid molecule or the vector, and a kit comprising the artificial nucleic acid molecule, the vector and/or the pharmaceutical composition, which is preferably used in the field of gene therapy and/or gene vaccination.
  • mRNA stabilization As an alternative to mRNA stabilization, it has been found that naturally occurring eukaryotic mRNA molecules contain characteristic stabilization elements. For example, they can contain so-called untranslated regions (UTR) at their 5'-terminal (5'-UTR) and/or at their 3'-terminal (3'-UTR) and other structural features, such as 5'cap structure or 3'-polyadenylate tail. Both 5'-UTR and 3'-UTR are typically transcribed from genomic DNA and are therefore premature mRNA elements.
  • UTR untranslated regions
  • the unique structural features of mature mRNA such as 5'cap and 3'-polyadenylate tail (also called polyadenylate tail or polyadenylate sequence) are usually added to the transcribed (premature) mRNA.
  • the 3'-polyadenylate tail is typically a monotonic adenosine nucleotide sequence added to the 3'-terminal of the transcribed mRNA. It can contain up to about 400 adenosine nucleotides. It is found that the length of this 3'-polyadenylate tail is a possible key element for the stability of individual mRNA.
  • ⁇ -globin mRNA may be an important factor for the stability of the well-known ⁇ -globin mRNA (Rodgers et al., Regulated ⁇ -globin mRNA decay is a cytoplasmic eventproceeding through 3'-to-5'exosome-dependent decapping, RNA, 8, pages 1526-1537, 2002) .
  • ⁇ -globulin mRNA The 3'UTR of ⁇ -globulin mRNA is obviously involved in the formation of specific nucleoprotein-complex ( ⁇ -complex) , and its existence is related to the stability of mRNA in vitro (Wang et al., An mRNA stability complex functions with poly (A) -binding protein to stabilize mRNA in vitro, Molecular and Cellular biology, Volume 19, Issue 7, July 1999, pages 4552-4560) .
  • the UTR in the ribosomal protein mRNA has further shown interesting regulatory functions: while the 5'-UTR of the ribosomal protein mRNA controls the translation of growth-related mRNA, the stringency of this regulation is conferred by each 3'-UTR in the ribosomal protein mRNA (Ledda et al., Effect of the 3'-UTR length on the translational regulation of 5'-terminal oligopyrimidine mRNAs, Gene, Vol. 344, 2005, p. 213-220) .
  • ribosomal proteins which are usually transcribed in a constant manner so that some ribosomal protein mRNAs such as ribosomal protein S9 or ribosomal protein L32 are called housekeeping genes (Janovick-Guretzky et al., Housekeeping Gene Expression in Bovine Liver is Affected by Physiological State, Feed Intake, and Dietary Treatment, J. Dairy Sci., Vol. 90, 2007, p. 2246-2252) .
  • the growth-related expression patterns of ribosomal proteins are therefore mainly due to the regulation of translation levels.
  • 3'-UTR element refers to a nucleic acid sequence comprising a 3'-UTR or a variant or fragment derived from a 3'-UTR or a variant derived from a 3'-UTR or a 3'-UTR or a nucleic acid sequence composed of a fragment of the nucleic acid sequence.
  • the "3'-UTR element” preferably refers to an artificial nucleic acid sequence, such as a nucleic acid sequence contained in the 3'-UTR of artificial mRNA.
  • the 3'-UTR element can be comprised by the 3'-UTR of mRNA, preferably artificial mRNA, or the 3'-UTR element can be comprised by the 3'-UTR of the respective transcription template.
  • the 3'-UTR element is a nucleic acid sequence corresponding to the 3'-UTR of the mRNA, preferably an artificial mRNA, such as the 3'-UTR of the mRNA obtained by transcribing a genetically modified vector construct.
  • the 3'-UTR element in the meaning of the present invention functions as a 3'-UTR or encodes a nucleotide sequence that performs the function of the 3'-UTR.
  • the term "5'-UTR element” refers to a nucleic acid sequence comprising a variant or fragment derived from 5'-UTR or 5'-UTR or a variant or fragment derived from 5'-UTR or a nucleic acid sequence composed of the nucleic acid sequence of a variant or fragment of 5’-UTR.
  • the "5'-UTR element” preferably refers to an artificial nucleic acid sequence, such as a nucleic acid sequence contained in the 5'-UTR of artificial mRNA.
  • the 5'-UTR element can be comprised by the 5'-UTR of mRNA, preferably artificial mRNA, or the 5'-UTR element can be comprised by the 5'-UTR of the respective transcription template.
  • the 5'-UTR element is a nucleic acid sequence corresponding to the 5'-UTR of the mRNA, preferably an artificial mRNA, such as the 5'-UTR of the mRNA obtained by transcribing a genetically modified vector construct.
  • the 5'-UTR element in the meaning of the present invention functions as a 5'-UTR or encodes a nucleotide sequence that performs the function of the 5'-UTR.
  • the 3'-UTR element and/or 5'-UTR element in the artificial nucleic acid molecule according to the present invention extends and/or increases the protein production from the artificial nucleic acid molecule. Therefore, the artificial nucleic acid molecule according to the present invention may especially include the following one or several functional 3'-UTR elements and/or 5'-UTR elements: increasing the 3'-UTR element produced from the protein of the artificial nucleic acid molecule, extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule, increasing and extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule, increasing the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, extending the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, increasing and extending the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, increasing the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and increasing the 5
  • the artificial nucleic acid molecule according to the present invention comprises a 3'-UTR element that prolongs protein production from the artificial nucleic acid molecule and/or a 5'-UTR element that increases protein production from the artificial nucleic acid molecule.
  • the artificial nucleic acid molecule according to the present invention comprises at least one 3'-UTR element and at least one 5'-UTR element, that is, at least one 3'-UTR element that extends and/or increases protein production from the artificial nucleic acid molecule and is derived from stable mRNA, and at least one 5'-UTR element that extends and/or increases protein production from the artificial nucleic acid molecule and is derived from stable mRNA.
  • Extending and/or increasing protein production from the artificial nucleic acid molecule generally refers to the absence of 3'-UTR and/or 5'-UTR or the inclusion of reference 3'-UTR and/or reference 5'-UTR (such as the 3'-UTR and/or 5'-UTR that naturally exist in combination with ORF) , compared with the amount of protein produced by each reference nucleic acid, from those with each 3'-UTR element and/or 5'-UTR element The amount of protein produced by the artificial nucleic acid molecule according to the present invention.
  • At least one 3'-UTR element and/or 5'-UTR element of the artificial nucleic acid molecule according to the present invention is extended from the artificial nucleic acid molecule according to the present invention, for example from the protein produced from the mRNA according to the present invention.
  • At least one 3'-UTR element and/or 5'-UTR element of the artificial nucleic acid molecule according to the present invention increases protein production from the artificial nucleic acid molecule according to the present invention, for example from the mRNA according to the present invention, especially protein expression and/or total protein production.
  • the at least one 3'-UTR element and/or the at least one 5'-UTR element of the artificial nucleic acid molecule of the present invention does not negatively affect the translation efficiency of the nucleic acid.
  • the translation efficiency is enhanced by 3'-UTR and/or 5'-UTR compared to the protein encoded by each ORF in its natural state.
  • each nucleic acid molecule or “reference nucleic acid molecule” as used herein means that -in addition to a different 3'-UTR and/or 5'-UTR -a reference nucleic acid molecule is comparable, preferably identical with a 3'-UTR element and/or the 5'-UTR element of the artificial nucleic acid molecule of the present invention.
  • the 5'-terminal and 3'-terminal of the ORF of the present invention include, for example, one UTR sequence comprising 5'UTR shown in SEQ NO: 36-1 to 36-12, or one or more of the 3'UTR sequences shown in SEQ NO: 37-1 to 37-12.
  • the 5'UTR sequence is a sequence shown in SEQ NO: 36-11
  • the 3'UTR sequence is a sequence shown in SEQ NO: 37-11
  • the 5'UTR sequence is a sequence shown in SEQ NO: 36-12
  • the 3'UTR sequence is a sequence shown in SEQ NO: 37-12.
  • the 3'-terminal of the ORF sequence of the present invention comprises the sequence shown in SEQ NO: 37-11 or SEQ NO: 37-12.
  • the application also discloses a pharmaceutical composition
  • a pharmaceutical composition comprising a compound, a modified nucleoside, a modified nucleotide, or the modified nucleic acid provided in the application.
  • the pharmaceutical composition of the present invention can be administered to a subject by any methods known to those skilled in the art, such as parenteral, oral, transmucosal, transdermal, intramuscular, intravenous, intradermal, Subcutaneous, intraperitoneal, intraventricular, intracranial, intravaginal or intratumoral administration.
  • the pharmaceutical composition can be administered by intravenous, intraarterial or intramuscular injection of the liquid formulation.
  • suitable liquid preparations include solution, suspension, dispersion, emulsion, oil and the like.
  • the pharmaceutical composition is administered intravenously and therefore is formulated in a form suitable for intravenous administration.
  • the pharmaceutical composition is administered intraarterially and therefore is formulated in a form suitable for intraarterial administration.
  • the pharmaceutical composition is administered intramuscularly and therefore is formulated in a form suitable for intramuscular administration.
  • the pharmaceutical composition can be administered by using a vesicle, for example, a liposome (see Langer, Science 249: 1527-1533 (1990) ; Treatetal., inLiposomesin the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (ed. ) , Liss, New York, pp. 353 -365 (1989) ; Lopez-Berestein, ibid., pp. 317-327; see generallyibid) .
  • a vesicle for example, a liposome (see Langer, Science 249: 1527-1533 (1990) ; Treatetal., inLiposomesin the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (ed. ) , Liss, New York, pp. 353 -365 (1989) ; Lopez-Berestein, ibid., pp. 317-327; see generallyibid) .
  • the pharmaceutical composition can be administered orally, and therefore can be formulated into a form suitable for oral administration, that is, a solid or liquid preparation.
  • Suitable solid oral preparations may include tablet, capsule, granule, pill and the like.
  • Suitable liquid oral preparations may include solution, suspension, dispersion, emulsion, and oil.
  • the pharmaceutical composition can be administered topically to the body surface and therefore can be formulated into a form suitable for topical administration. Suitable topical preparations may include gel, ointment, cream, lotion, drop and the like.
  • the composition or a physiologically tolerable derivative thereof can be prepared and applied to a physiologically acceptable diluent as a solution, suspension or emulsion with or without a pharmaceutical carrier.
  • the pharmaceutical composition can be administered as a suppository, such as a rectal suppository or a urethral suppository.
  • the pharmaceutical composition is administered by subcutaneously implanted particles. In some examples, the particles provide controlled release of the agent over a period of time.
  • the pharmaceutical composition may additionally include pharmaceutically acceptable excipients, as used in this application, including any and all solvents, dispersion media, diluents or other liquid carriers, dispersion or suspension aids, surfactants, isotonic agents, Thickeners or emulsifiers, preservatives, solid binders, lubricants, and the like, which are suitable for the specific dosage form required.
  • pharmaceutically acceptable excipients including any and all solvents, dispersion media, diluents or other liquid carriers, dispersion or suspension aids, surfactants, isotonic agents, Thickeners or emulsifiers, preservatives, solid binders, lubricants, and the like, which are suitable for the specific dosage form required.
  • Remington's "Science and Practice of Pharmacy” Edition 21, ARGennaro (Lippincott, Williams &Wilkins, Baltimore, Md., 2006; incorporated herein by reference) discloses various excipients for formulating pharmaceutical compositions and
  • the purity of the pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%.
  • excipients are approved for human and veterinary use.
  • the excipient is approved by Food and Drug Administration.
  • the excipient is pharmaceutical grade.
  • the excipient meets the standards of the United States Pharmacopoeia (USP) , European Pharmacopoeia (EP) , British Pharmacopoeia, and/or International Pharmacopoeia.
  • Pharmaceutically acceptable carriers for the liquid formulation can be aqueous or non-aqueous solution, suspension, emulsion or oil.
  • the non-aqueous solvent may be propylene glycol, polyethylene glycol, and injectable organic ester such as ethyl oleate.
  • Aqueous carrier can include water, alcohol/aqueous solution, emulsion or suspension, including saline and buffered media.
  • oil may be the oil of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, olive oil, sunflower oil, and cod liver oil.
  • Carriers for parenteral administration may include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's solution and fixed oil.
  • Intravenous carriers include fluid and nutritional supplement, electrolyte supplement, such as Ringer's dextrose-based electrolyte supplement, and the like.
  • Examples may be sterile liquid, such as water and oil, with or without the addition of surfactants and other pharmaceutically acceptable adjuvants.
  • water, saline, aqueous dextrose and related sugar solution, and glycol such as propylene glycol or polyethylene glycol are the preferred liquid carriers, especially for injectable solutions.
  • Examples of oil may be the oil of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, olive oil, sunflower oil, and cod liver oil.
  • the pharmaceutical composition may further include a binder (e.g., acacia, corn starch, gelatin, carbomer, ethyl cellulose, guar gum, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, povidone) , a disintegrant (such as corn starch, potato starch, alginic acid, silicon dioxide, croscarmellose sodium, crospovidone, guar gum, sodium starch glycolate) , various pH and ionic strength buffer (such as Tris-HCl, acetate, phosphate) , an additive such as albumin or gelatin and the like to prevent absorption on the surface, a detergent (such as Tween 20, Tween 80, pluronic F68, bile salt) , a protease inhibitor, a surfactant (such as sodium lauryl sulfate) , a penetration enhancer, a solubilizer (such as glycerin, polyethylene glycol glycerin
  • the pharmaceutical composition provided in this application may be a controlled release composition, that is, a composition in which the compound is released within a period of time after administration.
  • the controlled release or sustained release composition may include a formulation in lipophilic depot (e.g. fatty acid, wax, oil) .
  • the pharmaceutical composition may be an immediate release composition, i.e., a composition in which the entire compound is released immediately after administration.
  • Suitable devices for delivering the intradermal pharmaceutical composition described in this application may include short needle devices such as those described in U.S. Patents 4,886,499, 5,190,521, 5,328,483, 5,527,288, 4,270,537, 5,015,235, 5,141,496, and 5,417,662.
  • the intradermal composition can be applied through a device that limit the effective penetration length of the needle into the skin, such as those described in PCT Publication WO 99/34850 and their functional equivalents.
  • a jet injection device that delivers the liquid composition to the dermis through a liquid jet syringe and/or through a needle that pierces the stratum corneum and generates a jet that reaches the dermis may be suitable.
  • the jet injection equipment is described in, for example, U.S. Patent Nos. 5,480,381, 5,599,302, 5,334,144, 5,993,412, 5,649,912, 5,569,189, 5,704,911, 5,383,851, 5,893,397, 5,466,220, 5,339,163, 5,312,335, 5,503,639, 4,880, and PCT 4,940, 4,880, and PCT publications 97/37705 and WO 97/13537.
  • a ballistic powder/particle delivery device using compressed gas to accelerate vaccine in powder form through the outer layer of the skin to the dermis may be suitable.
  • a conventional syringe can be used in the classic intradermal method of tuberculin administration intradermally.
  • the mRNA is encapsulated in a transfer carrier, such as a nanoparticle.
  • a transfer carrier such as a nanoparticle.
  • one purpose of such encapsulation is usually to protect the nucleic acid from the environment that may contain an enzyme or chemical that may degrade the nucleic acid and/or cause rapid excretion of the nucleic acid or receptor. Therefore, in some examples, a suitable delivery carrier can enhance the stability of the mRNA included therein and/or facilitate the delivery of the mRNA to the target cell or tissue.
  • the nanoparticle may be a lipid-based nanoparticle, for example, including a liposome or a polymer-based nanoparticle.
  • the nanoparticle may have a diameter of less than about 40-100 nm.
  • the nanoparticle may include at least 1 ⁇ g, 10 ⁇ g, 100 ⁇ g, 1 mg, 10 mg, 100 mg, 1 g or more mRNA.
  • nanoparticle can also be a particle with a core-shell structure.
  • nucleic acid and polymer are mixed to form a core, and then liposomes are encapsulated around the core structure, it can also be completed by the mixer of the present invention.
  • the nucleic acid and polymer can be formed into a particle structure through a mixer first, and then the particles and lipid components can be formed into a particle structure through the mixer.
  • This so-called core-shell structure for example, all core materials and shell materials in Patent Application No. 201880001680.5 can be formed by the mixer of the present invention, and all the materials constituting the core and the materials forming the shell in the patent are a specific embodiment of the present invention.
  • the delivery carrier is a liposomal vesicle, or other means to facilitate the transfer of nucleic acid to a target cell and tissue.
  • Suitable transport carrier can include, but is not limited to, a liposome, a nanoliposome, a ceramide-containing nanosome, a proteoliposome, a nanoparticle, a calcium phosphate-silicate nanoparticle, a calcium phosphate nanoparticle, a silica nanoparticle, a nanocrystalline particle, a semiconductor nanoparticle, poly (D-arginine) , a nanodendrimer, a starch-based delivery system, a micelle, an emulsion, a vesicle, a plasmid, a virus, a calcium phosphate based nucleotide, an aptamer, a peptide and other carrier tags. It is also considered to use a bio-ion capsule and other viral capsid protein assemblies as suitable transfer carriers. (Hum. Gene Ther
  • the liposome may include one or more cationic liposomes, one or more non-cationic liposomes, one or more sterol-based liposomes, and/or one or more PEG-modified liposomes.
  • the liposome may include three or more different liposome components, one of which is a sterol-based cationic liposome.
  • the sterol-based cationic liposome is cholesteryl imidazole or "ICE" liposome (see WO2011/068810, which is incorporated into this application by reference) .
  • the sterol-based cationic liposome can constitute no more than 70% (e.g., no more than 65%and 60%) of the total lipid in the lipid nanoparticles (e.g., liposomes) .
  • suitable liposome may include, for example, phosphatidyl compound, such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipid, cerebroside, and gangliosides.
  • Non-limiting examples of the cationic liposome may include C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazolyl) , HGT5000, HGT5001, OF-02, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA and HGT4003, or combinations thereof.
  • Non-limiting examples of the non-cationic liposome can comprise ceramide, cephalin, cerebroside, diacylglycerol, 1, 2-dipalmitoyl-sn-glyceryl-3-phosphorylglycerol sodium salt (DPPG) , 1, 2-distearoyl-sn-glyceryl-3-phosphoethanolamine (DSPE) , 1, 2-distearoyl-sn-glyceryl-3-phosphocholine (DSPC) , 1, 2-dipalmitoyl-sn-glyceryl-3-phosphocholine (DPPC) , 1, 2-dioleyl-sn-glyceryl-3-phosphoethanolamine (DOPE) , 1, 2-dioleyl-sn-glyceryl-3-phosphatidylcholine (DOPC) , 1, 2-dipalmitoyl-sn-glyceryl-3-phosphoethanolamine (DPPE) , 1, 2-dimyristoyl-sn-glyceryl-3-phosphoethanolamine (DM
  • the PEG-modified liposome may be a poly (ethylene) glycol chain with a length of up to 5 kDa, which is covalently attached to a liposome having an alkyl chain with a length of C6-C20.
  • Non-limiting examples of the PEG-modified liposome can include DMG-PEG, DMG-PEG2K, C8-PEG, DOGPEG, ceramide PEG, and DSPE-PEG, or combinations thereof.
  • Suitable polymer may include, for example, polyacrylate, polyalkylcyanoacrylate, polylactide, polylactide-polyglycolide copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, and polyethyleneimine.
  • the polymer-based nanoparticle may include polyethyleneimine (PEI) , such as branched PEI.
  • the vaccine agent includes the aforementioned nucleic acid, which can be translated to express an antigen or an antigen fragment of the coronavirus.
  • nucleic acid is contained in a plurality of polymer complexes or protein core particles, and the plurality of polymer complexes or protein core particles are themselves encapsulated in the first biocompatible lipid bilayer shell.
  • the polymer complex or protein core particle contains at least a first positively charged polymer or protein.
  • the first biocompatible lipid bilayer shell promotes the macropinocytosis of one or more mammalian antigen-presenting cells on the plurality of polymer complexes or protein core particles.
  • the vaccine agent further comprises an adjuvant selected from CpG, poly (I: C) , alum, and any combinations thereof encapsulated in the biocompatible lipid bilayer.
  • the vaccine agent also includes an immunomodulatory compound encapsulated in the space between the biocompatible lipid bilayers, such as IL-12p70 protein, FLT3 ligand, or indoleamine 2, 3 -dioxygenase (IDO-1) inhibitor.
  • IDO-1 inhibitor is GDC-0919, INCB24360, or combinations thereof.
  • the positively charged polymer or protein comprises protamine, polyethyleneimine, poly (B-amino ester) , or any combinations thereof.
  • the biocompatible lipid bilayer comprises one or more of the following: 1, 2-dioleoyl-sn-glycerol-3-ethylphosphocholine (EDOPC) ; 1, 2-dioleoyl-sn-glycerol-3-phosphatidylethanolamine (DOPE) ; 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine-N- [amino (polyethylene glycol) -2000] (DSPE-PEG) ; and combinations thereof.
  • EOPC 2-dioleoyl-sn-glycerol-3-ethylphosphocholine
  • DOPE 2-dioleoyl-sn-glycerol-3-phosphatidylethanolamine
  • DSPE-PEG 2-distearoyl-sn-glycerol-3-phosphoethanol
  • the biocompatible lipid bilayer comprises: (a) about 30%to about 70%1, 2-dioleoyl-sn-glycerol-3-ethylphosphocholine (EDOPC) ; (b) about 70%to about 30%of 1, 2-dioleoyl-sn-glycerol-3-phosphatidylethanolamine (DOPE) ; or (c) about 0.5%to about 5%of 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine-N- [amino (polyethylene glycol) -2000] (DSPE-PEG) .
  • EOPC 2-dioleoyl-sn-glycerol-3-ethylphosphocholine
  • DOPE 2-dioleoyl-sn-glycerol-3-phosphatidylethanolamine
  • DSPE-PEG 2-distearoyl-sn-glycerol-3-phosphoethanolamine-N- [amino (polyethylene glycol) -
  • the biocompatible lipid bilayer comprises: (a) about 45%to about 55%1, 2-dioleoyl-sn-glycerol-3-ethylphosphocholine (EDOPC) ; (b) about 55%to about 45%of 1, 2-dioleoyl-sn-glycerol-3-phosphatidylethanolamine (DOPE) ; and (c) about 1%to about 2%of 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine-N- [amino (polyethylene glycol) -2000] (DSPE-PEG) .
  • EOPC 2-dioleoyl-sn-glycerol-3-ethylphosphocholine
  • DOPE 2-dioleoyl-sn-glycerol-3-phosphatidylethanolamine
  • DSPE-PEG 2-distearoyl-sn-glycerol-3-phosphoethanolamine-N- [amino (polyethylene glyco
  • Example 1 Design and preparation of mRNA candidate sequence: DNA sequence in SEQ ID NO: 1 as the template to prepare mRNA sequence
  • thermofisher T7 RNA polymerase (1) SpeI DNA endonuclease, (2) high-fidelity DNA polymerase, (3) DNA purification column, (4) thermofisher T7 RNA polymerase, (5) thermofisher 75mM rNTP, (6) 100 mM N1 -Methyl pseudouridine-5'-triphosphate, (7) yeasenvaccinia virus capping enzyme, (8) 32mM SAM (9) thermofisherdynabeadsmyone, etc.
  • the transcription template DNA could be obtained by the linearized template plasmid as the template, using polyT long primer, high-fidelity DNA polymerase, dNTP and other raw materials, according to the appropriate program on the PCR instrument. (As shown in FIG. 2 below) .
  • Forward primerr 5'TTGGACCCTCGTACAGAAGCTAATACG3' (SEQ ID NO: 10) ;
  • Table 1 For example, to obtain the PCR reaction system configuration of SEQ ID NO: 1.
  • Table 2 PCR program of SEQ ID NO: 1.
  • Table 3 The ratio of the transcription system in vitro.
  • Capping reaction the 5'-terminal of the transcribed mRNA was capped by vaccinia virus capping enzyme to produce cap0 cap structure mRNA.
  • the reaction system was shown in Table 4:
  • the mRNA after completion of the capping reaction was purified by using thermo fisher dynabeadsmyone.
  • the volume ratio of mRNA to magnetic beads purification buffer was 1: 2, and the mass ratio of magnetic beads to mRNA was 1: 1.
  • the purified mRNA was dissolved in sodium citrate solution, followed by subsequent preparation coating.
  • the wild-type natural sequence corresponding to the above optimized sequence was shown in Table 6.
  • the sequence Nos. 1, 8, and 9 in Table 5 were optimized based on the natural sequence shown in the sequence No. 1-1 in Table 6; the sequence Nos. 5 and 6 in Table 5 were optimized based on the natural sequence shown in the sequence No. 3-3 in Table 6; the sequence No. 3 in Table 5 was optimized based on the natural sequence shown in the sequence No. 5-5 in Table 6; the sequence No. 7 in Table 5 was optimized based on the natural sequence shown in the sequence No. 9-9 in Table 6.
  • the so-called optimization could be the optimization of all the full-length sequences or the optimization of partial sequences, for example, the Nos. 1, 8, and 9 in Table 5 were the full-length optimization or partial optimization of the S gene, which only showed the length of the sequence or the optimization of partial sequences at different positions in the full-length sequence.
  • the optimization process was to improve or design the nucleic acid DNA so that the transformed RNA sequence could express more target antigens in the cell, or be more stable, or had other functional requirements.
  • Table 6 List of natural (wild type, WT) DNA sequences corresponding to the optimized sequences in Table 5.
  • the DNA template sequences numbered 1-9 differed only in the ORF region sequence, and the rest of the functional regions such as the T7 promoter sequence, the UTR sequence at the 5'a nd 3'-terminals were identical to the polyA sequence.
  • the optimized sequence was compared with the corresponding natural wild-type DNA sequence.
  • the blast method was as described in the website address: Clustal Omega (https: //www. ebi. ac. uk/Tools/msa /clustalo/) comparison, and the results obtained were shown in Table 7 below.
  • Clustal Omega https: //www. ebi. ac. uk/Tools/msa /clustalo/
  • Table 8 List of mRNA sequences obtained according to the above method.
  • the 9 mRNA sequences listed in Table 8 were different only in the ORF region, and other functional regions such as UTR sequence and polyA sequence were exactly identical; and ORF regions were all sequences transcribed from optimized or unoptimized DNA sequences.
  • the sequence without optimization referred to the sequence identical to or having a homology more than or equal to 95%with the natural wild-type nucleic acid sequence, such as SEQ NO: 2 or SEQ NO: 1.2; or SEQ NO: 1.4 or SEQ NO: 4 for the new coronavirus of the present invention.
  • T7 promoter TAATACGACTCACTATA (SEQ ID NO: 12)
  • the DNA optimized sequence in Table 7 corresponded to the mRNA sequence in Table 9. This was because the optimized DNA sequence was analyzed and compared with the natural sequence, so that according to this logic, the obtained optimized mRNA sequence had a similar relationship with the natural sequence (wild type) . See Table 9 for details.
  • the sequence Nos. 1.1; 1.8; 1.9 in Table 8 were optimized based on the natural sequence shown in the sequence No. 1-1-1 in Table 9; the sequence Nos. 1.5; 1.6 in Table 8 were optimized based on the natural sequence shown in the sequence No. 5-5-5 in Table 9; the sequence No. 1.3 in Table 8 were optimized based on the natural sequence shown in the sequence No. 3-3-3 in Table 9; the sequence No.
  • SEQ NO: 1-1-1) S (SEQ NO: 2-2-2) S-RBD (SEQ NO: 3-3-3) M (SEQ NO: 4-4-4) N (SEQ NO: 5-5-5) S-RBD (SEQ NO: 6-6-6) S-RBD (SEQ NO: 7-7-7) E (SEQ NO: 8-8-8) S partial (partial) (SEQ NO: 9-9-9) S1
  • Table 10 Comparison of homology between the natural mRNA sequence and the optimized sequence.
  • RNA sequence could be obtained through the optimized DNA sequence, and of course it was also possible to directly generate the RNA sequence through sequence synthesis.
  • promoters conventional promoter sequences could be used, or untranslated regions could be added at the beginning and terminal of the sequence, such as UTR sequence, which could make the RNA sequence more stable.
  • the specific screening of the UTR sequence would be described in detail in the specific embodiments of the present invention.
  • General UTR sequences could be achieved.
  • the specific sequences of these so-called promoters, suitable UTR sequences, poly sequences, and nucleic acid modification and sequence optimization were all to ensure the stable transmission of nucleic acid sequences in the body, meanwhile, or with high expression.
  • some additional sequences could be inserted in front of the ORF sequence. These sequences could also help to achieve functional improvements in RNA expression, such as reducing some restriction sites to make the protein more active.
  • Such sequences could be the following sequences: for example, insertion of the sequence into the fourth nucleoside at 5’-terminal of the ORF sequence. For example, all nucleotides at the 5’-terminal started with AUG, and then one or more of the following sequences was inserted from the fourth nucleotide.
  • the insertion site it could be inserted after the first few nucleotides at the 5’-terminal, of course, it could also be inserted at the 3’-terminal, and of course, it could also be directly connected to the ORF (open reading frame) sequence.
  • ORF open reading frame
  • the utility of these sequences was diverse, with sequences that comprehensively improve RNA performance.
  • These additional sequences could be inserted into the ORF sequence and became part of the ORF sequence. It could be understood that sequences other than the ORF sequence were all a preferred embodiment of the present invention, but these preferred embodiments did not indicate that these sequences must be possessed to achieve the objective and intention of the present invention.
  • Table 11 Translated and expressed amino acid sequences in Table 8.
  • Example 2 Cell expression level verification of candidate mRNA sequences in vitro
  • Table 12 Specific sequence features of 9 new coronavirus mRNA vaccines.
  • the "********" in the above table represented the complete sequence containing the 9 different RNAs in Table 8.
  • the complete sequence included other functional regions such as the promoter sequence, the UTR sequence and the polyA sequence were exactly identical, (without additional sequences ) , a total of 9 items, named nCoV-N, where N was a natural number from 1-9, see the table for details.
  • Test reagents HEK-293 cells (purchased by the manufacturer: ) ; DMEM complete medium (Gibco) : 1%double antibody (Gibco) , 10%FBS (Hyclone) ; PBS (Solebold) ; Transfection dilution: Opti-MEM (Gibco) ; LipofectamineMessengerMAX (Invitrogen) ; RIPA Lysis Solution (Strong) (Protease Inhibitor Mixture Pierce TM Protein Concentrator PES, 3K MWCO (Pierce) ; BCA Protein Concentration Determination Kit (Enhanced) (Biyuntian) ; Tris-glycine electrophoresis buffer (Solebold) ; Electrotransfer solution (Solebold) ; TBST: 1 ⁇ TBS (Solebold) +1 ⁇ Tween-20 (Solebold) ; Skim milk powder (Anjia) ; Methanol (Aladdin) ; Bey
  • Test consumables T75 cell culture flask (Thermo) ; 15/50 ml centrifuge tube (Corning) ; pipette (Corning) ; 1.5/0.5 ml centrifuge tube (Axygen) ; PVDF membrane (Biyuntian) ; transfer filter paper (Biyuntian) ; X-OMAT BT film (5 ⁇ 7 inches) (Biyuntian) ; tablet cassette (Biyuntian) ; 3.3 Test equipments; CO 2 incubator (Panasonic) ; inverted microscope (Leica) ; electrophoresis instrument (Bio-Rad) ; electrophoresis tank (Bio-Rad) ; transfer tank (Bio-Rad) ; centrifuge (Kubota) ; gel imaging Universal Hood II (Bio-Rad) .
  • HEK 293 cells were plating at 1 ⁇ 10 6 cells per well in a six-well plate, and incubated at 37°C in an incubator for 16 hours.
  • BSA standard 0.8 ml of protein standard preparation solution was add to a tube of protein standard (20 mg BSA) , to prepare 25 mg/ml of BSA standard solution after being fully dissolved. 920 ⁇ l PBS were added to 80 ⁇ l of 25 mg/ml BSA standard solution to prepare 2 mg/ml BSA standard.
  • BCA working solution Preparation of BCA working solution: according to the number of samples, an appropriate amount of BCA working solution were prepared based on 50 volumes of BCA reagent A plus 1 volume of BCA reagent B (50: 1) , and mixed well.
  • the BSA standard was diluted to make a standard curve, with the system as follows (Table 14) :
  • each cell lysate containing 45 ⁇ g protein was pipetted into a 0.5 ml centrifuge tube, with addition of 3 ⁇ l 5 ⁇ SDS sample buffer, and each protein sample was adjusted to the final volume of 15 ⁇ l by H 2 O; the medium supernatant sample was prepared according to the corresponding cell lysate volume, and the protein was denatured by boiling in boiling water for 5 minutes before loading (to obtain the protein containing the encoded antigen) .
  • the precast gel was took out, and the electrophoresis device was assembled, with addition of the electrophoresis buffer, and loading the sample. 15 ⁇ l 1 ⁇ SDS loading buffer were added to the wells without protein sample.
  • Electrophoresis was performed at a constant voltage of 80 V for 30 minutes, then the voltage was adjusted to 100 V for electrophoresis for 40 minutes. After the electrophoresis, the gel plate was washed with H2O, from which the gel was carefully removed.
  • Transfer membrane the PVDF membrane was activated in methanol, and the membrane, sponge and filter paper were immersed in the pre-cooled transfer membrane solution.
  • the black transfer film clip on top of which were sponge, two layers of filter paper, glue, PVDF membrane, two layers of filter paper, sponge in turn, was put down into the transfer liquid, without bubbles in each step.
  • the transfer clip was closed and put into the transfer tank, so that the black side of the clip faced the black side of the tank, while the white clip faced the red side of the tank, and then the ice box was put into the transfer tank, followed by pouring the electro-transfer fluid and inserting the electrode.
  • transfer membrane was performed at constant voltage of 100 V for 90 minutes; for nCoV-2/3/5/6/7 with smaller molecular weight, transfer membrane was performed at constant voltage of 100 V for 60 minute. After completion, the PVDF membrane was took out with the directional marking of the membrane, which was placd in the Western blot antibody incubation box.
  • Blocking the membrane was placed in the blocking solution that was 10%skimmed milk powder solution prepared with 1 ⁇ TBST, and was blocked on a shaker at room temperature for 1 hour.
  • HRP His-Tag
  • Chemiluminescence, development, fixation according to the chemiluminescence detection, the film was incubated with the chemiluminescence substrate, exposed and developed by X film, which was scanned.
  • nCoV-2/4/5/7 protein molecular weight was substantially identical as expected.
  • the molecular weight of nCoV-1/6/8/9 protein was slightly larger than expected, which might be due to the highly glycosylated modification of S protein in vivo.
  • nCoV-3 there was a small molecular weight band below the expected band for nCoV-3, which might be due to shearing in vivo.
  • there was a diffusion band at high molecular weight suggesting that there might be a multimeric form in vivo.
  • Transcription was carried out by using the DNA in the cell as a template based on the principle of base complementary pairing, to produce a single-stranded mRNA having the sequence complementary to the non-coding strand of DNA but identical with the coding strand as a direct template for protein biosynthesis; translation was to interpret the genetic information contained in the nucleotide sequence of mRNA and generate the amino acid sequence of the protein, according to the triplet code rule for determining an amino acid for every three nucleotides, to synthesize protein peptide chains with specific amino acid sequences starting with the start codon at the 5'-terminal of the mRNA in the 5' ⁇ 3' direction.
  • the transcribed mRNA in vitro was delivered to the antigen presenting cell (dendritic cell) through the delivery system, so that the dendritic cell directly expressed the antigen efficiently, through MHC I or MHC class II molecules stimulation and antigen-specific T cells activation, thereby activating B cells and T cells to produce antigen-specific immune response in the body. Therefore, the correct expression of the target protein by mRNA was the first prerequisite for mRNA vaccine to function.
  • mature mRNA directly used as a translation template must have one or several of the following structural features: (1) A protein coding sequence containing a start codon and a stop codon, with continuity between the codons, Without any nucleotide separation; (2) There are untranslated regions (UTR) at both ends of the coding sequence, and the 5'-end UTR is located from the methylated guanine nucleotide cap at the beginning of the mRNA to the start codon The sub-AUG, 3'UTR extends from the stop codon at the end of the coding region to the front end of the poly-A tail (Poly-A) , which is very important for translation efficiency and mRNA stability; (3) 5'-terminal cap structure, which is a The methylated guanine nucleotide (m7GpppNp) that binds to the 5'-terminal of the mRNA through a unique 5'-5' binding method helps the ribosome to recognize the mRNA during
  • UTR sequences had also been screened, and these sequences had different effects on the expression of the same ORF region. Meanwhile, the present invention had also improved UTR sequences, thereby improving the stable mRNA system.
  • a person skilled in the present invention could understand that the UTR sequence not only had an effect on the COVID-19 mRNA, but also had a similar effect on other non-mRNA sequences.
  • the 5'UTR and 3'UTR sequences used were identical, so that the nucleic acid could be expressed in the cell, indicating that these selected genes were likely to produce antigens in the body, thereby causing the subject to produce antibodies.
  • this experiment used LipofectamineMessengerMAX transfection to make the mRNA into HEK293 cells for expression. After 24 hours of transfection, the foreign protein expression level reached the peak, and the culture supernatant and cell lysate were collected at the same time, followed by detecting the expression of the target antigen using Western blot technology.
  • HEK-293 cells rarely expressing endogenous receptors required for extracellular ligands and easy to transfection, were a very commonly cell line used for expressing and studying foreign genes. Therefore, HEK-293 cells could be selected as host cells, to ensure smooth entry of mRNA into cells.
  • CAU histidine codons
  • the ELISA method was used to detect the antigen-specific antibody titers in the mice, and the best vaccine agents were screened by comparing the antibody titers.
  • the drug product was directly provided by the preparation department of Siwei (Shanghai) Biotechnology Co., Ltd., and adjusted according to the prescribed concentration. It was carried to Shanghai Southern Model Biology Research Center at 2-8°C and delivered to the barrier for administration.
  • Table 15 Concentrations and doses of various administrations and injection routes.
  • sequence numbered 1-9 corresponded to the sequence of mRNA1-9 in Table 8 above, wherein 2019-nCoV-1-9 corresponded to the sequences in SEQ NO: 1.1-1.9.
  • PbAE refers to protamine sulfate, sigma
  • DOPE adjuvanti
  • M5 Wildi AppTec
  • DSPE-mPEG2000 lipoid
  • mRNA as shown in Table 8
  • PbAE solution an appropriate amount of PbAE was dissolved in an appropriate amount of aqueous solution to prepare 1 mg/ml PbAE solution;
  • mRNA solution the appropriate solution was diluted to 1mg/ml
  • PbAE phase an appropriate amount of PbAE solution was diluted to 0.60 mg/ml with purified water;
  • mRNA phase an appropriate amount of mRNA solution was diluted to 0.20 mg/ml with purified water;
  • the prepared LPP lipid nanoparticles were diluted with a PBS solution, followed with purification with an ultrafiltration centrifuge tube under centrifugation to obtain a purified lipid nanoparticle solution.
  • Blocking solution 10%adult bovine serum (Sijiqing) + PBS; sample dilution: 10%adult bovine serum + 0.05%Tween-20 + PBS; color developing solution: 3, 3', 5, 5'-tetramethyl Benzidine TMB (Thermo) ; stop solution: 2N H2SO4; secondary antibody: anti-mouse IgG-HRP (Abcam) ; coating antigen (antigen corresponding to the antibody) :
  • the route of administration was intramuscular injection, similar to the route proposed for the clinical trial.
  • the administration volume was 100 ⁇ l/mouse, and 50 ⁇ l of the drug was injected into the thigh muscles of the left and right hind limbs of each mouse.
  • blood was collected for antibody titer detection.
  • mice During the experiment, the animal room management staff would assist in checking and observing the state of the mice according to the experiment regulations.
  • the experimenters regularly observed the state of the mice, including but not limited to: behavioral activities, food and water intake, changes in body weight (measured 3 times a week) , physical signs or other abnormalities.
  • the number of animal deaths and side effects in each group were recorded based on the number of animals in each group.
  • the abnormal conditions of mice include but were not limited to: significant weight loss, weight loss of more than 20%; inability to eat and drink freely; and the following clinical manifestations of the animal with continuous deterioration: piloerection; arched back; pale ears, nose, eyes or feet; shortness of breath; convulsion; continuous diarrhea; dehydration; slow movement; vocalization.
  • Antigen coating was performed according to the antigens corresponding to different vaccines in Table 15. See Table 16 for the list of antigens. The antigen was diluted with PBS and coated at a concentration of 5 ⁇ g/ml, with addition of 50 ⁇ l to each well of a 96-well plate and incubation for 12 hours at 4°C in an air bath.
  • Blocking was used to block 96-well plates, with addition of 200 ⁇ l to each well and incubation for 2 hours at 27°C in an air bath. After blocking the plate, 200 ⁇ l cleaning solution were added to each well for cleaning, and washed three times.
  • Sample dilution the sample was diluted with the sample diluent according to equal volume of serum dilution gradient (200/600/1800/5400/16200/48600/145800/437400) . Each sample was tested in repeated wells, with additon of 50 ⁇ l sample to each well and incubation at 27°C for 2 hours in an air bath.
  • Secondary antibody incubation HRP-labeled goat anti-mouse IgG secondary antibody: the secondary antibody was diluted with the sample diluent at a dilution of 1: 100,000, with addition of 50 ⁇ l to each well and incubation at 27°C for 1 hour.
  • Termination 50 ⁇ l termination solution were added to each well for termination, followed by testing on the machine.
  • Microplate reader dual-wavelength detection indicator the OD value was red under 450 nm wavelength and 610 nm wavelength.
  • vaccine No. 1 (SEQ NO: 1) , SEQ NO: 1-1) (named COVID-19-LPP-mRNA) could stimulate the body to produce a higher level of antigen-specific antibodies in a short time. In order to determine the vaccine No. 1 (named COVID-19-LPP-mRNA) for subsequent process development and clinical research.
  • the COVID-19 mRNA vaccine was administered intramuscularly to immunize mice. During the experiment, except for one accidental death in the 2019-nCoV-2 test group, no animals were in moribund or dead. Daily observation of mice did not find obvious abnormalities in posture and behavior. After 1-2 days of administration, the weight of the mice in the test group decreased slightly, but they were all within the acceptable range, and their body weights recovered after 1-2 days.
  • the immunogenicity of different mRNA vaccines was evaluated by detecting the antibody titers in the serum of mice, and then the mRNA vaccines with strong immunogenicity and effective activation of antigen-specific immune response in the body were screened out.
  • the antibody titer of the mice in the nCoV-1 vaccine administration group was the highest, the mice in the nCoV-2/5/9 vaccine administration group had almost no antigen-specific antibodies, and the nCoV-4/8 vaccine could activate the body to produce antigen-specific antibodies with low antibody titer. It could be seen that the nCoV-1 coronavirus mRNA vaccine could effectively activate the body's humoral immune response, including the formation of germinal center B cells, antibody type conversion, and high-affinity antibody maturation.
  • vaccines No. 2, No. 4, No. 5, No. 8 and No. 9 could not well activate the body's humoral immune response, and the antigen-specific antibody titer was low and could not reach the ideal standard.
  • Vaccines No. 3, No. 6, and No. 7 could not be tested for vaccine immunogenicity due to antigen synthesis, and their data was not shown in the antibody titer test. However, after testing, these three vaccines also produced antibodies with not high titer, but higher than the control, indicating antibodies production causing the body's immunity.
  • agent No. 1 had a good effect
  • agents No. 4 or No. 8 had antibody production.
  • mice were injected intramuscularly with different concentrations of COVID-19-LPP-mRNA twice, once on day 10 and once on the day 7, to observe the weight change of the mice, and on day 10 after the second immunization, blood was collected and centrifuged to obtain serum; spleen tissue was taken on day 14 after the second immunization, with treatment on spleen cells.
  • Table 17 Name: COVID-19-LPP-mRNA concentration dilution table
  • mice/strains C57BL/6 mice; grade: SPF grade; female: 30; weight: about 18-20 g; age: 8-9 weeks.
  • the mouse ears were identified by a puncher.
  • the upper, middle, and lower left ears represented No. 1/2/3, respectively, and the upper, middle and lower right ears represented No. 4/5/6, respectively.
  • mice were housed in IVC cages, no more than five in each cage. During the housing period, the environmental parameters of the animal house (411) were recorded. All feed and drinking water were purchased and provided by the Shanghai Southern Model Biology Research Center. The SPF-grade mouse feed sterilized by 60 Co irradiation was provided by Jiangsu Synergy Pharmaceutical and Biological Co., Ltd. Each batch of feed was provided with a quality inspection report containing indicators such as nutrition, pesticides and microorganisms. The deionized water, feeding container and padding were autoclaved into the barrier and replaced twice a week.
  • Administration administration on day 0 and day 7 respectively (the day of the first administration was recorded as day 0) .
  • the dose was 100 ⁇ l/mouse, and 50 ⁇ l of the drug was injected into the thigh muscles of the left and right hind limbs of each mouse.
  • mice management staff of the Nanmo Animal House would assist in checking the status of the mice and observing the status of the mice as required.
  • the experimenters regularly observed the state of the mice as required, including but not limited to: behavioral activities, food and water intake, changes in body weight (measured 3 times a week) , physical signs or other abnormalities.
  • the number of animal deaths and side effects in each group were recorded based on the number of animals in each group.
  • mice include but were not limited to: significant weight loss, weight loss of more than 20%; inability to eat and drink freely; and the following clinical manifestations of the animal with continuous deterioration: piloerection; arched back; pale ears, nose, eyes or feet; shortness of breath; convulsion; continuous diarrhea; dehydration; slow movement; vocalization.
  • Blood collection preparation and blood sample processing after the day 10 of the second immunization, we would collect blood from all mice in the test. Blood would be collected from the veins of the orbital plexus, and about 500 uL of blood would be collected from each mouse. After the collected whole blood was allowed to stand at room temperature for 2 hours, it was centrifuged at 8000 rpm for 10 minutes, and the serum was collected and stored at -20°C.
  • mice after day 14 of the second immunization, the mice were euthanized to dissect the spleen to prepare a spleen single cell suspension.
  • COVID-19 mRNA vaccine (COVID-19-LPP-mRNA) was evaluated for the level of inducing mice to produce specific binding antibodies and neutralizing antibodies by using indirect ELISA, SARS-CoV-2 pseudovirus neutralization method, live virus plaque detection method.
  • Test product information name: mRNA vaccine COVID-19-LPP-mRNA (No. 1 vaccine screened out in Example 3) ; specification: 0.5 mg/ml; traits: milky white liquid; expiration date: stored at 2-8°C for 28 days
  • mice SPF-grade inbred mice; quantity: 18 BALB/C mice; 30 C57BL/6 mice (albino laboratory mice, like many commonly used sub-lines, originated in Xiaojia Mouse (Musmusculus) . Since their birth in New York in 1920, BALB/c mice had bred more than 200 generations in research institutions around the world, and were widely used in immunology and physiology animal experiments) ; gender: female; age: 6-8 weeks.
  • SARS-CoV-2 2019-nCoV Spike Protein (S1+S2 ECD, His tag)
  • S1+S2 ECD Spike Protein
  • His tag the full name of S1+S2 ECD was called S1+S2 extracellular domain, which was the extracellular domain of S protein, the full-length molecular weight of S protein was 141.20 kDa, and the molecular weight of S1+S2 ECD protein was 134.36 kDa
  • SARS-CoV-2 2019-nCoV Spike Protein
  • His tag the full name of S1+S2 ECD was called S1+S2 extracellular domain, which was the extracellular domain of S protein, the full-length molecular weight of S protein was 141.20 kDa, and the molecular weight of S1+S2 ECD protein was 134.36 kDa
  • EIA/RIA 96-well plate 0.05M pH9.6 carbonate buffer (coating solution) ; 0.5 ⁇ Tween-20 PBS (PBST washing solution) ; 10%goat serum PBS (blocking solution) ; 2%goat serum PBST (Antibody dilution) ; HRP-labeled goat anti-mouse IgG secondary antibody; single-component TMB color developing solution; 2M H2SO4 solution (stop solution) ; cell culture flask; 96-well cell culture plate; 12-well cell culture plate (Corning ) ; DMEM medium (Hyclone) ; Fetal Bovine Serum (Gibco; GEMINI) ; Penicillin Streptomycin Mix (Gibco) ; Avicel RC-581 (FMC Biopolymer) ; Crystal Violet (Solabol) ; Bright-Glo Fluorescein Enzyme detection reagent (Promega)
  • SARS-CoV-2 virus SARS-CoV-2 (C-Tan-nCoV-HB-01 strain, GISAID accession no. EPI_ISL_402119)
  • SARS-CoV-2 pseudovirus the HIV-1 core SARS-CoV-2 pseudovirus (that was, the virus containing the antigen of HIV-1 instead of the new coronavirus) was prepared by our laboratory.
  • SARS-CoV-2 Spike antigen protein was diluted to concentraion of 0.5 ⁇ g/mL with coating solution, with addition of 100 ⁇ L to EIA/RIA 96-well plate, and was coated by antigen overnight at 4°C.
  • Blocking detection plate the coated EIA plate was washed 3 times with washing solution, with addition of 250 ⁇ L of 10%goat serum PBS blocking solution to each well, and the plate was blocked at 37°C for 2 h.
  • Serum sample dilution the serum was diluted with the antibody diluent. Samples was diluted from 1: 100 or 1: 300, with 2 or 3 times ratio dilution, 9 dilutions in total. The specific dilution ratios were shown as the value of the X axis in FIG. 7, FIG. 9, FIG. 10, and FIG. 12.
  • Serum antibody adsorption the blocked test plate was washed 3 times with washing solution, with addition of 100 ⁇ L of diluted serum sample to each well, and incubated at 37°C for 1h, with a blank control with addition of only antibody diluent
  • the detection plate was washed 5 times with washing solution, with addition of 100 ⁇ L of 1: 10000 diluted HRP-labeled goat anti-mouse IgG secondary antibody to each well, with incubation for 1 h at room temperature.
  • test plate was washed 5 times with washing solution, with addition of 100 ⁇ L single-component TMB color development solution to each well, to develop color at room temperature for about 5 min with addition of 50 ⁇ L stop solution.
  • Absorbance detection and titer determination the 450 wavelength absorption peak (630 determination was used as a reference value, only for stability determination) was determined by a microplate reader, and the OD450 of the blank well of the test plate was used as the base value, and the 2.1 times of the blank well was judged as positive. The highest dilution factor at which a sample was judged to be positive was the sample binding antibody titer.
  • Huh7.5 cells were passaged, inoculated into 96-well plates at a rate of 1 ⁇ 10 5 cells/mL, and cultured in a CO2 incubator until to 60%-80%confluent of the cells.
  • Serum dilution and virus premixing serum samples were diluted with DMEM medium to 50 ⁇ L starting from 1: 25 at 2 times ratio with 9 dilutions, and mixed with the same volume of pseudovirus, with incubation together at 37°C for 1 h (the specific dilution ratio shown as the X-axis value in FIG. 7, FIG. 9, FIG. 10, FIG. 12) .
  • Virus infection the cell supernatant prepared the day before was removed, with addition of the serum-virus mixture, and cultured overnight in the incubator, followed by changing the medium to 2%FBS DMEM the next day to continue culturing for 48 h.
  • Neutralization detection the expression of Fluc was detected in cells by Bright-Glo Luciferase Assay System, which was recorded as relative light unit (RLU) .
  • Vero cells were passaged one day before infection, 1 mL from which was inoculated into a 12-well plate at the amount of 1 ⁇ 10 4 cells/100 ⁇ L, with placement in a CO 2 incubator to culture until to 80%-90%confluent of the cells..
  • Serum dilution the tested serum was inactivated at 56°C for 30 minutes, which was diluted with serum-free DMEM under aseptic conditions with 3 dilutions by 4-fold dilution.
  • washing cells the next day before entering the P3 laboratory, the cell culture medium was discarded, with addition of 500 ⁇ L/well of 2%FBS-DMEM maintenance medium, which was carried into the P3 laboratory by the operator.
  • Virus preparation the viruses were took out of the refrigerator at -70°C, thawed in a P3 biological safety cabinet and diluted with serum-free DMEM medium.
  • Serum/antibody and virus neutralization each dilution of serum/antibody was diluted with an equal volume of viruses, with incubation at 37°C in a 5%CO 2 incubator for 1 h.
  • the infection solution was pipetted and discarded, with addition of 1mL Avicel-2%FBS-DMEM medium to each well, and incubation in at 37°C in a 5%CO 2 incubator for 72 h.
  • the serum samples of vaccine-immunized mice were diluted from 1: 300, at 3 times ratio to 1: 656100, with a total of 8 dilutions.
  • the mouse serum samples of the control group were diluted from 1: 100, at 3 times ratio to 1: 2700, with a total of 4 dilutions (FIG. 6 -FIG. 7) .
  • the serum antibody titers in BALB/c &C57BL/6 mice shown in FIG. 8: the two strains of mice after the vaccine immunization could produce antibodies against COVID-19 S protein. After the high dose second immune boost, the two strains of mice produced specific IgG titers exceeding 1: 10 5 , wherein the antibody titer produced by BALB/c mice was 1: 310,000 on average; the antibody titer produced by C57BL/6 mice was 1: 180,000 on average.
  • low dose second immunization could also induce specific antibodies with a titer close to 10 4 ; in C57BL/6 micehigh dose single immunization and low dose second immunization could induce similar antibody levels, both exceeding 10 3 .
  • Specific humoral immune response could be activated after vaccine immunization, showing the vaccine with good immunogenicity.
  • mice immunized with the high dose double-injection vaccine were diluted from 1: 100 at 2 times ratio to 1: 25600, with a total of 9 dilutions; the serum samples of the mice immunized with the high dose single-dose and low dose double-dose vaccines were diluted from 1: 50 at 2 times ratio to 1: 12800, with a total of 9 dilutions.
  • the serum samples of mice immunized with low dose single-injection vaccine were diluted from 1: 25 at 2 times ratio to 1: 6400, with a total of 9 dilutions; the serum samples of control mice were diluted from 1: 25 at 2 times ratio to 1: 800, with a total of 4 dilutions.
  • mice The results of neutralizing antibodies in BALB/c mice were shown in Table 4-3 and FIG. 9, and the results of C57BL/6 mice were shown in Table 4-4 and FIG. 10. Except for the low dose single-injection immunization, other immunization groups all induced a certain level of neutralizing antibodies, and the high dose double-injection immunizations of both mice induced higher titers of neutralizing antibodies.
  • the titers of neutralizing antibody for pseudovirus detection in the serum of BALB/c &C57BL/6 mice shown in FIG. 11 the two strains of mice after the vaccine immunization could produce neutralizing antibodies against COVID-19. After the high dose second immune boost, the two strains of mice produced neutralizing antibodies with a titer of more than 1: 10 4 , wherein the neutralizing antibody titer produced by BALB/c mice was 1: 13,000 on average; the antibody titer produced by C57BL/6 mice was 1: 25,000 on average.
  • the samples were all diluted at 1: 50, 1: 200, 1: 800 with 3 dilutions, used for virus serum mixing.
  • the results of neutralizing antibodies in BALB/c mice were shown in Table 4-5 and FIG. 12, and the results of C57BL/6 mice were shown in Table 4-6 and FIG. 13.
  • high titers of neutralizing antibodies were induced to inhibit the infection of SARS-CoV-2 live virus.
  • the results of the live virus plaque reduction test showed that the two strains of high dose two-injection mice produced neutralizing antibodies with titers close to or more than 1: 10 4 , wherein the antibody titer produced by BALB/c mice was 1: 9,800 on average; the antibody titer produced by C57BL/6 mice was 1: 12,000 on average.
  • the neutralizing antibody titers of most serum samples in the low dose and high dose single-injection immunization groups were not enough to reach half the effective concentration at the test dilution, but the test results showed that the virus infection could be partially inhibited at the low dilution, with significant difference compared with the control group.
  • SW0123 vaccine could effectively induce specific humoral immune responses in BALB/c and C57BL/6 mice, and antigen-specific IgG had good neutralizing activity; high dose double-injection immunization could induce potently active antibodies in animals.
  • mice with COVID-LPP-mRNA after immunizing mice with COVID-LPP-mRNA, the levels of cellular immune response in mice were detected by the ELISPOT method.
  • Test product information name: mRNA vaccine COVID-19-LPP-mRNA;
  • Weeks of age 8-9 weeks.
  • mice were housed in IVC cages, no more than five in each cage. During the housing period, the environmental parameters of the animal house (411) were recorded. All feed and drinking water were purchased and provided by the Shanghai Southern Model Biology Research Center. The SPF-grade mouse feed sterilized by 60Co irradiation was provided by Jiangsu Synergy Pharmaceutical and Biological Co., Ltd. Each batch of feed was provided with a quality inspection report containing indicators such as nutrition, pesticides and microorganisms. The deionized water, feeding container and padding were autoclaved into the barrier and replaced twice a week.
  • mice were injected intramuscularly with different concentrations of mRNA vaccine for COVID-19 twice, once on day 0 and on day 7, and spleen cells were prepared on day 14 after the second immunization.
  • the spleen was ground to prepare the splenic single cell suspension, with addition of 5 ml of red blood cell lysis solution to each sample spleen cell for red blood cell lysis.
  • the cells were centrifuged at 1500 rpm for 5 min, the supernatant was discarded, and 5 ml medium was added to resuspend the cells for counting.
  • the concentration of the counted cells was ajusted to 3*10E6 cells/ml.
  • the cell suspension was added to the detection plate, with 100 ⁇ l of cell suspension (300,000 cells) to each well.
  • the corresponding antigen polypeptide (20 ⁇ g/ml) solution was prepared to resuspend the cells with culture medium, with PMA-Ionomycin as a positive control, OVA (20 ⁇ g/ml) as a negative control, and a cell suspension without any stimulus as a blank control. 100 ⁇ l antigen diluent (concentration: 10 ⁇ g/ml) were added to each well to stimulate cells for 24 hours.
  • the anti-mouse IFN- ⁇ antibody was diluted to 1 ⁇ g/ml, with addition of 100 ⁇ l to each well for incubation at 27°C in an air bath for 2 hours.
  • the secondary antibody was added and diluted at a dilution of 1: 1000, with addition of 100 ⁇ l to each well for incubation at 27°C in an air bath for 1 hour.
  • Color development 100 ⁇ l color developer were added to each well for color development.
  • the vaccine was phagocytized by the antigen-presenting cells.
  • the mRNA escaped through the lysosome and was released into the cytoplasm and binded with the ribosome to translate into an antigen protein.
  • most of the antigen proteins were degraded into antigen polypeptides through the proteasome and lysosome degradation pathways, and a small part of the undegraded proteins were expressed on the cell surface.
  • the degraded antigen polypeptides were binded to MHC-I molecules and MHC-II molecules in the cells and presented to the cell surface. By binding to TCR molecules on the surface of different subgroups of T cells, the activation of different T cells was stimulated.
  • the activated antigen-presenting cells stimulated the body to produce antigen-specific CTL immune responses through the interaction of MHC-I molecules with the surface TCR of CD8 T cells through the interaction of MHC-II molecules with CD4 T cell surface TCR.
  • Different CD4 T cells displayed different functions, on the one hand, they could mutually promote and maintain CTL immune response with CD8 T cells, and on the other hand, follicular helper T cells could promote interaction with germinal center B cells to promote the secretion of antigen-specific and high-affinity antibodies by B cells.
  • the antigens expressed partially on the surface of antigen presenting cells activated B cells by binding to BCR on the surface of B cells.
  • the activated B cells gradually differentiated and developed into germinal center B cells.
  • germinal center B cells Under the interaction with follicular helper T cells activated by the same antigen, germinal center B cells underwent somatic high frequency mutation, antibody type conversion, and high affinity antibody maturation, etc.
  • memory B cells and plasma cells were formed.
  • the antigen-specific IgG type antibody in the mouse serum was at a high level, while the antigen-specific IgM antibody was at a low level.
  • IgM type antibodies Under the interaction of B cells and T cells, and the action of different cytokines on germinal center B cells, IgM type antibodies gradually switched to different types of antibodies as time.
  • the titers of IgM antibodies in the body were at a low level, mainly IgG type antibodies.
  • the IgG1 type antibodies in the mouse serum were at a relatively high level, slightly lower than the total IgG antibodies.
  • the results of this experiment showed that the IgG type antibodies in mice were mainly IgG1 antibodies.
  • IL-4 binded to the IL-4 receptor on the surface of B cells, and activated the signaling pathway related to the conversion of IgG1 type antibodies in the downstream of B cells, thereby promoting the conversion of IgM type antibodies to IgG1 type antibodies in the body. Therefore, it could be known that the antigen-specific antibodies produced by the COVID-19 mRNA vaccine activated by the body were mainly of the IgG1 type, and the IgG1 type antibody had a potent role in resisting viral infection.
  • the secretion of IgM type antibodies presented a significant dose-effect relationship.
  • the antibody titer gradually decreased.
  • Total IgG and IgG1 antibodies did not show a significant dose-effect relationship, but the difference in antibody titers between the high dose group and the low dose group could also be seen.
  • the antibody titer of the 30 ⁇ g administration group was the highest, and the antibody titer of the 1 ⁇ g administration group was the lowest, and there was no significant difference between the 7.5 ⁇ g and 15 ⁇ g groups.
  • the immune response of antigen-specific T cells in mice was significantly increased after vaccine immunization, and showed a dose-effect relationship.
  • This result indicated that the vaccine was phagocytized by antigen-presenting cells after entering into the body, and CD4 and CD8 T cells were activated in the body by a series of immune responses to differentiate into effector T cells and memory T cells. Restimulation of spleen cells with the same antigen in vitro could quickly activate antigen-specific effector T cells and memory T cells and secreted corresponding cytokines (such as IFN- ⁇ ) (FIG. 16A) .
  • cytokines such as IFN- ⁇
  • the intensity of T cell immune response gradually decreased as the dose decreases, showing a dose-effect relationship.
  • the vaccine could activate the antigen-specific T cell immune response in the body.
  • the COVID-19-LPP-mRNA vaccine could activate the body fluid and cellular immune response, stimulate the body to produce higher titers of antigen-specific IgM, IgG and IgG1 type antibodies and more potent antigen-specific T cell immune response. Therefore, it could be considered that the COVID-19-LPP-mRNA vaccine had superior immunogenicity and immunoreactivity.
  • C57BL/6 mice were injected intramuscularly with different concentrations of COVID-19-LPP-mRNA twice, once on day 0 and once on day 7. Blood was collected on day 10 after the second immunization, and serum was obtained by centrifugation. For specific steps, see "COVID-19-LPP-mRNA immunized C57BL/6 mice" report. In this experiment, three dose groups of 30 ⁇ g, 7.5 ⁇ g, and 1 ⁇ g were selected for neutralizing antibody detection.
  • Test reagents Huh-7 cell (from the National Inspection Institute) ; pseudovirus (from the National Inspection Institute) DMEM complete medium (Gibco) : 1%double antibody (Gibco) , 10%FBS (Hyclone) Luciferase detection kit (PerkinElmer) PBS (Solebold) ; 0.25%pancreatin (Gibco)
  • Test consumables T75 cell culture flask (Thermo) ; 96-well white cell culture plate (Corning) ; 15/50 ml centrifuge tube (Corning) ; 3.3 Test equipment; inverted microscope (Leica) ; CO 2 incubator (Panasonic)
  • Serum sample dilution the serum sample was diluted with the complete medium at20X, 60X, 180X, 540X, 1620X, 4860X.
  • the viruses were diluted to 2*10 4 TCID 50 /ml using the complete medium.
  • test group 100 ⁇ l diluted serum and 50 ⁇ l virus dilution were added to each well; in the blank control group, 150 ⁇ l complete medium were added; in the virus control group, 100 ⁇ l complete medium and 50 ⁇ l virus dilution were added.
  • Huh-7 cells were digested with trypsin for 1 minute, neutralized with complete medium, centrifuged at 210 g for 5 minutes, resuspended in complete medium, counted, with the cell concentration ajustedto 2*10 5 cells/ml.
  • the cells were added to a 96-well luminescent plate with 100 ⁇ l per well at 37°C, 5%CO 2 , and incubated for 20-28 hours.
  • the cell supernatant was pipetted and washed again with PBS. After washing, 100 ⁇ l PBS were added to each well.
  • A Inhibition rate of the proportional wells with a fluorescence value higher than 50%
  • B Inhibition rate of the proportional wells with a fluorescence value below 50%
  • X the dilution ratio of the fluorescence value below 50%
  • K Serial dilution ratio.
  • mice were immunized with the COVID-19-LPP-mRNA vaccine on day 10 after their blood was taken, and the level of neutralizing antibodies in the serum was detected by pseudovirus.
  • the results showed that the mouse serum produced a higher level of neutralizing antibodies after the second immunization, which could effectively neutralize the pseudovirus constructed by the SARS-CoV-2 S protein, and had a strong inhibitory effect on the pseudovirus-infected cells with a dose-effect relationship.
  • the half-inhibitory dilution ID 50 of neutralizing antibody in mouse serum was lower than 20; in the middle-dose group (7.5 ⁇ g/mouse) , except for one mouse whose serum ID 50 was lower than 20, the remaining mice had an average serum ID 50 The value is 990; the average serum ID 50 of mice in the high dose group (30 ⁇ g/mouse) is 2918.
  • Neutralizing antibody was an important indicator to measure the protective effect of vaccines, and it was also an important basis for vaccine evaluation and quality control.
  • the use of live viruses for neutralizing antibody detection in vitro required high laboratory levels and needed to be carried out in a third-level biosafety laboratory, which brought great difficulties to research. Therefore, researchers could also use the pseudovirus system for neutralizing antibody detection.
  • Pseudovirus-infected cells referred to susceptible cells infected by pseudoviruses constructed with the spike protein (S protein) of the target virus to simulate the process of virus infection and replication, which usually introduced a highly sensitive and easy to detect reporter gene such as Luciferase to optimize the detection system.
  • a pseudovirus containing the spike protein (S) of the SARS-CoV-2 virus and the Luciferase reporter gene was used to detect the serum neutralizing antibody titers of the immunized mice.
  • the basic principle of the Luciferase reporter pseudovirus detection system was as follows: the susceptible cells (Huh-7 cells) were infected with the pseudovirus to translate luciferase, which catalyzed the oxidative decarboxylation of luciferin (D-luciferin) with the participation of Mg 2+ , ATP, and O 2 , to produce activated oxyluciferin and emit photons to produce fluorescence at 550-580 nm. The fluorescence intensity was detected by a microplate reader, and the obtained detection value could reflect the infection efficiency of the pseudovirus on the cells.
  • mice was immunized with COVID-19-LPP-mRNA vaccine encoding the SARS-CoV-2 virus S protein antigen.
  • the mice would produce neutralizing antibodies against the SARS-CoV-2 virus S protein.
  • the neutralizing antibody in the serum could bind to the S protein on the pseudovirus particle to prevent the S protein from binding to the receptor ACE2, thereby blocking the pseudovirus from entering the host cell and reducing the expression of luciferase.
  • COVID-19-LPP-mRNA vaccine could stimulate the body to produce high levels of neutralizing antibodies and prevent the pseudovirus from infecting cells, suggesting that the COVID-19-LPP-mRNA vaccine had a better preventive effect on SARS-CoV-2 virus infection. And by analyzing the neutralizing antibody levels of mice in three different dose groups, it was found that COVID-19-LPP-mRNA had a significant dose-effect relationship, which provided reference for subsequent challenge trials and clinical applications.
  • Weight record form lung weight record sheet. 200 ⁇ l pipette tip with filter element, 2 boxes; 1 ml pipette tip with filter element 1 box.
  • Grinder high-speed centrifuge in the core area; 1 ml syringe; dissecting board-foam; 3 sets of sterile scissors and forceps;
  • mice Grouping of mice and immunization methods
  • the vaccine was diluted with PBS to reach the specified concentration, it was injected intramuscularly through the thigh with an injection volume of 30 ⁇ l per side and injected bilaterally.
  • mice were lightly anesthetized 45 ⁇ l of DMEM culture medium containing 2.5 ⁇ 10 8 pfu Ad5-hACE2 was transfected into the respiratory system of the mice by nasal drops. The mice were then transferred to the ABSL3 Biosafety Laboratory, kept for 5 days and prepared for SARS-CoV-2 infection experiments.
  • mice were infected intranasally with 50 ⁇ l of the virus containing 5 ⁇ 10 5 TCID 50 dose after deep anesthetization.
  • mice were observed and their body weights were recorded every day for 3 consecutive days
  • ⁇ 1XPBS buffer 1000 ml, ready for use after high pressure: dividing 500 ml, addition of double antibody PS (10000U) (5ml+500ml) according to the ratio of 1: 100.
  • Dissecting instruments 2 sets, each set included: elbow forceps, tooth forceps, small scissors, flat-tip forceps, elbow scissors, 2 surgical forceps, ready for use after high pressure.
  • mice were sprayed with 75%ethanol on the whole body, fixed with the abdomen facing up, and dissected in a biological safety cabinet.
  • the abdominal skin was picked up by an elbow tweezer in the left hand, and the subcutaneous tissue and muscles were cut by a scissor in your right hand with forward to the neck; the skin was turned towards both sides to expose the chest, the ribs on both sides were each cut once by another sterile scissor, and the sternum and ribs were turned up, and then the entire lung was lift out by inserting elbow ophthalmic tweezers from the lung and trachea junction.
  • Lung tissue homogenization the lung tissue was took out from -70°C refrigerator and homogenized after thawing.
  • TCID 50 titer of lung tissue homogenate (2020.5.12-5.15) : 100 ⁇ l of the supernatant were pipetted and diluted 10 times from 10 -1 , with a total of 4 dilutions (10 -1 , 10 -2 , 10 -3 , 10 -4 ) , 100 ⁇ l from which was used to infect the Vero cells prepared in advance, with 8 replicate wells for each dilution, followed by observation to determine the TCID 50 after 72 ⁇ 96 h.
  • reaction system 12.5 ⁇ L 2 ⁇ One Step SYBR RT-PCR Buffer III, 0.5 ⁇ L Takara Ex Taq HS, 0.5 ⁇ LPrimeScript RT Enzyme Mix II, 1 ⁇ L upstream primer, 1 ⁇ L downstream primer, 1 ⁇ L probe, 5 ⁇ L RNA template, to 25 ⁇ L with sterile double distilled water.
  • the reaction parameters were: 42°C for 5 min, 95°C for 10 s, a cycle; 95°C for 10s, 60°C for 30 s, 40 cycles, and fluorescence signals were collected after extension.
  • mice see Table 6-1 for the raw data of daily mouse weight. The weight of the mouse on the first day was taken as the initial weight, and the trend of daily weight change of the mouse was analyzed.
  • the results of Balb/C mice were shown in Table 6-1 and FIG. 18. Balb/C mice were infected with COVID-19 on day 5 after transduction of Ad-hACE2, and were observed for 4 consecutive days. They were in good condition and showed no significant weight loss.
  • the results of C57 mice were shown in Table 6-2 and FIG. 19. C57 mice were infected with COVID-19 on day 5 after transduction of Ad-hACE2, and were observed for 4 consecutive days. They were in good condition and showed no significant weight loss.
  • Viral load titration of mouse lung tissue the dissected lung tissue was weighed and ground, followed by RNA extraction and quantitative PCR analysis, for the weight of the ground lung tissue and the original data of the Ct value obtained by quantitative PCR and the determination of TCID50, with results shown in Table 6-3, Table 6-4 and FIG. 20, FIG. 21.
  • the high dose mRNA vaccine immunization group could effectively protect Balb/C against COVID-19 challenge.
  • FIG. 22-23 showed the results of Balb/C mice in each group, and FIG. 6-6 showed the results of C57 mice in each group.
  • Control group pulmonary phlebitis and interstitial pneumonia. There were large areas of pulmonary alveolar rupture, a large number of inflammatory cell infiltration, serious lung pathology, and inflammatory exudation in the alveolar cavity.
  • Vaccine group pulmonary phlebitis and interstitial pneumonia. The alveoli appeared partially ruptured and partially infiltrated with inflammatory cells. Only some alveolar fusion, a small amount of alveolar wall thickening, and a small amount of inflammatory cell infiltration were visible.
  • the weight of Balb/C mice control group did not decrease significantly after challenge.
  • the lung lesions were obvious, with severe interstitial pneumonia.
  • mice immunized with 2 injections of the high dose mRNA vaccine did not significantly decrease.
  • the high dose two-injection vaccine of mRNA vaccine had obvious protective effect.
  • the weight of the C57 mouse control group did not decrease significantly after challenge.
  • the lung lesions were obvious, with severe interstitial pneumonia.
  • Test article information name: mRNA vaccine COVID-19-LPP-mRNA; provider: Siwei (Shanghai) Biotechnology Co., Ltd.; specification: 0.2 mg/ml; traits: milky white liquid; expiration date: stored at 2-8°C for 28 days.
  • mice 7 male experimental rhesus monkeys were provided by the Institute of Medical Biology, Chinese Academy of Medical Sciences (experimental animal production license: SCXK (Dian) K2015-0004) , aged 4 years, divided into 2 groups, PBS group (3 monkeys) , vaccine group (4 monkeys) . Three days before the challenge, they were transferred to the P4 large animal laboratory for adaptive breeding. All animal experiments were carried out in compliance with biosafety operating regulations and animal ethics, and humane care was given to animals to ensure animal welfare. The experimental operations were all performed under anesthesia, which could take into account biological safety and animal ethics. The animal experiment was reviewed and approved by the Experimental Animal Ethics Committee of the Institute of Medical Biology, Chinese Academy of Medical Sciences, with the approval number: DWSP202004042.
  • First immunization Day 0; Second immunization: Day 14; Third immunization: Day 33;
  • Immunization method intramuscular injection, two-point injection on the left and right arms;
  • No adjuvant vaccine group 200 ⁇ g COVID-19-LPP-mRNA
  • SARS-CoV-2 virus had good adaptability in VERO-E6 cells.
  • the viruses were collected at about 72 hours after observing the obvious CPE under a microscope and stored at 80°C. On the next day, the viruses were thawed slowly at 4°C and centrifuged, with collection of the supernatant by ultrafiltration and concentrated, which was filtered with PBS three times, followed by eluting the viruses in a total volume of 200 mL, to obtain 200 mL of virus concentrate. Then the virus titer was determined by the plaque test.
  • Weight test from 3 days before the challenge, weight would be tested after the challenge for every day.
  • Body temperature change detection the body temperature was tested at the site of anus by an electronic body temperature measuring instrument. Before the challenge, the body temperature of each monkey was tested and recorded. After the challenge, the monkey's body temperature was monitored every day and the body temperature change data were recorded.
  • RNA template being stored at -80°C for later use. It was used for subsequent real-time qRT-PCR analysis of viral load.
  • lungs Seven days after the challenge, the lungs were dissected to observe the general pathological changes.
  • the lungs left-upper-middle-lower, right-upper-middle-lower) , trachea, and bronchus were taken for viral load detection and tissue section HE staining diagnosis, focusing on the lung tissues for pathological testing.
  • Viral genomic RNA was determined by Quantitative real-time reverse transcription PCR (qRT-PCR) .
  • QRT-PCR quantitative real-time reverse transcription PCR was used to determine the viral load of lung tissues, throat swabs, anal swabs, nasal swabs, etc.
  • the primer and probe sequences were derived from the N gene, referring to the sequences recommended by WHO and China CDC. Forward: 5’-GGGGAACTTCTCCTGCTAGAAT-3’, Reverse: 5’-CAGACATTTTGCTCTCAAGCTG-3’,
  • the virus neutralization titer of immune serum in rhesus monkey was shown in Table 7-1. It could be seen from Table 7-1 that no neutralization titer was detected in the PBS group during the challenge, and the neutralization titer of the vaccine group monkeys was 16249 (1: 16) , 16175 (1: 8) , 16145 (1: 64) , 16045 (1: 8) , respectively.
  • FIG. 24 The results of the detection of viral load in the lung tissues of experimental monkeys infected with SARS-CoV-2 were shown in FIG. 24 (gRNA detection) . It could be seen from FIG. 24 that after the animals were euthanized on day 7 after the challenge, the average viral load in the trachea of the vaccine group decreased by 3 log values compared with the PBS group; in the bronchus immunization group, none of the 4 animals was detected with viral load: gRNA was not detected in all 6-lobe lung tissues of 4 animals in the vaccine group. High levels of gRNA were detected in the multilobed lung tissues of all animals in the PBS group.
  • the alveolar lavage fluid of each animal was taken from the left lung and the right lung to determine the virus gRNA content, and the results were shown in FIG. 25. No virus was detected in the left alveolar lavage fluid samples of 4 animals in the vaccine group; while the left alveolar lavage fluid samples of 3 animals in the model group were all detected high levels of viral load.
  • FIG. 27 The results of the viral load detection in the throat swabs of experimental monkeys infected with SARS-CoV-2 were shown in FIG. 27 (gRNA detection) . It could be seen from FIG. 27 that gRNA could be detected in each experimental group from day 1 after the challenge. From day 3 after challenge, the result in vaccine-immunized group was lower than that in the PBS group. On day 7, 3 of the 4 animals in the vaccine group had a viral load of 0, and the PBS group still had a high level of viral load.
  • the rhesus monkeys in each group were euthanized to collect lung tissues (the left and right lungs are the upper, middle and lower lobes in total) , which were fixed in formalin for histological observation. After a rigorous pathological tissue section preparation procedure, the histopathological changes of the lungs were observed in double-blind by two pathologists under a microscope.
  • the comprehensive evaluation results of the 6-lobe lung of monkeys in the PBS group were: local thickening of the lung septum, hemorrhage, lymphocyte nodules, local thickening of blood vessel walls, thrombosis in the lumen, blood cell-like exudates in the tracheal lumen, local pathological changes such as carbon deposition.
  • the comprehensive evaluation results of the 6-lobe lung of the monkeys in the vaccine group were as follows: the alveolar structure was relatively intact, the lung septum was slightly thickened, with slight hemorrhage, the distribution of focal dust cells, and a small amount of inflammatory cell infiltration.
  • H&E hematoxylin-eosin
  • the pathological slices of each lung of each rhesus monkey’s lung tissue were graded. First, at least 5 visual fields in each lung tissue of each rhesus monkey (upper left, middle left, lower left, upper right, middle right, and lower right, in total of 6-lobe lung) were randomly selected for scoring. The average of pathological scores of all lung lobes was the comprehensive pathological score of the entire lung of this monkey. The comprehensive pathological score results of each monkey in each group were shown below table. The results showed that the comprehensive pathological scores of lung tissue in the vaccine group were significantly lower than those in the PBS group (see the following table and FIG. 28-34) .
  • the average lung pathological damage score of animals in the PBS model control group was 6.28 points, and the average lung pathological damage score of animals in the vaccine group was 2.04 points.
  • the UTR sequence In order to obtain a better UTR sequence based on the optimized sequence, we screened the UTR sequence, and obtained some UTR sequence pairs used in the present invention by screening the UTR sequence.
  • the method of screening was to refer to the method of Example 1, that was , selecting the ORF sequences of NDA numbers 1 and 9, on which the UTR sequence was linked at 5’-terminal, and the following 3’UTR sequence as well as PloyA sequence were linked at 3’-terminal by transcription, none of which had be subjected to nucleic acid modification.
  • the liposome was encapsulated by the RNA of these sequences, with the specific steps of: mixing appropriate amount of lipid solution (ionizable lipid MC3, DSPC, cholesterol, mPEG2000-DMG according to the molar ratio of 50: 10: 38.5: 1.5 to prepare 10mg /ml lipid solution) with eGFP-mRNA (dissolved in 1mM citrate-sodium citrate buffer pH6.4) , according to the different flow rate of 12 mixing flow rate, with a fixed mixing ratio of 3 (mRNA solution ) : 1 (lipid solution) , at a fixed temperature of 37°C, to obtain lipid nanoparticles, and the particle sizes were tested to be 90.6 ⁇ 5.4 nanometers (nm) .
  • lipid solution ionizable lipid MC3, DSPC, cholesterol, mPEG2000-DMG according to the molar ratio of 50: 10: 38.5: 1.5
  • eGFP-mRNA dissolved in 1mM citrate-sodium cit
  • the mRNA sequence used is the GFP sequence ( (SEQ NO: 40) :
  • the specific process was as follows: linking the UTR-5' sequence before the 5 sequence of the GFP, and then selecting the UTR-3' sequence which was linked to the 3’-terminal of the GFP with the specific linking method as Example 1, and linking during reverse transcription, follwed by the cell experiment as in Example 2 to obtain a better experimental pair.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Communicable Diseases (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Dispersion Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Engineering & Computer Science (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Provided is a vaccine agent for treating or preventing corona virus disease, comprising an mRNA fragment of a corona virus antigen and the DNA or RNA sequences．

Description

Vaccine Agent for Treating or Preventing Coronavirus Disease
Cross-Reference to Related Applications
This application claims the priority of prior applications as follows, Application No.: 202010090564.4 filed on February 13, 2020; Application No.: 202010418211.2 filed on May 18, 2020; Application No.: 202010767364.8, filed on August 03, 2020; the contents disclosed in which are as part of the present invention.
Field Of Invention
The invention belongs to the field of biotechnology, and specifically relates to a vaccine or vaccine agent for treating and preventing coronavirus infection.
Background of the Invention
The description of the background art is only a general description for the convenience of understanding the content of the present invention, and does not limit the present invention.
Coronavirus infections are distributed in many parts of the world, and has been identified in China, the United Kingdom, the United States, Germany, Japan, Russia, Finland, India and other countries. Infections caused by the virus mainly occur in winter and early spring. Human diseases caused by coronavirus are mainly respiratory infections. The virus is sensitive to temperature, specially grows well at 33℃ but is inhibited at 35℃, Due to such characteristic; winter and early spring are the epidemic seasons of the virus disease. Coronavirus is one of the main pathogens of the common cold in adults, and it is also an important pathogen of acute exacerbation in adult patients with chronic bronchitis.
Human coronavirus can cause the common cold, severe acute respiratory syndrome (SARS) , Middle East respiratory syndrome (MERS) and new coronary pneumonia (COVID-19) , but they have certain differences in epidemiological characteristics. Globally, 10%～30%of upper respiratory tract infections are caused by four types of coronaviruses: HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1, which are the second cause of the common cold, second only to the nose virus. The infection shows seasonal epidemic,  with high incidence of the disease in each spring and winter. The incubation period is 2-5 days, and the population is generally susceptible, mainly transmitting through human-to-human contact.
SARS is caused by human infection with SARS-CoV, which first appears in parts of Guangdong Province in China, and then spread to 24 provinces, autonomous regions and municipalities in China and 28 other countries and regions around the world. During the first SARS epidemic in the world from November 2002 to July 2003, a total of 8096 cases diagnosed clinically and 774 deaths were reported globally, with a mortality of 9.6%. The incubation period of SARS is usually limited to 2 weeks, usually about 2 to 10 days. The population is generally susceptible to SARS, the main source of infection of which is SARS patients, especially patients with obvious symptoms that are highly infectious, while patients in the incubation period or cured are not infectious.
MERS is a viral respiratory disease caused by MERS-CoV, which is first confirmed in Saudi Arabia in 2012. Since 2012, MERS has spread to 27 countries and regions such as the Middle East, Asia, Europe, etc., and 80%of cases are from Saudi Arabia, with a mortality of about 35%. The incubation period is up to 14 days, and the population is generally susceptible. Dromedary camel is a major host of MERS-CoV and is the main source of infections across humans, with limited human-to-human transmission.
[Corrected under Rule 26, 03.03.2021]
This requires the development of a vaccine agent with preventive and therapeutic effects, which can induce antibodies to resist coronavirus infection or treat humans or mammals infected by coronavirus.
Summary of the Invention
The present invention provides a coronavirus vaccine agent with preventive and therapeutic effects, which can not only prevent the coronavirus disease, but also can treat the disease.
In one aspect, the present invention provides a vaccine agent, comprising an mRNA fragment of a coronavirus antigen, wherein the mRNA fragment contains one or more of antigen sequences such as S, S1, RBD, N, E, M and the like, and a combination thereof. In some embodiments, these fragments are artificially optimized or modified.
The coronavirus here is a human or mammalian coronavirus. In some embodiments, the coronavirus is one of severe acute respiratory syndrome (SARS) , Middle East respiratory syndrome (MERS) and coronavirus disease 2019 (COVID-19) . In some embodiments, the coronavirus virus is one or more of HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1.
In some embodiments, the mRNA sequence is selected from one or more of SEQ NO: 1.1-1.9. In some embodiments, the sequence is SEQ NO: 1.1. In some embodiments, the mRNA sequence has been subjected to nucleic acid modification with the modification ratio of 20-100%. In some embodiments, the modification is that uridine is modified by 1-methylpseudouracil. The structure of 1-methylpseudouracil is as follows:
Figure PCTCN2021074670-appb-000001
In some embodiments, the modification is that uridine is modified by 1-methylpseudouracil with the modification ratio of 50%.
In some embodiments, the nucleic acid further comprises a cap structure. In some embodiments, the cap structure is as follows:
Figure PCTCN2021074670-appb-000002
The cap is added at the 5’-terminal. In some embodiments, the cap can be also added at the 3’-terminal.
In some embodiments, the nucleic acid is encapsulated, and the encapsulated structure comprises a core structure formed by mixing nucleic acid and polymer or protein. In some embodiments, the core structure further comprises a shell structure, such as a shell structure formed by phospholipids.
On the other hand, in some embodiments, the present invention provides a DNA sequence, being one or more of sequences shown in SEQ NO: 1, SEQ NO: 2, SEQ NO: 3, SEQ NO: 4, SEQ NO: 5, SEQ NO: 6, SEQ NO: 7, SEQ NO: 8 or SEQ NO: 9, or a sequence having a homology of 60%-100%or identical functions with any one of the sequences. Alternatively, these sequences are complementary sequences.
In some embodiments, the sequence is one or more of sequences shown in SEQ NO: 1, SEQ NO: 2, SEQ NO: 4, SEQ NO: 5, SEQ NO: 8 or SEQ NO: 9; or a sequence having identical functions with any one of the sequences.
In some embodiments, the sequence is a sequence shown in SEQ NO: 1.
In some embodiments, the sequence further comprises a sequence shown in SEQ NO: 11 at a 5'-terminal thereof.
In some embodiments, the sequence further comprises a sequence shown in SEQ NO: 12 at a 5'-terminal thereof.
In some embodiments, the sequence further comprises a sequence shown in SEQ NO: 13 at a 3'-terminal thereof.
In some embodiments, the sequence further comprises a sequence shown in SEQ NO:  14 at a 3'-terminal thereof.
In some embodiments, a tail sequence is also included. In some preferred embodiments, the tail sequence is a sequence shown in SEQ NO: 15.
In some embodiments, the homology is 65-100%. In some embodiments, the homology is 70-100%. In some embodiments, the homology is 71-100%. In some embodiments, the homology is 73-100%. In some embodiments, the homology is 74-100%. In some embodiments, the homology is 100%.
In some embodiments, the sequence is a sequence having a homology of 70-100%with the sequence shown in SEQ NO: 1; a sequence having a homology of 74-100%with the sequence shown in SEQ NO: 3; a sequence having a homology of 70-100%with the sequence shown in SEQ NO: 5; a sequence having a homology of 65-100%with the sequence shown in SEQ NO: 6; a sequence having a homology of 65-100%with the sequence shown in SEQ NO: 7; a sequence having a homology of 70-100%with the sequence shown in SEQ NO: 8; or a sequence having a homology of 70-100%with the sequence shown in SEQ NO: 9.
In another aspect, the present invention provides an RNA sequence, being one or more of RNA sequences shown in SEQ NO: 1.1, SEQ NO: 2.2, SEQ NO: 3.3, SEQ NO: 4.4, SEQ NO: 5.5, SEQ NO: 6.6, SEQ NO: 7.7, SEQ NO: 8.8 or SEQ NO: 9.9, or a sequence having a homology of 60%-100%or identical functions with one of the sequences, or a sequence complementary to the above sequence. In some preferred embodiments, the sequence is one or more of sequences shown in SEQ NO: 1.1, SEQ NO: 2.2, SEQ NO: 4.4, SEQ NO: 5.5, SEQ NO: 8.8 or SEQ NO: 9.9; or a sequence having a homology of 60%-100%with one of the sequences.
In some preferred embodiments, the sequence is a sequence shown in SEQ NO: 1 or has a homology of 60%-100%with the sequence. In some preferred embodiments, the homology is 65-100%. In some preferred embodiments, the homology is 75-100%. In some preferred embodiments, the homology is 85-100%. In some preferred embodiments, the homology is 95-100%. In some preferred embodiments, the homology is 98-100%. In some preferred embodiments, wherein the homology is 99-100%. In some preferred embodiments, the homology is 100%.
In some preferred embodiments, the sequence further comprises UTR sequence at the 5'-terminal and/or the 3'-terminal thereof. In some embodiments, a promoter region is further comprised at the 5'-terminal. In some embodiments, a tail structure is further comprised at the 3'-terminal. In some preferred embodiments, the sequence further comprises one of the sequences shown in SEQ NO: 36-1 to SEQ NO: 36-12 at a 5'-terminal thereof. In some preferred embodiments, the sequence further comprises one of the sequences shown in SEQ NO: 36-11 to SEQ NO: 36-12 at a 5'-terminal thereof. In some preferred embodiments, the sequence further comprises one of the sequences shown in SEQ NO: 37-1 to SEQ NO: 37-12 at a 3'-terminal thereof. In some preferred embodiments, the sequence further comprises one of the sequences shown in SEQ NO: 37-11 to SEQ NO: 37-12 at a 3'-terminal thereof. In some embodiments, the 5'-terminal of the sequence can also be the sequence shown in SEQ NO: 11. In some embodiments, the 5'-terminal of the sequence can also be the sequence shown in SEQ NO: 12. In some embodiments, the 3'-terminal of the sequence can also be the sequence shown in SEQ NO: 13.
In some embodiments, the sequence further comprises a sequence shown in SEQ NO: 14 at a 3'-terminal thereof.
In some embodiments, a tail sequence that is the sequence described in SEQ NO: 15 is further included at the 3'-terminal.
In some embodiments, a promoter is further included at the 5'-terminal, and in some embodiments, the sequence of the promoter is a sequence shown in SEQ ID NO: 12.
In some embodiments, the sequence further comprises an additional sequence shown in SEQ ID NO: 38 or SEQ ID NO: 39. In some embodiments, these sequences are inserted behind AUG nucleotides. In some embodiments, the additional sequence is located at the 5'-terminal.
In some embodiments, the RNA sequence comprises ORF sequence, promoter sequence, UTR sequence at the 5'-terminal and/or UTR sequence at the 3'-terminal. In some embodiments, the ORF sequence comprises the additional sequence. In some embodiments, in the order from the 5'-terminal to the 3'-terminal, the sequence is as follows: promoter sequence -UTR sequence at the 5'-terminal -ORF sequence -UTR sequence at the 3'-terminal -tail sequence.
On the other hand, the present invention provides a coronavirus mRNA vaccine agent, comprising the mRNA sequence of any one of the preceding embodiments, or an mRNA sequence obtained by reverse transcription in vitro from the DNA sequence of the preceding embodiments.
In some embodiments, the mRNA comprises a modified nucleotide, wherein the modified nucleotide is selected from one or more of the following nucleotides: 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O (6) -methylguanine, pseudouridine, N-1-methyl-pseudouridine, 2-thiouridine and 2-thiocytidine; methylated base; inserted base; 2'-fluororibose, ribose, 2'-deoxyribose, arabinose and hexose; phosphorothioate and 5'-N-phosphoramidite bond. And modified nucleotides described in PCT/CN2020/074825, PCT/CN2020/106696 are modified. In some embodiments, the mRNA comprises a modified nucleotide, and the modified nucleotide is N-1-methyl-pseudouridine.
In some embodiments, the modification ratio is 0.1%-100%. In some embodiments, the modification ratio is 2%-90%. In some embodiments, the modification ratio is 5%-80%. In some embodiments, the modification ratio is 20%-80%. In some embodiments, the modification ratio is 40%-70%. In some embodiments, the modification ratio is 50%.
In some embodiments, the agent further comprises a polymer that forms a nanoparticle with the nucleotide, wherein the polymer is selected from one or more of the following polymers: polyacrylate, polyalkylcyanoacrylate, polylactide, polylactide-polyglycolide copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, polyethyleneimine, polyethyleneimine (PEI) , or branched PEI.
In some embodiments, the agent further comprises a liposome, wherein a core structure comprising the nucleotide and a polymer is encapsulated in the liposome to form nanoparticles.
In some embodiments, the agent further comprises a liposome, wherein the nucleotide is encapsulated by the liposome to form nanoparticles. In some embodiments, the liposome  is selected from one or more of the following: cationic liposome, non-cationic liposome, sterol-based liposome, and/or PEG-modified liposome. In some embodiments, the cationic liposome comprises: C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazolyl) , HGT5000, HGT5001, OF-02, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA and HGT4003, or combinations thereof. In some embodiments, non-limiting examples of the non-cationic liposome may include ceramide, cephalin, cerebroside, diacylglycerol, 1, 2-dipalmitoyl-sn-glyceryl-3-phosphorylglycerol sodium salt (DPPG) , 1, 2-distearoyl-sn-glyceryl-3-phosphoethanolamine (DSPE) , 1, 2-distearoyl-sn-glyceryl-3-phosphocholine (DSPC) , 1, 2-dipalmitoyl-sn-glyceryl-3-phosphocholine (DPPC) , 1, 2-dioleyl-sn-glyceryl-3-phosphoethanolamine (DOPE) , 1, 2-dioleyl-sn-glyceryl-3-phosphatidylcholine (DOPC) , 1, 2-dipalmitoyl-sn-glyceryl-3-phosphoethanolamine (DPPE) , 1, 2-dimyristoyl-sn-glyceryl-3-phosphoethanolamine (DMPE) , and 1, 2-dioleoyl-sn-glyceryl-3-phosphate- (1'-rac-glycerol) (DOPG) , 1-palmitoyl-2-oleoyl-phosphatidylethanolamine (POPE) , 1-palmitoyl-2-oleoyl-sn-glyceryl-3-phosphocholine (POPC) , 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE) , sphingomyelin, or combinations thereof. In some embodiments, the sterol-based cationic liposome can constitute no more than 70%of the total liposome in liposomal nanoparticles. In some embodiments, the sterol-based cationic liposome comprises phosphatidyl compound, phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipid, cerebroside, and ganglioside, or combinations thereof. In some embodiments, a PEG-modified liposome, such as DMG-PEG, DMG-PEG2K, C8-PEG, DOGPEG, ceramide PEG and DSPE-PEG, or combinations thereof, is further comprised.
In some embodiments, the vaccine agent further comprises protamine sulfate, DOPE, DSPE-mPEG2000 and M5, wherein a structure of the M5 is:
Figure PCTCN2021074670-appb-000003
In some embodiments, the M5: DOPE: DSPE-mPEG2000=49: 49: 2 (mass ratio) . The present invention provides a DNA vaccine agent, comprising the DNA sequence described in any of the preceding embodiments. In some embodiments, the sequence is selected from one or more of SEQ NO: 1-9.
In one aspect, the present invention provides a UTR sequence, comprising one or more of 5'UTR sequences shown in SEQ NO: 36-1 to 36-12, or 3'UTR sequences shown in SEQ NO: 37-1 to 37-12. In some embodiments, the 5'UTR sequence is a sequence shown in SEQ NO: 36-11, the 3'UTR sequence is a sequence shown in SEQ NO: 37-11; or the 5'UTR sequence is a sequence shown in SEQ NO: 36-12, the 3'UTR sequence is a sequence shown in SEQ NO: 37-12.
On the other hand, the present invention provides a UTR sequence at 3’-terminal, comprising a sequence shown in SEQ NO: 37-11 or SEQ NO: 37-12.
In another aspect of the present invention, an additional sequence of RNA for ORF is provided, and the additional sequence is a sequence shown in SEQ NO: 38 or SEQ NO: 39. In some embodiments, the additional sequence is located at the 5'-terminal. In some embodiments, the additional sequence is inserted from the AUG sequence. In some embodiments, the ORF sequence of the RNA is the sequence in any of the preceding embodiments.
Brief Description of the Drawings
FIG. 1 is a schematic diagram of the structure of the DNA template in the plasmid, showing that the DNA sequence comprises T1 promoter, UTR sequence and DNAORF sequence.
FIG. 2 is a structure diagram of the RNA sequence obtained by transcription from the DNA template, and also contains the T7, UTR sequence and PolyA sequence obtained by transcription from the DNA sequence.
FIG. 3 is a graph showing the antigen expression results of 9 RNA sequences at the cellular level using liposomes.
FIG. 4 is a comparison of the immunogenicity of 9 mRNA vaccines in mice, wherein PBS  is the blank control, and others are the comparison of the immunogenicity of the core-shell structured nanoparticles containing different RNA sequences (ORF) in mice. It is found that some are higher than the blank control, some are lower than the blank control, and some are not immunogenic, that is, they cannot cause mammals to produce antibodies or the amount or titer of antibodies is low.
FIG. 5 shows the effect of the selected vaccine agents on the body weight of mice (experiments on immunizing C57BL/6 mice with different concentrations of COVID-19-LPP-mRNA) .
FIG. 6 is the dilution curve of BALB/c mouse antibody detection (for different doses of vaccine agents)
FIG. 7 is the dilution curve of C57BL/6 mouse antibody detection (for different doses of vaccine agents) .
FIG. 8 is a comparison chart of specific IgG titers (for different doses of vaccine agents) .
FIG. 9 is a neutralizing antibody titer curve for BALB/c mice (for different doses of vaccine agents) .
FIG. 10 is a neutralizing antibody titer curve for C57BL/6 mice (for different doses of vaccine agents) .
FIG. 11 is a summary of titers of the neutralizing antibody against pseudovirus in two mice (for different doses of vaccine agents) .
IFG. 12 is a neutralizing antibody titer curve for BALB/c mice (for different doses of vaccine agents) .
IFG. 13 is a neutralizing antibody titer curve for C57BL/6 mice (for different doses of vaccine agents) .
FIG. 14 is a summary chart of antibody titers (for different doses of vaccine agents) .
FIG. 15 is a graph showing antibody titers of different antibody subtypes (for vaccine agents of different concentrations or doses) . Wherein FIG. 15A is for IgM, FIG. 15B is for IgG, and FIG. 15C is for IgM.
FIG. 16A is a graph showing the evaluation results of antigen-specific T cell response levels in mice after immunization with different doses of COVID-LPP-mRNA. FIG. 16B is a plot (dot plot) showing the evaluation results of serum neutralizing antibody levels in mice after immunization with different doses of COVID-LPP-mRNA.
FIG. 17 is a graph showing the evaluation results of serum neutralizing antibody levels in mice after immunization with different doses of COVID-LPP-mRNA.
FIG. 18 shows the evaluation results of the protective effect of mice against SARS-CoV-2 infection after immunization with COVID-19-LPP-mRNA (weight changes of Balb/C mice) .
FIG. 19 shows the evaluation results of the protective effect of mice against SARS-CoV-2 infection after immunization with COVID-19-LPP-mRNA (weight changes of C57 mice) .
FIG. 20 shows the viral load in the lung tissue of Balb/C mice on Day 4 after challenge, wherein FIG. 20A shows the RNA copy number, and FIG. 20B shows the comparison of TCID50 titer data.
FIG. 21 shows the viral load in the lung tissue of C57BL/6 mice on Day 4 after challenge, wherein FIG. 21A shows the RNA copy number, and FIG. 21B shows the comparison of TCID50 titer data.
FIG. 22 shows the pathological section of the lung tissue of Balb/C mice on Day 4 after challenge (with different experimental treatments, HD is for high dose (upper) , LD is for low dose (middle) , and comparation with coronavirus (lower) ) .
FIG. 23 shows the pathological section of lung tissue of C57BL/6 mice on Day 4 after challenge (with different experimental treatments, HD is for high dose (double-injection DD -upper) , HD is for high dose (single-injection SD -middle-upper) ; LD is for double-injection (DD) and single-injection (SD) in low dose, and comparation with coronavirus (lower) ) .
FIG. 24 shows the results of gRNA detection in lung tissue, trachea, and bronchus of experimental monkeys infected with SARS-CoV-2.
FIG. 25 shows the results of gRNA detection in the lung lavage fluid from experimental monkeys infected with SARS-CoV-2.
FIG. 26 shows the results of gRNA detection in nasal swabs from experimental monkeys infected with SARS-CoV-2.
FIG. 27 shows the results of gRNA detection in throat swabs from experimental monkeys infected with SARS-CoV-2.
FIG. 28 shows the lung tissue section of the animal numbered 16139 in PBS control group. It can be seen that the pulmonary septum is locally thickened with slight hemorrhage, accompanied with lymphocyte nodules, local blood vessel wall thickening, thrombosis seen in the lumen, and blood cell-like exudate seen in the tracheal lumen.
FIG. 29 is the lung tissue section of the animal numbered 16113 in PBS control group. It can be seen slight hemorrhage in the pulmonary septum, accompanied with inflammatory cell infiltration, pigmentation, local blood vessel wall thickening, and thrombosis in the lumen.
FIG. 30 is the lung tissue section of the animal numbered 16217 in PBS control group. It can be seen that most of the lung septum is thickened with slight to moderate hemorrhage, accompanied with lymphocyte nodules, local blood vessel wall thickening, thrombosis seen in the lumen of the blood vessel, exfoliated tissues and cells seen in the tracheal lumen, and local carbon deposition.
FIG. 31 is the lung tissue section of the animal numbered 16145 in the vaccine group. It can be seen that the alveolar structure is relatively intact, accompanied with slight to moderate hemorrhage in the pulmonary septum and inflammatory cell infiltration.
FIG. 32 is the lung tissue section of the animal numbered 16045 in the vaccine group. It can be seen that the alveolar structure is relatively intact, accompanied with the lung septum thickening slightly and a small amount of inflammatory cells infiltration.
FIG. 33 is the lung tissue section of the animal numbered 16175 in the vaccine group. It can be seen that the alveolar structure is relatively intact, accompanied with the lung septum thickening slightly, bleeding, and lymphocyte nodules.
FIG. 34 is the lung tissue section of the animal numbered 16249 in the vaccine group. It can  be seen that the pulmonary septum is slightly thickened with slight hemorrhage, accompanied with focal dust cells distribution, vascular congestion, and inflammatory cells infiltration.
FIG. 35 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 1-1-1 and the optimized sequence shown in SEQ NO: 1.1.
FIG. 36 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 2-2-2 and the optimized sequence shown in SEQ NO: 2.2.
FIG. 37 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 3-3-3 and the optimized sequence shown in SEQ NO: 3.3.
FIG. 38 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 4-4-4 and the optimized sequence shown in SEQ NO: 4.4.
FIG. 39 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 5-5-5 and the optimized sequence shown in SEQ NO: 5.5.
FIG. 40 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 6-6-6 and the optimized sequence shown in SEQ NO: 7.7.
FIG. 41 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 7-7-7 and the optimized sequence shown in SEQ NO: 7.7.
FIG. 42 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 8-8-8 and the optimized sequence shown in SEQ NO: 8.8.
FIG. 43 is a graph showing the comparison of RNA homology between the natural sequence shown in SEQ NO: 9-9-9 and the optimized sequence shown in SEQ NO: 9.1.
Detailed Description
Definition
Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those of ordinary skill in the art to which the present invention belongs. The following references provide those skilled in the art with general definitions of many terms used in the present invention: Dictionary of Biochemistry and Molecular Biology, (Edition 2) J. Stenesh (ed. ) , Wiley  -Interscience (1989) ; Dictionary of Microbiology and Molecular Biology (Edition 3) , P. Singleton and D. Sainsbury (ed. ) , Wiley-Interscience (2007) ; Chambers Dictionary of Science and Technology (Edition 2) , P. Walker (ed. ) , Chambers (2007) ; Glossary of Genetics (Edition 5) , R. Rieger et al. (ed. ) , Springer-Verlag (1991) ; and The HarperCollins Dictionary of Biology, WG Hale and JP Margham, (ed. ) , HarperCollins (1991) .
Although any methods and compositions similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and compositions are described herein. For the purpose of the present invention, the following terms are defined below for clarity and ease of reference: according to the practice of patent law for long, when a reference without a quantitative indication is used in this application including the claims, it means "one or more" . The terms "about" and "approximately" are interchangeable when used herein, and should generally be understood to refer to the range of numbers around a given number, as well as all numbers within the recited number range (for example, "about 5 to 15" means "about 5 to about 15" unless otherwise stated) . In addition, all numerical ranges herein should be understood to include each integer within the range.
As used herein, an "antigenic polypeptide" or "immunogenic polypeptide" is a polypeptide that reacts with molecules of the vertebrate immune system when introduced into a vertebrate, that is, it is antigenic, and/or induces an immune response in the vertebrate, that is, it is immunogenic.
"Biocompatible" refers to a substance that, when exposed to living cells, will support proper activities of cells without causing undesired effects in cells such as changes in cell life cycle, changes in cell proliferation rate, or cytotoxicity effects.
The term "biofunctionally equivalent" is well known in the art and is defined in further detail herein. Therefore, a sequence having about 85%to about 90%, or more preferably about 91%to about 95%, or even more preferably about 96%to about 99%identity or functional equivalence with one or more nucleotide sequences provided herein are specifically considered useful in the practice of the methods and compositions described in this application.
As used herein, the term "buffer" includes one or more compositions or their aqueous solution, which resists fluctuations in pH when an acid or base is added to a solution or composition containing the buffer. This resistance to pH changes is due to the buffering property of this solution, and may be a function of one or more specific compounds included in the composition. Therefore, the solution or another composition that exhibits buffering activity is called buffer or buffer solution. Buffers generally do not have unlimited ability to maintain the pH of a solution or composition; instead, they are generally capable of maintaining the pH within a certain range, such as a pH of about 5 to 7.
As used herein, the term "carrier" is intended to include any solvent, dispersion medium, coating, diluent, buffer, isotonic agent, solution, suspension, colloid, inert body, etc., or combinations thereof, which is pharmaceutically acceptable for administration to the relevant animal or, if applicable, for therapeutic or diagnostic purposes.
As used herein, the term "DNA fragment" refers to a DNA molecule that has been separated from the total genomic DNA of a specific species. Therefore, the DNA fragment obtained from a biological sample using one of the compositions disclosed herein refers to one or more DNA fragments that have been separated or purified from the total genomic DNA of the specific species from which they are obtained. The term "DNA fragment" includes the DNA fragment and smaller fragments thereof, as well as a recombinant vector, including such as a plasmid, cosmid, phage, virus and the like.
As used herein, the term "effective amount" refers to an amount capable of treating or ameliorating a disease or condition or capable of producing the desired therapeutic effect.
As used herein, the term "epitope" refers to a part of a given immunogenic substance, determined by any method known in the art, and the part is the target of an antibody or cell surface receptor in the host immune system that has elicits an immune response to the given immunogenic substance, that is, it binds to the antibody or cell surface receptor. Further, the epitope can be defined as a part of an immunogenic substance, as determined by any method available in the art (see, for example, Geysen  et al., 1984) , which elicits an antibody response or induces T cell response. The epitope can be part of any immunogenic substance, such as a protein, polynucleotide, polysaccharide, organic or inorganic chemical substance, or any combinations thereof. The term "epitope" can also be used interchangeably with "antigenic determinant" or "antigenic determinant site" .
As used herein, the term "such as" is only for illustration and not intended to be limiting, and should not be interpreted as referring to only those items explicitly listed in the specification.
As used herein, "heterologous" is defined relative to a predefined reference nucleic acid sequence. For example, for a structural gene sequence, a heterologous promoter is defined as a naturally occurring promoter that does not adjacent to the reference structural gene, but is placed through laboratory operations. Similarly, a heterologous gene or nucleic acid fragment is defined as a naturally occurring gene or fragment that does not adjacent to a reference promoter and/or enhancer element.
As used herein, when referring to a polynucleotide, "homologous" refers to sequences that have identical or substantially identical nucleotide sequence despite being from different sources. Generally, homologous nucleic acid sequences are derived from closely related genes or organisms that have one or more substantially similar genomic sequences. On the contrary, “analogous” polynucleotides are polynucleotides sharing identical function with polynucleotides from different species or organisms with possible significantly different primary nucleotide sequences, which encode one or more proteins or polypeptides that achieve similar functions or have similar biological activities. Analogous polynucleotides can often be derived from two or more (e.g., genetically or phylogenetically) organisms that are not closely related.
As used herein, the term "homology" refers to the degree of complementarity between two or more polynucleotide or polypeptide sequences. When first nucleic acid or amino acid sequence has the same primary sequence as second nucleic acid or amino acid sequence, the word "identity" can replace the word "homology" . Sequence homology and sequence identity can be determined by analyzing two or more sequences using algorithms and computer programs known in the art. Such methods  can be used to assess whether a given sequence has identity or homology with another selected sequence.
In the context of two or more nucleic acid or polypeptide sequences, the term "identical" or "identity" percentage refers to two or more sequences or subsequences are identical or have a specific percentage of identical amino acid residues or nucleotides, when using one of the sequence alignment algorithms described below (or other algorithms available to the ordinary skilled person) or by visual inspection measurement for comparison and blast for maximum correspondence.
As used herein, the phrase "in need of treatment" means that the patient needs (alternatively, in one or more ways, will benefit from) treatment based on the judgment by a carer such as a doctor or veterinarian. Such judgment can be made based on various factors in the field of expertise of the carer, and can include the recognition that the patient has a disease state that can be treated with one or more compounds or pharmaceutical compositions, such as those described herein.
The phrase "isolated" or "biologically pure" refers to a substance that is substantially or essentially free of components that normally accompany the substance in its natural state. Therefore, isolated polynucleotides or polypeptides according to the present disclosure are preferably free of substances that are normally associated with those polynucleotides or polypeptides in their natural or in situ environment.
As used herein, the term "kit" can be used to describe a variant of a portable self-contained package that includes at least one set of agents, components or pharmaceutically formulated compositions of the present invention. Optionally, such kit may include one or more sets of instructions regarding, for example, the use of the enclosed composition in a laboratory or clinical application.
"Linking" or "binding" refers to any method known in the art for functionally linking one or more proteins, peptides, nucleic acids or polynucleotides, including but not limited to recombinant fusion, covalent bonding, disulfide bonding, ionic bonding, hydrogen bonding, electrostatic bonding, etc.
As used herein, the term "naturally occurring" when applied to an object refers to the fact that an object can exist in nature. For example, polypeptides or polynucleotide  sequences present in organisms (including viruses) , which can be isolated from sources in nature and have not been subjected to intentionally artificial modification in the laboratory, are naturally occurring. As used herein, laboratory rodent species that have been selectively bred according to classical genetics are considered to be naturally occurring animals.
As used herein, the term "nucleic acid" includes one or more of the following types: polydeoxyribonucleotide (containing 2-deoxy-D-ribose) , polyribonucleotide (containing D-ribose) , and any other types of polynucleotides, which are N-glycosides of purine or pyrimidine bases or modified thereof (including abasic sites) . As used herein, the term "nucleic acid" also includes the covalently bonded polymer of ribonucleosides or deoxyribonucleosides. The covalently bonding is usually occurred through a phosphodiester bond between subunits, but in some cases through a phosphorothioate, methylphosphonate, or the like. "Nucleic acid" includes single-stranded and double-stranded DNA, as well as single-stranded and double-stranded RNA. Exemplary nucleic acids include, but are not limited to, gDNA; hnRNA; mRNA; rRNA, tRNA, microRNA (miRNA) , small interfering RNA (siRNA) , small nucleolar RNA (snoRNA) , small nuclear RNA (snRNA) and small temporal RNA (stRNA) ) , etc., and any combinations thereof.
As used herein, the term "operably link" means that the linked nucleic acid sequences are usually adjacent or substantially adjacent, and in the case where two protein coding regions need to be binded, are adjacent and within reading frame. However, because enhancers generally function when separated from the promoter by several thousand bases, and intron sequences can have variable lengths, some polynucleotide elements can be operably linked but not adjacent.
As used herein, the term "patient" (also interchangeably referred to as "recipient" , "subject" , "host" or "object" ) refers to any host that can be a recipient of one or more of the vascular access devices discussed herein. In some aspects, the recipient will be a vertebrate, which is intended to represent any animal species (and preferably, a mammalian species, such as humans) . In some embodiments, "patient" refers to any animal hosts, including but not limited to human and non-human primates, avians,  reptiles, amphibians, cattles, dogs, caprines, cavines, crows, epines, equines, cats, hircines, rabbits, leporines, lupines, murines, sheep, pigs, racines, foxes, etc., including but not limited to domestic livestocks, grazing or migrating animals or birds, foreign or zoo samples and companion animals, pets, and any animals under the care of a licensed veterinarian.
The phrase "pharmaceutically acceptable" refers to a molecular entity and composition that does not produce allergy or similar adverse reaction when administered to humans, especially to human eyes. The preparation of an aqueous composition containing protein as an active ingredient is well known in the art. Generally, such composition is prepared as an injection, or as liquid solution or suspension. Alternatively, they can be prepared in a solid form suitable for dissolution or suspension in a liquid prior to injection.
As used herein, "pharmaceutically acceptable salt" refers to a salt that retains the desired biological activity of the parent compound and does not produce any undesired toxicological effects. Examples of such salts include, but are not limited to, acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, etc.; and salts formed with organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, pamoic acid (methylene pamoic acid) , alginic acid, naphthoic acid, polyglutamic acid, naphthalenesulfonic acid, naphthalene disulfonic acid, polygalacturonic acid, etc.; salts formed with polyvalent metal cations such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, etc.; and salts formed with organic cations such as N, N'-dibenzylethylenediamine or ethylenediamine; and combinations thereof.
As used herein, the term "plasmid" or "vector" refers to a genetic construct composed of genetic materials (i.e., nucleic acids) . Generally, a plasmid or vector contains an origin of replication that is functional in a bacterial host cell, such as E. coli, and a selective marker for detecting the bacterial host cell containing the plasmid. The plasmid and vector of the present invention can comprise one or more genetic  elements as described herein, which are arranged so that the inserted coding sequence can be transcribed and translated in a suitable expression cell. In addition, the plasmid or vector can comprise one or more nucleic acid fragments, genes, promoters, enhancers, activators, polyclonal regions or any combinations thereof, including fragments obtained or derived from one or more natural and/or artificial sources.
As used herein, the term "polypeptide" is intended to encompass "a polypeptide" as well as "polypeptides" , and includes any chain of two or more amino acids. Therefore, as used herein, terms including but not limited to "peptide" , "dipeptide" , "tripeptide" , "protein" , "enzyme” , "amino acid chain" and "contiguous amino acid sequence” are all included in the definition of “polypeptide” , and the term "polypeptide" may replace or be used interchangeably with any of these terms. The term also includes polypeptides that have undergone one or more post-translational modifications or modified by one or more non-naturally occurring amino acids, and the post-translational modification includes, for example, but not limited to, glycation, acetylation, phosphorylation, amidation, derivatization, proteolytic cleavage, and post-translational processing. There are conventional nomenclatures for polynucleotide and polypeptide structures in the art.
For example, one-letter and three-letter abbreviations are widely used to describe amino acids: Alanine (A; Ala) , Arginine (R; Arg) , Asparagine (N; Asn) , Aspartic acid (D; Asp) , Cysteine (C; Cys) , Glutamine (Q; Gln) , Glutamic acid (E; Glu) , Glycine (G; Gly) , Histidine (H; His) , Isoleucine (I; Ile) , Leucine (L; Leu) , Methionine (M; Met) , Phenylalanine (F; Phe) , Proline (P; Pro) , Serine (S; Ser) , Threonine (T; Thr) , Tryptophan (W; Trp) , Tyrosine (Y; Tyr) , Valine (V; Val) , and Lysine (K; Lys) . The amino acid residue described herein is preferably in the "l" isomeric form. However, a residue in the "d" isomeric form can be substituted for an amino acid residue in the l isomeric form, provided that the desired polypeptide property is retained.
As used herein, the terms "prevention" and "inhibition" refer to administration of a compound alone or contained in a pharmaceutical composition before the onset of the clinical symptoms of the disease state, in order to prevent any symptoms, aspects  or features of the disease state. Such prevention and inhibition need not be absolutely considered to be medically useful.
“Protein" is used interchangeably with "peptide" and "polypeptide" herein, and includes both synthetic, recombinant, or in vitro produced peptides and polypeptides, and peptides and polypeptides that are expressed in vivo after the nucleic acid sequence is administered to a host animal or human subject. The term "polypeptide" preferably means a short peptide having a length of any amino acid chain, including a length of from about 2 to about 20 amino acid residues, an oligopeptide having a length of from about 10 to about 100 amino acid residues, and a longer polypeptide comprising a length of 100 amino acid residues or more. In addition, the term is also intended to comprise an enzyme, that is, a functional biomolecule that comprises at least one amino acid polymer. The polypeptide and protein of the present invention also include a polypeptide and protein that are post-translationally modified or have been post-translationally modified, and include any glycosides or other derivatives or conjugates added to the main chain amino acid chain.
"Purify" , as used herein, means separation from many other compounds or entities. The compound or entity may be partially purified, substantially purified or pure. When a compound or entity is removed from substantially all other compounds or entities, it is considered pure, that is, preferably at least about 90%, more preferably at least about 91%, 92%, 93%, 94%, 95%, 96%%, 97%, 98%, 99%, or more than 99%pure. A partially or substantially purified compound or entity can remove at least 50%, at least 60%, at least 70%, or at least 80%of materials naturally present with it, for example, cellular materials such as cellular proteins and/or nucleic acids.
The term "recombinant" refers to a substance (e.g., a polynucleotide or polypeptide) that is artificially or (non-naturally) synthetically altered by human intervention. The alteration can be made to a substances in its natural environment or natural state, or to a substance removed from its natural environment or natural state. Specifically, for example, a promoter sequence is "recombinant" when it is produced by expressing an artificially engineered nucleic acid fragment. For example, "recombinant nucleic acid" is produced by nucleic acid recombination during cloning,  DNA shuffling or other procedures, or by chemical or other mutagenesis; "recombinant polypeptide" or "recombinant protein" is produced by expression of a recombinant nucleic acid polypeptide or protein; and "recombinant virus" , such as recombinant AAV virus, is produced by expression of a recombinant nucleic acid.
The term "regulatory element" as used herein refers to a region of a nucleic acid sequence that regulates transcription. Exemplary regulatory element includes, but is not limited to, a enhancer, post-transcriptional element, transcription control sequence, and the like.
The term "RNA fragment" refers to an RNA molecule that has been isolated from total cellular RNA of a specific species. Therefore, RNA fragment can refer to one or more RNA fragments (natural or synthetic sources) that have been isolated or purified from other RNA. The term "RNA fragment" includes the RNA fragment and smaller fragments thereof.
When referring to amino acids, the term "sequence" involves to all or part of the linear N-terminal to C-terminal sequence of amino acids in a given amino acid chain, such as a polypeptide or protein; "subsequence" means any consecutive amino acid fragments within the sequence, for example, at least 3 consecutive amino acids within a given protein or polypeptide sequence. Regarding the nucleotide chain, "sequence" and "subsequence" have similar meanings related to the nucleotide sequence from 5’ to 3’.
The term "sequence substantially as shown in SEQ ID NO: X" means that the sequence substantially corresponds to a part of SEQ ID NO: X and has relatively few nucleotides (or amino acids in the case of a polypeptide sequence) inconsistent with the nucleotide (or amino acid) of SEQ ID NO: X or is the biological functional equivalent of the nucleotide (or amino acid) of SEQ ID NO: X. The term "biologically functional equivalent" is well known in the art and is defined in further detail herein. Therefore, a sequence having about 65%to about 90%, or more preferably about 85%to about 95%, or even more preferably about 96%to about 99%identity or functional equivalence with one or more nucleotide sequences provided herein are specifically considered useful in the practice of the present invention. When referring to a  sequence shown in a certain numbering sequence, a sequence complementary to the sequence is also included. For example, the sequence shown in SEQ ID NO: X not only includes the sequence feature of the sequence itself, but also naturally includes the sequence features complementary to the sequence, and "complementary" herein means that substantially all sequences are in a one-to-one correspondence according to the complementary sequence under the basic common sense of biology. For example, if the DNA sequence shown in SEQ ID NO: X is a DNA sequence, another DNA sequence complementary to the sequence is naturally included, unless the other sequence is specifically excluded.
Suitable standard nucleic acid hybridization conditions for the present invention include, for example, hybridization in 50%formamide, 5×Denhardt's solution, 5×SSC, 25mM sodium phosphate, 0.1%SDS and 100 μg/mL denatured salmon sperm DNA at 42℃ for 16 hours, followed by washing continuously with 0.1×SSC, 0.1%SDS solution at 60℃ for 1 hour to remove the required amount of background signal. The hybridization conditions of the present invention with lower stringency include, for example, hybridization in 35%formamide, 5×Dunport’ s solution, 5×SSC, 25mM sodium phosphate, 0.1%SDS and 100μg/mL denatured salmon sperm DNA or E. coli DNA at 42℃ for 16 hours, following by washing continuously with 0.8×SSC, 0.1%SDS at 55℃. Those of ordinary skill in the art will recognize that such hybridization conditions can be easily adjusted to obtain the desired level of stringency for a particular application.
As used herein, the term "structural gene" is intended to generally describe a polynucleotide, such as a gene, which is expressed to produce the encoded peptide, polypeptide, protein, ribozyme, catalytic RNA molecule or antisense molecule.
The term "object" , as used herein, describes an organism, including mammals such as primates, for which treatment using the composition of the invention can be provided. Mammal species that can benefit from the disclosed treatment methods include, but are not limited to, ape; chimpanzee; orangutan; human; monkey; domestic animal such as dog and cat; livestock such as horse, cow, pig, sheep, goat, and chicken; and other animals, such as mouse, rat, guinea pig, and hamster.
The term "substantially complementary" , when used to define an amino acid or nucleic acid sequence, means that a specific target sequence, such as an oligonucleotide sequence, is substantially complementary to all or a part of a selected sequence, and therefore will specifically bind to a part of the mRNA encoding the selected sequence. Therefore, generally the sequence will be highly complementary to the mRNA "target" sequence, and will have no more than about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10 base mismatches and the like in the complementary portion of the sequence. In many cases, it may be desirable for the sequence to be an exact match, that is, to be completely complementary to the sequence to which the oligonucleotide specifically binds, and therefore have no mismatch along the complementary strand. Therefore, highly complementary sequences will generally bind fairly specifically to the target sequence region of the mRNA, and therefore will effectively reduce and/or even inhibit the translation of the target mRNA sequence into a polypeptide product.
The substantially complementary nucleic acid sequence will be more than about 80%and preferabley more than 85%complementary (or "%exact match" ) to the corresponding nucleic acid target sequence that specifically binds to the nucleic acid. In some aspects, as described above, it will be desirable to have an even more substantially complementary nucleic acid sequence for use in the practice of the present invention, and in such a case, the nucleic acid sequence will be more than about 90% (and more than about 95%in some embodiments) complementary to the corresponding target sequence that specifically binds to the nucleic acid, and will be exactly matched and complementary to all or even up to (and including) about 96%, about 97%, about 98%, about 99%, and even about 100%of the target sequence that specifically binds to the designed nucleic acid.
The percent similarity or percent complementarity of any disclosed nucleic acid sequence can, for example, be determined by comparing sequence information using the GAP computer program version 6.0 available from the University of Wisconsin Genetics Computer Group (UWGCG) . The GAP program uses the blast method of Needleman and Wunsch (1970) . In brief, the GAP program defines similarity as the  number of similar blast symbols (i.e., nucleotides or amino acids) divided by the total number of symbols in the shorter sequence of the two sequences. The preferred default parameters of the GAP program include: (1) the unary comparison matrix of nucleotides (including the value 1 for identity and the value 0 for non-identity) , and the weighted comparison matrix of Gribskov and Burgess (1986) , (2) The penalty for each gap is 3.0 and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps.
Naturally, the present invention also includes nucleic acid fragments that are complementary, essentially complementary, and/or substantially complementary to at least one or more specific nucleotide sequences specifically described herein. A "complementary" nucleic acid sequence is a nucleic acid sequence capable of base pairing according to the standard Watson-Crick complementation rule. As used herein, the term "complementary sequence" refers to a nucleic acid sequence that is substantially complementary, which can be assessed by the nucleotide comparison as above, or defined as being able to hybridize with one or more specific nucleic acid fragments disclosed herein under relatively stringent conditions, such as those just described above.
As used herein, the term "essentially free" or "essentially free" in relation to the amount of components preferably means that the composition contains less than about 10%by weight, preferably less than about 5%by weight, more preferably less than about 1%by weight of a certain compound. In preferred embodiments, these terms refer to less than about 0.5%by weight, less than about 0.1%by weight, or less than about 0.01%by weight.
The probes and primers used in the present invention can have any suitable length. By assigning numerical values to the sequence, for example, the first residue is 1, the second residue is 2, etc., an algorithm can be proposed to limit all probes or primers contained in a given sequence: n to n + y, wherein n is an integer from 1 to the last number of the sequence, y is the length of the probe or primer minus 1, wherein n + y does not exceed the last number of the sequence. Therefore, for a probe or primer with 25 base pairs (i.e., "25mer" ) , the set of probes or primers has an entire length of the  sequence corresponding to bases 1 to 25, bases 2 to 26, bases 3 to 27, bases 4 to 28, and so on. Similarly, for a probe or primer with 35 base pair (i.e., "35mer" ) , exemplary primer or probe sequences include, but are not limited to, the sequences have an entire length corresponding to bases 1 to 35, bases 2 to 36, bases 3 to 37, bases 4 to 38, and so on. Similarly, for 40mer, such probe or primer can correspond to the nucleotide from the first base pair to bp 40, from the second bp of the sequence to bp 41, from the third bp to bp 42, etc. For 50mer, such probe or primer can correspond to the nucleotide sequence extended from bp 1 to bp 50, from bp 2 to bp 51, from bp 3 to bp 52, from bp 4 to bp 53, etc.
As used herein, the term "substantially correspond to" , "substantially homologous" or "substantially identical" refers to the features of a nucleic acid or amino acid sequence, wherein the selected nucleic acid or amino acid sequence has at least about 70 or about 75%sequence identity compared to the selected reference nucleic acid or amino acid sequence. More generally, the selected sequence and the reference sequence will have at least about 76, 77, 78, 79, 80, 81, 82, 83, 84 or even 85%sequence identity, more preferably at least about 86, 87 , 88, 89, 90, 91, 92, 93, 94 or 95%sequence identity. Still more preferably, highly homologous sequences often share greater than at least about 96, 97, 98, or 99%sequence identity between the selected sequence and the reference sequence with which it is compared.
As used herein, "synthetic" shall mean that the substance does not origin from the human or animal.
The term "treatment practice period" refers to the period of time necessary for one or more active agents to be effective for treatment. The term "therapeutically effective" refers to reducing the severity and/or frequency of one or more symptoms, eliminating one or more symptoms and/or underlying causes, preventing the occurrence of symptoms and/or their underlying causes, and improving or repairing injury.
The "therapeutic agent" can be any physiologically or pharmacologically active substance, which can produce the desired biological effect at the target site of an object. The therapeutic agent can be a chemotherapeutic agent, an immunosuppressant,  a cytokine, a cytotoxic agent, a nuclear lytic compound, a radioisotope, a receptor, and a prodrug activating enzyme, which can be naturally occurring or produced by synthetic or recombinant methods or any combinations thereof. Drugs affected by classic multidrug resistance, such as vinblastine alkaloid (such as vinblastine and vincristine) , anthracycline (such as doxorubicin and daunorubicin) , a RNA transcription inhibitor (such as actinomycin) Bacteriocin-D) and a microtubule stabilizing drug (such as paclitaxel) may have specific uses as therapeutic agents. Cytokines can also be used as therapeutic agents. Examples of such cytokines are lymphokines, monocytes, and traditional polypeptide hormones. Cancer chemotherapeutic agents may be the preferred therapeutic agents. For more detailed descriptions of anticancer agents and other therapeutic agents, those skilled in the art can refer to various instruction manuals, including but not limited to, Physician's Desk Reference and Goodman and Gilman's "Pharmacological Basis of Therapeutics" Basis of Therapeutics" , Edition 10, Hardman et al. (ed. ) (2001) .
As used herein, "transcription factor recognition site" and "transcription factor binding site" refer to a polynucleotide sequence or sequence motif, which is identified as a sequence-specific interaction site of one or more transcription factors, often in the form of direct protein-DNA binding. Generally, the transcription factor binding site can be identified by DNA footprinting, gel mobility variation analysis, etc., and/or can be predicted based on known consensus sequence motifs or by other methods known to those of ordinary skill in the art.
"Transcription regulatory element" refers to a polynucleotide sequence that activates transcription alone or in combination with one or more other nucleic acid sequences. The transcriptional regulatory element may, for example, comprise one or more promoters, one or more response elements, one or more negative regulatory elements, and/or one or more enhancers.
"Transcription unit" refers to a polynucleotide sequence comprising at least a first structural gene that is operably linked to at least a first cis-acting promoter sequence and is optionally operably linked to one or more other cis-acting nucleic acid sequences necessary for the effective transcription of the structural gene sequence, as  well as if possible, the first structural gene is at least a first distal regulatory element required to operably place the appropriate tissue-specific and developmental transcription of the structural gene sequence under the control of the promoter and/or enhancer element, and any additional cis sequences necessary for effective transcription and translation (e.g., polyadenylation sites, mRNA stability control sequences, etc. ) .
As used herein, the term "transformation" is intended to generally describe a method of introducing an exogenous polynucleotide sequence (for example, a viral vector, plasmid, or recombinant DNA or RNA molecule) into a host cell or protoplast, in which the host The exogenous polynucleotide in the cell or protoplast is incorporated into at least the first chromosome or is capable of autonomous replication in the transformed host cell. Transfection, electroporation, and "naked" nucleic acid uptake all represent examples of techniques used to transform host cells with one or more polynucleotides.
As used herein, the term "transformed cell" means a host cell whose nucleic acid complementarity has been altered by introducing one or more exogenous polynucleotides into the cell.
"Treatment" as used herein refers to providing any type of medical or surgical management to an object. Treatment may include, but is not limited to, administration of a composition comprising a therapeutic agent to an object. "Treatment" includes administration or application of the compound or composition of the present invention to an object for purposes such as curing, reversing, alleviating, reducing the severity of, inhibiting the progression of, or reducing the possibility of a disease, disorder or condition or one or more symptoms or manifestations thereof. In some aspects, the composition of the invention may also be administered prophylactically, that is, before any symptoms or manifestations of the condition develop, where such prevention is guaranteed. Generally, in such cases, the object will be diagnosed as "at risk" develop such a disease or condition due to family history, medical history, or completion of one or more indications for subsequent diagnosis or prognostic testing of such disease or condition.
The term "vector" as used herein refers to a nucleic acid molecule (usually composed of DNA) that can replicate in a host cell and/or can be operatively linked to another nucleic acid fragment to cause replication of the connected fragment.
Exemplary vector is a plasmid, cosmid or virus.
The expression "zero order" or "near zero order" as applied to the release kinetics of the active agent from the disclosed vaccine delivery composition is intended to include the rate at which the active agent is released in a controlled manner during the therapeutic practice period after administration of the composition to achieve the therapeutically effective plasma concentration of the active agent.
In some embodiments, it will be advantageous to use one or more nucleic acid fragments of the present invention in combination with a suitable detectable label (i.e., "marker" ) , for example, in the case of hybridization analysis using a labeled polynucleotide probe to determine the presence of a given target sequence. A variety of appropriate indicator compounds and compositions are known in the art for labeling oligonucleotide probes, including but not limited to a fluorescent ligand, a radioligand, an enzyme ligand or other ligands such as avidin/biotin and the like, which can be detected in a suitable analysis. In specific embodiments, one or more fluorescent labels or enzyme tags, such as urease, alkaline phosphatase, or peroxidase, can also be used instead of radioactive or other environmentally less ideal reagents. In the case of enzyme tags, known colorimetric, color-developing or fluorescent indicator substrates can be used to provide a method that is visible to the human eyes or is detected by analytical methods such as scintillation scanning, fluorometry, spectrophotometry, etc., to identify specific hybridization to a sample containing one or more complementary or substantially complementary nucleic acid sequences. In the case of so-called "multiplex" analysis in which two or more labeled probes are detected simultaneously or sequentially, it may be necessary to label a first oligonucleotide probe by using a first marker having a first detection property or parameter (for example, emission and/or excitation spectrum maximum) , which also labels a second oligonucleotide by a second marker having a second detection property or parameter that is different (i.e., irrelevant or distinguishable from the first marker) . The use of multiplex analysis, especially in the context of genetic amplification/detection protocol, is well  known to those of ordinary skill in the field of molecular genetics.
Nucleic Acid
The term "nucleic acid" includes any compounds and/or substances that can or can be incorporated into an oligonucleotide chain. Exemplary nucleic acids used in accordance with this application include but are not limited to DNA, RNA including messenger mRNA (mRNA) , its hybrid, RNAi inducer, RNAi agent, siRNA, shRNA, miRNA, antisense RNA, ribozyme, catalytic DNA, RNA inducing triple helix formation, aptamer, vector, etc., which are described in detail in this application.
The term "deoxyribonucleic acid" , "DNA" or "DNA molecule" refers to a molecule composed of two strands (polynucleotides) , each of which containing a monomer unit of nucleotides. Nucleotides are linked to each other in the chain by a covalent bond between a glycosyl of one nucleotide and a phosphate group of the next nucleotide, creating an alternating glycosyl-phosphate group backbone. The nitrogenous bases of two separate polynucleotide chains are hydrogen bonded together to produce double-stranded DNA.
The term "ribonucleic acid" , "RNA" or "RNA molecule" refers to a chain composed of at least 2 base-glycosyl-phosphate groups. In one example, the term includes a compound composed of nucleotides, wherein the glycosyl moiety is ribose. In another example, the terminal includes RNA and RNA derivative in which the backbone is modified. In one example, RNA may be present in the form of tRNA (transfer RNA) , snRNA (small nuclear RNA) , rRNA (ribosomal RNA) , mRNA (messenger RNA) , antisense RNA, small inhibitory RNA (siRNA) , microRNA (miRNA) and ribozyme. The use of siRNA and miRNA has been described (CaudyA A et al, Genes &Devel16: 2491-96 and references cited therein) . In addition, these forms of RNA can be single-stranded, double-stranded, triple-stranded, or four-stranded. In another embodiment, the term also includes artificial nucleic acids having other types of backbones but with the same base. In another example, the artificial nucleic acid is PNA (Peptide Nucleic Acid) . PNA contains a peptide backbone and nucleotide bases, and can bind to DNA and RNA molecules in another example. In another example, the nucleotide is a modified oxetane. In another example, the nucleotide is modified by replacing one or more phosphodiester bonds with phosphorothioate bonds.  In another example, the modified nucleic acid includes any other variants of the phosphate backbone of natural nucleic acids known in the art. Those of ordinary skill in the art are familiar with the use of the phosphorothioate nucleic acid and PNA, which are described in, for example, Neilsen PE, CurrOpinStructBiol 9: 353-57; [0280] and Raz N Ket al BiochemBiophys Res Commun. 297: 1075-84. The production and use of nucleic acids are well known to those skilled in the art, which are described in Molecular Cloning, (2001) , Sambrook and Russell, eds. and Methods in Enzymology: Methodsformolecular cloning in eukaryotic cells (2003) Purchio and GC Fareed, wherein each of the nucleic acid derivatives represents a separate example of the present invention.
Modified Nucleic Acid
Disclosed herein is a modified nucleic acid, such as mRNA and synthesis method thereof. The nucleic acid used in accordance with the present application may be based on any existing technologies, including but not limited to chemical synthesis, enzymatic synthesis, usually in vitro transcription of the terminal of a longer precursor, enzymatic or chemical cleavage, etc. Methods of synthesizing RNA are well known in the art (see, for example, Gait, MJ (ed. ) Oligonucleotide synthesis: a practical approach, Oxford [Oxfordshire] , Washington, District of Columbia: IRL Press, 1984; and Herdewijn, P. (ed. ) Oligonucleotide synthesis: methods and applications, Methods in Molecular Biology, v. 288 (Clifton, NJ) Totowa, NJ: Humana Press, 2005; both are fully incorporated into this application by reference) . mRNA can be produced using a reaction mixture that includes RNA polymerase, a linear DNA template, and RNA polymerase reaction buffer (e.g., nucleotides such as ribonucleotides) . US Patent Publication US20120195936 and International Publication WO2011012316 disclose the use of RNA, both of which is incorporated into this application in its entirety by reference. RNA polymerase reaction buffer generally includes salts/buffering agents such as Tris, HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, sodium phosphate, sodium chloride, and magnesium chloride. The reaction mixture may have a pH of about 6 to 8.5, 6.5 to 8.0, 7.0 to 7.5, and in some example, the pH of 7.5. In one example, the reaction mixture includes NTP in a concentration range of 1-10 mM, DNA template in a  concentration range of 0.01-0.5 mg/ml, and RNA polymerase in a concentration range of 0.01-0.1 mg/ml, for example, the reaction mixture includes NTP at a concentration of 5 mM, DNA template at a concentration of 0.1 mg/ml, and RNA polymerase at a concentration of 0.05 mg/ml. In some embodiments, the DNA template is optimized or modified, which is different from natural DNA, and this difference is reflected in the difference in homology analysis. This modified DNA is reverse transcribed in vitro to form an optimized sequence. In some embodiments, the optimized DNA sequence is double-stranded, or it can be a single-stranded sequence synthesized in vitro. The homology between this optimized or improved DNA sequence and the natural sequence is less than 40%, or less than 45%, less than 50%, less than 55%, less than 58%, less than 60%, less than 65%, less than 70%, less than 69 %, less than 75%, less than 77%, less than 78%, less than 80%, less than 90%or less than 95%. It can even be considered that although the homology between the optimized DNA sequence and the natural sequence is only less than 95-99.9%, with a change of 1-2 nucleotides, there are indeed differences in function, which is also an embodiment of the present invention.
Similarly, the homology between the RNA sequence translated or transcribed by optimized or modified DNA and the natural RNA sequence is less than 40%, or less than 45%, less than 50%, less than 55%, less than 58%, and less than 60%, less than 65%, less than 70%, less than 69%, less than 75%, less than 77%, less than 78%, less than 80%, less than 90%or less than 95%. It can even be considered that although the homology between the optimized RNA sequence and the natural sequence is only less than 95-99.9%, with a change of 1-2 nucleotides, there are indeed functional differences, which is also an embodiment of the present invention.
According to the present invention, naturally occurring or modified nucleosides and/or nucleotides, or optimized nucleotides can be used to prepare modified nucleic acids, such as modified mRNA. For example, modified mRNA may include one or more natural nucleosides (for example, adenosine, guanosine, cytidine, uridine) ; modified nucleosides (for example, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine,  2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O (6) -methylguanine, pseudouridine (for example, N-1-methyl-pseudouridine) , 2-thiouridine and 2-thiocytidine) ; chemically modified bases; biologically modified bases (for example, methylated bases) ; inserted bases; modified saccharides (for example, 2'-fluororibose , ribose, 2'-deoxyribose, arabinose and hexose) ; modified phosphate groups (such as phosphorothioate and 5'-N-phosphoramidite bond) , or any combinations thereof. These modified nucleotides can be natural nucleotides, or artificially optimized or modified nucleotides.
An RNA molecule (e.g., mRNA) can include at least two nucleotides. Nucleotides can be naturally occurring nucleotides or modified nucleotides. In some examples, the RNA molecule includes about 5 nucleotides to about 5,000 nucleotides. In some examples, the RNA molecule includes at least about 5 nucleotides. In some examples, the RNA molecule include up to about 5,000 nucleotides. In some examples, the RNA molecule includes about 5 nucleotides to about 20 nucleotides, about 5 nucleotides to about 40 nucleotides, about 5 nucleotides to about 60 nucleotides , about 5 nucleotides to about 80 nucleotides, about 5 nucleotides to about 100 nucleotides, about 5 nucleotides to about 200 nucleotides, about 5 nucleotides to about 500 nucleotides, about 5 nucleotides to about 1,000 nucleotides, about 5 nucleotides to about 2,000 nucleotides, about 5 nucleotides to about 5,000 nucleotides, about 20 nucleotides to about 40 nucleotides, about 20 nucleotides to about 60 nucleotides, about 20 nucleotides to about 80 nucleotides, about 20 nucleotides to about 100 nucleotides, about 20 nucleotides to about 200 nucleotides, about 20 nucleotides to about 500 nucleotides, about 20 nucleotides to about 1,000 nucleotides, about 20 nucleotides to about 2,000 nucleotides, about 20 nucleotides to about 5,000 nucleotides, about 40 nucleotides to about 60 nucleotides, about 40 nucleotides to about 80 nucleotides, about 40 nucleotides to about 100 nucleotides, about 40 nucleotides to about 200 nucleotides, about 40 nucleotides, about 500 nucleotides, about 40 nucleotides to about 1,000 nucleotides, about 40 nucleotides to about 2000 nucleotides, about 40 nucleotides to about 5,000  nucleotides, about 60 nucleotides to about 80 nucleotides, about 60 nucleotides to about 100 nucleotides, about 60 nucleotides to about 200 nucleotides, about 60 nucleotides to about 500 nucleotides, about 60 nucleotides to about 1,000 nucleotides, about 60 nucleotides to about 2,000 nucleotides, about 60 nucleotides to about 5,000 nucleotides, about 80 nucleotides to about 100 nucleotides, about 80 nucleotides to about 200 nucleotides, about 80 nucleotides to about 500 nucleotides, about 80 nucleotides to about 1,000 nucleotides, about 80 nucleotides to about 2,000 nucleotides, about 80 nucleotides to about 5,000 nucleotides, about 100 nucleotides to about 200 nucleotides, about 100 nucleotides to about 500 nucleotides, about 100 nucleotides to about 1,000 nucleotides, about 100 nucleotides to about 2000 nucleotides, about 100 nucleotides to about 5,000 nucleotides, about 200 nucleotides to about 500 nucleotides, about 200 nucleotides to about 1,000 nucleotides, about 200 nucleotides to about 2000 nucleotides, about 200 nucleotides, about 5000 nucleotides, about 500 nucleotides to about 1,000 nucleotides, about 500 nucleotides to about 2000 nucleotides, about 500 nucleotides to about 5,000 nucleotides, about 1,000 nucleotides to about 2000 nucleotides, about 1,000 nucleotides to about 5,000 nucleotides, or about 2000 nucleotides to about 5,000 nucleotides. In some examples, the RNA molecule includes about 5 nucleotides, about 20 nucleotides, about 40 nucleotides, about 60 nucleotides, about 80 nucleotides, about 100 nucleotides , about 200 nucleotides, about 500 nucleotides, about 1,000 nucleotides, about 2000 nucleotides, or about 5000 nucleotides.
RNA molecules (e.g., mRNA) may include at least one modified nucleotide as described in this application. In some examples, the RNA molecule includes about 1 modified nucleotide to about 100 modified nucleotides. In some examples, the RNA molecule includes at least about 1 modified nucleotide. In some examples, the RNA molecule includes up to about 100 modified nucleotides. In some examples, the RNA molecule includes about 1 modified nucleotide to about 2 modified nucleotides, about 1 modified nucleotide to about 3 modified nucleotides, about 1 modified nucleotide to about 4 modified nucleotides, about 1 modified nucleotides to about 5 modified nucleotides, about 1 modified nucleotides to about 10 modified nucleotides, about 1 modified  nucleotides to about 20 modified nucleotides, about 1 modified nucleotides to about 100 modified nucleotides, about 2 modified nucleotides to about 3 modified nucleotides, about 2 modified nucleotides to about 4 modified nucleotides, about 2 modified nucleotides to about 5 modified nucleotides, about 2 modified nucleotides to about 10 modified nucleotides, about 2 modified nucleotides to about 20 modified nucleotides, about 2 modified nucleotides to about 100 modified nucleotides, about 3 modified nucleotides to about 4 modified nucleotides, about 3 modified nucleotides to about 5 modified nucleotides, about 3 modified nucleotides to about 10 modified nucleotides, about 3 modified nucleotides to about 20 modified nucleotides, about 3 modified nucleotides to about 100 modified nucleotides, about 4 modified nucleotides to about 5 modified nucleotides, about 4 modified nucleotides to about 10 modified nucleotides, about 4 modified nucleotides to about 20 modified nucleotides, about 4 modified nucleotides to about 100 modified nucleotides, about 5 modified nucleotides to about 10 modified nucleotides, about 5 modified nucleotides to about 20 modified nucleotides, about 5 modified nucleotides to about 100 modified nucleotides, about 10 modified nucleotides to about 20 modified nucleotides, about 10 modified nucleotides to about 100 modified nucleotides, or about 20 modified nucleotides to about 100 modified nucleotides. In some examples, the RNA molecule includes about 1 modified nucleotide, about 2 modified nucleotides, about 3 modified nucleotides, about 4 modified nucleotides, about 5 modified nucleotides, about 10 kinds of modified nucleotides, about 20 kinds of modified nucleotides, or about 100 kinds of modified nucleotides.
RNA molecules (e.g., mRNA) can include at least 0.1%modified nucleotides. The fraction of modified nucleotides can be calculated as: number of modified nucleotides/total number of nucleotides*100%. In some examples, the RNA molecule includes about 0.1%modified nucleotides to about 100%modified nucleotides. In some examples, the RNA molecule includes at least about 0.1%modified nucleotides. In some examples, the RNA molecule includes up to about 100%modified nucleotides. In some examples, the RNA molecule includes about 0.1%modified nucleotides to about 0.2%modified nucleotides, about 0.1%modified nucleotides to about 0.5%modified nucleotides, about 0.1%modified  nucleotides to about about 1%modified nucleotides, about 0.1%modified nucleotides to about 2%modified nucleotides, about 0.1%modified nucleotides to about 5%modified nucleotides, about 0.1%modified nucleotides to about 10%modified nucleotides, about 0.1%modified nucleotides to about 20%modified nucleotides, about 0.1%modified nucleotides to about 50%modified nucleotides, about 0.1%modified nucleotides to about 100%modified nucleotides, about 0.2%modified nucleotides to about 0.5%modified nucleotides, about 0.2%modified nucleotides to about 1%modified nucleotides, about 0.2%modified nucleotides to about 2%modified nucleotides, about 0.2%modified nucleotides to about 5%modified nucleotides, about 0.2%modified nucleotides to about 10%modified nucleotides, about 0.2%modified nucleotides to about 20%modified nucleotides, about 0.2%modified nucleotides to about 50%modified nucleotides, about 0.2%modified nucleotides to about 100%modified nucleotides, about 0.5%modified nucleotides to about 1%modified nucleotides, about 0.5%modified nucleotides to about 2%modified nucleotides, about 0.5%modified nucleotides to about 5%modified nucleotides, about 0.5%modified nucleotides to about 10%modified nucleotides, about 0.5%modified nucleotides to about 20%modified nucleotides, about 0.5%modified nucleotides to about 50%modified nucleotides, about 0.5%modified nucleotides to about 100%modified nucleotides, about 1%modified nucleotides to about 2%modified nucleotides, about 1%modified nucleotides to about 5%modified nucleotides, about 1%modified nucleotides to about 10%modified nucleotides, about 1%modified nucleotides to about 20%modified nucleotides, about 1%modified nucleotides to about 50%modified nucleotides, about 1%modified nucleotides to about 100%modified nucleotides, about 2%modified nucleotides to about 5%modified nucleotides, about 2%modified nucleotides to about 10%modified nucleotides, about 2%modified nucleotides to about 20%modified nucleotides, about 2%modified nucleotides to about 50%modified nucleotides, about 2%modified nucleotides to about 100%modified nucleotides, about 5%modified nucleotides to about 10%modified nucleotides, about 5%modified nucleotides to about 20%modified nucleotides, about 5%modified nucleotides to about 50%modified nucleotides, about 5%modified nucleotides to about 100%modified nucleotides, about 10%modified nucleotides to about 20%modified nucleotides, about 10%modified nucleotides to about 50% modified nucleotides, about 10%modified nucleotides to about 100%modified nucleotides, about 20%modified nucleotides to about 50%modified nucleotides, about 20%modified nucleotides to about 100%modified nucleotides or about 50%modified nucleotides to about 100%modified nucleotides. In some examples, the RNA molecule includes about 0.1%modified nucleotides, about 0.2%modified nucleotides, about 0.5%modified nucleotides, about 1%modified nucleotides, about 2%modified nucleotides, about 5%modified nucleotides, about 10%modified nucleotides, about 20%modified nucleotides, about 50%modified nucleotides, or about 100%modified nucleotides.
Nucleotides such as ribonucleotides (e.g., in combination of ATP, GTP, CTP, and UTP) are used at a total concentration of between 0.5 mM and about 500 mM in the reaction. In some examples, the total concentration of nucleotides is about 0.5 mM to about 500 mM. In some examples, the total concentration of nucleotides is at least about 0.5 mM. In some examples, the total concentration of nucleotides is up to about 500 mM. In some examples, the total concentration of nucleotides is about 0.5 mM to about 1 mM, about 0.5 mM to about 5 mM, about 0.5 mM to about 10 mM, about 0.5 mM to about 50 mM, about 0.5 mM to about 100 mM, about 0.5 mM to about 200 mM, about 0.5 mM to about 300 mM, about 0.5 mM to about 500 mM, about 1 mM to about 5 mM, about 1 mM to about 10 mM, about 1 mM to about 50 mM, about 1 mM to about 100 mM, about 1 mM to about 200 mM, about 1 mM to about 300 mM, about 1 mM to about 500 mM, about 5 mM to about 10 mM, about 5 mM to about 50 mM, about 5 mM to about 100 mM, about 5 mM to about 200 mM, about 5 mM to about 300 mM, about 5 mM to about 500 mM, about 10 mM to about 50 mM, about 10 mM to about 100 mM, about 10 mM to about 200 mM, about 10 mM to about 300 mM, about 10 mM to about 500 mM, about 50 mM to about 100 mM, about 50 mM to about 200 mM, about 50 mM to about 300 mM, about 50 mM to about 500 mM , about 100 mM to about 200 mM, about 100 mM to about 300 mM, about 100 mM to about 500 mM, about 200 mM to about 300 mM, about 200 mM to about 500 mM, or about 300 mM to about 500 mM. In some examples, the total concentration of nucleotides is about 0.5 mM, about 1 mM, about 5 mM, about 10 mM, about 50 mM, about 100 mM, about 200 mM, about 300 mM, or about 500 mM.
Post-synthesis Processing
After synthesis, 5'-cap and/or 3'-tail can be added. The presence of the cap can provide resistance to nucleases found in most eukaryotic cells. The presence of "tail" can be used to protect mRNA from exonuclease degradation and/or to regulate protein expression levels.
5'-cap can be added as follows: firstly, one terminal phosphate group is removed from the 5'-nucleotide by RNA terminal phosphatase, leaving two terminal phosphate groups; then guanosine triphosphate (GTP) is added to the terminal phosphate group by guanylyltransferase to produce 5', 5', 5'-triphosphate bond; then the 7-nitrogen of guanine is methylated by methyltransferase. Examples of the cap structure include, but are not limited to, m7G (5') ppp (5' (A, G (5') ppp (5') A and G (5') ppp (5') G. More cap structures are described in the published U.S. Application No. US 2016/0032356, AshqulHaque et al., “Chemically modified hCFTR mRNAs recuperate lung function in a mouse model of cysticfibrosis” , Scientific Reports (2018) 8: 16776, and Kore et al., “Recent Developments in 5'-Terminal Cap Analogs: Synthesis and Biological Ramifications” Mini-Reviews in Organic Chemistry 2008, 5, 179-192, which is incorporated into this application by reference.
The tail structure may include poly (A) and/or poly (C) tails. The poly-A tail on the 3'-terminal of the mRNA (for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides at the 3'-terminal) may include at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%or 99%adenosine nucleotides. The poly-A tail on the 3'-terminal of the mRNA (for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides at the 3'-terminal) may include at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%or 99%cytosine nucleotides.
As described in this application, the addition of 5'-cap and/or 3'-tail can help to detect invalid transcripts produced during in vitro synthesis, because the size of those mRNA transcripts that are terminated prematurely may be too small to be detected without capping and/or tailing. Therefore, in some examples, 5'-cap and/or 3'-tail are added to the synthetic mRNA before testing for mRNA purity (e.g., the level of invalid transcripts present in the  mRNA) . In some examples, 5'-cap and/or 3'-tail are added to the synthesized mRNA before purifying the mRNA as described in this application. In other examples, 5'-cap and/or 3'-tail are added to the synthesized mRNA after purifying the mRNA as described in this application.
In addition to the above methods, the steps of capping or tailing are always completed during the transcription in vitro from DNA to RNA. These methods are freely selected by those skilled in the art.
The mRNA synthesized according to the present invention can be used without further purification. In particular, mRNA synthesized according to the present invention can be used without a step of removing short polymers. In some examples, mRNA synthesized according to the present invention can be further purified. According to the present invention, synthesized mRNA can be purified by various methods. For example, mRNA can by purified by centrifugation, filtration, and/or chromatography. In some examples, the synthesized mRNA is purified by ethanol precipitation or filtration or chromatography, or gel purification, or any other suitable methods. In some examples, mRNA is purified by HPLC. In some examples, mRNA is extracted in standard solution of phenol: chloroform: isoamyl alcohol, which is well known to those skilled in the art. In some examples, mRNA is purified by tangential flow filtration. Suitable purification methods include methods described in US 2016/0040154, US 2015/0376220, PCT application PCT/US18/19954 filed on February 27, 2018, entitled "Method for Purifying Messenger RNA" , and PCT application PCT/US18/19978 filed on Febrary 27, 2018, entitled "Method for Purifying Messenger RNA" , all of which are incorporated into this application by reference and can be used to implement the present invention.
In some examples, mRNA is purified before capping and tailing. In some examples, mRNA is purified after capping and tailing. In some examples, mRNA is purified both before and after capping and tailing. In some examples, mRNA is purified by centrifugation before or after capping and tailing, or both. In some examples, mRNA is purified by filtration before or after capping and tailing, or both. In some examples, mRNA is purified by tangential flow filtration (TFF) before or after capping and tailing, or both. In some  examples, mRNA is purified by chromatography before or after capping and tailing, or both.
In some embodiments, tailing is accompanied by transcription. Therefore, the nucleic acid can also be purified after completion of the tailing and capping steps. The purification method is as described above. Therefore, in some embodiments, the purification step should be performed after tailing. Of course, mRNA can also be purified before capping. Of course, it can also be purified after transcription.
The full-length or null transcript of mRNA can be detected and quantified by any methods available in the art. In some examples, the synthetic mRNA molecules are detected using blotting, capillary electrophoresis, chromatography, fluorescence, gel electrophoresis, HPLC, silver staining, spectroscopy, ultraviolet (UV) or UPLC, or combinations thereof. Other detection methods known in the art are included in the present invention. In some examples, the synthesized mRNA molecules are detected by capillary electrophoresis separation using UV absorption spectroscopy. In some examples, the mRNA is denatured with glyoxal dye before gel electrophoresis ( "glyoxal gel electrophoresis" ) . In some examples, the synthetic mRNA is characterized before capping or tailing. In some examples, the synthetic mRNA is characterized after capping and tail sealing.
In some examples, the mRNA produced by the methods disclosed herein includes less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, Less than 1%, less than 0.5%, less than 0.1%of impurities other than full-length mRNA. Impurities include IVT contaminants, such as proteins, enzymes, free nucleotides and/or short polymers.
In some examples, the mRNA prepared according to the invention is substantially free of short polymers or null transcripts. In particular, the mRNA prepared according to the present invention includes undetectable levels of short polymers or invalid transcripts by capillary electrophoresis or glyoxal gel electrophoresis. As used herein, the term "short polymer" or "null transcript" refers to any transcripts that are less than full length. In some examples, "short polymer" or "null transcript" has a length of less than 100, less than 90,  less than 80, less than 70, less than 60, less than 50, less than 40, less than 30, less than 20, or less than 10 nucleotides. In some examples, the short polymers is detected or quantified after addition of 5'-cap and/or 3'-poly A tail.
UTR Sequence
3'-untranslated region (3'-UTR) : generally, the term "3'-UTR" refers to a part of an artificial nucleic acid molecule that is located at 3' (i.e., "downstream" ) of the open reading frame, and it is not translated as protein. Generally, the 3'-UTR is a part of the mRNA between the protein coding region (open reading frame (ORF) or coding sequence (CDS) ) of the mRNA and the polyadenylation sequence. In the context of the present invention, the term 3'-UTR may also comprises an element that is not encoded in the template, from which RNA is transcribed, but are added after transcription during the maturation process, such as polyadenylic acid sequence. The 3'-UTR of mRNA is not translated into an amino acid sequence. The 3'-UTR sequence is usually encoded by the gene that is transcribed into the respective mRNA during gene expression. The genomic sequence is first transcribed into premature mRNA containing optional introns. The prematuration mRNA is then further processed into mature mRNA during the maturation process. The maturation process includes the following steps: 5′ capping, splicing of premature mRNA to excise optional introns and modification at 3′-terminal (such as polyadenylation at 3′-terminal of premature mRNA and optional endonuclease/or exonuclease cutting, etc. ) . Within the scope of the present invention, 3'-UTR corresponds to a stop codon located in the protein coding region, preferably between the 3'-terminal of the stop codon of the protein coding region and the polyadenylation sequence of the mRNA. The term "corresponding to" means that the 3'-UTR sequence can be RNA sequence as used to define the 3'-UTR sequence in an mRNA sequence, or in a DNA sequence corresponding to this RNA sequence. Within the scope of the present invention, the term "3'-UTR of a gene" refers to a sequence corresponding to the 3'-UTR of a mature mRNA derived from the gene, which is obtained through gene transcription and maturation of pre-mRNA. The term "3'-UTR of a gene" includes the DNA sequence and the RNA sequence of the 3'-UTR (both sense and antisense strands and both mature and immature) . Preferably, the 3'UTR has a length of more than 20,  30, 40 or 50 nucleotides. 3'-untranslated region (3'UTR) : 3'UTR is typically a part of the mRNA, which is located between the protein coding region (i.e., reading frame) of the mRNA and the polyadenylation sequence. The 3'UTR of mRNA is not translated into an amino acid sequence. Within the scope of the present invention, 3'UTR corresponds to the 3'-terminal of the stop codon in the protein coding region, preferably immediately to 3'-terminal of the stop codon in the protein coding region, and in direction to the 5'-terminal of the polyadenylic acid sequence, preferably, the mature mRNA sequence extends to the nucleotides immediately to 5’-terminal of the polyadenylic acid sequence. The term "corresponding to" means that the 3'UTR sequence can be RNA sequence as used to define the 3'UTR sequence in an mRNA sequence, or in a DNA sequence corresponding to this RNA sequence. Within the scope of the present invention, the term "3'UTR of a gene" , such as "3'UTR of an albumin gene" , refers to a sequence corresponding to the 3'UTR of a mature mRNA derived from the gene, which is obtained through gene transcription and maturation of pre-mRNA. The term "3'UTR of a gene" includes the DNA sequence and the RNA sequence of the 3'UTR.
5'-untranslated region (5'-UTR) : generally, the term "5'-UTR" refers to a part of an artificial nucleic acid molecule that is located at 5' (i.e., "upstream" ) of the open reading frame, and it is not translated as protein. 5'-UTR is generally understood as a specific fragment of messenger RNA (mRNA) that is located 5'-terminal of the open reading frame of the mRNA. Generally, the 5'-UTR starts at the transcription start site and terminates at one nucleotide before the start codon of the open reading frame. Preferably, the 5'UTR has a length of more than 20, 30, 40 or 50 nucleotides. 5'-UTR may contain elements for controlling gene expression, also called regulatory elements. The regulatory element may be, for example, a ribosome binding site. 5'-UTR can be modified post-transcriptionally, for example by addition of 5'-cap modification. The 5'-UTR of mRNA is not translated into an amino acid sequence. The 5'-UTR sequence is usually encoded by the gene that is transcribed into the respective mRNA during gene expression. The genomic sequence is first transcribed into pre-mRNA, which contains optional introns. The pre-mature mRNA is then further processed into mature mRNA during the maturation process. The maturation process includes the following steps: 5′ capping, splicing of premature mRNA to excise  optional introns and modification at 3′-terminal (such as polyadenylation at 3′-terminal of premature mRNA and optional endonuclease/or exonuclease cutting, etc. ) . Within the scope of the present invention, 5'-UTR corresponds to a mature mRNA sequence located between the start codon and, for example, the 5'-cap. Preferably, the 5′-UTR corresponds to the sequence extends from the nucleotide located on the 3′ side of the 5′-cap, more preferably from the nucleotideat 3′ side immediately adjacent to the 5′-cap, to the 5′ side of the start codon of the protein coding region, preferably, to the nucleotide at 5’ side immediately to the start codon of the protein coding region. The nucleotide at 3’ side immediately to the 5'-cap of the mature mRNA typically corresponds to the transcription start site. The term "corresponding to" means that the 5'-UTR sequence can be RNA sequence as used to define the 5'-UTR sequence in an mRNA sequence, or in a DNA sequence corresponding to this RNA sequence. Within the scope of the present invention, the term "5'-UTR of a gene" refers to a sequence corresponding to the 5'-UTR of a mature mRNA derived from the gene, which is obtained through gene transcription and maturation of pre-mRNA. The term "5'-UTR of a gene" includes the DNA sequence and the RNA sequence of the 5'-UTR (both sense and antisense strands and both mature and immature) .
The present invention relates to an artificial nucleic acid molecule, which comprises an open reading frame ORF, 3'-untranslated region elements (3'-UTR elements) and/or 5'-untranslated region elements (5'-UTR elements) and optionally polyadenylation sequence and/or polyadenylation-signal.
The present invention also relates to a vector containing a 3'-UTR element and/or a 5'-UTR element, to a cell containing the artificial nucleic acid molecule or the vector, and to a pharmaceutical composition containing the artificial nucleic acid molecule or the vector, and a kit comprising the artificial nucleic acid molecule, the vector and/or the pharmaceutical composition, which is preferably used in the field of gene therapy and/or gene vaccination.
As an alternative to mRNA stabilization, it has been found that naturally occurring eukaryotic mRNA molecules contain characteristic stabilization elements. For example, they can contain so-called untranslated regions (UTR) at their 5'-terminal (5'-UTR) and/or at their 3'-terminal (3'-UTR) and other structural features, such as 5'cap structure or  3'-polyadenylate tail. Both 5'-UTR and 3'-UTR are typically transcribed from genomic DNA and are therefore premature mRNA elements. In the process of mRNA processing, the unique structural features of mature mRNA, such as 5'cap and 3'-polyadenylate tail (also called polyadenylate tail or polyadenylate sequence) are usually added to the transcribed (premature) mRNA.
The 3'-polyadenylate tail is typically a monotonic adenosine nucleotide sequence added to the 3'-terminal of the transcribed mRNA. It can contain up to about 400 adenosine nucleotides. It is found that the length of this 3'-polyadenylate tail is a possible key element for the stability of individual mRNA. In addition, it has been shown that the 3'UTR of α-globin mRNA may be an important factor for the stability of the well-known α-globin mRNA (Rodgers et al., Regulatedα-globin mRNA decay is a cytoplasmic eventproceeding through 3'-to-5'exosome-dependent decapping, RNA, 8, pages 1526-1537, 2002) . The 3'UTR of α-globulin mRNA is obviously involved in the formation of specific nucleoprotein-complex (α-complex) , and its existence is related to the stability of mRNA in vitro (Wang et al., An mRNA stability complex functions with poly (A) -binding protein to stabilize mRNA in vitro, Molecular and Cellular biology, Volume 19, Issue 7, July 1999, pages 4552-4560) . The UTR in the ribosomal protein mRNA has further shown interesting regulatory functions: while the 5'-UTR of the ribosomal protein mRNA controls the translation of growth-related mRNA, the stringency of this regulation is conferred by each 3'-UTR in the ribosomal protein mRNA (Ledda et al., Effect of the 3'-UTR length on the translational regulation of 5'-terminal oligopyrimidine mRNAs, Gene, Vol. 344, 2005, p. 213-220) . This mechanism promotes the specific expression of ribosomal proteins, which are usually transcribed in a constant manner so that some ribosomal protein mRNAs such as ribosomal protein S9 or ribosomal protein L32 are called housekeeping genes (Janovick-Guretzky et al., Housekeeping Gene Expression in Bovine Liver is Affected by Physiological State, Feed Intake, and Dietary Treatment, J. Dairy Sci., Vol. 90, 2007, p. 2246-2252) . The growth-related expression patterns of ribosomal proteins are therefore mainly due to the regulation of translation levels.
The term "3'-UTR element" refers to a nucleic acid sequence comprising a 3'-UTR or a variant or fragment derived from a 3'-UTR or a variant derived from a 3'-UTR or a  3'-UTR or a nucleic acid sequence composed of a fragment of the nucleic acid sequence. The "3'-UTR element" preferably refers to an artificial nucleic acid sequence, such as a nucleic acid sequence contained in the 3'-UTR of artificial mRNA. Therefore, in the meaning of the present invention, preferably, the 3'-UTR element can be comprised by the 3'-UTR of mRNA, preferably artificial mRNA, or the 3'-UTR element can be comprised by the 3'-UTR of the respective transcription template. Preferably, the 3'-UTR element is a nucleic acid sequence corresponding to the 3'-UTR of the mRNA, preferably an artificial mRNA, such as the 3'-UTR of the mRNA obtained by transcribing a genetically modified vector construct. Preferably, the 3'-UTR element in the meaning of the present invention functions as a 3'-UTR or encodes a nucleotide sequence that performs the function of the 3'-UTR.
Therefore, the term "5'-UTR element" refers to a nucleic acid sequence comprising a variant or fragment derived from 5'-UTR or 5'-UTR or a variant or fragment derived from 5'-UTR or a nucleic acid sequence composed of the nucleic acid sequence of a variant or fragment of 5’-UTR. The "5'-UTR element" preferably refers to an artificial nucleic acid sequence, such as a nucleic acid sequence contained in the 5'-UTR of artificial mRNA. Therefore, in the meaning of the present invention, preferably, the 5'-UTR element can be comprised by the 5'-UTR of mRNA, preferably artificial mRNA, or the 5'-UTR element can be comprised by the 5'-UTR of the respective transcription template. Preferably, the 5'-UTR element is a nucleic acid sequence corresponding to the 5'-UTR of the mRNA, preferably an artificial mRNA, such as the 5'-UTR of the mRNA obtained by transcribing a genetically modified vector construct. Preferably, the 5'-UTR element in the meaning of the present invention functions as a 5'-UTR or encodes a nucleotide sequence that performs the function of the 5'-UTR.
The 3'-UTR element and/or 5'-UTR element in the artificial nucleic acid molecule according to the present invention extends and/or increases the protein production from the artificial nucleic acid molecule. Therefore, the artificial nucleic acid molecule according to the present invention may especially include the following one or several functional 3'-UTR elements and/or 5'-UTR elements: increasing the 3'-UTR element produced from the protein of the artificial nucleic acid molecule, extending the 3'-UTR element produced  from the protein of the artificial nucleic acid molecule, increasing and extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule, increasing the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, extending the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, increasing and extending the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, increasing the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and increasing the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, increasing the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and extending the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, increasing the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and increasing and extending the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and increasing the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and extending the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and increasing and extending the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, increasing and extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and increasing the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, increasing and extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and extending the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, or increasing and extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and increasing and extending the 5'-UTR element produced from the protein of the artificial nucleic acid molecule. Preferably, the artificial nucleic acid molecule according to the present invention comprises a 3'-UTR element that prolongs protein production from the artificial nucleic acid molecule and/or a 5'-UTR element that increases protein production from the artificial nucleic acid molecule. Preferably, the artificial nucleic  acid molecule according to the present invention comprises at least one 3'-UTR element and at least one 5'-UTR element, that is, at least one 3'-UTR element that extends and/or increases protein production from the artificial nucleic acid molecule and is derived from stable mRNA, and at least one 5'-UTR element that extends and/or increases protein production from the artificial nucleic acid molecule and is derived from stable mRNA. "Extending and/or increasing protein production from the artificial nucleic acid molecule" generally refers to the absence of 3'-UTR and/or 5'-UTR or the inclusion of reference 3'-UTR and/or reference 5'-UTR (such as the 3'-UTR and/or 5'-UTR that naturally exist in combination with ORF) , compared with the amount of protein produced by each reference nucleic acid, from those with each 3'-UTR element and/or 5'-UTR element The amount of protein produced by the artificial nucleic acid molecule according to the present invention. In particular, comparing with each nucleic acid lacking 3'-UTR and/or 5'-UTR or containing reference 3'-UTR and/or 5'-UTR, such as 3'-and/or 5'-UTR that naturally exists in combination with ORF, at least one 3'-UTR element and/or 5'-UTR element of the artificial nucleic acid molecule according to the present invention is extended from the artificial nucleic acid molecule according to the present invention, for example from the protein produced from the mRNA according to the present invention. Especially, comparing with each nucleic acid lacking 3'-and/or 5'-UTR or containing reference 3'-and/or 5'-UTR, such as 3'-and/or 5'-UTR that naturally exists in combination with ORF, at least one 3'-UTR element and/or 5'-UTR element of the artificial nucleic acid molecule according to the present invention increases protein production from the artificial nucleic acid molecule according to the present invention, for example from the mRNA according to the present invention, especially protein expression and/or total protein production. Preferably, comparing with the translation efficiency of each nucleic acid lacking 3'-UTR and/or 5'-UTR or containing reference 3'-UTR and/or reference 5'-UTR, such as 3'-UTR and/or 5'-UTR that naturally exists in combination with ORF, the at least one 3'-UTR element and/or the at least one 5'-UTR element of the artificial nucleic acid molecule of the present invention does not negatively affect the translation efficiency of the nucleic acid. Even more preferably, the translation efficiency is enhanced by 3'-UTR and/or 5'-UTR compared to the protein encoded by each ORF in its natural state. The term "each nucleic acid  molecule" or "reference nucleic acid molecule" as used herein means that -in addition to a different 3'-UTR and/or 5'-UTR -a reference nucleic acid molecule is comparable, preferably identical with a 3'-UTR element and/or the 5'-UTR element of the artificial nucleic acid molecule of the present invention.
In some embodiments, the 5'-terminal and 3'-terminal of the ORF of the present invention include, for example, one UTR sequence comprising 5'UTR shown in SEQ NO: 36-1 to 36-12, or one or more of the 3'UTR sequences shown in SEQ NO: 37-1 to 37-12. In some embodiments, the 5'UTR sequence is a sequence shown in SEQ NO: 36-11, the 3'UTR sequence is a sequence shown in SEQ NO: 37-11; or the 5'UTR sequence is a sequence shown in SEQ NO: 36-12, the 3'UTR sequence is a sequence shown in SEQ NO: 37-12. Alternatively, in some embodiments, the 3'-terminal of the ORF sequence of the present invention comprises the sequence shown in SEQ NO: 37-11 or SEQ NO: 37-12.
Pharmaceutical Composition
The application also discloses a pharmaceutical composition comprising a compound, a modified nucleoside, a modified nucleotide, or the modified nucleic acid provided in the application.
In some examples, the pharmaceutical composition of the present invention can be administered to a subject by any methods known to those skilled in the art, such as parenteral, oral, transmucosal, transdermal, intramuscular, intravenous, intradermal, Subcutaneous, intraperitoneal, intraventricular, intracranial, intravaginal or intratumoral administration.
The pharmaceutical composition can be administered by intravenous, intraarterial or intramuscular injection of the liquid formulation. Suitable liquid preparations include solution, suspension, dispersion, emulsion, oil and the like. In some examples, the pharmaceutical composition is administered intravenously and therefore is formulated in a form suitable for intravenous administration. In some examples, the pharmaceutical composition is administered intraarterially and therefore is formulated in a form suitable for intraarterial administration. In some examples, the pharmaceutical composition is administered intramuscularly and therefore is formulated in a form suitable for  intramuscular administration.
The pharmaceutical composition can be administered by using a vesicle, for example, a liposome (see Langer, Science 249: 1527-1533 (1990) ; Treatetal., inLiposomesin the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (ed. ) , Liss, New York, pp. 353 -365 (1989) ; Lopez-Berestein, ibid., pp. 317-327; see generallyibid) .
The pharmaceutical composition can be administered orally, and therefore can be formulated into a form suitable for oral administration, that is, a solid or liquid preparation. Suitable solid oral preparations may include tablet, capsule, granule, pill and the like. Suitable liquid oral preparations may include solution, suspension, dispersion, emulsion, and oil.
The pharmaceutical composition can be administered topically to the body surface and therefore can be formulated into a form suitable for topical administration. Suitable topical preparations may include gel, ointment, cream, lotion, drop and the like. For topical administration, the composition or a physiologically tolerable derivative thereof can be prepared and applied to a physiologically acceptable diluent as a solution, suspension or emulsion with or without a pharmaceutical carrier. The pharmaceutical composition can be administered as a suppository, such as a rectal suppository or a urethral suppository. In some examples, the pharmaceutical composition is administered by subcutaneously implanted particles. In some examples, the particles provide controlled release of the agent over a period of time. The pharmaceutical composition may additionally include pharmaceutically acceptable excipients, as used in this application, including any and all solvents, dispersion media, diluents or other liquid carriers, dispersion or suspension aids, surfactants, isotonic agents, Thickeners or emulsifiers, preservatives, solid binders, lubricants, and the like, which are suitable for the specific dosage form required. Remington's "Science and Practice of Pharmacy" , Edition 21, ARGennaro (Lippincott, Williams &Wilkins, Baltimore, Md., 2006; incorporated herein by reference) discloses various excipients for formulating pharmaceutical compositions and known techniques for its preparation.
In some examples, the purity of the pharmaceutically acceptable excipient is at least  95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%. In some examples, excipients are approved for human and veterinary use. In some examples, the excipient is approved by Food and Drug Administration. In some examples, the excipient is pharmaceutical grade. In some examples, the excipient meets the standards of the United States Pharmacopoeia (USP) , European Pharmacopoeia (EP) , British Pharmacopoeia, and/or International Pharmacopoeia.
Pharmaceutically acceptable carriers for the liquid formulation can be aqueous or non-aqueous solution, suspension, emulsion or oil. Examples of the non-aqueous solvent may be propylene glycol, polyethylene glycol, and injectable organic ester such as ethyl oleate. Aqueous carrier can include water, alcohol/aqueous solution, emulsion or suspension, including saline and buffered media. Examples of oil may be the oil of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, olive oil, sunflower oil, and cod liver oil.
Carriers for parenteral administration (for subcutaneous, intravenous, intraarterial or intramuscular injection) may include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's solution and fixed oil. Intravenous carriers include fluid and nutritional supplement, electrolyte supplement, such as Ringer's dextrose-based electrolyte supplement, and the like. Examples may be sterile liquid, such as water and oil, with or without the addition of surfactants and other pharmaceutically acceptable adjuvants. Generally, water, saline, aqueous dextrose and related sugar solution, and glycol such as propylene glycol or polyethylene glycol are the preferred liquid carriers, especially for injectable solutions. Examples of oil may be the oil of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, olive oil, sunflower oil, and cod liver oil.
The pharmaceutical composition may further include a binder (e.g., acacia, corn starch, gelatin, carbomer, ethyl cellulose, guar gum, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, povidone) , a disintegrant (such as corn starch, potato starch, alginic acid, silicon dioxide, croscarmellose sodium, crospovidone, guar gum, sodium starch glycolate) , various pH and ionic strength buffer (such as Tris-HCl, acetate,  phosphate) , an additive such as albumin or gelatin and the like to prevent absorption on the surface, a detergent (such as Tween 20, Tween 80, pluronic F68, bile salt) , a protease inhibitor, a surfactant (such as sodium lauryl sulfate) , a penetration enhancer, a solubilizer (such as glycerin, polyethylene glycol glycerin) , an antioxidant (such as ascorbic acid, sodium metabisulfite, butylatedhydroxyanisole) , a stabilizer (such as hydroxypropyl cellulose, hydroxypropyl methyl cellulose) , a thickener (such as carbomer, colloidal silicon dioxide, ethyl cellulose, guar gum) , a sweetener (such as aspartame, citric acid) , a preservative (such as thimerosal, benzyl alcohol, paraben) , a lubricant (such as stearic acid, magnesium stearate, polyethylene glycol, sodium dodecyl sulfate) , a flow aid (such as colloidal silicon dioxide) , a plasticizer (such as diethyl phthalate, triethyl citrate) , an emulsifier (such as carbomer, hydroxypropyl cellulose, sodium dodecyl sulfate) , a polymer coating (such as poloxamer or poloxamine) , a coating and film former (such as ethyl cellulose, acrylate, polymethacrylate) and/or an adjuvant.
The pharmaceutical composition provided in this application may be a controlled release composition, that is, a composition in which the compound is released within a period of time after administration. The controlled release or sustained release composition may include a formulation in lipophilic depot (e.g. fatty acid, wax, oil) . In some examples, the pharmaceutical composition may be an immediate release composition, i.e., a composition in which the entire compound is released immediately after administration.
Suitable devices for delivering the intradermal pharmaceutical composition described in this application may include short needle devices such as those described in U.S. Patents 4,886,499, 5,190,521, 5,328,483, 5,527,288, 4,270,537, 5,015,235, 5,141,496, and 5,417,662. The intradermal composition can be applied through a device that limit the effective penetration length of the needle into the skin, such as those described in PCT Publication WO 99/34850 and their functional equivalents. A jet injection device that delivers the liquid composition to the dermis through a liquid jet syringe and/or through a needle that pierces the stratum corneum and generates a jet that reaches the dermis may be suitable. The jet injection equipment is described in, for example, U.S. Patent Nos. 5,480,381, 5,599,302, 5,334,144, 5,993,412, 5,649,912, 5,569,189, 5,704,911, 5,383,851,  5,893,397, 5,466,220, 5,339,163, 5,312,335, 5,503,639, 4,880, and PCT 4,940, 4,880, and PCT publications 97/37705 and WO 97/13537. A ballistic powder/particle delivery device using compressed gas to accelerate vaccine in powder form through the outer layer of the skin to the dermis may be suitable. Alternatively or in addition, a conventional syringe can be used in the classic intradermal method of tuberculin administration intradermally.
Delivery Carrier
Any methods can be used to formulate and deliver mRNA synthesized according to the present invention for protein production in vivo. In some examples, the mRNA is encapsulated in a transfer carrier, such as a nanoparticle. In addition, one purpose of such encapsulation is usually to protect the nucleic acid from the environment that may contain an enzyme or chemical that may degrade the nucleic acid and/or cause rapid excretion of the nucleic acid or receptor. Therefore, in some examples, a suitable delivery carrier can enhance the stability of the mRNA included therein and/or facilitate the delivery of the mRNA to the target cell or tissue. In some examples, the nanoparticle may be a lipid-based nanoparticle, for example, including a liposome or a polymer-based nanoparticle. In some examples, the nanoparticle may have a diameter of less than about 40-100 nm. The nanoparticle may include at least 1 μg, 10 μg, 100 μg, 1 mg, 10 mg, 100 mg, 1 g or more mRNA.
Of course, such nanoparticle can also be a particle with a core-shell structure. If nucleic acid and polymer are mixed to form a core, and then liposomes are encapsulated around the core structure, it can also be completed by the mixer of the present invention. The nucleic acid and polymer can be formed into a particle structure through a mixer first, and then the particles and lipid components can be formed into a particle structure through the mixer. This so-called core-shell structure, for example, all core materials and shell materials in Patent Application No. 201880001680.5 can be formed by the mixer of the present invention, and all the materials constituting the core and the materials forming the shell in the patent are a specific embodiment of the present invention.
In some examples, the delivery carrier is a liposomal vesicle, or other means to facilitate the transfer of nucleic acid to a target cell and tissue. Suitable transport carrier can  include, but is not limited to, a liposome, a nanoliposome, a ceramide-containing nanosome, a proteoliposome, a nanoparticle, a calcium phosphate-silicate nanoparticle, a calcium phosphate nanoparticle, a silica nanoparticle, a nanocrystalline particle, a semiconductor nanoparticle, poly (D-arginine) , a nanodendrimer, a starch-based delivery system, a micelle, an emulsion, a vesicle, a plasmid, a virus, a calcium phosphate based nucleotide, an aptamer, a peptide and other carrier tags. It is also considered to use a bio-ion capsule and other viral capsid protein assemblies as suitable transfer carriers. (Hum. Gene Ther. 2008 September; 19 (9) : 887-95) .
The liposome may include one or more cationic liposomes, one or more non-cationic liposomes, one or more sterol-based liposomes, and/or one or more PEG-modified liposomes. The liposome may include three or more different liposome components, one of which is a sterol-based cationic liposome. In some examples, the sterol-based cationic liposome is cholesteryl imidazole or "ICE" liposome (see WO2011/068810, which is incorporated into this application by reference) . In some examples, the sterol-based cationic liposome can constitute no more than 70% (e.g., no more than 65%and 60%) of the total lipid in the lipid nanoparticles (e.g., liposomes) . Examples of suitable liposome may include, for example, phosphatidyl compound, such as phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipid, cerebroside, and gangliosides.
Non-limiting examples of the cationic liposome may include C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazolyl) , HGT5000, HGT5001, OF-02, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA and HGT4003, or combinations thereof.
Non-limiting examples of the non-cationic liposome can comprise ceramide, cephalin, cerebroside, diacylglycerol, 1, 2-dipalmitoyl-sn-glyceryl-3-phosphorylglycerol sodium salt (DPPG) , 1, 2-distearoyl-sn-glyceryl-3-phosphoethanolamine (DSPE) , 1, 2-distearoyl-sn-glyceryl-3-phosphocholine (DSPC) ,  1, 2-dipalmitoyl-sn-glyceryl-3-phosphocholine (DPPC) , 1, 2-dioleyl-sn-glyceryl-3-phosphoethanolamine (DOPE) , 1, 2-dioleyl-sn-glyceryl-3-phosphatidylcholine (DOPC) , 1, 2-dipalmitoyl-sn-glyceryl-3-phosphoethanolamine (DPPE) , 1, 2-dimyristoyl-sn-glyceryl-3-phosphoethanolamine (DMPE) , and 1, 2-dioleoyl-sn-glyceryl-3-phosphate- (1'-rac-glycerol) (DOPG) , 1-palmitoyl-2-oleoyl-phosphatidylethanolamine (POPE) , 1-palmitoyl-2-oleoyl-sn-glyceryl-3-phosphocholine (POPC) , 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE) , sphingomyelin, or combinations thereof.
In some examples, the PEG-modified liposome may be a poly (ethylene) glycol chain with a length of up to 5 kDa, which is covalently attached to a liposome having an alkyl chain with a length of C6-C20. Non-limiting examples of the PEG-modified liposome can include DMG-PEG, DMG-PEG2K, C8-PEG, DOGPEG, ceramide PEG, and DSPE-PEG, or combinations thereof.
It is also considered to use a polymer as a transfer carrier, whether used alone or in combination with other transfer carriers. Suitable polymer may include, for example, polyacrylate, polyalkylcyanoacrylate, polylactide, polylactide-polyglycolide copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, and polyethyleneimine. The polymer-based nanoparticle may include polyethyleneimine (PEI) , such as branched PEI.
The core-shell structure of the carrier is another specific embodiment. In some embodiments, the vaccine agent includes the aforementioned nucleic acid, which can be translated to express an antigen or an antigen fragment of the coronavirus. Such nucleic acid is contained in a plurality of polymer complexes or protein core particles, and the the plurality of polymer complexes or protein core particles are themselves encapsulated in the first biocompatible lipid bilayer shell. In some embodiments, the polymer complex or protein core particle contains at least a first positively charged polymer or protein. The first biocompatible lipid bilayer shell promotes the macropinocytosis of one or more  mammalian antigen-presenting cells on the plurality of polymer complexes or protein core particles. In some embodiments, the vaccine agent further comprises an adjuvant selected from CpG, poly (I: C) , alum, and any combinations thereof encapsulated in the biocompatible lipid bilayer. In some embodiments, the vaccine agent also includes an immunomodulatory compound encapsulated in the space between the biocompatible lipid bilayers, such as IL-12p70 protein, FLT3 ligand, or indoleamine 2, 3 -dioxygenase (IDO-1) inhibitor. In some embodiments, wherein the indoleamine 2, 3-dioxygenase (IDO-1) inhibitor is GDC-0919, INCB24360, or combinations thereof. In some embodiments, wherein the positively charged polymer or protein comprises protamine, polyethyleneimine, poly (B-amino ester) , or any combinations thereof. In some embodiments, the biocompatible lipid bilayer comprises one or more of the following: 1, 2-dioleoyl-sn-glycerol-3-ethylphosphocholine (EDOPC) ; 1, 2-dioleoyl-sn-glycerol-3-phosphatidylethanolamine (DOPE) ; 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine-N- [amino (polyethylene glycol) -2000] (DSPE-PEG) ; and combinations thereof. In some embodiments, the biocompatible lipid bilayer comprises: (a) about 30%to about 70%1, 2-dioleoyl-sn-glycerol-3-ethylphosphocholine (EDOPC) ; (b) about 70%to about 30%of 1, 2-dioleoyl-sn-glycerol-3-phosphatidylethanolamine (DOPE) ; or (c) about 0.5%to about 5%of 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine-N- [amino (polyethylene glycol) -2000] (DSPE-PEG) . In some embodiments, the biocompatible lipid bilayer comprises: (a) about 45%to about 55%1, 2-dioleoyl-sn-glycerol-3-ethylphosphocholine (EDOPC) ; (b) about 55%to about 45%of 1, 2-dioleoyl-sn-glycerol-3-phosphatidylethanolamine (DOPE) ; and (c) about 1%to about 2%of 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine-N- [amino (polyethylene glycol) -2000] (DSPE-PEG) .
Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. The references cited herein are not considered prior art to the claimed invention. In addition, the materials,  methods, and examples are only illustrative and not restrictive.
Detailed Description of Embodiments
The detailed description of embodiments of the present invention are merely a limited enumeration under the essence of the invention to illustrate how the present invention is realized, and cannot constitute any limitation to the present invention.
Example 1: Design and preparation of mRNA candidate sequence: DNA sequence in  SEQ ID NO: 1 as the template to prepare mRNA sequence
Experimental reagents: (1) SpeI DNA endonuclease, (2) high-fidelity DNA polymerase, (3) DNA purification column, (4) thermofisher T7 RNA polymerase, (5) thermofisher 75mM rNTP, (6) 100 mM N1 -Methyl pseudouridine-5'-triphosphate, (7) yeasenvaccinia virus capping enzyme, (8) 32mM SAM (9) thermofisherdynabeadsmyone, etc.
1.1 Full gene synthesis of template plasmid: the ORF (open reading frame) sequences (SEQ ID NO: 1 to SEQ ID NO: 9) of DNA sequences of different target antigens were combined with the T7 promoter sequence (SEQ ID NO: 11) , 5'UTR sequence, 3'UTR sequence and polyA sequence, followed by full gene synthesis using Puc57 (provided by full gene synthesis company "Nanjing GenScript Biotechnology Co., Ltd. " ) as the vector, to obtain the template plasmid. Some of the DNA sequences were artificially modified sequences, and the modified sequences were artificially synthesized and cloned into the vector, and some of them were not artificially optimized.
1.2 PCR to obtain the transcription template DNA sequence: the transcription template DNA could be obtained by the linearized template plasmid as the template, using polyT long primer, high-fidelity DNA polymerase, dNTP and other raw materials, according to the appropriate program on the PCR instrument. (As shown in FIG. 2 below) .
Forward primerr: 5'TTGGACCCTCGTACAGAAGCTAATACG3' (SEQ ID NO: 10) ;
Reverse primer:
5’TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGTTCTAGACCCTCACTTCCTACTCAGG3’ (SEQ ID NO: 11)
Table 1: For example, to obtain the PCR reaction system configuration of SEQ ID NO: 1.
Figure PCTCN2021074670-appb-000004
Table 2: PCR program of SEQ ID NO: 1.
Figure PCTCN2021074670-appb-000005
1.3 Preparation of mRNA by transcription reaction in vitro (60 μL reaction system as an example) (SEQ ID NO: 1) : the prepared IVT template with T7 RNA polymerase, rNTPs mononucleotide and other raw materials were mixed according to the Table 3 below, followed by the transcription reaction at 37℃ for 8 hours. After completion of the transcription reaction, the IVT template was digested by DNase to reduce the risk of residual DNA template. Wherein, the modification ratio of methyl pseudouracil nucleotides was 50%.
Table 3: The ratio of the transcription system in vitro.
Reaction system Dosage (μL)
10×T7 transcription buffer 6
T7 enzyme 4
ATP (75mM) 4
CTP (75mM) 4
GTP (75mM) 4
UTP (75mM) 2
Methyl pseudouracil nucleotide (100 mM) 1.5
DNA template 1μg
H 2O Supplement to 60
Capping reaction: the 5'-terminal of the transcribed mRNA was capped by vaccinia virus capping enzyme to produce cap0 cap structure mRNA. The reaction system was shown in Table 4:
Table 4: Capping reaction system
Component Volume
RNA
15 μL
10×Capping Buffer 2.0 μL
GTP (10 mM) 1.0 μL
SAM (2 mM) 1.0 μL
Vaccinia Capping Enzyme (10 U/μL) 1.0 μL
1.5 Purification: the mRNA after completion of the capping reaction was purified by using thermo fisher dynabeadsmyone. The volume ratio of mRNA to magnetic beads purification buffer was 1: 2, and the mass ratio of magnetic beads to mRNA was 1: 1. The purified mRNA was dissolved in sodium citrate solution, followed by subsequent preparation coating.
The above was only the process of preparing the final mRNA for the DNA shown in sequence 1 (SEQ NO: 1) , and the process of preparing the mRNA sequence for the other 8 DNAs was similar to the above except that the sequence in the open reading frame was different. Those of ordinary skill in the art could comlete these based on the method disclosed in the present invention. The present invention used the specific information of the 9 new DNA coronavirus sequences as shown in Table 5:
Table 5: DNA sequence description (including optimized and non-optimized  natural sequences)
Figure PCTCN2021074670-appb-000006
The wild-type natural sequence corresponding to the above optimized sequence was shown in Table 6. The sequence Nos. 1, 8, and 9 in Table 5 were optimized based on the natural sequence shown in the sequence No. 1-1 in Table 6; the sequence Nos. 5 and 6 in Table 5 were optimized based on the natural sequence shown in the sequence No. 3-3 in Table 6; the sequence No. 3 in Table 5 was optimized based on the natural sequence shown in the sequence No. 5-5 in Table 6; the sequence No. 7 in Table 5 was optimized based on the natural sequence shown in the sequence No. 9-9 in Table 6. As shown, in fact, only  sequences  4 and 2 were natural sequences and had not been optimized; therefore, there were only 2 natural sequences. The so-called optimization could be the optimization of all the full-length sequences or the optimization of partial sequences, for example, the Nos. 1, 8, and 9 in Table 5 were the full-length optimization or partial optimization of the S gene, which only showed the length of the sequence or the optimization of partial sequences at different positions in the full-length sequence. The optimization process was to improve or design the nucleic acid DNA so that the transformed RNA sequence could express more target antigens in the cell, or be more stable, or had other functional requirements.
Table 6: List of natural (wild type, WT) DNA sequences corresponding to the optimized sequences in Table 5.
No. Name of the sequence
(SEQ NO: 1-1) S
(SEQ NO: 3-3) S-RBD
(SEQ NO: 5-5) M
(SEQ NO: 6-6) N
(SEQ NO: 7-7) S-RBD
(SEQ NO: 8-8) S-RBD
(SEQ NO: 9-9) E
For the above DNA sequences, the DNA template sequences numbered 1-9 differed only in the ORF region sequence, and the rest of the functional regions such as the T7 promoter sequence, the UTR sequence at the 5'a nd 3'-terminals were identical to the polyA sequence.
The optimized sequence was compared with the corresponding natural wild-type DNA sequence. The blast method was as described in the website address: Clustal Omega (https: //www. ebi. ac. uk/Tools/msa /clustalo/) comparison, and the results obtained were shown in Table 7 below. Of course, the two sequences numbered 2 and 4 had not been optimized, so the sequence homology was 100%.
Table 7: Comparison results of homology pairs of natural and optimized DNA sequences.
Figure PCTCN2021074670-appb-000007
According to the above method, the sequences of 9 mRNAs obtained by the transcription in vitro were shown in Table 8 below:
Table 8: List of mRNA sequences obtained according to the above method.
No. Name of the sequence Sequence optimization or not
(SEQ NO: 1.1) S yes
(SEQ NO: 1.2) S-RBD No (natural sequence)
(SEQ NO: 1.3) M yes
(SEQ NO: 1.4) N No (natural sequence)
(SEQ NO: 1.5) S-RBD yes
(SEQ NO: 1.6) S-RBD yes
(SEQ NO: 1.7) E yes
(SEQ NO: 1.8) S partial yes
(SEQ NO: 1.9) S1 yes
The 9 mRNA sequences listed in Table 8 were different only in the ORF region, and other functional regions such as UTR sequence and polyA sequence were exactly identical; and ORF regions were all sequences transcribed from optimized or unoptimized DNA sequences. The sequence without optimization referred to the sequence identical to or having a homology more than or equal to 95%with the natural wild-type nucleic acid sequence, such as SEQ NO: 2 or SEQ NO: 1.2; or SEQ NO: 1.4 or SEQ NO: 4 for the new coronavirus of the present invention.
T7 promoter: TAATACGACTCACTATA (SEQ ID NO: 12)
5’UTR sequence:
Figure PCTCN2021074670-appb-000008
3’UTR
sequence: GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC (SEQ ID NO: 14) ;
PolyA tail sequence:
Figure PCTCN2021074670-appb-000009
The DNA optimized sequence in Table 7 corresponded to the mRNA sequence in Table 9. This was because the optimized DNA sequence was analyzed and compared with the natural sequence, so that according to this logic, the obtained optimized mRNA sequence had a similar relationship with the natural sequence (wild type) . See Table 9 for details. The sequence Nos. 1.1; 1.8; 1.9 in Table 8 were optimized based on the natural sequence shown in the sequence No. 1-1-1 in Table 9; the sequence Nos. 1.5; 1.6 in Table 8 were optimized based on the natural sequence shown in the sequence No. 5-5-5 in Table 9; the sequence No. 1.3 in Table 8 were optimized based on the natural sequence shown in the sequence No.  3-3-3 in Table 9; the sequence No. 1.7 in Table 8 were optimized based on the natural sequence shown in the sequence No. 7-7-7 in Table 9;  sequences  2 and 4 were natural sequences and had not been optimized; therefore, there were only two natural sequences: SEQ NO: 2-2-2; SEQ NO: 4-4-4.
Table 9: Natural mRNA sequence.
No. Name of the sequence
(SEQ NO: 1-1-1) S
(SEQ NO: 2-2-2) S-RBD
(SEQ NO: 3-3-3) M
(SEQ NO: 4-4-4) N
(SEQ NO: 5-5-5) S-RBD
(SEQ NO: 6-6-6) S-RBD
(SEQ NO: 7-7-7) E
(SEQ NO: 8-8-8) S partial (partial)
(SEQ NO: 9-9-9) S1
Table 10: Comparison of homology between the natural mRNA sequence and the optimized sequence.
Figure PCTCN2021074670-appb-000010
It could be understood here that the optimized RNA sequence could be obtained through the optimized DNA sequence, and of course it was also possible to directly generate the RNA sequence through sequence synthesis. For promoters, conventional promoter sequences could be used, or untranslated regions could be added at the beginning and terminal of the sequence, such as UTR sequence, which could make the RNA sequence  more stable. The specific screening of the UTR sequence would be described in detail in the specific embodiments of the present invention. General UTR sequences could be achieved. The specific sequences of these so-called promoters, suitable UTR sequences, poly sequences, and nucleic acid modification and sequence optimization were all to ensure the stable transmission of nucleic acid sequences in the body, meanwhile, or with high expression. Generally, those in the art should understand that any other sequence was achievable in the present invention, and was some preferred examples of the present invention, but without these elements, only optimized new coronavirus sequences could be achieved, but the effect of which might not be very ideal. It could also be seen from the subsequent experiments that even if the sequence of these elements was identical, the key to the effect, or the decisive factor was still determined by the nature of the ORF sequence itself. But it was undeniable that these additional sequences together with ORF sequences could have better results.
In some alternative embodiments, some additional sequences could be inserted in front of the ORF sequence. These sequences could also help to achieve functional improvements in RNA expression, such as reducing some restriction sites to make the protein more active. Such sequences could be the following sequences: for example, insertion of the sequence into the fourth nucleoside at 5’-terminal of the ORF sequence. For example, all nucleotides at the 5’-terminal started with AUG, and then one or more of the following sequences was inserted from the fourth nucleotide.
5’-AUGUUCCUGCUGACUACAAAACGGACU-3’ (SEQ NO: 38)
5’-GACGCUAUGAAGAGGGGCCUGUGCUGUGUGCUGCUGCUGUGCGGAGCUGUGUUCGUGUCCAACAGC-3’ (SEQ NO: 39) ,
For the insertion site, it could be inserted after the first few nucleotides at the 5’-terminal, of course, it could also be inserted at the 3’-terminal, and of course, it could also be directly connected to the ORF (open reading frame) sequence. The utility of these sequences was diverse, with sequences that comprehensively improve RNA performance. These additional sequences could be inserted into the ORF sequence and became part of the  ORF sequence. It could be understood that sequences other than the ORF sequence were all a preferred embodiment of the present invention, but these preferred embodiments did not indicate that these sequences must be possessed to achieve the objective and intention of the present invention.
Table 11: Translated and expressed amino acid sequences in Table 8.
Figure PCTCN2021074670-appb-000011
Compared with the amino acid sequence translated and expressed by the mRNA translation and expression in Table 8 and the amino acid sequence translated and expressed by the natural mRNA sequence in Table 9, the homology was 100%. This showed that whether it was an optimized sequence or a natural sequence, the final amino acid expressed, that is, the amino acid sequence of the protein was identical. The identical sequence only showed that the substance was essentially the same, but the content and activity were not equal concepts.
Example 2: Cell expression level verification of candidate mRNA sequences in vitro
1.1 Test article:
9 new coronavirus mRNA vaccines: in order to detect protein products, 6 consecutive histidine codons (CAU, see Table 12 for details) in this experiment were fused at the 3'-terminal of each mRNA sequence, which could produce histidine tags (His-tag) formed by 6 consecutive histidines at the C-terminus of the protein product, so that the  anti-histidine tag antibody could be used to indirectly detect the expression of the target antigen.
Table 12: Specific sequence features of 9 new coronavirus mRNA vaccines.
Figure PCTCN2021074670-appb-000012
The "********" in the above table represented the complete sequence containing the 9 different RNAs in Table 8. The complete sequence included other functional regions such as the promoter sequence, the UTR sequence and the polyA sequence were exactly identical, (without additional sequences ) , a total of 9 items, named nCoV-N, where N was a natural number from 1-9, see the table for details.
2.2 Test reagents: HEK-293 cells (purchased by the manufacturer: ) ; DMEM complete medium (Gibco) : 1%double antibody (Gibco) , 10%FBS (Hyclone) ; PBS (Solebold) ; Transfection dilution: Opti-MEM (Gibco) ; LipofectamineMessengerMAX (Invitrogen) ; RIPA Lysis Solution (Strong) (Protease Inhibitor Mixture Pierce TM Protein Concentrator PES, 3K MWCO (Pierce) ; BCA Protein Concentration Determination Kit (Enhanced) (Biyuntian) ; Tris-glycine electrophoresis buffer (Solebold) ; Electrotransfer solution  (Solebold) ; TBST: 1×TBS (Solebold) +1‰Tween-20 (Solebold) ; Skim milk powder (Anjia) ; Methanol (Aladdin) ; BeyoGel TM Plus PAGE precast gel (4-20%, 15 holes) (Biyuntian) ; His Tag Antibody (HRP) (Solebold) ; High-sig ECL Western Blotting Substrate (Tanon) ; Development Fixing kit (Biyuntian) .
2.3 Test consumables: T75 cell culture flask (Thermo) ; 15/50 ml centrifuge tube (Corning) ; pipette (Corning) ; 1.5/0.5 ml centrifuge tube (Axygen) ; PVDF membrane (Biyuntian) ; transfer filter paper (Biyuntian) ; X-OMAT BT film (5×7 inches) (Biyuntian) ; tablet cassette (Biyuntian) ; 3.3 Test equipments; CO 2 incubator (Panasonic) ; inverted microscope (Leica) ; electrophoresis instrument (Bio-Rad) ; electrophoresis tank (Bio-Rad) ; transfer tank (Bio-Rad) ; centrifuge (Kubota) ; gel imaging Universal Hood Ⅱ (Bio-Rad) .
Experimental methods
1.) HEK 293 cells were plating at 1×10 6 cells per well in a six-well plate, and incubated at 37℃ in an incubator for 16 hours.
2.) 2 μg each of the 9 mRNA vaccine sequences in Table 1 (prepared in Example 1) were transfected with LipofectamineMessengerMAX transfection reagent, with the following specific steps: solution A was incubated for 10 minutes, mixed with solution B and incubated at room temperature for 5 minutes, followed by cell transfection.
Table 13: Reagent composition and content of solution A and solution B
Figure PCTCN2021074670-appb-000013
3) . After 24 hours of transfection, the medium supernatant was collected, with immediate addition of 1/100 volume of protease inhibitor, which was placed on ice; and then 200 μL of RIPA lysis solution were added to each well of cells (1/100 volume of protease inhibitor had been added) with lysing on ice for 30 minutes, followed by transferring the lysate to a 1.5 ml centrifuge tube, centrifuging at 4℃ at 18000 rpm for 20 minutes, and transferring  the supernatant to a new centrifuge tube.
4) . Concentrating the medium supernatant by Protein Concentrator PES: 500 μl of the collected medium supernatant were pipetted and added to the adsorption column, with centrifugation at 12000 rpm for 30 minutes, and then the concentrated medium supernatant was transferred to a new centrifuge tube.
5) . Detection of the protein concentration of cell lysate by BCA kit.
Preparation of BSA standard: 0.8 ml of protein standard preparation solution was add to a tube of protein standard (20 mg BSA) , to prepare 25 mg/ml of BSA standard solution after being fully dissolved. 920 μl PBS were added to 80 μl of 25 mg/ml BSA standard solution to prepare 2 mg/ml BSA standard.
Preparation of BCA working solution: according to the number of samples, an appropriate amount of BCA working solution were prepared based on 50 volumes of BCA reagent A plus 1 volume of BCA reagent B (50: 1) , and mixed well.
The BSA standard was diluted to make a standard curve, with the system as follows (Table 14) :
Figure PCTCN2021074670-appb-000014
100 μl of each of the 8 standards were added to a 96-well plate with two replicate wells. Sample well: 100 μl H 2O were added to each well of a 96-well plate. and 1 μl sample was added, respectively, with two duplicate wells. 100 μl of BCA working solution were added to each well and placed at 37℃ for 30 minutes. A562 was measured with a microplate reader. The protein concentration of the sample was calculated according to the standard curve.
6) . Preparation of protein sample: according to the protein concentration of the sample, each cell lysate containing 45 μg protein was pipetted into a 0.5 ml centrifuge tube, with addition of 3 μl 5×SDS sample buffer, and each protein sample was adjusted to the final volume of 15 μl by H 2O; the medium supernatant sample was prepared according to the corresponding cell lysate volume, and the protein was denatured by boiling in boiling water  for 5 minutes before loading (to obtain the protein containing the encoded antigen) .
7) . The precast gel was took out, and the electrophoresis device was assembled, with addition of the electrophoresis buffer, and loading the sample. 15 μl 1×SDS loading buffer were added to the wells without protein sample.
8) . Electrophoresis: electrophoresis was performed at a constant voltage of 80 V for 30 minutes, then the voltage was adjusted to 100 V for electrophoresis for 40 minutes. After the electrophoresis, the gel plate was washed with H2O, from which the gel was carefully removed.
9) . Transfer membrane: the PVDF membrane was activated in methanol, and the membrane, sponge and filter paper were immersed in the pre-cooled transfer membrane solution. The black transfer film clip, on top of which were sponge, two layers of filter paper, glue, PVDF membrane, two layers of filter paper, sponge in turn, was put down into the transfer liquid, without bubbles in each step. The transfer clip was closed and put into the transfer tank, so that the black side of the clip faced the black side of the tank, while the white clip faced the red side of the tank, and then the ice box was put into the transfer tank, followed by pouring the electro-transfer fluid and inserting the electrode. For nCoV-1/4/8/9 with larger molecular weight, transfer membrane was performed at constant voltage of 100 V for 90 minutes; for nCoV-2/3/5/6/7 with smaller molecular weight, transfer membrane was performed at constant voltage of 100 V for 60 minute. After completion, the PVDF membrane was took out with the directional marking of the membrane, which was placd in the Western blot antibody incubation box.
10) . Blocking: the membrane was placed in the blocking solution that was 10%skimmed milk powder solution prepared with 1×TBST, and was blocked on a shaker at room temperature for 1 hour.
11) . Primary antibody incubation: His-Tag (HRP) primary antibody, which was diluted with 10%skimmed milk powder solution prepared with 1×TBST at 1: 10000, was added and incubated for 2 hours on a shaker at room temperature.
12) . Washing the membrane: after recovery of the primary antibody, the membrane was washed 4 times with 1×TBST, 5 minutes each time.
13) . Chemiluminescence, development, fixation: according to the chemiluminescence  detection, the film was incubated with the chemiluminescence substrate, exposed and developed by X film, which was scanned.
2.5 Experimental results shown in FIG. 3. Result analysis: the cells were in good condition after transfecting with 9 mRNA vaccine sequences by LipofectamineMessengerMAX; the Western blot exposure results were scanned by gel imaging Universal Hood Ⅱ, and then mapped and analyzed using Image J and Adobe Illustrator. The results showed that the exposure background was low, and the protein band was clear and specific (shown in FIG. 3) . After 9 kinds of mRNA vaccine sequences were transfected into HEK-293 cells, the target bands were detected in the culture supernatant or cell lysate, wherein because of the signal peptide sequence present in nCoV-5/6/8/9, the secreted extracellular nCoV-5/6/8/9 protein could be detected in the culture supernatant.
The molecular weight of each protein was compared with the expected molecular weight: nCoV-2/4/5/7 protein molecular weight was substantially identical as expected. The molecular weight of nCoV-1/6/8/9 protein was slightly larger than expected, which might be due to the highly glycosylated modification of S protein in vivo. There was a smaller molecular weight band below the expected band for nCoV-8 in the medium supernatant, which might be the S2 subunit formed by shearing of the S protein in vivo. There was a small molecular weight band below the expected band for nCoV-3, which might be due to shearing in vivo. In addition, there was a diffusion band at high molecular weight, suggesting that there might be a multimeric form in vivo.
In summary, the results showed that the 9 mRNA vaccine sequences were correctly designed and could be expressed correctly in vitro. RNA was the main role of gene expression. The entire process of maintaining and expressing genetic information was performed in the "RNA world" , wherein messenger RNA (mRNA) provided an information transmission intermediate representing the DNA sequence of the protein. Gene expression could be divided into two stages-transcription and translation. Transcription was carried out by using the DNA in the cell as a template based on the principle of base complementary pairing, to produce a single-stranded mRNA having the sequence complementary to the non-coding strand of DNA but identical with the coding strand as a direct template for protein biosynthesis; translation was to interpret the genetic information contained in the  nucleotide sequence of mRNA and generate the amino acid sequence of the protein, according to the triplet code rule for determining an amino acid for every three nucleotides, to synthesize protein peptide chains with specific amino acid sequences starting with the start codon at the 5'-terminal of the mRNA in the 5'→3' direction. For the mRNA vaccine, based on the ability of mRNA to quickly translate the target protein, the transcribed mRNA in vitro was delivered to the antigen presenting cell (dendritic cell) through the delivery system, so that the dendritic cell directly expressed the antigen efficiently, through MHC I or MHC class II molecules stimulation and antigen-specific T cells activation, thereby activating B cells and T cells to produce antigen-specific immune response in the body. Therefore, the correct expression of the target protein by mRNA was the first prerequisite for mRNA vaccine to function.
This also illustrated that some other sequences front or behind the ORF region were feasible, and in the respect of functionality, they could achieve antigen expression. Meanwhile, with the addition of additional sequences, the successful expression of antigens in cells in vitro could also be achieved (the specific experimental data was omitted) . As mentioned above, the core coding protein information contained in the decisive RNA itself.
In eukaryotic cells, mature mRNA directly used as a translation template must have one or several of the following structural features: (1) A protein coding sequence containing a start codon and a stop codon, with continuity between the codons, Without any nucleotide separation; (2) There are untranslated regions (UTR) at both ends of the coding sequence, and the 5'-end UTR is located from the methylated guanine nucleotide cap at the beginning of the mRNA to the start codon The sub-AUG, 3'UTR extends from the stop codon at the end of the coding region to the front end of the poly-A tail (Poly-A) , which is very important for translation efficiency and mRNA stability; (3) 5'-terminal cap structure, which is a The methylated guanine nucleotide (m7GpppNp) that binds to the 5'-terminal of the mRNA through a unique 5'-5' binding method helps the ribosome to recognize the mRNA during the translation process, and stabilizes the ribosome and The binding of mRNA promotes the initiation reaction and ensures that the translation proceeds in the correct direction; (4) The poly A tail structure at the 3'-terminal can recruit key translation initiation factors to bind tightly to the 3'-terminal of the mRNA, so that the mRNA  maintains a kind of The circular conformation improves the efficiency of translation initiation and promotes the restart of the translation process. In addition, the Poly A tail and the protein bound to it helped to protect mRNA from exonuclease degradation, thereby enhancing mRNA stability.
Through the present invention, some more effective UTR sequences had also been screened, and these sequences had different effects on the expression of the same ORF region. Meanwhile, the present invention had also improved UTR sequences, thereby improving the stable mRNA system. A person skilled in the present invention could understand that the UTR sequence not only had an effect on the COVID-19 mRNA, but also had a similar effect on other non-mRNA sequences.
Therefore, in order to ensure that transcribed mRNA could be efficiently and stably expressed in cells like mature mRNA molecules in vitro, a series of optimizations had been made in the vaccine design and synthesis process in this experiment, including: 1) modification of nucleotides to reduce the innate immune response of mRNA in human bodis; 2) optimizing codons, replacing rarer codons in mRNA with more common synonymous codons to increase protein expression; 3) optimizing 5'UTR and 3'UTR sequences to improve mRNA translation efficiency, and enhance the stability of mRNA, extend the half-life of mRNA; 4) capping at 5’-terminal, to enhance the stability of mRNA and increase protein expression; 5) poly-A tailing at 3’-terminal, to enhance the stability of mRNA annd translation efficiency; 6) purifying the prepared mRNA to reduce double-stranded by-products and prevent unnecessary immune stimulation. Among these optimizations, any one could improve the traditional technology.
From the present invention, for the 1-9 mRNAs of COVID-19, in the specific embodiment, the 5'UTR and 3'UTR sequences used were identical, so that the nucleic acid could be expressed in the cell, indicating that these selected genes were likely to produce antigens in the body, thereby causing the subject to produce antibodies.
In order to detect whether the 9 new coronavirus mRNA vaccines designed for the correct expression, this experiment used LipofectamineMessengerMAX transfection to make the mRNA into HEK293 cells for expression. After 24 hours of transfection, the foreign protein expression level reached the peak, and the culture supernatant and cell  lysate were collected at the same time, followed by detecting the expression of the target antigen using Western blot technology. HEK-293 cells rarely expressing endogenous receptors required for extracellular ligands and easy to transfection, were a very commonly cell line used for expressing and studying foreign genes. Therefore, HEK-293 cells could be selected as host cells, to ensure smooth entry of mRNA into cells. Because some mRNA sequences had signal peptides, their protein products would be secreted outside the cell, so this test detected the protein expression in the cell lysate as well as the protein expression in the culture supernatant. Western blot technology used specific antibodies to stain protein samples processed by gel electrophoresis, and obtained informations about the expression of specific proteins in the analyzed cells or tissues by analyzing the position and depth of the staining. Due to the lack of specific antibodies, 6 consecutive histidine codons (CAU) in this experiment were fused at the 3'-terminal of each mRNA sequence, which could produce histidine tags formed by 6 consecutive histidines at the C-terminus of the protein product, so that the anti-histidine tag antibody could be used to indirectly detect the expression of the target antigen. In fact, the histidine tag formed by amino acid was used to indirectly detect whether antigenic substances were produced in the cell (the antigen here was actually the protein information encoded by the mRNA) .
Experiment 3: Comparison of the immunogenicity of 9 mRNA vaccines in mice
3.1 Experimental objective
After immunizing mice with 9 different new coronavirus mRNA vaccines, the ELISA method was used to detect the antigen-specific antibody titers in the mice, and the best vaccine agents were screened by comparing the antibody titers.
3.2 Test article information
The drug product was directly provided by the preparation department of Siwei (Shanghai) Biotechnology Co., Ltd., and adjusted according to the prescribed concentration. It was carried to Shanghai Southern Model Biology Research Center at 2-8℃ and delivered to the barrier for administration.
Table 15: Concentrations and doses of various administrations and injection routes.
Figure PCTCN2021074670-appb-000015
Note: The sequence numbered 1-9 corresponded to the sequence of mRNA1-9 in Table 8 above, wherein 2019-nCoV-1-9 corresponded to the sequences in SEQ NO: 1.1-1.9.
3.3 The preparation process of LPP as delivery carrier.
Materials: PbAE (refers to protamine sulfate, sigma) , DOPE (Avanti) , M5 (Wuxi AppTec) , DSPE-mPEG2000 (lipoid) , mRNA (as shown in Table 8) containen the complete sequence of different mRNA OFRs, numbered 2019-nCoV;
The structural formula of M5 was as follows:
Figure PCTCN2021074670-appb-000016
Preparation process:
3.3.1 Preparation of solution:
Preparation of PbAE solution: an appropriate amount of PbAE was dissolved in an appropriate amount of aqueous solution to prepare 1 mg/ml PbAE solution;
Preparation of lipid solution: a lipid solution was formulated with a concentration of 40 mg/ml according to the mass ratio M5: DOPE: DSPE-mPEG2000=49: 49: 2;
mRNA solution: the appropriate solution was diluted to 1mg/ml;
3.3.2 Preparation of nuclear nanoparticles:
Preparation of PbAE phase: an appropriate amount of PbAE solution was diluted to 0.60 mg/ml with purified water;
Preparation of mRNA phase: an appropriate amount of mRNA solution was diluted to 0.20 mg/ml with purified water;
The PbAE solution was added to the mRNA solution while stirring, with the mixing volume ratio of PbAE solution: mRNA solution=5: 1.
3.3.3 Preparation of LPP lipid nanoparticles:
According to the parameters as follows: Volume=12.0 mL; Start waste=0.35 mL, End waste=0.10 mL, flow rate ratio=3 (nuclear nanoparticle solution) : 1 (lipid solution) , flow rate=20 ml/min, temperature=37℃ mixing; the operation was carried out on a microfluidic chip device, which was a fishbone chip of a commercially available manufacturer PNI for preparing lipid nanoparticles.
4. Purification of LPP lipid nanoparticles:
The prepared LPP lipid nanoparticles were diluted with a PBS solution, followed with purification with an ultrafiltration centrifuge tube under centrifugation to obtain a purified lipid nanoparticle solution.
3.3 Experimental reagents
0.01 M PBS buffer (PH=7.4) (Solebold) ; washing solution: 0.05%Tween-20  (Solebold) +PBS
Blocking solution: 10%adult bovine serum (Sijiqing) + PBS; sample dilution: 10%adult bovine serum + 0.05%Tween-20 + PBS; color developing solution: 3, 3', 5, 5'-tetramethyl Benzidine TMB (Thermo) ; stop solution: 2N H2SO4; secondary antibody: anti-mouse IgG-HRP (Abcam) ; coating antigen (antigen corresponding to the antibody) :
Table 16: List of different antigens
Figure PCTCN2021074670-appb-000017
3.4 Administration
The route of administration was intramuscular injection, similar to the route proposed for the clinical trial. The administration volume was 100 μl/mouse, and 50 μl of the drug was injected into the thigh muscles of the left and right hind limbs of each mouse. On the day 10 after immunization, blood was collected for antibody titer detection.
3.5 Observation and inspection
During the experiment, the animal room management staff would assist in checking and observing the state of the mice according to the experiment regulations. The experimenters regularly observed the state of the mice, including but not limited to: behavioral activities, food and water intake, changes in body weight (measured 3 times a week) , physical signs or other abnormalities. The number of animal deaths and side effects in each group were recorded based on the number of animals in each group. The abnormal  conditions of mice include but were not limited to: significant weight loss, weight loss of more than 20%; inability to eat and drink freely; and the following clinical manifestations of the animal with continuous deterioration: piloerection; arched back; pale ears, nose, eyes or feet; shortness of breath; convulsion; continuous diarrhea; dehydration; slow movement; vocalization.
3.5.3 Antibody titer detection
1) . Antigen coating: antigen coating was performed according to the antigens corresponding to different vaccines in Table 15. See Table 16 for the list of antigens. The antigen was diluted with PBS and coated at a concentration of 5 μg/ml, with addition of 50 μl to each well of a 96-well plate and incubation for 12 hours at 4℃ in an air bath.
2) . Washing: 200 μl cleaning solution were added to each well for cleaning, and washed three times.
3) . Blocking: blocking solution was used to block 96-well plates, with addition of 200 μl to each well and incubation for 2 hours at 27℃ in an air bath. After blocking the plate, 200 μl cleaning solution were added to each well for cleaning, and washed three times.
4) . Sample dilution: the sample was diluted with the sample diluent according to equal volume of serum dilution gradient (200/600/1800/5400/16200/48600/145800/437400) . Each sample was tested in repeated wells, with additon of 50 μl sample to each well and incubation at 27℃ for 2 hours in an air bath.
5) . Washing: the plate was washed 3 times with a washing solution, 200 μl each time.
6) . Secondary antibody incubation (HRP-labeled goat anti-mouse IgG secondary antibody) : the secondary antibody was diluted with the sample diluent at a dilution of 1: 100,000, with addition of 50 μl to each well and incubation at 27℃ for 1 hour.
7) . Washing: the ELISA plate was washed 4 times, 200 μl per well for each time, with removal of the liquid from the plate at the last wash.
8) . Color development: after washing the plate, 50 μl TMB color development solution were added to each well for color development, with observation of the color development  status in real time.
9) . Termination: 50 μl termination solution were added to each well for termination, followed by testing on the machine.
10) . Microplate reader dual-wavelength detection indicator: the OD value was red under 450 nm wavelength and 610 nm wavelength.
11) . Data analysis: 1) the sample dilution was fit with the detected OD value through the curve. 2) The logarithmic curve equation Y=M*ln (X) +Z was obtained, wherein the Y value was substituted into the negative control OD value to confirm R2.3) The 2.1 times OD value of the negative control (Cut off) was plugged into the equation X=EXP ( (Y-Z) /M) to calculate the antibody titer.
The results were shown in the experimental results shown in FIG. 4. The results showed that the antigen-specific IgG antibody in the mouse serum was detected on the day 10 after the vaccine administration, and it was found that the serum titer of the mice administered with vaccine No. 1 was the highest, vaccine No. 2/5/9 produced almost no antibodies, and vaccine No. 4/8 produced relatively low levels of antibodies. The antibody titer level of vaccine No. 1 reached 10 4, which could effectively activate the humoral immune response. Compared with other vaccines, vaccine No. 1 ( (SEQ NO: 1) , SEQ NO: 1-1) (named COVID-19-LPP-mRNA) could stimulate the body to produce a higher level of antigen-specific antibodies in a short time. In order to determine the vaccine No. 1 (named COVID-19-LPP-mRNA) for subsequent process development and clinical research.
The COVID-19 mRNA vaccine was administered intramuscularly to immunize mice. During the experiment, except for one accidental death in the 2019-nCoV-2 test group, no animals were in moribund or dead. Daily observation of mice did not find obvious abnormalities in posture and behavior. After 1-2 days of administration, the weight of the mice in the test group decreased slightly, but they were all within the acceptable range, and their body weights recovered after 1-2 days.
On the day 10 after immunization, the immunogenicity of different mRNA vaccines was evaluated by detecting the antibody titers in the serum of mice, and then the mRNA  vaccines with strong immunogenicity and effective activation of antigen-specific immune response in the body were screened out. According to the results, the antibody titer of the mice in the nCoV-1 vaccine administration group was the highest, the mice in the nCoV-2/5/9 vaccine administration group had almost no antigen-specific antibodies, and the nCoV-4/8 vaccine could activate the body to produce antigen-specific antibodies with low antibody titer. It could be seen that the nCoV-1 coronavirus mRNA vaccine could effectively activate the body's humoral immune response, including the formation of germinal center B cells, antibody type conversion, and high-affinity antibody maturation.
It promoted the differentiation of
Figure PCTCN2021074670-appb-000018
B cells into memory B cells and plasma cells to produce higher levels of antigen-specific antibodies. The remaining vaccines, vaccines No. 2, No. 4, No. 5, No. 8 and No. 9, could not well activate the body's humoral immune response, and the antigen-specific antibody titer was low and could not reach the ideal standard. Vaccines No. 3, No. 6, and No. 7 could not be tested for vaccine immunogenicity due to antigen synthesis, and their data was not shown in the antibody titer test. However, after testing, these three vaccines also produced antibodies with not high titer, but higher than the control, indicating antibodies production causing the body's immunity.
The above experimental results showed that agent No. 1 had a good effect, and agents No. 4 or No. 8 had antibody production. These differences might be caused by the design and optimization of different nucleic acid sequences to produce different antibodies, thus comprehensively showing different titer.
Experiment 4: Experiments on immunizing C57BL/6 mice with different  concentrations of COVID-19-LPP-mRNA
1 Experimental objective: C57BL/6 mice were injected intramuscularly with different concentrations of COVID-19-LPP-mRNA twice, once on day 10 and once on the day 7, to observe the weight change of the mice, and on day 10 after the second immunization, blood was collected and centrifuged to obtain serum; spleen tissue was taken on day 14 after the second immunization, with treatment on spleen cells.
2. Test drug information
Table 17: Name: COVID-19-LPP-mRNA concentration dilution table
Figure PCTCN2021074670-appb-000019
3. Experimental animals and management
3.1 Experimental animals: Species/strains: C57BL/6 mice; grade: SPF grade; female: 30; weight: about 18-20 g; age: 8-9 weeks. On the day of the animal grouping, the mouse ears were identified by a puncher. The upper, middle, and lower left ears represented No. 1/2/3, respectively, and the upper, middle and lower right ears represented No. 4/5/6, respectively.
3.2 Animal housing: the veterinarian of the animal room would conduct quarantine on this batch of animals during the quarantine period of 3 days. The mice were housed in IVC cages, no more than five in each cage. During the housing period, the environmental parameters of the animal house (411) were recorded. All feed and drinking water were purchased and provided by the Shanghai Southern Model Biology Research Center. The SPF-grade mouse feed sterilized by  60Co irradiation was provided by Jiangsu Synergy Pharmaceutical and Biological Co., Ltd. Each batch of feed was provided with a quality  inspection report containing indicators such as nutrition, pesticides and microorganisms. The deionized water, feeding container and padding were autoclaved into the barrier and replaced twice a week.
4 Experimental method
Administration: administration on day 0 and day 7 respectively (the day of the first administration was recorded as day 0) . The dose was 100μl/mouse, and 50μl of the drug was injected into the thigh muscles of the left and right hind limbs of each mouse.
4.1 Observation and inspection: during the experiment, the animal management staff of the Nanmo Animal House would assist in checking the status of the mice and observing the status of the mice as required. The experimenters regularly observed the state of the mice as required, including but not limited to: behavioral activities, food and water intake, changes in body weight (measured 3 times a week) , physical signs or other abnormalities. The number of animal deaths and side effects in each group were recorded based on the number of animals in each group. The abnormal conditions of mice include but were not limited to: significant weight loss, weight loss of more than 20%; inability to eat and drink freely; and the following clinical manifestations of the animal with continuous deterioration: piloerection; arched back; pale ears, nose, eyes or feet; shortness of breath; convulsion; continuous diarrhea; dehydration; slow movement; vocalization.
4.2 Blood collection preparation and blood sample processing: after the day 10 of the second immunization, we would collect blood from all mice in the test. Blood would be collected from the veins of the orbital plexus, and about 500 uL of blood would be collected from each mouse. After the collected whole blood was allowed to stand at room temperature for 2 hours, it was centrifuged at 8000 rpm for 10 minutes, and the serum was collected and stored at -20℃.
4.3 Spleen collection and cell processing: after day 14 of the second immunization, the mice were euthanized to dissect the spleen to prepare a spleen single cell suspension.
Experimental results
5.1 Death and clinical observation
During the experiment, no animals were found dead or moribund. During the experiment,  no obvious abnormality was seen in all test mice. 5.2 Weight
There were no significant weight fluctuations during the experiment. Because of the random grouping, the average basic body weight of the mice in each group was not at the same baseline, so the weight change percentage was compared to measure the animal weight change. The specific weight percentage change trend was shown in FIG. 5 below. During the experiment, the mice were observed daily, with no obvious abnormalities in posture and behavior. After 1-2 days of immunization, the mice in the test group lost a little weight, but there was no weight loss of more than 10%, and their weight recovered after 1-2 days. The degree of weight loss substantially corresponded to the concentration of the test product, but the difference was not obvious. It was preliminarily speculated that the weight loss was caused by the stress response of the immune system.
Discussion and conclusion
In summary, under the conditions of this experiment, C57BL/6 mice were given COVID-19-LPP-mRNA by intramuscular injection twice, once on day 0 and once on day 7, at the doses of 30/15/7.5/2.5/1. μg/mouse, respectively, and the results showed that there was no moribund/death related to the test drug. There were no abnormalities in the mice's behavioral activities, food and water intake, weight change (measured 3 times per week) , and physical signs. The above data preliminarily showed that COVID-19-LPP-mRNA had no obvious toxicity.
Experiment 6: Evaluation of the effect of mouse antibody response after  COVID-19-LPP-mRNA immunization
6.1 Experimental objective: the COVID-19 mRNA vaccine (COVID-19-LPP-mRNA) was evaluated for the level of inducing mice to produce specific binding antibodies and neutralizing antibodies by using indirect ELISA, SARS-CoV-2 pseudovirus neutralization method, live virus plaque detection method.
6.2 Test product information: name: mRNA vaccine COVID-19-LPP-mRNA (No. 1 vaccine screened out in Example 3) ; specification: 0.5 mg/ml; traits: milky white liquid; expiration date: stored at 2-8℃ for 28 days
6.3 Experimental animals: name: SPF-grade inbred mice; quantity: 18 BALB/C mice; 30 C57BL/6 mice (albino laboratory mice, like many commonly used sub-lines, originated in Xiaojia Mouse (Musmusculus) . Since their birth in New York in 1920, BALB/c mice had bred more than 200 generations in research institutions around the world, and were widely used in immunology and physiology animal experiments) ; gender: female; age: 6-8 weeks.
4.4 Experimental reagents and consumables: SARS-CoV-2 (2019-nCoV) Spike Protein (S1+S2 ECD, His tag) (the full name of S1+S2 ECD was called S1+S2 extracellular domain, which was the extracellular domain of S protein, the full-length molecular weight of S protein was 141.20 kDa, and the molecular weight of S1+S2 ECD protein was 134.36 kDa) ; purchased from Beijing YiqiaoShenzhou Technology Co., Ltd.
EIA/RIA 96-well plate; 0.05M pH9.6 carbonate buffer (coating solution) ; 0.5‰Tween-20 PBS (PBST washing solution) ; 10%goat serum PBS (blocking solution) ; 2%goat serum PBST (Antibody dilution) ; HRP-labeled goat anti-mouse IgG secondary antibody; single-component TMB color developing solution; 2M H2SO4 solution (stop solution) ; cell culture flask; 96-well cell culture plate; 12-well cell culture plate (Corning ) ; DMEM medium (Hyclone) ; Fetal Bovine Serum (Gibco; GEMINI) ; Penicillin Streptomycin Mix (Gibco) ; Avicel RC-581 (FMC Biopolymer) ; Crystal Violet (Solabol) ; Bright-Glo Fluorescein Enzyme detection reagent (Promega)
SARS-CoV-2 virus: SARS-CoV-2 (C-Tan-nCoV-HB-01 strain, GISAID accession no. EPI_ISL_402119)
SARS-CoV-2 pseudovirus: the HIV-1 core SARS-CoV-2 pseudovirus (that was, the virus containing the antigen of HIV-1 instead of the new coronavirus) was prepared by our laboratory.
4.5 Experimental methods
4.5.1. Animal immunization: in this experiment, we used BALB/C and C57BL/6 mice for vaccine immunogenicity testing, with two immunization doses: 30 μg (high dose) /3 μg (low dose) ; 2 immune cycles: single-injection (immunization on day 0) and double-injection (immunization on day 0 and 21) , a total of 8 groups. After the vaccine was  diluted with PBS to reach the specified concentration, it was injected intramuscularly through the thigh with an injection volume of 30 μl per side and injected bilaterally. There were 6 mice in each group of BALB/c and C57BL/6 strains, a total of 18 BALB/c mice and 30 C57BL/6 mice (see Table 18 for details) .
4.5.2. Obtaining serum samples: in week 5 after immunization, 500 μL of blood was taken from the orbit, centrifuged twice at 10000×g with separation of the serum. The samples were stored at -30℃.
4.5.3. Indirect ELISA:
Antigen coating: SARS-CoV-2 Spike antigen protein was diluted to concentraion of 0.5μg/mL with coating solution, with addition of 100 μL to EIA/RIA 96-well plate, and was coated by antigen overnight at 4℃.
Blocking detection plate: the coated EIA plate was washed 3 times with washing solution, with addition of 250 μL of 10%goat serum PBS blocking solution to each well, and the plate was blocked at 37℃ for 2 h.
Serum sample dilution: the serum was diluted with the antibody diluent. Samples was diluted from 1: 100 or 1: 300, with 2 or 3 times ratio dilution, 9 dilutions in total. The specific dilution ratios were shown as the value of the X axis in FIG. 7, FIG. 9, FIG. 10, and FIG. 12.
Serum antibody adsorption: the blocked test plate was washed 3 times with washing solution, with addition of 100μL of diluted serum sample to each well, and incubated at 37℃ for 1h, with a blank control with addition of only antibody diluent
Secondary antibody binding: the detection plate was washed 5 times with washing solution, with addition of 100μL of 1: 10000 diluted HRP-labeled goat anti-mouse IgG secondary antibody to each well, with incubation for 1 h at room temperature.
Color development and termination: the test plate was washed 5 times with washing solution, with addition of 100 μL single-component TMB color development solution to each well, to develop color at room temperature for about 5 min with addition of 50 μL stop solution.
Absorbance detection and titer determination: the 450 wavelength absorption peak (630  determination was used as a reference value, only for stability determination) was determined by a microplate reader, and the OD450 of the blank well of the test plate was used as the base value, and the 2.1 times of the blank well was judged as positive. The highest dilution factor at which a sample was judged to be positive was the sample binding antibody titer.
4.5.4. SARS-CoV-2 pseudovirus neutralization detection
Cell preparation: at the day before infection, Huh7.5 cells were passaged, inoculated into 96-well plates at a rate of 1×10 5 cells/mL, and cultured in a CO2 incubator until to 60%-80%confluent of the cells.
Serum dilution and virus premixing: serum samples were diluted with DMEM medium to 50 μL starting from 1: 25 at 2 times ratio with 9 dilutions, and mixed with the same volume of pseudovirus, with incubation together at 37℃ for 1 h (the specific dilution ratio shown as the X-axis value in FIG. 7, FIG. 9, FIG. 10, FIG. 12) .
Virus infection: the cell supernatant prepared the day before was removed, with addition of the serum-virus mixture, and cultured overnight in the incubator, followed by changing the medium to 2%FBS DMEM the next day to continue culturing for 48 h.
Neutralization detection: the expression of Fluc was detected in cells by Bright-Glo Luciferase Assay System, which was recorded as relative light unit (RLU) . The neutralization calculation method was as follows, neutralization percentage = (blank control RLU-serum neutralization RLU) /blank control RLU *100%.
Half effective concentration calculation: log EC50 = the highest dilution logarithm of positive percentage more than 50%+ distance ratio × log the dilution coefficient (distance ratio = (positive percentage more than 50%-50) / (positive percentage more than 50%-positive percentage less than 50%)
4.5.5. SARS-CoV-2 live virus plaque reduction and neutralization experiment
Cell preparation: Vero cells were passaged one day before infection, 1 mL from which was inoculated into a 12-well plate at the amount of 1×10 4 cells/100μL, with placement in a CO 2 incubator to culture until to 80%-90%confluent of the cells..
Serum dilution: the tested serum was inactivated at 56℃ for 30 minutes, which was diluted with serum-free DMEM under aseptic conditions with 3 dilutions by 4-fold dilution.
Washing cells: the next day before entering the P3 laboratory, the cell culture medium was discarded, with addition of 500 μL/well of 2%FBS-DMEM maintenance medium, which was carried into the P3 laboratory by the operator.
Virus preparation: the viruses were took out of the refrigerator at -70℃, thawed in a P3 biological safety cabinet and diluted with serum-free DMEM medium.
Serum/antibody and virus neutralization: each dilution of serum/antibody was diluted with an equal volume of viruses, with incubation at 37℃ in a 5%CO 2 incubator for 1 h.
Cells infected with virus-serum/antibody: the culture medium was pipetted and discarded, with addition of the diluted virus-antibody mixture, and incubation in at 37℃ in a 5%CO 2 incubator for 1 h.
Addition of cover solution: the infection solution was pipetted and discarded, with addition of 1mL Avicel-2%FBS-DMEM medium to each well, and incubation in at 37℃ in a 5%CO 2 incubator for 72 h.
Fixation: after 72 h, the 12-well plate was removed from the CO 2 incubator, with addition of 1 mL of pre-cooled 4%paraformaldehyde to each well, and fixed for 30 min at room temperature.
Staining: paraformaldehyde was pipetted and discarded, with addition of 500 μL of 0.1%crystal violet to each well for 5 min.
Washing: the staining solution was pipetted and discarded, followed by washing 1-2 times with 1 mL of double distilled water, and counting after drying.
Observation and counting: the number of plaques were counted based on the staining results, and the neutralization rate was calculated based on the number of plaques in the virus control wells and experimental wells. Neutralization rate= (number of virus hole plaques-number of experimental hole plaques) /number of virus hole plaques*100%
Half effective concentration calculation: log EC50 = the highest dilution logarithm of positive percentage more than 50%+ distance ratio × log the dilution coefficient (distance  ratio = (positive percentage more than 50%-50) / (positive percentage more than 50%-positive percentage less than 50%) .
4.6 Experimental results
4.6.1 Animal immunization, grouping and time point
Table 18: Dose and vaccination table of different strains of mice
Figure PCTCN2021074670-appb-000020
4.6.2. Binding antibody titer detection
The serum samples of vaccine-immunized mice were diluted from 1: 300, at 3 times ratio to 1: 656100, with a total of 8 dilutions. The mouse serum samples of the control group were diluted from 1: 100, at 3 times ratio to 1: 2700, with a total of 4 dilutions (FIG. 6 -FIG. 7) .
The results of serum detection of BALB/c mice were shown in Table 4-1 and FIG. 6, and the results of C57BL/6 mice weRE shown in Table 4-2 and FIG. 7. High levels of antigen-specific IgG were detected for both strains of mice in the high dose two-injection  group, proving the vaccine having good immunogenicity. For low dose two-injection, antibody production could also be detected with relatively low titer. In the C57BL/6 single-injection group, high dose single immunization could induce certain specific antibodies, while low dose single immunization could not effectively induce specific antibody production.
Table 4-1. Antibody detection titer in BALB/c mouse
Figure PCTCN2021074670-appb-000021
Table 4-2. Detection titer of C57BL/6 mouse antibody
Figure PCTCN2021074670-appb-000022
The serum antibody titers in BALB/c &C57BL/6 mice shown in FIG. 8: , the two  strains of mice after the vaccine immunization could produce antibodies against COVID-19 S protein. After the high dose second immune boost, the two strains of mice produced specific IgG titers exceeding 1: 10 5, wherein the antibody titer produced by BALB/c mice was 1: 310,000 on average; the antibody titer produced by C57BL/6 mice was 1: 180,000 on average. In BALB/c mice, low dose second immunization could also induce specific antibodies with a titer close to 10 4; in C57BL/6 micehigh dose single immunization and low dose second immunization could induce similar antibody levels, both exceeding 10 3. Specific humoral immune response could be activated after vaccine immunization, showing the vaccine with good immunogenicity.
4.6.3. Serum neutralizing antibody titer detection based on SARS-CoV-2 pseudovirus
The serum samples of mice immunized with the high dose double-injection vaccine were diluted from 1: 100 at 2 times ratio to 1: 25600, with a total of 9 dilutions; the serum samples of the mice immunized with the high dose single-dose and low dose double-dose vaccines were diluted from 1: 50 at 2 times ratio to 1: 12800, with a total of 9 dilutions. The serum samples of mice immunized with low dose single-injection vaccine were diluted from 1: 25 at 2 times ratio to 1: 6400, with a total of 9 dilutions; the serum samples of control mice were diluted from 1: 25 at 2 times ratio to 1: 800, with a total of 4 dilutions.
The results of neutralizing antibodies in BALB/c mice were shown in Table 4-3 and FIG. 9, and the results of C57BL/6 mice were shown in Table 4-4 and FIG. 10. Except for the low dose single-injection immunization, other immunization groups all induced a certain level of neutralizing antibodies, and the high dose double-injection immunizations of both mice induced higher titers of neutralizing antibodies.
Table 4-3. Neutralizing antibody titer in BALB/c mouse
Figure PCTCN2021074670-appb-000023
Figure PCTCN2021074670-appb-000024
Table 4-4. Neutralizing antibody titer in C57BL/6 mice
Figure PCTCN2021074670-appb-000025
*Serum-free
The titers of neutralizing antibody for pseudovirus detection in the serum of BALB/c &C57BL/6 mice shown in FIG. 11: the two strains of mice after the vaccine immunization could produce neutralizing antibodies against COVID-19. After the high dose second immune boost, the two strains of mice produced neutralizing antibodies with a titer of more than 1: 10 4, wherein the neutralizing antibody titer produced by BALB/c mice was 1: 13,000 on average; the antibody titer produced by C57BL/6 mice was 1: 25,000 on average. In BALB/c mice, two immunizations with low doses could also induce neutralizing antibodies, which were stable and detectable; in C57BL/6 mice, the titers of neutralizing antibodies induced by high dose single-injection were superior to low dose two injections. After vaccine immunization, neutralizing antibodies against SARS-CoV-2 could be produced, indicating that the dose and immunization strategy were appropriate, with induction high levels of neutralizing antibodies.
4.6.5. SARS-CoV-2 plaque reduction neutralizing antibody test results
The samples were all diluted at 1: 50, 1: 200, 1: 800 with 3 dilutions, used for virus serum mixing. The results of neutralizing antibodies in BALB/c mice were shown in Table 4-5 and FIG. 12, and the results of C57BL/6 mice were shown in Table 4-6 and FIG. 13. For  the two strains of mice, in the high dose double-injection group, high titers of neutralizing antibodies were induced to inhibit the infection of SARS-CoV-2 live virus.
Table 4-5. Live virus neutralizing antibody titer in BALB/c mouse
Figure PCTCN2021074670-appb-000026
Table 4-6. Neutralizing antibody titer in C57BL/6 mouse
Figure PCTCN2021074670-appb-000027
*Serum-free
The titers of neutralizing antibodies for live virus detection in the serum of BALB/c &C57BL/6 mice were shown in FIG. 14.
The results of the live virus plaque reduction test showed that the two strains of high dose two-injection mice produced neutralizing antibodies with titers close to or more than 1: 10 4, wherein the antibody titer produced by BALB/c mice was 1: 9,800 on average; the antibody titer produced by C57BL/6 mice was 1: 12,000 on average. The neutralizing  antibody titers of most serum samples in the low dose and high dose single-injection immunization groups were not enough to reach half the effective concentration at the test dilution, but the test results showed that the virus infection could be partially inhibited at the low dilution, with significant difference compared with the control group.
4.7. Experimental conclusion
After immunizing mice with COVID-19 mRNA vaccine SW0123, it could induce the production of specific IgG, and the induced antibodies had good neutralizing activity. Two immunization programs with a dose of 30 μg and an interval of 3 weeks could effectively induce the production of high-titer specific antibodies, wherein the detectable antibody titer in BALB/c mice was 1: 310,000 on average; the detectable antibody titer in C57BL/6 mice was 1: 180,000 on average. The binding antibody titer exceeded 1: 10 5, showing the excellent ability to induce humoral immunity. After immunization with the vaccine, both strains of mice could produce neutralizing antibodies against COVID-19. At 30 μg of high dose double-injection immunization, both strains of mice produced neutralizing antibodies with a titer close to 1: 10 4, which could effectively inhibit infection at the viral cell level.
Experiments had shown that SW0123 vaccine could effectively induce specific humoral immune responses in BALB/c and C57BL/6 mice, and antigen-specific IgG had good neutralizing activity; high dose double-injection immunization could induce potently active antibodies in animals.
Experiment 7: Evaluation of antigen-specific T cell response levels in mice after  immunization with different doses of COVID-LPP-mRNA
7.1. Experimental objective: after immunizing mice with COVID-LPP-mRNA, the levels of cellular immune response in mice were detected by the ELISPOT method.
7.2 Test product information: name: mRNA vaccine COVID-19-LPP-mRNA;
specification: 0.5 mg/ml; traits: milky white liquid; expiration date: stored at 2-8℃ for 28 days
7.3 Experimental animals: species, strains, grade, number and weight, weeks of age;
Species/strains: C57BL/6 mice, female
Level: SPF level
Weight: about 18-20 g
Weeks of age: 8-9 weeks.
The veterinarian of the animal room would conduct quarantine on this batch of animals during the quarantine period of 3 days. The mice were housed in IVC cages, no more than five in each cage. During the housing period, the environmental parameters of the animal house (411) were recorded. All feed and drinking water were purchased and provided by the Shanghai Southern Model Biology Research Center. The SPF-grade mouse feed sterilized by 60Co irradiation was provided by Jiangsu Synergy Pharmaceutical and Biological Co., Ltd. Each batch of feed was provided with a quality inspection report containing indicators such as nutrition, pesticides and microorganisms. The deionized water, feeding container and padding were autoclaved into the barrier and replaced twice a week.
7.4 Experimental reagents and consumables
0.01 M PBS buffer (PH=7.4) (Solebao) ; red blood cell lysate (Mao Kang) ; RPMI-1640 medium (Gibco) ; fetal calf serum; ELISPOT detection: Elispot detection kit (Mabtech) , OVA Antigen (GenScript) , PMA (Daktronics) ; coating antigen: S protein extracellular fragment (YiqiaoShenzhou) ; centrifuge; carbon dioxide cell incubator (Panasonic) ;
ELISPOT plate reader (Germany Eddy)
7.5 Experimental method
5.5.1 Mouse immunization
C57BL/6 mice were injected intramuscularly with different concentrations of mRNA vaccine for COVID-19 twice, once on day 0 and on day 7, and spleen cells were prepared on day 14 after the second immunization.
5.5.2 Spleen cell preparation
The spleen was ground to prepare the splenic single cell suspension, with addition of 5 ml of red blood cell lysis solution to each sample spleen cell for red blood cell lysis.
Subsequently, 25 ml of 1640 medium was added for termination, and the cell suspension was filtered using a cell sieve to filter out miscellaneous tissue debris.
The cells were centrifuged at 1500 rpm for 5 min, the supernatant was discarded, and 5 ml medium was added to resuspend the cells for counting.
5.5.3 Antigen-specific T cell immune response detection
The concentration of the counted cells was ajusted to 3*10E6 cells/ml.
The cell suspension was added to the detection plate, with 100 μl of cell suspension (300,000 cells) to each well.
The corresponding antigen polypeptide (20 μg/ml) solution was prepared to resuspend the cells with culture medium, with PMA-Ionomycin as a positive control, OVA (20 μg/ml) as a negative control, and a cell suspension without any stimulus as a blank control. 100 μl antigen diluent (concentration: 10 μg/ml) were added to each well to stimulate cells for 24 hours.
The next day after stimulation, the operation was carried out according to the instructions of the kit:
(1) The cell culture medium was discarded in the detection plate, followed by washing with PBS at 200 μl/well for 5 times.
(2) The anti-mouse IFN-γ antibody was diluted to 1 μg/ml, with addition of 100 μl to each well for incubation at 27℃ in an air bath for 2 hours.
(3) After the incubation, the sample was washed with PBS at 200 μl/well for 5 times.
(4) The secondary antibody was added and diluted at a dilution of 1: 1000, with addition of 100 μl to each well for incubation at 27℃ in an air bath for 1 hour.
(5) After the incubation, the sample was washed with PBS at 200 μl/well for 5 times.
(6) Color development: 100 μl color developer were added to each well for color development.
(7) Termination: after completion of the color development, the color development solution was discarded, followed by washing with double distilled water and drying for scanning.
5.6 Experimental results
According to the results (FIG. 15A-15C) , blood was taken from mice after two immunizations with vaccines, and it was found that IgM, IgG and IgG1 type antibodies all had higher antibody titers, wherein IgG antibody titers were the highest. According to the results of different vaccine doses, the IgM antibody titers decreased with the decrease of the administered dose, and the IgG and IgG1 antibody titers also decreased gradually with the decrease of the vaccine dose, but the decline was not significant. In addition, comparing IgG1 and IgG antibody titers, the IgG1 titer was lower than the IgG antibody titer.
The results showed (FIG. 16A-16B) that COVID-LPP-mRNA could significantly activate the antigen-specific T cell response in a dose-dependent manner. The results showed that antigen-specific T cells in the spleen of mice in the high dose and low dose groups increased significantly after vaccine immunization. According to the results of different doses, as the vaccine dose decreases, the intensity of the antigen-specific T cell response gradually decreased, and the most potent antigen response was obtained in the 30 μg immune dose group. Mice were immunized with COVID-19-LPP-mRNA vaccine by administration intramuscularly. After the mRNA vaccine enters the body, it could activate antigen-presenting cells including macrophages, dendritic cells and B lymphocytes. Meanwhile, the vaccine was phagocytized by the antigen-presenting cells. In the cells, the mRNA escaped through the lysosome and was released into the cytoplasm and binded with the ribosome to translate into an antigen protein. Subsequently, most of the antigen proteins were degraded into antigen polypeptides through the proteasome and lysosome degradation pathways, and a small part of the undegraded proteins were expressed on the cell surface. The degraded antigen polypeptides were binded to MHC-I molecules and MHC-II molecules in the cells and presented to the cell surface. By binding to TCR molecules on the surface of different subgroups of T cells, the activation of different T cells was stimulated. The activated antigen-presenting cells stimulated the body to produce antigen-specific CTL immune responses through the interaction of MHC-I molecules with the surface TCR of CD8 T cells through the interaction of MHC-II molecules with CD4 T cell surface TCR. Different CD4 T cells displayed different functions, on the one hand, they could mutually promote and maintain CTL immune response with CD8 T cells, and on the  other hand, follicular helper T cells could promote interaction with germinal center B cells to promote the secretion of antigen-specific and high-affinity antibodies by B cells.
The antigens expressed partially on the surface of antigen presenting cells (macrophages, dendritic cells) activated B cells by binding to BCR on the surface of
Figure PCTCN2021074670-appb-000028
 B cells. The activated B cells gradually differentiated and developed into germinal center B cells. Under the interaction with follicular helper T cells activated by the same antigen, germinal center B cells underwent somatic high frequency mutation, antibody type conversion, and high affinity antibody maturation, etc. During the final differentiation process, memory B cells and plasma cells were formed.
According to the results of IgM and IgG detection, on day 10 after the second immunization, the antigen-specific IgG type antibody in the mouse serum was at a high level, while the antigen-specific IgM antibody was at a low level. The main reason was that in the initial stage of vaccine immunization, the body's secretion of antibodies was mainly IgM antibodies. Under the interaction of B cells and T cells, and the action of different cytokines on germinal center B cells, IgM type antibodies gradually switched to different types of antibodies as time. In the later stage of immunization, the titers of IgM antibodies in the body were at a low level, mainly IgG type antibodies.
According to the test results of IgG and IgG1 antibodies, the IgG1 type antibodies in the mouse serum were at a relatively high level, slightly lower than the total IgG antibodies. The results of this experiment showed that the IgG type antibodies in mice were mainly IgG1 antibodies. After vaccine immunization, it promoted the interaction between germinal center B cells and follicular helper T cells to secrete large amounts of interleukin-4 (IL-4) . IL-4 binded to the IL-4 receptor on the surface of B cells, and activated the signaling pathway related to the conversion of IgG1 type antibodies in the downstream of B cells, thereby promoting the conversion of IgM type antibodies to IgG1 type antibodies in the body. Therefore, it could be known that the antigen-specific antibodies produced by the COVID-19 mRNA vaccine activated by the body were mainly of the IgG1 type, and the IgG1 type antibody had a potent role in resisting viral infection.
According to the results of different dosages, the secretion of IgM type antibodies presented a significant dose-effect relationship. With the gradual decrease of the vaccine  dosage, the antibody titer gradually decreased. Total IgG and IgG1 antibodies did not show a significant dose-effect relationship, but the difference in antibody titers between the high dose group and the low dose group could also be seen. Among them, the antibody titer of the 30 μg administration group was the highest, and the antibody titer of the 1 μg administration group was the lowest, and there was no significant difference between the 7.5 μg and 15 μg groups. The difference was not obvious mainly because this experiment was performed on day 10 after two administrations to detect the antibody titer, the detection time point was in the late stage of immunity, and the secretion level of IgG type antibodies was in the highest stage, it was difficult to observe the obvious difference in the strength of the immune response caused by the difference in the small dose. Therefore, it could be known that the titers of antibodies produced in the body had a rising trend when the dose was gradually increased, and the highest antibody titers were shown at the highest dose.
According to the results of antigen-specific T cell immune response, the immune response of antigen-specific T cells in mice was significantly increased after vaccine immunization, and showed a dose-effect relationship. This result indicated that the vaccine was phagocytized by antigen-presenting cells after entering into the body, and
Figure PCTCN2021074670-appb-000029
CD4 and CD8 T cells were activated in the body by a series of immune responses to differentiate into effector T cells and memory T cells. Restimulation of spleen cells with the same antigen in vitro could quickly activate antigen-specific effector T cells and memory T cells and secreted corresponding cytokines (such as IFN-γ) (FIG. 16A) . According to the results of different doses, the intensity of T cell immune response gradually decreased as the dose decreases, showing a dose-effect relationship. Among them, there was no significant difference between the 15 μg administration group and the 7.5 μg administration group, and there was no significant difference between the 1 μg administration group and the 2.5 μg administration group. Probably due to the small difference in the dose, it did not cause a significant change in T cell immune response. In summary, the vaccine could activate the antigen-specific T cell immune response in the body.
In conclusion, the COVID-19-LPP-mRNA vaccine could activate the body fluid and cellular immune response, stimulate the body to produce higher titers of antigen-specific  IgM, IgG and IgG1 type antibodies and more potent antigen-specific T cell immune response. Therefore, it could be considered that the COVID-19-LPP-mRNA vaccine had superior immunogenicity and immunoreactivity.
Experiment 8: Detection of neutralizing antibody titer in the serum of mice after  immunization with COVID-19-LPP-mRNA vaccine
Test product information:
C57BL/6 mice were injected intramuscularly with different concentrations of COVID-19-LPP-mRNA twice, once on day 0 and once on day 7. Blood was collected on day 10 after the second immunization, and serum was obtained by centrifugation. For specific steps, see "COVID-19-LPP-mRNA immunized C57BL/6 mice" report. In this experiment, three dose groups of 30 μg, 7.5 μg, and 1 μg were selected for neutralizing antibody detection.
Test reagents: Huh-7 cell (from the National Inspection Institute) ; pseudovirus (from the National Inspection Institute) DMEM complete medium (Gibco) : 1%double antibody (Gibco) , 10%FBS (Hyclone) Luciferase detection kit (PerkinElmer) PBS (Solebold) ; 0.25%pancreatin (Gibco)
Test consumables: T75 cell culture flask (Thermo) ; 96-well white cell culture plate (Corning) ; 15/50 ml centrifuge tube (Corning) ; 3.3 Test equipment; inverted microscope (Leica) ; CO 2 incubator (Panasonic)
Microplate reader (BioTek)
Experiment procedure
1. Serum sample dilution: the serum sample was diluted with the complete medium at20X, 60X, 180X, 540X, 1620X, 4860X.
2. The viruses were diluted to 2*10 4 TCID 50/ml using the complete medium.
3. In the test group, 100 μl diluted serum and 50 μl virus dilution were added to each well; in the blank control group, 150 μl complete medium were added; in the virus control group,  100 μl complete medium and 50 μl virus dilution were added.
4. Incubation was kept at 37℃, 5%CO 2 for 1 hour.
5. Huh-7 cells were digested with trypsin for 1 minute, neutralized with complete medium, centrifuged at 210 g for 5 minutes, resuspended in complete medium, counted, with the cell concentration ajustedto 2*10 5 cells/ml.
6. After the serum and the pseudovirus were incubated for 1 hour, the cells were added to a 96-well luminescent plate with 100 μl per well at 37℃, 5%CO 2, and incubated for 20-28 hours.
7. The cell supernatant was pipetted and washed again with PBS. After washing, 100 μl PBS were added to each well.
8. Then 100 μl luciferase detection reagent were added. Reaction at room temperature and dark for 2 min.
9. After the reaction, the fluorescence value was detected by a microplate reader.
10. The inhibition rate and the half-inhibition dilution ID 50was calculated. Inhibition rate= [ (1- (mean sample group-mean blank control group) / (mean virus group-mean blank control group) ] *100%. According to the inhibition rate data, the half-inhibition dilution ID 50 was calculted by Reed-Muench with the specific calculation formula as follows: ID50= 10 lg (X) +lg (1/K) × (0.5‐B) / (A‐B)
A: Inhibition rate of the proportional wells with a fluorescence value higher than 50%; B: Inhibition rate of the proportional wells with a fluorescence value below 50%; X: the dilution ratio of the fluorescence value below 50%; K: Serial dilution ratio.
4 Experimental results
5.1 Inhibition rate of mouse serum in different dose groups on pseudovirus infected cells (FIG. 17)
5.2 Half-inhibitory dilution (ID 50) of mouse serum in different dose groups
Figure PCTCN2021074670-appb-000030
Figure PCTCN2021074670-appb-000031
By intramuscular administration, mice were immunized with the COVID-19-LPP-mRNA vaccine on day 10 after their blood was taken, and the level of neutralizing antibodies in the serum was detected by pseudovirus. The results showed that the mouse serum produced a higher level of neutralizing antibodies after the second immunization, which could effectively neutralize the pseudovirus constructed by the SARS-CoV-2 S protein, and had a strong inhibitory effect on the pseudovirus-infected cells with a dose-effect relationship. In the low dose group (1 μg/mouse) , the half-inhibitory dilution ID 50 of neutralizing antibody in mouse serum was lower than 20; in the middle-dose group (7.5 μg/mouse) , except for one mouse whose serum ID 50 was lower than 20, the remaining mice had an average serum ID 50 The value is 990; the average serum ID 50 of mice in the high dose group (30 μg/mouse) is 2918. The above results indicated that COVID-19-LPP-mRNA could induce high levels of neutralizing antibodies after two immunizations, which could effectively inhibit the infection of pseudoviruses.
Neutralizing antibody was an important indicator to measure the protective effect of vaccines, and it was also an important basis for vaccine evaluation and quality control. The use of live viruses for neutralizing antibody detection in vitro required high laboratory levels and needed to be carried out in a third-level biosafety laboratory, which brought great difficulties to research. Therefore, researchers could also use the pseudovirus system for neutralizing antibody detection. Pseudovirus-infected cells referred to susceptible cells infected by pseudoviruses constructed with the spike protein (S protein) of the target virus to simulate the process of virus infection and replication, which usually introduced a highly sensitive and easy to detect reporter gene such as Luciferase to optimize the detection system. In this experiment, a pseudovirus containing the spike protein (S) of the SARS-CoV-2 virus and the Luciferase reporter gene was used to detect the serum neutralizing antibody titers of the immunized mice.
The basic principle of the Luciferase reporter pseudovirus detection system was as  follows: the susceptible cells (Huh-7 cells) were infected with the pseudovirus to translate luciferase, which catalyzed the oxidative decarboxylation of luciferin (D-luciferin) with the participation of Mg 2+, ATP, and O 2, to produce activated oxyluciferin and emit photons to produce fluorescence at 550-580 nm. The fluorescence intensity was detected by a microplate reader, and the obtained detection value could reflect the infection efficiency of the pseudovirus on the cells.
In this experiment, mice was immunized with COVID-19-LPP-mRNA vaccine encoding the SARS-CoV-2 virus S protein antigen. The mice would produce neutralizing antibodies against the SARS-CoV-2 virus S protein. After co-incubation the immunized mouse serum with the pseudovirus, the neutralizing antibody in the serum could bind to the S protein on the pseudovirus particle to prevent the S protein from binding to the receptor ACE2, thereby blocking the pseudovirus from entering the host cell and reducing the expression of luciferase. We set a series of concentration gradients to dilute mouse serum, which was added to susceptible cells Huh-7 after co-incubation with pseudovirus, followed by culture for 20-28 hours, and detection of the infection efficiency of virus to cells by a luciferase detection kit. By calculating the inhibition rate of the neutralizing antibody against the pseudovirus infection, based on the inhibition rate data, the ID50 was calculated using Reed-Muench.
The COVID-19-LPP-mRNA vaccine could stimulate the body to produce high levels of neutralizing antibodies and prevent the pseudovirus from infecting cells, suggesting that the COVID-19-LPP-mRNA vaccine had a better preventive effect on SARS-CoV-2 virus infection. And by analyzing the neutralizing antibody levels of mice in three different dose groups, it was found that COVID-19-LPP-mRNA had a significant dose-effect relationship, which provided reference for subsequent challenge trials and clinical applications.
Experiment 9: Evaluation of the protective effect of COVID-19-LPP-mRNA  immunization on mice against SARS-CoV-2 infection
Experimental objective: using SARS-CoV-2 infection Ad-hACE2 transduction mouse model to evaluate the protective effect of the new coronavirus mRNA vaccine.
Test product information
Name: mRNA vaccine COVID-19-LPP-mRNA
Provider: Siwei (Shanghai) Biotechnology Co., Ltd.
Specification: 0.5 mg/ml
Traits: milky white liquid
Expiration date: stored at 2-8℃ for 28 days
Experimental animals
Name: Ad-hACE2 transduced mice
Quantity: 12 BALB/C mice; 19 C57BL/6 mice
Sex: female
Age: 18-20 weeks old
Animal source: Charles River Company
Animal production license number: SCXK (Beijing) 2016-006
Experimental reagents and consumables
Screw port 1.5 (SCT-150-CS) and 2.0ml (SCT-200-CS) EP tubes; sodium pentobarbital anesthetic; 4%paraformaldehyde; DMEM medium; 75%ethanol; sterile PBS; 1 ml pipette, 200 μl pipette;
One metal bath, into which a screw-top tube was put; a 50 ml tube foam box, and a 15 ml tube foam box, two for each.
Weight record form, lung weight record sheet. 200 μl pipette tip with filter element, 2 boxes; 1 ml pipette tip with filter element 1 box.
Grinder; high-speed centrifuge in the core area; 1 ml syringe; dissecting board-foam; 3 sets of sterile scissors and forceps;
Experimental methods
Grouping of mice and immunization methods
In this experiment, we used BALB/C and C57BL/6 mice to complete the immunogenicity test together, with two kinds of immunization doses: (high dose) 30μg/3μg (low dose) ; two immunization cycles: single-injection immunization (administration on day 0) and double-injection immunization (administration on day 0 and 21) , a total of 8 groups.
After the vaccine was diluted with PBS to reach the specified concentration, it was injected intramuscularly through the thigh with an injection volume of 30 μl per side and injected bilaterally.
The specific groups and experiment dates were shown in the following table:
Figure PCTCN2021074670-appb-000032
Figure PCTCN2021074670-appb-000033
Note: C: C57BL/6; B: Balb/C; DD: Double-injection immunization; SD: single-injection immunization; LD: low dose; HD: high dose
Transduction of Ad5-hACE2
Five days before the challenge, after the mice were lightly anesthetized, 45 μl of DMEM culture medium containing 2.5 × 10 8pfu Ad5-hACE2 was transfected into the  respiratory system of the mice by nasal drops. The mice were then transferred to the ABSL3 Biosafety Laboratory, kept for 5 days and prepared for SARS-CoV-2 infection experiments.
Virus challenge experiment
Day 0: SARS-CoV-2 infection
(1) Weighing: the Ad5-hACE2 transfected mice were weight after confirming in good condition.
(2) Anesthesia: pentobarbital sodium was used for anesthesia at a dose of 60 mg/Kg.
(3) Intranasal infection: the mice were infected intranasally with 50 μl of the virus containing 5× 10 5 TCID 50 dose after deep anesthetization.
Day 1-3: observation and weighing, preparation of supplies
(1) Observation and weighing: the mice were observed and their body weights were recorded every day for 3 consecutive days
(2) Preparation of the following experimental supplies according to the number of mice and experimental groups:
□ 1XPBS buffer: 1000 ml, ready for use after high pressure: dividing 500 ml, addition of double antibody PS (10000U) (5ml+500ml) according to the ratio of 1: 100.
□ Dissecting instruments: 2 sets, each set included: elbow forceps, tooth forceps, small scissors, flat-tip forceps, elbow scissors, 2 surgical forceps, ready for use after high pressure.
□ 1.5 ml spiral EP tube: 2 boxes, ready for use after high pressure.
□ 1.5 ml spiral EP tube (filled with Halo beads) : 1 box, ready for use after high pressure.
□ 5 ml centrifuge tube: 2 boxes, ready for use after high pressure.
□ 50 ml centrifuge tube: 25 (pre-installed 30ml 4%paraformaldehyde)
□ Anticoagulant 1.5 ml centrifuge tube: 1 box (prepared according to the delivery situation)
□ High-throughput tissue homogenizer
Blood collection, dissection and tissue collection from mice
(1) Blood collection and sacrifice: blood was collected from the orbit from 3 mice in each group in the biological safety cabinet, and the mice were euthanized by cervical dislocation.
(2) Dissection and lung tissue collection: the mice were sprayed with 75%ethanol on the whole body, fixed with the abdomen facing up, and dissected in a biological safety cabinet. The abdominal skin was picked up by an elbow tweezer in the left hand, and the subcutaneous tissue and muscles were cut by a scissor in your right hand with forward to  the neck; the skin was turned towards both sides to expose the chest, the ribs on both sides were each cut once by another sterile scissor, and the sternum and ribs were turned up, and then the entire lung was lift out by inserting elbow ophthalmic tweezers from the lung and trachea junction.
(4) Lung tissue treatment:
(A) Left lung: it was placed in 2 ml PBS (PS+) , washed twice and directly immersed in 10 ml 4%paraformaldehyde for pathological sectioning and histochemistry. The specimens were processed by conventional tissues, embedded in paraffin, sectioned, H.E. Stained and scanned to collect digital images.
(B) Right lung: it was weight and recorded, placed in 2 ml PBS (PS+) , washed twice, and resuspended in PBS (PS+) at a volume of 1: 10～1: 20 (the resuspension volume was not less than 300 μl, if the volume was too small, the resuspension volume was amplified at 1: 30) , and transferred to a 1.5 ml spiral tube with Halo beads. After frozen at -70℃ overnight, the lung tissue homogenate was prepared the next day (K4 laboratory) .
(5) Sample transfer: all samples were placed in sealed cryotubes and containers, and the surface of the container was fully disinfected and transferred to K4 laboratory.
Treatment of lung tissue homogenate and determination of virus titer
(1) Lung tissue homogenization: the lung tissue was took out from -70℃ refrigerator and homogenized after thawing.
(2) Centrifugation: the homogenate was centrifuged at 4000 rpm at 4℃ for 5 minutes, and the supernatant was transferred to a new 1.5 ml screw-top EP tube.
(3) Determination of nucleic acid copy number in lung tissue homogenate (2020.5.12) : 100 μl of supernatant were pipetted to extract nucleic acid, to determine the virus copy number of lung tissue by RT-PCR method.
(4) Determination of TCID 50 titer of lung tissue homogenate (2020.5.12-5.15) : 100 μl of the supernatant were pipetted and diluted 10 times from 10 -1, with a total of 4 dilutions (10 -1, 10 -2, 10 -3, 10 -4) , 100 μl from which was used to infect the Vero cells prepared in advance, with 8 replicate wells for each dilution, followed by observation to determine the TCID 50 after 72～96 h.
Viral nucleic acid extraction and real-time qCPR detection
200 μl of mouse lung suspension was pipetted in a biological safety cabinet and added to the lysis solution of Ex-DNA/RNA virus (CDC) nucleic acid extraction kit (T104, Xi’a n Tianlong Technology Co., Ltd. ) for lysis, followed by nucleic acid extraction according to instructions of the automatic rotary nucleic acid extractor (GeneRotex 96, Xi'an  TianlongTechnology Co., Ltd. ) , and finally to elute with 80μl of eluent. 5μl of nucleic acid was took to prepare the system for real-time fluorescent RT-PCR reaction on the ABI Q5 fluorescent quantitative PCR instrument. Forward primer (F) :
CCCTGTGGGTTTTACACTTAA; reverse primer (R) : ACGATTGTGCATCAGCTGA; fluorescent probe (P) : 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3', reaction system: 12.5 μL 2×One Step SYBR RT-PCR Buffer Ⅲ, 0.5 μL Takara Ex Taq HS, 0.5 μLPrimeScript RT Enzyme Mix Ⅱ, 1 μL upstream primer, 1 μL downstream primer, 1 μL probe, 5 μL RNA template, to 25 μL with sterile double distilled water. The reaction parameters were: 42℃ for 5 min, 95℃ for 10 s, a cycle; 95℃ for 10s, 60℃ for 30 s, 40 cycles, and fluorescence signals were collected after extension.
6.6 Experimental results
6.6.1 Mouse weight: see Table 6-1 for the raw data of daily mouse weight. The weight of the mouse on the first day was taken as the initial weight, and the trend of daily weight change of the mouse was analyzed. The results of Balb/C mice were shown in Table 6-1 and FIG. 18. Balb/C mice were infected with COVID-19 on day 5 after transduction of Ad-hACE2, and were observed for 4 consecutive days. They were in good condition and showed no significant weight loss. The results of C57 mice were shown in Table 6-2 and FIG. 19. C57 mice were infected with COVID-19 on day 5 after transduction of Ad-hACE2, and were observed for 4 consecutive days. They were in good condition and showed no significant weight loss.
Table 6-1 Raw weight data of Balb/C mice
Figure PCTCN2021074670-appb-000034
Table 6-2. Raw data of the body weight of C57 mouse
Figure PCTCN2021074670-appb-000035
6.6.2 Viral load titration of mouse lung tissue: the dissected lung tissue was weighed and ground, followed by RNA extraction and quantitative PCR analysis, for the weight of the ground lung tissue and the original data of the Ct value obtained by quantitative PCR and the determination of TCID50, with results shown in Table 6-3, Table 6-4 and FIG. 20, FIG. 21. Balb/C mice were infected with COVID-19 after transduction of Ad-hACE2, and the replication and proliferation of the virus in the lungs could be detected (mean Copies/g=10 9.12; logTCID 50/ml=4.75) . The high dose mRNA vaccine immunization group could effectively protect Balb/C against COVID-19 challenge. The mean Copies/g=10 7.84; logTCID 50/ml=2.54 of the double-injection immunization group was statistically different from the control group (Table 6-3, FIG. 20) .
C57 mice were infected with COVID-19 after transduction of Ad-hACE2, and the replication and proliferation of the virus in the lungs could be detected (mean Copies/g=10 9.03; logTCID 50/ml=4.06) . The high dose mRNA vaccine immunization group could effectively protect C57 mice against COVID-19 challenge. The mean Copies/g=10 6.67; logTCID 50/ml=2.79 of the single-injection immunization group; the mean Copies/g=10 4.56; logTCID 50/ml=1.96 of the double-injection immunization group were statistically different  from the control group (Table 6-4, FIG. 21) .
Table 6-3 Raw data related to titration of viral load in lung tissue of Balb/C mice
Figure PCTCN2021074670-appb-000036
Table 6-4 Raw data related to titration of viral load in lung tissue of C57 mice
Figure PCTCN2021074670-appb-000037
6.6.3 Lung tissue pathology
The lungs of 3 mice in each of the immunized group and the control group were embedded in paraffin for tissue sectioning. Then they were stained with hematoxylin and eosin (H&E) . FIG. 22-23 showed the results of Balb/C mice in each group, and FIG. 6-6 showed the results of C57 mice in each group. Control group: pulmonary phlebitis and interstitial pneumonia. There were large areas of pulmonary alveolar rupture, a large number of inflammatory cell infiltration, serious lung pathology, and inflammatory exudation in the alveolar cavity. Vaccine group: pulmonary phlebitis and interstitial  pneumonia. The alveoli appeared partially ruptured and partially infiltrated with inflammatory cells. Only some alveolar fusion, a small amount of alveolar wall thickening, and a small amount of inflammatory cell infiltration were visible.
6.7 Experimental conclusion
The weight of Balb/C mice control group did not decrease significantly after challenge. The number of RNA copies of virus titer in lung tissue reached Copies/g=10 9.12 per gram, and the virus TCID 50 reached logTCID 50/ml=4.75 per gram. The lung lesions were obvious, with severe interstitial pneumonia.
After the Balb/C mouse immunization group was challenged, the weight of the mice immunized with 2 injections of the high dose mRNA vaccine did not significantly decrease. Lung tissue virus titer RNA copy number is Copies/g=10 7.84 per gram, with an average decrease of 1.28 Log times (19.1 times) ; virus TCID 50 titer was logTCID 50/ml=2.54 per gram, with an average decrease of 2.21 Log times (161 times) There were slight lung lesions, with mild interstitial pneumonia. It was suggested that the high dose two-injection vaccine of mRNA vaccine had obvious protective effect.
The weight of the C57 mouse control group did not decrease significantly after challenge. The number of RNA copies of virus titer in lung tissue reached Copies/g=10 9.03 per gram and the virus TCID 50 reached logTCID 50/ml=4.06 per gram. The lung lesions were obvious, with severe interstitial pneumonia.
After the C57 mouse immunization group was challenged, the weight of the mice in the high dose mRNA vaccine immunization group did not significantly decrease. Lung tissue virus titer RNA copy number is Copies/g=10 4.56 per gram, with an average decrease of 4.47 Log times (29211 times) ; virus TCID 50 titer was logTCID 50/ml=1.96 per gram, with an average decrease of 2.1 Log times (120 times) There were slight lung lesions, with mild interstitial pneumonia.
It was suggested that the high dose two-injection vaccine of mRNA vaccine had obvious protective effect.
Experiment 10: Verification of COVID-19 infection effect in rhesus monkeys  immunized with COVID-19-LPP-mRNA
Experimental objective: Using P3/P4 Laboratory of the National Kunming High-level Biosafety Primate Experimental Center, Institute of Medical Biology, Chinese Academy of Medical Sciences, the immunogenicity of rhesus monkeys after immunization with  COVID-19 mRNA vaccine (COVID-19-LPP-mRNA) and the protective effect after COVID-19 challenge were evaluated.
Test article information: name: mRNA vaccine COVID-19-LPP-mRNA; provider: Siwei (Shanghai) Biotechnology Co., Ltd.; specification: 0.2 mg/ml; traits: milky white liquid; expiration date: stored at 2-8℃ for 28 days.
Experimental animals: 7 male experimental rhesus monkeys were provided by the Institute of Medical Biology, Chinese Academy of Medical Sciences (experimental animal production license: SCXK (Dian) K2015-0004) , aged 4 years, divided into 2 groups, PBS group (3 monkeys) , vaccine group (4 monkeys) . Three days before the challenge, they were transferred to the P4 large animal laboratory for adaptive breeding. All animal experiments were carried out in compliance with biosafety operating regulations and animal ethics, and humane care was given to animals to ensure animal welfare. The experimental operations were all performed under anesthesia, which could take into account biological safety and animal ethics. The animal experiment was reviewed and approved by the Experimental Animal Ethics Committee of the Institute of Medical Biology, Chinese Academy of Medical Sciences, with the approval number: DWSP202004042.
Experimental strain: COVID-19 (SARS-CoV-2) was obtained from the Guangdong Provincial Center for Disease Control and Prevention, and the strain used was the strain named "GD108#strain" . The introduction and transportation of the virus by the National Kunming High-level Biosafety Experimental Center was approved by the National Health Commission, and it was amplified and stored in this center.
Experimental reagents
Figure PCTCN2021074670-appb-000038
Figure PCTCN2021074670-appb-000039
Experimental devices
Figure PCTCN2021074670-appb-000040
Experimental methods
0.7.1 Vaccine immunization
Monkeys under the same breeding conditions were grouped according to grouping requirements for immunization.
Figure PCTCN2021074670-appb-000041
First immunization: Day 0; Second immunization: Day 14; Third immunization: Day 33;
10.7.2 Immunization method and dose
Immunization method: intramuscular injection, two-point injection on the left and right  arms;
Dose: No adjuvant vaccine group: 200 μg COVID-19-LPP-mRNA;
Volume: 1.0 mL;
Concentration: 200 μg/mL;
10.7.3 Cultivation, concentration and titration of SARS-CoV-2 virus
SARS-CoV-2 virus had good adaptability in VERO-E6 cells. After inoculating the viruses with 20 T225 cell culture flasks, the viruses were collected at about 72 hours after observing the obvious CPE under a microscope and stored at 80℃. On the next day, the viruses were thawed slowly at 4℃ and centrifuged, with collection of the supernatant by ultrafiltration and concentrated, which was filtered with PBS three times, followed by eluting the viruses in a total volume of 200 mL, to obtain 200 mL of virus concentrate. Then the virus titer was determined by the plaque test.
10.7.4 Monkey challenge and detection
1) 15 days after the third immunization, the viruses were challenged by intranasal +tracheal injection. Strain GD108# (titer 1×106 Pfu/mL) was used to inoculate 500 μL each through intranasal and tracheal injection to challenge with the amount of 1×106 Pfu for each monkey.
2) Weight test: from 3 days before the challenge, weight would be tested after the challenge for every day.
3) Body temperature change detection: the body temperature was tested at the site of anus by an electronic body temperature measuring instrument. Before the challenge, the body temperature of each monkey was tested and recorded. After the challenge, the monkey's body temperature was monitored every day and the body temperature change data were recorded.
4) Sample treatment: before and on  days  1, 3, 5, and 7 after the challenge, the experimental monkeys were anesthetized to collect nasal swabs, throat swabs, and anal swabs. The swabs were lysed with 800 μL Trizol, 400μL of which was taken to extract the RNA template, which was washed with 50 μL water to prepare the RNA template being stored at -80℃ for later use and detected by qRT-PCR in one step. At the time of dissection,  about 50 mg of lung tissue from each lobe of the animal was taken and used for tissue homogenization with 500 μL of Trizol, 300 μL of which were taken to extract RNA template, washed with 50 μL water to prepare RNA template being stored at -80℃ for later use. It was used for subsequent real-time qRT-PCR analysis of viral load.
5) On day 7 after challenge, lung samples were collected using bronchoalveolar lavage.
6) The lungs of monkeys were analyzed by X-ray imaging.
7) Seven days after the challenge, the lungs were dissected to observe the general pathological changes. The lungs (left-upper-middle-lower, right-upper-middle-lower) , trachea, and bronchus were taken for viral load detection and tissue section HE staining diagnosis, focusing on the lung tissues for pathological testing.
10.7.5 Viral load detection
Viral genomic RNA (gRNA) was determined by Quantitative real-time reverse transcription PCR (qRT-PCR) . QRT-PCR was used to determine the viral load of lung tissues, throat swabs, anal swabs, nasal swabs, etc. The primer and probe sequences were derived from the N gene, referring to the sequences recommended by WHO and China CDC. Forward: 5’-GGGGAACTTCTCCTGCTAGAAT-3’, Reverse: 5’-CAGACATTTTGCTCTCAAGCTG-3’,
Probe: 5'-FAMTTGCTGCTGCTTGACAGATT-TAMRA-3'
10.7.6 Determination of virus neutralization titer of immune serum in rhesus monkey SARS-CoV-2 live virus neutralization test on serum at 0dpi (45 days after immunization) before challenge was carried out on VeroE6 cells, and the antibody neutralization antibody titer of the new coronary pneumonia mRNA vaccine was initially evaluated by the CPE method. The neutralizing virus titer of serum neutralizing antibody was detected. The corresponding SARS-CoV-2 virus infection was performed on VEROE6 cells according to different serum dilution ratios and 0.05 MOI as the standard. After 72 h, the serum neutralizing antibody titer was determined by cell CPE Neutralizing antibody detection: the neutralizing antibody in immune serum was determined by the method of neutralizing true virus in vitro.
10.7.7 Pathological analysis
Whole body tissues and organs were collected for new coronavirus tissue tropism and pathological analysis. After the animals were euthanized, the lung tissues of each lobe (the left and right lungs had 6 lobes, and the frontal lobe of the right lung was too small for analysis) were fixed in formalin and used for histological observation. The histopathological changes of the lungs were observed in double-blind by two pathologists under a microscope. Vaccine effectiveness was assessed.
10.8 Experimental results
10.8.1 Virus neutralization titer of immune serum in rhesus monkey
The virus neutralization titer of immune serum in rhesus monkey was shown in Table 7-1. It could be seen from Table 7-1 that no neutralization titer was detected in the PBS group during the challenge, and the neutralization titer of the vaccine group monkeys was 16249 (1: 16) , 16175 (1: 8) , 16145 (1: 64) , 16045 (1: 8) , respectively.
Table 7-1. Virus neutralizing antibody titer of immune serum in rhesus monkey
Figure PCTCN2021074670-appb-000042
7.8.2 Changes in viral load of experimental monkeys infected with SARS-CoV-2
7.8.2.1 Viral load in lung tissues
The results of the detection of viral load in the lung tissues of experimental monkeys  infected with SARS-CoV-2 were shown in FIG. 24 (gRNA detection) . It could be seen from FIG. 24 that after the animals were euthanized on day 7 after the challenge, the average viral load in the trachea of the vaccine group decreased by 3 log values compared with the PBS group; in the bronchus immunization group, none of the 4 animals was detected with viral load: gRNA was not detected in all 6-lobe lung tissues of 4 animals in the vaccine group. High levels of gRNA were detected in the multilobed lung tissues of all animals in the PBS group.
After infection, the alveolar lavage fluid of each animal was taken from the left lung and the right lung to determine the virus gRNA content, and the results were shown in FIG. 25. No virus was detected in the left alveolar lavage fluid samples of 4 animals in the vaccine group; while the left alveolar lavage fluid samples of 3 animals in the model group were all detected high levels of viral load.
10.8.2.2 Viral load of nasal swabs
For the determination of viral load of nasal swabs, all experimental monkeys were detected a higher viral load on day 1 after virus inoculation. From day 3, the viral load of the vaccine group was significantly lower than that of the PBS group by at least 3 log values (see FIG. 26) . The viral load of the PBS group had been maintained at a high level. On day 3, the viral load of one animal in the vaccine group was 0. Although there was a slight rebound on day 5, it was again 0 on day 7. On day 7, the average viral load of the vaccine group was reduced by 3.3 log values compared with the model group.
7.8.2.3 Viral load of throat swabs
The results of the viral load detection in the throat swabs of experimental monkeys infected with SARS-CoV-2 were shown in FIG. 27 (gRNA detection) . It could be seen from FIG. 27 that gRNA could be detected in each experimental group from day 1 after the challenge. From day 3 after challenge, the result in vaccine-immunized group was lower than that in the PBS group. On  day  7, 3 of the 4 animals in the vaccine group had a viral load of 0, and the PBS group still had a high level of viral load.
7.8.3 Pathological changes
7.8.3.1 Pathological analysis
On day 7 after challenge, the rhesus monkeys in each group were euthanized to collect  lung tissues (the left and right lungs are the upper, middle and lower lobes in total) , which were fixed in formalin for histological observation. After a rigorous pathological tissue section preparation procedure, the histopathological changes of the lungs were observed in double-blind by two pathologists under a microscope.
7.8.3.2 Evaluation of lung tissue lesions
After the lung tissues of different parts were fixed in paraformaldehyde, embedded in paraffin, and stained with HE, the histopathological changes of the lungs were observed under a microscope.
The comprehensive evaluation results of the 6-lobe lung of monkeys in the PBS group were: local thickening of the lung septum, hemorrhage, lymphocyte nodules, local thickening of blood vessel walls, thrombosis in the lumen, blood cell-like exudates in the tracheal lumen, local pathological changes such as carbon deposition.
The comprehensive evaluation results of the 6-lobe lung of the monkeys in the vaccine group were as follows: the alveolar structure was relatively intact, the lung septum was slightly thickened, with slight hemorrhage, the distribution of focal dust cells, and a small amount of inflammatory cell infiltration.
7.8.3.2 Pathology score for lung tissue
All lung tissue sections were stained with hematoxylin-eosin (H&E) (Bar value represents 100μm) according to the method reported in the literature (Liu L, et al. Anti-spike IgG causes severe acute lung injury by skewing macrophage responses during acute SARS-CoV infection. JCI Insight. 2019; 4 (4) : E123158) to grade rhesus monkey lung inflammation, lung structural changes and hemorrhage, and the scoring standards of each indicator were shown in the table below. The lung tissue pathological evaluation of this batch of experiments was scored against the scoring standard table.
Lung pathological changes score sheet in rhesus monkey
Figure PCTCN2021074670-appb-000043
Figure PCTCN2021074670-appb-000044
(See: Liu L, et al. JCI Insight. 2019; 4 (4) : e123158)
According to the scoring table, the pathological slices of each lung of each rhesus monkey’s lung tissue were graded. First, at least 5 visual fields in each lung tissue of each rhesus monkey (upper left, middle left, lower left, upper right, middle right, and lower right, in total of 6-lobe lung) were randomly selected for scoring. The average of pathological scores of all lung lobes was the comprehensive pathological score of the entire lung of this monkey. The comprehensive pathological score results of each monkey in each group were shown below table. The results showed that the comprehensive pathological scores of lung tissue in the vaccine group were significantly lower than those in the PBS group (see the following table and FIG. 28-34) . The average lung pathological damage score of animals in the PBS model control group was 6.28 points, and the average lung pathological damage score of animals in the vaccine group was 2.04 points. The results indicated that the vaccine had a significant protective effect on the lung tissue damage of rhesus monkeys.
Statistics of pathological scores of various lung lobes in rhesus monkeys
Figure PCTCN2021074670-appb-000045
Figure PCTCN2021074670-appb-000046
7.8 Experimental conclusion
On day 7 after challenge, no viral load was detected in the experimental monkey throat swabs of the vaccine group (3/3) , but the PBS group (3/3) still had a viral load above 5 log; the viral load of nasal swabs in the vaccine group was significantly lower than that in the PBS group by 3.3 log values. It showed that the vaccine could effectively eliminate SARS-CoV-2. On day 7 after challenge, no viral load was detected in the bronchus and left lower lung lavage fluid of the vaccine group animals; no viral load was detected in the lungs of 3/4 of the experimental monkeys. This showed that the vaccine could eliminate SARS-CoV-2 from the lungs.
Example 11: Screening experiment of UTR sequence
In order to obtain a better UTR sequence based on the optimized sequence, we screened the UTR sequence, and obtained some UTR sequence pairs used in the present invention by screening the UTR sequence. The method of screening was to refer to the method of Example 1, that was , selecting the ORF sequences of  NDA numbers  1 and 9, on which the UTR sequence was linked at 5’-terminal, and the following 3’UTR sequence as well as PloyA sequence were linked at 3’-terminal by transcription, none of which had be subjected to nucleic acid modification.
The liposome was encapsulated by the RNA of these sequences, with the specific steps of: mixing appropriate amount of lipid solution (ionizable lipid MC3, DSPC, cholesterol, mPEG2000-DMG according to the molar ratio of 50: 10: 38.5: 1.5 to prepare 10mg /ml lipid solution) with eGFP-mRNA (dissolved in 1mM citrate-sodium citrate buffer pH6.4) , according to the different flow rate of 12 mixing flow rate, with a fixed mixing ratio of 3 (mRNA solution ) : 1 (lipid solution) , at a fixed temperature of 37℃, to obtain lipid nanoparticles, and the particle sizes were tested to be 90.6±5.4 nanometers (nm) .
Then the cell experiment in vitro was carried out as in Example 2, and PBS without UTR sequence as a blank experimental control. It was found that UTR sequences with the  following paired sequences could all increase the expression level of RNA. UTR pairs were paired one by one according to the number, and the UTR-1 at 5'-terminal and the UTR sequence at 3'-terminal were used as a pair.
5’UTR sequence
>5’UTR-1 (SEQ NO: 36-1)
Figure PCTCN2021074670-appb-000047
>5’UTR-2 (SEQ NO: 36-2)
Figure PCTCN2021074670-appb-000048
>5’UTR-3 (SEQ NO: 36-3)
Figure PCTCN2021074670-appb-000049
>5’UTR-4 (SEQ NO: 36-4)
Figure PCTCN2021074670-appb-000050
>5’UTR-5 (SEQ NO: 36-5)
Figure PCTCN2021074670-appb-000051
>5’UTR-6 (SEQ NO: 36-6)
Figure PCTCN2021074670-appb-000052
>5’UTR-7 (SEQ NO: 36-7)
Figure PCTCN2021074670-appb-000053
>5’UTR-8 (SEQ NO: 36-8)
Figure PCTCN2021074670-appb-000054
>5’UTR-9 (SEQ NO: 36-9)
Figure PCTCN2021074670-appb-000055
>5’UTR-10 (SEQ NO: 36-10)
Figure PCTCN2021074670-appb-000056
>5’UTR-11 (SEQ NO: 36-11)
Figure PCTCN2021074670-appb-000057
>5’UTR-12 (SEQ NO: 36-12)
Figure PCTCN2021074670-appb-000058
The sequence of the 3’UTR sequence is as follows:
>3’UTR-1 (SEQ NO: 37-1)
Figure PCTCN2021074670-appb-000059
>3’UTR-2 (SEQ NO: 37-2)
Figure PCTCN2021074670-appb-000060
Figure PCTCN2021074670-appb-000061
>3’UTR-3 (SEQ NO: 37-3)
Figure PCTCN2021074670-appb-000062
>3’UTR-4 (SEQ NO: 37-4)
Figure PCTCN2021074670-appb-000063
>3’UTR-5 (SEQ NO: 37-5)
Figure PCTCN2021074670-appb-000064
>3’UTR-6 (SEQ NO: 37-6)
Figure PCTCN2021074670-appb-000065
>3’UTR-7 (SEQ NO: 37-7)
Figure PCTCN2021074670-appb-000066
>3’UTR-8 (SEQ NO: 37-8)
Figure PCTCN2021074670-appb-000067
>3’UTR-9 (SEQ NO: 37-9)
Figure PCTCN2021074670-appb-000068
>3’UTR-10 (SEQ NO: 37-10)
Figure PCTCN2021074670-appb-000069
>3’UTR-11 (SEQ NO: 37-11)
Figure PCTCN2021074670-appb-000070
>3’UTR-12 (SEQ NO: 37-12)
Figure PCTCN2021074670-appb-000071
The mRNA sequence used is the GFP sequence ( (SEQ NO: 40) :
Figure PCTCN2021074670-appb-000072
The specific process was as follows: linking the UTR-5' sequence before the 5 sequence of the GFP, and then selecting the UTR-3' sequence which was linked to the 3’-terminal of the GFP with the specific linking method as Example 1, and linking during reverse transcription, follwed by the cell experiment as in Example 2 to obtain a better  experimental pair.
The specific result was that the above corresponded according to the sequence number, that is, the 5'UTR (SEQ NO: 36-1) corresponded to the 3'UTR number, and 12 pairs of sequences were obtained, meanwhile, the fluorescent protein was expressed. From the expression results, each the paired expression levels were not significantly different, indicating that the above sequences could be used for the use of non-coding regions of messenger RNA (specific data omitted) .
In the absence of any element or limitation specifically disclosed herein, the present invention shown and described herein can be implemented. The used terms and expressions are used as explanatory terms rather than limitations, it is not intended to exclude any equivalents of the features or some of the features shown and described from the use of these terms and expressions, and it should be recognized that various modifications are possible within the scope of the present invention. Therefore, it should be understood that although the present invention is specifically disclosed through various embodiments and optional features, modifications and variations of the concepts described in the specification can be used by those of ordinary skill in the art, and it is considered that these modifications and variations fall within the scope of the present invention defined by the appended claims.
The contents of the articles, patents, patent applications, and all other documents thereof, and electronically available information described or recorded in this specification are included herein for reference in their entirety to the extent that each individual publication is specifically and separately pointed out for reference. The applicant reserves the right to incorporate any and all materials and information from any such articles, patents, patent applications, or other documents into this application.

Claims (52)

  1. A DNA sequence, comprising one or more of sequences shown in SEQ NO: 1, SEQ NO: 2, SEQ NO: 3, SEQ NO: 4, SEQ NO: 5, SEQ NO: 6, SEQ NO: 7, SEQ NO: 8 or SEQ NO: 9, or a sequence having a homology of 60%-100%or identical functions with any one of the sequences.
  2. The DNA sequence according to claim 1, wherein the sequence is one or more of sequences shown in SEQ NO: 1, SEQ NO: 2, SEQ NO: 4, SEQ NO: 5, SEQ NO: 8 or SEQ NO: 9; or a sequence having identical functions with any one of the sequences.
  3. The DNA sequence according to claim 1, wherein the sequence is a sequence shown in SEQ NO: 1.
  4. TheDNA sequence according to claim 1, further comprising a sequence shown in SEQ NO: 11 at a 5'-terminal thereof.
  5. The DNA sequence according to claim 1, further comprising a sequence shown in SEQ NO: 12 at the 5'-terminal thereof.
  6. The DNA sequence according to claim 1, further comprising a sequence shown in SEQ NO: 13 at a 3'-terminal thereof.
  7. The DNA sequence according to claim 1, further comprising a sequence shown in SEQ NO: 14 at the 3'-terminal thereof.
  8. The DNA sequence according to claim 1, whereinthe homology is 65-100%.
  9. The DNA sequence according to claim 8, whereinthe homology is70-100%.
  10. The DNA sequence according to claim 9, whereinthe homology is71-100%.
  11. The DNA sequence according to claim 10, whereinthe homology is 73-100%.
  12. The DNA sequence according to claim 11, whereinthe homology is74-100%.
  13. The DNA sequence according to claim 11, whereinthe homology is100%.
  14. The DNA sequence according to claim 11, wherein the sequence is a sequence having a homology of 70-100%with the sequence shown in SEQ NO: 1; a sequence having a homology of 74-100%with the sequence shown in SEQ NO: 3; a sequence having a homology of 70-100%with the sequence shown in SEQ NO: 5; a sequence having a homology of 65-100%with the sequence shown in SEQ  NO: 6; a sequence having a homology of 65-100%with the sequence shown in SEQ NO: 7; a sequence having a homology of 70-100%with the sequence shown in SEQ NO: 8; or a sequence having a homology of 70-100%with the sequence shown in SEQ NO: 9.
  15. A mRNA sequence, comprising one or more of mRNA sequences shown in SEQ NO: 1.1, SEQ NO: 2.2, SEQ NO: 3.3, SEQ NO: 4.4, SEQ NO: 5.5, SEQ NO: 6.6, SEQ NO: 7.7, SEQ NO: 8.8 or SEQ NO: 9.9, or a sequence having a homology of 60%-100%or identical functions with one of the sequences.
  16. The mRNA sequence according to claim 15, wherein the mRNA sequence is one or more of sequences shown in SEQ NO: 1.1, SEQ NO: 2.2, SEQ NO: 4.4, SEQ NO: 5.5, SEQ NO: 8.8 or SEQ NO: 9.9; or a sequence having a homology of 60%-100%with one of the sequences.
  17. The mRNA sequence according to claim 15 or 16, wherein the mRNA sequence is a sequence shown in SEQ NO: 1 or has a homology of 60%-100%with the sequence.
  18. The mRNA sequence according to claim 17, whereinthe homology is 65-100%.
  19. The mRNA sequence according to claim 18, whereinthe homology is 75-100%.
  20. The mRNA sequence according to claim 19, whereinthe homology is 85-100%.
  21. The mRNA sequence according to claim 20, whereinthe homology is 95-100%.
  22. The mRNA sequence according to claim 21, whereinthe homology is 98-100%.
  23. The mRNA sequence according to claim 22, whereinthe homology is 99-100%.
  24. The mRNA sequence according to claim 23, whereinthe homology is 100%.
  25. The mRNA sequence according to any one of claims 15-24, further comprising a sequence shown in SEQ NO: 11 at a 5'-terminal thereof.
  26. The mRNA sequence according to any one of claims 15-25, further comprising a sequence shown in SEQ NO: 15 at the 5'-terminal thereof.
  27. The mRNA sequence according to any one of claims 15-26, further comprising a sequence shown in SEQ NO: 16 at a 3'-terminal thereof.
  28. The mRNA sequence according to any one of claims 15-27, further comprising a sequence shown in SEQ NO: 17 at the 3'-terminal thereof.
  29. A coronavirus mRNA vaccine agent, comprising the mRNA sequence as defined in any one of claims 15-28, or an mRNA sequence obtained by reverse transcription from the DNA sequence as defined in any one of claims 1-14.
  30. The vaccine agent according to claim 29, wherein the mRNA comprises a modified nucleotide, wherein the modified nucleotide is selected from one or more of the following nucleotides: 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O (6) -methylguanine, pseudouridine, N-1-methyl-pseudouridine, 2-thiouridine and 2-thiocytidine; methylated base; inserted base; 2'-fluororibose, ribose, 2'-deoxyribose, arabinose and hexose; phosphorothioate and 5'-N-phosphoramidite bond.
  31. The vaccine agent according to claim 30, wherein the mRNA comprises a modified nucleotide, and the modified nucleotide is N-1-methyl-pseudouridine.
  32. The vaccine agent according to claim 30, wherein the modification ratio is 1%-80%.
  33. The vaccine agent according to claim 30, wherein the modification ratio is 2%-80%.
  34. The vaccine agent according to claim 30, wherein the modification ratio is 10%-80%.
  35. The vaccine agent according to claim 30, wherein the modification ratio is 30%-80%.
  36. The vaccine agent according to claim 30, wherein the modification ratio is 40%-60%.
  37. The vaccine agent according to claim 30, wherein the modification ratio is 50%.
  38. The vaccine agent according to claim 29, further comprising a polymer that forms a nanoparticle with the nucleotide, wherein the polymer is selected from one or more of the following polymers: polyacrylate, polyalkylcyanoacrylate,  polylactide, polylactide-polyglycolide copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, polyethyleneimine, polyethyleneimine (PEI) , or branched PEI.
  39. The vaccine agent according to claim 29, further comprising a liposome, wherein a core structure comprising the nucleotide anda polymer is encapsulated in the liposome to form nanoparticles.
  40. The vaccine agent according to claim 29, further comprising a liposome, wherein the nucleotide is encapsulated by the liposome to form nanoparticles.
  41. The vaccine agent according to any one of claims 39-40, wherein the liposome is selected from one or more of the following: cationic liposome, non-cationic liposome, sterol-based liposome, and/or PEG-modified liposome.
  42. The vaccine agent according to claim 41, wherein a cationic liposome comprises: C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazolyl) , HGT5000, HGT5001, OF-02, DODAC, DDAB, DMRIE, DOSPA , DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA and HGT4003, or combinations thereof.
  43. The vaccine agent according to claim 41, wherein a non-limiting instance of the non-cationic liposome can comprise ceramide, cephalin, cerebroside, diacylglycerol, 1, 2-dipalmitoyl-sn-glyceryl-3-phosphorylglycerol sodium salt (DPPG) , 1, 2-distearoyl-sn-glyceryl-3-phosphoethanolamine (DSPE) , 1, 2-distearoyl-sn-glyceryl-3-phosphocholine (DSPC) , 1, 2-dipalmitoyl-sn-glyceryl-3-phosphocholine (DPPC) , 1, 2-dioleyl-sn-glyceryl-3-phosphoethanolamine (DOPE) , 1, 2-dioleyl-sn-glyceryl-3-phosphatidylcholine (DOPC) , 1, 2-dipalmitoyl-sn-glyceryl-3-phosphoethanolamine (DPPE) , 1, 2-dimyristoyl-sn-glyceryl-3-phosphoethanolamine (DMPE) , and 1, 2-dioleoyl-sn-glyceryl-3-phosphate- (1'-rac-glycerol) (DOPG) , 1-palmitoyl-2-oleoyl-phosphatidylethanolamine (POPE) , 1-palmitoyl-2-oleoyl-sn-glyceryl-3-phosphocholine (POPC) ,  1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE) , sphingomyelin, or combinations thereof.
  44. The vaccine agent according to claim 41, a sterol-based cationic liposome can constitute no more than 70%of the total liposome in liposomal nanoparticles.
  45. The vaccine agent according to claim 44, wherein the sterol-based cationic liposome comprises phosphatidyl compound, phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipid, cerebroside, and ganglioside, or combinations thereof.
  46. The vaccine agent according to any one of claims 39-46, further comprising a PEG-modified liposome, such as DMG-PEG, DMG-PEG2K, C8-PEG, DOGPEG, ceramide PEG and DSPE-PEG, or combinations thereof.
  47. The vaccine agent according to claim 29, further comprising protamine sulfate, DOPE, DSPE-mPEG2000 and M5, wherein a structure of the M5 is:
    Figure PCTCN2021074670-appb-100001
  48. The vaccine agent of claim 47, wherein the M5: DOPE: DSPE-mPEG2000=49: 49: 2 (mass ratio) .
  49. A DNA vaccine agent, comprising the DNA sequence as defined in any one of claims 1-14.
  50. A UTR sequence, comprising one or more of 5'UTR sequences shown in SEQ NO: 36-1 to 36-12, or 3'UTR sequences shown in SEQ NO: 37-1 to 37-12.
  51. The UTR sequence according to claim 51, the 5'UTR sequence is a sequence shown in SEQ NO: 36-11, the 3'UTR sequence is a sequence shown in SEQ NO: 37-11; or the 5'UTR sequence is a sequence shown in SEQ NO: 36-12, the 3'UTR sequence is a sequence shown in SEQ NO: 37-12.
  52. A UTR sequence at 3’-terminal, comprising a sequence shown in SEQ NO: 37-11 or SEQ NO: 37-12.
PCT/CN2021/074670 2020-02-13 2021-02-01 Vaccine agent for treating or preventing coronavirus disease WO2021159985A1 (en)

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
CN202010090564.4 2020-02-13
CN202010090564 2020-02-13
CN202010418211.2 2020-05-18
CN202010418211 2020-05-18
CN202010767364 2020-08-03
CN202010767364.8 2020-08-03
CN202110109503.2A CN113186203B (en) 2020-02-13 2021-01-27 Vaccine agent for treating or preventing coronavirus diseases
CN202110109503.2 2021-01-27

Publications (1)

Publication Number Publication Date
WO2021159985A1 true WO2021159985A1 (en) 2021-08-19

Family

ID=76972663

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2021/074670 WO2021159985A1 (en) 2020-02-13 2021-02-01 Vaccine agent for treating or preventing coronavirus disease

Country Status (2)

Country Link
CN (1) CN113186203B (en)
WO (1) WO2021159985A1 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113633764A (en) * 2021-09-02 2021-11-12 中国食品药品检定研究院 Novel corona DNA vaccine containing adjuvant
US11241493B2 (en) 2020-02-04 2022-02-08 Curevac Ag Coronavirus vaccine
US11471525B2 (en) 2020-02-04 2022-10-18 Curevac Ag Coronavirus vaccine
US11547673B1 (en) 2020-04-22 2023-01-10 BioNTech SE Coronavirus vaccine
WO2023113094A1 (en) * 2021-12-16 2023-06-22 주식회사 씨티씨백 Covid-19 vaccine composition with increased immunogenicity
WO2023067193A3 (en) * 2021-10-22 2023-07-06 BioNTech SE Compositions for administration of different doses of rna
US11865190B2 (en) 2018-10-09 2024-01-09 The University Of British Columbia Compositions and systems comprising transfection-competent vesicles free of organic-solvents and detergents and methods related thereto
US11872280B2 (en) 2020-12-22 2024-01-16 CureVac SE RNA vaccine against SARS-CoV-2 variants
US11878055B1 (en) 2022-06-26 2024-01-23 BioNTech SE Coronavirus vaccine

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113322271A (en) * 2020-06-24 2021-08-31 西南交通大学 COVID-19 subunit vaccine based on yeast surface display system
CN112575008B (en) * 2020-12-31 2023-03-24 四川大学华西医院 Nucleic acid molecules encoding structural proteins of novel coronaviruses and novel coronavirus vaccines
CN114432435B (en) * 2022-01-25 2024-05-17 苏州大学 SARS-Cov-2 vaccine based on polyhedra nano structure and its preparation method and application
CN114644686B (en) * 2022-03-24 2023-09-05 中国人民解放军陆军军医大学 Delivery system for DNA vaccine, application of delivery system and DNA vaccine
CN116925195B (en) * 2022-04-22 2024-06-21 仁景(苏州)生物科技有限公司 MRNA vaccine based on novel coronavirus
TW202400251A (en) * 2022-04-27 2024-01-01 大陸商瑞可迪（上海）生物醫藥有限公司 Nucleic acid constructs and applications thereof
WO2023217267A1 (en) * 2022-05-13 2023-11-16 上海瑞宏迪医药有限公司 Nucleic acid construct comprising utr and use thereof
WO2024017253A1 (en) * 2022-07-19 2024-01-25 深圳深信生物科技有限公司 Mrna for sars-cov-2 s protein and use thereof
WO2024032611A1 (en) * 2022-08-09 2024-02-15 斯微(上海)生物科技股份有限公司 Lipid composition
CN115869332A (en) * 2022-10-27 2023-03-31 北京新合睿恩生物医疗科技有限公司 mRNA drug with low expression in liver after delivery into body and preparation method thereof
WO2024098361A1 (en) * 2022-11-11 2024-05-16 斯微(上海)生物科技股份有限公司 Artificial nucleic acid molecule

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004096842A2 (en) * 2003-04-28 2004-11-11 Public Health Agency Of Canada Sars virus nucleotide and amino acid sequences and uses thereof
WO2018115527A2 (en) * 2016-12-23 2018-06-28 Curevac Ag Mers coronavirus vaccine
WO2019092437A1 (en) * 2017-11-10 2019-05-16 Ucl Business Plc Improved lipid-peptide nanocomplex formulation for mrna delivery to cells
CN110167587A (en) * 2016-11-11 2019-08-23 摩登纳特斯有限公司 Influenza vaccines
WO2019209914A2 (en) * 2018-04-27 2019-10-31 Seattle Children's Hospital (dba Seattle Children's Research Institute) Homology-directed repair template design and delivery to edit hemoglobin-related mutations
WO2019232097A1 (en) * 2018-05-30 2019-12-05 Translate Bio, Inc. Phosphoester cationic lipids

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004096842A2 (en) * 2003-04-28 2004-11-11 Public Health Agency Of Canada Sars virus nucleotide and amino acid sequences and uses thereof
CN110167587A (en) * 2016-11-11 2019-08-23 摩登纳特斯有限公司 Influenza vaccines
WO2018115527A2 (en) * 2016-12-23 2018-06-28 Curevac Ag Mers coronavirus vaccine
WO2019092437A1 (en) * 2017-11-10 2019-05-16 Ucl Business Plc Improved lipid-peptide nanocomplex formulation for mrna delivery to cells
WO2019209914A2 (en) * 2018-04-27 2019-10-31 Seattle Children's Hospital (dba Seattle Children's Research Institute) Homology-directed repair template design and delivery to edit hemoglobin-related mutations
WO2019232097A1 (en) * 2018-05-30 2019-12-05 Translate Bio, Inc. Phosphoester cationic lipids

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE Nucleotide Genbank; ANONYMOUS: "Severe acute respiratory syndrome coronavirus 2 isolate 2019-nCoV_HKU-", XP055836894, retrieved from NCBI *
NORBERT PARDI, MICHAEL J. HOGAN, FREDERICK W. PORTER, DREW WEISSMAN: "mRNA vaccines — a new era in vaccinology", NATURE REVIEWS DRUG DISCOVERY, NATURE PUBLISHING GROUP, GB, vol. 17, no. 4, GB, pages 261 - 279, XP055524319, ISSN: 1474-1776, DOI: 10.1038/nrd.2017.243 *

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11865190B2 (en) 2018-10-09 2024-01-09 The University Of British Columbia Compositions and systems comprising transfection-competent vesicles free of organic-solvents and detergents and methods related thereto
US11980673B2 (en) 2018-10-09 2024-05-14 The University Of British Columbia Compositions and systems comprising transfection-competent vesicles free of organic-solvents and detergents and methods related thereto
US11596686B2 (en) 2020-02-04 2023-03-07 CureVac SE Coronavirus vaccine
US11576966B2 (en) 2020-02-04 2023-02-14 CureVac SE Coronavirus vaccine
US11241493B2 (en) 2020-02-04 2022-02-08 Curevac Ag Coronavirus vaccine
US11964011B2 (en) 2020-02-04 2024-04-23 CureVac SE Coronavirus vaccine
US11964012B2 (en) 2020-02-04 2024-04-23 CureVac SE Coronavirus vaccine
US11471525B2 (en) 2020-02-04 2022-10-18 Curevac Ag Coronavirus vaccine
US11925694B2 (en) 2020-04-22 2024-03-12 BioNTech SE Coronavirus vaccine
US11779659B2 (en) 2020-04-22 2023-10-10 BioNTech SE RNA constructs and uses thereof
US11951185B2 (en) 2020-04-22 2024-04-09 BioNTech SE RNA constructs and uses thereof
US11547673B1 (en) 2020-04-22 2023-01-10 BioNTech SE Coronavirus vaccine
US11872280B2 (en) 2020-12-22 2024-01-16 CureVac SE RNA vaccine against SARS-CoV-2 variants
US11918643B2 (en) 2020-12-22 2024-03-05 CureVac SE RNA vaccine against SARS-CoV-2 variants
CN113633764B (en) * 2021-09-02 2024-05-14 中国食品药品检定研究院 New crown DNA vaccine containing adjuvant
CN113633764A (en) * 2021-09-02 2021-11-12 中国食品药品检定研究院 Novel corona DNA vaccine containing adjuvant
EP4238577A3 (en) * 2021-10-22 2023-12-06 BioNTech SE Compositions for administration of different doses of rna
WO2023067193A3 (en) * 2021-10-22 2023-07-06 BioNTech SE Compositions for administration of different doses of rna
WO2023113094A1 (en) * 2021-12-16 2023-06-22 주식회사 씨티씨백 Covid-19 vaccine composition with increased immunogenicity
US11878055B1 (en) 2022-06-26 2024-01-23 BioNTech SE Coronavirus vaccine

Also Published As

Publication number Publication date
CN113186203A (en) 2021-07-30
CN113186203B (en) 2022-12-30

Similar Documents

Publication Publication Date Title
WO2021159985A1 (en) Vaccine agent for treating or preventing coronavirus disease
JP2023513073A (en) Respiratory virus immunization composition
JP2022523794A (en) Cyclic polyribonucleotide and pharmaceutical composition thereof
KR20220053599A (en) Improved Lipid Nanoparticles for Delivery of Nucleic Acids
JP2022519557A (en) Method for preparing lipid nanoparticles
EP3746090A1 (en) Rsv rna vaccines
CN106413811A (en) Mrna therapy for argininosuccinate synthetase deficiency
TW201136594A (en) Modulation of hsp47 expression
EA012965B1 (en) Composition for preparing high titer recombinant influenza viruses, method for preparing thereof and high titer recombinant influenza viruses
JP2024514183A (en) Epstein-Barr virus mRNA vaccine
Zhao et al. Immersion vaccination of Mandarin fish Siniperca chuatsi against infectious spleen and kidney necrosis virus with a SWCNTs-based subunit vaccine
KR20220143684A (en) Composition and method of mRNA vaccine against novel coronavirus infection
TW202216739A (en) mRNA and novel coronavirus mRNA vaccine containing the same which is economical and efficient, safer and more efficient, more stable in structure, and more efficient in protein expression
EP4366768A1 (en) Pan-human coronavirus vaccines
WO2018160690A1 (en) Rna pharmaceutical formulations for prophylactic and therapeutic treatment of zika virus infection
JP2022536951A (en) Methods of administering cyclic polyribonucleotides
TW202218669A (en) Immunogenic compositions and uses thereof
AU2022237382A1 (en) Therapeutic use of sars-cov-2 mrna domain vaccines
KR101715228B1 (en) Dengue virus-specific sirna, double helix oligo-rna structure comprising sirna, and composition for suppressing proliferation of dengue virus comprising rna structure
US20230330211A1 (en) Compositions and methods for treating and preventing coronaviruses
EP4228679A1 (en) Pan-ras mrna cancer vaccines
WO2021185766A1 (en) Treatment of covid-19 with reverse micelle system comprising unmodified oligonucleotides
DK2191002T3 (en) BACULOVIRUS VECTORS WITH A DOUBLE VERTEBRAT AND BACULOVIRUS PROMOTER REGULATING AN IMMUNOGENT FUSION GENE
CN117043343A (en) Nucleic acid vaccine for mutant coronaviruses
CN115960180A (en) 2019-nCoV S protein mutant and genetically engineered mRNA and vaccine composition thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21753687

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21753687

Country of ref document: EP

Kind code of ref document: A1

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM1205A DATED 09.03.2023)

122 Ep: pct application non-entry in european phase

Ref document number: 21753687

Country of ref document: EP

Kind code of ref document: A1