CN117043343A - Nucleic acid vaccine for mutant coronaviruses - Google Patents

Nucleic acid vaccine for mutant coronaviruses Download PDF

Info

Publication number
CN117043343A
CN117043343A CN202280005623.0A CN202280005623A CN117043343A CN 117043343 A CN117043343 A CN 117043343A CN 202280005623 A CN202280005623 A CN 202280005623A CN 117043343 A CN117043343 A CN 117043343A
Authority
CN
China
Prior art keywords
nucleic acid
lipid
protein
acid molecule
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202280005623.0A
Other languages
Chinese (zh)
Inventor
英博
路希山
燕化远
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Aibo Biotechnology Co ltd
Original Assignee
Suzhou Aibo Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Aibo Biotechnology Co ltd filed Critical Suzhou Aibo Biotechnology Co ltd
Publication of CN117043343A publication Critical patent/CN117043343A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/575—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5123—Organic compounds, e.g. fats, sugars
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Abstract

Provided herein are therapeutic nucleic acid molecules for controlling, preventing and/or treating infectious diseases caused by coronaviruses. Also provided herein are therapeutic compositions, including vaccines and lipid nanoparticles, comprising the therapeutic nucleic acids, and related therapeutic methods and uses.

Description

Nucleic acid vaccine for mutant coronaviruses
1. Cross-reference to related applications
The present application claims the title "NUCLEIC ACID VACCINES FOR MUTANT CORONAVIRUS" filed on 7.7.30 of 2021 and designates the rights and priority of PCT application number PCT/CN2021/109704, which is hereby incorporated by reference in its entirety for all purposes.
2. Technical field
The present disclosure relates generally to nucleic acid molecules useful in the control, prevention and treatment of coronavirus infections, including infections caused by mutants of the viruses. The disclosure also relates to lipid-containing compositions (including vaccines) of the nucleic acid molecules, and related methods of delivery.
3. Background art
Coronaviruses pose a serious health threat to humans and other animals. From 2002 to 2003, severe acute respiratory syndrome coronavirus (SARS-CoV) infects 8,000 people with a mortality rate of about 9%. Since 2012, the middle east respiratory syndrome coronavirus (MERS-CoV) infects 1,700 more people with a mortality rate of about 36%. Porcine epidemic diarrhea coronavirus (PEDV) has rolled throughout the united states since 2013, resulting in almost 100% mortality of piglets and over 10% of american swine herds being destroyed in less than one year. In month 3 of 2020, the World Health Organization (WHO) announced a pandemic caused by a 2019 coronavirus disease (covd-19) outbreak, which has been coiled for more than 180 countries and caused 80,000 deaths in the first months of the outbreak. The infectious pathogen responsible for COVID-19 is the coronavirus SARS-CoV-2. Subsequently, various mutant variants of SARS-CoV-2 coronavirus have emerged, which variants differ from the initially detected virus pattern. For example, a mutant form was detected in southeast England in month 9 of 2020. This variant (now called b.1.1.7) rapidly became the most common coronavirus type in the uk, accounting for about 60% of new covd-19 cases at 12 in 2020. Different variants appear in brazil, california and other areas. Another variant, termed b.1.351, first appears in south africa and is reported to have the ability to reinfect humans recovering from early versions of coronaviruses and may also be somewhat resistant to some coronavirus vaccines designed for early versions of coronaviruses.
In general, the patient with covd-19 shows symptoms of a wide range of respiratory, gastrointestinal and central nervous system diseases in humans and other animals. The pandemic threatens human health and causes economic losses in many countries and regions of the world. Thus, there is a need for effective therapeutic agents, including vaccines, for inhibiting coronavirus infection. The present disclosure meets this need.
4. Summary of the invention
In one aspect, provided herein are non-naturally occurring nucleic acid molecules useful for the prevention, control, and treatment of infectious diseases. In some embodiments, the non-naturally occurring nucleic acid encodes a viral peptide or protein derived from a coronavirus SARS-CoV-2 b.1.351 variant. In some embodiments, the non-naturally occurring nucleic acid encodes a viral peptide or protein derived from a coronavirus comprising a genome, wherein the genome comprises the nucleic acid sequence set forth in SEQ ID NO. 69.
In some embodiments, the non-naturally occurring nucleic acid molecule comprises a coding region, wherein the coding region comprises one or more Open Reading Frames (ORFs), and wherein at least one ORF encodes the viral peptide or protein. In some embodiments, at least one ORF encodes a heterologous peptide or polypeptide. In some embodiments, the heterologous peptide or polypeptide is an immunostimulatory peptide or protein. In some embodiments, the ORF encodes a fusion protein comprising a viral peptide or protein fused to a heterologous peptide or polypeptide. In some embodiments, the heterologous peptide or polypeptide is selected from the group consisting of an Fc region of a human immunoglobulin, a signal peptide, and a peptide that promotes multimerization of a fusion protein.
In some embodiments, the one or more ORFs consist of a coding sequence selected from SEQ ID NOS: 61, 62, 64, 65, 67, 68, 71 or transcribed RNA sequences thereof. In some embodiments, the one or more ORFs encode a peptide or protein selected from SEQ ID NOS 60, 63, 66, and 70.
In some embodiments, the non-naturally occurring nucleic acid molecule further comprises a 5' untranslated region (5 ' -UTR), wherein the 5' -UTR comprises the sequence set forth in SEQ ID NO: 46-51. In some embodiments, the non-naturally occurring nucleic acid molecule further comprises a 3' untranslated region (3 ' -UTR), wherein the 3' -UTR comprises the sequences set forth in SEQ ID NOS 52-57. In some embodiments, the 3' -UTR further comprises a poly-a tail or polyadenylation signal.
In some embodiments, the non-naturally occurring nucleic acid molecule further comprises one or more functional nucleotide analogs selected from the group consisting of pseudouridine, 1-methyl-pseudouridine, and 5-methylcytosine. In some embodiments, the non-naturally occurring nucleic acid molecule further comprises a nucleic acid that is DNA or mRNA.
In some embodiments, disclosed herein are vectors or cells comprising a non-naturally occurring nucleic acid molecule as described herein. In some embodiments, disclosed herein are compositions comprising non-naturally occurring nucleic acid molecules as described herein. In some embodiments, the composition is formulated as a lipid nanoparticle encapsulating the nucleic acid in a lipid shell. In some embodiments, the composition is a pharmaceutical composition.
In one aspect, provided herein are pharmaceutical compositions comprising at least one nucleic acid encoding a viral peptide or protein derived from a coronavirus SARS-CoV-2 b.1.351 variant. In some embodiments, provided herein are pharmaceutical compositions comprising at least one nucleic acid encoding a viral peptide or protein derived from a coronavirus comprising a genome, wherein the genome comprises the nucleic acid sequence set forth in SEQ ID No. 69.
In some embodiments of the pharmaceutical compositions described herein, the viral peptide or protein is selected from the group consisting of: (a) spike (S) protein of coronavirus; (b) A matrix (M) protein of a coronavirus, (c) a nucleocapsid (N) protein of a coronavirus, (d) an envelope (E) protein of a coronavirus, (E) a Hemagglutinin Esterase (HE) protein, (f) an immunogenic fragment of any of (a) to (E), and (g) a functional derivative of any of (a) to (f).
In some embodiments, the viral peptide or protein is an S protein, an immunogenic fragment of an S protein, or a functional derivative of an S protein or immunogenic fragment thereof. In some embodiments, the immunogenic fragment of the S protein is selected from the group consisting of an extracellular domain (ECD), an S1 subunit, a Receptor Binding Domain (RBD), and a Receptor Binding Motif (RBM).
In some embodiments of the pharmaceutical compositions described herein, the viral peptide or protein is a functional derivative of RBD. In some embodiments, the functional derivative of the RBD comprises one or more amino acid substitutions in the RBD capable of increasing the binding affinity of the RBD for a receptor in a host cell. In some embodiments, the receptor is ACE2. In some embodiments, the amino acid substitution comprises Y501T.
In some embodiments of the pharmaceutical compositions described herein, the viral peptide or protein comprises the amino acid sequence set forth in SEQ ID NO 60, 63 or 66. In some embodiments, the nucleic acid comprises the sequences set forth in SEQ ID NOS: 61, 62, 64, 65, 67, 68 or transcribed RNA sequences thereof.
In some embodiments of the pharmaceutical compositions described herein, the functional derivative of RBD comprises RBD fused to the Fc region of a human immunoglobulin. In some embodiments, the immunoglobulin is IgG1.
In some embodiments of the pharmaceutical compositions described herein, the functional derivative of RBD comprises RBD fused to a peptide that promotes multimerization of the fusion protein. In some embodiments, the functional derivative of the S-RBD is configured to form a trimeric complex.
In some embodiments of the pharmaceutical compositions described herein, the viral peptide or protein is an N protein. In some embodiments, the N protein comprises the amino acid sequence set forth in SEQ ID NO. 70. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO. 71 or an RNA sequence transcribed therefrom.
In some embodiments of the pharmaceutical compositions described herein, the nucleic acid further comprises a 5 'untranslated region and/or a 3' untranslated region. In some embodiments, the 5' untranslated region comprises a sequence selected from the group consisting of SEQ ID NOS: 46-51. In some embodiments, the 3' untranslated region comprises a poly-A tail or a polyadenylation signal. In some embodiments, the 3' untranslated region comprises a sequence selected from the group consisting of SEQ ID NOS: 52-57.
In some embodiments of the pharmaceutical compositions described herein, the nucleic acid comprises one or more functional nucleotide analogs selected from the group consisting of pseudouridine, 1-methyl-pseudouridine, and 5-methylcytosine.
In some embodiments of the pharmaceutical compositions described herein, the composition further comprises at least one first lipid. In some embodiments, the first lipid is a compound according to formulas (1) to (4). In some embodiments of the present invention, in some embodiments, the first lipid is according to formula (1-A), (1-B '), (1-B "), (1-C), (1-D), (1-E), (1-F '), (1-F"), (1-G), (1-H), (1-I), (1-J '), (1-J "), (1-K), (1-L), (1-M), (1-N), and (1-E) (1-N '), (1-N"), (1-O), (1-P), (1-Q), (1-R '), (1-R "), (1-S), (1-T), (1-U) (2-A), (2-B '), (2-B"), (2-C), (2-D), (2-E), (2-F '), (2-F "), and (2-F") (2-G), (2-H), (2-I), (2-J '), (2-K), (2-L), (2-M), (2-N'), (2-N "), (2-O), (2-P), (2-Q), (2-R '), (2-R"), (2-S), (2-T), (2-U), and (2-N) (3-A), (3-B'), (3-B "), (3-C), (3-D), (3-E), (3-F '), (3-F"), (3-G), (3-H), (3-I), (3-J'), (3-K), (3-L), (3-M), (3-N '), a (3-G), (3-H), (3-I), (3-J'), (3-N "), (3-O), (3-P), (3-Q), (3-R '), (3-R"), (3-S), (3-T), (3-U), (4-A), (4-B'), (4-B "), (4-C), (4-D), (4-E), (4-F '), (4-F"), (4-G), (4-H), (4-I), (4-J'), (4-J "), (4-K), (4-L), (4-M), (4-N '), (4-N"), (4-O), (4-P), (4-Q), (4-R'), (4-R "), (4-S), (4-T) or (4-U). In some embodiments, the first lipid is a compound listed in table 7. In some embodiments, the composition is formulated as a lipid nanoparticle encapsulating the nucleic acid in a lipid shell. In some embodiments, the composition is a vaccine.
In some embodiments of the pharmaceutical compositions described herein, the composition further comprises at least one first lipid. In some embodiments, the first lipid is a compound according to formulas (5) to (9). In some embodiments, the first lipid is a compound according to formula (5-A), (5-B), (7-A), or (8-A). In some embodiments, the first lipid is a compound listed in table 8. In some embodiments, the composition is formulated as a lipid nanoparticle encapsulating the nucleic acid in a lipid shell. In some embodiments, the composition is a vaccine.
In some embodiments of the pharmaceutical compositions described herein, the composition further comprises at least one first lipid. In some embodiments, the first lipid is a compound according to formulas (10) to (17). In some embodiments, the first lipid is a compound listed in table 9. In some embodiments, the composition is formulated as a lipid nanoparticle encapsulating the nucleic acid in a lipid shell. In some embodiments, the composition is a vaccine.
In some embodiments of the pharmaceutical compositions described herein, the composition further comprises at least one first lipid. In some embodiments, the first lipid is a compound according to formulas (18) to (26). In some embodiments, the first lipid is a compound according to formula (21-A), (21-B), (21-C), (21-D), (21-E), (21-F), (21-G), (21-H), (22-A), (22-B), (22-C), (22-D), (22-E), (22-F), (22-G), or (22-H). In some embodiments, the first lipid is a compound listed in table 10. In some embodiments, the composition is formulated as a lipid nanoparticle encapsulating the nucleic acid in a lipid shell. In some embodiments, the composition is a vaccine.
In some embodiments of the pharmaceutical compositions described herein, the composition further comprises at least a first lipid. In some embodiments, the first lipid is a compound according to formulas (27) to (40). In some embodiments, the first lipid is a compound according to formula (30-A), (30-B), (30-C), (30-D), (30-E), (30-F), (30-G), (30-H), (31-A), (31-B), (31-C), (31-D), (31-E), (31-F), (31-G), (31-H), (32-A), (32-B), (32-C), or (32-D). In some embodiments, the first lipid is a compound listed in table 12. In some embodiments, the composition is formulated as a lipid nanoparticle encapsulating the nucleic acid in a lipid shell. In some embodiments, the composition is a vaccine.
In some embodiments of the pharmaceutical compositions described herein, the composition further comprises at least a second lipid. In some embodiments, the second lipid is a compound according to formulas (41) to (46). In some embodiments, the second lipid is a compound according to formula (41-A), (41-B), (41-C), (41-D), (41-E), (42-A), (42-B), (42-C), (42-D), (42-E), (43-A), (43-B), (43-C), (44-A), (44-B), (44-C), (45-A), (45-B), (45-C), (46-A), (46-B), or (46-C). In some embodiments, the second lipid is a compound listed in table 14. In some embodiments, the composition is formulated as a lipid nanoparticle encapsulating the nucleic acid in a lipid shell. In some embodiments, the composition is a vaccine.
In one aspect, provided herein is a method for controlling, preventing, or treating an infectious disease caused by a coronavirus in a subject, the method comprising administering to the subject a therapeutically effective amount of a non-naturally occurring nucleic acid as described herein or a therapeutically effective amount of a pharmaceutical composition as described herein. In some embodiments, the coronavirus is SARS-CoV-2 or a variant thereof. In some embodiments, the variant is SARS-CoV-2 B.1.351.
In some embodiments of the methods described herein, the subject is a human or non-human mammal. In some embodiments, the subject is a human adult, a human child, or a human infant. In some embodiments, the subject has an infectious disease. In some embodiments, the subject is at risk for or susceptible to a coronavirus infection. In some embodiments, the subject is an elderly person. In some embodiments, the subject has been diagnosed as positive for coronavirus infection. In some embodiments, the subject is asymptomatic.
In some embodiments of the methods described herein, the method comprises administering to the subject a lipid nanoparticle encapsulating the nucleic acid, and wherein the lipid nanoparticle is endocytosed by a cell in the subject. In some embodiments, the nucleic acid is expressed by a cell in the subject.
In some embodiments of the methods described herein, an immune response is elicited in the subject against the coronavirus. In some embodiments, the immune response includes the generation of antibodies that specifically bind to viral peptides or proteins encoded by the nucleic acids. In some embodiments, the antibody is a neutralizing antibody to the coronavirus or a cell infected with the coronavirus. In some embodiments, the serum titer of the antibodies in the subject is increased.
In some embodiments, the antibody specifically binds to one or more epitopes of the S protein. In some embodiments of the methods described herein, one or more functions or activities of the S protein are reduced. In some embodiments, the decrease in S protein function or activity is measured by: (a) reduced binding of the S protein to a host cell receptor; (b) reduced attachment of coronavirus to host cells; (c) Reduction of host cell membrane fusion induced by coronavirus; or (d) a reduction in the number of cells infected with coronavirus in the subject. In some embodiments, the host receptor is selected from the group consisting of angiotensin converting enzyme 2 (ACE 2), aminopeptidase N (APN), dipeptidyl peptidase 4 (DPP 4), carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM 1), and a saccharide. In some embodiments, the function or activity of the S protein is reduced by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%.
In some embodiments of the methods described herein, the antibody specifically binds to one or more epitopes of the N protein. In some embodiments, one or more functions or activities of the N protein are attenuated. In some embodiments, the decrease in N protein function or activity is measured by: (a) Binding of the N protein to the replicating genomic sequence of the coronavirus is reduced; (b) Packaging of the replication genomic sequence of the coronavirus into the functional viral capsid is reduced; or (c) a reduction in the number of replicating viral particles in the subject. In some embodiments, the function or activity of the N protein is reduced by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%.
In some embodiments of the methods described herein, the antibody binds to a viral particle or an infected cell, and the viral particle of the infected cell is labeled for destruction by the immune system of the subject. In some embodiments, endocytosis of the viral particle bound by the antibody is induced or enhanced. In some embodiments, antibody-dependent cell-mediated cytotoxicity (ADCC) against the infected cells in the subject is induced or enhanced. In some embodiments, antibody-dependent cell phagocytosis (ADCP) is induced or enhanced in the subject against the infected cells. In some embodiments, complement Dependent Cytotoxicity (CDC) against the infected cells in the subject is induced or enhanced.
In some embodiments of the methods described herein, the infectious disease is a respiratory tract infection, a lung infection, a kidney infection, a liver infection, an intestinal infection, a nervous system infection, a respiratory syndrome, bronchitis, pneumonia, gastroenteritis, encephalomyelitis, encephalitis, sarcoidosis, diarrhea, hepatitis, and a demyelinating disease. In some embodiments, the infectious disease is a respiratory tract infection. In some embodiments, the infectious disease is a lung infection. In some embodiments, the infectious disease is respiratory syndrome. In some embodiments, the infectious disease is pneumonia.
5. Description of the drawings
FIG. 1A shows the purity of sample 3 (mRNA construct of SEQ ID NO: 72) tested by the bioanalyzer, and FIG. 1B shows the purity of sample 4 (mRNA construct of SEQ ID NO: 73) tested by the bioanalyzer.
FIG. 2 shows confocal fluorescence microscopy images of Hela cells transfected with mRNA constructs according to the present disclosure. The RBD-FITC channel shows staining of cells with 3 different monoclonal antibodies (H014, mh001 and mh 219) that recognize the SARS-CoV-2S protein RBD, respectively. DAPI channel shows staining of cells with blue fluorescent DNA stain DAPI (4', 6-diamidino-2-phenylindole). The bright channels display bright field images of the cells. Untransfected Hela cells (mock) were included as negative controls. The scale bar is 50mm.
FIG. 3 shows Western blot analysis of culture supernatants of HeLa cells transfected with mRNA constructs encoding SARS-CoV-2S protein antigen according to the present disclosure. In particular, three different mRNA constructs (RBD sample 1, RBD sample 2 and rRBD-His) encoding different antigen fragments of the SARS-CoV-2S protein RBD were included in the assay. An unrelated mRNA control was also included. Monomers and dimers of the encoded RBD fragments are shown on the blot.
FIG. 4 shows an exemplary quantification of mRNA encoded SARS-CoV-2S protein antigen concentration (ng/mL) in cell culture supernatant as determined by ELISA.
FIG. 5 shows neutralizing antibody titers in serum collected from mice vaccinated with Lipid Nanoparticle (LNP) vaccines containing mRNA encoding SARS-CoV-2 antigen. In particular, neutralizing antibody titers were measured as PRNT50 values.
FIG. 6 shows RBD expression levels in serum of five groups of experimental mice receiving 1ug-5ug doses.
Fig. 7 shows the results of detection of RBD-specific IgG antibody titers in immunized mice on days 14, 21 and 29 as measured by ELISA.
FIG. 8 shows an exemplary quantification of concentration (ng/mL) of mRNA (sample 4) encoded in cell culture supernatant from S protein antigen derived from SARS-CoV-2 and SARS-CoV-2 B.1.351 variants, respectively, as determined by ELISA.
FIG. 9A shows the results of detection of RBD-specific IgG antibody titers in mice immunized with Lipid Nanoparticles (LNP) containing mRNA encoding the SARS-CoV-2S protein RBD antigen (panel 1), LNP (panel 2, sample 3 or sample 4) containing mRNA encoding the SARS-CoV-2 B.1.351S protein RBD antigen, or PBS (panel 3), as measured by ELISA on days 14 and 21.
FIG. 9B shows the results of detection of RBD-specific IgG antibody titers in mice immunized with Lipid Nanoparticles (LNP) containing mRNA encoding the SARS-CoV-2S protein RBD antigen (panel 1), LNP (panel 2, sample 3 or sample 4) containing mRNA encoding the SARS-CoV-2 B.1.351S protein RBD antigen, or PBS (panel 3), as measured by ELISA on days 14 and 21.
FIG. 10 shows neutralizing antibody titers in serum collected from mice vaccinated with Lipid Nanoparticles (LNP) containing mRNA encoding the SARS-CoV-2S protein RBD antigen (group 1), LNP containing mRNA encoding the SARS-CoV-2 B.1.351S protein RBD antigen (group 2, sample 3 or sample 4), or PBS (group 3). In particular, neutralizing antibody titers were measured using SARS-CoV-2 pseudovirus (WT pseudovirus) or SARS-CoV-2 B.1.351 pseudovirus (SA pseudovirus) as NT50 values.
6. Detailed description of the preferred embodiments
Provided herein are therapeutic nucleic acid molecules useful for the prevention, control and treatment of infectious diseases or disorders caused by coronaviruses. Also provided herein are pharmaceutical compositions, including pharmaceutical compositions formulated as lipid nanoparticles, comprising therapeutic nucleic acid molecules, and related therapeutic methods and uses for preventing, controlling, and treating infectious diseases or disorders caused by coronaviruses, including pathogens causing pandemic disease known as covd-19. Additional features of the present disclosure will become apparent to those skilled in the art upon consideration of the following detailed description of specific embodiments.
6.1 general technique
Techniques and procedures described or referenced herein include those commonly employed by those skilled in the art to which the general understanding and/or use of conventional methods are well suited, such as, for example, sambrook et al Molecular Cloning: A Laboratory Manual (3 rd edition, 2001); current Protocols in Molecular Biology (Ausubel et al, 2003).
6.2 terminology
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For the purposes of explaining the present specification, the following description of terms will be applied, and terms used in the singular will also include the plural and vice versa, where appropriate. All patents, applications, published applications, and other publications are incorporated by reference in their entirety. If any description of a stated term conflicts with any document incorporated by reference herein, the description of the stated term shall govern as follows.
As used herein and unless otherwise indicated, the term "lipid" refers to a group of organic compounds that include, but are not limited to, fatty acid esters and are generally characterized as poorly soluble in water but soluble in many nonpolar organic solvents. Although lipids generally have poor water solubility, certain classes of lipids (e.g., lipids modified with polar groups, such as DMG-PEG 2000) have limited water solubility and are soluble in water under certain conditions. Known lipid types include biomolecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides and phospholipids. Lipids can be divided into at least three classes: (1) "simple lipids" including fats and oils, and waxes; (2) "complex lipids" including phospholipids and glycolipids (e.g., DMPE-PEG 2000); and (3) "derived lipids", such as steroids. Furthermore, as used herein, lipids also include lipid compounds. The term "lipid compound" is also referred to simply as "lipid" and refers to lipid-like compounds (e.g., amphiphilic compounds having lipid-like physical properties).
The term "lipid nanoparticle" or "LNP" refers to particles having at least one nanometer (nm) scale size (e.g., 1 to 1,000 nm) that contain one or more types of lipid molecules. The LNPs provided herein can further comprise at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules). In some embodiments, the LNP comprises a non-lipid payload molecule partially or fully encapsulated within a lipid shell. In particular, in some embodiments, wherein the payload is a negatively charged molecule (e.g., mRNA encoding a viral protein), and the lipid component of the LNP comprises at least one cationic lipid. Without being bound by theory, it is expected that cationic lipids can interact with negatively charged payload molecules and facilitate incorporation and/or encapsulation of the payload into the LNP during LNP formation. Other lipids that may form part of the LNP as provided herein include, but are not limited to, neutral lipids and charged lipids, such as steroids, polymer-bound lipids, and various zwitterionic lipids. In certain embodiments, an LNP according to the present disclosure comprises one or more cationic lipids of formulas (1) to (40) (and sub-formulas thereof) as described herein. In certain embodiments, an LNP according to the present disclosure comprises one or more polymer-bound lipids of formulas (41) through (46) (and sub-formulas thereof) as described herein.
The term "cationic lipid" refers to a lipid that is positively charged at any pH or hydrogen ion activity of its environment, or that is capable of being positively charged in response to the pH or hydrogen ion activity of its environment (e.g., the environment in which it is intended to be used). Thus, the term "cation" encompasses both "permanent cations" and "cationizable". In certain embodiments, the positive charge in the cationic lipid is caused by the presence of a quaternary nitrogen atom. In certain embodiments, the cationic lipid comprises a zwitterionic lipid that is positively charged in the environment in which it is intended to be used (e.g., at physiological pH). In certain embodiments, the cationic lipid is one or more lipids of formulas (1) to (40) (and sub-formulas thereof) as described herein.
The term "polymer-bound lipid" refers to a molecule that comprises both a lipid moiety and a polymer moiety. An example of a polymer-bound lipid is a pegylated lipid (PEG-lipid), wherein the polymer moiety comprises polyethylene glycol. In certain embodiments, the polymer-bound lipid is one or more lipids of formulas (41) to (46) (and subformulae thereof) as described herein.
The term "neutral lipid" encompasses any lipid molecule that exists in an uncharged form or in a neutral zwitterionic form at or within a selected pH range. In some embodiments, the useful pH or range selected corresponds to a pH condition in the environment of the intended lipid use, such as a physiological pH. As non-limiting examples, neutral lipids that may be used in connection with the present disclosure include, but are not limited to, phosphatidylcholine, such as 1, 2-distearoyl-sn-glycero-3-phosphorylcholine (DSPC), 1, 2-dipalmitoyl-sn-glycero-3-phosphorylcholine (DPPC), 1, 2-dimyristoyl-sn-glycero-3-phosphorylcholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphorylcholine (POPC), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (DOPC); phosphatidylethanolamine such as 1, 2-dioleoyl-sn-glycero-3-phosphate ethanolamine (DOPE), ethyl 2- ((2, 3-bis (oleoyloxy) propyl) dimethylammonium) phosphate (DOCP); sphingomyelin (SM); a ceramide; steroids such as sterols and derivatives thereof. Neutral lipids provided herein may be synthetic or derived from (isolated or modified from) natural sources or compounds.
The term "charged lipid" encompasses any lipid molecule that exists in a positively or negatively charged form at or within a selected pH. In some embodiments, the selected pH value or range corresponds to a pH condition in the environment of the intended lipid use, such as a physiological pH value. As non-limiting examples, charged lipids that may be used in connection with the present disclosure include, but are not limited to, phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, sterol hemisuccinate, dialkyltrimethylammonium-propane (e.g., DOTAP, DOTMA), dialkyldimethylaminopropane, ethylcholine phosphate, dimethylaminoethane carbamoyl sterols (e.g., DC-Chol), 1, 2-dioleoyl-sn-glycerol-3-phosphate-L-serine sodium salt (DOPS-Na), 1, 2-dioleoyl-sn-glycerol-3-phosphate- (1' -rac-glycerol) sodium salt (DOPG-Na), and 1, 2-dioleoyl-sn-glycerol-3-phosphate sodium salt (DOPA-Na). Charged lipids provided herein may be synthetic or derived from (isolated or modified from) natural sources or compounds.
As used herein and unless otherwise indicated, the term "alkyl" refers to a saturated straight or branched hydrocarbon chain group consisting of only carbon and hydrogen atoms. In one embodiment, the alkyl group has, for example, 1 to 24 carbon atoms (C 1 -C 24 Alkyl), 4 to 20 carbon atoms (C 4 -C 20 Alkyl), 6 to 16 carbon atoms (C 6 -C 16 Alkyl), 6 to 9 carbon atoms (C 6 -C 9 Alkyl), 1 to 15 carbon atoms (C 1 -C 15 Alkyl), 1 to 12 carbon atoms (C 1 -C 12 Alkyl), 1 to 8 carbon atoms (C 1 -C 8 Alkyl) or 1 to 6 carbonsAtom (C) 1 -C 6 Alkyl) and is attached to the remainder of the molecule by a single bond. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1-dimethylethyl (t-butyl), 3-methylhexyl, 2-methylhexyl, and the like. Unless otherwise indicated, alkyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "alkenyl" refers to a straight or branched hydrocarbon chain group consisting of only carbon and hydrogen atoms, which contains one or more carbon-carbon double bonds. As understood by one of ordinary skill in the art, the term "alkenyl" also encompasses groups having "cis" and "trans" configurations or, alternatively, "E" and "Z" configurations. In one embodiment, the alkenyl group has, for example, 2 to 24 carbon atoms (C 2 -C 24 Alkenyl), 4 to 20 carbon atoms (C 4 -C 20 Alkenyl), 6 to 16 carbon atoms (C 6 -C 16 Alkenyl), 6 to 9 carbon atoms (C 6 -C 9 Alkenyl), 2 to 15 carbon atoms (C 2 -C 15 Alkenyl), 2 to 12 carbon atoms (C 2 -C 12 Alkenyl), 2 to 8 carbon atoms (C 2 -C 8 Alkenyl) or 2 to 6 carbon atoms (C 2 -C 6 Alkenyl) and is linked to the remainder of the molecule by a single bond. Examples of alkenyl groups include, but are not limited to, vinyl, prop-1-enyl, but-1-enyl, pent-1, 4-dienyl, and the like. Unless otherwise indicated, alkenyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "alkynyl" refers to a straight or branched hydrocarbon chain group consisting of only carbon and hydrogen atoms, which contains one or more carbon-carbon triple bonds. In one embodiment, the alkynyl group has, for example, 2 to 24 carbon atoms (C 2 -C 24 Alkynyl), 4 to 20 carbon atoms (C 4 -C 20 Alkynyl), 6 to 16 carbon atoms (C 6 -C 16 Alkynyl), 6 to 9 carbon atoms (C 6 -C 9 Alkynyl), 2 to 15 carbon atoms (C 2 -C 15 Alkynyl), 2 to 12 carbon atoms (C 2 -C 12 Alkynyl), 2 to 8 carbon atoms (C 2 -C 8 Alkynyl) or 2 to 6 carbon atoms (C 2 -C 6 Alkynyl) and is attached to the remainder of the molecule by a single bond. Examples of alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, and the like. Unless otherwise indicated, alkynyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "alkylene" or "alkylene chain" refers to a straight or branched divalent hydrocarbon chain that connects the remainder of the molecule to a group, consisting of only carbon and hydrogen, and being saturated. In one embodiment, the alkylene group has, for example, 1 to 24 carbon atoms (C 1 -C 24 Alkylene), 1 to 15 carbon atoms (C 1 -C 15 Alkylene), 1 to 12 carbon atoms (C 1 -C 12 Alkylene), 1 to 8 carbon atoms (C 1 -C 8 Alkylene), 1 to 6 carbon atoms (C 1 -C 6 Alkylene), 2 to 4 carbon atoms (C 2 -C 4 Alkylene), 1 to 2 carbon atoms (C 1 -C 2 An alkylene group). Examples of alkylene groups include, but are not limited to, methylene, ethylene, propylene, n-butylene, and the like. The alkylene chain is linked to the rest of the molecule by a single bond and to the group by a single bond. The point of attachment of the alkylene chain to the remainder of the molecule and to the group may be through one carbon or any two carbons within the chain. Unless otherwise indicated, the alkylene chain is optionally substituted.
As used herein and unless otherwise indicated, the term "alkenylene" refers to a straight or branched divalent hydrocarbon chain that connects the rest of the molecule to a group, consisting of only carbon and hydrogen and containing one or more carbon-carbon double bonds. In one embodiment, the alkenylene group has, for example, 2 to 24 carbon atoms (C 2 -C 24 Alkenylene), 2 to 15 carbon atoms (C 2 -C 15 Alkenylene), 2 to 12 carbon atoms (C 2 -C 12 Alkenylene), 2 to 8 carbon atoms (C 2 -C 8 Alkenylene), 2 to 6 carbon atoms (C 2 -C 6 Alkenylene) or 2 to 4 carbon atoms (C 2 -C 4 Alkenylene). Examples of alkenylene groups include, but are not limited to, ethenylene, propenylene, n-butenylene, and the like. Alkenylene group Is linked to the remainder of the molecule by a single or double bond and is linked to the group by a single or double bond. The point of attachment of the alkenylene group to the remainder of the molecule and to the group may be through one carbon or any two carbons within the chain. Unless otherwise indicated, alkenylene groups are optionally substituted.
As used herein and unless otherwise indicated, the term "cycloalkyl" refers to a non-aromatic saturated monocyclic or polycyclic hydrocarbon group consisting of only carbon and hydrogen atoms. Cycloalkyl groups may include fused or bridged ring systems. In one embodiment, cycloalkyl groups have, for example, 3 to 15 ring carbon atoms (C 3 -C 15 Cycloalkyl), 3 to 10 ring carbon atoms (C 3 -C 10 Cycloalkyl) or 3 to 8 ring carbon atoms (C 3 -C 8 Cycloalkyl). Cycloalkyl groups are linked to the rest of the molecule by single bonds. Examples of monocyclic cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic cycloalkyl groups include, but are not limited to, adamantyl, norbornyl, decalinyl, 7-dimethyl-bicyclo [2.2.1]Heptyl, and the like. Unless otherwise indicated, cycloalkyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "cycloalkylene" is a divalent cycloalkyl group. Unless otherwise indicated, cycloalkylene groups are optionally substituted.
As used herein and unless otherwise indicated, the term "cycloalkenyl" refers to a non-aromatic monocyclic or polycyclic hydrocarbon group consisting of only carbon and hydrogen atoms and including one or more carbon-carbon double bonds. Cycloalkenyl groups may include fused or bridged ring systems. In one embodiment, cycloalkenyl groups have, for example, 3 to 15 ring carbon atoms (C 3 -C 15 Cycloalkenyl), 3 to 10 ring carbon atoms (C 3 -C 10 Cycloalkenyl) or 3 to 8 ring carbon atoms (C 3 -C 8 Cycloalkenyl group). The cycloalkenyl group is linked to the rest of the molecule by a single bond. Examples of monocyclic cycloalkenyl groups include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, and the like. Unless otherwise indicated, cycloalkenyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "cycloalkenyl" is a divalent cycloalkenyl group. Unless otherwise indicated, cycloalkenyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "heterocyclyl" refers to a monocyclic or polycyclic moiety of a non-aromatic radical containing one or more (e.g., one or two, one to three, or one to four) heteroatoms independently selected from nitrogen, oxygen, phosphorus, and sulfur. The heterocyclyl may be attached to the main structure at any heteroatom or carbon atom. The heterocyclyl may be a monocyclic, bicyclic, tricyclic, tetracyclic or other polycyclic ring system, wherein the polycyclic ring system may be a fused, bridged or spiro ring system. The heterocyclyl-based multicyclic system may contain one or more heteroatoms in one or more rings. The heterocyclyl groups may be saturated or partially unsaturated. Saturated heterocycloalkyl groups may be referred to as "heterocycloalkyl groups". Partially unsaturated heterocycloalkyl groups may be referred to as "heterocycloalkenyl" when the heterocyclyl contains at least one double bond, or as "heterocycloalkynyl" when the heterocyclyl contains at least one triple bond. In one embodiment, the heterocyclic group has, for example, 3 to 18 ring atoms (3-to 18-membered heterocyclic group), 4 to 18 ring atoms (4-to 18-membered heterocyclic group), 5 to 18 ring atoms (3-to 18-membered heterocyclic group), 4 to 8 ring atoms (4-to 8-membered heterocyclic group), or 5 to 8 ring atoms (5-to 8-membered heterocyclic group). When appearing herein, a numerical range, such as "3 to 18" refers to each integer in the given range; for example, "3 to 18 ring atoms" means that the heterocyclic group may consist of 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, and the like (up to and including 18 ring atoms). Examples of heterocyclyl groups include, but are not limited to, imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thienyl, pyridyl, piperidyl, quinolinyl, and isoquinolinyl. Unless otherwise indicated, the heterocyclyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "heterocyclyl" is a divalent heterocyclyl. Unless otherwise indicated, the heterocyclylene groups are optionally substituted.
As used herein and unless otherwise indicated, the term "aryl" refers to a monocyclic aromatic group and/or a polycyclic monovalent aromatic group containing at least one aromatic hydrocarbon ring. In certain embodiments, aryl groups have 6 to 18 ring carbon atoms (C 6 -C 18 Aryl), 6 to 14 ring carbon atoms (C 6 -C 14 Aryl) or 6 to 10 ring carbon atoms (C 6 -C 10 Aryl). Examples of aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthracenyl, phenanthrenyl, pyrenyl, biphenyl, and biphenyl. The term "aryl" also refers to bicyclic, tricyclic, or other polycyclic hydrocarbon rings in which at least one ring is aromatic, and the other rings may be saturated, partially unsaturated, or aromatic, such as dihydronaphthyl, indenyl, indanyl, or tetrahydronaphthyl (tetrahydroaphthayl/tetralinyl). Unless otherwise indicated, aryl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "arylene" is a divalent aryl group. Unless otherwise indicated, arylene groups are optionally substituted.
As used herein and unless otherwise indicated, the term "heteroaryl" refers to a monocyclic aromatic group and/or polycyclic aromatic group containing at least one aromatic ring, wherein at least one aromatic ring contains one or more (e.g., one or two, one to three, or one to four) heteroatoms independently selected from O, S and N. Heteroaryl groups may be attached to the main structure at any heteroatom or carbon atom. In certain embodiments, heteroaryl groups have 5 to 20, 5 to 15, or 5 to 10 ring atoms. The term "heteroaryl" also refers to bicyclic, tricyclic, or other polycyclic rings in which at least one ring is aromatic, and the other rings may be saturated, partially unsaturated, or aromatic, in which at least one aromatic ring contains one or more heteroatoms independently selected from O, S and N. Examples of monocyclic heteroaryl groups include, but are not limited to, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furanyl, thienyl, oxadiazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl. Examples of bicyclic heteroaryl groups include, but are not limited to, indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, isobenzofuranyl, chromonyl, coumarin, cinnolinyl, quinoxalinyl, indazolyl, purinyl, pyrrolopyridinyl, furopyridinyl, thienopyridinyl, dihydroisoindolyl, and tetrahydroquinolinyl. Examples of tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzindolyl, phenanthrolinyl, acridinyl, phenanthridinyl, and xanthenyl. Unless otherwise indicated, heteroaryl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "heteroarylene" is a divalent heteroaryl group. Unless otherwise indicated, heteroarylene is optionally substituted.
When a group described herein is referred to as "substituted," it may be substituted with one or more of any suitable substituents. Illustrative examples of substituents include, but are not limited to, those found in the exemplary compounds and embodiments provided herein, and: halogen atoms such as F, cl, br or I; cyano group; oxo (=o); hydroxyl (-OH); an alkyl group; alkenyl groups; alkynyl; cycloalkyl; an aryl group; - (c=o) OR'; -O (c=o) R'; -C (=o) R'; -OR'; s (O) x R’；-S-SR’；-C(＝O)SR’；-SC(＝O)R’；-NR’R’；-NR’C(＝O)R’；-C(＝O)NR’R’；-NR’C(＝O)NR’R’；-OC(＝O)NR’R’；-NR’C(＝O)OR’；-NR’S(O) x NR’R’；-NR’S(O) x R'; -S (O) x NR 'R', wherein: r' is independently at each occurrence H, C 1 -C 15 Alkyl or cycloalkyl, and x is 0, 1 or 2. In some embodiments, the substituent is C 1 -C 12 An alkyl group. In other embodiments, the substituent is cycloalkyl. In other embodiments, the substituent is a halo group, such as a fluoro group. In other embodiments, the substituent is oxo. In other embodiments, the substituent is hydroxy. In other embodiments, the substituent is an alkoxy group(-OR'). In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amino group (-NR 'R').
As used herein and unless otherwise indicated, the term "optionally present" or "optionally" (e.g., optionally substituted) means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. For example, "optionally substituted alkyl" means that the alkyl group may or may not be substituted, and the description includes both substituted alkyl groups and unsubstituted alkyl groups.
As used herein and unless otherwise indicated, the term "prodrug" of a bioactive compound refers to a compound that can be converted to the bioactive compound under physiological conditions or by solvolysis. In one embodiment, the term "prodrug" refers to a pharmaceutically acceptable metabolic precursor of a biologically active compound. Prodrugs may be inactive when administered to a subject in need thereof, but are converted to the biologically active compound in vivo. Prodrugs are often rapidly transformed in vivo to produce the parent bioactive compound, for example, by hydrolysis in the blood. Prodrug compounds generally provide solubility, histocompatibility or delayed release advantages in mammalian organisms (see Bundgard, h., design of Prodrugs (1985), pages 7-9, pages 21-24 (Elsevier, amsterdam)). Discussion of prodrugs is provided in Higuchi, t et al, a.c. s. Symposium Series, volume 14; and Bioreversible Carriers in Drug Design, edward b.roche edit, american Pharmaceutical Association and Pergamon Press, 1987.
In one embodiment, the term "prodrug" is also intended to include any covalently bonded carrier that releases the active compound in vivo when such prodrug is administered to a mammalian subject. Prodrugs of the compounds may be prepared by modifying functional groups present in the compound in such a way that the modification may be cleaved, either in routine manipulation or in vivo, to yield the parent compound. Prodrugs include compounds wherein a hydroxyl, amino, or sulfhydryl group is bonded to any group that, when the prodrug of the compound is administered to a mammalian subject, cleaves to form a free hydroxyl, free amino, or free sulfhydryl group, respectively.
Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol functional groups or amide derivatives of amine functional groups in the compounds provided herein.
As used herein and unless otherwise indicated, the term "pharmaceutically acceptable salt" includes both acid addition salts and base addition salts.
Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; and organic acids such as, but not limited to, acetic acid, 2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, 10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclic acid, dodecylsulfuric acid, ethane-1, 2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactose diacid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxoglutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1, 5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, lactic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, glutamic acid, salicylic acid, 4-sulfamic acid, succinic acid, tartaric acid, succinic acid, thioundecylenic acid, and the like.
Examples of pharmaceutically acceptable base addition salts include, but are not limited to, salts prepared by adding an inorganic or organic base to the free acid compound. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum, and the like. In one embodiment, the inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, the following: primary, secondary and tertiary amines; substituted amines, including naturally occurring substituted amines; cyclic amines and basic ion exchange resins such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, dantol (deanol), 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine (procaine), hydramine, choline, betaine, phenethylamine (bennethamine), benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine (theobromine), triethanolamine, tromethamine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like. In one embodiment, the organic base is isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.
The compounds provided herein may contain one or more asymmetric centers and thus may produce enantiomers, diastereomers, and other stereoisomeric forms, which may be defined as (R) -or (S) -or (D) -or (L) -for amino acids, depending on the absolute stereochemistry. Unless otherwise indicated, the compounds provided herein are intended to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R) -and (S) -or (D) -and (L) -isomers can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, such as chromatography and fractional crystallization. Conventional techniques for preparing/separating individual enantiomers include chiral synthesis from suitable optically pure precursors or resolution of the racemate (or of a salt or derivative) using, for example, chiral High Pressure Liquid Chromatography (HPLC). When a compound described herein contains an olefinic double bond or other geometric asymmetric center, the compound is intended to include both the E and Z geometric isomers unless specified otherwise. Also, all tautomeric forms are intended to be included.
As used herein and unless otherwise indicated, the term "isomer" refers to different compounds having the same formula. "stereoisomers" are isomers that differ only in the arrangement of atoms in space. "atropisomers" are stereoisomers resulting from a hindered rotation about a single bond. "enantiomers" are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of any ratio of a pair of enantiomers may be referred to as a "racemic" mixture. "diastereomers" are stereoisomers which have at least two asymmetric atoms and which are not mirror images of each other.
"stereoisomers" may also include E and Z isomers or mixtures thereof, as well as cis and trans isomers or mixtures thereof. In certain embodiments, the compounds described herein are isolated as the E or Z isomer. In other embodiments, the compounds described herein are mixtures of E and Z isomers.
"tautomer" refers to the isomeric forms of a compound that are balanced with each other. The concentration of the isomeric forms will depend on the environment in which the compound is located and may vary depending on, for example, whether the compound is solid or in an organic or aqueous solution.
It should also be noted that the compounds described herein may contain non-natural proportions of atomic isotopes at one or more atoms. For example, the compounds may be administered using a radioisotope, such as tritium @, for example 3 H) Iodine-125% 125 I) Sulfur-35% 35 S) or C-14% 14 C) Radiolabelling or may be isotopically enriched, such as deuterium # 2 H) Carbon-13% 13 C) Or nitrogen-15% 15 N). As used herein, "isotopologue" is an isotopically enriched compound. The term "isotopically enriched" refers to an atom whose isotopic composition differs from the natural isotopic composition of the atom. "isotopically enriched" may also mean that the isotopic composition of at least one atom contained in a compound is different from the natural isotopic composition of that atom. The term "isotopic composition" refers to the amount of each isotope present for a given atom. Radiolabeled and isotopically enriched compounds are useful as therapeutic agents, for example, cancer therapeutic agents; research reagents, such as binding assay reagents; and diagnostic agents, such as in vivo imaging agents. All isotopic variations of the compounds described herein, whether radioactive or not, are intended to be encompassed within the scope of the embodiments provided herein. In some embodiments, provided herein Isotopologues of the compounds, e.g., isotopologues, are enriched with deuterium, carbon-13 and/or nitrogen-15. As used herein, "deuterated" means that at least one hydrogen (H) in the compound has deuterium (in D or 2 H represents) substitution, i.e., the compound is deuterium-enriched in at least one position.
It should be noted that if there is a difference between the depicted structure and the name of the structure, the depicted structure should be subject to.
As used herein and unless otherwise indicated, the term "pharmaceutically acceptable carrier, diluent or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye/colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonicity agent, solvent or emulsifying agent approved by the U.S. food and drug administration (United States Food and Drug Administration) for use in humans or domestic animals.
The term "composition" is intended to encompass products containing the specified ingredients (e.g., mRNA molecules provided herein) in the specified amounts, optionally selected.
As used interchangeably herein, the term "polynucleotide" or "nucleic acid" refers to a polymer of nucleotides of any length, and includes, for example, DNA and RNA. The nucleotide may be a deoxyribonucleotide, a ribonucleotide, a modified nucleotide or base and/or analogue thereof, or any substrate that can be incorporated into the polymer by a DNA or RNA polymerase or by a synthetic reaction. Polynucleotides may comprise modified nucleotides, such as methylated nucleotides and analogs thereof. The nucleic acid may be in single strand or double strand form. As used herein and unless otherwise indicated, "nucleic acid" also includes nucleic acid mimics, such as Locked Nucleic Acids (LNAs), peptide Nucleic Acids (PNAs), and morpholino nucleic acids. As used herein, "oligonucleotide" refers to a short synthetic polynucleotide, typically but not necessarily less than about 200 nucleotides in length. The terms "oligonucleotide" and "polynucleotide" are not mutually exclusive. The above description of polynucleotides applies equally well to oligonucleotides. Unless otherwise indicated, the left hand end of any single stranded polynucleotide sequence disclosed herein is the 5' end; the left hand orientation of the duplex polynucleotide sequence is referred to as the 5' orientation. The 5 'to 3' addition direction of nascent RNA transcripts is referred to as the transcription direction; the region of the sequence on the DNA strand that has the same sequence as the RNA transcript and is located 5 'relative to the 5' end of the RNA transcript is referred to as the "upstream sequence"; the region of sequence on the DNA strand that has the same sequence as the RNA transcript and is located 3 'relative to the 3' end of the RNA transcript is referred to as the "downstream sequence".
As used herein, the term "non-naturally occurring" when used in reference to a nucleic acid molecule as described herein is intended to mean that the nucleic acid molecule is not present in nature. Non-naturally occurring nucleic acids encoding viral peptides or proteins contain at least one genetic alteration or chemical modification that is not normally present in a naturally occurring strain of a virus, including a wild-type strain of a virus. Genetic alterations include, for example, modifications that introduce expressible nucleic acid sequences encoding heterologous peptides or polypeptides of the virus, other nucleic acid additions, nucleic acid deletions, nucleic acid substitutions, and/or other functional disruption of the genetic material of the virus. Such modifications include, for example, modifications to coding regions of heterologous, homologous, or heterologous and homologous polypeptides of a viral species and functional fragments thereof. Additional modifications include, for example, modifications to non-coding regulatory regions, wherein the modifications alter expression of a gene or an operon. Additional modifications also include, for example, incorporation of the nucleic acid sequence into a vector such as a plasmid or artificial chromosome. Chemical modifications include, for example, one or more functional nucleotide analogs as described herein.
"isolated nucleic acid" refers to nucleic acids, such as RNA, DNA, or mixed nucleic acids, that are substantially isolated from other genomic DNA sequences that naturally accompany the native sequence, as well as from proteins or complexes such as ribosomes and polymerases. An "isolated" nucleic acid molecule is a nucleic acid molecule that is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid molecule. Furthermore, an "isolated" nucleic acid molecule, such as an mRNA molecule, may be substantially free of other cellular material or culture medium when manufactured by recombinant techniques, or it may be substantially free of chemical precursors or other chemicals when chemically synthesized. In particular embodiments, one or more nucleic acid molecules encoding an antigen described herein are isolated or purified. The term includes nucleic acid sequences that have been removed from their naturally occurring environment, and includes recombinant or cloned DNA or RNA isolates as well as chemically synthesized analogs or analogs biosynthesized by heterologous systems. Substantially pure molecules may include isolated forms of the molecule.
The term "encoding nucleic acid" or grammatical equivalents thereof when used in reference to a nucleic acid molecule includes: (a) Nucleic acid molecules which, when in a native state or when manipulated by methods well known to those skilled in the art, can be transcribed to produce mRNA and then translated into peptides and/or polypeptides; and (b) the mRNA molecule itself. The antisense strand is the complement of such a nucleic acid molecule and from which the coding sequence can be deduced. The term "coding region" refers to the portion of a coding nucleic acid sequence that is translated into a peptide or polypeptide. The term "untranslated region" or "UTR" refers to a portion of a coding nucleic acid that is not translated into a peptide or polypeptide. Depending on the orientation of the UTR relative to the coding region of the nucleic acid molecule, the UTR is referred to as a 5'-UTR if it is located at the 5' end of the coding region and the UTR is referred to as a 3'-UTR if it is located at the 3' end of the coding region.
As used herein, the term "mRNA" refers to a messenger RNA molecule comprising one or more Open Reading Frames (ORFs) that can be translated by a cell or organism having the mRNA to produce one or more peptide or protein products. The region containing one or more ORFs is referred to as the coding region of the mRNA molecule. In certain embodiments, the mRNA molecule further comprises one or more untranslated regions (UTRs).
In certain embodiments, the mRNA is a monocistronic mRNA comprising only one ORF. In certain embodiments, the monocistronic mRNA encodes a peptide or protein comprising at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor-associated antigen). In other embodiments, the mRNA is a polycistronic mRNA comprising two or more ORFs. In certain embodiments, polycistronic mRNA encodes two or more peptides or proteins that may be the same or different from each other. In certain embodiments, each peptide or protein encoded by the polycistronic mRNA comprises at least one epitope of the selected antigen. In certain embodiments, the different peptides or proteins encoded by the polycistronic mRNA each comprise at least one epitope of a different antigen. In any of the embodiments described herein, the at least one epitope may be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 epitopes of the antigen.
The term "nucleobase" encompasses purines and pyrimidines, including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural or synthetic analogs or derivatives thereof.
As used herein, the term "functional nucleotide analog" refers to a modified version of a classical nucleotide A, G, C, U or T that (a) retains the base pairing properties of the corresponding classical nucleotide and (b) contains at least one chemical modification to (i) a nucleobase, (ii) a glycosyl, (iii) a phosphate group, or (iv) any combination of (i) to (iii) of the corresponding natural nucleotide. As used herein, base pairing encompasses not only classical Watson-Crick (Watson-Crick) adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between a classical nucleotide and a functional nucleotide analogue or between a pair of functional nucleotide analogues, wherein the arrangement of the hydrogen bond donor and the hydrogen bond acceptor allows hydrogen bonding to be formed between a modified nucleobase and a classical nucleobase or between two complementary modified nucleobase structures. For example, functional analogs of guanosine (G) retain the ability to base pair with cytosine (C) or functional analogs of cytosine. An example of such non-classical base pairing is base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. As described herein, functional nucleotide analogs can be naturally occurring or non-naturally occurring. Thus, a nucleic acid molecule containing a functional nucleotide analog may have at least one modified nucleobase, sugar group, and/or internucleoside linkage. Exemplary chemical modifications to nucleobases, glycosyls, or internucleoside linkages of nucleic acid molecules are provided herein.
As used herein, the terms "translational enhancer element," "TEE," and "translational enhancer" refer to regions in a nucleic acid molecule that are used to facilitate translation of a coding sequence of a nucleic acid into a protein or peptide product, such as by cap-dependent or non-cap-dependent translation. TEE is typically located in the UTR region of a nucleic acid molecule (e.g., mRNA) and enhances the level of translation of coding sequences located upstream or downstream. For example, a TEE in the 5' -UTR of a nucleic acid molecule may be located between the promoter and the start codon of the nucleic acid molecule. Various TEE sequences are known in the art (Wellensiek et al, genome-wide profiling of human cap-independent translation-enhancing elements, nature Methods, month 8 of 2013; 10 (8): 747-750; chappell et al, PNAS, month 29 of 2004, 101 (26) 9590-9594). Some TEEs are known to be conserved across species (P anek et al, nucleic Acids Research, volume 41, 16, 2013, 9, 1, pages 7625-7634).
As used herein, the term "stem-loop sequence" refers to a single stranded polynucleotide sequence having at least two regions that are complementary or substantially complementary to each other when read in opposite directions, and thus are capable of base pairing with each other to form at least one duplex and unpaired loop. The resulting structure is known as a stem-loop structure, hairpin, or hairpin loop, which is a secondary structure found in many RNA molecules.
As used herein, the term "peptide" refers to a polymer containing from two to fifty (2-50) amino acid residues linked via one or more covalent peptide bonds. The term applies to naturally occurring amino acid polymers and amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs or non-natural amino acids).
The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer having more than fifty (50) amino acid residues joined by covalent peptide bonds. That is, the description for polypeptides applies equally to the description for proteins and vice versa. The term applies to naturally occurring amino acid polymers and amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs). As used herein, the term encompasses amino acid chains of any length, including full-length proteins (e.g., antigens).
In the case of a peptide or polypeptide, the term "derivative" as used herein refers to a peptide or polypeptide comprising the amino acid sequence of a viral peptide or protein or a fragment of a viral peptide or protein that has been altered by the introduction of amino acid residue substitutions, deletions or additions. As used herein, the term "derivative" also refers to a viral peptide or protein, or a fragment of a viral peptide or protein, which has been chemically modified, for example, by covalently linking any type of molecule to a polypeptide. For example, but not by way of limitation, a viral peptide or protein or fragment of a viral peptide or protein may be chemically modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, chemical cleavage, formulation, metabolic synthesis of tunicamycin, attachment to a cellular ligand or other protein, and the like. Derivatives are modified in a manner that differs from the naturally occurring or starting peptide or polypeptide in the type or position of the attached molecule. Derivatives also include the absence of one or more chemical groups naturally present on the viral peptide or protein. In addition, the viral peptide or protein or a derivative of a fragment of the viral peptide or protein may contain one or more non-classical amino acids. In particular embodiments, a derivative is a functional derivative of a native or unmodified peptide or polypeptide from which the derivative is derived.
The term "functional derivative" refers to a derivative that retains one or more functions or activities of a naturally occurring or starting peptide or polypeptide from which the derivative is derived. For example, functional derivatives of coronavirus S protein may retain the ability to bind to one or more of its receptors on a host cell. For example, functional derivatives of the coronavirus N protein may retain the ability to bind RNA or package the viral genome.
The term "identity" refers to the relationship between sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by aligning and comparing the sequences. "percent (%) amino acid sequence identity" with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical to amino acid residues in the reference polypeptide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and does not consider any conservative substitutions as part of the sequence identity. Alignment for the purpose of determining the percent amino acid sequence identity may be accomplished in a variety of ways within the skill of the art, for example using publicly available computer software such as BLAST, BLAST-2, ALIGN, or megasign (DNAStar, inc.) software. One skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms needed to achieve maximum alignment over the full length of the compared sequences.
"modification" of an amino acid residue/position refers to a change in the primary amino acid sequence as compared to the starting amino acid sequence, wherein the change is caused by a sequence change involving the amino acid residue/position. For example, typical modifications include substitution of a residue with another amino acid (e.g., conservative or non-conservative substitutions), insertion of one or more (e.g., typically less than 5, 4, or 3) amino acids immediately adjacent to the residue/position, and/or deletion of the residue/position.
In the case of peptides or polypeptides, the term "fragment" as used herein refers to a peptide or polypeptide comprising less than the full length amino acid sequence. Such fragments may, for example, result from amino-terminal truncations, carboxy-terminal truncations and/or internal deletions of residues in the amino acid sequence. Fragments may be produced, for example, by alternative RNA splicing or by protease activity in vivo. In certain embodiments, a fragment refers to a polypeptide comprising at least 5 consecutive amino acid residues, at least 10 consecutive amino acid residues, at least 15 consecutive amino acid residues, at least 20 consecutive amino acid residues, at least 25 consecutive amino acid residues, at least 30 consecutive amino acid residues, at least 40 consecutive amino acid residues, at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 80 consecutive amino acid residues, at least 90 consecutive amino acid residues, at least 100 consecutive amino acid residues, at least 125 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 175 consecutive amino acid residues, at least 200 consecutive amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900 or at least 950 consecutive amino acid residues of the amino acid sequence of the polypeptide. In particular embodiments, fragments of a polypeptide retain at least 1, at least 2, at least 3, or more functions of the polypeptide.
As used herein in the context of a peptide or polypeptide (e.g., a protein), the term "immunogenic fragment" refers to a fragment of a peptide or polypeptide that retains the ability of the peptide or polypeptide to elicit an immune response (including an innate immune response and/or an adaptive immune response) upon contact with the immune system of a mammal. In some embodiments, the immunogenic fragment of a peptide or polypeptide may be an epitope.
The term "antigen" refers to a substance that is capable of being recognized by the immune system of a subject (including the adaptive immune system) and is capable of triggering an immune response (including an antigen-specific immune response) upon contacting the subject with the antigen. In certain embodiments, the antigen is a protein (e.g., a tumor-associated antigen (TAA)) associated with a diseased cell, such as a pathogen-infected cell, or a neoplastic cell.
An "epitope" is a site on the surface of an antigen molecule that binds to a single antibody molecule, such as a localized region on the surface of an antigen that is capable of binding to one or more antigen binding regions of an antibody and has antigenic or immunogenic activity in an animal, such as a mammal (e.g., a human being), capable of eliciting an immune response. An epitope with immunogenic activity is a portion of a polypeptide that elicits an antibody response in an animal. Epitopes having antigenic activity are part of the polypeptide to which the antibody binds, as determined by any method well known in the art, including, for example, by immunoassay. An epitope is not necessarily immunogenic. Epitopes are generally composed of chemically active surface groups of molecules such as amino acids or sugar side chains, and have specific three-dimensional structural features as well as specific charge characteristics. The antibody epitope may be a linear epitope or a conformational epitope. Linear epitopes are formed by contiguous amino acid sequences in proteins. Conformational epitopes are formed by amino acids that are discontinuous in the protein sequence, but which group together when the protein folds into its three-dimensional structure. An induced epitope is formed when the three-dimensional structure of a protein is in an altered conformation, such as upon activation or binding of another protein or ligand. In certain embodiments, the epitope is a three-dimensional surface feature of the polypeptide. In other embodiments, the epitope is a linear characteristic of the polypeptide. Typically, an antigen has several or many different epitopes and can react with many different antibodies.
The terms "Severe acute respiratory syndrome coronavirus 2" or "SARS-CoV-2" or "2019-nCoV" are used interchangeably herein to refer to a pandemic coronavirus that caused the infectious disease identified in 2019 in the first case. GenBank TM Accession number MN908947 provides an exemplary genomic sequence of SARS-CoV-2 (SEQ ID NO: 1).
As used herein, the term "SARS-CoV-2 variant" refers to a mutant form of the coronavirus SARS-CoV-2, wherein the genome of the variant contains at least one mutation compared to the genome of SARS-CoV-2. Exemplary SARS-CoV-2 variants have emerged in humans and replaced ancestral strains. One of the variants first identified contained a D614G mutation in the gene encoding spike (S) protein that enhanced viral infectivity and converted the S protein conformation to angiotensin converting enzyme 2 (ACE 2) binding fusion competent state without significantly altering the sensitivity to antibody neutralization. Additional SARS-CoV-2 variants have emerged in several countries with a combination of mutations and deletions in the Receptor Binding Domain (RBD) and N-terminal domain of the S protein, as well as in other proteins. The b.1.1.7 variant appears in the uk, the b.1.351variant (also known as 501y.v2) appears in south africa, and the p.1 and p.2 variants appear in brazil. RBD mutation N501Y is present in B.1.1.7and B.1.351 (ZahradnIk, J. Et al, SARS-CoV-2RBD in vitro evolution follows contagious mutation spread,yet generates an able infection inhibitor.Preprint at BioRxiv doi.org/10.1101/2021.01.06.425392 (2021)). RBD mutations E484K and K417N/T are present in strains B.1.351 and P.1 (Planas, D., bruel, T., grzelak, L., et al, sensitivity of infectious SARS-CoV-2 B.1.1.7and B.1.351variants to neutralizing antibodies.Nat Med 27,917-924 (2021), doi.org/10.1038/s 41591-021-01318-5).
The term "SARS-CoV-2 south Africa variant" or "SARS-CoV-2 B.1.351" is used interchangeably herein to refer to a variant of SARS-CoV-2 that was first detected in south Africa during the period of the COVID-19 pandemic in 2020. GenBank TM Accession number MZ314998.1 provides an exemplary genomic sequence of SARS-CoV-2 B.1.351 (SEQ ID NO: 69).
The term "heterologous" refers to an entity that is not found in nature in association with (e.g., encoded and/or expressed by the genome of) a naturally occurring coronavirus. The term "homologous" refers to an entity found in nature that is associated with (e.g., encoded and/or expressed by the genome of) a naturally occurring coronavirus.
As used herein, the term "genetic vaccine" refers to a therapeutic or prophylactic composition comprising at least one nucleic acid molecule encoding an antigen associated with a target disease (e.g., an infectious disease or neoplastic disease). Administration of a vaccine to a subject ("vaccination") allows for the production of the encoded peptide or protein, thereby eliciting an immune response against the target disease in the subject. In certain embodiments, the immune response includes an adaptive immune response, such as the production of antibodies to the encoded antigen, and/or the activation and proliferation of immune cells capable of specifically eliminating diseased cells expressing the antigen. In certain embodiments, the immune response further comprises an innate immune response. According to the present disclosure, the vaccine may be administered to the subject either before or after the onset of clinical symptoms of the target disease. In some embodiments, vaccinating healthy or asymptomatic subjects renders the vaccinated subjects immune or less susceptible to the development of a target disease. In some embodiments, vaccinating a subject exhibiting symptoms of a disease improves the disease condition or treats the disease in the vaccinated subject.
The term "vector" refers to a substance used to carry or contain a nucleic acid sequence, including, for example, a nucleic acid sequence encoding a viral peptide or protein described herein, in order to introduce the nucleic acid sequence into a host cell, or to serve as a transcription template to perform an in vitro transcription reaction in a cell-free system to produce mRNA. Vectors suitable for use include, for example, expression vectors, plasmids, phage vectors, viral vectors, episomes, and artificial chromosomes, which may include selection sequences or markers operable for stable integration into the chromosomes of a host cell. In addition, the vector may include one or more selectable marker genes and appropriate transcriptional or translational control sequences. For example, selectable marker genes may be included to provide resistance to antibiotics or toxins, to supplement auxotrophs for deficiency, or to provide key nutrients that are not in the medium. Transcriptional or translational control sequences may include constitutive and inducible promoters, transcriptional enhancers, transcriptional terminators, and the like, as are well known in the art. When two or more nucleic acid molecules (e.g., nucleic acid molecules encoding two or more different viral peptides or proteins) are co-transcribed or co-translated, the two nucleic acid molecules may be inserted, for example, into the same expression vector or into separate expression vectors. For single vector transcription and/or translation, the coding nucleic acids may be operably linked to one common transcriptional or translational control sequence, or to different transcriptional or translational control sequences, such as an inducible promoter and a constitutive promoter. The introduction of a nucleic acid molecule into a host cell can be confirmed using methods well known in the art. Such methods include, for example, nucleic acid analysis, such as Northern blot or Polymerase Chain Reaction (PCR) amplification of mRNA; immunoblots for expression of gene products; or other suitable analytical methods for testing the expression of the introduced nucleic acid sequence or its corresponding gene product. Those of skill in the art will understand that a nucleic acid molecule is expressed in sufficient amounts to produce a desired product (e.g., an mRNA transcript of a nucleic acid as described herein), and will further understand that the expression level can be optimized to obtain sufficient expression using methods well known in the art.
The terms "innate immune response" and "innate immunity" are well known in the art and refer to the non-specific defense mechanisms that the body's immune system initiates upon recognition of pathogen-associated molecular patterns, which involve different forms of cellular activity, including cytokine production and cell death through various pathways. As used herein, an innate immune response includes, but is not limited to, increased production of inflammatory cytokines (e.g., type I interferon or IL-10 production); activation of the nfkb pathway; proliferation, maturation, differentiation and/or survival of immune cells are increased, and in some cases induction of apoptosis. Activation of innate immunity can be detected using methods known in the art, such as measuring (NF) - κb activation.
The terms "adaptive immune response" and "adaptive immunity" are art-recognized and refer to antigen-specific defense mechanisms initiated by the body's immune system upon recognition of a particular antigen, including humoral and cell-mediated responses. As used herein, an adaptive immune response includes a cellular response triggered and/or enhanced by a vaccine composition, such as the genetic compositions described herein. In some embodiments, the vaccine composition comprises an antigen that is a target of an antigen-specific adaptive immune response. In other embodiments, the vaccine composition allows for the production of an antigen in the immunized subject after administration, which is a target of an antigen-specific adaptive immune response. Activation of the adaptive immune response may be detected using methods known in the art, such as measuring the production of antigen-specific antibodies or the level of antigen-specific cell-mediated cytotoxicity.
"antibody-dependent cell-mediated cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted immunoglobulins that bind to Fc receptors (fcrs) present on certain cytotoxic cells (e.g., natural Killer (NK) cells, neutrophils, and macrophages) enable these cytotoxic effector cells to specifically bind to antigen-bearing target cells and subsequently kill the target cells with cytotoxins. Antibodies "arm" cytotoxic cells and are absolutely required for such killing. NK cells (the primary cells used to mediate ADCC) express fcyriii only, whereas monocytes express fcyri, fcyrii and fcyriii. FcR expression on hematopoietic cells is known (see, e.g., ravetch and Kinet,1991, annu. Rev. Immunol. 9:457-92). To assess ADCC activity of a target molecule, an in vitro ADCC assay may be performed (see, e.g., U.S. Pat. nos. 5,500,362 and 5,821,337). Useful effector cells for such assays include Peripheral Blood Mononuclear Cells (PBMC) and Natural Killer (NK) cells. Alternatively or additionally, ADCC activity of the target molecule may be assessed in vivo, e.g., in animal models (see, e.g., clynes et al, 1998,Proc.Natl.Acad.Sci.USA 95:652-56). Antibodies with little or no ADCC activity may be selected for use.
"antibody-dependent cellular phagocytosis" or "ADCP" refers to the destruction of target cells via monocyte or macrophage-mediated phagocytosis when immunoglobulins bind to Fc receptors (fcrs) present on certain phagocytes (e.g., neutrophils, monocytes, and macrophages) so that these phagocytes can specifically bind to and subsequently kill antigen-bearing target cells. To assess ADCP activity of a target molecule, an in vitro ADCP assay may be performed (see, e.g., bracher et al, 2007,J.Immunol.Methods 323:160-71). Useful phagocytes for such assays include Peripheral Blood Mononuclear Cells (PBMCs), purified monocytes from PBMCs, or U937 cells differentiated into a mononuclear type. Alternatively or additionally, ADCP activity of the target molecule may be assessed in vivo, for example in an animal model (see, e.g., wallace et al, 2001,J.Immunol.Methods 248:167-82). Antibodies with little or no ADCP activity may be selected for use.
"Fc receptor" or "FcR" describes a receptor that binds to the Fc region of an antibody. An exemplary FcR is a native sequence human FcR. Furthermore, exemplary fcrs are receptors that bind IgG antibodies (e.g., gamma receptors), and include receptors of fcγri, fcγrii, and fcγriii subclasses, including allelic variants and alternatively spliced forms of these receptors. Fcγrii receptors include fcγriia ("activating receptor") and fcγriib ("inhibiting receptor") which have similar amino acid sequences differing primarily in their cytoplasmic domains (see, e.g. 1997, annu. Rev. Immunol. 15:203-34). Various FcRs are known (see, e.g., ravetch and Kinet,1991, annu. Rev. Immunol.9:457-92; capel et al,1994,Immunomethods 4:25-34; and de Haas et al, 1995, J.Lab. Clin. Med. 126:330-41). The term "FcR" herein encompasses other fcrs, including those to be identified in the future. The term also includes the neonatal receptor FcRn, which is responsible for transferring maternal IgG to the fetus (see, e.g., guyer et al 1976, J.Immunol.117:587-93; and Kim et al 1994, eu.J.Immunol.24:2429-34). Antibody variants with improved or reduced binding to FcR have been described (see, e.g., WO 2000/42072; U.S. Pat. No. 7,183,387;7,332,581; and 7,335,742; shields et al, 2001, J.biol. Chem.9 (2): 6591-604).
"complement dependent cytotoxicity" or "CDC" refers to the lysis of target cells in the presence of complement. Activation of the classical complement pathway is initiated by binding of the first component of the complement system (C1 q) to antibodies (of the appropriate subclass) that bind to their cognate antigens. To assess complement activation, CDC analysis may be performed (see, e.g., gazzano-Santoro et al, 1996,J.Immunol.Methods 202:163). Polypeptide variants having altered amino acid sequences of the Fc region (polypeptides having variant Fc regions) and increased or decreased C1q binding capacity have been described (see, e.g., U.S. Pat. No. 6,194,551;WO 1999/51642; idusogie et al, 2000, J. Immunol. 164:4178-84). Antibodies with little or no CDC activity may be selected for use.
The term "antibody" is intended to include polypeptide products of B cells within polypeptides of the immunoglobulin class that are capable of binding to a particular molecular antigen and are composed of two pairs of identical polypeptide chains, wherein each pair has one heavy chain (about 50-70 kDa) and one light chain (about 25 kDa), each amino-terminal portion of each chain comprises a variable region of about 100 to about 130 amino acids or more, and each carboxy-terminal portion of each chain comprises a constant region. See, e.g., antibody Engineering (Borrebaeck edit, 2 nd edition, 1995); and Kuby, immunology (3 rd edition, 1997). In particular embodiments, a particular molecular antigen may be bound by an antibody provided herein, including a polypeptide, fragment or epitope thereof. Antibodies also include, but are not limited to, synthetic antibodies, recombinantly produced antibodies, camelized antibodies, intracellular antibodies, anti-idiotype (anti-Id) antibodies, and any of the aboveA functional fragment of an antibody heavy or light chain polypeptide that retains some or all of the binding activity of the antibody from which the fragment is derived. Non-limiting examples of functional fragments include single chain Fv (scFv) (e.g., including monospecific, bispecific, etc.), fab fragments, F (ab') fragments, F (ab) 2 Fragments, F (ab') 2 Fragments, disulfide-linked Fv (dsFv), fd fragments, fv fragments, diabodies, triabodies, tetrabodies, and minibodies. In particular, antibodies provided herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, such as antigen binding domains or molecules that contain an antigen binding site (e.g., one or more CDRs of an antibody). Such antibody fragments can be found, for example, in Harlow and Lane, antibodies: A Laboratory Manual (1989); mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers editions, 1995); huston et al, 1993,Cell Biophysics 22:189-224; pluckthun and Skerra,1989, meth. Enzymol.178:497-515; and Day, advanced Immunochemistry (2 nd edition, 1990). Antibodies provided herein can have any class (e.g., igG, igE, igM, igD and IgA) or any subclass (e.g., igG1, igG2, igG3, igG4, igA1, and IgA 2) of immunoglobulin molecules.
The term "administer" refers to an operation of injecting or otherwise physically delivering a substance present in vitro (e.g., a lipid nanoparticle composition described herein) into a patient, such as transmucosal, intradermal, intravenous, intramuscular delivery, and/or any other physical delivery method described herein or known in the art. When treating a disease, disorder, condition, or symptom thereof, administration of the substance is typically performed after the onset of the disease, disorder, condition, or symptom thereof. When preventing a disease, disorder, condition, or symptom thereof, administration of the substance is typically performed prior to onset of the disease, disorder, condition, or symptom thereof.
"chronic" administration is in contrast to acute mode, meaning that one or more agents are administered in a continuous mode (e.g., for a period of time, such as days, weeks, months, or years), thereby maintaining an initial therapeutic effect (activity) over a longer period of time. By "intermittent" administration is meant that the treatment is not carried out continuously without interruption, but rather is periodic in nature.
As used herein, the term "targeted delivery" or verb form "targeted" refers to a process that facilitates the delivery of an agent (such as a therapeutic payload molecule in a lipid nanoparticle composition described herein) to a particular organ, tissue, cell, and/or intracellular compartment (referred to as a target site) as compared to delivery to any other organ, tissue, cell, or intracellular compartment (referred to as a non-target site). Targeted delivery can be detected using methods known in the art, for example, by comparing the concentration of the delivered agent in the target cell population to the concentration of the delivered agent at the non-target cell population after systemic administration. In certain embodiments, targeted delivery results in a concentration at the target location that is at least 2 times higher than the concentration at the non-target location.
An "effective amount" is generally sufficient to reduce the severity and/or frequency of symptoms; elimination of symptoms and/or underlying causes; preventing the occurrence of symptoms and/or their underlying causes; and/or ameliorating or remediating the amount of damage caused by or associated with a disease, disorder or condition, including, for example, infection and neoplasia. In some embodiments, the effective amount is a therapeutically effective amount or a prophylactically effective amount.
As used herein, the term "therapeutically effective amount" refers to an amount of an agent (e.g., a vaccine composition) sufficient to reduce and/or ameliorate the severity and/or duration of a given disease, disorder or condition, and/or symptoms associated therewith (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as cancer). The "therapeutically effective amount" of a substance/molecule/agent of the present disclosure (e.g., a lipid nanoparticle composition described herein) can vary depending on a number of factors, such as the disease state, age, sex, and weight of the individual, as well as the ability of the substance/molecule/agent to elicit a desired response in the individual. A therapeutically effective amount comprises an amount of the therapeutically beneficial effect of the substance/molecule/agent that outweighs any toxic or detrimental effect thereof. In certain embodiments, the term "therapeutically effective amount" refers to an amount of a lipid nanoparticle composition as described herein or a therapeutic or prophylactic agent (e.g., therapeutic mRNA) contained therein that is effective to "treat" a disease, disorder, or condition in a subject or mammal.
A "prophylactically effective amount" is an amount of a pharmaceutical composition that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing a disease, disorder, condition, or related symptom (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as cancer), delaying the onset (or recurrence) thereof, or reducing the likelihood of onset (or recurrence) thereof. Typically, but not necessarily, since the prophylactic dose is for the subject prior to or at an early stage of the disease, disorder or condition, the prophylactically effective amount may be less than the therapeutically effective amount. The complete therapeutic or prophylactic effect does not necessarily occur by administration of one dose, but may occur only after administration of a series of doses. Thus, a therapeutically or prophylactically effective amount can be administered in one or more administrations.
The term "preventing" refers to reducing the likelihood of onset (or recurrence) of a disease, disorder, condition, or associated symptom (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as cancer).
The term "managing" refers to the beneficial effect a subject obtains from therapy (e.g., prophylactic or therapeutic agent) that does not cause a cure of the disease. In certain embodiments, one or more therapies (e.g., prophylactic or therapeutic agents, such as lipid nanoparticle compositions described herein) are administered to a subject to "control" an infectious or neoplastic disease, one or more symptoms thereof, thereby preventing progression or worsening of the disease.
The term "prophylactic agent" refers to any agent that can inhibit, in whole or in part, the development, recurrence, onset, or spread of a disease and/or symptoms associated therewith in a subject.
The term "therapeutic agent" refers to any agent that can be used to treat, prevent, or ameliorate a disease, disorder, or condition, including one or more symptoms of a disease, disorder, or condition and/or symptoms related thereto.
The term "therapy" refers to any regimen, method and/or agent that may be used to prevent, control, treat and/or ameliorate a disease, disorder or condition. In certain embodiments, the term "therapies" refers to biological therapies, supportive therapies, and/or other therapies known to those of skill in the art, such as medical personnel, that are useful in preventing, controlling, treating, and/or ameliorating a disease, disorder, or condition.
As used herein, a "prophylactically effective serum titer" is a serum titer of an antibody that completely or partially inhibits the development, recurrence, onset, or spread of a disease, disorder, or condition in a subject (e.g., a human) and/or symptoms associated therewith in the subject.
In certain embodiments, a "therapeutically effective serum titer" is a serum titer of an antibody in a subject (e.g., a human) that reduces the severity, duration, and/or symptoms associated with a disease, disorder, or condition in the subject.
The term "serum titer" refers to the average serum titer in a subject from multiple samples (e.g., at multiple time points) or in a population of at least 10, at least 20, at least 40 up to about 100, 1000, or more subjects.
The term "side effects" encompasses unwanted and/or adverse effects of a therapy (e.g., a prophylactic or therapeutic agent). The unwanted effect is not necessarily an adverse effect. Adverse effects of therapies (e.g., prophylactic or therapeutic agents) can be detrimental, uncomfortable, or risky. Examples of side effects include diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramps, fever, pain, weight loss, dehydration, alopecia, dyspnea, insomnia, dizziness, mucositis, nerve and muscle effects, fatigue, dry mouth, loss of appetite, rash or swelling at the site of administration, flu-like symptoms such as fever, coldness and fatigue, digestive tract problems and allergic reactions. Other undesirable effects experienced by patients are numerous and known in the art. There are many roles described in Physics's Desk Reference (68 th edition, 2014).
The term "subject" is used interchangeably with "patient". As used herein, in certain embodiments, the subject is a mammal, such as a non-primate (e.g., cow, pig, horse, cat, dog, rat, etc.) or a primate (e.g., monkey and human). In particular embodiments, the subject is a human. In one embodiment, the subject is a mammal (e.g., a human) having an infectious disease or neoplastic disease. In another embodiment, the subject is a mammal (e.g., a human) at risk of developing an infectious disease or neoplastic disease.
The term "elderly" refers to people over 65 years old. The term "human adult" refers to a person over 18 years of age. The term "human child" refers to a person aged 1 to 18 years. The term "human infant" refers to a person aged 1 to 3 years. The term "human infant" refers to a newborn to a person of 1 year old.
The term "detectable probe" refers to a composition that provides a detectable signal. The term includes, but is not limited to, any fluorophore, chromophore, radiolabel, enzyme, antibody or antibody fragment, etc. that provides a detectable signal by activity.
The term "detectable agent" refers to a substance that can be used to determine the presence of a desired molecule, such as an antigen encoded by an mRNA molecule described herein, in a sample or subject. The detectable agent may be a substance that can be visually detected or a substance that can be otherwise determined and/or measured (e.g., by quantification).
"substantially all" means at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.
As used herein and unless otherwise indicated, the term "about" or "approximately" means an acceptable error for a particular value determined by one of ordinary skill in the art, which depends in part on the manner in which the value is measured or determined. In certain embodiments, the term "about" or "approximately" means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the term "about" or "approximately" means within 20%, within 15%, within 10%, within 9%, within 8%, within 7%, within 6%, within 5%, within 4%, within 3%, within 2%, within 1%, within 0.5%, within 0.05% or less of a given value or range.
As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.
All publications, patent applications, accession numbers, and other references cited in this specification are herein incorporated by reference in their entirety to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the application is not entitled to antedate such publication by virtue of prior application. In addition, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
Various embodiments of the present invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, the description in the experimental section and examples is intended to illustrate and not limit the scope of the invention as described in the claims.
6.3 therapeutic nucleic acids
In one aspect, provided herein are therapeutic nucleic acid molecules for the control, prevention, and treatment of coronavirus infections. In some embodiments, the therapeutic nucleic acid encodes a peptide or polypeptide that, when administered to a subject in need thereof, is expressed by cells in the subject to produce the encoded peptide or polypeptide. In some embodiments, the therapeutic nucleic acid molecule is a DNA molecule. In other embodiments, the therapeutic nucleic acid molecule is an RNA molecule. In particular embodiments, the therapeutic nucleic acid molecule is an mRNA molecule.
In some embodiments, the therapeutic nucleic acid molecule is formulated in a vaccine composition. In some embodiments, the vaccine composition is a genetic vaccine as described herein. In some embodiments, the vaccine composition comprises an mRNA molecule as described herein.
In some embodiments, the mRNA molecules of the present disclosure encode a peptide or polypeptide of interest, including any naturally or non-naturally occurring or otherwise modified polypeptide. The peptide or polypeptide encoded by the mRNA may be of any size and may have any secondary structure or activity. In some embodiments, the polypeptide encoded by the mRNA payload may have a therapeutic effect when expressed in a cell.
In some embodiments, the mRNA molecules of the present disclosure comprise at least one coding region (e.g., an Open Reading Frame (ORF)) encoding a peptide or polypeptide of interest. In some embodiments, the nucleic acid molecule further comprises at least one untranslated region (UTR). In certain embodiments, the untranslated region (UTR) is located upstream (5 'to) the coding region, and is referred to herein as the 5' -UTR. In certain embodiments, the untranslated region (UTR) is located downstream (3 'end) of the coding region, and is referred to herein as the 3' -UTR. In particular embodiments, the nucleic acid molecule comprises both a 5'-UTR and a 3' -UTR. In some embodiments, the 5'-UTR comprises a 5' -cap structure. In some embodiments, the nucleic acid molecule comprises a Kozak sequence (e.g., in the 5' -UTR). In some embodiments, the nucleic acid molecule comprises a poly-A region (e.g., in the 3' -UTR). In some embodiments, the nucleic acid molecule comprises a polyadenylation signal (e.g., in the 3' -UTR). In some embodiments, the nucleic acid molecule comprises a stabilizing region (e.g., in the 3' -UTR). In some embodiments, the nucleic acid molecule comprises a secondary structure. In some embodiments, the secondary structure is a stem-loop. In some embodiments, the nucleic acid molecule comprises a stem-loop sequence (e.g., in the 5'-UTR and/or 3' -UTR). In some embodiments, the nucleic acid molecule comprises one or more intron regions capable of excision during splicing. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from the group consisting of 5' -UTR and coding region. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from the group consisting of coding regions and 3' -UTRs. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from the group consisting of 5'-UTR, coding region and 3' -UTR.
6.3.1 coding region
In some embodiments, the nucleic acid molecules of the present disclosure comprise at least one coding region. In some embodiments, the coding region is an Open Reading Frame (ORF) encoding a single peptide or protein. In some embodiments, the coding region comprises at least two ORFs, each ORF encoding a peptide or protein. In embodiments where the coding region comprises more than one ORF, the peptides and/or proteins encoded may be the same or different from each other. In some embodiments, the multiple ORFs in the coding region are separated by a non-coding sequence. In a specific embodiment, the non-coding sequence separating the two ORFs comprises an Internal Ribosome Entry Site (IRES).
Without being bound by theory, it is contemplated that an Internal Ribosome Entry Site (IRES) can be used as the sole ribosome binding site, or as one of a plurality of ribosome binding sites of an mRNA. mRNA molecules containing more than one functional ribosome binding site can encode several peptides or proteins that are independently translated by the ribosome (e.g., polycistronic mRNA). Thus, in some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises one or more Internal Ribosome Entry Sites (IRES). Examples of IRES sequences that may be used in connection with the present disclosure include, but are not limited to, those from picornaviruses (e.g., FMDV), pestiviruses (CFFV), polioviruses (PV), encephalomyocarditis viruses (ECMV), foot and Mouth Disease Viruses (FMDV), hepatitis C Viruses (HCV), swine fever viruses (CSFV), murine Leukemia Viruses (MLV), monkey immunodeficiency viruses (SIV), or cricket paralysis viruses (CrPV).
In various embodiments, the nucleic acid molecules of the present disclosure encode at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 peptides or proteins. The peptides and proteins encoded by the nucleic acid molecules may be the same or different. In some embodiments, the nucleic acid molecules of the present disclosure encode dipeptides (e.g., carnosine and anserine). In some embodiments, the nucleic acid molecule encodes a tripeptide. In some embodiments, the nucleic acid molecule encodes a tetrapeptide. In some embodiments, the nucleic acid molecule encodes a pentapeptide. In some embodiments, the nucleic acid molecule encodes a hexapeptide. In some embodiments, the nucleic acid molecule encodes a heptapeptide. In some embodiments, the nucleic acid molecule encodes an octapeptide. In some embodiments, the nucleic acid molecule encodes a nonapeptide. In some embodiments, the nucleic acid molecule encodes a decapeptide. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 15 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 50 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 100 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 150 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 300 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 500 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 1000 amino acids.
In some embodiments, the nucleic acid molecules of the present disclosure are at least about 30 nucleotides (nt) in length. In some embodiments, the nucleic acid molecule is at least about 35nt in length. In some embodiments, the nucleic acid molecule is at least about 40nt in length. In some embodiments, the nucleic acid molecule is at least about 45nt in length. In some embodiments, the nucleic acid molecule is at least about 50nt in length. In some embodiments, the nucleic acid molecule is at least about 55nt in length. In some embodiments, the nucleic acid molecule is at least about 60nt in length. In some embodiments, the nucleic acid molecule is at least about 65nt in length. In some embodiments, the nucleic acid molecule is at least about 70nt in length. In some embodiments, the nucleic acid molecule is at least about 75nt in length. In some embodiments, the nucleic acid molecule is at least about 80nt in length. In some embodiments, the nucleic acid molecule is at least about 85nt in length. In some embodiments, the nucleic acid molecule is at least about 90nt in length. In some embodiments, the nucleic acid molecule is at least about 95nt in length. In some embodiments, the nucleic acid molecule is at least about 100nt in length. In some embodiments, the nucleic acid molecule is at least about 120nt in length. In some embodiments, the nucleic acid molecule is at least about 140nt in length. In some embodiments, the nucleic acid molecule is at least about 160nt in length. In some embodiments, the nucleic acid molecule is at least about 180nt in length. In some embodiments, the nucleic acid molecule is at least about 200nt in length. In some embodiments, the nucleic acid molecule is at least about 250nt in length. In some embodiments, the nucleic acid molecule is at least about 300nt in length. In some embodiments, the nucleic acid molecule is at least about 400nt in length. In some embodiments, the nucleic acid molecule is at least about 500nt in length. In some embodiments, the nucleic acid molecule is at least about 600nt in length. In some embodiments, the nucleic acid molecule is at least about 700nt in length. In some embodiments, the nucleic acid molecule is at least about 800nt in length. In some embodiments, the nucleic acid molecule is at least about 900nt in length. In some embodiments, the nucleic acid molecule is at least about 1000nt in length. In some embodiments, the nucleic acid molecule is at least about 1100nt in length. In some embodiments, the nucleic acid molecule is at least about 1200nt in length. In some embodiments, the nucleic acid molecule is at least about 1300nt in length. In some embodiments, the nucleic acid molecule is at least about 1400nt in length. In some embodiments, the nucleic acid molecule is at least about 1500nt in length. In some embodiments, the nucleic acid molecule is at least about 1600nt in length. In some embodiments, the nucleic acid molecule is at least about 1700nt in length. In some embodiments, the nucleic acid molecule is at least about 1800nt in length. In some embodiments, the nucleic acid molecule is at least about 1900nt in length. In some embodiments, the nucleic acid molecule is at least about 2000nt in length. In some embodiments, the nucleic acid molecule is at least about 2500nt in length. In some embodiments, the nucleic acid molecule is at least about 3000nt in length. In some embodiments, the nucleic acid molecule is at least about 3500nt in length. In some embodiments, the nucleic acid molecule is at least about 4000nt in length. In some embodiments, the nucleic acid molecule is at least about 4500nt in length. In some embodiments, the nucleic acid molecule is at least about 5000nt in length.
In particular embodiments, the therapeutic nucleic acids of the present disclosure are formulated into vaccine compositions (e.g., genetic vaccines) as described herein. In some embodiments, the therapeutic nucleic acid encodes a peptide or protein capable of eliciting an immunity against one or more target conditions or diseases. In some embodiments, the target disorder is associated with or caused by infection by a pathogen, such as coronavirus (e.g., covd-19), influenza virus, measles virus, human Papilloma Virus (HPV), rabies virus, meningitis virus, pertussis virus, tetanus virus, plague virus, hepatitis virus, and tuberculosis virus. In some embodiments, the therapeutic nucleic acid sequence (e.g., mRNA) encodes a pathogenic protein characteristic of a pathogen or an immunogenic fragment (e.g., epitope) or derivative thereof. The vaccine, upon administration to a vaccinated subject, allows expression of the encoded pathogenic protein (or immunogenic fragment or derivative thereof), thereby eliciting immunity against the pathogen in the subject.
In particular embodiments, provided herein are therapeutic compositions (e.g., vaccine compositions) for controlling, preventing, and treating infectious diseases or conditions caused by coronaviruses. Coronaviruses belong to the order nidoviridae (nidovirales) Coronaviridae (Coronaviridae) and are divided into four genera: alpha-coronavirus, beta-coronavirus, gamma-coronavirus and delta-coronavirus. Wherein the α -coronavirus and the β -coronavirus infect mammals, the γ -coronavirus infects birds, and the δ -coronavirus infects mammals and birds. Representative alpha-coronaviruses include human coronavirus NL63 (HCoV-NL 63), porcine transmissible gastroenteritis coronavirus (TGEV), PEDV, and Porcine Respiratory Coronavirus (PRCV). Representative beta-coronaviruses include SARS-CoV, MERS-CoV, bats coronavirus HKU4, mouse hepatitis coronavirus (MHV), bovine coronavirus (BCoV), and human coronavirus OC43. Representative gamma-coronaviruses and delta-coronaviruses include avian infectious bronchitis coronavirus (IBV) and porcine delta-coronavirus (PdCV), respectively. Li et al, annu Rev Virol.2016 3 (1): 237-261.
Without being bound by theory, it is contemplated that the coronavirus is an enveloped positive-stranded RNA virus. They have a large genome, typically ranging from 27kb to 32kb. The genome is stacked inside a helical capsid formed by a nucleocapsid (N) protein and further surrounded by an envelope. At least three structural proteins are associated with the viral envelope: the membrane (M) and envelope (E) proteins are involved in viral assembly, while the spike (S) proteins mediate viral entry into host cells. Some coronaviruses also encode envelope-associated Hemagglutinin Esterase (HE) proteins. Among these structural proteins, spike proteins form larger protrusions from the viral surface, making coronaviruses look like crowns. It is further contemplated that in addition to mediating viral entry, spike proteins may also play a role in determining viral host range and tissue tropism and are the primary inducers of host immune responses. Li et al, annu Rev Virol.2016 3 (1): 237-261.
Thus, in some embodiments, provided herein are therapeutic nucleic acids encoding viral peptides or proteins derived from coronaviruses. In some embodiments, the nucleic acid encodes a viral peptide or protein derived from a coronavirus, wherein the viral peptide or protein is selected from one or more of the following: (a) N protein; (b) M protein; (c) E protein; (d) S protein; (e) HE protein; (f) an immunogenic fragment of any one of (a) to (e); and (g) a functional derivative according to any one of (a) to (f).
Without being bound by theory, it is expected that the coronavirus S protein contains three segments: an extracellular domain, a single pass transmembrane anchor, and an intracellular tail. It is further contemplated that the extracellular domain comprises receptor binding subunit S1 and membrane fusion subunit S2. The S1 subunit also comprises two major domains: n-terminal domain (S1-NTD) and C-terminal domain (S1-CTD). It is further contemplated that one or both of these domains in the S1 subunit may bind to a receptor on a host cell and function as a Receptor Binding Domain (RBD). In particular, host receptors recognized by any of the domains in the S1 subunit are further contemplated to include angiotensin converting enzyme 2 (ACE 2), aminopeptidase N (APN), dipeptidylpeptidase 4 (DPP 4), carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM 1), and saccharides. It is further contemplated that S1-CTD contains two subdomains: core structure and Receptor Binding Motif (RBM). The RBM binds to ACE2 receptors on host cells.
Thus, in some embodiments, the therapeutic nucleic acids of the present disclosure encode a coronavirus S protein, or an immunogenic fragment of an S protein, or a functional derivative of an S protein or immunogenic fragment thereof. In specific embodiments, the immunogenic fragment of the S protein is selected from the group consisting of an extracellular domain, an S1 subunit, a Receptor Binding Domain (RBD), and a Receptor Binding Motif (RBM). In other embodiments, the immunogenic fragment of the S protein is selected from the group consisting of a transmembrane domain, an intracellular tail, an S2 subunit, an S1-NTD domain, and an S1-CTD domain. Table 1 shows exemplary SARS-CoV-2 natural antigen sequences.
Table 1 illustrates the natural SARS-CoV-2 antigen sequence.
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S protein of coronavirus SARS-CoV-2, wherein the S protein has the amino acid sequence of SEQ ID NO. 2. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 3. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 3. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the extracellular domain (ECD) of the S protein of coronavirus SARS-CoV-2, and wherein said extracellular domain has the amino acid sequence of SEQ ID NO. 4. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the ECD of the S protein of coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 5. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the ECD of the S protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 5. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S1 subunit of the S protein of coronavirus SARS-CoV-2, and wherein said S1 subunit has the amino acid sequence of SEQ ID NO. 6. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S1 subunit of the S protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 7. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S1 subunit of the S protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 7. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes an immunogenic fragment of the S protein of coronavirus SARS-CoV-2. In some embodiments, the immunogenic fragment is the Receptor Binding Domain (RBD) of the S protein of coronavirus SARS-CoV-2. In some embodiments, the therapeutic nucleic acids of the present disclosure encode an RBD sequence located at residues 319-541 of the S protein and having the amino acid sequence of SEQ ID NO. 8. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 9. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of the coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 9. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes an RBD sequence located at residues 331-529 of the S protein of the coronavirus SARS-CoV-2 and having the amino acid sequence of SEQ ID NO. 10. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 11. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of the coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 11. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of coronavirus SARS-CoV-2, and wherein said RBD sequence is located at residues 331-524 of the S protein and has the amino acid sequence of SEQ ID NO. 12. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 13. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of the coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 13. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of coronavirus SARS-CoV-2, and wherein said RBD domain is located at residues 319-529 of the S protein and has the amino acid sequence of SEQ ID NO. 14. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 15. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of the coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 15. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the Receptor Binding Motif (RBM) sequence of the S protein of the coronavirus SARS-CoV-2, and wherein said RBM has the amino acid sequence of SEQ ID NO. 16. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBM of the S protein of the coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 17. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBM of the S protein of the coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 17. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In some embodiments, the therapeutic nucleic acids of the present disclosure encode functional derivatives of RBD. In certain embodiments, the functional derivative of the RBD comprises one or more mutations that increase the binding affinity of the RBD to the host receptor as compared to the RBD without such mutations. In a particular embodiment, the coronavirus is SARS-CoV and wherein the mutation is K479N and/or S487T.
In a particular embodiment, the coronavirus is SARS-CoV-2, and wherein the mutation is N501T. Table 2 shows exemplary sequences of the S protein of coronavirus SARS-CoV-2 or antigenic fragment thereof having the N501T mutation.
Table 2 exemplary mutant sequences of SARS-CoV-2 antigen.
/>
/>
/>
/>
In a particular embodiment, the therapeutic nucleic acid encodes a functional derivative of the S protein of the coronavirus SARS-CoV-2. In certain embodiments, the functional derivative of the encoded S protein comprises the amino acid substitution N501T. In a particular embodiment, the functional derivative of the encoded S protein comprises the amino acid sequence of SEQ ID NO. 20.
In a particular embodiment, the therapeutic nucleic acid encodes a functional derivative of the extracellular domain of the S protein of the coronavirus SARS-CoV-2. In a particular embodiment, the functional derivative of the encoded S protein extracellular domain comprises the amino acid substitution N501T. In a particular embodiment, the functional derivative of the extracellular domain of the encoded S protein comprises the amino acid sequence of SEQ ID NO. 21.
In a particular embodiment, the therapeutic nucleic acid encodes a functional derivative of the S1 subunit of the S protein of the coronavirus SARS-CoV-2. In a particular embodiment, the functional derivative of the S1 subunit of the encoded S protein comprises the amino acid substitution N501T. In a particular embodiment, the functional derivative of the S1 subunit of the encoded S protein comprises the amino acid sequence of SEQ ID NO. 22.
In particular embodiments, the therapeutic nucleic acid encodes a functional derivative of the Receptor Binding Domain (RBD) sequence of the S protein of the coronavirus SARS-CoV-2. In a particular embodiment, the functional derivative of the encoded S protein RBD sequence comprises the amino acid substitution N501T. In particular embodiments, the functional derivative of the encoded S protein RBD sequence comprises the amino acid sequence of SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25 or SEQ ID NO. 26. In a particular embodiment, the therapeutic nucleic acid encoding a functional derivative of the RBD sequence of the S protein of the coronavirus SARS-CoV-2 comprises the DNA coding sequence of SEQ ID NO. 27. In a particular embodiment, the therapeutic nucleic acid encoding a functional derivative of the RBD sequence of the S protein of the coronavirus SARS-CoV-2 comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 27. In some embodiments, the RNA sequence is transcribed in vitro. In certain embodiments, the therapeutic nucleic acid is an mRNA molecule.
Table 3 shows exemplary SARS-CoV-2 B.1.351 natural antigen sequences, as well as nucleic acid molecules encoding the SARS-CoV-2 B.1.351 antigens.
TABLE 3 exemplary Natural SARS-CoV-2 B.1.351 antigen sequence
/>
/>
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes an immunogenic fragment of the S protein of coronavirus SARS-CoV-2 B.1.351. In some embodiments, the immunogenic fragment is the Receptor Binding Domain (RBD) of the S protein of coronavirus SARS-CoV-2 B.1.351. In some embodiments, the therapeutic nucleic acids of the present disclosure encode an RBD fragment (SA-RBD) of SARS-CoV-2 B.1.351 having the amino acid sequence of SEQ ID NO: 60. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes an RBD fragment of the S protein of coronavirus SARS-CoV-2 B.1.351, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 61. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes an RBD fragment of the S protein of coronavirus SARS-CoV-2 B.1.351, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 61. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes an RBD fragment of the S protein of coronavirus SARS-CoV-2 B.1.351, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 62. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes an RBD fragment of the S protein of coronavirus SARS-CoV-2 B.1.351, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 62. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
Without being bound by theory, it is expected that in the spike structure of coronaviruses, three S1 heads are located on top of the trimeric S2 stem. Between the two major S1 domains, S1-CTD is located at the very top of the spike, while S1-NTD is in direct contact and structurally constrains S2. Thus, in some embodiments, the therapeutic nucleic acids of the present disclosure encode functional derivatives of S protein. In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising an S protein or fragment thereof fused to a trimerizing peptide such that the fusion protein is capable of forming a trimeric complex comprising three copies of the S protein or fragment thereof. In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising an extracellular domain of an S protein fused to a trimerizing peptide, wherein the fusion protein is capable of forming a trimeric complex comprising three copies of the extracellular domain. In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising an RBD of an S protein fused to a trimerizing peptide, wherein the fusion protein is capable of forming a trimeric complex comprising three copies of the RBD. In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising S1-CTD fused to a trimerizing peptide, wherein the fusion protein is capable of forming a trimeric complex comprising three copies of S1-CTD. In some embodiments, the S protein or fragment thereof is fused to the trimerized peptide via a peptide linker. Table 4 shows the sequences of exemplary trimeric and linker peptides, as well as fusion proteins, that can be used in connection with the present disclosure.
Table 4 shows the sequences of exemplary linker peptides, trimerized peptides and SARS-CoV-2 antigen.
/>
/>
/>
/>
/>
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the S protein of coronavirus SARS-CoV-2, or a functional derivative thereof, fused to a trimerized peptide. In some embodiments, the fusion between the S protein and the trimerized peptide is via a peptide linker. In a specific embodiment, the S protein or functional derivative thereof comprises the amino acid sequence of SEQ ID NO. 2 or SEQ ID NO. 20. In a specific embodiment, the peptide linker comprises the amino acid sequence of SEQ ID NO. 28. In some embodiments, the trimerized peptide comprises the amino acid sequence of SEQ ID NO. 30.
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the extracellular domain (ECD) of the S protein of coronavirus SARS-CoV-2 or a functional derivative thereof fused to a trimerization peptide. In some embodiments, the fusion between the extracellular domain of the S protein and the trimerized peptide is via a peptide linker. In a specific embodiment, the extracellular domain of the S protein or a functional derivative thereof comprises the amino acid sequence of SEQ ID NO. 4 or SEQ ID NO. 21. In a specific embodiment, the peptide linker comprises the amino acid sequence of SEQ ID NO. 28. In some embodiments, the trimerized peptide comprises the amino acid sequence of SEQ ID NO. 30.
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising an extracellular domain of an S protein of the coronavirus SARS-CoV-2, or a functional derivative thereof, fused to a trimerization peptide. In a particular embodiment, the fusion protein has the amino acid sequence of SEQ ID NO. 32. In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the extracellular domain of the S protein of SARS-CoV-2 fused to a trimerization peptide, wherein the nucleic acid comprises the DNA coding sequence of SEQ ID NO. 33. In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the extracellular domain of the S protein of SARS-CoV-2 fused to a trimerization peptide, wherein the nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 33. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the S1 subunit of the S protein of coronavirus SARS-CoV-2, or a functional derivative thereof, fused to a trimerized peptide. In some embodiments, the fusion between the extracellular domain of the S protein and the trimerized peptide is via a peptide linker. In a specific embodiment, the S1 subunit of the S protein, or a functional derivative thereof, comprises the amino acid sequence of SEQ ID NO. 6 or SEQ ID NO. 22. In a specific embodiment, the peptide linker comprises the amino acid sequence of SEQ ID NO. 28. In some embodiments, the trimerized peptide comprises the amino acid sequence of SEQ ID NO. 30.
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the Receptor Binding Domain (RBD) sequence of the S protein of coronavirus SARS-CoV-2, or a functional derivative thereof, fused to a trimerization peptide. In some embodiments, the fusion between the RBD sequence of the S protein and the trimerized peptide is via a peptide linker. In a specific embodiment, the RBD sequence of an S protein, or a functional derivative thereof, comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 8, 10, 12, 14, 23, 24, 25 and 26. In a specific embodiment, the peptide linker comprises the amino acid sequence of SEQ ID NO. 28. In some embodiments, the trimerized peptide comprises the amino acid sequence of SEQ ID NO. 30.
In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the RBD sequence of the S protein of SARS-CoV-2 fused to a trimerization peptide, wherein said fusion protein has the amino acid sequence of SEQ ID NO. 34. In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the RBD of the S protein of SARS-CoV-2 fused to a trimerization peptide, wherein said nucleic acid comprises the DNA coding sequence of SEQ ID NO. 35. In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the RBD of the S protein of SARS-CoV-2 fused to a trimerization peptide, wherein said nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 35. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the Receptor Binding Domain (RBD) sequence of the S protein of coronavirus SARS-CoV-2 b.1.351, or a functional derivative thereof, fused to a trimerization peptide. In some embodiments, the fusion between the RBD sequence of the S protein and the trimerized peptide is via a peptide linker. In a specific embodiment, the RBD sequence of the S protein, or a functional derivative thereof, comprises an amino acid sequence selected from the group consisting of SEQ ID NO. 60. In a specific embodiment, the peptide linker comprises the amino acid sequence of SEQ ID NO. 28. In some embodiments, the trimerized peptide comprises the amino acid sequence of SEQ ID NO. 30.
In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the RBD sequence of the S protein of SARS-CoV-2 B.1.351 fused to a trimerization peptide, wherein said fusion protein has the amino acid sequence of SEQ ID NO. 63. In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the RBD of the S protein of SARS-CoV-2 B.1.351 fused to a trimerization peptide, wherein said nucleic acid comprises the DNA coding sequence of SEQ ID NO. 64. In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the RBD of the S protein of SARS-CoV-2 B.1.351 fused to a trimerization peptide, wherein said nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 64. In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the RBD of the S protein of SARS-CoV-2 B.1.351 fused to a trimerization peptide, wherein said nucleic acid comprises the DNA coding sequence of SEQ ID NO. 65. In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the RBD of the S protein of SARS-CoV-2 B.1.351 fused to a trimerization peptide, wherein said nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 65. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the Receptor Binding Motif (RBM) sequence of the S protein of coronavirus SARS-CoV-2, or a functional derivative thereof, fused to a trimerization peptide. In some embodiments, the fusion between the RBM sequence of the S protein and the trimerized peptide is via a peptide linker. In a specific embodiment, the RBM sequence of the S protein, or a functional derivative thereof, comprises the amino acid sequence of SEQ ID NO. 16. In a specific embodiment, the peptide linker comprises the amino acid sequence of SEQ ID NO. 28. In some embodiments, the trimerized peptide comprises the amino acid sequence of SEQ ID NO. 30.
Without being bound by theory, it is expected that the N protein of coronavirus comprises an N-terminal domain (N-NTD) and a C-terminal domain (N-CTD) interspersed with several regions of Inherent Disorder (IDRs). For example, SARS-CoV N protein has three IDRs at residues 1-44, 182-247 and 366-422, respectively, and N-NTD at residues 45-181 and N-CTD at residues 248-365.
Thus, in some embodiments, the therapeutic nucleic acids of the present disclosure encode a coronavirus N protein, or an immunogenic fragment of an N protein, or a functional derivative of an N protein or immunogenic fragment thereof. In particular embodiments, the therapeutic nucleic acid encodes a full-length N protein. In particular embodiments, the therapeutic nucleic acid encodes one or more immunogenic fragments of an N protein selected from the group consisting of N-NTD, N-CTD, and IDR.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the nucleocapsid (N) protein of coronavirus SARS-CoV-2, and wherein said N protein has the amino acid sequence of SEQ ID NO. 18. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the N protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 19. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the N protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 19. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the nucleocapsid (N) protein of coronavirus SARS-CoV-2 B.1.351, and wherein said N protein has the amino acid sequence of SEQ ID NO. 70. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the N protein of coronavirus SARS-CoV-2 B.1.351, and wherein the therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO: 71. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the N protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO: 71. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
Without being bound by theory, it is contemplated that fusion proteins comprising a viral peptide or polypeptide fused to an immunoglobulin Fc region may enhance the immunogenicity of the viral peptide or polypeptide. Thus, in some embodiments, the therapeutic nucleic acid molecules of the present disclosure encode fusion proteins comprising a viral peptide or protein derived from a coronavirus fused to the Fc region of an immunoglobulin. In particular embodiments, the viral peptide or protein is selected from one or more of the following: (a) N protein; (b) M protein; (c) E protein; (d) S protein; (e) HE protein; (f) an immunogenic fragment of any one of (a) to (e); and (g) a functional derivative according to any one of (a) to (f). In a particular embodiment, the immunoglobulin is a human immunoglobulin (Ig). In a particular embodiment, the immunoglobulin is human IgG, igA, igD, igE or IgM. In particular embodiments, the immunoglobulin is human IgG1, igG2, igG3, or IgG4. In some embodiments, the immunoglobulin Fc is fused to the N-terminus of a viral peptide or polypeptide. In other embodiments, the immunoglobulin Fc is fused to the C-terminus of a viral peptide or polypeptide.
Without being bound by theory, it is contemplated that the signal peptide may mediate transport of the polypeptide to which it is fused to a specific location of the cell. Thus, in some embodiments, the therapeutic nucleic acid molecules of the present disclosure encode fusion proteins comprising a viral peptide or protein fused to a signal peptide. In particular embodiments, the viral peptide or protein is selected from one or more of the following: (a) N protein; (b) M protein; (c) E protein; (d) S protein; (e) HE protein; (f) an immunogenic fragment of any one of (a) to (e); and (g) a functional derivative according to any one of (a) to (f). In some embodiments, the signal peptide is fused to the N-terminus of the viral peptide or polypeptide. In other embodiments, the signal peptide is fused to the C-terminus of the viral peptide or polypeptide. Table 5 shows exemplary sequences of signal peptides that can be used in conjunction with the present disclosure, as well as exemplary SARS-CoV-2 antigen sequences that comprise the signal peptides.
Table 5: exemplary sequences of signal peptide and SARS-CoV-2 antigen.
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
In particular embodiments, the signal peptide is encoded by a gene of a coronavirus from which the viral peptide or polypeptide is derived. In certain embodiments, the signal peptide encoded by a gene of a coronavirus is fused to a viral peptide or polypeptide encoded by a different gene of a coronavirus. In other embodiments, the signal peptide encoded by a gene of a coronavirus is fused to a viral peptide or polypeptide encoded by the same gene of a coronavirus. For example, in some embodiments, a signal peptide having the amino acid sequence of MFVFLVLLPLVSS (SEQ ID NO: 36) is fused to a viral peptide or polypeptide encoded by a nucleic acid molecule of the present disclosure. In various embodiments, the viral peptide or protein is selected from one or more of the following: (a) N protein; (b) M protein; (c) E protein; (d) S protein; (e) HE protein; (f) an immunogenic fragment of any one of (a) to (e); and (g) a functional derivative according to any one of (a) to (f).
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S protein of coronavirus SARS-CoV-2 without a natural signal peptide. In a particular embodiment, the encoded S protein comprises the amino acid sequence of SEQ ID NO. 40. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S protein of coronavirus SARS-CoV-2 having a signal peptide, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 41. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S protein of coronavirus SARS-CoV-2 having a signal peptide, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 41. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the extracellular domain (ECD) of the S protein of coronavirus SARS-CoV-2 with a signal peptide. In a particular embodiment, the extracellular domain of the encoded S protein comprises the amino acid sequence of SEQ ID NO. 42. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the extracellular domain of the S protein of coronavirus SARS-CoV-2 having a signal peptide, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 43. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the extracellular domain of the S protein of coronavirus SARS-CoV-2 having a signal peptide, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 43. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S1 subunit of the S protein of coronavirus SARS-CoV-2 with a signal peptide. In a particular embodiment, the S1 subunit of the encoded S protein comprises the amino acid sequence of SEQ ID NO. 44. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S1 subunit of the S protein of coronavirus SARS-CoV-2 having a signal peptide, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 45. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S1 subunit of the S protein of coronavirus SARS-CoV-2 having a signal peptide, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 45. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In other embodiments, the signal peptide is encoded by a foreign gene sequence that is not present in the coronavirus from which the viral peptide or polypeptide is derived. In some embodiments, the heterologous signal peptide replaces a homologous signal peptide in a fusion protein encoded by a nucleic acid molecule of the present disclosure. In particular embodiments, the signal peptide is encoded by a mammalian gene. In a specific embodiment, the signal peptide is encoded by a human immunoglobulin gene. In a specific embodiment, the signal peptide is encoded by the human IgE gene. For example, in some embodiments, a signal peptide having the amino acid sequence of MDWTWILFLVAAATRVHS (SEQ ID NO: 38) is fused to a viral peptide or polypeptide encoded by a nucleic acid molecule of the present disclosure. In various embodiments, the viral peptide or protein is selected from one or more of the following: (a) N protein; (b) M protein; (c) E protein; (d) S protein; (e) HE protein; (f) an immunogenic fragment of any one of (a) to (e); and (g) a functional derivative according to any one of (a) to (f).
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the Receptor Binding Domain (RBD) sequence of the S protein of coronavirus SARS-CoV-2 b.1.351 fused to the human IgE signal peptide. In a particular embodiment, the fusion protein in which the RBD sequence of the encoded S protein is fused to the human IgE signal peptide comprises the amino acid sequence of SEQ ID NO. 66. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes a fusion protein of the RBD sequence of the S protein and a human IgE signal peptide, and wherein the therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID No. 67. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes a fusion protein of the RBD sequence of the S protein and a human IgE signal peptide, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID No. 67. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes a fusion protein of the RBD sequence of the S protein and a human IgE signal peptide, and wherein the therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID No. 68. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes a fusion protein of the RBD sequence of the S protein and a human IgE signal peptide, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID No. 68. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
6.3.2 5' -cap structure
Without being bound by theory, it is expected that the 5' -cap structure of the polynucleotide participates in nuclear export and increases polynucleotide stability, and binds to mRNA Cap Binding Protein (CBP), which is responsible for polynucleotide stability in cells, and induces translational capacity by associating CBP with poly-a binding protein to form mature circular mRNA species. The 5 '-cap structure further facilitates removal of the 5' -proximal intron during mRNA splicing. Thus, in some embodiments, the nucleic acid molecules of the present disclosure comprise a 5' -cap structure.
The nucleic acid molecule may be capped at the 5 'end by a cellular endogenous transcription machinery, thereby creating a 5' -ppp-5 '-triphosphate linkage between the terminal guanosine cap residue of the polynucleotide and the 5' end transcribed sense nucleotide. The 5' -guanylate cap may then be methylated to produce an N7-methyl-guanylate residue. The ribose of the 5 'end of the polynucleotide and/or the pre-terminal (ante-terminal) transcribed nucleotide may also optionally be 2' -O-methylated. 5' -uncapping by hydrolysis and cleavage of guanylate cap structures can target nucleic acid molecules, such as mRNA molecules, for degradation.
In some embodiments, the nucleic acid molecules of the present disclosure comprise one or more alterations to the native 5' -cap structure produced by endogenous processes. Without being bound by theory, modification of the 5' -cap may increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and may increase the translational efficiency of the polynucleotide.
Exemplary alterations to the native 5' -cap structure include the creation of a non-hydrolyzable cap structure to prevent uncapping, thereby increasing the half-life of the polynucleotide. In some embodiments, because hydrolysis of the cap structure requires cleavage of the 5'-ppp-5' phosphodiester linkage, in some embodiments, modified nucleotides may be used during the capping reaction. For example, in some embodiments, vaccinia virus capping enzyme (Vaccinia Capping Enzyme) from New England Biolabs (Ipswich, mass.) can be used for α -thioguanosine nucleotides to produce phosphorothioate linkages in the 5' -ppp-5' cap according to the manufacturer's instructions. Additional modified guanosine nucleotides such as alpha-methylphosphonic acid and selenophosphate nucleotides may be used.
Additional exemplary alterations to the native 5' -cap structure also include modifications at the 2' and/or 3' positions of the capped Guanosine Triphosphate (GTP) and substitution of the sugar epoxy (resulting in a carbocyclic oxygen) for a methylene moiety (CH 2 ) Modification at the triphosphate bridge portion of the cap structure or modification at the nucleobase (G) portion.
Additional exemplary alterations to the native 5' -cap structure include, but are not limited to, 2' -O-methylation of ribose of the 5' -end and/or 5' -end pre-nucleotides of the polynucleotide at the sugar 2' -hydroxyl (as described above). A variety of different 5 '-cap structures can be used to create a 5' -cap of a polynucleotide (such as an mRNA molecule). Additional exemplary 5 '-cap structures that may be used in connection with the present disclosure also include those 5' -cap structures described in international patent publications No. WO2008127688, no. WO 2008016473, and No. WO 2011015347, the entire contents of each of which are incorporated herein by reference.
In various embodiments, the 5' -end cap can comprise a cap analog. Cap analogs are also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs that differ in chemical structure from the natural (i.e., endogenous, wild-type, or physiological) 5' -cap while retaining cap function. Cap analogs can be chemically (i.e., non-enzymatically) or enzymatically synthesized and/or linked to a polynucleotide.
For example, an anti-reverse cap analogue (ARCA) cap contains two guanosine groups linked via a 5'-5' -triphosphate group, wherein one guanosine group contains an N7-methyl group and a 3 '-O-methyl group (i.e., N7,3' -O-dimethyl-guanosine-5 '-triphosphate-5' -guanosine, i.e., m 7 G-3'mppp-G, which may equivalently be referred to as 3' O-Me-m7G (5 ') ppp (5') G). The 3'-O atom of the other unchanged guanosine is attached to the 5' -terminal nucleotide of a capped polynucleotide (e.g.mRNA). N7-and 3' -O-methylated guanines provide the terminal portion of a capped polynucleotide (e.g., mRNA). Another exemplary cap structure is a mCAP, which is similar to ARCA, but has a 2 '-O-methyl group on guanosine (i.e., N7,2' -O-dimethyl-guanosine-5 '-triphosphate-5' -guanosine, i.e., m) 7 Gm-ppp-G)。
In some embodiments, the cap analog can be a dinucleotide cap analog. As non-limiting examples, dinucleotide cap analogs may be modified with a borane phosphate group (borophosphate) or a selenophosphate group (phosphoselenoate) at different phosphate positions, such as the dinucleotide cap analogs described in U.S. patent No. 8,519,110, the entire contents of which are incorporated herein by reference in their entirety.
In some embodiments, cap analogs can be N7- (4-chlorophenoxyethyl) -substituted dinucleotide cap analogs known in the art and/or described herein. Non-limiting examples of N7- (4-chlorophenoxyethyl) -substituted dinucleotide cap analogs include N7- (4-chlorophenoxyethyl) -G (5 ') ppp (5 ') G and N7- (4-chlorophenoxyethyl) -m3' -OG (5 ') ppp (5 ') G cap analogs (see, e.g., kore et al, bioorganic & Medicinal Chemistry 2013:4570-4574, various cap analogs and methods of synthesizing cap analogs; the entire contents of this document are incorporated herein by reference). In other embodiments, the cap analogs that can be used in conjunction with the nucleic acid molecules of the present disclosure are 4-chloro/bromophenoxyethyl analogs.
In various embodiments, the cap analog can include a guanosine analog. Useful guanosine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2' -fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
Without being bound by theory, it is expected that although cap analogs allow for simultaneous capping of polynucleotides in an in vitro transcription reaction, up to 20% of transcripts remain uncapped. This and the structural differences in the native 5' -cap structure of the cap analogue and the polynucleotide produced by the endogenous transcriptional machinery of the cell may lead to reduced translational capacity and reduced cell stability.
Thus, in some embodiments, the nucleic acid molecules of the present disclosure may also be capped post-transcriptionally using enzymes in order to produce a more authentic (authentic) 5' -cap structure. As used herein, the phrase "more realistic" refers to a feature that closely reflects or mimics an endogenous or wild-type feature in structure or function. That is, a "more authentic" feature better represents an endogenous, wild-type, natural, or physiological cell function and/or structure, or it outperforms a corresponding endogenous, wild-type, natural, or physiological feature in one or more respects, as compared to a synthetic feature or analog of the prior art. Non-limiting examples of more realistic 5' -cap structures that can be used in conjunction with the nucleic acid molecules of the present disclosure are synthetic 5' -cap structures (or compared to wild-type, natural or physiological 5' -cap structures) as known in the art, particularly structures with enhanced binding to cap binding proteins, increased half-life, reduced sensitivity to 5' -endonucleases, and/or reduced 5' -uncapping. For example, in some embodiments, the recombinant vaccinia virus capping enzyme and the recombinant 2 '-O-methyltransferase can create a classical 5' -5 '-triphosphate linkage between a 5' -terminal nucleotide of a polynucleotide and a guanosine cap nucleotide, wherein the guanosine cap contains N7-methylation and the 5 '-terminal nucleotide of the polynucleotide contains a 2' -O-methyl group. This structure is referred to as the cap 1 structure. Such caps result in higher translational capacity, cell stability, and reduced activation of cellular pro-inflammatory cytokines than, for example, other 5' cap analog structures known in the art. Other exemplary cap structures include 7mG (5 ') ppp (5 ') N, pN2p (cap 0), 7mG (5 ') ppp (5 ') Nlmp Np (cap 1), 7mG (5 ') -ppp (5 ') NlmpN2mp (cap 2), and m (7) Gpppm (3) (6,6,2 ') Apm (2 ') Cpm (2) (3, 2 ') Up (cap 4).
Without being bound by theory, it is contemplated that the nucleic acid molecules of the present disclosure may be capped post-transcriptionally, and since this approach is more efficient, nearly 100% of the nucleic acid molecules may be capped.
6.3.3 untranslated regions (UTRs)
In some embodiments, the nucleic acid molecules of the disclosure comprise one or more untranslated regions (UTRs). In some embodiments, the UTR is located upstream of the coding region in the nucleic acid molecule and is referred to as a 5' -UTR. In some embodiments, the UTR is located downstream of the coding region in the nucleic acid molecule and is referred to as a 3' -UTR. The sequence of the UTR may be homologous or heterologous to the sequence of the coding region found in the nucleic acid molecule. Multiple UTRs may be included in a nucleic acid molecule and may have the same or different sequences and/or genetic origins. According to the present disclosure, any portion (including none) of the UTRs in a nucleic acid molecule may be codon optimized, and any portion may independently contain one or more different structural or chemical modifications before and/or after codon optimization.
In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises UTR and coding regions that are homologous with respect to each other. In other embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise UTR and coding regions that are heterologous with respect to each other. In some embodiments, to monitor the activity of a UTR sequence, a nucleic acid molecule comprising a coding sequence of a UTR and a detectable probe may be administered in vitro (e.g., a cell or tissue culture) or in vivo (e.g., to a subject), and the effect of the UTR sequence (e.g., modulating expression levels, cellular localization of the encoded product, or half-life of the encoded product) may be measured using methods known in the art.
In some embodiments, the UTR of a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises at least one Translational Enhancer Element (TEE) that functions to increase the amount of polypeptide or protein produced by the nucleic acid molecule. In some embodiments, the TEE is located in the 5' -UTR of the nucleic acid molecule. In other embodiments, the TEE is located at the 3' -UTR of the nucleic acid molecule. In other embodiments, at least two TEEs are located at the 5'-UTR and 3' -UTR, respectively, of a nucleic acid molecule. In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure may comprise one or more copies of a TEE sequence or comprise more than one different TEE sequence. In some embodiments, the different TEE sequences present in the nucleic acid molecules of the disclosure may be homologous or heterologous with respect to each other.
Various TEE sequences are known in the art and may be used in connection with the present disclosure. For example, in some embodiments, the TEE may be an Internal Ribosome Entry Site (IRES), HCV-IRES, or IRES element. Chappell et al, proc.Natl. Acad. Sci. USA 101:9590-9594,2004; zhou et al Proc.Natl.Acad.Sci.102:6273-6278,2005. Additional Internal Ribosome Entry Sites (IRES) that can be used in conjunction with the present disclosure include, but are not limited to, IRES described in U.S. patent No. 7,468,275, U.S. patent publication No. 2007/0048776, and U.S. patent publication No. 2011/0123410, as well as international patent publication nos. WO2007/025008 and WO2001/055369, the contents of each of which are incorporated herein by reference in their entirety. In some embodiments, the TEE may be Wellensiek et al Genome-wide profiling of human cap-independent translation-enhancing elements, nature Methods, month 8 of 2013; 10 (8) supplement Table 1 and supplement Table 2 for 747-750; the content of this document is incorporated by reference in its entirety.
Additional exemplary TEEs that may be used in conjunction with the present disclosure include, but are not limited to, TEE sequences described in U.S. patent No. 6,310,197, U.S. patent No. 6,849,405, U.S. patent No. 7,456,273, U.S. patent No. 7,183,395, U.S. patent publication No. 2009/0226470, U.S. patent publication No. 2013/0177581, U.S. patent publication No. 2007/0048776, U.S. patent publication No. 2011/0127800, U.S. patent publication No. 2009/0093049, international patent publication No. WO2009/075886, international patent publication No. WO2012/009644 and international patent publication No. WO 1999/02455, international patent publication No. WO2007/025008, international patent publication No. WO2001/055371, european patent No. 2610341, european patent No. 2610340, the contents of each of which are incorporated herein by reference in their entirety.
In various embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises at least one UTR comprising at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. In some embodiments, the TEE sequence in the nucleic acid molecule UTR is a copy of the same TEE sequence. In other embodiments, at least two TEE sequences in a nucleic acid molecule UTR have different TEE sequences. In some embodiments, a plurality of different TEE sequences are arranged in one or more repeating patterns in the UTR region of the nucleic acid molecule. For illustration purposes only, the repeating pattern may be, for example, ABABAB, AABBAABBAABB, ABCABCABC, etc., wherein in these exemplary patterns each capital letter (A, B or C) represents a different TEE sequence. In some embodiments, at least two TEE sequences are contiguous with each other (i.e., without a spacer sequence therebetween) in the UTR of a nucleic acid molecule. In other embodiments, at least two TEE sequences are separated by a spacer sequence. In some embodiments, UTRs may comprise TEE sequence-spacer sequence modules that are repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times in UTRs. In any of the embodiments described in this paragraph, the UTR can be the 5'-UTR, the 3' -UTR, or both the 5'-UTR and the 3' -UTR of the nucleic acid molecule.
In some embodiments, the UTR of a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises at least one translational inhibiting element that functions to reduce the amount of polypeptide or protein produced by the nucleic acid molecule. In some embodiments, the UTR of the nucleic acid molecule comprises one or more miR sequences or fragments thereof (e.g., miR seed sequences) that are recognized by one or more micrornas. In some embodiments, the UTR of the nucleic acid molecule comprises one or more stem-loop structures that down-regulate the translational activity of the nucleic acid molecule. Other mechanisms for inhibiting the translational activity associated with nucleic acid molecules are known in the art. In any of the embodiments described in this paragraph, the UTR can be the 5'-UTR, the 3' -UTR, or both the 5'-UTR and the 3' -UTR of the nucleic acid molecule. Table 6 shows exemplary 5'-UTR and 3' -UTR sequences that may be used in connection with the present disclosure.
Table 6 illustrates an exemplary untranslated region (UTR) sequence.
/>
/>
In a specific embodiment, the nucleic acid molecules of the present disclosure comprise a 5' -UTR selected from the group consisting of SEQ ID NOS: 46-51. In a specific embodiment, the nucleic acid molecules of the present disclosure comprise a 3' -UTR selected from the group consisting of SEQ ID NOS: 52-57. In a specific embodiment, the nucleic acid molecules of the present disclosure comprise a 5'-UTR selected from SEQ ID NOS: 46-51 and a 3' -UTR selected from SEQ ID NOS: 52-57. In any of the embodiments described in this paragraph, the nucleic acid molecule may further comprise a coding region having a sequence as described in section 6.3.1, such as any of the DNA coding sequences in tables 1 to 5 or an equivalent RNA sequence thereof. In particular embodiments, the nucleic acid molecule described in this paragraph may be an in vitro transcribed RNA molecule.
6.3.4 polyadenylation (Poly-A) region
Long-chain adenosine nucleotides (poly-a regions) are typically added to messenger RNA (mRNA) molecules during natural RNA processing to increase the stability of the molecules. Immediately after transcription, the 3 '-end of the transcript is cleaved to release the 3' -hydroxyl group. Next, a poly-A polymerase adds a series of adenosine nucleotides to the RNA. This process is called polyadenylation and adds a poly-A region between 100 and 250 residues in length. Without being bound by theory, it is contemplated that the poly-a region may confer a number of advantages to the nucleic acid molecules of the present disclosure.
Thus, in some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises a polyadenylation signal. In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises one or more polyadenylation (poly-A) regions. In some embodiments, the poly-A region consists entirely of adenine nucleotides or functional analogs thereof. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 3' end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5' end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5 'end and at least one poly-A region at its 3' end.
In accordance with the present disclosure, the poly-A regions may have different lengths in different embodiments. In particular, in some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 30 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 35 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 40 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 45 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 50 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 55 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 60 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 65 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 70 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 75 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 80 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 85 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 90 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 95 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 100 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 110 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 120 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 130 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 140 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 150 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 160 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 170 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 180 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 190 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 200 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 225 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 250 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 275 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 300 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 350 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 400 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 450 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 500 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 600 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 700 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 800 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 900 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1000 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1100 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1200 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 1300 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1400 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1500 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 1600 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 1700 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1800 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 1900 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2000 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 2250 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2500 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2750 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 3000 nucleotides in length.
In some embodiments, the length of the poly-a region in a nucleic acid molecule can be selected based on the total length of the nucleic acid molecule or a portion thereof (such as the length of the coding region or the length of the open reading frame of the nucleic acid molecule, etc.). For example, in some embodiments, the poly-a region comprises about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the total length of the nucleic acid molecule comprising the poly-a region.
Without being bound by theory, it is contemplated that certain RNA binding proteins may bind to the poly-A region located at the 3' end of the mRNA molecule. These poly-A binding proteins (PABP) may regulate mRNA expression, such as interacting with translation initiation mechanisms in cells and/or protecting the 3' -poly-A tail from degradation. Thus, in some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises at least one binding site for a poly-a binding protein (PABP). In other embodiments, the nucleic acid molecule is allowed to form a conjugate or complex with the PABP prior to loading into a delivery vehicle (e.g., a lipid nanoparticle).
In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises a poly-A-G quadruplex. G quadruplets are circular arrays of four guanosine nucleotides that can form hydrogen bonds from G-rich sequences in DNA and RNA. In this embodiment, the G quadruplex is incorporated into one end of the poly-A region. The resulting polynucleotides (e.g., mRNA) can be analyzed for stability, protein yield, and other parameters, including half-life at various time points. It has been found that the poly-A-G quadruplex structure results in a protein yield corresponding to at least 75% of that observed with the 120 nucleotide poly-A region alone.
In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure may comprise a poly-a region and may be stabilized by the addition of a 3' -stabilizing region. In some embodiments, a 3' -stabilizing region useful for stabilizing nucleic acid molecules (e.g., mRNA) comprising a poly-a or poly-a-G quadruplet structure is described in international patent publication No. WO2013/103659, the contents of which are incorporated herein by reference in their entirety.
In other embodiments, the 3 '-stabilizing region that can be used in conjunction with the nucleic acid molecules of the present disclosure includes chain terminating nucleosides, such as, but not limited to, 3' -deoxyadenosine (cordycepin); 3' -deoxyuridine; 3' -deoxycytosine; 3' -deoxyguanosine; 3' -deoxythymine; 2',3' -dideoxynucleosides such as 2',3' -dideoxyadenosine, 2',3' -dideoxyuridine, 2',3' -dideoxycytosine, 2',3' -dideoxyguanosine, 2',3' -dideoxythymine; 2' -deoxynucleosides; or O-methyl nucleoside; 3' -deoxynucleosides; 2',3' -dideoxynucleosides; 3' -O-methyl nucleoside; 3' -O-ethyl nucleoside; 3' -arabinoside, as well as other alternative nucleosides known in the art and/or described herein.
6.3.5 secondary Structure
Without being bound by theory, it is contemplated that the stem-loop structure may guide RNA folding, preserve the structural stability of the nucleic acid molecule (e.g., mRNA), provide recognition sites for RNA binding proteins, and serve as substrates for enzymatic reactions. For example, the incorporation of miR sequences and/or TEE sequences will alter the shape of the stem-loop region, whereby translation can be increased and/or decreased (Kedde et al, A Pumilio-induced RNAstructure switch in p27-3'UTR controls miR-221 and miR-222accessibility.Nat Cell Biol; 10. 2010; 12 (10): 1014-20, the contents of which are incorporated herein by reference in their entirety).
Thus, in some embodiments, a nucleic acid molecule (e.g., mRNA) described herein, or a portion thereof, may be in a stem-loop structure, such as, but not limited to, a histone stem-loop. In some embodiments, the stem-loop structure is formed from a stem-loop sequence of about 25 or about 26 nucleotides in length, such as, but not limited to, the structure described in international patent publication No. WO2013/103659, the contents of which are incorporated herein by reference in their entirety. Additional examples of stem-loop sequences include those described in international patent publication No. WO2012/019780 and international patent publication No. WO201502667, the contents of each of which are incorporated herein by reference. In some embodiments, the stem-loop sequence comprises a TEE as described herein. In some embodiments, the stem-loop sequence comprises a miR sequence as described herein. In particular embodiments, the stem-loop sequence can include a miR-122 seed sequence. In a specific embodiment, the nucleic acid molecule comprises a stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 58). In other embodiments, the nucleic acid molecule comprises a stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 59).
In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises a stem-loop sequence located upstream (at the 5' end) of the coding region in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 5' -UTR of the nucleic acid molecule. In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises a stem-loop sequence located downstream (at the 3' end) of the coding region in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 3' -UTR of the nucleic acid molecule. In some cases, the nucleic acid molecule may contain more than one stem-loop sequence. In some embodiments, the nucleic acid molecule comprises at least one stem-loop sequence in the 5'-UTR and at least one stem-loop sequence in the 3' -UTR.
In some embodiments, the nucleic acid molecule comprising a stem-loop structure further comprises a stabilizing region. In some embodiments, the stabilizing region comprises at least one chain terminating nucleoside that acts to slow degradation and thereby increase the half-life of the nucleic acid molecule. Exemplary chain terminating nucleosides that can be used in conjunction with the nucleic acid molecules of the present disclosure include, but are not limited to, 3' -deoxyadenosine (cordycepin); 3' -deoxyuridine; 3' -deoxycytosine; 3' -deoxyguanosine; 3' -deoxythymine; 2',3' -dideoxynucleosides such as 2',3' -dideoxyadenosine, 2',3' -dideoxyuridine, 2',3' -dideoxycytosine, 2',3' -dideoxyguanosine, 2',3' -dideoxythymine; 2' -deoxynucleosides; or O-methyl nucleoside; 3' -deoxynucleosides; 2',3' -dideoxynucleosides; 3' -O-methyl nucleoside; 3' -O-ethyl nucleoside; 3' -arabinoside, as well as other alternative nucleosides known in the art and/or described herein. In other embodiments, the stem-loop structure may be stabilized by altering the 3' -region of the polynucleotide, which may prevent and/or inhibit the addition of oligo (U) (international patent publication No. WO2013/103659, which is incorporated herein by reference in its entirety).
In some embodiments, the nucleic acid molecules of the present disclosure comprise at least one stem-loop sequence and a poly-A region or polyadenylation signal. Non-limiting examples of polynucleotide sequences comprising at least one stem-loop sequence and a poly-a region or polyadenylation signal include the sequences described in international patent publication No. WO2013/120497, international patent publication No. WO2013/120629, international patent publication No. WO2013/120500, international patent publication No. WO2013/120627, international patent publication No. WO2013/120498, international patent publication No. WO2013/120626, international patent publication No. WO2013/120499, and international patent publication No. WO2013/120628, the contents of each of which are incorporated herein by reference in their entirety.
In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-a region or polyadenylation signal may encode a pathogen antigen or fragment thereof, such as the polynucleotide sequences described in international patent publication No. WO2013/120499 and international patent publication No. WO2013/120628, the contents of each of which are incorporated herein by reference in their entirety.
In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-a region or polyadenylation signal may encode a therapeutic protein, such as the polynucleotide sequences described in international patent publication No. WO2013/120497 and international patent publication No. WO2013/120629, the contents of each of which are incorporated herein by reference in their entirety.
In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-a region or polyadenylation signal may encode a tumor antigen or fragment thereof, such as the polynucleotide sequences described in international patent publication No. WO2013/120500 and international patent publication No. WO2013/120627, the contents of each of which are incorporated herein by reference in their entirety.
In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-a region or polyadenylation signal may encode a sensitising antigen or an autoimmune autoantigen, such as the polynucleotide sequences described in international patent publication No. WO2013/120498 and international patent publication No. WO2013/120626, the contents of each of which are incorporated herein by reference in their entirety.
6.3.6 functional nucleotide analogues
In some embodiments, the payload nucleic acid molecules described herein contain only classical nucleotides selected from a (adenosine), G (guanosine), C (cytosine), U (uridine), and T (thymidine). Without being bound by theory, it is expected that certain functional nucleotide analogs may confer useful properties to a nucleic acid molecule. In the context of the present disclosure, examples of such useful properties include, but are not limited to, increased stability of the nucleic acid molecule, reduced immunogenicity of the nucleic acid molecule in inducing an innate immune response, increased production of proteins encoded by the nucleic acid molecule, increased intracellular delivery and/or retention of the nucleic acid molecule, and/or reduced cytotoxicity of the nucleic acid molecule, among others.
Thus, in some embodiments, the payload nucleic acid molecule comprises at least one functional nucleotide analog as described herein. In some embodiments, the functional nucleotide analog contains at least one chemical modification to a nucleobase, a sugar group, and/or a phosphate group. Thus, a payload nucleic acid molecule comprising at least one functional nucleotide analogue contains at least one chemical modification directed to nucleobases, sugar groups and/or internucleoside linkages. Exemplary chemical modifications to nucleobases, glycosyls, or internucleoside linkages of nucleic acid molecules are provided herein.
As described herein, nucleotides ranging from 0% to 100% of all nucleotides in a payload nucleic acid molecule can be functional nucleotide analogs as described herein. For example, in various embodiments, from about 1% to about 20%, from about 1% to about 25%, from about 1% to about 50%, from about 1% to about 60%, from about 1% to about 70%, from about 1% to about 80%, from about 1% to about 90%, from about 1% to about 95%, from about 10% to about 20%, from about 10% to about 25%, from about 10% to about 50%, from about 10% to about 60%, from about 10% to about 70%, from about 10% to about 80%, from about 10% to about 90%, from about 10% to about 95%, from about 10% to about 100%, from about 20% to about 25%, from about 20% to about 50%, from about 20% to about 60%, from about 20% to about 70%, from about 20% to about 80%, from about 20% to about 95%, from about 20% to about 100%, from about 50% to about 70%, from about 50% to about 80%, from about 50% to about 90%, from about 50% to about 95%, from about 50% to about 100%, from about 70%, from about 50% to about 80%, from about 95% to about 95%, from about 95% to about 100%, from about 80%, from about 95% to about 100% of the nucleotide in all nucleotides in a nucleic acid molecule. In any of these embodiments, the functional nucleotide analog may be present at any position of the nucleic acid molecule, including the 5 '-terminus, the 3' -terminus, and/or one or more internal positions. In some embodiments, a single nucleic acid molecule may contain different sugar modifications, different nucleobase modifications, and/or different types of internucleoside linkages (e.g., backbone structures).
As described herein, from 0% to 100% of the nucleotides in one type of all nucleotides in a payload nucleic acid molecule (e.g., as all purine-containing nucleotides of one type, or as all pyrimidine-containing nucleotides of one type, or as all A, G, C, T or U of one type) can be functional nucleotide analogs described herein. For example, in various embodiments, from about 1% to about 20%, from about 1% to about 25%, from about 1% to about 50%, from about 1% to about 60%, from about 1% to about 70%, from about 1% to about 80%, from about 1% to about 90%, from about 1% to about 95%, from about 10% to about 20%, from about 10% to about 25%, from about 10% to about 50%, from about 10% to about 60%, from about 10% to about 70%, from about 10% to about 80%, from about 10% to about 90%, from about 10% to about 95%, from about 10% to about 100%, from about 20% to about 25%, from about 20% to about 50%, from about 20% to about 60%, from about 20% to about 70%, from about 20% to about 80%, from about 20% to about 95%, from about 20% to about 100%, from about 50% to about 70%, from about 50% to about 80%, from about 50% to about 90%, from about 50% to about 95%, from about 50% to about 100%, from about 50% to about 70%, from about 80%, from about 95% to about 100%, from about 80% to about 95%, from about 95% to about 100% of the nucleotide in one type of nucleotide in the nucleic acid molecule. In any of these embodiments, the functional nucleotide analog may be present at any position of the nucleic acid molecule, including the 5 '-terminus, the 3' -terminus, and/or one or more internal positions. In some embodiments, a single nucleic acid molecule may contain different sugar modifications, different nucleobase modifications, and/or different types of internucleoside linkages (e.g., backbone structures).
Modification of 6.3.7 nucleobases
In some embodiments, the functional nucleotide analog contains a non-classical nucleobase. In some embodiments, classical nucleobases (e.g., adenine, guanine, uracil, thymine, and cytosine) in a nucleotide may be modified or substituted to provide one or more functional nucleotide analogs. Exemplary modifications of nucleobases include, but are not limited to, one or more substitutions or modifications including, but not limited to, alkyl, aryl, halo, oxo, hydroxy, alkoxy, and/or thio substitutions; one or more fused or open rings; oxidation and/or reduction.
In some embodiments, the non-classical nucleobase is a modified uracil. Exemplary nucleobases and nucleosides with modified uracils include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil(s) 2 U), 4-thiouracil(s) 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho) 5 U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil), 3-methyluracil (m) 3 U), 5-methoxy-uracil (mo) 5 U), uracil 5-oxyacetic acid (cmo) 5 U), uracil 5-oxyacetic acid methyl ester (mcmo) 5 U), 5-carboxymethyl-uracil (cm) 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm) 5 U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm) 5 U), 5-methoxycarbonylmethyl-uracil (mcm) 5 U), 5-methoxycarbonylmethyl-2-thio-uracil (mcm) 5 s 2 U), 5-aminomethyl-2-thio-uracil (nm) 5 s 2 U), 5-methylaminomethyl-uracil (mn) 5 U), 5-methylaminomethyl-2-thio-uracil (mn) 5 s 2 U), 5-methylaminomethyl-2-seleno-uracil (mn) 5 se 2 U), 5-carbamoylmethyl-uracil (ncm) 5 U), 5-carboxymethylaminomethyl-uracil (cmnm) 5 U), 5-carboxymethylaminomethyl-2-thio-uracil (cmnm) 5 s 2 U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurine methyl-uracil (τm) 5 U), 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thio-uracil (τm) 5 5s 2 U), 1-taurine methyl-4-thio-pseudouridine, 5-methyl-uracil (m) 5 U, i.e. having the nucleobase deoxythymine), 1-methyl-pseudouridine (m 1 Psi), 1-ethyl-pseudouridine (Et) 1 Psi), 5-methyl-2-thiouracil (m) 5 s 2 U), 1-methyl-4-thio-pseudouridine (m) 1 s 4 Psi), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m) 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydro uracil (D), dihydro-pseudouridine, 5, 6-dihydro uracil, 5-methyl-dihydro-uracil (m) 5 D) 2-thio-dihydro-uracil, 2-thio-dihydro-pseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3- (3-amino-3-carboxypropyl) uracil (acp) 3 U), 1-methyl-3- (3-amino-3-carboxypropyl) pseudouridine (acp) 3 Psi), 5- (isopentenyl aminomethyl) uracil (m) 5 U), 5- (isopentenylaminomethyl) -2-thio-uracil (m) 5 s 2 U), 5,2' -O-dimethyl-uridine (m) 5 Um), 2-thio-2' -O-methyl-uridine(s) 2 Um), 5-methoxycarbonylmethyl-2' -O-methyl-uridine (mcm) 5 Um), 5-carbamoylmethyl-2' -O-methyl-uridine (ncm) 5 Um), 5-carboxymethylaminomethyl-2' -O-methyl-uridine (cmnm) 5 Um), 3,2' -O-dimethyl-uridine (m) 3 Um) and 5- (isopentenylaminomethyl) -2' -O-methyl-uridine (mm) 5 Um), 1-thio-uremic acid and its usePyridine, deoxythymidine, 5- (2-methoxycarbonylvinyl) -uracil, 5- (carbamoyl hydroxymethyl) -uracil, 5-carbamoyl methyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil and 5- [3- (1-E-propenyl amino ] ]Uracil.
In some embodiments, the non-classical nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosines include 5-azacytosine, 6-azacytosine, pseudoisocytosine, 3-methylcytosine (m 3C), N4-acetylcytosine (ac 4C), 5-formylcytosine (f 5C), N4-methyl-cytosine (m 4C), 5-methyl-cytosine (m 5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm 5C), 1-methyl-pseudoisocytosine, pyrrolo-cytosine, pyrrolo-pseudoisocytosine, 2-thiocytosine (s 2C) 2-thio-5-methylcytosine, 4-thio-pseudoisocytosine, 4-thio-1-methyl-1-deaza-pseudoisocytosine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudoisocytosine, 4-methoxy-1-methyl-pseudoisocytosine, risperidine (k 2C), 5,2' -O-dimethyl-cytidine (m 5 Cm), N4-acetyl-2 ' -O-methyl-cytidine (ac 4 Cm), N4,2' -O-dimethyl-cytidine (m 4 Cm), 5-formyl-2 ' -O-methyl-cytidine (fSCm), N4,2' -O-trimethyl-cytidine (m 42 Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5- (3-azidopropyl) -cytosine, and 5- (2-azidoethyl) -cytosine.
In some embodiments, the non-canonical nucleobase is a modified adenine. Exemplary nucleobases and nucleosides with substituted adenine include 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1-methyl-adenine (m 1A), 2-methyl-adenine (m 2A), N6-methyl-adenine (m 6A), 2-methylthio-N6-methyl-adenine (ms 2m 6A), N6-isopentenyl-adenine (i 6A), 2-methylthio-N6-isopentenyl-adenine (m 6A), cis-hydroxy-5-adenine (m 6A), N6-threonyl carbamoyl-adenine (t 6A), N6-methyl-N6-threonyl carbamoyl-adenine (m 6t 6A), 2-methylsulfanyl-N6-threonyl carbamoyl-adenine (ms 2g 6A), N6-dimethyl-adenine (m 62A), N6-hydroxy-N-valyl carbamoyl-adenine (hn 6A), 2-methylsulfanyl-N6-hydroxy-N-valyl carbamoyl-adenine (ms 2hn 6A), N6-acetyl-adenine (ac 6A), 7-methyl-adenine, 2-methylsulfanyl-adenine, 2-methoxy-adenine, N6,2' -O-dimethyl-adenine (m 6 Am), N6,2' -O-trimethyl-adenine (m 62A), 1,2' -O-dimethyl-adenine (m 1 Am), 2-amino-N6-methyl-adenine, N6-acetyl-adenine (ac 6A), 7-methyl-adenine, 2-methylsulfanyl-adenine, 2-methoxy-adenine, N6,2' -O-dimethyl-adenine (m 6 Am), 1,2' -O-dimethyl-adenine (m 1 Am), 2-amino-N6-methyl-adenine, N8-hydroxy-adenine, and nona-methyl adenine.
In some embodiments, the non-canonical nucleobase is a modified guanine. Exemplary nucleobases and nucleosides with modified guanines include inosine (I), 1-methyl-inosine (m 1I), bosyl (wyosine) (imG), methyl bosyl (mimG), 4-demethyl-bosyl (imG-14), isobornyl (imG), huai Dinggan (wybutosine) (yW), peroxy Huai Dinggan (o 2 yW), hydroxy Huai Dinggan (OHyW), hydroxy Huai Dinggan (OHyW) of undermodified (unrermodified), 7-deaza-guanosine, pigtail (queuosine) (Q), epoxy pigtail (oQ), galactosyl-pigtail (galQ), mannosyl-pigtail (manQ), 7-cyano-7-deaza-guanosine (preQO), 7-aminomethyl-7-deaza-guanosine (preQ 1), gulin (c) and guanosine) (G+), 7-deaza-guanosine-8, 6-deaza-guanosine (6-thioguanosine), 7-methyl-6-thioguanosine (G), 6-deaza-guanosine (6-thioguanosine) and methyl-6-thioguanosine (6-thioguanosine) are described herein N2-methyl-guanine (m 2G), N2-dimethyl-guanine (m 22G), N2, 7-dimethyl-guanine (m 2, 7G), N2, 7-dimethyl-guanine (m 2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thioguanine, N2-dimethyl-6-thioguanine, N2-methyl-2 ' -O-methyl-guanosine (m 2 Gm), N2-dimethyl-2 ' -O-methyl-guanosine (m 22 Gm), 1-methyl-2 ' -O-methyl-guanosine (m 1 Gm), N2, 7-dimethyl-2 ' -O-methyl-guanosine (m 2,7 Gm), 2' -O-methyl-inosine (Im), 1,2' -O-dimethyl-2 ' -O-methyl-guanosine (m) and 1-thioguanosine (Im).
In some embodiments, the non-classical nucleobases of the functional nucleotide analogs can independently be purines, pyrimidines, purine analogs, or pyrimidine analogs. For example, in some embodiments, the non-canonical nucleobase can be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, non-classical nucleobases may also include naturally occurring and synthetic derivatives of, for example, bases, including pyrazolo [3,4-d ] pyrimidines; 5-methylcytosine (5-me-C); 5-hydroxymethylcytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine and 2-thiocytosine; 5-propynyluracil and cytosine; 6-azo uracil, cytosine and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, and other 8-substituted adenine and guanine; 5-halo (especially 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azaadenine; deazaguanine, 7-deazaguanine, 3-deazaguanine; deazaadenine, 7-deazaadenine, 3-deazaadenine; pyrazolo [3,4-d ] pyrimidines; imidazo [1,5-a ]1,3, 5-triazinone; 9-deazapurine; imidazo [4,5-d ] pyrazines; thiazolo [4,5-d ] pyrimidine; pyrazin-2-one; 1,2, 4-triazine; pyridazine; or 1,3, 5-triazine.
6.3.8 modification of sugar
In some embodiments, the functional nucleotide analog contains a non-canonical glycosyl. In various embodiments, the non-classical sugar group may be a 5-carbon or 6-carbon sugar (such as pentose, ribose, arabinose, xylose, glucose, galactose, or deoxy derivatives thereof) having one or more substitutions such as halo, hydroxy, thiol, alkyl, alkoxy, alkenyloxy, alkynyloxy, cycloalkyl, aminoalkoxy, alkoxyalkoxy, hydroxyalkoxy, amino, azido, aryl, aminoalkyl, aminoalkenyl, aminoalkyl, and the like.
In general, RNA molecules contain ribosyl groups that are oxygen-containing 5-membered rings. Exemplary, non-limiting alternative nucleotides include substitution of oxygen in ribose (e.g., substitution with S, se or an alkylene group such as methylene or ethylene); adding a double bond (e.g., replacing ribose with cyclopentenyl or cyclohexenyl); ring shrinkage of ribose (e.g., 4 membered rings forming cyclobutane or oxetane); ring extension of ribose (e.g., forming a 6 or 7 membered ring with additional carbon or heteroatoms, such as for anhydrohexitol, altritol (altritol), mannitol, cyclohexyl, cyclohexenyl, and morpholino (which also has a phosphoramidate backbone)); polycyclic forms (e.g., tricyclic and "unlocked" forms, such as diol nucleic acids (GNAs) (e.g., R-GNAs or S-GNAs, wherein ribose is replaced by a diol unit attached to a phosphodiester linkage), threose nucleic acids (TNA, wherein ribose is replaced by an α -L-threofuranosyl- (3 '→2') linkage), and peptide nucleic acids (PNA, wherein 2-amino-ethyl-glycine linkages replace ribose and phosphodiester backbones)).
In some embodiments, the glycosyl group contains one or more carbons having a stereochemical configuration opposite to the corresponding carbon in ribose. Thus, a nucleic acid molecule may comprise a nucleotide containing, for example, arabinose or L-ribose as sugar. In some embodiments, the nucleic acid molecule comprises at least one nucleoside wherein the sugar is L-ribose, 2 '-O-methyl ribose, 2' -fluoro ribose, arabinose, hexitol, LNA, or PNA.
6.3.9 modification of internucleoside linkage
In some embodiments, the payload nucleic acid molecules of the present disclosure may contain one or more modified internucleoside linkages (e.g., phosphate backbones). The backbone phosphate group may be altered by replacing one or more oxygen atoms with different substituents.
In some embodiments, the functional nucleotide analogs can include substitution of an unchanged phosphate moiety with another internucleoside linkage described herein. Examples of alternative phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenos, boranophosphates (borophosphosphates/boranophosphate ester), hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates and phosphotriesters. Both non-linking oxygens of the dithiophosphate are replaced by sulfur. The phosphate linker can also be altered by replacing the linking oxygen with nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate) and carbon (bridged methylphosphonate).
Alternative nucleosides and nucleotides can include one or more non-bridging oxyborane moieties (BH 3 ) Sulfur (thio), methyl, ethyl, and/or methoxy substitution. As a non-limiting example, two non-bridging oxygens at the same position (e.g., the alpha, beta, or gamma (gamma) position) may be replaced with a thio (thio) and methoxy group. Replacement of one or more oxygen atoms at the phosphate moiety (e.g., alpha-phosphorothioate) position may impart RNA and DNA stability (such as stability against exonucleases and endonucleases) through non-natural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and therefore have a longer half-life in the cellular environment.
Other internucleoside linkages, including internucleoside linkages that do not contain a phosphorus atom, that can be used in accordance with the present disclosure are described herein.
Additional examples of nucleic acid molecules (e.g., mRNA), related compositions, formulations, and/or methods that can be used in conjunction with the present disclosure also include those of WO2002/098443, WO2003/051401, WO2008/052770, WO2009127230, WO2006122828, WO2008/083949, WO2010088927, WO2010/037539, WO2004/004743, WO2005/016376, WO 2006/024318, WO2007/095976, WO2008/014979, WO2008/077592, WO2009/030481, WO2009/095226, WO2011069586, WO 3835, WO2011/144358, WO2012019780, WO2012013326, WO2012089338, WO2012113513, WO2012116811, WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO2013143699, WO2013143700, WO 2013/626, WO2013120627, WO2013120628, WO 024/669, WO 66668, WO 024/024, WO2015/024, WO2015,2015, WO 2015/2013120628, WO 2015.
Therapeutic nucleic acid molecules as described herein can be isolated or synthesized by using methods known in the art. In some embodiments, the DNA or RNA molecules used in connection with the present disclosure are chemically synthesized. In other embodiments, the DNA or RNA molecules used in connection with the present disclosure are isolated from a natural source.
In some embodiments, mRNA molecules used in connection with the present disclosure are biosynthesized using host cells. In certain embodiments, the mRNA is produced by transcription of the corresponding DNA sequence using a host cell. In some embodiments, the DNA sequence encoding the mRNA sequence is incorporated into an expression vector using methods known in the art, and then the vector is introduced into a host cell (e.g., e.coli). The host cell is then cultured under suitable conditions to produce mRNA transcripts. Other methods of generating mRNA molecules from coding DNA are known in the art. For example, in some embodiments, mRNA transcripts may be produced using a cell-free (in vitro) transcription system comprising enzymes of the transcription machinery of the host cell. An exemplary cell-free transcription reaction system is described in example 1 of the present disclosure.
6.4 nanoparticle compositions
In one aspect, the nucleic acid molecules described herein are formulated for in vitro and in vivo delivery. In particular, in some embodiments, the nucleic acid molecule is formulated as a lipid-containing composition. In some embodiments, the lipid-containing composition forms a lipid nanoparticle that encapsulates the nucleic acid molecule within a lipid shell. In some embodiments, the lipid shell protects the nucleic acid molecule from degradation. In some embodiments, the lipid nanoparticle also facilitates transport of the encapsulated nucleic acid molecule into an intracellular compartment and/or mechanism to perform a desired therapeutic or prophylactic function. In certain embodiments, the nucleic acid, when present in the lipid nanoparticle, resists degradation by nucleases in aqueous solution. Lipid nanoparticles comprising nucleic acids and methods of making the same are known in the art, such as those disclosed in, for example, U.S. patent publication No. 2004/0142025, U.S. patent publication No. 2007/0042031, PCT publication No. WO 2017/004143, PCT publication No. WO 2015/199952, PCT publication No. WO 2013/016058, and PCT publication No. WO 2013/086373, the complete disclosure of each of which is incorporated herein by reference in its entirety for all purposes.
In some embodiments, nanoparticle compositions provided herein have a maximum dimension of 1 μm or less (e.g., 1 μm, 900nm, 800nm, 700nm, 600nm, 500nm, 400nm, 300nm, 200nm, 175nm, 150nm, 125nm, 100nm, 75nm, 50nm or less), such as when measured by Dynamic Light Scattering (DLS), transmission electron microscopy, scanning electron microscopy, or another method. In one embodiment, the lipid nanoparticle provided herein has at least one dimension in the range of about 40nm to about 200 nm. In one embodiment, the at least one dimension is in the range of about 40nm to about 100 nm.
Nanoparticle compositions that can be used in connection with the present disclosure include, for example, lipid Nanoparticles (LNP), nanolipoprotein particles, liposomes, lipid vesicles, and lipid complexes (lipoplex). In some embodiments, the nanoparticle composition is a vesicle comprising one or more lipid bilayers. In some embodiments, the nanoparticle composition comprises two or more concentric bilayers separated by an aqueous compartment. The lipid bilayers may be functionalized and/or crosslinked to each other. The lipid bilayer may include one or more ligands, proteins, or channels.
In some embodiments, the nanoparticle composition comprises a lipid component comprising at least one lipid, such as a compound according to one of formulas (1) to (46) (and sub-formulae thereof) as described herein. For example, in some embodiments, the nanoparticle composition can comprise a lipid component comprising one of the compounds provided herein. The nanoparticle composition may also include one or more other lipid or non-lipid components as described below.
6.4.1 cationic lipid
In some embodiments, the lipid-containing composition comprises at least one lipid compound according to formula (1):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
G 1 and G 2 Each independently is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene, wherein one or more of the alkylene or alkenylene groups are-CH 2 -optionally via-O-substitution;
L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 Or R is 2 ；
R 1 And R is 2 Each independently is C 6 -C 32 Alkyl or C 6 -C 32 Alkenyl groups;
R a 、R b 、R d and R is e Each independently is H, C 1 -C 24 Alkyl or C 2 -C 24 Alkenyl groups;
R c and R is f Each independently is C 1 -C 32 Alkyl or C 2 -C 32 Alkenyl groups;
G 3 Is C 2 -C 24 Alkylene, C 2 -C 24 Alkenylene, C 3 -C 8 Cycloalkylene or C 3 -C 8 A cycloalkenyl group;
R 3 is-N (R) 4 )R 5 ；
R 4 Is C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, 4-to 8-membered heterocyclyl or C 6 -C 10 An aryl group; or R is 4 、G 3 Or G 3 Together with the nitrogen to which they are attached, form a cyclic moiety;
R 5 is C 1 -C 12 Alkyl or C 3 -C 8 Cycloalkyl; or R is 4 、R 5 Forms together with the nitrogen to which they are attached a cyclic moiety;
x is 0, 1 or 2; and is also provided with
Wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
In one embodiment, provided herein are compounds of formula (1):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
G 1 and G 2 Each independently is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 Or R is 2 ；
R 1 And R is 2 Each independently is C 6 -C 24 Alkyl or C 6 -C 24 Alkenyl groups;
R a 、R b 、R d and R is e Each independently is H, C 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
R c and R is f Each independently is C 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
G 3 is C 2 -C 24 Alkylene, C 2 -C 24 Alkenylene, C 3 -C 8 Cycloalkylene or C 3 -C 8 A cycloalkenyl group;
R 3 is-N (R) 4 )R 5 ；
R 4 Is C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl or C 6 -C 10 An aryl group;
R 5 is C 1 -C 12 An alkyl group;
x is 0, 1 or 2; and is also provided with
Wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, and heteroarylene is independently optionally substituted.
In one embodiment, provided herein are compounds of formula (2):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
is a single bond or a double bond;
G 1 and G 2 Each independently is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene, wherein one or more of the alkylene or alkenylene groups are-CH 2 -optionally via-O-substitution;
L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 Or R is 2 ；
R 1 And R is 2 Each independently is C 6 -C 32 Alkyl or C 6 -C 32 Alkenyl groups;
R a 、R b 、R d and R is e Each independently is H, C 1 -C 24 Alkyl or C 2 -C 24 Alkenyl groups;
R c and R is f Each independently ofThe standing site is C 1 -C 32 Alkyl or C 2 -C 32 Alkenyl groups;
G 4 is a bond, C 1 -C 23 Alkylene, C 2 -C 23 Alkenylene, C 3 -C 8 Cycloalkylene or C 3 -C 8 A cycloalkenyl group;
R 3 is-N (R) 4 )R 5 ；
R 4 Is C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, 4-to 8-membered heterocyclyl or C 6 -C 10 An aryl group; or R is 4 、G 3 Or G 3 Together with the nitrogen to which they are attached, form a cyclic moiety;
R 5 Is C 1 -C 12 Alkyl or C 3 -C 8 Cycloalkyl; or R is 4 、R 5 Forms together with the nitrogen to which they are attached a cyclic moiety;
x is 0, 1 or 2; and is also provided with
Wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
In one embodiment, provided herein are compounds of formula (2):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
is a single bond or a double bond;
G 1 and G 2 Each independently is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 Or R is 2 ；
R 1 And R is 2 Each independently is C 6 -C 24 Alkyl or C 6 -C 24 Alkenyl groups;
R a 、R b 、R d and R is e Each independently is H, C 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
R c and R is f Each independently is C 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
G 4 is a bond, C 1 -C 23 Alkylene, C 2 -C 23 Alkenylene group,C 3 -C 8 Cycloalkylene or C 3 -C 8 A cycloalkenyl group;
R 3 is-N (R) 4 )R 5 ；
R 4 Is C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl or C 6 -C 10 An aryl group;
R 5 is C 1 -C 12 An alkyl group;
x is 0, 1 or 2; and is also provided with
Wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, and heteroarylene is independently optionally substituted.
In one embodiment of the present invention, in one embodiment,is a single bond. In one embodiment, the ∈ ->Is a double bond. In one embodiment, the ∈ ->Is a double bond, and the compound has the (Z) configuration. In one embodiment, the ∈ ->Is a double bond, and the compound has the (E) configuration.
In one embodiment, provided herein are compounds of formula (3):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, provided herein are compounds of formula (4):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, G 1 Is a key. In one embodiment, G 2 Is a key. In one embodiment, G 1 And G 2 Both are keys.
In one embodiment, G 1 And G 2 Each independently is C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene radicals. In one embodiment, G 1 And G 2 Each independently is C 2 -C 12 An alkylene group. In one embodiment, G 1 And G 2 Each independently is C 2 -C 12 Alkenylene radicals. In one embodiment, G 1 And G 2 Each independently is C 3 -C 7 An alkylene group. In one embodiment, G 1 And G 2 Each independently is C 5 An alkylene group.
In one embodiment, G 1 Unsubstituted. In one embodiment, G 1 Substituted. In one embodiment, G 1 Substituted with-OH. In one embodiment, G 1 Warp (second) L 1 Substitution (i.e. G 1 Is connected to two L 1 ). In one embodiment, G 1 warp-O- (C) 6 -C 24 Alkyl) substitution. In one embodiment, G 1 warp-O- (C) 6 -C 24 Alkenyl) substitution. In one embodiment, G 1 trans-C (=o) - (C 6 -C 24 Alkyl) substitution. In one embodiment, G 1 trans-C (=o) - (C 6 -C 24 Alkenyl) substitution.
In one embodiment, G 2 Unsubstituted. In one embodiment, G 2 Substituted. In one embodiment, G 2 Substituted with-OH. In one embodiment, G 2 Warp (second) L 2 Substitution (i.e，G 2 Is connected to two L 2 ). In one embodiment, G 2 warp-O- (C) 6 -C 24 Alkyl) substitution. In one embodiment, G 2 warp-O- (C) 6 -C 24 Alkenyl) substitution. In one embodiment, G 2 trans-C (=o) - (C 6 -C 24 Alkyl) substitution. In one embodiment, G 2 trans-C (=o) - (C 6 -C 24 Alkenyl) substitution.
In one embodiment, G 1 And/or G 2 One or more of alkylene or alkenylene groups-CH 2 -optionally via-O-substitution. In one embodiment, G 1 And G 2 Each independently is C 5 -C 9 An alkylene group, wherein one or more of the alkylene groups are-CH 2 -optionally via-O-substitution. In one embodiment, G 1 And G 2 Each independently is C 5 -C 7 An alkylene group, wherein one or more of the alkylene groups are-CH 2 -optionally via-O-substitution. In one embodiment, G 1 And G 2 Both are-CH 2 -CH 2 -O-CH 2 -CH 2 -. In one embodiment, G 1 And G 2 Both are-CH 2 -CH 2 -O-CH 2 -CH 2 -O-CH 2 -。
In one embodiment, the compound is a compound of formula (1-A):
wherein y and z are each independently integers from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (2-A):
wherein y and z are each independently integers from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (3-A):
wherein y and z are each independently integers from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (4-A):
wherein y and z are each independently integers from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, y and z are each independently integers from 2 to 10. In one embodiment, y and z are each independently integers from 2 to 6. In one embodiment, y and z are each independently integers from 4 to 10.
In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8 and 9. In one embodiment, y is 5 and z is 5.
In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 OR-P (=O) (OR b )(OR c ). In one embodiment, L 1 Is- (C) 6 -C 10 Arylene) -R 1 . In one embodiment, L 1 Is- (6-to 10-membered heteroarylene) -R 1 . In one embodiment, L 1 Is R 1 。
In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 or-C (=O) NR b R c . In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-NR a C(＝O)R 1 or-C (=O) NR b R c . In one embodiment, L 1 is-OC (=O) R 1 . In one embodiment, L 1 is-C (=O) OR 1 . In one embodiment, L 1 is-NR a C(＝O)R 1 . In one embodiment, L 1 is-C (=O) NR b R c . In one embodiment, L 1 is-NR a C(＝O)NR b R c . In one embodiment, L 1 is-OC (=O) NR b R c . In one embodiment, L 1 is-NR a C(＝O)OR 1 。
In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 OR-P (=O) (OR e )(OR f ). In one implementationIn the scheme, L 2 Is- (C) 6 -C 10 Arylene) -R 2 . In one embodiment, L 2 Is- (6-to 10-membered heteroarylene) -R 2 . In one embodiment, L 2 Is R 2 。
In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 or-C (=O) NR e R f . In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-NR d C(＝O)R 2 or-C (=O) NR e R f . In one embodiment, L 2 is-OC (=O) R 2 . In one embodiment, L 2 is-C (=O) OR 2 . In one embodiment, L 2 is-NR d C(＝O)R 2 . In one embodiment, L 2 is-C (=O) NR e R f . In one embodiment, L 2 is-NR d C(＝O)NR e R f . In one embodiment, L 2 is-OC (=O) NR e R f . In one embodiment, L 2 is-NR d C(＝O)OR 2 。
In one embodiment, L 1 is-OC (=O) R 1 、-NR a C(＝O)R 1 、-C(＝O)OR 1 or-C (=O) NR b R c And L is 2 is-OC (=O) R 2 、-NR d C(＝O)R 2 、-C(＝O)OR 2 or-C (=O) NR e R f . In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 or-C (=O) NR b R c And L is 2 is-OC (=O) R 2 、-C(＝O)OR 2 or-C (=O) NR e R f . In one embodiment, L 1 is-OC (=O) R 1 And L is 2 is-OC (=O) R 2 . In one embodiment, L 1 is-OC (=O) R 1 And L is 2 is-NR d C(＝O)R 2 . At the position ofIn one embodiment, L 1 is-NR a C(＝O)R 1 And L is 2 is-NR d C(＝O)R 2 . In one embodiment, L 1 is-C (=O) OR 1 And L is 2 is-C (=O) OR 2 . In one embodiment, L 1 is-C (=O) OR 1 And L is 2 is-C (=O) NR e R f . In one embodiment, L 1 is-C (=O) NR b R c And L is 2 is-C (=O) NR e R f 。
In one embodiment, L 1 is-NR a C(＝O)NR b R c And L is 2 is-NR d C(＝O)NR e R f . In one embodiment, L 1 is-OC (=O) NR b R c And L is 2 is-OC (=O) NR e R f . In one embodiment, L 1 is-NR a C(＝O)OR 1 And L is 2 is-NR d C(＝O)OR 2 。
In one embodiment, the compound is a compound of formula (I-B), (I-B'), (I-B "), (I-C), (I-D), or (I-E):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (2-B), (2-B'), (2-B "), (2-C), (2-D) or (2-E):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (3-B), (3-B'), (3-B "), (3-C), (3-D) or (3-E):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (4-B), (4-B'), (4-B "), (4-C), (4-D) or (4-E):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (1-F), (1-F'), (1-F "), (1-G), (1-H), or (1-I):
wherein y and z are each independently integers from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (2-F), (2-F'), (2-F "), (2-G), (2-H), or (2-I):
wherein y and z are each independently integers from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (3-F), (3-F'), (3-F "), (3-G), (3-H), or (3-I):
wherein y and z are each independently integers from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (4-F), (4-F'), (4-F "), (4-G), (4-H), or (4-I):
/>
wherein y and z are each independently integers from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, y and z are each independently integers from 2 to 10. In one embodiment, y and z are each independently integers from 2 to 6. In one embodiment, y and z are each independently integers from 4 to 10.
In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8 and 9. In one embodiment, y is 5 and z is 5.
In one embodiment, G 3 Is C 2 -C 24 An alkylene group. In one embodiment, G 3 Is C 2 -C 12 An alkylene group. In one embodiment, G 3 Is C 2 -C 8 An alkylene group. In one embodiment, G 3 Is C 2 -C 6 An alkylene group. In one embodiment, G 3 Is C 2 -C 4 An alkylene group. In one embodiment, G 3 Is C 2 An alkylene group. In one embodiment, G 3 Is C 4 An alkylene group.
In one embodiment, G 3 Substituted with one or more oxo groups. In one embodiment, G 3 Is- (C) 1 -C 23 Alkylene) -C (=o) -. In one embodiment, G 3 Is- (C) 1 -C 11 Alkylene) -C (=o) -. In one embodiment, G 3 Is- (C) 1 -C 7 Alkylene) -C (=o) -. In one embodiment, G 3 Is- (C) 1 -C 5 Alkylene) -C (=o) -. In one embodiment, G 3 Is- (C) 1 -C 3 Alkylene) -C (=o) -. In one embodiment, G 3 is-CH 2 -C (=o) -. In one embodiment, G 3 is-CH 2 -CH 2 -CH 2 -C (=o) -. In one embodiment, -C (=o) -is attached to the nitrogen atom and alkylene is attached to R 3 。
In one embodiment, the compound is a compound of formula (1-J), (1-J'), (1-J "), (1-K), (1-L) or (1-M):
wherein y and z are each independently integers from 2 to 12, and
s is an integer of 2 to 24,
Or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, y and z are each independently integers from 2 to 10. In one embodiment, y and z are each independently integers from 2 to 6. In one embodiment, y and z are each independently integers from 4 to 10.
In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8 and 9. In one embodiment, y is 5 and z is 5.
In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 4.
In one embodiment, y is 5, z is 5, and s is 2.
In one embodiment, y is 5, z is 5, and s is 4.
In one embodiment, G 3 Is C 2 -C 24 Alkenylene radicals. In one embodiment, G 3 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 3 Is C 2 -C 8 Alkenylene radicals. In one embodiment, G 3 Is C 2 -C 6 Alkenylene radicals. In one embodiment, G 3 Is C 2 -C 4 Alkenylene radicals.
In one embodiment, G 3 Is C 3 -C 8 Cycloalkylene radicals. In one embodiment, G 3 Is C 5 -C 6 Cycloalkylene radicals.
In one embodiment, G 3 Is C 3 -C 8 A cycloalkenylene group. In one embodiment, G 3 Is C 5 -C 6 A cycloalkenylene group.
In one embodiment, G 4 Is a key.
In one embodiment, G 4 Is C 1 -C 23 An alkylene group. In one embodiment, G 4 Is C 1 -C 11 An alkylene group. In one embodiment, G 4 Is C 1 -C 7 An alkylene group. In one embodiment, G 4 Is C 1 -C 5 An alkylene group. In one embodiment, G 4 Is C 1 -C 3 An alkylene group. In one embodiment, G 4 Is C 1 An alkylene group. In one embodiment, G 4 Is C 2 An alkylene group. In one embodiment, G 4 Is C 3 An alkylene group. In one embodiment, G 4 Is C 4 An alkylene group.
In one embodiment, the compound is a compound of formula (2-J), (2-J'), (2-J "), (2-K), (2-L) or (2-M):
wherein y and z are each independently integers from 2 to 12, and
u is an integer of 0 to 23,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (3-J), (3-J'), (3-J "), (3-K), (3-L) or (3-M):
wherein y and z are each independently integers from 2 to 12, and
u is an integer of 0 to 23,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (4-J), (4-J'), (4-J "), (4-K), (4-L) or (4-M):
/>
wherein y and z are each independently integers from 2 to 12, and
u is an integer of 0 to 23,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, y and z are each independently integers from 2 to 10. In one embodiment, y and z are each independently integers from 2 to 6. In one embodiment, y and z are each independently integers from 4 to 10.
In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8 and 9. In one embodiment, y is 5 and z is 5.
In one embodiment, u is an integer from 0 to 12. In one embodiment, u is an integer from 0 to 8. In one embodiment, u is an integer from 0 to 6. In one embodiment, u is an integer from 0 to 4. In one embodiment, u is 0. In one embodiment, u is 1. In one embodiment, u is 2. In one embodiment, u is 3. In one embodiment, u is 4.
In one embodiment, y is 5, z is 5, and u is 0.
In one embodiment, y is 5, z is 5, and u is 2.
In one embodiment, G 4 Is C 2 -C 23 Alkenylene radicals. In one embodiment, G 4 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 4 Is C 2 -C 8 Alkenylene radicals. In one embodiment, G 4 Is C 2 -C 6 Alkenylene radicals. In one embodiment, G 4 Is C 2 -C 4 Alkenylene radicals.
In one embodiment, G 4 Is C 3 -C 8 Cycloalkylene radicals. In one embodiment, G 4 Is C 5 -C 6 Cycloalkylene radicals.
In one embodiment, G 4 Is C 3 -C 8 A cycloalkenylene group. In one embodiment, G 4 Is C 5 -C 6 A cycloalkenylene group.
In one embodiment, R 5 Is C 1 -C 12 An alkyl group. In one embodiment, R 5 Is C 1 -C 10 An alkyl group. In one embodiment, R 5 Is C 1 -C 8 An alkyl group. In one embodiment, R 5 Is C 1 -C 6 An alkyl group. In one embodiment, R 5 Is C 1 -C 4 An alkyl group. In one embodiment, R 5 Is C 1 -C 2 An alkyl group. In one embodiment, R 5 Is methyl. In one embodiment, R 5 Is ethyl. In one embodiment, R 5 Is propyl. In one embodiment, R 5 Is n-butyl. In one embodiment, R 5 Is n-hexyl. In one embodiment, R 5 Is n-octyl. In one embodiment, R 5 Is n-nonyl.
In one embodiment, R 5 Is C 3 -C 8 Cycloalkyl groups. In one embodiment, R 5 Is cyclopropyl. In one embodiment, R 5 Is cyclobutyl. In one embodiment, R 5 Is cyclopentyl. In one embodiment, R 5 Is cyclohexyl. In one embodiment, R 5 Is cycloheptyl. In one embodiment, R 5 Is cyclooctyl.
In one embodiment, R 4 、R 5 Together with the nitrogen to which they are attached form a cyclic moiety.
In one embodiment, the cyclic moiety (consisting of R 4 And R is 5 Together with the nitrogen to which they are attached) is a heterocyclic group. In one embodiment, the cyclic moiety is a heterocycloalkyl group. In one embodiment, the cyclic moiety is a 4 to 8 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 4 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 5-membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 6 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 7-membered heterocycloalkyl. In one embodiment, the cyclic moiety is an 8-membered heterocycloalkyl.
In one embodiment, the cyclic moiety (consisting of R 4 And R is 5 Formed together with the nitrogen to which they are attached) is azetidin-1-yl. In one embodiment, the cyclic moiety is pyrrolidin-1-yl. In one embodiment, the cyclic moiety is piperidin-1-yl. In one embodiment, the cyclic moiety is azepan-1-yl. In one embodiment, the cyclic moiety is azacyclooctan-1-yl. In one embodiment, the cyclic moiety is morpholinyl. In one embodiment, the cyclic moiety is piperazin-1-yl. The point of attachment in these groups is to G 3 。
As described herein and unless otherwise indicated, R 5 The substitution pattern of (C) is also applicable to R 4 And R is 5 A cyclic moiety formed with the nitrogen to which they are attached.
In one embodiment, R 5 Unsubstituted.
In one embodiment, R 5 Substituted with one or more substituents selected from the group consisting of: oxo, -OR g 、-NR g C(＝O)R h 、-C(＝O)NR g R h 、-C(＝O)R h 、-OC(＝O)R h 、-C(＝O)OR h and-O-R i -OH, wherein:
R g at each occurrence independently is H or C 1 -C 6 An alkyl group;
R h independently at each occurrence C 1 -C 6 An alkyl group; and is also provided with
R i Independently at each occurrence C 1 -C 6 An alkylene group.
In one embodiment, R 5 Substituted with one or more hydroxy groups. In one embodiment, R 5 Substituted with a hydroxy group.
In one embodiment, R 5 Substituted with one or more hydroxy groups and one or more oxo groups. In one embodiment, R 5 Substituted with one hydroxy and one oxo group. In one embodiment, R 5 is-CH 2 CH 2 OH。
In one embodiment, R 5 Is- (CH) 2 ) p Q、-(CH 2 ) p CHQR, -CHQR or-CQ (R) 2 Wherein Q is C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-to 8-membered heterocyclyl, C 6 -C 10 Aryl, 5-to 10-membered heteroaryl, -OR, -O (CH) 2 ) p N(R) 2 、-C(O)OR、-OC(O)R、-CX 3 、-CX 2 H、-CXH 2 、-CN、-N(R) 2 、-C(O)N(R) 2 、-N(R)C(O)R、-N(R)S(O) 2 R、-N(R)C(O)N(R) 2 、-N(R)C(S)N(R) 2 、-N(R)R 22 、-O(CH 2 ) p OR、-N(R)C(＝NR 23 )N(R) 2 、-N(R)C(＝CHR 23 )N(R) 2 、-OC(O)N(R) 2 、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O) 2 R、-N(OR)C(O)OR、-N(OR)C(O)N(R) 2 、-N(OR)C(S)N(R) 2 、-N(OR)C(＝NR 23 )N(R) 2 、-N(OR)C(＝CHR 23 )N(R) 2 、-C(＝NR 23 )N(R) 2 、-C(＝NR 23 ) R, -C (O) N (R) OR OR-C (R) N (R) 2 C (O) OR, and each p is independently 1, 2, 3, 4, OR 5;
R 22 is C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-to 8-membered heterocyclyl, C 6 -C 10 Aryl or 5 to 10 membered heteroaryl;
R 23 is H, -CN, -NO 2 、C 1 -C 6 Alkyl, -OR, -S (O) 2 R、-S(O) 2 N(R) 2 、C 2 -C 6 Alkenyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-to 8-membered heterocyclyl, C 6 -C 10 Aryl or 5 to 10 membered heteroaryl;
each R is independently H, C 1 -C 3 Alkyl or C 2 -C 3 Alkenyl groups; or N (R) 2 Two R's in the moiety being bound to themNitrogen together form a cyclic moiety; and is also provided with
Each X is independently F, cl, br or I.
In one embodiment, the compound is a compound of formula (1-N), (1-N'), (1-N "), (1-O), (1-P) or (1-Q):
wherein y and z are each independently integers from 2 to 12,
s is an integer of 2 to 24,
t is an integer of 1 to 12, and
R 6 is hydrogen or a hydroxyl group, and is preferably a hydroxyl group,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (2-N), (2-N'), (2-N "), (2-O), (2-P) or (2-Q):
wherein y and z are each independently integers from 2 to 12,
u is an integer of 0 to 23,
t is an integer of 1 to 12, and
R 6 is hydrogen or a hydroxyl group, and is preferably a hydroxyl group,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (3-N), (3-N'), (3-N "), (3-O), (3-P) or (3-Q):
wherein y and z are each independently integers from 2 to 12,
u is an integer of 0 to 23,
t is an integer of 1 to 12, and
R 6 is hydrogen or a hydroxyl group, and is preferably a hydroxyl group,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (4-N), (4-N'), (4-N "), (4-O), (4-P) or (4-Q):
wherein y and z are each independently integers from 2 to 12,
u is an integer of 0 to 23,
t is an integer of 1 to 12, and
R 6 is hydrogen or a hydroxyl group, and is preferably a hydroxyl group,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (1-R), (1-R'), (1-R "), (1-S), (1-T) or (1-U):
Wherein y and z are each independently integers from 2 to 12,
s is an integer of 2 to 24,
t is an integer of 1 to 12, and
R 6 is hydrogen or a hydroxyl group, and is preferably a hydroxyl group,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (2-R), (2-R'), (2-R "), (2-S), (2-T) or (2-U):
wherein y and z are each independently integers from 2 to 12,
u is an integer of 0 to 23,
t is an integer of 1 to 12, and
R 6 is hydrogen or a hydroxyl group, and is preferably a hydroxyl group,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (3-R), (3-R'), (3-R "), (3-S), (3-T) or (3-U):
wherein y and z are each independently integers from 2 to 12,
u is an integer of 0 to 23,
t is an integer of 1 to 12, and
R 6 is hydrogen or a hydroxyl group, and is preferably a hydroxyl group,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (4-R), (4-R'), (4-R "), (4-S), (4-T) or (4-U):
wherein y and z are each independently integers from 2 to 12,
u is an integer of 0 to 23,
t is an integer of 1 to 12, and
R 6 is hydrogen or a hydroxyl group, and is preferably a hydroxyl group,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, y and z are each independently integers from 2 to 10. In one embodiment, y and z are each independently integers from 2 to 6. In one embodiment, y and z are each independently integers from 4 to 10.
In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8 and 9. In one embodiment, y is 5 and z is 5.
In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 4.
In one embodiment, y is 5, z is 5, and s is 2.
In one embodiment, y is 5, z is 5, and s is 4.
In one embodiment, u is an integer from 0 to 12. In one embodiment, u is an integer from 0 to 8. In one embodiment, u is an integer from 0 to 6. In one embodiment, u is an integer from 0 to 4. In one embodiment, u is 0. In one embodiment, u is 1. In one embodiment, u is 2. In one embodiment, u is 3. In one embodiment, u is 4.
In one embodiment, y is 5, z is 5, and u is 0.
In one embodiment, y is 5, z is 5, and u is 2.
In one embodiment, t is an integer from 1 to 10. In one embodiment, t is an integer from 1 to 8. In one embodiment, t is an integer from 1 to 6. In one embodiment, t is an integer from 1 to 4. In one embodiment, t is an integer from 1 to 3. In one embodiment, t is an integer from 1 to 2. In one embodiment, t is 1. In one embodiment, t is 2. In one embodiment, t is 3. In one embodiment, t is 4. In one embodiment, t is 5. In one embodiment, t is 6. In one embodiment, t is 7.
In one embodiment, R 4 Is C 1 -C 12 An alkyl group. In one embodiment, R 4 Is C 1 -C 8 An alkyl group. In one embodiment, R 4 Is C 1 -C 6 An alkyl group. In one embodiment, R 4 Is C 1 -C 4 An alkyl group. In one embodiment, R 4 Is methyl. In one embodiment, R 4 Is ethyl. In one embodiment, R 4 Is n-propyl. In one embodiment, R 4 Is n-butyl. In one embodiment, R 4 Is n-amyl. In one embodiment, R 4 Is n-hexyl. In one embodiment, R 4 Is n-octyl. In one embodiment, R 4 Is n-nonyl.
In one embodiment, R 4 Is C 3 -C 8 Cycloalkyl groups. In one embodiment, R 4 Is cyclopropyl. In one embodiment, R 4 Is cyclobutyl. In one embodiment, R 4 Is cyclopentyl. In one embodiment, R 4 Is cyclohexyl. In one embodiment, R 4 Is cycloheptyl. In one embodiment, R 4 Is cyclooctyl.
In one embodiment, R 4 Is C 3 -C 8 A cycloalkenyl group. In one embodiment, R 4 Is cyclopropenyl. In one embodiment, R 4 Is cyclobutenyl. In one embodiment, R 4 Is cyclopentenyl. In one embodiment, R 4 Is cyclohexenyl. In one embodiment, R 4 Is cycloheptenyl. In one embodiment, R 4 Is cyclooctenyl.
In one embodiment, R 4 Is C 6 -C 10 Aryl groups. In one embodiment, R 4 Is phenyl.
In one embodiment, R 4 Is a 4-to 8-membered heterocyclic group. In one embodiment, R 4 Is a 4-to 8-membered heterocycloalkyl. In one embodiment, R 4 Is oxetanyl. In one embodiment, R 4 Is tetrahydrofuranyl. In one embodiment, R 4 Is tetrahydropyranyl. In one embodiment, R 4 Is tetrahydrothiopyranyl. In one embodiment, R 4 Is N-methylpiperidinyl.
In one embodiment, R 4 、G 3 Or G 3 Together with the nitrogen to which they are attached form a cyclic moiety.
In one embodiment, the cyclic moiety (consisting of R 4 、G 3 Or G 3 Forms part of (c) together with the nitrogen to which they are attached) is a heterocyclic group. In one embodiment, the cyclic moiety is a heterocycloalkyl group. In one embodiment, the cyclic moiety is a 4 to 8 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 4 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 5-membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 6 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 7-membered heterocycloalkyl. In one embodiment, the cyclic moiety is an 8-membered heterocycloalkyl.
In one embodiment, the cyclic moiety (consisting of R 4 、G 3 Or G 3 Together with the nitrogen to which they are attached) is azetidin-3-yl. In one embodiment, the cyclic moiety is pyrrolidin-3-yl. In one embodiment, the cyclic moiety is piperidin-4-yl. In one embodiment, the cyclic moiety is azepan-4-yl. In one embodiment, the cyclic moiety is azacyclooctan-5-yl. The point of attachment of these groups is to G 1 And G 2 The direction of the attached nitrogen.
As described herein and unless otherwise indicated, R 4 The substitution pattern of (C) is also applicable to R 4 、G 3 Or G 3 Together with the nitrogen to which they are attached.
In one embodiment, R 4 Unsubstituted.
In one embodiment, R 4 Substituted with one or more substituents selected from the group consisting of: oxo, -OR g 、-NR g C(＝O)R h 、-C(＝O)NR g R h 、-C(＝O)R h 、-OC(＝O)R h 、-C(＝O)OR h and-O-R i -OH, wherein:
R g at each occurrence independently is H or C 1 -C 6 An alkyl group;
R h independently at each occurrence C 1 -C 6 An alkyl group; and is also provided with
R i Independently at each occurrence C 1 -C 6 An alkylene group.
In one embodiment, R 4 Substituted with one or more hydroxy groups. In one embodiment, R 4 Substituted with a hydroxy group.
In one embodiment, R 4 Substituted with one or more hydroxy groups and one or more oxo groups. In one embodiment, R 4 Substituted with one hydroxy and one oxo group.
In one embodiment, R 3 Has one of the following structures:
in one embodiment, R 3 Has the following characteristics ofIs a structure of (a).
In one embodiment, R 3 Has the following characteristics ofIs a structure of (a).
In one embodiment, R 1 And R is 2 Each independently is a branched chain C 6 -C 32 Alkyl or branched C 6 -C 32 Alkenyl groups. In one embodiment, R 1 And R is 2 Each independently is a branched chain C 6 -C 24 Alkyl or branched C 6 -C 24 Alkenyl groups.
In one embodiment, R 1 And R is 2 Each independently is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 1 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkyl or C 2 -C 10 Alkenyl groups.
In one embodiment, R 1 Is straight chain C 6 -C 32 An alkyl group. In one embodiment, R 1 Is straight chain C 6 -C 24 An alkyl group. In one embodiment, R 1 Is straight chain C 7 -C 15 An alkyl group. In one embodiment, R 1 Is straight chain C 7 An alkyl group. In one embodiment, R 1 Is straight chain C 8 An alkyl group. In one embodiment, R 1 Is straight chain C 9 An alkyl group. In one embodiment, R 1 Is straight chain C 10 An alkyl group. In one embodiment, R 1 Is straight chain C 11 An alkyl group. In one embodiment, R 1 Is straight chain C 12 An alkyl group. In one embodiment, R 1 Is straight chain C 13 An alkyl group. In one embodiment, R 1 Is straight chain C 14 An alkyl group. In one embodiment, R 1 Is straight chain C 15 An alkyl group.
In one embodiment, R 1 Is straight chain C 6 -C 32 Alkenyl groups. In one embodiment, R 1 Is straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R 1 Is straight chain C 7 -C 17 Alkenyl groups. In one embodiment, R 1 Is straight chain C 7 Alkenyl groups. In one embodiment, R 1 Is straight chain C 8 Alkenyl groups. In one embodiment, R 1 Is straight chain C 9 Alkenyl groups. In one embodiment, R 1 Is straight chain C 10 Alkenyl groups. In one embodiment, R 1 Is straight chain C 11 Alkenyl groups. In one embodiment, R 1 Is straight chain C 12 Alkenyl groups. In one embodiment, R 1 Is straight chain C 13 Alkenyl groups. In one embodiment, R 1 Is straight chain C 14 Alkenyl groups. In one implementationIn the scheme, R 1 Is straight chain C 15 Alkenyl groups. In one embodiment, R 1 Is straight chain C 16 Alkenyl groups. In one embodiment, R 1 Is straight chain C 17 Alkenyl groups.
In one embodiment, R 1 Is branched C 6 -C 32 An alkyl group. In one embodiment, R 1 Is branched C 6 -C 24 An alkyl group. In one embodiment, R 1 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group. In one embodiment, R 1 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R 1 Is branched C 6 -C 32 Alkenyl groups. In one embodiment, R 1 Is branched C 6 -C 24 Alkenyl groups. In one embodiment, R 1 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkenyl groups. In one embodiment, R 1 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 6 -C 10 Alkenyl groups.
In one embodiment, R 2 Is straight chain C 6 -C 32 An alkyl group. In one embodiment, R 2 Is straight chain C 6 -C 24 An alkyl group. In one embodiment, R 2 Is straight chain C 7 -C 15 An alkyl group. In one embodiment, R 2 Is straight chain C 7 An alkyl group. In one embodiment, R 2 Is straight chain C 8 An alkyl group. In one embodiment, R 2 Is straightChain C 9 An alkyl group. In one embodiment, R 2 Is straight chain C 10 An alkyl group. In one embodiment, R 2 Is straight chain C 11 An alkyl group. In one embodiment, R 2 Is straight chain C 12 An alkyl group. In one embodiment, R 2 Is straight chain C 13 An alkyl group. In one embodiment, R 2 Is straight chain C 14 An alkyl group. In one embodiment, R 2 Is straight chain C 15 An alkyl group.
In one embodiment, R 2 Is straight chain C 6 -C 32 Alkenyl groups. In one embodiment, R 2 Is straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R 2 Is straight chain C 7 -C 17 Alkenyl groups. In one embodiment, R 2 Is straight chain C 7 Alkenyl groups. In one embodiment, R 2 Is straight chain C 8 Alkenyl groups. In one embodiment, R 2 Is straight chain C 9 Alkenyl groups. In one embodiment, R 2 Is straight chain C 10 Alkenyl groups. In one embodiment, R 2 Is straight chain C 11 Alkenyl groups. In one embodiment, R 2 Is straight chain C 12 Alkenyl groups. In one embodiment, R 2 Is straight chain C 13 Alkenyl groups. In one embodiment, R 2 Is straight chain C 14 Alkenyl groups. In one embodiment, R 2 Is straight chain C 15 Alkenyl groups. In one embodiment, R 2 Is straight chain C 16 Alkenyl groups. In one embodiment, R 2 Is straight chain C 17 Alkenyl groups.
In one embodiment, R 2 Is branched C 6 -C 32 An alkyl group. In one embodiment, R 2 Is branched C 6 -C 24 An alkyl group. In one embodiment, R 2 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group. In one embodiment, R 2 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R 2 Is branched C 6 -C 32 Alkenyl groups. In one embodiment, R 2 Is branched C 6 -C 24 Alkenyl groups. In one embodiment, R 2 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkenyl groups. In one embodiment, R 2 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 6 -C 10 Alkenyl groups.
In one embodiment, R c Is straight chain C 6 -C 32 An alkyl group. In one embodiment, R c Is straight chain C 6 -C 24 An alkyl group. In one embodiment, R c Is straight chain C 7 -C 15 An alkyl group. In one embodiment, R c Is straight chain C 7 An alkyl group. In one embodiment, R c Is straight chain C 8 An alkyl group. In one embodiment, R c Is straight chain C 9 An alkyl group. In one embodiment, R c Is straight chain C 10 An alkyl group. In one embodiment, R c Is straight chain C 11 An alkyl group. In one embodiment, R c Is straight chain C 12 An alkyl group. In one embodiment, R c Is straight chain C 13 An alkyl group. In one embodiment, R c Is straight chain C 14 An alkyl group. In one embodiment, R c Is straight chain C 15 An alkyl group.
In one embodiment, R c Is straight chain C 6 -C 32 Alkenyl groups. In one embodiment, R c Is straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R c Is straight chain C 7 -C 17 Alkenyl groups. In one embodiment, R c Is straight chain C 7 Alkenyl groups. In one embodiment, R c Is straight chain C 8 Alkenyl groups. In one embodiment, R c Is straight chain C 9 Alkenyl groups. In one embodiment, R c Is straight chain C 10 Alkenyl groups. In one embodiment, R c Is straight chain C 11 Alkenyl groups. In one embodiment, R c Is straight chain C 12 Alkenyl groups. In one embodiment, R c Is straight chain C 13 Alkenyl groups. In one embodiment, R c Is straight chain C 14 Alkenyl groups. In one embodiment, R c Is straight chain C 15 Alkenyl groups. In one embodiment, R c Is straight chain C 16 Alkenyl groups. In one embodiment, R c Is straight chain C 17 Alkenyl groups.
In one embodiment, R c Is branched C 6 -C 32 An alkyl group. In one embodiment, R c Is branched C 6 -C 24 An alkyl group. In one embodiment, R c is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group. In one embodiment, R c is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R c Is branched C 6 -C 32 Alkenyl groups. In one embodiment, R c Is branched C 6 -C 24 Alkenyl groups. In one embodiment, R c is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkenyl groups. In one embodiment, R c is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 6 -C 10 Alkenyl groups.
In one embodiment, R f Is straight chain C 6 -C 32 An alkyl group. In one embodiment, R f Is straight chain C 6 -C 24 An alkyl group. In one embodiment, R f Is straight chain C 7 -C 15 An alkyl group. In one embodiment, R f Is straight chain C 7 An alkyl group. In one embodiment, R f Is straight chain C 8 An alkyl group. In one embodiment, R f Is straight chain C 9 An alkyl group. In one embodiment, R f Is straight chain C 10 An alkyl group. In one embodiment, R f Is straight chain C 11 An alkyl group. In one embodiment, R f Is straight chain C 12 An alkyl group. In one embodiment, R f Is straight chain C 13 An alkyl group. In one embodiment, R f Is straight chain C 14 An alkyl group. In one embodiment, R f Is straight chain C 15 An alkyl group.
In one embodiment, R f Is straight chain C 6 -C 32 Alkenyl groups. In one embodiment, R f Is straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R f Is straight chain C 7 -C 17 Alkenyl groups. In one embodiment, R f Is straight chain C 7 Alkenyl groups. In one embodiment, R f Is straight chain C 8 Alkenyl groups. In one embodiment, R f Is straight chain C 9 Alkenyl groups. In one embodiment, R f Is straight chain C 10 Alkenyl groups. In one embodiment, R f Is straight chain C 11 Alkenyl groups. In one embodiment, R f Is straight chain C 12 Alkenyl groups. In one embodiment, R f Is straight chain C 13 Alkenyl groups. In one embodiment, R f Is straight chain C 14 Alkenyl groups. In one embodiment, R f Is straight chain C 15 Alkenyl groups. In one embodimentIn the scheme, R f Is straight chain C 16 Alkenyl groups. In one embodiment, R f Is straight chain C 17 Alkenyl groups.
In one embodiment, R f Is branched C 6 -C 32 An alkyl group. In one embodiment, R f Is branched C 6 -C 24 An alkyl group. In one embodiment, R f is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group. In one embodiment, R f is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R f Is branched C 6 -C 32 Alkenyl groups. In one embodiment, R f Is branched C 6 -C 24 Alkenyl groups. In one embodiment, R f is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkenyl groups. In one embodiment, R f is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 6 -C 10 Alkenyl groups.
In one embodiment, R 1 、R 2 、R c And R is f Each independently is a straight chain C 6 -C 18 Alkyl, straight chain C 6 -C 18 Alkenyl or-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkyl or C 2 -C 10 Alkenyl groups.
In one embodiment, R 1 、R 2 、R c And R is f Each independently is a straight chain C 7 -C 15 Alkyl, straight chain C 7 -C 15 Alkenyl or-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 Alkyl or C 6 -C 10 Alkenyl groups.
In one embodiment, R 1 、R 2 、R c And R is f Each independently is one of the following structures:
in one embodiment, R 1 、R 2 、R c And R is f Each independently optionally substituted. In one embodiment, the optional substituent is-O- (C) 6 -C 24 Alkyl). In one embodiment, the optional substituent is-O- (C) 6 -C 24 Alkenyl). In one embodiment, the optional substituents are-C (=o) - (C 6 -C 24 Alkyl). In one embodiment, the optional substituents are-C (=o) - (C 6 -C 24 Alkenyl).
In one embodiment, R a And R is d Each independently is H. In one embodiment, R a 、R b 、R d And R is e Each independently is H. In one embodiment, R a And R is d Each independently is C 1 -C 24 An alkyl group. In one embodiment, R a And R is d Each independently is C 1 -C 18 An alkyl group. In one embodiment, R a And R is d Each independently is C 1 -C 12 An alkyl group. In one embodiment, R a And R is d Each independently is C 1 -C 6 An alkyl group.
In one embodiment, R b 、R c 、R e And R is f Each independently is n-hexyl or n-octyl.
In one embodiment, R c And R is f Each independently is a branched chain C 6 -C 24 Alkyl or branched C 6 -C 24 Alkenyl groups. In one embodiment, R c And R is f Each independently is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 1 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkyl or C 2 -C 10 Alkenyl groups.
In one embodiment, the compound is a compound of table 7, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
Table 7.
/>
/>
/>
/>
/>
/>
/>
/>
/>
In one embodiment, provided herein are compounds of formula (5):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
y is-O-G 2 -L 2 or-X-G 3 -NR 4 R 5 ；
G 1 And G 2 Each independently is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 Or R is 2 ；
R 1 And R is 2 Each independently is C 6 -C 24 Alkyl or C 6 -C 24 Alkenyl groups;
R a 、R b 、R d and R is e Each independently is H, C 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
R c and R is f Each independently is C 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
each X is independently O, NR 3 Or CR (CR) 10 R 11 ；
Each G 3 Independently C 2 -C 24 Alkylene, C 2 -C 24 Alkenylene, C 3 -C 8 Cycloalkylene or C 3 -C 8 A cycloalkenyl group;
each R 3 Independently H or C 1 -C 12 An alkyl group; or R is 3 、G 3 Or G 3 Together with the nitrogen to which they are attached, form a cyclic moiety a;
each R 4 Independently C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl; or R is 4 、G 3 Or G 3 Together with the nitrogen to which they are attached, form a cyclic moiety B;
each R 5 Independently C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl; or R is 4 、R 5 Together with the nitrogen to which they are attached, form a cyclic moiety C;
R 10 and R is 11 Each independently is H, C 1 -C 3 Alkyl or C 2 -C 3 Alkenyl groups;
x is 0, 1 or 2; and is also provided with
Wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
In one embodiment, Y is-O-G 2 -L 2 . In one embodiment, the compound is a compound of formula (5-A):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, Y is-X-G 3 -NR 4 R 5 . In one embodiment, the compound is a compound of formula (5-B):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, G 3 Is C 2 -C 24 An alkylene group. In one embodiment, G 3 Is C 2 -C 12 An alkylene group. In one embodiment, G 3 Is C 2 -C 8 An alkylene group. In one embodiment, G 3 Is C 2 -C 6 An alkylene group. In one embodiment, G 3 Is C 2 -C 4 An alkylene group. In one embodiment, G 3 Is C 2 An alkylene group. In one embodiment, G 3 Is C 3 An alkylene group. In one embodiment, G 3 Is C 4 An alkylene group.
In one embodiment, X is O. In one embodiment, X is CR 10 R 11 . In one embodiment, R 10 And R is 11 Both are hydrogen. In one embodiment, R 10 And R is 11 One of which is hydrogen and the other is C 1 -C 3 An alkyl group. In one embodiment, R 10 And R is 11 One of which is hydrogen and the other is C 2 -C 3 Alkenyl groups.
In one embodiment, X is NR 3 。
In one embodiment, R 3 Is H.
In one embodiment, the compound is a compound of formula (6):
wherein s is an integer of 2 to 24,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 3. In one embodiment, s is 4.
In one embodiment, R 3 Is C 1 -C 12 An alkyl group. In one embodiment, R 3 Is C 1 -C 10 An alkyl group. In one embodiment, R 3 Is C 1 -C 8 An alkyl group. In one embodiment, R 3 Is C 1 -C 6 An alkyl group. In one embodiment, R 3 Is C 1 -C 4 An alkyl group. In one embodiment, R 3 Is methyl. In one embodiment, R 3 Is ethyl. In one embodiment, R 3 Unsubstituted.
In one embodiment, R 3 、G 3 Or G 3 Together with the nitrogen to which they are attached form a cyclic moiety a.
In one embodiment, the compound is a compound of formula (7):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, cyclic moiety a is heterocyclyl. In one embodiment, cyclic moiety a is heterocycloalkyl. In one embodiment, the cyclic moiety a is a 4 to 8 membered heterocycloalkyl. In one embodiment, cyclic moiety a is a 4 membered heterocycloalkyl. In one embodiment, cyclic moiety a is a 5 membered heterocycloalkyl. In one embodiment, cyclic moiety a is a 6 membered heterocycloalkyl. In one embodiment, cyclic moiety a is a 7 membered heterocycloalkyl. In one embodiment, cyclic moiety a is an 8-membered heterocycloalkyl.
In one embodiment, the compound is a compound of formula (7-A):
wherein n is 1, 2 or 3; and m is 1, 2 or 3;
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, n is 1. In one embodiment, n is 2. In one embodiment, n is 3. In one embodiment, m is 1. In one embodiment, m is 2. In one embodiment, m is 3.
In one embodiment, n is 1 and m is 1. In one embodiment, n is 2 and m is 2. In one embodiment, n is 3 and m is 3.
In one embodiment, cyclic moiety a is azetidin-1-yl. In one embodiment, cyclic moiety a is pyrrolidin-1-yl. In one embodiment, cyclic moiety A is piperidin-1-yl. In one embodiment, cyclic moiety A is azepan-1-yl. In one embodiment, cyclic moiety A is azacyclooctan-1-yl. The point of attachment in these groups is to phosphorus.
In one embodiment, R 4 Is C 1 -C 12 An alkyl group. In one embodiment, R 4 Is C 1 -C 8 An alkyl group. In one embodiment, R 4 Is C 1 -C 6 An alkyl group. In one embodiment, R 4 Is C 1 -C 4 An alkyl group. In one embodiment, R 4 Is methyl. In one embodiment, R 4 Is ethyl. In one embodiment, R 4 Is n-propyl. In one embodiment, R 4 Is isopropyl. In one embodiment, R 4 Is n-butyl. In one embodiment, R 4 Is n-amyl. In one embodiment, R 4 Is n-hexyl. In one embodiment, R 4 Is n-octyl. In one embodiment, R 4 Is n-nonyl.
In one embodiment, R 4 Is C 3 -C 8 Cycloalkyl groups. In one embodiment, R 4 Is cyclopropyl. In one embodiment, R 4 Is cyclobutyl. In one embodiment, R 4 Is cyclopentyl. In one embodiment, R 4 Is cyclohexyl. In one embodiment, R 4 Is cycloheptyl. In one embodiment, R 4 Is cyclooctyl.
In one embodiment, R 4 Is C 3 -C 8 A cycloalkenyl group. In one embodiment, R 4 Is cyclopropenyl. In one embodiment, R 4 Is cyclobutenyl. In one embodiment, R 4 Is cyclopentenyl. In one embodiment, R 4 Is cyclohexenyl. In one embodiment, R 4 Is cycloheptenyl. In one embodiment, R 4 Is cyclooctenyl.
In one embodiment, R 4 Is C 6 -C 10 Aryl groups. In one embodiment, R 4 Is phenyl.
In one embodiment, R 4 Is a 4-to 8-membered heterocycloalkyl. In one embodiment, R 4 Is a 4-membered heterocycloalkyl. In one embodiment, R 4 Is a 5 membered heterocycloalkyl. In one embodiment, R 4 Is a 6 membered heterocycloalkyl. In one embodiment, R 4 Is a 7 membered heterocycloalkyl. In one embodiment, R 4 Is an 8-membered heterocycloalkyl group. In one embodiment, R 4 Is azetidin-3-yl. In one embodiment, R 4 Is pyrrolidin-3-yl. In one embodiment, R 4 Is piperidin-4-yl. In one embodiment, R 4 Is azepan-4-yl. In one embodiment, R 4 Is azacyclooctan-5-yl. In one embodiment, R 4 Is tetrahydropyran-4-yl. The point of attachment in these groups is to R 4 The nitrogen attached.
In one embodiment, R 4 Unsubstituted.
In a real worldIn embodiments, R 4 Substituted with one or more substituents selected from the group consisting of: oxo, -OR g 、-NR g C(＝O)R h 、-C(＝O)NR g R h 、-C(＝O)R h 、-OC(＝O)R h 、-C(＝O)OR h and-O-R i -OH, wherein:
R g at each occurrence independently is H or C 1 -C 6 An alkyl group;
R h independently at each occurrence C 1 -C 6 An alkyl group; and is also provided with
R i Independently at each occurrence C 1 -C 6 An alkylene group.
In one embodiment, R 4 Substituted with one or more hydroxy groups. In one embodiment, R 4 Substituted with a hydroxy group.
In one embodiment, R 4 Substituted with one or more hydroxy groups and one or more oxo groups. In one embodiment, R 4 Substituted with one hydroxy and one oxo group.
In one embodiment, R 4 、R 5 Together with the nitrogen to which they are attached form a cyclic moiety C.
In one embodiment, cyclic moiety C is heterocyclyl. In one embodiment, cyclic moiety C is heterocycloalkyl. In one embodiment, the cyclic moiety C is a 4 to 8 membered heterocycloalkyl. In one embodiment, the cyclic moiety C is a 4 membered heterocycloalkyl. In one embodiment, the cyclic moiety C is a 5 membered heterocycloalkyl. In one embodiment, the cyclic moiety C is a 6 membered heterocycloalkyl. In one embodiment, the cyclic moiety C is a 7 membered heterocycloalkyl. In one embodiment, the cyclic moiety C is an 8 membered heterocycloalkyl. In one embodiment, cyclic moiety C is a fused heterocycloalkyl. In one embodiment, cyclic moiety C is a fused 6-to 12-membered heterocycloalkyl. In one embodiment, cyclic moiety C is a fused 6-to 8-membered heterocycloalkyl.
In one embodiment, cyclic moiety C is azetidin-1-yl. In one implementationIn the scheme, cyclic moiety C is pyrrolidin-1-yl. In one embodiment, cyclic moiety C is piperidin-1-yl. In one embodiment, cyclic moiety C is azepan-1-yl. In one embodiment, cyclic moiety C is azacyclooctan-1-yl. In one embodiment, cyclic moiety C is morpholinyl. In one embodiment, cyclic moiety C is piperazin-1-yl. In one embodiment, cyclic moiety C isIn one embodiment, the cyclic moiety C is +.>The point of attachment in these groups is to G 3 。
In one embodiment, cyclic moiety C is unsubstituted.
In one embodiment, the cyclic moiety C is substituted with one or more substituents selected from the group consisting of: oxo, -OR g 、-NR g C(＝O)R h 、-C(＝O)NR g R h 、-C(＝O)R h 、-OC(＝O)R h 、-C(＝O)OR h and-O-R i -OH, wherein:
R g at each occurrence independently is H or C 1 -C 6 An alkyl group;
R h independently at each occurrence C 1 -C 6 An alkyl group; and is also provided with
R i Independently at each occurrence C 1 -C 6 An alkylene group.
In one embodiment, cyclic moiety C is 4-acetylpiperazin-1-yl.
In one embodiment, R 4 、G 3 Or G 3 Together with the nitrogen to which they are attached form a cyclic moiety B.
In one embodiment, the compound is a compound of formula (8):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, cyclic moiety B is heterocyclyl. In one embodiment, cyclic moiety B is heterocycloalkyl. In one embodiment, cyclic moiety B is a 4 to 8 membered heterocycloalkyl. In one embodiment, cyclic moiety B is a 4 membered heterocycloalkyl. In one embodiment, cyclic moiety B is a 5 membered heterocycloalkyl. In one embodiment, cyclic moiety B is a 6 membered heterocycloalkyl. In one embodiment, cyclic moiety B is a 7-membered heterocycloalkyl. In one embodiment, cyclic moiety B is an 8-membered heterocycloalkyl.
In one embodiment, the compound is a compound of formula (8-A):
wherein n is 1, 2 or 3; and m is 1, 2 or 3;
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, n is 1. In one embodiment, n is 2. In one embodiment, n is 3. In one embodiment, m is 1. In one embodiment, m is 2. In one embodiment, m is 3.
In one embodiment, n is 1 and m is 1. In one embodiment, n is 2 and m is 2. In one embodiment, n is 3 and m is 3.
In one embodiment, cyclic moiety B is azetidin-3-yl. In one embodiment, cyclic moiety B is pyrrolidin-3-yl. In one embodiment, cyclic moiety B is piperidin-4-yl. In one embodiment, cyclic moiety B is azepan-4-yl. In one embodiment, cyclic moiety B is azacyclooctan-5-yl. The point of attachment of these groups is to a phosphoramide.
In one embodiment, the compound is a compound of formula (9):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, cyclic moiety a and cyclic moiety B are each independently heterocyclyl. In one embodiment, cyclic moiety a and cyclic moiety B are each independently heterocycloalkyl. In one embodiment, cyclic moiety a and cyclic moiety B are each independently 4 to 8 membered heterocycloalkyl.
In one embodiment, cyclic moiety A and cyclic moiety B together are 2, 7-diazaspiro [3.5] non-2-yl.
In one embodiment, R 5 Is C 1 -C 12 An alkyl group. In one embodiment, R 5 Is C 1 -C 8 An alkyl group. In one embodiment, R 5 Is C 1 -C 6 An alkyl group. In one embodiment, R 5 Is C 1 -C 4 An alkyl group. In one embodiment, R 5 Is methyl. In one embodiment, R 5 Is ethyl. In one embodiment, R 5 Is n-propyl. In one embodiment, R 5 Is isopropyl. In one embodiment, R 5 Is n-butyl. In one embodiment, R 5 Is n-amyl. In one embodiment, R 5 Is n-hexyl. In one embodiment, R 5 Is n-octyl. In one embodiment, R 5 Is n-nonyl.
In one embodiment, R 5 Is C 3 -C 8 Cycloalkyl groups. In one embodiment, R 5 Is cyclopropyl. In one embodiment, R 5 Is cyclobutyl. In one embodiment, R 5 Is cyclopentyl. In one embodiment, R 5 Is cyclohexyl. In one embodiment, R 5 Is cycloheptyl. In one embodiment, R 5 Is cyclooctyl.
In one embodiment, R 5 Is C 3 -C 8 A cycloalkenyl group. In one embodiment, R 5 Is cyclopropenyl. In one embodiment, R 5 Is cyclobutenyl. In one embodiment, R 5 Is cyclopentenyl. In one embodiment, R 5 Is cyclohexenyl. In one embodiment, R 5 Is cycloheptenyl. In one embodiment, R 5 Is cyclooctenyl.
In one embodiment, R 5 Is C 6 -C 10 Aryl groups. In one embodiment, R 5 Is phenyl.
In one embodiment, R 5 Is a 4-to 8-membered heterocycloalkyl. In one embodiment, R 5 Is a 4-membered heterocycloalkyl. In one embodiment, R 5 Is a 5 membered heterocycloalkyl. In one embodiment, R 5 Is a 6 membered heterocycloalkyl. In one embodiment, R 5 Is a 7 membered heterocycloalkyl. In one embodiment, R 5 Is an 8-membered heterocycloalkyl group. In one embodiment, R 5 Is azetidin-3-yl. In one embodiment, R 5 Is pyrrolidin-3-yl. In one embodiment, R 5 Is piperidin-4-yl. In one embodiment, R 5 Is azepan-4-yl. In one embodiment, R 5 Is azacyclooctan-5-yl. In one embodiment, R 5 Is tetrahydropyran-4-yl.
In one embodiment, R 5 Unsubstituted.
In one embodiment, R 5 Substituted with one or more substituents selected from the group consisting of: oxo, -OR g 、-NR g C(＝O)R h 、-C(＝O)NR g R h 、-C(＝O)R h 、-OC(＝O)R h 、-C(＝O)OR h and-O-R i -OH, wherein:
R g at each occurrence independently is H or C 1 -C 6 An alkyl group;
R h at each occurrence independentlyThe standing site is C 1 -C 6 An alkyl group; and is also provided with
R i Independently at each occurrence C 1 -C 6 An alkylene group.
In one embodiment, R 5 Substituted with one or more hydroxy groups. In one embodiment, R 5 Substituted with a hydroxy group.
In one embodiment, R 5 Substituted with one or more hydroxy groups and one or more oxo groups. In one embodiment, R 5 Substituted with one hydroxy and one oxo group.
In one embodiment, N (R 4 )(R 5 )-G 3 -X-has one of the following structures:
in one embodiment, G 1 Is a key. In one embodiment, G 1 Is C 2 -C 12 An alkylene group. In one embodiment, G 1 Is C 4 -C 8 An alkylene group. In one embodiment, G 1 Is C 5 -C 7 An alkylene group. In one embodiment, G 1 Is C 5 An alkylene group. In one embodiment, G 1 Is C 7 An alkylene group. In one embodiment, G 1 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 1 Is C 4 -C 8 Alkenylene radicals. In one embodiment, G 1 Is C 5 -C 7 Alkenylene radicals. In one embodiment, G 1 Is C 5 Alkenylene radicals. In one embodiment, G 1 Is C 7 Alkenylene radicals.
In one embodiment, G 2 Is a key. In one embodiment, G 2 Is C 2 -C 12 An alkylene group. In one embodiment, G 2 Is C 4 -C 8 An alkylene group. In one embodiment, G 2 Is C 5 -C 7 An alkylene group. In one embodiment, G 2 Is C 5 An alkylene group. In one embodiment, G 2 Is C 7 An alkylene group. In one embodiment, G 2 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 2 Is C 4 -C 8 Alkenylene radicals. In one embodiment, G 2 Is C 5 -C 7 Alkenylene radicals. In one embodiment, G 2 Is C 5 Alkenylene radicals. In one embodiment, G 2 Is C 7 Alkenylene radicals.
In one embodiment, G 1 And G 2 Each independently is a bond or C 2 -C 12 Alkylene (e.g., C 4 -C 8 Alkylene groups, e.g. C 5 -C 7 Alkylene groups, e.g. C 5 Alkylene or C 7 An alkylene group). In one embodiment, G 1 And G 2 Both are keys. In one embodiment, G 1 And G 2 One of which is a bond and the other is C 2 -C 12 Alkylene (e.g., C 4 -C 8 Alkylene groups, e.g. C 5 -C 7 Alkylene groups, e.g. C 5 Alkylene or C 7 An alkylene group). In one embodiment, G 1 And G 2 Each independently is C 2 -C 12 Alkylene (e.g., C 4 -C 8 Alkylene groups, e.g. C 5 -C 7 Alkylene groups, e.g. C 5 Alkylene or C 7 An alkylene group). In one embodiment, G 1 And G 2 Each independently is a bond, C 5 Alkylene or C 7 An alkylene group.
In one embodiment, L 1 Is R 1 。
In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 OR-P (=O) (OR b )(OR c ). In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 or-C (=O) NR b R c . In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-NR a C(＝O)R 1 or-C (=O) NR b R c . In one embodiment, L 1 is-OC (=O) R 1 . In one embodiment, L 1 is-C (=O) OR 1 . In one embodiment, L 1 is-NR a C(＝O)R 1 . In one embodiment, L 1 is-C (=O) NR b R c 。
In one embodiment, L 2 Is R 2 。
In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 OR-P (=O) (OR e )(OR f ). In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 or-C (=O) NR e R f . In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-NR d C(＝O)R 2 or-C (=O) NR e R f . In one embodiment, L 2 is-OC (=O) R 2 . In one embodiment, L 2 is-C (=O) OR 2 . In one embodiment, L 2 is-NR d C(＝O)R 2 . In one embodiment, L 2 is-C (=O) NR e R f 。
In one embodiment, G 1 Is a bond, and L 1 Is R 1 . In one embodiment, G 1 Is C 2 -C 12 Alkylene group, and L 1 is-C (=O) OR 1 。
In one embodiment, G 2 Is a bond, and L 2 Is R 2 . In one embodiment, G 2 Is C 2 -C 12 Alkylene group, and L 2 is-C (=O) OR 2 。
In one embodiment, R 1 And R is 2 Each independently is a straight chain C 6 -C 24 Alkyl or branched C 6 -C 24 An alkyl group.
In one embodiment, R 1 And R is 2 Each independently is a straight chain C 6 -C 18 Alkyl or-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group.
In one embodiment, R 1 And R is 2 Each independently is a straight chain C 6 -C 14 Alkyl or-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R 1 And R is 2 Each independently is a branched chain C 6 -C 24 Alkyl or branched C 6 -C 24 Alkenyl groups.
In one embodiment, R 1 And R is 2 Each independently is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 1 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkyl or C 2 -C 10 Alkenyl groups.
In one embodiment, R 1 Or R is 2 Or both independently have one of the following structures:
in one embodiment, R a And R is d Each independently is H.
In one embodiment, R b 、R c 、R e And R is f Each independently is n-hexyl or n-octyl.
In one embodiment, the compound is a compound of table 8, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
Table 8.
/>
/>
/>
/>
/>
/>
In one embodiment, provided herein are compounds of formula (10):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
G 1 and G 2 Each independently is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 Or R is 2 ；
R 1 And R is 2 Each independently is C 6 -C 24 Alkyl or C 6 -C 24 Alkenyl groups;
R a 、R b 、R d and R is e Each independently is H, C 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
R c and R is f Each independently is C 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
G 3 and G 4 Each independently is C 1 -C 12 An alkylene group;
L 3 and L 4 Each independently is-OC (=o) -, -C (=o) O-, -OC (=o) O-, -C (=o) -, -O-, -S (O) x -、-S-S-、-C(＝O)S-、-SC(＝O)-、-NR a C(＝O)-、-C(＝O)NR b -、-NR a C(＝O)NR b -、-OC(＝O)NR b -、-NR a C(＝O)O-、-SC(＝S)-、-C(＝S)S-、-C(＝S)-、-CH(OH)-、-P(＝O)(OR b )O-、-(C 6 -C 10 Arylene) -or- (6-to 10-membered heteroarylene) -;
G 5 is C 2 -C 24 Alkylene, C 2 -C 24 Alkenylene, C 3 -C 8 Cycloalkylene or C 3 -C 8 A cycloalkenyl group;
R 3 is-N (R) 4 )R 5 OR-OR 6 ；
R 4 Is hydrogen, C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl or C 6 -C 10 An aryl group;
R 5 is C 1 -C 12 An alkyl group;
or R is 4 And R is 5 Forms together with the nitrogen to which they are attached a cyclic moiety;
R 6 is hydrogen, C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl or C 6 -C 10 An aryl group;
x is 0, 1 or 2;
n is 1, 2 or 3;
m is 1, 2 or 3; and is also provided with
Wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
In one embodiment, n is 1. In one embodiment, n is 2. In one embodiment, n is 3. In one embodiment, m is 1. In one embodiment, m is 2. In one embodiment, m is 3. In one embodiment, n is 1 and m is 1. In one embodiment, n is 1 and m is 2. In one embodiment, n is 1 and m is 3. In one embodiment, n is 2 and m is 2. In one embodiment, n is 2 and m is 3. In one embodiment, n is 3 and m is 3.
In one embodiment, the compound is a compound of formula (11):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, G 5 Is C 2 -C 24 An alkylene group. In one embodiment, G 5 Is C 2 -C 12 An alkylene group. In one embodiment, G 5 Is C 2 -C 8 An alkylene group. In one embodiment, G 5 Is C 2 -C 6 An alkylene group. In one embodiment, G 5 Is C 2 -C 4 An alkylene group. In one embodiment, G 5 Is C 2 An alkylene group. In one embodiment, G 5 Is C 3 An alkylene group. In one embodiment, G 5 Is C 4 An alkylene group. In one embodiment, G 5 Is C 5 An alkylene group. In one embodiment, G 5 Is C 6 An alkylene group.
In one embodiment, G 5 Is C 2 -C 24 Alkenylene radicals. In one embodiment, G 5 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 5 Is C 2 -C 8 Alkenylene radicals. In one embodiment, G 5 Is C 2 -C 6 Alkenylene radicals. In one embodiment, G 5 Is C 2 -C 4 Alkenylene radicals.
In one embodiment, G 5 Is C 3 -C 8 Cycloalkylene radicals. In one embodiment, G 5 Is C 5 -C 6 Cycloalkylene radicals.
In one embodiment, G 5 Is C 3 -C 8 A cycloalkenylene group. In one embodiment, G 5 Is C 5 -C 6 A cycloalkenylene group.
In one embodiment, G 5 Unsubstituted. In one embodiment, G 5 Through one or more oxo groups or C 1 -C 6 Alkyl substitution. In one embodiment, G 5 Substituted with oxo. In one embodiment, G 5 Warp C 1 -C 6 Alkyl substitution. In one embodiment, G 5 Substituted with methyl.
In one embodiment, the compound is a compound of formula (12):
wherein s is an integer of 2 to 24,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 3. In one embodiment, s is 4. In one embodiment, s is 5. In one embodiment, s is 6.
In one embodiment, the compound is a compound of formula (13):
wherein t is an integer of 1 to 23,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, t is an integer from 2 to 12. In one embodiment, t is an integer from 2 to 8. In one embodiment, t is an integer from 2 to 6. In one embodiment, t is an integer from 2 to 4. In one embodiment, t is 2. In one embodiment, t is 3. In one embodiment, t is 4. In one embodiment, t is 5. In one embodiment, t is 6.
In one embodiment, G 3 And G 4 Each independently is C 1 -C 6 An alkylene group. In one embodiment, G 3 And G 4 Each independently is C 1 -C 3 An alkylene group. In one embodiment, G 3 And G 4 Each independently is C 1 Or C 2 An alkylene group. In one embodiment, G 3 And G 4 Each independently is-CH 2 -or-CH 2 -CH 2 -. In one embodiment, G 3 And G 4 Both are-CH 2 -. In one embodiment, G 3 And G 4 Both are-CH 2 -CH 2 -。
In one embodiment, L 3 And L 4 Each independently is-OC (=o) -, -C (=o) O-, -C (=o) S-, -SC (=o) -, -NR a C (=o) -or-C (=o) NR b -. In one embodiment, L 3 And L 4 Each independently is-O-, -OC (=o) -or-C (=o) O-.
In one embodiment, L 3 is-O-. In one embodiment, L 3 is-OC (=o) -. In one embodiment, L 3 is-C (=O) O-.
In one embodiment, L 4 is-O-. In one embodiment, L 4 is-OC (=o) -. In one embodiment, L 4 is-C (=O) O-.
In one embodiment, L 3 And L 4 Both are-OC (=o) -. In one embodiment, L 3 And L 4 Both are-C (=o) O-. In one embodiment, L 3 And L 4 Both are-O-. In one embodiment, L 3 And L 4 One of them is-O-, and L 3 And L 4 The other of (a) is-OC (=O) -. In one embodiment, L 3 And L 4 One of them is-O-, and L 3 And L 4 The other of (C (=O) O).
As described herein and unless otherwise indicated, L 3 The connection point on the left side is with G 3 And L is 3 The right connection point is connected with G 1 . For example, when L 3 when-OC (=O) -it means G 3 -OC(＝O)-G 1 . Similarly, as described herein and unless otherwise indicated, L 4 The connection point on the left side is with G 4 And L is 4 The right connection point is connected with G 2 。
In one embodiment, the compound is a compound of formula (14):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (15):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (16):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, R 3 is-N (R) 4 )R 5 。
In one embodiment, R 4 Is hydrogen. In one embodiment, R 4 Is C 1 -C 12 An alkyl group. In one embodiment, R 4 Is C 1 -C 8 An alkyl group. In one embodiment, R 4 Is C 1 -C 6 An alkyl group. In one embodiment, R 4 Is C 1 -C 4 An alkyl group. In one embodiment, R 4 Is methyl. In one embodiment, R 4 Is ethyl. In one embodiment, R 4 Is n-propyl. In one embodiment, R 4 Is isopropyl. In one embodiment, R 4 Is n-butyl. In one embodiment, R 4 Is n-amyl. In one embodiment, R 4 Is n-hexyl. In one embodiment, R 4 Is n-octyl. In one embodiment, R 4 Is n-nonyl.
In one embodiment, R 4 Is C 3 -C 8 Cycloalkyl groups. In one embodiment, R 4 Is cyclopropyl. In one embodiment, R 4 Is cyclobutyl. In one embodiment, R 4 Is cyclopentyl. In one embodiment, R 4 Is cyclohexyl. In one embodiment, R 4 Is cycloheptyl. In one embodiment, R 4 Is cyclooctyl.
In one embodiment, R 4 Is C 3 -C 8 A cycloalkenyl group. In one embodiment, R 4 Is cyclopropenyl. In one embodiment, R 4 Is cyclobutenyl. In one embodiment, R 4 Is cyclopentenyl. In one embodiment, R 4 Is cyclohexenyl. In one embodiment, R 4 Is cycloheptenyl. In one embodiment, R 4 Is cyclooctenyl.
In one embodiment, R 4 Is C 6 -C 10 Aryl groups. In one embodiment, R 4 Is phenyl.
In one embodiment, R 4 Unsubstituted.
In one embodiment, R 4 Substituted with one or more substituents selected from the group consisting of: oxo, -OR g 、-NR g C(＝O)R h 、-C(＝O)NR g R h 、-C(＝O)R h 、-OC(＝O)R h 、-C(＝O)OR h and-O-R i -OH, wherein:
R g at each occurrence independently is H or C 1 -C 6 An alkyl group;
R h independently at each occurrence C 1 -C 6 An alkyl group; and is also provided with
R i Independently at each occurrence C 1 -C 6 An alkylene group.
In one embodiment, R 4 Substituted with one or more hydroxy groups. In one embodiment, R 4 Substituted with a hydroxy group.
In one embodiment, R 5 Is C 1 -C 12 An alkyl group. In one embodiment, R 5 Is C 1 -C 8 An alkyl group. In one embodiment, R 5 Is C 1 -C 6 Alkyl group. In one embodiment, R 5 Is C 1 -C 4 An alkyl group. In one embodiment, R 5 Is methyl. In one embodiment, R 5 Is ethyl. In one embodiment, R 5 Is n-propyl. In one embodiment, R 5 Is isopropyl. In one embodiment, R 5 Is n-butyl. In one embodiment, R 5 Is n-amyl. In one embodiment, R 5 Is n-hexyl. In one embodiment, R 5 Is n-octyl. In one embodiment, R 5 Is n-nonyl.
In one embodiment, R 5 Unsubstituted.
In one embodiment, R 5 Substituted with one or more substituents selected from the group consisting of: oxo, -OR g 、-NR g C(＝O)R h 、-C(＝O)NR g R h 、-C(＝O)R h 、-OC(＝O)R h 、-C(＝O)OR h 、-O-R i -OH and-N (R) 10 )R 11 Wherein:
R g at each occurrence independently is H or C 1 -C 6 An alkyl group;
R h independently at each occurrence C 1 -C 6 An alkyl group;
R i independently at each occurrence C 1 -C 6 An alkylene group;
R 10 is hydrogen or C 1 -C 6 An alkyl group;
R 11 is C 1 -C 6 Alkyl, C 3 -C 8 Cycloalkyl or C 3 -C 8 A cycloalkenyl group;
or R is 10 And R is 11 Forms together with the nitrogen to which they are attached a cyclic moiety;
and R is 11 Or cyclic moieties optionally via hydroxy, oxo, -NH 2 、-NH(C 1 -C 6 Alkyl) or-N (C) 1 -C 6 Alkyl group 2 One or more substitutions in (a).
In one embodiment, R 5 Through one or more hydroxy groups or-N (R 10 )R 11 And (3) substitution.
In one embodiment, R 5 Substituted with one or more hydroxy groups. In one embodiment, R 5 Substituted with a hydroxy group.
In one embodiment, R 5 Through one or more-N (R) 10 )R 11 And (3) substitution. In one embodiment, R 5 Through a group of-N (R) 10 )R 11 And (3) substitution.
In one embodiment, R 10 Is hydrogen.
In one embodiment, R 11 Is C 3 -C 8 A cycloalkenyl group. In one embodiment, R 11 Is cyclobutenyl. In one embodiment, R 11 Oxo, -NH 2 、-NH(C 1 -C 6 Alkyl) or-N (C) 1 -C 6 Alkyl group 2 One or more substitutions in (a).
In one embodiment, R 10 And R is 11 Together with the nitrogen to which they are attached form a cyclic moiety. In one embodiment, the cyclic moiety is a 5 to 10 membered heteroaryl. In one embodiment, the cyclic moiety is pyrimidin-1-yl. In one embodiment, the cyclic moiety is purin-9-yl. In one embodiment, the cyclic moiety is oxo, -NH 2 、-NH(C 1 -C 6 Alkyl) or-N (C) 1 -C 6 Alkyl group 2 One or more substitutions in (a).
In one embodiment, R 5 Warp yarn And (3) substitution.
In one embodiment, R 4 And R is 5 Together with the nitrogen to which they are attached form a cyclic moiety.
In one embodimentA cyclic part (formed by R 4 And R is 5 Together with the nitrogen to which they are attached) is a heterocyclic group. In one embodiment, the cyclic moiety is a heterocycloalkyl group. In one embodiment, the cyclic moiety is a 4 to 8 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 4 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 5-membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 6 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 7-membered heterocycloalkyl. In one embodiment, the cyclic moiety is an 8-membered heterocycloalkyl.
In one embodiment, the cyclic moiety (consisting of R 4 And R is 5 Formed together with the nitrogen to which they are attached) is azetidin-1-yl. In one embodiment, the cyclic moiety is pyrrolidin-1-yl. In one embodiment, the cyclic moiety is piperidin-1-yl. In one embodiment, the cyclic moiety is azepan-1-yl. In one embodiment, the cyclic moiety is azacyclooctan-1-yl. In one embodiment, the cyclic moiety is morpholinyl. In one embodiment, the cyclic moiety is piperazin-1-yl.
In one embodiment, the cyclic moiety (consisting of R 4 And R is 5 Formed with the nitrogen to which they are attached) is unsubstituted.
In one embodiment, the cyclic moiety (consisting of R 4 And R is 5 Formed with the nitrogen to which they are attached) is substituted with one or more substituents selected from the group consisting of: oxo, -OR g 、-NR g C(＝O)R h 、-C(＝O)NR g R h 、-C(＝O)R h 、-OC(＝O)R h 、-C(＝O)OR h and-O-R i -OH, wherein:
R g at each occurrence independently is H or C 1 -C 6 An alkyl group;
R h independently at each occurrence C 1 -C 6 An alkyl group; and is also provided with
R i Independently at each occurrence C 1 -C 6 An alkylene group.
In one implementationIn the scheme, the cyclic moiety (represented by R 4 And R is 5 Formed together with the nitrogen to which they are attached) is 4-acetylpiperazin-1-yl.
In one embodiment, R 3 is-OR 6 。
In one embodiment, R 6 Is hydrogen. In one embodiment, R 6 Is C 1 -C 12 An alkyl group. In one embodiment, R 6 Is C 1 -C 8 An alkyl group. In one embodiment, R 6 Is C 1 -C 6 An alkyl group. In one embodiment, R 6 Is C 1 -C 4 An alkyl group. In one embodiment, R 6 Is methyl. In one embodiment, R 6 Is ethyl. In one embodiment, R 6 Is C 3 -C 8 Cycloalkyl groups. In one embodiment, R 6 Is C 3 -C 8 A cycloalkenyl group. In one embodiment, R 6 Is C 6 -C 10 Aryl groups. In one embodiment, R 6 Is phenyl.
In one embodiment, G 1 Is a key. In one embodiment, G 1 Is C 2 -C 12 An alkylene group. In one embodiment, G 1 Is C 4 -C 8 An alkylene group. In one embodiment, G 1 Is C 5 -C 7 An alkylene group. In one embodiment, G 1 Is C 5 An alkylene group. In one embodiment, G 1 Is C 7 An alkylene group. In one embodiment, G 1 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 1 Is C 4 -C 8 Alkenylene radicals. In one embodiment, G 1 Is C 5 -C 7 Alkenylene radicals. In one embodiment, G 1 Is C 5 Alkenylene radicals. In one embodiment, G 1 Is C 7 Alkenylene radicals.
In one embodiment, G 2 Is a key. In one embodiment, G 2 Is C 2 -C 12 An alkylene group. In one ofIn embodiments, G 2 Is C 4 -C 8 An alkylene group. In one embodiment, G 2 Is C 5 -C 7 An alkylene group. In one embodiment, G 2 Is C 5 An alkylene group. In one embodiment, G 2 Is C 7 An alkylene group. In one embodiment, G 2 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 2 Is C 4 -C 8 Alkenylene radicals. In one embodiment, G 2 Is C 5 -C 7 Alkenylene radicals. In one embodiment, G 2 Is C 5 Alkenylene radicals. In one embodiment, G 2 Is C 7 Alkenylene radicals.
In one embodiment, G 1 And G 2 Each independently is a bond or C 2 -C 12 Alkylene (e.g., C 4 -C 8 Alkylene groups, e.g. C 5 -C 7 Alkylene groups, e.g. C 5 Alkylene or C 7 An alkylene group). In one embodiment, G 1 And G 2 Both are keys. In one embodiment, G 1 And G 2 One of which is a bond and the other is C 2 -C 12 Alkylene (e.g., C 4 -C 8 Alkylene groups, e.g. C 5 -C 7 Alkylene groups, e.g. C 5 Alkylene or C 7 An alkylene group). In one embodiment, G 1 And G 2 Each independently is C 2 -C 12 Alkylene (e.g., C 4 -C 8 Alkylene groups, e.g. C 5 -C 7 Alkylene groups, e.g. C 5 Alkylene or C 7 An alkylene group). In one embodiment, G 1 And G 2 Each independently is a bond, C 5 Alkylene or C 7 An alkylene group.
In one embodiment, L 1 Is R 1 。
In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 OR-P (=O) (OR b )(OR c ). In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 or-C (=O) NR b R c . In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-NR a C(＝O)R 1 or-C (=O) NR b R c . In one embodiment, L 1 is-OC (=O) R 1 . In one embodiment, L 1 is-C (=O) OR 1 . In one embodiment, L 1 is-NR a C(＝O)R 1 . In one embodiment, L 1 is-C (=O) NR b R c 。
In one embodiment, L 2 Is R 2 。
In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 OR-P (=O) (OR e )(OR f ). In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 Or-C(＝O)NR e R f . In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-NR d C(＝O)R 2 or-C (=O) NR e R f . In one embodiment, L 2 is-OC (=O) R 2 . In one embodiment, L 2 is-C (=O) OR 2 . In one embodiment, L 2 is-NR d C(＝O)R 2 . In one embodiment, L 2 is-C (=O) NR e R f 。
In one embodiment, G 1 Is a bond, and L 1 Is R 1 . In one embodiment, G 1 Is C 2 -C 12 Alkylene group, and L 1 is-C (=O) OR 1 。
In one embodiment, G 2 Is a bond, and L 2 Is R 2 . In one embodiment, G 2 Is C 2 -C 12 Alkylene group, and L 2 is-C (=O) OR 2 。
In one embodiment, the compound is a compound of formula (17):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, R 1 And R is 2 Each independently is a straight chain C 6 -C 24 Alkyl, branched C 6 -C 24 Alkyl or straight-chain C 6 -C 24 Alkenyl groups.
In one embodiment, R 1 And R is 2 Each independently is a straight chain C 6 -C 18 Alkyl, -R 7 -CH(R 8 )(R 9 ) Or C 6 -C 18 Alkenyl, wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group.
In one embodiment, R 1 And R is 2 Each independently is a straight chain C 7 -C 15 Alkyl or-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R 1 And R is 2 Each independently is a straight chain C 6 -C 24 An alkyl group. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 7 -C 15 An alkyl group. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 7 An alkyl group. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 9 An alkyl group. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 11 An alkyl group. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 13 An alkyl group. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 15 An alkyl group.
In one embodiment, R 1 And R is 2 Each independently is a branched chain C 6 -C 24 Alkyl or branched C 6 -C 24 Alkenyl groups.
In one embodiment, R 1 And R is 2 Each independently is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 1 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkyl or C 2 -C 10 Alkenyl groups.
In one embodiment, R 1 And R is 2 Each independently is a straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 6 -C 18 Alkenyl groups. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 17 Alkenyl groups.
In one placeIn one embodiment, R 1 Or R is 2 Or both independently have one of the following structures:
in one embodiment, R a And R is d Each independently is H.
In one embodiment, R b 、R c 、R e And R is f Each independently is n-hexyl or n-octyl.
In one embodiment, -N (R 4 )R 5 Has one of the following structures:
in one embodiment, the compound is a compound of table 9, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
Table 9.
/>
/>
/>
/>
In one embodiment, provided herein are compounds of formula (18):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
G 1 and G 2 Each independently is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
each L 1 Independently is-OC (=o) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
Each L 2 Independently is-OC (=o) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 Or R is 2 ；
R 1 And R is 2 Each independently is C 6 -C 24 Alkyl or C 6 -C 24 Alkenyl groups;
R a 、R b 、R d and R is e Each independently is H, C 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
R c and R is f Each independently is C 1 -C 24 Alkyl or C 2 -C 24 Alkenyl groups;
G 3 is C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene in which a part or all of the alkylene or alkenylene groups are optionally substituted by C 3 -C 8 Cycloalkylene, C 3 -C 8 Cycloalkenyl ene, C 3 -C 8 Cycloalkynylene, 4-to 8-membered heterocyclylene, C 6 -C 10 Arylene or 5 to 10 membered heteroarylene substitution;
R 3 is hydrogen, C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 2 -C 12 Alkynyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-to 8-membered heterocyclyl, C 6 -C 10 Aryl or 5 to 10 membered heteroaryl; or R is 3 、G 1 Or G 1 Together with the nitrogen to which they are attached, form a cyclic moiety; or R is 3 、G 3 Or G 3 Together with the nitrogen to which they are attached, form a cyclic moiety;
R 4 is C 1 -C 12 Alkyl or C 3 -C 8 Cycloalkyl;
x is 0, 1 or 2;
n is 1 or 2;
m is 1 or 2; and is also provided with
Wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenyl, cycloalkynylene, heterocyclylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
In one embodiment, n is 1. In one embodiment, n is 2. In one embodiment, m is 1. In one embodiment, m is 2. In one embodiment, n is 1 and m is 1. In one embodiment, n is 1 and m is 2. In one embodiment, n is 2 and m is 1. In one embodiment, n is 2 and m is 2.
In one embodiment, the compound is a compound of formula (19):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, G 3 Is C 2 -C 12 An alkylene group. In one embodiment, G 3 Is C 2 -C 8 An alkylene group. In one embodiment, G 3 Is C 2 -C 6 An alkylene group. In one embodiment, G 3 Is C 2 -C 4 An alkylene group. In one embodiment, G 3 Is C 2 An alkylene group. In one embodiment, G 3 Is C 3 An alkylene group. In one embodiment, G 3 Is C 4 An alkylene group. In one embodiment, G 3 Is C 5 An alkylene group. In one embodiment, G 3 Is C 6 An alkylene group. In one embodiment, G 3 is-CH 2 CH 2 -。
In one embodiment, G 3 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 3 Is C 2 -C 8 Alkenylene radicals. In one embodiment, G 3 Is C 2 -C 6 Alkenylene radicals. In one embodiment, G 3 Is C 2 -C 4 Alkenylene radicals. In one embodiment, G 3 Is C 2 Alkenylene radicals. In one embodiment, G 3 Is C 3 Alkenylene radicals. In one embodiment, G 3 Is C 4 Alkenylene radicals. In one embodiment, G 3 Is C 5 Alkenylene radicals. In one embodiment, G 3 Is C 6 Alkenylene radicals. In one embodiment, G 3 Is (Z) -CH 2 -CH＝CH-CH 2 -. In one embodiment, G 3 Is (E) -CH 2 -CH＝CH-CH 2 -。
In one embodiment, G 3 Is C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene in which a part or all of the alkylene or alkenylene groups are C-substituted 3 -C 8 Cycloalkylene, C 3 -C 8 Cycloalkenyl ene, C 3 -C 8 Cycloalkynylene, 4-to 8-membered heterocyclylene, C 6 -C 10 Arylene or 5 to 10 membered heteroarylene. In one embodiment, G 3 Is C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene in which a part or all of the alkylene or alkenylene groups are C-substituted 3 -C 8 Cycloalkyl group substitution. In one embodiment, G 3 Is C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene in which the alkylene or alkenylene groups are all C-substituted 3 -C 8 Cycloalkylene substitution, i.e. G 3 Is C 3 -C 8 Cycloalkylene radicals. In one embodiment, G 3 Is a cyclopropylene group. In one embodiment, G 3 Is cyclobutylidene. In one embodiment, G 3 Is cyclopentylene. In one embodiment, G 3 Is cyclohexylidene. In one embodiment, G 3 Is cycloheptylene. In one embodiment, G 3 Is cyclooctylene.
In one embodiment, G 3 Is that
In one embodiment, G 3 Unsubstituted.
In one embodiment, the compound is a compound of formula (20):
wherein s is an integer of 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 3. In one embodiment, s is 4. In one embodiment, s is 5. In one embodiment, s is 6.
In one embodiment, G 1 Is a key. In one embodiment, G 1 Is C 2 -C 12 An alkylene group. In one embodiment, G 1 Is C 4 -C 8 An alkylene group. In one embodiment, G 1 Is C 5 -C 7 An alkylene group. In one embodiment, G 1 Is C 5 An alkylene group. In one embodiment, G 1 Is C 7 An alkylene group. In one embodiment, G 1 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 1 Is C 4 -C 8 Alkenylene radicals. In one embodiment, G 1 Is C 5 -C 7 Alkenylene radicals. In one embodiment, G 1 Is C 5 Alkenylene radicals. In one embodiment, G 1 Is C 7 Alkenylene radicals.
In one embodiment, G 2 Is a key. In one embodiment, G 2 Is C 2 -C 12 An alkylene group. In one embodiment, G 2 Is C 4 -C 8 An alkylene group. At the position ofIn one embodiment, G 2 Is C 5 -C 7 An alkylene group. In one embodiment, G 2 Is C 5 An alkylene group. In one embodiment, G 2 Is C 7 An alkylene group. In one embodiment, G 2 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 2 Is C 4 -C 8 Alkenylene radicals. In one embodiment, G 2 Is C 5 -C 7 Alkenylene radicals. In one embodiment, G 2 Is C 5 Alkenylene radicals. In one embodiment, G 2 Is C 7 Alkenylene radicals.
In one embodiment, G 1 And G 2 Each independently is C 2 -C 12 An alkylene group. In one embodiment, G 1 And G 2 Each independently is C 5 An alkylene group. In one embodiment, G 1 And G 2 Each independently is C 7 An alkylene group.
In one embodiment, the compound is a compound of formula (21):
wherein s is an integer of 2 to 12,
y is an integer from 2 to 12; and is also provided with
z is an integer from 2 to 12;
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (21-A), (21-B), (21-C), (21-D), (21-E), (21-F), (21-G), or (21-H):
Or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (22):
wherein y is an integer from 2 to 12; and is also provided with
z is an integer from 2 to 12;
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (22-A), (22-B), (22-C), (22-D), (22-E), (22-F), (22-G), or (22-H):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, y and z are each independently integers from 2 to 10. In one embodiment, y and z are each independently integers from 2 to 6. In one embodiment, y and z are each independently integers from 4 to 10.
In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8 and 9. In one embodiment, y is 5 and z is 5.
In one embodiment, s is an integer from 2 to 12. In one embodiment, s is an integer from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one embodiment, s is an integer from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 3. In one embodiment, s is 4. In one embodiment, s is 5. In one embodiment, s is 6.
In one embodiment, y is 5, z is 5, and s is 2.
In one embodiment, L 1 Is R 1 。
In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 OR-P (=O) (OR b )(OR c ). In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 or-C (=O) NR b R c . In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-NR a C(＝O)R 1 or-C (=O) NR b R c . In one embodiment, L 1 is-OC (=O) R 1 . In one embodiment, L 1 is-C (=O) OR 1 . In one embodiment, L 1 is-NR a C(＝O)R 1 . In one embodiment, L 1 is-C (=O) NR b R c . In one embodiment, L 1 is-OR 1 。
In one embodiment, L 2 Is R 2 。
In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 OR-P (=O) (OR e )(OR f ). In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 or-C (=O) NR e R f . In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-NR d C(＝O)R 2 or-C (=O) NR e R f . In one embodiment, L 2 is-OC (=O) R 2 . In one embodiment, L 2 is-C (=O) OR 2 . In one embodiment, L 2 is-NR d C(＝O)R 2 . In one embodiment, L 2 is-C (=O) NR e R f . In one embodiment, L 2 is-OR 2 。
In one embodiment, L 1 is-C (=O) OR 1 or-C (=O) NR b R c The method comprises the steps of carrying out a first treatment on the surface of the And L is 2 is-C (=O) OR 2 or-C (=O) NR e R f . In one embodiment, L 1 is-C (=O) OR 1 And L is 2 is-C (=O) OR 2 . In one embodiment, L 1 is-C (=O) OR 1 And L is 2 is-C (=O) NR e R f . In one embodiment, L 1 is-C (=O) NR b R c And L is 2 is-C (=O) OR 2 . In one embodiment, L 1 is-C (=O) NR b R c And L is 2 is-C (=O) NR e R f 。
In one embodiment, L 1 is-OC (=O) R 1 or-NR a C(＝O)R 1 The method comprises the steps of carrying out a first treatment on the surface of the And L is 2 is-OC (=O) R 2 or-NR d C(＝O)R 2 . In one embodiment, L 1 is-OC (=O) R 1 And L is 2 is-OC (=O) R 2 . In one embodiment, L 1 is-OC (=O) R 1 And L is 2 is-NR d C(＝O)R 2 . In one embodiment, L 1 is-NR a C(＝O)R 1 And L is 2 is-OC (=O) R 2 . In one embodiment, L 1 is-NR a C(＝O)R 1 And L is 2 is-NR d C(＝O)R 2 。
In one embodiment, L 1 is-OR 1 And L is 2 is-C (=O) OR 2 . In one embodiment, L 1 is-OR 1 And L is 2 is-C (=O) NR e R f . In one embodiment, L 1 is-C (=O) OR 1 And L is 2 is-OR 2 . In one embodiment, L 1 is-C (=O) NR b R c And L is 2 is-OR 2 。
In one embodiment, the compound is a compound of formula (23):
wherein z is an integer from 2 to 12;
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, z is an integer from 2 to 10. In one embodiment, z is an integer from 2 to 6. In one embodiment, z is an integer from 4 to 10. In one embodiment, z is selected from 4, 5, 6, 7, 8, and 9. In one embodiment, z is 5.
In one embodiment, R 3 Is C 1 -C 12 An alkyl group. In one embodiment, R 3 Is C 1 -C 8 An alkyl group. In one embodiment, R 3 Is C 1 -C 6 An alkyl group. In one embodiment, R 3 Is C 1 -C 4 An alkyl group. In one embodiment, the alkyl group is a straight chain alkyl group. In one embodiment, the alkyl group is a branched alkyl group. In one embodiment, R 3 Is methyl. In one embodiment, R 3 Is ethyl. In one embodiment, R 3 Is n-propyl. In one embodiment, R 3 Is isopropyl. In one embodimentIn the scheme, R 3 Is n-butyl. In one embodiment, R 3 Is n-amyl. In one embodiment, R 3 Is n-hexyl. In one embodiment, R 3 Is n-octyl. In one embodiment, R 3 Is n-nonyl.
In one embodiment, R 3 Is C 2 -C 12 Alkenyl groups. In one embodiment, R 3 Is C 2 -C 8 Alkenyl groups. In one embodiment, R 3 Is C 2 -C 4 Alkenyl groups. In one embodiment, the alkenyl group is a linear alkenyl group. In one embodiment, the alkenyl group is a branched alkenyl group. In one embodiment, R 3 Is vinyl. In one embodiment, R 3 Is allyl.
In one embodiment, R 3 Is C 2 -C 12 Alkynyl groups. In one embodiment, R 3 Is C 2 -C 8 Alkynyl groups. In one embodiment, R 3 Is C 2 -C 4 Alkynyl groups. In one embodiment, the alkynyl group is a straight chain alkynyl group. In one embodiment, the alkynyl group is a branched alkynyl group.
In one embodiment, R 3 Is C 3 -C 8 Cycloalkyl groups. In one embodiment, R 3 Is cyclopropyl. In one embodiment, R 3 Is cyclobutyl. In one embodiment, R 3 Is cyclopentyl. In one embodiment, R 3 Is cyclohexyl. In one embodiment, R 3 Is cycloheptyl. In one embodiment, R 3 Is cyclooctyl.
In one embodiment, R 3 Is C 3 -C 8 A cycloalkenyl group. In one embodiment, R 3 Is cyclopropenyl. In one embodiment, R 3 Is cyclobutenyl. In one embodiment, R 3 Is cyclopentenyl. In one embodiment, R 3 Is cyclohexenyl. In one embodiment, R 3 Is cycloheptenyl. In one embodiment, R 3 Is cyclooctenyl.
In one embodiment, R 3 Is a 4-to 8-membered heterocyclic group. In one embodiment, R 3 Is a 4-to 8-membered heterocycloalkyl. In one embodiment, R 3 Is oxetanyl. In one embodiment, R 3 Is tetrahydrofuranyl. In one embodiment, R 3 Is tetrahydropyranyl. In one embodiment, R 3 Is tetrahydrothiopyranyl.
In one embodiment, R 3 Is C 6 -C 10 Aryl groups. In one embodiment, R 3 Is phenyl.
In one embodiment, R 3 Is a 5 to 10 membered heteroaryl. In one embodiment, R 3 Is a 5 membered heteroaryl. In one embodiment, R 3 Is a 6 membered heteroaryl.
In one embodiment, R 3 、G 1 Or G 1 Together with the nitrogen to which they are attached form a cyclic moiety.
In one embodiment, the compound is a compound of formula (24):
wherein s is an integer of 2 to 12,
u is 1, 2 or 3;
v is 1, 2 or 3;
y' is an integer from 0 to 10; and is also provided with
z is an integer from 2 to 12;
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, R 3 、G 3 Or G 3 Together with the nitrogen to which they are attached form a cyclic moiety.
In one embodiment, the compound is a compound of formula (25):
wherein s' is an integer of 0 to 10,
u is 1, 2 or 3;
v is 1, 2 or 3;
y is an integer from 2 to 10; and is also provided with
z is an integer from 2 to 12;
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, u is 1. In one embodiment, u is 2. In one embodiment, u is 3. In one embodiment, v is 1. In one embodiment, v is 2. In one embodiment, v is 3. In one embodiment, u is 1 and v is 1. In one embodiment, u is 2 and v is 2. In one embodiment, u is 3 and v is 3.
In one embodiment, R 3 Unsubstituted.
In one embodiment, R 3 Substituted with one or more substituents selected from the group consisting of: c (C) 1 -C 6 Alkyl, halo, C 1 -C 6 Haloalkyl, nitro, oxo, -OR g 、-NR g C(＝O)R h 、-C(＝O)NR g R h 、-C(＝O)R h 、-OC(＝O)R h 、-C(＝O)OR h and-O-R i -OH, wherein:
R g at each occurrence independently is H or C 1 -C 6 An alkyl group;
R h independently at each occurrence C 1 -C 6 An alkyl group; and is also provided with
R i Independently at each occurrence C 1 -C 6 An alkylene group.
In one embodiment, R 3 Via one or more C 1 -C 6 Haloalkyl (e.g., methyl) radicalsAnd (3) replacing. In one embodiment, R 3 Substituted with one or more halo groups (e.g., -F). In one embodiment, R 3 Via one or more C 1 -C 6 Haloalkyl (e.g., -CF) 3 ) And (3) substitution. In one embodiment, R 3 Substituted with one or more hydroxy groups. In one embodiment, R 3 Substituted with a hydroxy group.
In one embodiment, R 4 Is C 1 -C 12 An alkyl group. In one embodiment, R 4 Is C 1 -C 8 An alkyl group. In one embodiment, R 4 Is C 1 -C 6 An alkyl group. In one embodiment, R 4 Is C 1 -C 4 An alkyl group. In one embodiment, R 4 Is methyl. In one embodiment, R 4 Is ethyl. In one embodiment, R 4 Is n-propyl. In one embodiment, R 4 Is isopropyl. In one embodiment, R 4 Is n-butyl. In one embodiment, R 4 Is n-amyl. In one embodiment, R 4 Is n-hexyl. In one embodiment, R 4 Is n-octyl. In one embodiment, R 4 Is n-nonyl.
In one embodiment, R 4 Is C 3 -C 8 Cycloalkyl groups. In one embodiment, R 4 Is cyclopropyl. In one embodiment, R 4 Is cyclobutyl. In one embodiment, R 4 Is cyclopentyl. In one embodiment, R 4 Is cyclohexyl. In one embodiment, R 4 Is cycloheptyl. In one embodiment, R 4 Is cyclooctyl.
In one embodiment, R 4 Unsubstituted.
In one embodiment, R 4 Substituted with one or more substituents selected from the group consisting of: oxo, -OR g 、-NR g C(＝O)R h 、-C(＝O)NR g R h 、-C(＝O)R h 、-OC(＝O)R h 、-C(＝O)OR h 、-O-R i -OH and-N (R) 20 )R 21 Wherein:
R g at each occurrence independently is H or C 1 -C 6 An alkyl group;
R h independently at each occurrence C 1 -C 6 An alkyl group;
R i independently at each occurrence C 1 -C 6 An alkylene group;
R 20 is hydrogen or C 1 -C 6 An alkyl group;
R 21 is C 1 -C 6 Alkyl, C 3 -C 8 Cycloalkyl or C 3 -C 8 A cycloalkenyl group;
or R is 20 And R is 21 Forms together with the nitrogen to which they are attached a cyclic moiety;
and R is 21 Or cyclic moieties optionally via hydroxy, oxo, -NH 2 、-NH(C 1 -C 6 Alkyl) or-N (C) 1 -C 6 Alkyl group 2 One or more substitutions in (a).
In one embodiment, R 4 Substituted with one or more hydroxy groups. In one embodiment, R 4 Substituted with a hydroxy group.
In one embodiment, R 4 Is substituted C 1 -C 12 An alkyl group. In one embodiment, R 4 Is- (CH) 2 ) p Q、-(CH 2 ) p CHQR, -CHQR or-CQ (R) 2 Wherein Q is C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-to 8-membered heterocyclyl, C 6 -C 10 Aryl, 5-to 10-membered heteroaryl, -OR, -O (CH) 2 ) p N(R) 2 、-C(O)OR、-OC(O)R、-CX 3 、-CX 2 H、-CXH 2 、-CN、-N(R) 2 、-C(O)N(R) 2 、-N(R)C(O)R、-N(R)S(O) 2 R、-N(R)C(O)N(R) 2 、-N(R)C(S)N(R) 2 、-N(R)R 22 、-O(CH 2 ) p OR、-N(R)C(＝NR 23 )N(R) 2 、-N(R)C(＝CHR 23 )N(R) 2 、-OC(O)N(R) 2 、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O) 2 R、-N(OR)C(O)OR、-N(OR)C(O)N(R) 2 、-N(OR)C(S)N(R) 2 、-N(OR)C(＝NR 23 )N(R) 2 、-N(OR)C(＝CHR 23 )N(R) 2 、-C(＝NR 23 )N(R) 2 、-C(＝NR 23 ) R, -C (O) N (R) OR OR-C (R) N (R) 2 C (O) OR, and each p is independently 1, 2, 3, 4, OR 5;
R 22 is C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-to 8-membered heterocyclyl, C 6 -C 10 Aryl or 5 to 10 membered heteroaryl;
R 23 is H, -CN, -NO 2 、C 1 -C 6 Alkyl, -OR, -S (O) 2 R、-S(O) 2 N(R) 2 、C 2 -C 6 Alkenyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-to 8-membered heterocyclyl, C 6 -C 10 Aryl or 5 to 10 membered heteroaryl;
each R is independently H, C 1 -C 3 Alkyl or C 2 -C 3 Alkenyl groups; or N (R) 2 Two R in the moiety together with the nitrogen to which they are attached form a cyclic moiety; and is also provided with
Each X is independently F, cl, br or I.
In one embodiment, R 4 is-CH 2 CH 2 OH。
In one embodiment, R 1 Is straight chain C 6 -C 24 An alkyl group. In one embodiment, R 1 Is straight chain C 7 -C 15 An alkyl group. In one embodiment, R 1 Is straight chain C 7 An alkyl group. In one embodiment, R 1 Is straight chain C 8 An alkyl group. In one embodiment, R 1 Is straight chain C 9 An alkyl group. In one embodiment, R 1 Is straight chain C 10 An alkyl group. In one placeIn one embodiment, R 1 Is straight chain C 11 An alkyl group. In one embodiment, R 1 Is straight chain C 12 An alkyl group. In one embodiment, R 1 Is straight chain C 13 An alkyl group. In one embodiment, R 1 Is straight chain C 14 An alkyl group. In one embodiment, R 1 Is straight chain C 15 An alkyl group.
In one embodiment, R 1 Is straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R 1 Is straight chain C 7 -C 17 Alkenyl groups. In one embodiment, R 1 Is straight chain C 7 Alkenyl groups. In one embodiment, R 1 Is straight chain C 8 Alkenyl groups. In one embodiment, R 1 Is straight chain C 9 Alkenyl groups. In one embodiment, R 1 Is straight chain C 10 Alkenyl groups. In one embodiment, R 1 Is straight chain C 11 Alkenyl groups. In one embodiment, R 1 Is straight chain C 12 Alkenyl groups. In one embodiment, R 1 Is straight chain C 13 Alkenyl groups. In one embodiment, R 1 Is straight chain C 14 Alkenyl groups. In one embodiment, R 1 Is straight chain C 15 Alkenyl groups. In one embodiment, R 1 Is straight chain C 16 Alkenyl groups. In one embodiment, R 1 Is straight chain C 17 Alkenyl groups.
In one embodiment, R 1 Is branched C 6 -C 24 An alkyl group. In one embodiment, R 1 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group. In one embodiment, R 1 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R 1 Is branched C 6 -C 24 Alkenyl groups. In one embodiment, R 1 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkenyl groups. In one embodiment, R 1 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 6 -C 10 Alkenyl groups.
In one embodiment, R 2 Is straight chain C 6 -C 24 An alkyl group. In one embodiment, R 2 Is straight chain C 7 -C 15 An alkyl group. In one embodiment, R 2 Is straight chain C 7 An alkyl group. In one embodiment, R 2 Is straight chain C 8 An alkyl group. In one embodiment, R 2 Is straight chain C 9 An alkyl group. In one embodiment, R 2 Is straight chain C 10 An alkyl group. In one embodiment, R 2 Is straight chain C 11 An alkyl group. In one embodiment, R 2 Is straight chain C 12 An alkyl group. In one embodiment, R 2 Is straight chain C 13 An alkyl group. In one embodiment, R 2 Is straight chain C 14 An alkyl group. In one embodiment, R 2 Is straight chain C 15 An alkyl group.
In one embodiment, R 2 Is straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R 2 Is straight chain C 7 -C 17 Alkenyl groups. In one embodiment, R 2 Is straight chain C 7 Alkenyl groups. In one embodiment, R 2 Is straight chain C 8 Alkenyl groups. In one embodiment, R 2 Is straight chain C 9 Alkenyl groups. In one embodiment, R 2 Is straight chain C 10 Alkenyl groups. In one embodiment, R 2 Is straight chain C 11 Alkenyl groups. In one embodiment, R 2 Is straight chain C 12 Alkenyl groups. In one embodiment, R 2 Is straight chain C 13 Alkenyl groups. In one embodiment, R 2 Is straight chain C 14 Alkenyl groups. In one embodiment, R 2 Is straight chain C 15 Alkenyl groups. In one embodiment, R 2 Is straight chain C 16 Alkenyl groups. In one embodiment, R 2 Is straight chain C 17 Alkenyl groups.
In one embodiment, R 2 Is branched C 6 -C 24 An alkyl group. In one embodiment, R 2 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group. In one embodiment, R 2 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R 2 Is branched C 6 -C 24 Alkenyl groups. In one embodiment, R 2 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkenyl groups. In one embodiment, R 2 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 6 -C 10 Alkenyl groups.
In one embodiment, R c Is straight chain C 6 -C 24 An alkyl group. In one embodiment, R c Is straight chain C 7 -C 15 An alkyl group. In one embodiment, R c Is straight chain C 7 An alkyl group. In one embodiment, R c Is straight chain C 8 An alkyl group. In one embodiment, R c Is straight chain C 9 An alkyl group. In one embodiment, R c Is straight chain C 10 An alkyl group. In one embodiment, R c Is straight chain C 11 An alkyl group. In one embodiment, R c Is straight chain C 12 An alkyl group. In one embodiment, R c Is straight chain C 13 An alkyl group. In one embodiment, R c Is straight chain C 14 An alkyl group. In one embodiment, R c Is straight chain C 15 An alkyl group.
In one embodiment, R c Is straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R c Is straight chain C 7 -C 17 Alkenyl groups. In one embodiment, R c Is straight chain C 7 Alkenyl groups. In one embodiment, R c Is straight chain C 8 Alkenyl groups. In one embodiment, R c Is straight chain C 9 Alkenyl groups. In one embodiment, R c Is straight chain C 10 Alkenyl groups. In one embodiment, R c Is straight chain C 11 Alkenyl groups. In one embodiment, R c Is straight chain C 12 Alkenyl groups. In one embodiment, R c Is straight chain C 13 Alkenyl groups. In one embodiment, R c Is straight chain C 14 Alkenyl groups. In one embodiment, R c Is straight chain C 15 Alkenyl groups. In one embodiment, R c Is straight chain C 16 Alkenyl groups. In one embodiment, R c Is straight chain C 17 Alkenyl groups.
In one embodiment, R c Is branched C 6 -C 24 An alkyl group. In one embodiment, R c is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group. In one embodiment, R c is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R c Is branched C 6 -C 24 Alkenyl groups. In one embodiment, R c is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkenyl groups. In one embodiment, R c is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 6 -C 10 Alkenyl groups.
In one embodiment, R f Is straight chain C 6 -C 24 An alkyl group. In one embodiment, R f Is straight chain C 7 -C 15 An alkyl group. In one embodiment, R f Is straight chain C 7 An alkyl group. In one embodiment, R f Is straight chain C 8 An alkyl group. In one embodiment, R f Is straight chain C 9 An alkyl group. In one embodiment, R f Is straight chain C 10 An alkyl group. In one embodiment, R f Is straight chain C 11 An alkyl group. In one embodiment, R f Is straight chain C 12 An alkyl group. In one embodiment, R f Is straight chain C 13 An alkyl group. In one embodiment, R f Is straight chain C 14 An alkyl group. In one embodiment, R f Is straight chain C 15 An alkyl group.
In one embodiment, R f Is straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R f Is straight chain C 7 -C 17 Alkenyl groups. In one embodiment, R f Is straight chain C 7 Alkenyl groups. In one embodiment, R f Is straight chain C 8 Alkenyl groups. In one embodiment, R f Is straight chain C 9 Alkenyl groups. In one embodiment, R f Is straight chain C 10 Alkenyl groups. In one embodiment, R f Is straight chain C 11 Alkenyl groups. In one embodiment, R f Is straight chain C 12 Alkenyl groups. In one embodiment, R f Is straight chain C 13 Alkenyl groups. In one embodiment, R f Is straight chain C 14 Alkenyl groups. In one embodiment, R f Is straight chain C 15 Alkenyl groups. In one embodiment, R f Is straight chain C 16 Alkenyl groups. In one embodiment, R f Is straight chain C 17 Alkenyl groups.
In one embodiment, R f Is branched C 6 -C 24 An alkyl group. In one embodiment, R f is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group. In one embodiment, R f is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R f Is branched C 6 -C 24 Alkenyl groups. In one embodiment, R f is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkenyl groups. In one embodiment, R f is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 6 -C 10 Alkenyl groups.
In one embodiment, R 1 、R 2 、R c And R is f Each independently is a straight chain C 6 -C 18 Alkyl, straight chain C 6 -C 18 Alkenyl or-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkyl or C 2 -C 10 Alkenyl groups.
In one embodiment, R 1 、R 2 、R c And R is f Each independently is straightChain C 7 -C 15 Alkyl, straight chain C 7 -C 15 Alkenyl or-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 Alkyl or C 6 -C 10 Alkenyl groups.
In one embodiment, R 1 、R 2 、R c And R is f Each independently is one of the following structures:
in one embodiment, R a 、R b 、R d And R is e Each independently is H.
In one embodiment, the compound is a compound of table 10, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
Table 10.
/>
/>
/>
/>
In one embodiment, the compound is a compound of table 11, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
Table 11.
/>
/>
/>
/>
/>
/>
/>
In one embodiment, provided herein are compounds of formula (26):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
G 1 is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
each L 1 Independently is-OC (=o) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
R 1 Is C 6 -C 24 Alkyl or C 6 -C 24 Alkenyl groups;
R a and R is b Each independently is H, C 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
R c is C 1 -C 24 Alkyl or C 2 -C 24 Alkenyl groups;
R 3 is hydrogen, C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 2 -C 12 Alkynyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-to 8-membered heterocyclyl, C 6 -C 10 Aryl or 5 to 10 membered heteroaryl; or R is 3 、G 1 Or G 1 Together with the nitrogen to which they are attached, form a cyclic moiety;
x is 0, 1 or 2;
n is 1 or 2; and is also provided with
Z is-OH or halogen;
wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenyl, cycloalkynylene, heterocyclylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
In one embodiment, Z is-OH. In one embodiment, Z is halogen. In one embodiment, Z is-Cl.
In one embodiment, the compound of formula (26) is an intermediate used in the preparation of the compound of formula (18), e.g., as exemplified in the examples provided herein.
In one embodiment, provided herein are compounds of formula (27):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
G 1 and G 2 Each independently is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
L 2 is-OC (=O)R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 Or R is 2 ；
R 1 And R is 2 Each independently is C 5 -C 32 Alkyl or C 5 -C 32 Alkenyl groups;
R a 、R b 、R d and R is e Each independently is H, C 1 -C 24 Alkyl or C 2 -C 24 Alkenyl groups;
R c and R is f Each independently is C 1 -C 32 Alkyl or C 2 -C 32 Alkenyl groups;
R 0 is C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl;
G 3 is C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
R 4 is C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl;
R 5 is C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4 to8 membered heterocycloalkyl;
x is 0, 1 or 2;
s is 0 or 1; and is also provided with
Wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, alkylene, alkenylene, arylene, and heteroarylene is independently optionally substituted.
In one embodiment, s is 0. In one embodiment, s is 1.
In one embodiment, provided herein are compounds of formula (28):
Or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
G 1 and G 2 Each independently is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 Or R is 2 ；
R 1 And R is 2 Each independently is C 5 -C 32 Alkyl or C 5 -C 32 Alkenyl groups;
y is H, C 1 -C 14 Alkyl or-C (=o) (C 1 -C 14 An alkyl group);
R a 、R b 、R d and R is e Each independently is H, C 1 -C 24 Alkyl or C 2 -C 24 Alkenyl groups;
R c and R is f Each independently is C 1 -C 32 Alkyl or C 2 -C 32 Alkenyl groups;
G 3 is C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
R 3 is-N (R) 4 )R 5 OR-OR 6 ；
R 4 Is C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl;
R 5 is C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl; or R is 4 、R 5 Forms together with the nitrogen to which they are attached a cyclic moiety;
R 6 is hydrogen, C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl or C 6 -C 10 An aryl group;
x is 0, 1 or 2; and is also provided with
Wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, alkylene, alkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
In one embodiment, Y is H.
In one embodiment, Y is C 1 -C 14 An alkyl group. In one embodiment, Y is C 4 -C 14 An alkyl group. In one embodiment, Y is C 6 -C 12 An alkyl group. In one embodiment, Y is n-hexyl. In one embodiment, Y is n-octyl. In one embodiment, Y is n-decyl. In one embodiment, Y is n-dodecyl.
In one embodiment, Y is-C (=o) (C 1 -C 14 Alkyl). In one embodiment, Y is-C (=o) (C 1 -C 5 Alkyl). In one embodiment, Y is acetyl. In one embodiment, Y is propionyl. In one embodiment, Y is-C (=o) (n-pentyl).
In one embodiment, provided herein are compounds of formula (29):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
R 1 and R is 2 Each independently is C 5 -C 32 Alkyl or C 5 -C 32 Alkenyl groups;
R 0 is C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl;
G 3 is C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
G 4 is C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
R 3 is-N (R) 4 )R 5 OR-OR 6 ；
R 4 Is C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl;
R 5 is C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl; or R is 4 、R 5 Forms together with the nitrogen to which they are attached a cyclic moiety;
R 6 is hydrogen, C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl or C 6 -C 10 An aryl group; and is also provided with
Wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, alkylene, alkenylene, and cyclic moiety is independently optionally substituted.
In one embodiment, G 4 Is C 2 -C 12 An alkylene group. In one embodiment, G 4 Is C 2 -C 8 An alkylene group. In one embodiment, G 4 Is C 2 -C 6 An alkylene group. In one embodiment, G 4 Is C 2 -C 4 An alkylene group. In one embodiment, G 4 Is C 2 An alkylene group. In one embodiment, G 4 Is C 4 An alkylene group.
In one embodiment, G 4 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 4 Is C 2 -C 8 Alkenylene radicals. In one embodiment, G 4 Is C 2 -C 6 Alkenylene radicals. In one embodiment, G 4 Is C 2 -C 4 Alkenylene radicals.
In one embodiment, G 3 Is C 2 -C 12 An alkylene group. In one embodiment, G 3 Is C 2 -C 8 An alkylene group. In one embodiment, G 3 Is C 2 -C 6 An alkylene group. In one embodiment, G 3 Is C 2 -C 4 An alkylene group. In one embodiment, G 3 Is C 2 An alkylene group. In one embodiment, G 3 Is C 4 An alkylene group.
In one embodiment, G 3 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 3 Is C 2 -C 8 Alkenylene radicals. In one embodiment, G 3 Is C 2 -C 6 Alkenylene radicals. In one embodiment, G 3 Is C 2 -C 4 Alkenylene radicals.
In one embodiment, G 3 Substituted with one or more oxo groups. In one embodiment, G 3 Is- (C) 1 -C 11 Alkylene) -C (=o) -. In one embodiment, G 3 Is- (C) 1 -C 7 Alkylene) -C (=o) -. In one embodiment, G 3 Is- (C) 1 -C 5 Alkylene) -C (=o) -. In one embodiment, G 3 Is- (C) 1 -C 3 Alkylene) -C (=o) -. In one embodiment, G 3 is-CH 2 -C (=o) -. In one embodiment, G 3 is-CH 2 -CH 2 -CH 2 -C (=o) -. In one embodiment, -C (=o) -is attached to the nitrogen atom and alkylene is attached to-N (R) 4 )R 5 OR-OR 6 。
In one embodiment, R 3 is-OR 6 。
In one embodiment, R 6 Is hydrogen (i.e. R 3 is-OH). In one embodiment, R 6 Is C 1 -C 12 An alkyl group. In one embodiment, R 6 Is C 1 -C 8 An alkyl group. In one ofIn embodiments, R 6 Is C 1 -C 6 An alkyl group. In one embodiment, R 6 Is C 1 -C 4 An alkyl group. In one embodiment, R 6 Is methyl. In one embodiment, R 6 Is ethyl. In one embodiment, R 6 Is C 3 -C 8 Cycloalkyl groups. In one embodiment, R 6 Is C 3 -C 8 A cycloalkenyl group. In one embodiment, R 6 Is C 6 -C 10 Aryl groups. In one embodiment, R 6 Is phenyl.
In one embodiment, R 3 is-N (R) 4 )R 5 。R 4 And R is 5 Described herein or elsewhere.
In one embodiment, the compound is a compound of formula (30):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (31):
wherein t is an integer of 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (32):
wherein t is an integer of 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (33):
wherein t is an integer from 2 to 12, and
u is an integer of 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, t is an integer from 2 to 12. In one embodiment, t is an integer from 1 to 10. In one embodiment, t is an integer from 1 to 8. In one embodiment, t is an integer from 1 to 6. In one embodiment, t is an integer from 1 to 4. In one embodiment, t is an integer from 1 to 3. In one embodiment, t is an integer from 1 to 2. In one embodiment, t is 1. In one embodiment, t is 2. In one embodiment, t is 3. In one embodiment, t is 4. In one embodiment, t is 5. In one embodiment, t is 6. In one embodiment, t is 7.
In one embodiment, u is an integer from 2 to 12. In one embodiment, u is an integer from 1 to 10. In one embodiment, u is an integer from 1 to 8. In one embodiment, u is an integer from 1 to 6. In one embodiment, u is an integer from 1 to 4. In one embodiment, u is an integer from 1 to 3. In one embodiment, u is an integer from 1 to 2. In one embodiment, u is 1. In one embodiment, u is 2. In one embodiment, u is 3. In one embodiment, u is 4. In one embodiment, u is 5. In one embodiment, u is 6. In one embodiment, u is 7.
In one embodiment, t is 2 and u is 4.
In one embodiment, R 0 Is C 1 -C 12 An alkyl group. In one embodiment, R 0 Is C 1 -C 10 An alkyl group. In one embodiment, R 0 Is C 1 -C 8 An alkyl group. At the position ofIn one embodiment, R 0 Is C 1 -C 6 An alkyl group. In one embodiment, R 0 Is C 1 -C 4 An alkyl group. In one embodiment, R 0 Is C 1 -C 2 An alkyl group. In one embodiment, R 0 Is methyl. In one embodiment, R 0 Is ethyl. In one embodiment, R 0 Is propyl. In one embodiment, R 0 Is n-butyl. In one embodiment, R 0 Is n-amyl. In one embodiment, R 0 Is n-hexyl. In one embodiment, R 0 Is n-octyl. In one embodiment, R 0 Is n-nonyl.
In one embodiment, R 0 Is C 2 -C 12 Alkenyl groups. In one embodiment, R 0 Is C 2 -C 8 Alkenyl groups. In one embodiment, R 0 Is C 2 -C 6 Alkenyl groups. In one embodiment, R 0 Is C 2 -C 4 Alkenyl groups. In one embodiment, the alkenyl group is a linear alkenyl group. In one embodiment, the alkenyl group is a branched alkenyl group. In one embodiment, R 0 Is vinyl. In one embodiment, R 0 Is allyl.
In one embodiment, R 0 Is C 3 -C 8 Cycloalkyl groups. In one embodiment, R 0 Is cyclopropyl. In one embodiment, R 0 Is cyclobutyl. In one embodiment, R 0 Is cyclopentyl. In one embodiment, R 0 Is cyclohexyl. In one embodiment, R 0 Is cycloheptyl. In one embodiment, R 0 Is cyclooctyl.
In one embodiment, R 0 Is C 3 -C 8 A cycloalkenyl group. In one embodiment, R 0 Is cyclopropenyl. In one embodiment, R 0 Is cyclobutenyl. In one embodiment, R 0 Is cyclopentenyl. In one embodiment, R 0 Is cyclohexenyl. In one embodimentWherein R is 0 Is cycloheptenyl. In one embodiment, R 0 Is cyclooctenyl.
In one embodiment, R 0 Is C 6 -C 10 Aryl groups. In one embodiment, R 0 Is phenyl.
In one embodiment, R 0 Is a 4-to 8-membered heterocyclic group. In one embodiment, R 0 Is a 4-to 8-membered heterocycloalkyl. In one embodiment, R 0 Is oxetanyl. In one embodiment, R 0 Is tetrahydrofuranyl. In one embodiment, R 0 Is tetrahydropyranyl. In one embodiment, R 0 Is tetrahydrothiopyranyl. In one embodiment, R 0 Is N-methylpiperidinyl.
In one embodiment, R 0 Unsubstituted. In one embodiment, R 0 Substituted.
In one embodiment, R 4 Is C 1 -C 12 An alkyl group. In one embodiment, R 4 Is C 1 -C 8 An alkyl group. In one embodiment, R 4 Is C 1 -C 6 An alkyl group. In one embodiment, R 4 Is C 1 -C 4 An alkyl group. In one embodiment, R 4 Is methyl. In one embodiment, R 4 Is ethyl. In one embodiment, R 4 Is n-propyl. In one embodiment, R 4 Is n-butyl. In one embodiment, R 4 Is n-amyl. In one embodiment, R 4 Is n-hexyl. In one embodiment, R 4 Is n-octyl. In one embodiment, R 4 Is n-nonyl.
In one embodiment, R 4 Is C 2 -C 12 Alkenyl groups. In one embodiment, R 4 Is C 2 -C 8 Alkenyl groups. In one embodiment, R 4 Is C 2 -C 6 Alkenyl groups. In one embodiment, R 4 Is C 2 -C 4 Alkenyl groups. In one embodiment of the present invention, in one embodiment,alkenyl is straight chain alkenyl. In one embodiment, the alkenyl group is a branched alkenyl group. In one embodiment, R 4 Is vinyl. In one embodiment, R 4 Is allyl.
In one embodiment, R 4 Is C 3 -C 8 Cycloalkyl groups. In one embodiment, R 4 Is cyclopropyl. In one embodiment, R 4 Is cyclobutyl. In one embodiment, R 4 Is cyclopentyl. In one embodiment, R 4 Is cyclohexyl. In one embodiment, R 4 Is cycloheptyl. In one embodiment, R 4 Is cyclooctyl.
In one embodiment, R 4 Is C 3 -C 8 A cycloalkenyl group. In one embodiment, R 4 Is cyclopropenyl. In one embodiment, R 4 Is cyclobutenyl. In one embodiment, R 4 Is cyclopentenyl. In one embodiment, R 4 Is cyclohexenyl. In one embodiment, R 4 Is cycloheptenyl. In one embodiment, R 4 Is cyclooctenyl.
In one embodiment, R 4 Is C 6 -C 10 Aryl groups. In one embodiment, R 4 Is phenyl.
In one embodiment, R 4 Is a 4-to 8-membered heterocyclic group. In one embodiment, R 4 Is a 4-to 8-membered heterocycloalkyl. In one embodiment, R 4 Is oxetanyl. In one embodiment, R 4 Is tetrahydrofuranyl. In one embodiment, R 4 Is tetrahydropyranyl. In one embodiment, R 4 Is tetrahydrothiopyranyl. In one embodiment, R 4 Is N-methylpiperidinyl.
In one embodiment, R 4 Unsubstituted.
In one embodiment, R 4 Substituted with one or more substituents selected from the group consisting of: oxo, -OR g 、-NR g C(＝O)R h 、-C(＝O)NR g R h 、-C(＝O)R h 、-OC(＝O)R h 、-C(＝O)OR h and-O-R i -OH, wherein:
R g at each occurrence independently is H or C 1 -C 6 An alkyl group;
R h independently at each occurrence C 1 -C 6 An alkyl group; and is also provided with
R i Independently at each occurrence C 1 -C 6 An alkylene group.
In one embodiment, R 4 Substituted with one or more hydroxy groups. In one embodiment, R 4 Substituted with a hydroxy group.
In one embodiment, R 4 Substituted with one or more hydroxy groups and one or more oxo groups. In one embodiment, R 4 Substituted with one hydroxy and one oxo group.
In one embodiment, R 5 Is C 1 -C 12 An alkyl group. In one embodiment, R 5 Is C 1 -C 10 An alkyl group. In one embodiment, R 5 Is C 1 -C 8 An alkyl group. In one embodiment, R 5 Is C 1 -C 6 An alkyl group. In one embodiment, R 5 Is C 1 -C 4 An alkyl group. In one embodiment, R 5 Is C 1 -C 2 An alkyl group. In one embodiment, R 5 Is methyl. In one embodiment, R 5 Is ethyl. In one embodiment, R 5 Is propyl. In one embodiment, R 5 Is n-butyl. In one embodiment, R 5 Is n-hexyl. In one embodiment, R 5 Is n-octyl. In one embodiment, R 5 Is n-nonyl.
In one embodiment, R 5 Is C 3 -C 8 Cycloalkyl groups. In one embodiment, R 5 Is cyclopropyl. In one embodiment, R 5 Is cyclobutyl. In one embodiment, R 5 Is a ringAnd (3) amyl. In one embodiment, R 5 Is cyclohexyl. In one embodiment, R 5 Is cycloheptyl. In one embodiment, R 5 Is cyclooctyl.
In one embodiment, R 5 Is C 3 -C 8 A cycloalkenyl group. In one embodiment, R 5 Is cyclopropenyl. In one embodiment, R 5 Is cyclobutenyl. In one embodiment, R 5 Is cyclopentenyl. In one embodiment, R 5 Is cyclohexenyl. In one embodiment, R 5 Is cycloheptenyl. In one embodiment, R 5 Is cyclooctenyl.
In one embodiment, R 5 Is C 6 -C 10 Aryl groups. In one embodiment, R 5 Is phenyl.
In one embodiment, R 5 Is a 4-to 8-membered heterocyclic group. In one embodiment, R 5 Is a 4-to 8-membered heterocycloalkyl. In one embodiment, R 5 Is oxetanyl. In one embodiment, R 5 Is tetrahydrofuranyl. In one embodiment, R 5 Is tetrahydropyranyl. In one embodiment, R 5 Is tetrahydrothiopyranyl.
In one embodiment, R 4 、R 5 Together with the nitrogen to which they are attached form a cyclic moiety.
In one embodiment, the cyclic moiety (consisting of R 4 And R is 5 Together with the nitrogen to which they are attached) is a heterocyclic group. In one embodiment, the cyclic moiety is a heterocycloalkyl group. In one embodiment, the cyclic moiety is a 4 to 8 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 4 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 5-membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 6 membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 7-membered heterocycloalkyl. In one embodiment, the cyclic moiety is an 8-membered heterocycloalkyl.
In one embodiment, the cyclic moiety (consisting of R 4 And R is 5 Formed together with the nitrogen to which they are attached) is azetidin-1-yl. In one embodiment, the cyclic moiety is pyrrolidin-1-yl. In one embodiment, the cyclic moiety is piperidin-1-yl. In one embodiment, the cyclic moiety is azepan-1-yl. In one embodiment, the cyclic moiety is azacyclooctan-1-yl. In one embodiment, the cyclic moiety is morpholinyl. In one embodiment, the cyclic moiety is piperazin-1-yl. The point of attachment in these groups is to G 3 。
As described herein and unless otherwise indicated, R 5 The substitution pattern of (C) is also applicable to R 4 And R is 5 A cyclic moiety formed with the nitrogen to which they are attached.
In one embodiment, R 5 Unsubstituted.
In one embodiment, R 5 Substituted with one or more substituents selected from the group consisting of: oxo, -OR g 、-NR g C(＝O)R h 、-C(＝O)NR g R h 、-C(＝O)R h 、-OC(＝O)R h 、-C(＝O)OR h and-O-R i -OH, wherein:
R g at each occurrence independently is H or C 1 -C 6 An alkyl group;
R h independently at each occurrence C 1 -C 6 An alkyl group; and is also provided with
R i Independently at each occurrence C 1 -C 6 An alkylene group.
In one embodiment, R 5 Substituted with one or more hydroxy groups. In one embodiment, R 5 Substituted with a hydroxy group.
In one embodiment, R 5 Substituted with one or more hydroxy groups and one or more oxo groups. In one embodiment, R 5 Substituted with one hydroxy and one oxo group. In one embodiment, R 5 is-CH 2 CH 2 OH。
In one embodiment, R 5 Is- (CH) 2 ) p Q、-(CH 2 ) p CHQR, -CHQR or-CQ (R) 2 Wherein Q is C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-to 8-membered heterocyclyl, C 6 -C 10 Aryl, 5-to 10-membered heteroaryl, -OR, -O (CH) 2 ) p N(R) 2 、-C(O)OR、-OC(O)R、-CX 3 、-CX 2 H、-CXH 2 、-CN、-N(R) 2 、-C(O)N(R) 2 、-N(R)C(O)R、-N(R)S(O) 2 R、-N(R)C(O)N(R) 2 、-N(R)C(S)N(R) 2 、-N(R)R 22 、-O(CH 2 ) p OR、-N(R)C(＝NR 23 )N(R) 2 、-N(R)C(＝CHR 23 )N(R) 2 、-OC(O)N(R) 2 、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O) 2 R、-N(OR)C(O)OR、-N(OR)C(O)N(R) 2 、-N(OR)C(S)N(R) 2 、-N(OR)C(＝NR 23 )N(R) 2 、-N(OR)C(＝CHR 23 )N(R) 2 、-C(＝NR 23 )N(R) 2 、-C(＝NR 23 ) R, -C (O) N (R) OR OR-C (R) N (R) 2 C (O) OR, and each p is independently 1, 2, 3, 4, OR 5;
R 22 is C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-to 8-membered heterocyclyl, C 6 -C 10 Aryl or 5 to 10 membered heteroaryl;
R 23 is H, -CN, -NO 2 、C 1 -C 6 Alkyl, -OR, -S (O) 2 R、-S(O) 2 N(R) 2 、C 2 -C 6 Alkenyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-to 8-membered heterocyclyl, C 6 -C 10 Aryl or 5 to 10 membered heteroaryl;
each R is independently H, C 1 -C 3 Alkyl or C 2 -C 3 Alkenyl groups; or N (R) 2 Two R in the moiety together with the nitrogen to which they are attached form a cyclic moiety; and is also provided with
Each X is independently F, cl, br or I.
In one embodiment, G 1 Is a key. In one embodiment, G 1 Is C 2 -C 12 An alkylene group. In one embodiment, G 1 Is C 4 -C 8 An alkylene group. In one embodiment, G 1 Is C 5 -C 7 An alkylene group. In one embodiment, G 1 Is C 5 An alkylene group. In one embodiment, G 1 Is C 7 An alkylene group. In one embodiment, G 1 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 1 Is C 4 -C 8 Alkenylene radicals. In one embodiment, G 1 Is C 5 -C 7 Alkenylene radicals. In one embodiment, G 1 Is C 5 Alkenylene radicals. In one embodiment, G 1 Is C 7 Alkenylene radicals.
In one embodiment, G 2 Is a key. In one embodiment, G 2 Is C 2 -C 12 An alkylene group. In one embodiment, G 2 Is C 4 -C 8 An alkylene group. In one embodiment, G 2 Is C 5 -C 7 An alkylene group. In one embodiment, G 2 Is C 5 An alkylene group. In one embodiment, G 2 Is C 7 An alkylene group. In one embodiment, G 2 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 2 Is C 4 -C 8 Alkenylene radicals. In one embodiment, G 2 Is C 5 -C 7 Alkenylene radicals. In one embodiment, G 2 Is C 5 Alkenylene radicals. In one embodiment, G 2 Is C 7 Alkenylene radicals.
In one embodiment, G 1 And G 2 Each independently is C 2 -C 12 An alkylene group. In one embodiment, G 1 And G 2 Each independently is C 2 An alkylene group. In one embodiment, G 1 And G 2 Each independently of the otherGround is C 5 An alkylene group. In one embodiment, G 1 And G 2 Each independently is C 7 An alkylene group.
In one embodiment, G 1 Unsubstituted. In one embodiment, G 1 Substituted. In one embodiment, G 2 Unsubstituted. In one embodiment, G 2 Substituted.
In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 OR-P (=O) (OR b )(OR c ). In one embodiment, L 1 Is- (C) 6 -C 10 Arylene) -R 1 . In one embodiment, L 1 Is- (6-to 10-membered heteroarylene) -R 1 . In one embodiment, L 1 Is R 1 。
In one embodiment, L 1 is-C (=O) R 1 、-OC(＝O)R 1 、-C(＝O)OR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 or-C (=O) NR b R c . In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-NR a C(＝O)R 1 or-C (=O) NR b R c . In one embodiment, L 1 is-C (=O) R 1 . In one embodiment, L 1 is-OC (=O) R 1 . In one embodiment, L 1 is-C (=O) OR 1 . In one embodiment, L 1 is-NR a C(＝O)R 1 . In one embodiment, L 1 is-C (=O)NR b R c . In one embodiment, L 1 is-NR a C(＝O)NR b R c . In one embodiment, L 1 is-OC (=O) NR b R c . In one embodiment, L 1 is-NR a C(＝O)OR 1 。
In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 OR-P (=O) (OR e )(OR f ). In one embodiment, L 2 Is- (C) 6 -C 10 Arylene) -R 2 . In one embodiment, L 2 Is- (6-to 10-membered heteroarylene) -R 2 . In one embodiment, L 2 Is R 2 。
In one embodiment, L 2 is-C (=O) R 2 、-OC(＝O)R 2 、-C(＝O)OR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 or-C (=O) NR e R f . In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-NR d C(＝O)R 2 or-C (=O) NR e R f . In one embodiment, L 2 is-C (=O) R 2 . In one embodiment, L 2 is-OC (=O) R 2 . In one embodiment, L 2 is-C (=O) OR 2 . In one embodiment, L 2 is-NR d C(＝O)R 2 . In one embodiment, L 2 is-C (=O) NR e R f . In one embodiment, L 2 is-NR d C(＝O)NR e R f . In one embodiment, L 2 is-OC (=O) NR e R f . In one embodiment, L 2 is-NR d C(＝O)OR 2 。
In one embodiment, L 1 is-OC (=O) R 1 、-NR a C(＝O)R 1 、-C(＝O)OR 1 or-C (=O) NR b R c And L is 2 is-OC (=O) R 2 、-NR d C(＝O)R 2 、-C(＝O)OR 2 or-C (=O) NR e R f . In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 or-C (=O) NR b R c And L is 2 is-OC (=O) R 2 、-C(＝O)OR 2 or-C (=O) NR e R f . In one embodiment, L 1 is-OC (=O) R 1 And L is 2 is-OC (=O) R 2 . In one embodiment, L 1 is-OC (=O) R 1 And L is 2 is-NR d C(＝O)R 2 . In one embodiment, L 1 is-NR a C(＝O)R 1 And L is 2 is-NR d C(＝O)R 2 . In one embodiment, L 1 is-C (=O) OR 1 And L is 2 is-C (=O) OR 2 . In one embodiment, L 1 is-C (=O) OR 1 And L is 2 is-C (=O) NR e R f . In one embodiment, L 1 is-C (=O) NR b R c And L is 2 is-C (=O) NR e R f 。
In one embodiment, L 1 is-NR a C(＝O)NR b R c And L is 2 is-NR d C(＝O)NR e R f . In one embodiment, L 1 is-OC (=O) NR b R c And L is 2 is-OC (=O) NR e R f . In one embodiment, L 1 is-NR a C(＝O)OR 1 And L is 2 is-NR d C(＝O)OR 2 。
In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-C(＝O)R 1 、-C(＝O)NR b R c Or R is 1 The method comprises the steps of carrying out a first treatment on the surface of the And L is 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-C(＝O)R 2 、-C(＝O)NR e R f Or R is 2 。
In one embodiment, -G 1 -L 1 Is R 1 and-G 2 -L 2 Is R 2 . In one embodiment, -G 1 -L 1 Is R 1 and-G 2 -L 2 is-C (=O) R 2 . In one embodiment, -G 1 -L 1 Is R 1 and-G 2 -L 2 Is- (C) 2 -C 12 Alkylene) -C (=o) OR 2 . In one embodiment, -G 1 -L 1 Is R 1 and-G 2 -L 2 Is- (C) 2 -C 12 Alkylene) -C (=o) NR e R f 。
In one embodiment, -G 1 -L 1 is-C (=O) R 1 and-G 2 -L 2 Is R 2 . In one embodiment, -G 1 -L 1 is-C (=O) R 1 and-G 2 -L 2 is-C (=O) R 2 . In one embodiment, -G 1 -L 1 is-C (=O) R 1 and-G 2 -L 2 Is- (C) 2 -C 12 Alkylene) -C (=o) OR 2 . In one embodiment, -G 1 -L 1 is-C (=O) R 1 and-G 2 -L 2 Is- (C) 2 -C 12 Alkylene) -C (=o) NR e R f 。
In one embodiment, -G 1 -L 1 Is- (C) 2 -C 12 Alkylene) -C (=o) OR 1 and-G 2 -L 2 Is R 2 . In one embodiment, -G 1 -L 1 Is- (C) 2 -C 12 Alkylene) -C (=o) OR 1 and-G 2 -L 2 is-C (=O) R 2 . In one embodiment, -G 1 -L 1 Is- (C) 2 -C 12 Alkylene) -C (=o) OR 1 and-G 2 -L 2 Is- (C) 2 -C 12 Alkylene) -C (=o) OR 2 . In one embodiment, -G 1 -L 1 Is- (C) 2 -C 12 Alkylene) -C (=o) OR 1 and-G 2 -L 2 Is- (C) 2 -C 12 Alkylene) -C (=o) NR e R f 。
In one embodiment, -G 1 -L 1 Is- (C) 2 -C 12 Alkylene) -C (=o) NR b R c and-G 2 -L 2 Is R 2 . In one embodiment, -G 1 -L 1 Is- (C) 2 -C 12 Alkylene) -C (=o) NR b R c and-G 2 -L 2 is-C (=O) R 2 . In one embodiment, -G 1 -L 1 Is- (C) 2 -C 12 Alkylene) -C (=o) NR b R c and-G 2 -L 2 Is- (C) 2 -C 12 Alkylene) -C (=o) OR 2 . In one embodiment, -G 1 -L 1 Is- (C) 2 -C 12 Alkylene) -C (=o) NR b R c and-G 2 -L 2 Is- (C) 2 -C 12 Alkylene) -C (=o) NR e R f 。
In one embodiment, the compound is a compound of formula (30-A), (30-B), (30-C), (30-D), (30-E), (30-F), (30-G), or (30-H):
wherein y and z are each independently integers from 2 to 12,
t is an integer of from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (31-A), (31-B), (31-C), (31-D), (31-E), (31-F), (31-G) or (31-H):
wherein y and z are each independently integers from 2 to 12, and
t is an integer of from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (32-A), (32-B), (32-C) or (32-D):
wherein z is an integer from 2 to 12, and
t is an integer of from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
In one embodiment, y is an integer from 2 to 12. In one embodiment, y is an integer from 1 to 10. In one embodiment, y is an integer from 1 to 8. In one embodiment, y is an integer from 1 to 6. In one embodiment, y is an integer from 1 to 4. In one embodiment, y is an integer from 1 to 3. In one embodiment, y is an integer from 1 to 2. In one embodiment, y is 1. In one embodiment, y is 2. In one embodiment, y is 3. In one embodiment, y is 4. In one embodiment, y is 5. In one embodiment, y is 6. In one embodiment, y is 7.
In one embodiment, z is an integer from 2 to 12. In one embodiment, z is an integer from 1 to 10. In one embodiment, z is an integer from 1 to 8. In one embodiment, z is an integer from 1 to 6. In one embodiment, z is an integer from 1 to 4. In one embodiment, z is an integer from 1 to 3. In one embodiment, z is an integer from 1 to 2. In one embodiment, z is 1. In one embodiment, z is 2. In one embodiment, z is 3. In one embodiment, z is 4. In one embodiment, z is 5. In one embodiment, z is 6. In one embodiment, z is 7.
In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 2, 3, 4, 5, 6, 7, 8, and 9. In one embodiment, y is 2 and z is 2. In one embodiment, y is 5 and z is 5.
In one embodiment, R 1 Is straight chain C 5 -C 32 An alkyl group. In one embodiment, R 1 Is straight chain C 6 -C 32 An alkyl group. In one embodiment, R 1 Is straight chain C 6 -C 24 An alkyl group. In one embodiment, R 1 Is straight chain C 7 -C 15 An alkyl group. In one embodiment, R 1 Is straight chain C 7 An alkyl group. In one embodiment, R 1 Is straight chain C 8 An alkyl group. In one embodiment, R 1 Is straight chain C 9 An alkyl group. In one embodiment, R 1 Is straight chain C 10 An alkyl group. In one embodiment, R 1 Is straight chain C 11 An alkyl group. In one embodiment, R 1 Is straight chain C 12 An alkyl group. In one embodiment, R 1 Is straight chain C 13 An alkyl group. In one embodiment, R 1 Is straight chain C 14 An alkyl group. In one embodiment, R 1 Is straight chain C 15 An alkyl group.
In one placeIn one embodiment, R 1 Is straight chain C 5 -C 32 Alkenyl groups. In one embodiment, R 1 Is straight chain C 6 -C 32 Alkenyl groups. In one embodiment, R 1 Is straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R 1 Is straight chain C 7 -C 17 Alkenyl groups. In one embodiment, R 1 Is straight chain C 7 Alkenyl groups. In one embodiment, R 1 Is straight chain C 8 Alkenyl groups. In one embodiment, R 1 Is straight chain C 9 Alkenyl groups. In one embodiment, R 1 Is straight chain C 10 Alkenyl groups. In one embodiment, R 1 Is straight chain C 11 Alkenyl groups. In one embodiment, R 1 Is straight chain C 12 Alkenyl groups. In one embodiment, R 1 Is straight chain C 13 Alkenyl groups. In one embodiment, R 1 Is straight chain C 14 Alkenyl groups. In one embodiment, R 1 Is straight chain C 15 Alkenyl groups. In one embodiment, R 1 Is straight chain C 16 Alkenyl groups. In one embodiment, R 1 Is straight chain C 17 Alkenyl groups.
In one embodiment, R 1 Is branched C 5 -C 32 An alkyl group. In one embodiment, R 1 Is branched C 6 -C 32 An alkyl group. In one embodiment, R 1 Is branched C 6 -C 24 An alkyl group. In one embodiment, R 1 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group. In one embodiment, R 1 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R 1 Is branched C 5 -C 32 Alkenyl groups. In one embodiment, R 1 Is branched C 6 -C 32 Alkenyl groups. In one embodiment, R 1 Is branched C 6 -C 24 Alkenyl groups. In one embodiment, R 1 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkenyl groups. In one embodiment, R 1 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 6 -C 10 Alkenyl groups.
In one embodiment, R 2 Is straight chain C 5 -C 32 An alkyl group. In one embodiment, R 2 Is straight chain C 6 -C 32 An alkyl group. In one embodiment, R 2 Is straight chain C 6 -C 24 An alkyl group. In one embodiment, R 2 Is straight chain C 7 -C 15 An alkyl group. In one embodiment, R 2 Is straight chain C 7 An alkyl group. In one embodiment, R 2 Is straight chain C 8 An alkyl group. In one embodiment, R 2 Is straight chain C 9 An alkyl group. In one embodiment, R 2 Is straight chain C 10 An alkyl group. In one embodiment, R 2 Is straight chain C 11 An alkyl group. In one embodiment, R 2 Is straight chain C 12 An alkyl group. In one embodiment, R 2 Is straight chain C 13 An alkyl group. In one embodiment, R 2 Is straight chain C 14 An alkyl group. In one embodiment, R 2 Is straight chain C 15 An alkyl group.
In one embodiment, R 2 Is straight chain C 5 -C 32 Alkenyl groups. In one embodiment, R 2 Is straight chain C 6 -C 32 Alkenyl groups. In one embodiment, R 2 Is straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R 2 Is straight chain C 7 -C 17 Alkenyl groups. In one embodiment，R 2 Is straight chain C 7 Alkenyl groups. In one embodiment, R 2 Is straight chain C 8 Alkenyl groups. In one embodiment, R 2 Is straight chain C 9 Alkenyl groups. In one embodiment, R 2 Is straight chain C 10 Alkenyl groups. In one embodiment, R 2 Is straight chain C 11 Alkenyl groups. In one embodiment, R 2 Is straight chain C 12 Alkenyl groups. In one embodiment, R 2 Is straight chain C 13 Alkenyl groups. In one embodiment, R 2 Is straight chain C 14 Alkenyl groups. In one embodiment, R 2 Is straight chain C 15 Alkenyl groups. In one embodiment, R 2 Is straight chain C 16 Alkenyl groups. In one embodiment, R 2 Is straight chain C 17 Alkenyl groups.
In one embodiment, R 2 Is branched C 5 -C 32 An alkyl group. In one embodiment, R 2 Is branched C 6 -C 32 An alkyl group. In one embodiment, R 2 Is branched C 6 -C 24 An alkyl group. In one embodiment, R 2 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group. In one embodiment, R 2 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R 2 Is branched C 5 -C 32 Alkenyl groups. In one embodiment, R 2 Is branched C 6 -C 32 Alkenyl groups. In one embodiment, R 2 Is branched C 6 -C 24 Alkenyl groups. In one embodiment, R 2 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkenyl groups. In one embodiment, R 2 is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 6 -C 10 Alkenyl groups.
In one embodiment, R c Is straight chain C 5 -C 32 An alkyl group. In one embodiment, R c Is straight chain C 6 -C 32 An alkyl group. In one embodiment, R c Is straight chain C 6 -C 24 An alkyl group. In one embodiment, R c Is straight chain C 7 -C 15 An alkyl group. In one embodiment, R c Is straight chain C 7 An alkyl group. In one embodiment, R c Is straight chain C 8 An alkyl group. In one embodiment, R c Is straight chain C 9 An alkyl group. In one embodiment, R c Is straight chain C 10 An alkyl group. In one embodiment, R c Is straight chain C 11 An alkyl group. In one embodiment, R c Is straight chain C 12 An alkyl group. In one embodiment, R c Is straight chain C 13 An alkyl group. In one embodiment, R c Is straight chain C 14 An alkyl group. In one embodiment, R c Is straight chain C 15 An alkyl group.
In one embodiment, R c Is straight chain C 5 -C 32 Alkenyl groups. In one embodiment, R c Is straight chain C 6 -C 32 Alkenyl groups. In one embodiment, R c Is straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R c Is straight chain C 7 -C 17 Alkenyl groups. In one embodiment, R c Is straight chain C 7 Alkenyl groups. In one embodiment, R c Is straight chain C 8 Alkenyl groups. In one embodiment, R c Is straight chain C 9 Alkenyl groups. In one embodiment, R c Is straight chain C 10 Alkenyl groups. In one embodiment, R c Is straight chain C 11 Alkenyl groups. In one embodiment of the present invention, in one embodiment,R c is straight chain C 12 Alkenyl groups. In one embodiment, R c Is straight chain C 13 Alkenyl groups. In one embodiment, R c Is straight chain C 14 Alkenyl groups. In one embodiment, R c Is straight chain C 15 Alkenyl groups. In one embodiment, R c Is straight chain C 16 Alkenyl groups. In one embodiment, R c Is straight chain C 17 Alkenyl groups.
In one embodiment, R c Is branched C 5 -C 32 An alkyl group. In one embodiment, R c Is branched C 6 -C 32 An alkyl group. In one embodiment, R c Is branched C 6 -C 24 An alkyl group. In one embodiment, R c is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group. In one embodiment, R c is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R c Is branched C 5 -C 32 Alkenyl groups. In one embodiment, R c Is branched C 6 -C 32 Alkenyl groups. In one embodiment, R c Is branched C 6 -C 24 Alkenyl groups. In one embodiment, R c is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkenyl groups. In one embodiment, R c is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 6 -C 10 Alkenyl groups.
In one embodiment, R f Is straight chain C 5 -C 32 An alkyl group. In one embodiment, R f Is straight chain C 6 -C 32 An alkyl group. In one embodiment, R f Is straight chain C 6 -C 24 An alkyl group. In one embodiment, R f Is straight chain C 7 -C 15 An alkyl group. In one embodiment, R f Is straight chain C 7 An alkyl group. In one embodiment, R f Is straight chain C 8 An alkyl group. In one embodiment, R f Is straight chain C 9 An alkyl group. In one embodiment, R f Is straight chain C 10 An alkyl group. In one embodiment, R f Is straight chain C 11 An alkyl group. In one embodiment, R f Is straight chain C 12 An alkyl group. In one embodiment, R f Is straight chain C 13 An alkyl group. In one embodiment, R f Is straight chain C 14 An alkyl group. In one embodiment, R f Is straight chain C 15 An alkyl group.
In one embodiment, R f Is straight chain C 5 -C 32 Alkenyl groups. In one embodiment, R f Is straight chain C 6 -C 32 Alkenyl groups. In one embodiment, R f Is straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R f Is straight chain C 7 -C 17 Alkenyl groups. In one embodiment, R f Is straight chain C 7 Alkenyl groups. In one embodiment, R f Is straight chain C 8 Alkenyl groups. In one embodiment, R f Is straight chain C 9 Alkenyl groups. In one embodiment, R f Is straight chain C 10 Alkenyl groups. In one embodiment, R f Is straight chain C 11 Alkenyl groups. In one embodiment, R f Is straight chain C 12 Alkenyl groups. In one embodiment, R f Is straight chain C 13 Alkenyl groups. In one embodiment, R f Is straight chain C 14 Alkenyl groups. In one embodiment, R f Is straight chain C 15 Alkenyl groups. In one embodiment, R f Is straight chain C 16 Alkenyl groups. In one embodiment of the present invention, in one embodiment,R f is straight chain C 17 Alkenyl groups.
In one embodiment, R f Is branched C 5 -C 32 An alkyl group. In one embodiment, R f Is branched C 6 -C 32 An alkyl group. In one embodiment, R f Is branched C 6 -C 24 An alkyl group. In one embodiment, R f is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group. In one embodiment, R f is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R f Is branched C 5 -C 32 Alkenyl groups. In one embodiment, R f Is branched C 6 -C 32 Alkenyl groups. In one embodiment, R f Is branched C 6 -C 24 Alkenyl groups. In one embodiment, R f is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkenyl groups. In one embodiment, R f is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 6 -C 10 Alkenyl groups.
In one embodiment, R 1 、R 2 、R c And R is f Each independently is a straight chain C 6 -C 18 Alkyl, straight chain C 6 -C 18 Alkenyl or-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkyl or C 2 -C 10 Alkenyl groups.
In one embodiment, R 1 、R 2 、R c And R is f Each independently is a straight chain C 7 -C 15 Alkyl, straight chain C 7 -C 15 Alkenyl or-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 Alkyl or C 6 -C 10 Alkenyl groups.
In one embodiment, R 1 、R 2 、R c And R is f Each independently is a branched chain C 6 -C 24 Alkyl or branched C 6 -C 24 Alkenyl groups. In one embodiment, R c And R is f Each independently is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 1 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkyl or C 2 -C 10 Alkenyl groups.
In one embodiment, R 1 、R 2 、R c And R is f Each independently is one of the following structures:
in one embodiment, R 1 、R 2 、R c And R is f Each independently optionally substituted.
In one embodiment, R a And R is d Each independently is H. In one embodiment, R a 、R b 、R d And R is e Each independently is H. In one embodiment, R a And R is d Each independently is C 1 -C 24 An alkyl group. In one embodiment, R a And R is d Each independently is C 1 -C 18 An alkyl group. In one embodiment, R a And R is d Each independently is C 1 -C 12 An alkyl group. In one embodiment, R a And R is d Each independently is C 1 -C 6 An alkyl group.
In one embodiment, R b 、R c 、R e And R is f Each independently is n-hexyl or n-octyl.
In one embodiment, the compound is a compound of table 12, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
Table 12.
/>
/>
/>
/>
In one embodiment, the compound is a compound of table 13, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
Table 13.
In one embodiment, provided herein are compounds of formula (34), (35), (36), (37), (38), (39) or (40):
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein G 1 、G 2 、G 3 、L 1 、L 2 、Y、R 0 S and t are as defined herein or elsewhere, and wherein Z is-OH, halogen or a leaving group (e.g., -OMs or-OTs).
In one embodiment, Z is-OH. In one embodiment, Z is halogen. In one embodiment, Z is-Cl. In one embodiment, Z is-OMs.
In one embodiment, the compound of formula (34), (35), (36), (37), (38), (39) or (40) is an intermediate used in the preparation of the compound of formula (27), (28), (30), (31), (32) or (33), respectively, e.g., as exemplified in the examples provided herein.
In one embodiment, the compound of formula (34), (35), (36), (37), (38), (39) or (40) is itself a lipid compound and is used in the lipid nanoparticle or method provided herein.
It is to be understood that any embodiment of a compound provided herein as set forth above, and any particular substituent and/or variable of a compound provided herein as set forth above, may be independently combined with other embodiments and/or substituents and/or variables of a compound to form embodiments not specifically set forth above. Furthermore, where a list of substituents and/or variables is listed for any particular group or variable, it is to be understood that each individual substituent and/or variable may be deleted from a particular embodiment and/or technical scheme and that the remaining list of substituents and/or variables is to be considered within the scope of embodiments provided herein.
It is to be understood that in this specification, combinations of the various substituents and/or variables depicted are permissible only if such contributions result in stable compounds.
6.4.2 other ionizable lipids
As described herein, in some embodiments, nanoparticle compositions provided herein comprise one or more charged or ionizable lipids in addition to the lipids according to formulas (1) through (40) (and sub-formulas thereof). Without being bound by theory, it is expected that certain charged or zwitterionic lipid components of the nanoparticle composition are similar to the lipid components in the cell membrane, thereby improving cellular uptake of the nanoparticles. Exemplary charged or ionizable lipids that may form part of the nanoparticle compositions of the present invention include, but are not limited to, 3- (didodecylamino) -N1, 4-tris (dodecyl) -1-piperazineethylamine (KL 10), N1- [2- (didodecylamino) -1, 4-piperazinedieethylamine (KL 22), 14, 25-ditridecyl-15,18,21,24-tetraaza-trioctadecyl-amine (KL 25), 1, 2-dioleyloxy-N, N-dimethylaminopropane (DLinDMA), 2-dioleyl-4-dimethylaminomethyl- [1,3] -dioxolane (DLin-K-DMA), heptadec-6,9,28,31-tetraen-19-yl 4- (dimethylamino) butyrate (DLin-MC 3-DMA), 2-dioleyl-4- (2-dimethylaminoethyl) - [1,3] -dioxolane (DLin-KC 2-DMA), 1, 2-dioleyloxy-4-dimethylaminomethyl- [1,3] -dioleyl-4- [ (DLin-K-DMA), 2-dioleyl-4- (2-dimethylaminoethyl) - [1,3] -dioleyl-2- (-dioleyl-N-2-dioleyl-N-4-dioleyl-N-4- (. Beta.3-di-methyl) 2-dioleyl-N-dioride, n-dimethyl-3- [ (9Z, 12Z) -octadec-9, 12-dien-1-yloxy ] propan-1-amine (octyl-CLinDMA), (2R) -2- ({ 8- [ (3 beta) -cholest-5-en-3-yloxy ] octyl } oxy) -N, N-dimethyl-3- [ (9Z, 12Z) -octadec-9, 12-dien-1-yloxy ] propan-1-amine (octyl-CLinDMA (2R)), (2S) -2- ({ 8- [ (3 beta) -cholest-5-en-3-yloxy ] octyl } oxy) -N, N-dimethyl-3- [ (9Z-, 12Z) -octadec-9, 12-dien-1-yloxy ] propan-1-amine (octyl-CLinDMA (2S)), (12Z, 15Z) -N, N-dimethyl-2-nonyldi undec-12, 15-dien-1-amine, N-dimethyl-1-octylcyclopropyl-8-heptadecan-2-octyl-1-amine. Additional exemplary charged or ionizable lipids that may form part of the nanoparticle compositions of the present invention include those described in Sabnis et al, "A Novel Amino Lipid Series for mRNA Delivery: improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human matrices", molecular Therapy, vol.26, no. 6, 2018 (e.g., lipid 5), which is incorporated herein by reference in its entirety.
In some embodiments, a suitable cationThe ionic lipid comprises chlorinated N- [1- (2, 3-dioleyloxy) propyl group]-N, N-trimethylammonium (DOTMA); chlorinated N- [1- (2, 3-dioleoyloxy) propyl]-N, N-trimethylammonium (DOTAP); 1, 2-dioleoyl-sn-glycero-3-ethyl phosphorylcholine (DOEPC); 1, 2-dilauroyl-sn-glycero-3-ethyl phosphorylcholine (DLEPC); 1, 2-dimyristoyl-sn-glycero-3-ethyl phosphorylcholine (DMEPC); 1, 2-dimyristoyl-sn-glycero-3-ethyl phosphorylcholine (14:1); n1- [2- ((1S) -1- [ (3-aminopropyl) amino)]-4- [ bis (3-amino-propyl) amino group]Butyl carboxamide) ethyl]-3, 4-bis [ oleyloxy ]]-benzamide (MVL 5); dioctadecylamido-glycyl spermidine (DOGS); 3b- [ N- (N ', N' -dimethylaminoethyl) carbamoyl]Cholesterol (DC-Chol); dioctadecyl Dimethyl Ammonium Bromide (DDAB); SAINT-2, n-methyl-4- (dioleyl) methylpyridinium; 1, 2-dimyristoxypropyl-3-dimethylhydroxyethylammonium bromide (dmrii); 1, 2-dioleoyl-3-dimethyl-hydroxyethylammonium bromide (dorrie); 1, 2-dioleoyloxypropyl-3-dimethylhydroxyethyl ammonium chloride (DORI); dialkylated amino acids (DILA) 2 ) (e.g., C18:1-norArg-C16); dioleyldimethylammonium chloride (DODAC); 1-palmitoyl-2-oleoyl-sn-glycero-3-ethyl phosphorylcholine (poe pc); 1, 2-dimyristoyl-sn-glycero-3-ethyl phosphorylcholine (MOEPC); dioleate (R) -5- (dimethylamino) pentane-1, 2-diyl ester hydrochloride (DODAPEN-Cl); dioleate (R) -5-guanidinopentane-1, 2-diyl ester hydrochloride (DOPen-G); (R) -N, N, N-trimethyl-4, 5-bis (oleoyloxy) pentan-1-aminium chloride (DOTAPEN). Cationic lipids having a head group charged at physiological pH values are also suitable, such as primary amines (e.g., DODAG N ', N' -dioctadecyl-N-4, 8-diaza-10-aminodecanoylglycinamide) and guanidinium head groups (e.g., bis-guanidinium-spermidine-cholesterol (BGSC), bis-guanidinium-tren-cholesterol (BGTC), PONA and dioleate (R) -5-guanidinium-1, 2-diyl ester hydrochloride (DOPen-G)). Another suitable cationic lipid is dioleate (R) -5- (dimethylamino) pentane-1, 2-diyl ester hydrochloride (DODAPEN-Cl). In certain embodiments, the cationic lipids are in specific enantiomer or racemic forms, and include various salt forms (e.g., chloride or sulfate) of the cationic lipids described above. For example, in one In some embodiments, the cationic lipid is N- [1- (2, 3-dioleoyloxy) propyl chloride]-N, N, N-trimethylammonium (DOTAP-Cl) or N- [1- (2, 3-dioleoyloxy) propyl sulfate]-N, N-trimethylammonium (DOTAP-sulfate). In some embodiments, the cationic lipid is an ionizable cationic lipid, such as Dioctadecyl Dimethyl Ammonium Bromide (DDAB); 1, 2-dioleyloxy-3-dimethylaminopropane (DLinDMA); 2, 2-Di-lino-4- (2-dimethylaminoethyl) - [1,3 ]]-dioxolane (DLin-KC 2-DMA); thirty-seven carbon-6,9,28,31-tetraen-19-yl 4- (dimethylamino) butyrate (DLin-MC 3-DMA); 1, 2-dioleoyloxy-3-dimethylaminopropane (DODAP); 1, 2-dioleyloxy-3-dimethylaminopropane (DODMA); morpholinyl cholesterol (Mo-CHOL). In certain embodiments, the lipid nanoparticle comprises a combination of two or more cationic lipids (e.g., two or more of the cationic lipids described above).
Furthermore, in some embodiments, the charged or ionizable lipid that may form part of the nanoparticle compositions of the present invention is a lipid comprising a cyclic amine group. Additional cationic lipids suitable for the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of each being incorporated herein by reference in their entirety. Furthermore, in some embodiments, the charged or ionizable lipid that may form part of the nanoparticle compositions of the present invention is a lipid comprising a cyclic amine group. Additional cationic lipids suitable for the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of each being incorporated herein by reference in their entirety.
6.4.3 Polymer-bound lipids
In some embodiments, the lipid component of the nanoparticle composition may comprise one or more polymer-bound lipids, such as pegylated lipids (PEG lipids). Without being bound by theory, it is expected that the polymer-bound lipid component in the nanoparticle composition may improve colloidal stability and/or reduce protein absorption of the nanoparticle. Exemplary polymer-bound lipids that can be used in conjunction with the present disclosure include, but are not limited to, PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, the PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, ceramide-PEG 2000, or Chol-PEG2000.
In one embodiment, the polymer-bound lipid is a pegylated lipid. For example, some embodiments include polyethylene glycol diacylglycerols (PEG-DAG), such as 1- (monomethoxy-polyethylene glycol) -2, 3-dimyristoylglycerol (PEG-DMG); polyethylene glycol phosphatidylethanolamine (PEG-PE); PEG succinyl glycerol (PEG-S-DAG) such as 4-O- (2 ',3' -di (tetradecyloxy) propyl-1-O- (omega-methoxy (polyethoxy) ethyl) succinate (PEG-S-DMG), polyethylene glycol ceramide (PEG-cer), or PEG dialkoxypropyl carbamate such as omega-methoxy (polyethoxy) ethyl-N- (2, 3-di (tetradecyloxy) propyl) carbamate or 2, 3-di (tetradecyloxy) propyl-N- (omega-methoxy) (polyethoxy) ethyl) carbamate.
In one embodiment, the polymer-bound lipid is present at a concentration in the range of 1.0 mol% to 2.5 mol%. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.7 mole%. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mole%.
In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 35:1 to about 25:1. In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 100:1 to about 20:1.
In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 35:1 to about 25:1. In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 100:1 to about 20:1.
In one embodiment, the pegylated lipid has the formula:
or a pharmaceutically acceptable salt, tautomer, or stereoisomer thereof, wherein:
R 12 and R is 13 Each independently is a linear or branched saturated or unsaturated alkyl chain containing from 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester linkages; and is also provided with
w has an average value in the range of 30 to 60.
In one embodiment, R 12 And R is 13 Each independently is a straight saturated alkyl chain containing from 12 to 16 carbon atoms. In other embodiments, the w average value is in the range of 42 to 55, e.g., the w average value is 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55. In some embodiments, w average is about 49.
In one embodiment, the pegylated lipid has the formula:
wherein w average is about 49.
In one embodiment, provided herein are compounds of formula (41):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
l is a lipid;
x is a linker;
each R 3 Independently H or C 1 -C 6 An alkyl group;
each Y 1 Independently is a bond, O, S or NR a ；
Each G 4 Independently is a bond or C 1 -C 12 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -S-or-NR a -substitution;
each G 5 Independently is a bond or C 1 -C 12 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -S-or-NR a -substitution;
each R a H, C independently 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
Z 1 and Z 2 One of which is a positively charged moiety, and Z 1 And Z 2 The other of which is a negatively charged moiety;
n is an integer from 2 to 100;
t is hydrogen, halogen, alkyl, alkenyl, -OR ', -SR', -COOR ', -OCOR', -NR 'R', -N + (R”) 3 、-P + (R”) 3 -S-C (=s) -S-R ", -S-C (=s) -O-R", -S-C (=s) -NR "R", -S-C (=s) -aryl, cyano, azido, aryl, heteroaryl, or a targeting group, wherein R "is independently hydrogen or alkyl at each occurrence; and is also provided with
Wherein each alkyl, alkenyl, alkylene, aryl, and heteroaryl is independently optionally substituted; and is also provided with
Provided that the compound is not:
in one embodiment, when Z 1 Or Z is 2 Is carboxylate (-COO) - ) When T is not bromine.
In one embodiment, the compound is a compound of formula (42):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
l is a lipid;
x is a linker;
each R 3 Independently H or C 1 -C 6 An alkyl group;
each R 4 Independently H or C 1 -C 6 An alkyl group;
each X is 1 Independently is a bond or-C (O) -Y 1 -；
Each X is 2 Independently is a bond or-C (O) -Y 2 -；
Each Y 1 Independently is a bond, O, S or NR a ；
Each Y 2 Independently is a bond, O, S or NR a ；
Each G 4 Independently is a bond or C 1 -C 12 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -S-or-NR a -substitution;
Each G 5 Independently is a bond or C 1 -C 12 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -S-or-NR a -substitution;
each R a H, C independently 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
Z 1 and Z 2 One of which is a positively charged moiety, and Z 1 And Z 2 The other of which is a negatively charged moiety;
n is an even number from 2 to 100;
"ran" means eachUnit and each->The units appear in any order within { };
t is hydrogen, halogen, alkyl, alkenyl, -OR', -SR ", -COOR", -OCOR ", -NR" R ";、-N + (R”) 3 、-P + (R”) 3 -S-C (=s) -S-R ", -S-C (=s) -O-R", -S-C (=s) -NR "R", -S-C (=s) -aryl, cyano, azido, aryl, heteroaryl, or a targeting group, wherein R "is independently hydrogen or alkyl at each occurrence; and is also provided with
Wherein each alkyl, alkenyl, alkylene, aryl, and heteroaryl is independently optionally substituted.
In formula (42), there are equal numbers of positively and negatively charged moieties, such that the compound as a whole is neutral. Positively charged moieties (e.g., when Z 1 When positively chargedUnit) and negatively charged moiety (e.g., when Z 2 When negatively charged->The cells) may occur in any order within { }. For example, the charged moiety within { } may be +, -, +, - …; can be +, - …; can be +, - …; can be-, +, -, …
In one embodiment, X 1 Is a key. In one embodiment, X 1 is-C (O) -Y 1 -。
In one embodiment, X 2 Is a key. In one embodiment, X 2 is-C (O) -Y 2 -。
In one embodiment, Y 1 Is O. In one embodiment, Y 1 Is S. In one embodiment, Y 1 Is NR a . In one embodiment, Y 1 Is NH. In one embodiment, Y 1 Is a key.
In one embodiment, Y 2 Is O. In one embodiment, Y 2 Is S. In one embodiment, Y 2 Is NR a . In one embodiment, Y 2 Is NH. In a real worldIn embodiments, Y 2 Is a key.
In one embodiment, G 4 Is a key. In one embodiment, G 4 Is C 1 -C 6 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -S-or-NR a -substitution. In one embodiment, G 4 Is C 1 -C 3 An alkylene group. In one embodiment, G 4 Is C 1 An alkylene group. In one embodiment, G 4 Is C 2 An alkylene group. In one embodiment, G 4 Is C 3 An alkylene group.
In one embodiment, G 5 Is a key. In one embodiment, G 5 Is C 1 -C 6 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -S-or-NR a -substitution. In one embodiment, G 5 Is C 1 -C 3 An alkylene group. In one embodiment, G 5 Is C 1 An alkylene group. In one embodiment, G 5 Is C 2 An alkylene group. In one embodiment, G 5 Is C 3 An alkylene group.
In one embodiment, Z 1 Is a positively charged moiety, and Z 2 Is a negatively charged moiety. In one embodiment, Z 2 Is a positively charged moiety, and Z 1 Is a negatively charged moiety. As used herein and unless otherwise indicated, "charged moiety" refers to a moiety that is charged at any pH or hydrogen ion activity of its environment, or a moiety that is capable of being charged in response to the pH or hydrogen ion activity of its environment (e.g., the environment in which it is intended to be used).
In one embodiment, Z 1 Or Z is 2 Is a quaternary amine cation.
In one embodiment, Z 1 Or Z is 2 Is a carboxylate, sulfonate or phosphate anion.
In one embodiment, Z 1 Or Z is 2 Is negatively charged of (2)Is a carboxylate group, and corresponding X 1 And G 4 Or corresponding X 2 And G 5 Both are keys. In one embodiment of the present invention, in one embodiment,the units are->In one embodiment of the present invention, in one embodiment,the units are->
In one embodiment, the compound is a compound of formula (41-A):
Or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; and is also provided with
Wherein each alkyl and cyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (41-B):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; and is also provided with
Wherein each alkyl and cyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (41-C):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; or three R o Together with the nitrogen to which they are attached, form a bicyclic moiety; and is also provided with
Wherein each alkyl, cyclic moiety and bicyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (42-A):
Or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; or three R o Together with the nitrogen to which they are attached, form a bicyclic moiety; and is also provided with
Wherein each alkyl, cyclic moiety and bicyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (42-B):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; or three R o Together with the nitrogen to which they are attached, form a bicyclic moiety; and is also provided with
Wherein each alkyl, cyclic moiety and bicyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (42-C):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; or three R o Together with the nitrogen to which they are attached, form a bicyclic moiety;
Each R p Independently C 1 -C 6 Alkyl or-O- (C) 1 -C 6 An alkyl group); and is also provided with
Wherein each alkyl, cyclic moiety and bicyclic moiety is independently optionally substituted.
In one embodiment, L is a compound comprising one or more C 6 -C 24 Hydrocarbon chains (e.g. one or more C' s 6 -C 24 Alkyl or C 6 -C 24 Alkenyl) lipids. In one embodiment, L is a compound comprising twoC (C) 8 -C 24 Lipids of hydrocarbon chains. In one embodiment, two C 8 -C 24 The hydrocarbon chain being selected from two C 8 -C 22 Hydrocarbon chain, two C 8 -C 20 Hydrocarbon chain, two C 8 -C 19 Hydrocarbon chain, two C 8 -C 18 Hydrocarbon chain, two C 8 -C 17 Hydrocarbon chain, two C 10 -C 24 Hydrocarbon chain, two C 10 -C 22 Hydrocarbon chain, two C 10 -C 20 Hydrocarbon chain, two C 10 -C 19 Hydrocarbon chain, two C 10 -C 18 Hydrocarbon chain, two C 10 -C 17 Hydrocarbon chain, two C 12 -C 24 Hydrocarbon chain, two C 12 -C 22 Hydrocarbon chain, two C 12 -C 20 Hydrocarbon chain, two C 12 -C 19 Hydrocarbon chain, two C 12 -C 18 Hydrocarbon chain, two C 12 -C 17 Hydrocarbon chain, two C 13 -C 24 Hydrocarbon chain, two C 13 -C 22 Hydrocarbon chain, two C 13 -C 20 Hydrocarbon chain, two C 13 -C 19 Hydrocarbon chain, two C 13 -C 18 Hydrocarbon chain or two C 13 -C 17 A hydrocarbon chain. In one embodiment, the lipid is glycerophospholipid. In one embodiment, suitable glycerophospholipids include 1, 2-dilauroyl-sn-glycero-3-phosphoethanolamine, 1, 2-ditridecyl-sn-glycero-3-phosphoethanolamine, 1, 2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1, 2-dipentadecyl-sn-glycero-3-phosphoethanolamine, 1, 2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1, 2-bisheptadecanoyl-sn-glycero-3-phosphoethanolamine, 1, 2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1, 2-bisnonadecanoyl-sn-glycero-3-phosphoethanolamine, 1, 2-biseicosanoyl-sn-glycero-3-phosphoethanolamine, 1, 2-dimyristoyl-sn-glycero-3-phosphoethanolamine, 1, 2-dipalmitoyl-sn-3-phosphoethanolamine, 1, 2-bispalmitoyl-sn-3-phosphoethanolamine, 1, 2-distearoyl-sn-glycero-3-phosphoethanolamine, 1, 2-dioctanoyl-sn-3-phosphoethanolamine, di-glycero-2-dioctanoyl-3-phosphoethanolamine (DSPE), 1, 2-diisooleoyl (dioleceneoyl) -sn-glycerol Oil-3-phosphoethanolamine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, 1, 2-dioleoyl (dioleyiideoyl) -sn-glycero-3-phosphoethanolamine, 1, 2-di- α -linolenoyl-sn-glycero-3-phosphoethanolamine, and 1, 2-dioleoyl (dioleoyl) -sn-glycero-3-phosphoethanolamine. In one embodiment, the lipid is a glycerolipid. In one embodiment, suitable glycerides include dimyristoyl glycerol (DMG), distearoyl glycerol (DSG), dipalmitoyl glycerol (DPG), dilauroyl glycerol, ditridinyl glycerol, bispentadecanoyl glycerol, bisheptadecanoyl glycerol, bisnonadecanoyl glycerol, biseicosanoyl glycerol, dimyristoyl glycerol, dipalmitoyl glycerol, ditocenyl glycerol, dioleoyl glycerol, diisooleoyl glycerol, diiodoyl glycerol, ditelapsilon glycerol, di-alpha-linolenyl glycerol, and ditaxyl glycerol.
In one embodiment, L is a sterol lipid. In one embodiment, the lipid is selected from cholesterol, hemisuccinate, gu Dian glycoside I (sitoindoside I), gu Dian glycoside II, glucosyl stigmasterol, 16:0 stigmasterol glucose, 18:1 stigmasterol glucose, glucosyl sitosterol B, cholesterol sulfate, DHEA sulfate, FF-MAS, campesterol, campestanol, dihydroyeast sterol (zymoteno), sitostanol, sitosterol, stigmasterol, diosgenin (diogenin), 7-dehydrositosterol, lanosterol-95, dihydrolanosterol, 14-demethyl-lanosterol, yeast sterol (zymosterol), chain sterols, sitostanol, and pregnenolone. In one embodiment, the lipid is cholesterol.
In one embodiment, L is sphingolipid. In one embodiment, the sphingolipid is selected from the group consisting of N-octanoyl-sphingosine, sphinganine-1-phosphate (d17:0), sphingosine-1-phosphate (d17:1), sphinganine-1-phosphate (d18:0), sphingosine-1-phosphate (d18:1), sphinganine-1-phosphate (d20:0), sphingosine-1-phosphate (d20:1), 1-deoxysphinganine, sphinganine (d17:0), sphinganine (d18:0), sha Fenge (safingol), sphinganine (d20:0), sphingosine (d14:1), sphingosine (d17:1), sphingosine (d18:1), sphingosine (d20:1), 1-deoxysphingosine, 4E, 8Z-sphingodiene (sphingadiene), 11Z-sphingosine, and 14Z-diene. In one embodiment, the sphingolipid is N-octanoyl-sphingosine.
In one embodiment, L is a lipid comprising the formula, and in one embodiment, L is a lipid of the formula:
wherein:
G 1 、G 2 and G 3 Each independently is a bond, C 1 -C 12 Alkylene or C 2 -C 12 Alkenylene;
L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 Or R is 2 ；
L 3 is-OC (=O) -, -C (=O) O-; -OC (=o O-, O- -C (=o) -, -O-, -S (O) x -、-S-S-、-C(＝O)S-、-SC(＝O)-、-NR a C(＝O)-、-C(＝O)NR b -、-NR a C(＝O)NR b -、-OC(＝O)NR b -、-NR a C(＝O)O-、-SC(＝S)-、-C(＝S)S-、-C(＝S)-、-CH(OH)-、-P(＝O)(OR b )O-、-(C 6 -C 10 Arylene) -or- (6-to 10-membered heteroarylene) -;
R 1 and R is 2 Each independently is C 6 -C 24 Alkyl or C 6 -C 24 Alkenyl groups;
R a 、R b 、R d and R is e Each independently is H, C 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
R c and R is f Each independently is C 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
x is 0, 1 or 2, and
wherein each alkyl, alkenyl, alkylene, alkenylene, arylene, and heteroarylene is independently optionally substituted.
In one embodiment, the compound is a compound of formula (41-D):
or a pharmaceutically acceptable salt or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (42-D):
or a pharmaceutically acceptable salt or stereoisomer thereof.
In one embodiment, L is a lipid comprising the formula, and in one embodiment, L is a lipid of the formula:
in one embodiment, L is a lipid comprising the formula, and in one embodiment, L is a lipid of the formula:
in one embodiment, the compound is a compound of formula (41-E):
or a pharmaceutically acceptable salt or stereoisomer thereof.
In one embodiment, the compound is a compound of formula (42-E):
or a pharmaceutically acceptable salt or stereoisomer thereof.
In one embodiment, G 1 Is a key. In one embodiment, G 1 Is C 1 An alkylene group. In one embodiment, G 1 Is C 2 -C 12 An alkylene group. In one embodiment, G 1 Is C 4 -C 8 An alkylene group. In one embodiment, G 1 Is C 5 -C 7 An alkylene group. In one embodiment, G 1 Is C 5 An alkylene group. In one embodiment, G 1 Is C 7 An alkylene group. In one embodiment, G 1 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 1 Is C 4 -C 8 Alkenylene radicals. In one embodiment, G 1 Is C 5 -C 7 Alkenylene radicals. In one embodiment, G 1 Is C 5 Alkenylene radicals. In one embodiment, G 1 Is C 7 Alkenylene radicals.
In one embodiment, G 2 Is a key. In one embodiment, G 2 Is C 1 An alkylene group. In one embodiment, G 2 Is C 2 -C 12 An alkylene group. In one embodiment, G 2 Is C 4 -C 8 An alkylene group. In one embodiment, G 2 Is C 5 -C 7 An alkylene group. In one embodiment, G 2 Is C 5 An alkylene group. In one embodiment, G 2 Is C 7 An alkylene group. In one embodiment, G 2 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 2 Is C 4 -C 8 Alkenylene radicals. In one embodiment, G 2 Is C 5 -C 7 Alkenylene radicals. In one embodiment, G 2 Is C 5 Alkenylene radicals. In one embodiment, G 2 Is C 7 Alkenylene radicals.
In one embodiment, G 1 And G 2 Each independently is a bond or C 2 -C 12 Alkylene (e.g., C 4 -C 8 Alkylene groups, e.g. C 5 -C 7 Alkylene groups, e.g. C 5 Alkylene or C 7 An alkylene group). In one embodiment, G 1 And G 2 Both are keys. In one embodiment, G 1 And G 2 One of which is a bond and the other is C 2 -C 12 Alkylene (e.g., C 4 -C 8 Alkylene groups, e.g. C 5 -C 7 Alkylene groups, e.g. C 5 Alkylene or C 7 An alkylene group). In one embodiment, G 1 And G 2 Each independently is C 2 -C 12 Alkylene (example)E.g. C 4 -C 8 Alkylene groups, e.g. C 5 -C 7 Alkylene groups, e.g. C 5 Alkylene or C 7 An alkylene group). In one embodiment, G 1 And G 2 Each independently is a bond, C 5 Alkylene or C 7 An alkylene group. In one embodiment, G 1 And G 2 Each independently is a bond or C 1 An alkylene group. In one embodiment, G 1 And G 2 One of which is a bond and the other is C 1 An alkylene group. In one embodiment, G 1 And G 2 Both are C 1 An alkylene group.
In one embodiment, G 3 Is a key. In one embodiment, G 3 Is C 1 An alkylene group. In one embodiment, G 3 Is C 2 -C 12 An alkylene group. In one embodiment, G 3 Is C 4 -C 8 An alkylene group. In one embodiment, G 3 Is C 5 -C 7 An alkylene group. In one embodiment, G 3 Is C 5 An alkylene group. In one embodiment, G 3 Is C 7 An alkylene group. In one embodiment, G 3 Is C 2 -C 12 Alkenylene radicals. In one embodiment, G 3 Is C 4 -C 8 Alkenylene radicals. In one embodiment, G 3 Is C 5 -C 7 Alkenylene radicals. In one embodiment, G 3 Is C 5 Alkenylene radicals. In one embodiment, G 3 Is C 7 Alkenylene radicals.
In one embodiment, L 1 Is R 1 。
In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 OR-P (=O) (OR b )(OR c ). In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 or-C (=O) NR b R c . In one embodiment, L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-NR a C(＝O)R 1 or-C (=O) NR b R c . In one embodiment, L 1 is-OC (=O) R 1 . In one embodiment, L 1 is-C (=O) OR 1 . In one embodiment, L 1 is-NR a C(＝O)R 1 . In one embodiment, L 1 is-C (=O) NR b R c 。
In one embodiment, L 2 Is R 2 。
In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 OR-P (=O) (OR e )(OR f ). In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 or-C (=O) NR e R f . In one embodiment, L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-NR d C(＝O)R 2 or-C (=O) NR e R f . In one embodiment，L 2 is-OC (=O) R 2 . In one embodiment, L 2 is-C (=O) OR 2 . In one embodiment, L 2 is-NR d C(＝O)R 2 . In one embodiment, L 2 is-C (=O) NR e R f 。
In one embodiment, G 1 Is a bond, and L 1 Is R 1 . In one embodiment, G 1 Is a bond, and L 1 is-OC (=O) R 1 . In one embodiment, G 1 Is C 1 Alkylene group, and L 1 is-OC (=O) R 1 。
In one embodiment, G 2 Is a bond, and L 2 Is R 2 . In one embodiment, G 2 Is a bond, and L 2 is-OC (=O) R 2 . In one embodiment, G 2 Is C 1 Alkylene group, and L 2 is-OC (=O) R 2 。
In one embodiment, L 3 is-O-. In one embodiment, L 3 is-OC (=o) -. In one embodiment, L 3 is-C (=O) O-. As described herein and unless otherwise indicated, L 3 The connection point on the left side is with G 3 And L is 3 The connection point on the right is with X. For example, when L 3 when-OC (=O) -it means G 3 -OC(＝O)-X。
In one embodiment, L is a compound of formula (I)Is a lipid of (a). In one embodiment, L is of the formula +.>Or a stereoisomer thereof.
In one embodiment, X is C 1 -C 12 An alkylene group, wherein:
one or more-CH 2 -independently optionally via-O-, -NR a -、-OC(＝O)-、-C(＝O)O-、-OC(＝O)O-、-C(＝O)-、-S(O) x -、-S-S-、-C(＝O)S-、-SC(＝O)-、-NR a C(＝O)-、-C(＝O)NR b -、-NR a C(＝O)NR b -、-SC(＝S)-、-C(＝S)S-、-C(＝S)-、-P(＝O)(OR b )-O-、-O-P(＝O)(OR b )-O-、-(C 6 -C 10 Arylene) -or- (6-to 10-membered heteroarylene) -substitution;
x is 0, 1 or 2;
R a and R is b Each independently is H, C 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups; and is also provided with
And each alkyl, alkenyl, alkylene, arylene, and heteroarylene is optionally substituted.
In one embodiment, X is C 1 -C 12 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -NR a -、-OC(＝O)-、-C(＝O)O-、-NR a C (=o) -or-C (=o) NR b -substitution. In one embodiment, X is C 1 -C 8 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -NR a -、-OC(＝O)-、-C(＝O)O-、-NR a C (=o) -or-C (=o) NR b -substitution.
In one embodiment, X is-C (=o) -C 1 -C 11 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -NR a -、-OC(＝O)-、-C(＝O)O-、-NR a C (=o) -or-C (=o) NR b -substitution. In one embodiment, X is-C (=o) -C 1 -C 7 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -NR a -、-OC(＝O)-、-C(＝O)O-、-NR a C (=o) -or-C (=o) NR b -substitution.
In one embodiment, X is-P (=o) (OR b )-O-C 1 -C 11 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -NR a -、-OC(＝O)-、-C(＝O)O-、-NR a C (=o) -or-C (=o) NR b -substitution. In one embodimentWherein X is-P (=O) (OR b )-O-C 1 -C 7 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -NR a -、-OC(＝O)-、-C(＝O)O-、-NR a C (=o) -or-C (=o) NR b -substitution.
In one embodiment, the alkylene of X is optionally via C 1 -C 6 One or more of alkyl (e.g., methyl) or cyano.
In one embodiment, X has one of the following structures:
in one embodiment, the polymer-bound lipid compounds provided herein can be prepared by Controlled Radical Polymerization (CRP). In one embodiment, CRP is Atom Transfer Radical Polymerization (ATRP). In one embodiment, CRP is a Reversible Addition Fragmentation Transfer (RAFT) polymerization. In one embodiment, T is a polymer chain end group generated by CRP or modification of said chain end group. One common chain end group from ATRP is-Br. One common chain end group from RAFT polymerization is thiocarbonylthio. For a review of polymer chain end modifications see, for example, lunn et al, journal of Polymer Science, part A: polymer Chemistry 2017,55,2903-2914, the entire contents of which are incorporated herein by reference.
In one embodiment of the present invention, in one embodiment, T is hydrogen, halogen, alkyl, alkenyl, -OR ', -SR', -COOR ', -OCOR', -NR 'R', -N + (R”) 3 、-P + (R”) 3 -S-C (=s) -S-R ", -S-C (=s) -O-R", -S-C (=s) -NR "R", -S-C (=s) -aryl, cyano, azido, aryl, heteroaryl, or a targeting group, wherein R "is independently hydrogen or alkyl at each occurrence; and wherein each alkyl, alkenyl, aryl, and heteroaryl is independently optionally substituted.
In one embodiment, T is hydrogen. In one embodiment, T is bromine. In one embodiment, T is allyl. In one embodiment, T is-SR. In one embodiment, T is-S-alkyl, wherein alkyl is optionally substituted with one or more hydroxy, carboxy, or alkoxy groups. In one embodiment, T is-S-CH 2 -CH 2 -OH. In one embodiment, T is-S-CH 2 -CH 2 -COOH. In one embodiment, T is-S-CH 2 -CH 2 OMe. In one embodiment, T is-NH-alkyl, wherein alkyl is optionally substituted with one or more hydroxy, carboxy, or alkoxy groups. In one embodiment, T is-NH-CH 2 -CH 2 -OH. In one embodiment, T is-NH-CH 2 -CH 2 -COOH. In one embodiment, T is-NH-CH 2 -CH 2 -OMe。
In one embodiment, T is an azido (-N) 3 ). In one embodiment, T is optionally substituted 1,2, 3-triazole.
In one embodiment, T is-S-C (=s) -S-Et. In one embodiment, T is-S-C (=s) -S-C 12 H 25 . In one embodiment, T is-S-C (=s) -phenyl. In one embodiment, T is-S-C (=s) -N (Me) (phenyl).
In one embodiment, the targeting group specifically recognizes a molecule on the surface of a target cell, such as a cell surface receptor. Particularly suitable targeting groups include antibodies, antibody-like molecules, polypeptides, proteins (e.g., insulin-like growth factor II (IGF-II)), peptides (e.g., integrin binding peptides such as RGD-containing peptides), and small molecules such as sugars (e.g., lactose, galactose, N-acetylgalactosamine (GalNAc), mannose-6-phosphate (M6P)) or vitamins (e.g., folic acid). In one embodiment, the targeting group is a small molecule targeting group (e.g., folic acid). In one embodiment, the targeting group is a peptide, an aptamer, or a fragment of a monoclonal antibody. In one embodiment, the targeting group comprises one or more N-acetylgalactosamine (GalNAc) residues.
In one embodiment, the compound is a compound of formula (43):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
each R 5 H, C independently 1 -C 6 Alkyl or cyano.
In one embodiment, the compound is a compound of formula (44):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
each R 5 H, C independently 1 -C 6 Alkyl or cyano.
In one embodiment, the compound is a compound of formula (43-A):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; and is also provided with
Wherein each alkyl and cyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (43-B):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; and is also provided with
Wherein each alkyl and cyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (43-C):
Or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; or three R o Together with the nitrogen to which they are attached, form a bicyclic moiety; and is also provided with
Wherein each alkyl, cyclic moiety and bicyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (44-A):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; or three R o Together with the nitrogen to which they are attached, form a bicyclic moiety; and is also provided with
Wherein each alkyl, cyclic moiety and bicyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (44-B):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; or three R o Together with the nitrogen to which they are attached, form a bicyclic moiety; and is also provided with
Wherein each alkyl, cyclic moiety and bicyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (44-C):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; or three R o Together with the nitrogen to which they are attached, form a bicyclic moiety;
each R p Independently C 1 -C 6 Alkyl or-O- (C) 1 -C 6 An alkyl group); and is also provided with
Wherein each alkyl, cyclic moiety and bicyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (45):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
each R 5 H, C independently 1 -C 6 Alkyl or cyano.
In one embodiment, the compound is a compound of formula (46):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
each R 5 H, C independently 1 -C 6 Alkyl or cyano.
In one embodiment, the compound is a compound of formula (45-A):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
Each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; and is also provided with
Wherein each alkyl and cyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (45-B):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; and is also provided with
Wherein each alkyl and cyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (45-C):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; or three R o Together with the nitrogen to which they are attached, form a bicyclic moiety; and is also provided with
Wherein each alkyl, cyclic moiety and bicyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (46-A):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; or three R o With nitrogen to which they are attachedTogether forming a bicyclic moiety; and is also provided with
Wherein each alkyl, cyclic moiety and bicyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (46-B):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; or three R o Together with the nitrogen to which they are attached, form a bicyclic moiety; and is also provided with
Wherein each alkyl, cyclic moiety and bicyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of formula (46-C):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
s is an integer of 1 to 6;
t is an integer from 1 to 6;
each R o Independently C 1 -C 6 An alkyl group; or two R o Forms together with the nitrogen to which they are attached a cyclic moiety; or three R o Together with the nitrogen to which they are attached, form a bicyclic moiety;
each R p Independently C 1 -C 6 Alkyl or-O- (C) 1 -C 6 An alkyl group); and is also provided with
Wherein each alkyl, cyclic moiety and bicyclic moiety is independently optionally substituted.
In one embodiment of formulas (41-A), (41-B), (41-C), (42-A), (42-B), (42-C), (43-A), (43-B), (43-C), (44-A), (44-B), (44-C), (45-A), (45-B), (45-C), (46-A), (46-B) or (46-C), s is 1. In one embodiment, s is 2. In one embodiment, s is 3. In one embodiment, s is 4. In one embodiment, s is 5. In one embodiment, s is 6.
In one embodiment of formulas (41-A), (41-B), (41-C), (42-B), (42-C), (43-A), (43-B), (43-C), (44-B), (44-C), (45-A), (45-B), (45-C), (46-B) or (46-C), t is 1. In one embodiment, t is 2. In one embodiment, t is 3. In one embodiment, t is 4. In one embodiment, t is 5. In one embodiment, t is 6.
In one embodiment of formulas (41-A), (41-B), (41-C), (42-B), (42-C), (43-A), (43-B), (43-C), (44-B), (44-C), (45-A), (45-B), (45-C), (46-B) or (46-C), s is an integer from 1 to 3, and t is an integer from 1 to 3. In one embodiment, s is 1 and t is 1. In one embodiment, s is 1 and t is 2. In one embodiment, s is 1 and t is 3. In one embodiment, s is 2 and t is 1. In one embodiment, s is 2 and t is 2. In one embodiment, s is 2 and t is 3. In one embodiment, s is 3 and t is 1. In one embodiment, s is 3 and t is 2. In one embodiment, s is 3 and t is 3.
In one embodiment of formula (41-A), (43-A) or (45-A), s is 2 and t is 1.
In one embodiment of formulas (41-B), (43-B) or (45-B), s is 2 and t is 3.
In one embodiment of formulas (41-C), (43-C) or (45-C), s is 2, and t is 2.
In one embodiment of formula (42-B), (44-B) or (44-B), s is 2 and t is 1.
In one embodiment of formula (42-C), (44-C) or (44-C), s is 2 and t is 2.
In one embodiment, each R o Independently C 1 -C 6 An alkyl group. In one embodiment, each R o Independently C 1 -C 3 An alkyl group. In one embodiment, all R o Are all methyl groups. In one embodiment, all R o Are all ethyl groups. In one embodiment, two R' s o Together with the nitrogen to which they are attached form a cyclic moiety. In one embodiment, three R' s o Together with the nitrogen to which they are attached form a bicyclic moiety.
In one embodiment, R p Is C 1 -C 6 An alkyl group. In one embodiment, R p Is C 1 -C 3 An alkyl group. In one embodiment, R p Is methyl. In one embodiment, R p Is ethyl.
In one embodiment, R p is-O- (C) 1 -C 6 Alkyl). In one embodiment, R p is-O- (C) 1 -C 3 Alkyl). In one embodiment, R p Is methoxy. In one embodiment, R p Is ethoxy.
In one embodiment, R 1 And R is 2 Each independently is a straight chain C 6 -C 24 Alkyl, branched C 6 -C 24 Alkyl or straight-chain C 6 -C 24 Alkenyl groups.
In one embodiment, R 1 And R is 2 Each independently is a straight chain C 6 -C 18 Alkyl, -R 7 -CH(R 8 )(R 9 ) Or C 6 -C 18 Alkenyl, wherein R is 7 Is C 0 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 An alkyl group.
In one embodiment, R 1 And R is 2 Each independently is a straight chain C 7 -C 15 Alkyl or-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 0 -C 1 Alkylene group, and R 8 And R is 9 Independently C 4 -C 8 An alkyl group.
In one embodiment, R 1 And R is 2 Each independently is a straight chain C 6 -C 24 An alkyl group. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 7 -C 15 An alkyl group. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 7 An alkyl group. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 9 An alkyl group. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 11 An alkyl group. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 13 An alkyl group. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 15 An alkyl group.
In one embodiment, R 1 And R is 2 Each independently is a branched chain C 6 -C 24 Alkyl or branched C 6 -C 24 Alkenyl groups.
In one embodiment, R 1 And R is 2 Each independently is-R 7 -CH(R 8 )(R 9 ) Wherein R is 7 Is C 1 -C 5 Alkylene group, and R 8 And R is 9 Independently C 2 -C 10 Alkyl or C 2 -C 10 Alkenyl groups.
In one embodiment, R 1 And R is 2 Each independently is a straight chain C 6 -C 24 Alkenyl groups. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 6 -C 18 Alkenyl groups. In one embodiment, R 1 And R is 2 Each independently is a straight chain C 17 Alkenyl groups.
In one embodiment, R 1 Or R is 2 Or both independently have one of the following structures:
in one embodiment, R a And R is d Each independently is H.
In one embodiment, R b 、R c 、R e And R is f Each independently is n-hexyl or n-octyl.
In one embodiment, R 3 Is H. In one embodiment, R 3 Is C 1 -C 6 An alkyl group. In one embodiment, R 3 Is C 1 -C 4 An alkyl group. In one embodiment, R 3 Is methyl. In one embodiment, R 3 Is ethyl. In one embodiment, R 3 Is n-propyl. In one embodiment, R 3 Is isopropyl. In one embodiment, R 3 Is n-butyl. In one embodiment, R 3 Is n-amyl. In one embodiment, R 3 Is n-hexyl.
In one embodiment, n is an integer from 2 to 100. In one embodiment, n is an integer from 2 to 50. In one embodiment, n is an integer from 5 to 20. In one embodiment, n is 5. In one embodiment, n is 10. In one embodiment, n is 15. In one embodiment, n is 20.
In one embodiment, the compound is a compound of table 14, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
Table 14.
/>
/>
In one embodiment, the compound is a compound of table 15, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
Table 15.
/>
It is to be understood that any embodiment of a compound provided herein as set forth above, and any particular substituent and/or variable of a compound provided herein as set forth above, may be independently combined with other embodiments and/or substituents and/or variables of a compound to form embodiments not specifically set forth above. Furthermore, where a list of substituents and/or variables is listed for any particular group or variable, it is to be understood that each individual substituent and/or variable may be deleted from a particular embodiment and/or technical scheme and that the remaining list of substituents and/or variables is to be considered within the scope of embodiments provided herein.
It is to be understood that in this specification, combinations of the various substituents and/or variables depicted are permissible only if such contributions result in stable compounds.
6.4.4 structural lipids
In some embodiments, the lipid component of the nanoparticle composition may comprise one or more structural lipids. Without being bound by theory, it is expected that the structural lipids may stabilize the amphiphilic structure of the nanoparticle, such as, but not limited to, the lipid bilayer structure of the nanoparticle. Exemplary structural lipids that can be used in connection with the present disclosure include, but are not limited to, cholesterol, fecal sterols, sitosterols, ergosterols, campesterols, stigmasterols, brassicasterol, lycorine, lycoside, ursolic acid, alpha-tocopherol, and mixtures thereof. In certain embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipids include cholesterol and corticosteroids such as prednisolone (prednisolone), dexamethasone (dexamethasone), prednisone (prednisone), and hydrocortisone (hydrocortisone), or combinations thereof.
In one embodiment, the lipid nanoparticle provided herein comprises a steroid or steroid analogue. In one embodiment, the steroid or steroid analogue is cholesterol. In one embodiment, the steroid is present at a concentration in the range of 39 mole% to 49 mole%, 40 mole% to 46 mole%, 40 mole% to 44 mole%, 40 mole% to 42 mole%, 42 mole% to 44 mole%, or 44 mole% to 46 mole%. In one embodiment, the steroid is present at a concentration of 40 mole%, 41 mole%, 42 mole%, 43 mole%, 44 mole%, 45 mole%, or 46 mole%.
In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol is in the range of about 5:1 to 1:1. In one embodiment, the steroid is present at a concentration in the range of 32 mole% to 40 mole% steroid.
In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol is in the range of about 5:1 to 1:1. In one embodiment, the steroid is present at a concentration in the range of 32 mole% to 40 mole% steroid.
6.4.5 Phospholipids
In some embodiments, the lipid component of the nanoparticle composition may comprise one or more phospholipids, such as one or more (poly) unsaturated lipids. Without being bound by theory, it is contemplated that phospholipids may assemble into one or more lipid bilayer structures. Exemplary phospholipids that may form part of the nanoparticle compositions of the present invention include, but are not limited to, 1, 2-distearoyl-sn-glycero-3-phosphorylcholine (DSPC), 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (DLPC), 1, 2-dimyristoyl-sn-glycero-phosphorylcholine (DMPC), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (DOPC), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (DPPC), 1, 2-di (undecoyl) -sn-glycero-phosphorylcholine (DUPC), 1, 2-di (undecoyl) -sn-glycero-3-phosphorylcholine (ocpc), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphorylcholine (POPC), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (18:, 1, 2-di-arachidonyl-sn-glycero-3-phosphorylcholine, 1, 2-di (docosahexaenoic acid) -sn-glycero-3-phosphorylcholine, 1, 2-di-phytanic acid-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1, 2-distearoyl-sn-glycero-3-phosphoethanolamine, 1, 2-di-oleoyl-sn-glycero-3-phosphoethanolamine, 1, 2-di-linolenoyl-sn-glycero-3-phosphoethanolamine, 1, 2-di-arachidonyl-sn-glycero-3-phosphoethanolamine, 1, 2-di (docosahexaenoic acid) -sn-glycero-3-phosphoethanolamine, 1, 2-dioleoyl-sn-glycero-3-phospho-racemic- (1-glycero) sodium salt (DOPG), and sphingomyelin. In certain embodiments, the nanoparticle composition comprises DSPC. In certain embodiments, the nanoparticle composition comprises DOPE. In some embodiments, the nanoparticle composition comprises both DSPC and DOPE.
Additional exemplary neutral lipids include, for example, dipalmitoyl phosphatidylglycerol (DPPG), palmitoyl Oleoyl Phosphatidylethanolamine (POPE), and dioleoyl phosphatidylethanolamine 4- (N-maleimidomethyl) -cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl phosphatidylethanolamine (SOPE), and 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (trans-DOPE). In one embodiment, the neutral lipid is 1, 2-distearoyl-sn-glycero-3-phosphorylcholine (DSPC). In one embodiment, the neutral lipid is selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM.
In one embodiment, the neutral lipid is Phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidic Acid (PA), or Phosphatidylglycerol (PG).
In addition, phospholipids that may form part of the nanoparticle compositions of the present invention also include those described in WO2017/112865, the entire contents of which are incorporated herein by reference.
6.4.6 formulations
According to the present disclosure, nanoparticle compositions described herein can comprise at least one lipid component and one or more additional components, such as therapeutic and/or prophylactic agents (e.g., therapeutic nucleic acids described herein). Nanoparticle compositions can be designed for one or more specific applications or targets. The components of the nanoparticle composition can be selected based on the particular application or target, and/or based on the efficacy, toxicity, cost, ease of use, availability, or other characteristics of one or more of the components. Similarly, the particular formulation of the nanoparticle composition can be selected for a particular application or target, depending on, for example, the efficacy and toxicity of the particular combination of each component.
The lipid component of the nanoparticle composition may comprise, for example, a lipid according to one of formulas (1) to (40) (and subformulae thereof) described herein, a phospholipid (such as an unsaturated lipid, e.g., DOPE or DSPC), a PEG lipid, and a structural lipid. The ingredients of the lipid component may be provided at specific fractions.
In one embodiment, provided herein are nanoparticle compositions comprising a cationic or ionizable lipid compound provided herein, a therapeutic agent, and one or more excipients. In one embodiment, the cationic or ionizable lipid compound comprises a compound according to one of formulas (1) through (40) (and sub-formulas thereof) as described herein, and optionally one or more other ionizable lipid compounds. In one embodiment, the one or more excipients are selected from neutral lipids, steroids, and polymer-bound lipids. In one embodiment, the therapeutic agent is encapsulated within or associated with the lipid nanoparticle.
In one embodiment, provided herein is a nanoparticle composition (lipid nanoparticle) comprising:
i) Between 40mol% and 50mol% of cationic lipids;
ii) neutral lipids;
iii) A steroid;
iv) polymer-bound lipids; and
v) a therapeutic agent.
As used herein, "mol%" refers to the mole percent of a component relative to the total moles of all lipid components in the LNP (i.e., the total moles of cationic lipid, neutral lipid, steroid, and polymer-bound lipid).
In one embodiment, the lipid nanoparticle comprises 41mol% to 49mol%, 41mol% to 48mol%, 42mol% to 48mol%, 43mol% to 48mol%, 44mol% to 48mol%, 45mol% to 48mol%, 46mol% to 48mol%, or 47.2mol% to 47.8mol% of the cationic lipid. In one embodiment, the lipid nanoparticle comprises about 47.0mol%, 47.1mol%, 47.2mol%, 47.3mol%, 47.4mol%, 47.5mol%, 47.6mol%, 47.7mol%, 47.8mol%, 47.9mol%, or 48.0mol% cationic lipid.
In one embodiment, the neutral lipid is present at a concentration in the range of 5mol% to 15mol%, 7mol% to 13mol%, or 9mol% to 11 mol%. In one embodiment, the neutral lipid is present at a concentration of about 9.5mol%, 10mol%, or 10.5 mol%. In one embodiment, the molar ratio of cationic lipid to neutral lipid is in the range of about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.
In one embodiment, the steroid is present at a concentration in the range of 39 mole% to 49 mole%, 40 mole% to 46 mole%, 40 mole% to 44 mole%, 40 mole% to 42 mole%, 42 mole% to 44 mole%, or 44 mole% to 46 mole%. In one embodiment, the steroid is present at a concentration of 40 mole%, 41 mole%, 42 mole%, 43 mole%, 44 mole%, 45 mole%, or 46 mole%. In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2 or 1.0:1.0 to 1.0:1.2. In one embodiment, the steroid is cholesterol.
In one embodiment, the therapeutic to lipid ratio in the LNP (i.e., N/P, where N represents the moles of cationic lipid and P represents the moles of phosphate present as part of the nucleic acid backbone) is in the range of 2:1 to 30:1, e.g., 3:1 to 22:1. In one embodiment, N/P is in the range of 6:1 to 20:1 or 2:1 to 12:1. Exemplary N/P ranges include about 3:1, about 6:1, about 12:1, and about 22:1.
In one embodiment, provided herein are lipid nanoparticles comprising:
i) A cationic lipid having an effective pKa greater than 6.0;
ii) 5 to 15mol% neutral lipid;
iii) 1mol% to 15mol% of an anionic lipid;
iv) 30 to 45 mole% of a steroid;
v) polymer-bound lipids; and
vi) a therapeutic agent or a pharmaceutically acceptable salt or prodrug thereof,
wherein mol% is determined based on the total moles of lipids present in the lipid nanoparticle.
In one embodiment, the cationic lipid may be any of a variety of lipid species that carry a net positive charge at a selected pH (such as physiological pH). Exemplary cationic lipids are described below. In one embodiment, the cationic lipid has a pKa greater than 6.25. In one embodiment, the cationic lipid has a pKa greater than 6.5. In one embodiment, the cationic lipid has a pKa greater than 6.1, greater than 6.2, greater than 6.3, greater than 6.35, greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6, greater than 6.65, or greater than 6.7.
In one embodiment, the lipid nanoparticle comprises 40mol% to 45mol% cationic lipid. In one embodiment, the lipid nanoparticle comprises 45mol% to 50mol% cationic lipid.
In one embodiment, the molar ratio of cationic lipid to neutral lipid is in the range of about 2:1 to about 8:1. In one embodiment, the lipid nanoparticle comprises 5mol% to 10mol% neutral lipid.
Exemplary anionic lipids include, but are not limited to, phosphatidylglycerol, dioleoyl phosphatidylglycerol (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), or 1, 2-distearoyl-sn-glycerol-3-phosphate- (1' -rac-glycerol) (DSPG).
In one embodiment, the lipid nanoparticle comprises 1 to 10 mole% anionic lipid. In one embodiment, the lipid nanoparticle comprises 1 to 5 mole% anionic lipid. In one embodiment, the lipid nanoparticle comprises 1 to 9 mole%, 1 to 8 mole%, 1 to 7 mole%, or 1 to 6 mole% of an anionic lipid. In one embodiment, the molar ratio of anionic lipid to neutral lipid is in the range of 1:1 to 1:10.
In one embodiment, the steroid is cholesterol. In one embodiment, the molar ratio of cationic lipid to cholesterol is in the range of about 5:1 to 1:1. In one embodiment, the lipid nanoparticle comprises 32mol% to 40mol% of a steroid.
In one embodiment, the sum of the mole% of neutral lipids and the mole% of anionic lipids is in the range of 5 mole% to 15 mole%. In one embodiment, wherein the sum of the mole% of neutral lipids and the mole% of anionic lipids is in the range of 7 mole% to 12 mole%.
In one embodiment, the molar ratio of anionic lipid to neutral lipid is in the range of 1:1 to 1:10. In one embodiment, the sum of the mole% of neutral lipids and the mole% of steroids is in the range of 35 mole% to 45 mole%.
In one embodiment, the lipid nanoparticle comprises:
i) 45mol% to 55mol% of a cationic lipid;
ii) 5 to 10mol% neutral lipid;
iii) 1 to 5mol% of an anionic lipid; and
iv) 32 to 40 mole% of a steroid.
In one embodiment, the lipid nanoparticle comprises 1.0mol% to 2.5mol% of the bound lipid. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mol%.
In one embodiment, the neutral lipid is present at a concentration in the range of 5mol% to 15mol%, 7mol% to 13mol%, or 9mol% to 11 mol%. In one embodiment, the neutral lipid is present at a concentration of about 9.5mol%, 10mol%, or 10.5 mol%. In one embodiment, the molar ratio of cationic lipid to neutral lipid is in the range of about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.
In one embodiment, the steroid is cholesterol. In some embodiments, the steroid is present at a concentration in the range of 39 mole% to 49 mole%, 40 mole% to 46 mole%, 40 mole% to 44 mole%, 40 mole% to 42 mole%, 42 mole% to 44 mole%, or 44 mole% to 46 mole%. In one embodiment, the steroid is present at a concentration of 40 mole%, 41 mole%, 42 mole%, 43 mole%, 44 mole%, 45 mole%, or 46 mole%. In certain embodiments, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2 or 1.0:1.0 to 1.0:1.2.
In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 5:1 to 1:1.
In one embodiment, the lipid nanoparticle comprises 1.0mol% to 2.5mol% of the bound lipid. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mol%.
In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 100:1 to about 20:1. In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 35:1 to about 25:1.
In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 100:1 to about 20:1. In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 35:1 to about 25:1.
In one embodiment, the lipid nanoparticle has an average diameter in the range of 50nm to 100nm or 60nm to 85 nm.
In one embodiment, the composition comprises a cationic lipid, DSPC, cholesterol, and PEG-lipid as provided herein, and mRNA. In one embodiment, the cationic lipid, DSPC, cholesterol, and PEG-lipid provided herein are in a molar ratio of 50:10:38.5:1.5.
Nanoparticle compositions can be designed for one or more specific applications or targets. For example, nanoparticle compositions can be designed for delivery of therapeutic and/or prophylactic agents, such as RNA, to a particular cell, tissue, organ or system or group thereof in a mammal. The physicochemical properties of the nanoparticle composition can be altered to increase selectivity for a particular body target. For example, particle size may be adjusted based on fenestration size of different organs. The therapeutic and/or prophylactic agents included in the nanoparticle composition may also be selected based on one or more desired delivery targets. For example, a therapeutic and/or prophylactic agent may be selected for a particular indication, disorder, disease, or condition and/or for delivery to a particular cell, tissue, organ, or system or group thereof (e.g., local or specific delivery). In certain embodiments, nanoparticle compositions can comprise an mRNA encoding a polypeptide of interest, which is capable of translation within a cell to produce the polypeptide of interest. Such compositions may be designed to specifically deliver to a particular organ. In certain embodiments, the composition may be designed for specific delivery to the liver of a mammal.
The amount of therapeutic and/or prophylactic agent in the nanoparticle composition can depend on the size, composition, desired target and/or application, or other characteristics of the nanoparticle composition, as well as the characteristics of the therapeutic and/or prophylactic agent. For example, the amount of RNA that can be used in the nanoparticle composition can depend on the size, sequence, and other characteristics of the RNA. The relative amounts of therapeutic and/or prophylactic agents and other ingredients (e.g., lipids) in the nanoparticle composition can also vary. In some embodiments, the wt/wt ratio of lipid component to therapeutic and/or prophylactic agent in the nanoparticle composition can be about 5:1 to about 60:1, such as about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 22:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. For example, the wt/wt ratio of lipid component to therapeutic and/or prophylactic agent may be about 10:1 to about 40:1. In certain embodiments, the wt/wt ratio is about 20:1. The amount of therapeutic and/or prophylactic agent in the nanoparticle composition can be measured, for example, using absorption spectroscopy (e.g., ultraviolet-visible spectroscopy).
In some embodiments, the nanoparticle composition comprises one or more RNAs, and the one or more RNAs, lipids, and amounts thereof can be selected to provide a particular N: P ratio. The N: P ratio of the composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in the RNA. In some embodiments, a lower N to P ratio is selected. The one or more RNAs, lipids, and amounts thereof may be selected to provide an N to P ratio of about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In certain embodiments, the N to P ratio may be from about 2:1 to about 8:1. In other embodiments, the N to P ratio is from about 5:1 to about 8:1. For example, the N to P ratio may be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0:1. For example, the N to P ratio may be about 5.67:1.
The physical properties of the nanoparticle composition may depend on its components. For example, nanoparticle compositions comprising cholesterol as a structural lipid may have different characteristics than nanoparticle compositions comprising a different structural lipid. Similarly, the characteristics of a nanoparticle composition may depend on the absolute or relative amounts of its components. For example, nanoparticle compositions comprising higher mole fractions of phospholipids may have different characteristics than nanoparticle compositions comprising lower mole fractions of phospholipids. The characteristics may also vary depending on the method and conditions of preparation of the nanoparticle composition.
Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the nanoparticle composition. Zeta potential can be measured using dynamic light scattering or potentiometry (e.g., potentiometry). Dynamic light scattering can also be used to determine particle size. An instrument such as Zetasizer Nano ZS (Malvem Instruments Ltd, malvem, worcestershire, UK) can also be used to measure various characteristics of the nanoparticle composition such as particle size, polydispersity index, and zeta potential.
In various embodiments, the average size of the nanoparticle composition may be between tens of nanometers and hundreds of nanometers. For example, the average size may be about 40nm to about 150nm, such as about 40nm, 45nm, 50nm, 55nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm, 105nm, 110nm, 115nm, 120nm, 125nm, 130nm, 135nm, 140nm, 145nm, or 150nm. In some embodiments, the nanoparticle composition can have an average size of about 50nm to about 100nm, about 50nm to about 90nm, about 50nm to about 80nm, about 50nm to about 70nm, about 50nm to about 60nm, about 60nm to about 100nm, about 60nm to about 90nm, about 60nm to about 80nm, about 60nm to about 70nm, about 70nm to about 100nm, about 70nm to about 90nm, about 70nm to about 80nm, about 80nm to about 100nm, about 80nm to about 90nm, or about 90nm to about 100nm. In certain embodiments, the nanoparticle composition can have an average size of about 70nm to about 100nm. In some embodiments, the average size may be about 80nm. In other embodiments, the average size may be about 100nm.
The nanoparticle composition can be relatively homogeneous. The polydispersity index may be used to indicate the homogeneity of the nanoparticle composition, such as the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The nanoparticle composition can have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the nanoparticle composition can have a polydispersity index of about 0.10 to about 0.20.
The zeta potential of the nanoparticle composition can be used to indicate the zeta potential of the composition. For example, the zeta potential may describe the surface charge of the nanoparticle composition. Nanoparticle compositions having relatively low positive or negative charges are generally desirable because the higher charged species can undesirably interact with cells, tissues, and other components in the body. In some embodiments, the zeta potential of the nanoparticle composition may be from about-10 to about +20mV, from about-10 to about +15mV, from about-10 to about +10mV, from about-10 to about +5mV, from about-10 to about 0mV, from about-10 to about-5 mV, from about-5 to about +20mV, from about-5 to about +15mV, from about-5 to about +10mV, from about-5 to about +5mV, from about-5 to about 0mV, from about 0 to about +20mV, from about 0 to about +15mV, from about 0 to about +10mV, from about 0 to about +5mV, from about +5 to about +20mV, from about +5 to about +15mV, or from about +5 to about +10mV.
Encapsulation efficiency of a therapeutic and/or prophylactic agent describes the amount of therapeutic and/or prophylactic agent that is encapsulated or otherwise associated with a nanoparticle composition after preparation relative to the initial amount provided. Encapsulation efficiency is desirably high (e.g., near 100%). Encapsulation efficiency may be measured, for example, by comparing the amount of therapeutic and/or prophylactic agent in a solution containing the nanoparticle composition before and after disruption of the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and/or prophylactic agent (e.g., RNA) in a solution. For nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and/or prophylactic agent can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.
The nanoparticle composition may optionally comprise one or more coatings. For example, the nanoparticle composition can be formulated as a capsule, film or tablet with a coating. Capsules, films or tablets comprising the compositions described herein may be of any useful size, tensile strength, hardness or density.
6.4.7 pharmaceutical composition
Nanoparticle compositions according to the present disclosure may be formulated in whole or in part as pharmaceutical compositions. The pharmaceutical composition may comprise one or more nanoparticle compositions. For example, the pharmaceutical composition may comprise one or more nanoparticle compositions comprising one or more different therapeutic and/or prophylactic agents. The pharmaceutical composition may also comprise one or more pharmaceutically acceptable excipients or auxiliary ingredients, such as those described herein. General guidelines for the formulation and manufacture of pharmaceutical compositions and agents can be found, for example, in Remington, the Science and Practice of Pharmacy, 21 st edition, a.r. gennaro; obtained in Lippincott, williams & Wilkins, baltimore, md., 2006. Conventional excipients and adjunct ingredients can be used in any pharmaceutical composition unless any conventional excipient or adjunct ingredient is incompatible with one or more components of the nanoparticle composition. The excipient or adjunct ingredient is incompatible with the components of the nanoparticle composition if the combination of the excipient or adjunct ingredient and the components of the nanoparticle composition can cause any undesirable biological or other deleterious effects.
In some embodiments, one or more excipients or adjunct ingredients can comprise greater than 50% of the total mass or volume of the pharmaceutical composition comprising the nanoparticle composition. For example, one or more excipients or adjunct ingredients can constitute 50%, 60%, 70%, 80%, 90% or higher percent of the pharmaceutical composition. In some embodiments, the pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% pure. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the U.S. food and drug administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopeia (USP), the European Pharmacopeia (EP), the british pharmacopeia, and/or the international pharmacopeia.
The relative amounts of one or more nanoparticle compositions, one or more pharmaceutically acceptable excipients, and/or any additional ingredients in the pharmaceutical compositions according to the present disclosure will vary depending on the identity, constitution, and/or condition of the subject being treated and further depending on the route of administration of the composition. For example, the pharmaceutical composition may comprise between 0.1% and 100% (wt/wt) of one or more nanoparticle compositions.
In certain embodiments, nanoparticle compositions and/or pharmaceutical compositions of the present disclosure are stored and/or transported (e.g., stored at a temperature of 4 ℃ or less, such as between about-150 ℃ and about 0 ℃ or between about-80 ℃ and about-20 ℃ (e.g., about-5 ℃, -10 ℃, -15 ℃, -20 ℃, -25 ℃, -30 ℃, -40 ℃, -50 ℃, -60 ℃, -70 ℃, -80 ℃, -90 ℃, -130 ℃, or-150 ℃)) by refrigeration or freezing. For example, the pharmaceutical composition comprising the compound of any one of formulae (1) to (46) (and sub-formulae thereof) is a solution that is stored and/or transported refrigerated at, for example, about-20 ℃, 30 ℃, -40 ℃, -50 ℃, -60 ℃, -70 ℃, or-80 ℃. In certain embodiments, the present disclosure also relates to a method of increasing the stability of nanoparticle and/or pharmaceutical compositions comprising a compound of any one of formulas (1) to (46) (and sub-formulas thereof) by storing the nanoparticle and/or pharmaceutical composition at a temperature of 4 ℃ or less, such as between about-150 ℃ and about 0 ℃ or between about-80 ℃ and about-20 ℃, for example, about-5 ℃, -10 ℃, -15 ℃, -20 ℃, -25 ℃, -30 ℃, -40 ℃, -50 ℃, -60 ℃, -70 ℃, -80 ℃, -90 ℃, -130 ℃, or-150 ℃. For example, nanoparticle compositions and/or pharmaceutical compositions disclosed herein are stable for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months, at a temperature of, for example, 4 ℃ or less (e.g., between about 4 ℃ and-20 ℃). In one embodiment, the formulation is stable for at least 4 weeks at about 4 ℃. In certain embodiments, the pharmaceutical compositions of the present disclosure comprise a nanoparticle composition disclosed herein and a pharmaceutically acceptable carrier selected from one or more of the following: tris, acetate (e.g., sodium acetate), citrate (e.g., sodium citrate), physiological saline, PBS, and sucrose. In certain embodiments, the pharmaceutical compositions of the present disclosure have a pH of between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or between 7.5 and 8, or between 7 and 7.8). For example, the pharmaceutical compositions of the present disclosure comprise the nanoparticle compositions disclosed herein, tris, physiological saline, and sucrose, and have a pH of about 7.5-8, which is suitable for storage and/or transport at, for example, about-20 ℃. For example, the pharmaceutical compositions of the present disclosure comprise the nanoparticle compositions disclosed herein and PBS, and have a pH of about 7-7.8, which is suitable for storage and/or transportation at, for example, about 4 ℃ or less. In the context of the present disclosure, "stability," "stabilized," and "stable" refer to nanoparticle compositions and/or pharmaceutical compositions disclosed herein that are resistant to chemical or physical changes (e.g., degradation, particle size change, aggregation, change in encapsulation, etc.) under given manufacturing, transportation, storage, and/or use conditions, for example, when stress is applied, such as shear forces, freeze/thaw stresses, and the like.
The nanoparticle composition and/or pharmaceutical composition comprising one or more nanoparticle compositions can be administered to any patient or subject, including patients or subjects who may benefit from the therapeutic effect provided by delivery of a therapeutic and/or prophylactic agent to one or more specific cells, tissues, organs or systems or groups thereof, such as the renal system. Although the description provided herein of nanoparticle compositions and pharmaceutical compositions comprising nanoparticle compositions is primarily directed to compositions suitable for administration to humans, those skilled in the art will appreciate that such compositions are generally suitable for administration to any other mammal. Improvements to compositions suitable for administration to humans in order to render the compositions suitable for administration to a variety of animals are well known and veterinary pharmacologists of ordinary skill can design and/or make such improvements by mere routine experimentation, if any. It is contemplated that subjects to which the compositions are administered include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cows, pigs, horses, sheep, cats, dogs, mice, and/or rats.
Pharmaceutical compositions comprising one or more nanoparticle compositions may be prepared by any method known in the pharmacological arts or later developed. Generally, such methods of preparation involve combining the active ingredient with excipients and/or one or more other auxiliary ingredients and then, if desired or necessary, dividing, shaping and/or packaging the product into the desired single or multi-dose units.
Pharmaceutical compositions according to the present disclosure may be prepared, packaged and/or sold in bulk, as single unit doses and/or as multiple single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition comprising a predetermined amount of an active ingredient (e.g., a nanoparticle composition). The amount of active ingredient is generally equal to the dose of active ingredient and/or a convenient portion of this dose, such as half or one third of this dose, of the subject to be administered.
Pharmaceutical compositions may be prepared in a variety of forms suitable for a variety of routes and methods of administration. For example, pharmaceutical compositions may be prepared in liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders and granules), dosage forms for topical and/or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and patches), suspensions, powders and other forms.
Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and/or elixirs. In addition to the active ingredient, the liquid dosage forms may also contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents and emulsifiers, e.g., ethanol, isopropanol, carbonic acidEthyl ester, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1, 3-butanediol, dimethylformamide, oils (especially cottonseed, peanut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. In addition to inert diluents, the oral compositions can also include additional therapeutic and/or prophylactic agents, additional agents, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring and/or perfuming agents. In certain embodiments for parenteral administration, the composition is mixed with a solubilizing agent, such as Cremophor TM Alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers and/or combinations thereof.
Injectable formulations, such as sterile injectable aqueous or oleaginous suspensions, may be formulated according to the known art using suitable dispersing, wetting and/or suspending agents. The sterile injectable preparation may be a sterile injectable solution, suspension and/or emulsion in a non-toxic parenterally acceptable diluent and/or solvent, for example, as a solution in 1, 3-butanediol. Acceptable vehicles and solvents that may be used include water, ringer's solution (u.s.p.) and isotonic sodium chloride solution. Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono-or diglycerides. Fatty acids such as oleic acid find use in the preparation of injectables.
The injectable formulation may be sterilized, for example, by filtration through a bacterial-retaining filter, and/or by incorporating sterilizing agents in the form of sterile solid compositions which may be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
The present disclosure provides methods of delivering a therapeutic and/or prophylactic agent to a mammalian cell or organ, producing a polypeptide of interest in a mammalian cell, and treating a disease or disorder in a mammal in need thereof, the methods comprising administering to the mammal a nanoparticle composition comprising the therapeutic and/or prophylactic agent and/or contacting the mammalian cell with the nanoparticle composition.
6.5 method
In one aspect, provided herein are also methods for controlling, preventing, and treating infectious diseases caused by coronavirus infection in a subject. In some embodiments, the infectious disease controlled, prevented or treated with the methods described herein is caused by a coronavirus infection selected from the group consisting of SARS-CoV-2 or variants thereof, such as SARS-CoV-2 b.1.351 and SARS-CoV-2 b.1.1.7, severe acute respiratory syndrome coronavirus (SARS-CoV), middle east respiratory syndrome coronavirus (MERS-CoV), human coronavirus NL63 (HCoV-NL 63), human coronavirus OC43, porcine epidemic diarrhea coronavirus (PEDV), porcine transmissible gastroenteritis coronavirus (TGEV), porcine Respiratory Coronavirus (PRCV), bat coronavirus HKU4, mouse hepatitis coronavirus (MHV), bovine coronavirus (BCoV), avian infectious bronchitis coronavirus (IBV), porcine delta coronavirus (PdCV).
In particular embodiments, the infectious disease controlled, prevented or treated with the methods described herein is caused by a coronavirus infection of the respiratory system, nervous system, immune system, digestive system, and/or major organs of a subject (e.g., a human or non-human mammal). In particular embodiments, the infectious disease that is controlled, prevented or treated by the methods described herein is a respiratory tract infection, a lung infection, a kidney infection, a liver infection, an intestinal infection, a nervous system infection, a respiratory syndrome, bronchitis, pneumonia, gastroenteritis, encephalomyelitis, encephalitis, sarcoidosis, diarrhea, hepatitis or a demyelinating disease. In specific embodiments, the infectious disease is a respiratory infection, a pulmonary infection, a pneumonia, or a respiratory syndrome caused by infection with SARS-CoV-2 or a variant thereof.
In some embodiments, the methods of the invention for controlling, preventing, and treating an infectious disease caused by a coronavirus infection in a subject comprise administering to the subject a therapeutically effective amount of a therapeutic nucleic acid as described herein. In specific embodiments, the therapeutic nucleic acid is an mRNA molecule as described herein.
In some embodiments, the methods of the invention for controlling, preventing, and treating an infectious disease caused by a coronavirus infection in a subject comprise administering to the subject a therapeutically effective amount of a therapeutic composition comprising a therapeutic nucleic acid as described herein. In specific embodiments, the therapeutic nucleic acid is an mRNA molecule as described herein.
In some embodiments, the methods of the invention for controlling, preventing, and treating an infectious disease caused by a coronavirus infection in a subject comprise administering to the subject a therapeutically effective amount of a vaccine composition comprising a therapeutic nucleic acid as described herein. In specific embodiments, the therapeutic nucleic acid is an mRNA molecule as described herein.
In some embodiments, the methods of the invention for controlling, preventing, and treating an infectious disease caused by a coronavirus infection in a subject comprise administering to the subject a therapeutically effective amount of a lipid-containing composition comprising a therapeutic nucleic acid as described herein. In specific embodiments, the therapeutic nucleic acid is an mRNA molecule as described herein.
In some embodiments, the methods of the invention for controlling, preventing, and treating an infectious disease caused by a coronavirus infection in a subject comprise administering to the subject a therapeutically effective amount of a lipid-containing composition comprising a therapeutic nucleic acid as described herein, wherein the lipid-containing composition is formulated as a lipid nanoparticle encapsulating the therapeutic nucleic acid in a lipid shell. In specific embodiments, the therapeutic nucleic acid is an mRNA molecule as described herein. In particular embodiments, cells in a subject are effective to ingest lipid-containing compositions (e.g., lipid nanoparticles) described herein after administration. In particular embodiments, the lipid-containing compositions (e.g., lipid nanoparticles) described herein are endocytosed by a cell of a subject.
In some embodiments, after administration of a therapeutic nucleic acid as described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein to a subject in need thereof, cells in the subject ingest and express the administered therapeutic nucleic acid to produce a peptide or polypeptide encoded by the nucleic acid. In some embodiments, the encoded peptide or polypeptide is derived from a coronavirus that causes an infectious disease that is controlled, prevented or treated by the method.
6.5.1 immune response
In some embodiments, one or more immune responses against coronaviruses are elicited in a subject in need thereof after administration of a therapeutic nucleic acid as described herein, a vaccine composition comprising a therapeutic nucleic acid as described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid as described herein to the subject. In some embodiments, the immune response elicited comprises one or more adaptive immune responses against coronaviruses. In some embodiments, the immune response elicited includes one or more innate immune responses against coronaviruses. The one or more immune responses may be in the form of, for example, an antibody response (humoral response) or a cellular immune response such as cytokine secretion (e.g., interferon-gamma), helper activity, or cytotoxicity. In some embodiments, expression of an activation marker on an immune cell, expression of a co-stimulatory receptor on an immune cell, expression of a ligand of a co-stimulatory receptor, cytokine secretion, infiltration of an infected cell by an immune cell (e.g., a T lymphocyte, a B lymphocyte, and/or an NK cell), production of antibodies that specifically recognize one or more viral proteins (e.g., viral peptides or proteins encoded by a therapeutic nucleic acid), effector function, T cell activation, T cell differentiation, T cell proliferation, B cell differentiation, B cell proliferation, and/or NK cell proliferation. In some embodiments, activation and proliferation of bone Marrow Derived Suppressor Cells (MDSCs) and Treg cells are inhibited.
In some embodiments, upon administration of a therapeutic nucleic acid as described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein to a subject in need thereof, one or more neutralizing antibodies are produced in the subject against a coronavirus or cells infected with a coronavirus.
In particular embodiments, the neutralizing antibodies specifically bind to one or more epitopes of the S protein of the coronavirus and inhibit or reduce the function or activity of one or more S proteins. In particular embodiments, binding of the S protein to its cellular receptor is reduced or inhibited. In specific embodiments, the binding of coronavirus S protein to angiotensin converting enzyme 2 (ACE 2), aminopeptidase N (APN), dipeptidyl peptidase 4 (DPP 4), carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM 1) and/or sugar on the surface of a host cell is reduced or inhibited. In particular embodiments, the attachment of the coronavirus to a host cell in the subject is reduced or inhibited. In particular embodiments, host cell membrane fusion induced by coronavirus is reduced or inhibited. In particular embodiments, infection (e.g., entry) of a host cell in a subject by a coronavirus is reduced or inhibited. In some embodiments, neutralizing antibodies reduce the function or activity of the S protein by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100%.
In another embodiment, neutralizing antibodies are raised against a coronavirus or cells infected with a coronavirus in a subject. In particular embodiments, neutralizing antibodies specifically bind to one or more epitopes of the N protein of the coronavirus and inhibit or reduce the function or activity of one or more N proteins. In particular embodiments, the binding of the coronavirus N protein to the replicating viral genomic sequence is reduced or inhibited. In particular embodiments, packaging of the replicated viral genomic sequences into the functional viral capsid is reduced or inhibited. In particular embodiments, the propagation of surviving progeny of coronavirus is reduced or inhibited. In some embodiments, neutralizing antibodies reduce the function or activity of the S protein by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100%.
In particular embodiments, the neutralizing antibodies bind to one or more viral proteins present on the surface of a viral particle or infected cell and label the viral particle or infected cell for destruction by the immune system of the subject. In some embodiments, endocytosis of the viral particle by the white blood cells (e.g., macrophages) is induced or enhanced. In some embodiments, antibody-dependent cell-mediated cytotoxicity (ADCC) against the infected cells in the subject is induced or enhanced. In some embodiments, antibody-dependent cell phagocytosis (ADCP) is induced or enhanced in a subject against an infected cell. In some embodiments, complement Dependent Cytotoxicity (CDC) against the infected cells in the subject is induced or enhanced.
6.5.2 combination therapy
In some embodiments, the compositions of the present disclosure may further comprise one or more additional therapeutic agents. In some embodiments, the additional therapeutic agent is an adjuvant capable of enhancing the immunogenicity of the composition (e.g., a genetic vaccine). In some embodiments, the additional therapeutic agent is an immunomodulatory agent that enhances an immune response in the subject. In some embodiments, the adjuvant and therapeutic nucleic acid in the composition may have a synergistic effect in eliciting an immune response in a subject.
In some embodiments, the additional therapeutic agent and the therapeutic nucleic acid of the present disclosure may be co-formulated in one composition. For example, the additional therapeutic agent may be formulated as part of a composition comprising a therapeutic nucleic acid of the present disclosure. Alternatively, in some embodiments, the additional therapeutic agent and therapeutic nucleic acid of the present disclosure may be formulated as separate compositions or dosage units for co-administration to a subject sequentially or simultaneously.
In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated as part of a lipid-containing composition as described in section 6.4, and the additional therapeutic agent is formulated as a separate composition. In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated as part of a lipid-containing composition as described in section 6.4, wherein the additional therapeutic agent is also formulated as part of the lipid-containing composition.
In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated such that the therapeutic nucleic acids are encapsulated in the lipid shell of the lipid nanoparticle as described in section 6.4, and the additional therapeutic agent is formulated as a separate composition. In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated such that the therapeutic nucleic acids are encapsulated in the lipid shell of a lipid nanoparticle as described in section 6.4, wherein the lipid nanoparticle also encapsulates an additional therapeutic molecule or a nucleic acid encoding an additional therapeutic molecule. In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated such that the therapeutic nucleic acids are encapsulated in the lipid shell of the lipid nanoparticle as described in section 6.4, wherein the lipid nanoparticle and the additional therapeutic agent are formulated as a single composition.
In particular embodiments, the additional therapeutic agent is an adjuvant. In some embodiments, the adjuvant comprises an agent that promotes Dendritic Cell (DC) maturation in the vaccinated subject, such as, but not limited to, lipopolysaccharide, TNF-a, or CD40 ligand. In some embodiments, the adjuvant is an agent recognized as a "danger signal" by the immune system of the vaccinated subject, such as LPS, GP96, and the like.
In some embodiments, the adjuvant comprises an immunostimulatory cytokine such as, but not limited to, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, INF-alpha, IFN-beta, INF-gamma, GM-CSF, G-CSF, M-CSF, LT-beta, or TNF-alpha, a growth factor such as hGH.
In some embodiments, the adjuvant comprises a compound known to be capable of eliciting an innate immune response. An exemplary class of such compounds are Toll-like receptor ligands, such as those of the human Toll-like receptors TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, and murine Toll-like receptors TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11, TLR12 or TLR 13. Another exemplary class of such compounds are immunostimulatory nucleic acids, such as oligonucleotides containing CpG motifs. The CpG-containing nucleic acid may be a DNA (CpG-DNA) or RNA (CpG-RNA) molecule. The CpG-RNA or CpG-DNA may be a single strand CpG-DNA (ss CpG-DNA), a double strand CpG-DNA (dsDNA), a single strand CpG-RNA (ss CpG-RNA) or a double strand CpG-RNA (ds CpG-RNA). In some embodiments, the CpG nucleic acid is in the form of CpG-RNA. In particular embodiments, the CpG nucleic acid is in the form of a single strand CpG-RNA (ss CpG-RNA). In some embodiments, the CpG nucleic acid contains at least one or more (mitogenic) cytosine/guanine dinucleotide sequences (CpG motifs). In some embodiments, at least one CpG motif contained in these sequences (i.e., C (cytosine) and/or G (guanine) forming the CpG motif) is unmethylated.
In some embodiments, the additional therapeutic agent is an immunomodulatory agent that activates, boosts, or resumes normal immune function. In particular embodiments, the immunomodulator is an agonist of a costimulatory signal of an immune cell, such as a T lymphocyte, NK cell, or antigen presenting cell (e.g., a dendritic cell or macrophage). In particular embodiments, the immunomodulator is an antagonist of an inhibitory signal of an immune cell, such as a T lymphocyte, NK cell, or antigen presenting cell (e.g., a dendritic cell or macrophage).
Various immune cell stimulators known to those of skill in the art may be used in conjunction with the present disclosure. In certain embodiments, the agonist of the costimulatory signal is an agonist of a costimulatory molecule (e.g., a costimulatory receptor) found on an immune cell such as a T lymphocyte (e.g., a cd4+ or cd8+ T lymphocyte), an NK cell, and/or an antigen-presenting cell (e.g., a dendritic cell or macrophage). Specific examples of co-stimulatory molecules include glucocorticoid-induced tumor necrosis factor receptor (GITR), inducible T-cell co-stimulators (ICOS or CD 278), OX40 (CD 134), CD27, CD28, 4-IBB (CD 137), CD40, lymphotoxin alpha (lta), LIGHT (lymphotoxoid, which exhibits inducible expression and competes with herpes simplex virus glycoprotein D for HVEM (receptor expressed by T lymphocytes)), CD226, cytotoxic and regulatory T-cell molecules (CRT AM), death receptor 3 (DR 3), lymphotoxin beta receptor (LTBR), transmembrane activator and CAML interactive factor (transmembrane activator and CAML interactor, TACI), B-cell activator receptor (BAFFR) and B-cell maturation protein (BCMA).
In particular embodiments, the agonist of a co-stimulatory receptor is an antibody or antigen binding fragment thereof that specifically binds to the co-stimulatory receptor. Specific examples of co-stimulatory receptors include GITR, ICOS, OX, CD27, CD28, 4-1BB, CD40, LT alpha, LIGHT, CD226, CRT AM, DR3, LTBR, TACI, BAFFR, and BCMA. In certain embodiments, the antibody is a monoclonal antibody. In other embodiments, the antibody is sc-Fv. In a specific embodiment, the antibody is a bispecific antibody that binds to two receptors on immune cells. In other embodiments, the bispecific antibody binds to a receptor on an immune cell and another receptor on a virus-infected diseased cell. In specific embodiments, the antibody is a human or humanized antibody.
In another embodiment, the agonist of the co-stimulatory receptor is a ligand of the co-stimulatory receptor or a functional derivative thereof. In certain embodiments, the ligand is a fragment of a natural ligand. Specific examples of natural ligands include ICOSL, B7RP1, CD137L, OX40L, CD, herpes virus invasion mediator (HVEM), CD80 and CD86. Nucleotide sequences encoding natural ligands and amino acid sequences of natural ligands are known in the art.
In particular embodiments, the antagonist is an antagonist of an inhibitory molecule (e.g., an inhibitory receptor) found on immune cells such as T lymphocytes (e.g., cd4+ or cd8+ T lymphocytes), NK cells, and/or antigen presenting cells (e.g., dendritic cells or macrophages). Specific examples of inhibitory molecules include cytotoxic T lymphocyte-associated antigen 4 (CTLA-4 or CD 52), programmed cell death protein 1 (PD 1 or CD 279), B and T lymphocyte attenuation agents (BTLA), killer cell immunoglobulin-like receptor (KIR), lymphocyte activating gene 3 (LAG 3), T cell membrane protein 3 (TIM 3), CD 160, adenosine A2a receptor (A2 aR), T cell immune receptor (TIGIT) with immunoglobulin and ITIM domains, leukocyte-associated immunoglobulin-like receptor 1 (LAIR 1) and CD 160.
In another embodiment, the antagonist of the inhibitory receptor is an antibody (or antigen-binding fragment) that specifically binds to the natural ligand of the inhibitory receptor and prevents the natural ligand from binding to the inhibitory receptor and transducing an inhibitory signal. In certain embodiments, the antibody is a monoclonal antibody. In other embodiments, the antibody is sc-Fv. In a specific embodiment, the antibody is a bispecific antibody that binds to two receptors on immune cells. In other embodiments, the bispecific antibody binds to a receptor on an immune cell and another receptor on a virus-infected diseased cell. In specific embodiments, the antibody is a human or humanized antibody.
In another embodiment, the antagonist of the inhibitory receptor is a soluble receptor or a functional derivative thereof that specifically binds to the natural ligand of the inhibitory receptor and prevents the natural ligand from binding to the inhibitory receptor and transducing an inhibitory signal. Specific examples of natural ligands for inhibitory receptors include PDL-1, PDL-2, B7-H3, B7-H4, HVEM, gal9 and adenosine. Specific examples of inhibitory receptors that bind to natural ligands include CTLA-4, PD-1, BTLA, KIR, LAG3, TIM3 and A2aR.
In another embodiment, an antagonist of an inhibitory receptor is an antibody (or antigen binding fragment) or ligand that binds to the inhibitory receptor but does not transduce an inhibitory signal. Specific examples of inhibitory receptors include CTLA-4, PD1, BTLA, KIR, LAG3, TIM3 and A2aR. In certain embodiments, the antibody is a monoclonal antibody. In other embodiments, the antibody is an scFv. In particular embodiments, the antibody is a human or humanized antibody. A specific example of an antibody to an inhibitory receptor is an anti-CTLA-4 antibody (Leach DR, et al, science 1996; 271:1734-1736). Another example of an antibody to an inhibitory receptor is an anti-PD-1 antibody (Topalian SL, NEJM 2012; 28:3167-75).
6.5.3 patient population
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a subject in need thereof.
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a human subject. In some embodiments, the subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is an elderly human. In some embodiments, the subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is a human adult. In some embodiments, the subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is a human child. In some embodiments, the subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is a human pediatric. In some embodiments, the subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is a human infant.
In some embodiments, a subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is a non-human mammal.
In some embodiments, the subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is a subject exhibiting at least one symptom associated with a coronavirus infection. In some embodiments, a subject receiving administration of a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein exhibits one or more symptoms of an upper respiratory tract infection, a lower respiratory tract infection, a pulmonary infection, a kidney infection, a liver infection, an intestinal infection, a liver infection, a nervous system infection, a respiratory syndrome, pneumonia, gastroenteritis, encephalomyelitis, encephalitis, sarcoidosis, diarrhea, hepatitis, and demyelinating disease.
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy as described herein is administered to a subject without symptoms of a coronavirus infection.
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a subject at risk of or susceptible to a coronavirus infection. In some embodiments, the subject at risk of or susceptible to a coronavirus infection is an elderly. In some embodiments, the subject at risk of or susceptible to a coronavirus infection is a human adult. In some embodiments, the subject at risk of or susceptible to a coronavirus infection is a human child. In some embodiments, the subject at risk of or susceptible to a coronavirus infection is a human pediatric. In some embodiments, the subject at risk of or susceptible to a coronavirus infection is a human infant. In some embodiments, the subject at risk of or susceptible to a coronavirus infection is a human subject having an existing healthy condition affecting the immune system of the subject. In some embodiments, the subject at risk for or susceptible to coronavirus infection is a human subject having an existing healthy condition affecting a major organ of the subject. In some embodiments, the subject at risk for or susceptible to a coronavirus infection is a human subject having an existing healthy condition affecting the lung function of the subject. In some embodiments, the subject at risk for or susceptible to coronavirus infection is an elderly subject having an existing healthy condition affecting the subject's immune system or major organs (such as lung function). In various embodiments described in this paragraph, the subject at risk for or susceptible to a coronavirus infection may be a subject exhibiting symptoms of a coronavirus infection or free of symptoms of a coronavirus infection.
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a subject diagnosed as positive for a coronavirus infection. In some embodiments, the subject diagnosed as positive for a coronavirus infection is asymptomatic for the coronavirus infection, and the diagnosis is based on detecting the presence of viral nucleic acids or proteins from a sample from the subject. In some embodiments, the diagnosis is based on clinical symptoms exhibited by the patient. Exemplary symptoms that may serve as a basis for diagnosis include, but are not limited to, upper respiratory tract infection, lower respiratory tract infection, lung infection, kidney infection, liver infection, intestinal infection, liver infection, nervous system infection, respiratory syndrome, pneumonia, gastroenteritis, encephalomyelitis, encephalitis, sarcoidosis, diarrhea, hepatitis, and demyelinating diseases. In some embodiments, diagnosis is based on a history of clinical symptoms exhibited by the subject in combination with the subject's contact with a geographic location, population, and/or individual believed to be at high risk of carrying coronavirus (such as contact with another individual diagnosed as positive for coronavirus infection).
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a subject who has not previously received a therapeutic nucleic acid, a vaccine composition, a lipid-containing composition (e.g., a lipid nanoparticle), or a combination therapy administration.
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a subject that has previously received administration of a therapeutic nucleic acid, a vaccine composition, a lipid-containing composition (e.g., a lipid nanoparticle), or a combination therapy. In particular embodiments, the subject has previously been administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy as described herein one, two, three, or more times.
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a subject that has received therapy prior to administration of the therapeutic nucleic acid, vaccine composition, lipid-containing composition (e.g., lipid nanoparticle), or combination therapy. In some embodiments, a subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein experiences adverse side effects of a prior therapy or terminates a prior therapy due to unacceptable levels of toxicity to the subject.
6.5.4 administration doses and frequency
The amount of therapeutic nucleic acid or composition thereof effective in controlling, preventing and/or treating an infectious disease will depend on the nature of the disease being treated, the route of administration, the general health of the subject, etc., and should be decided according to the judgment of the physician. Standard clinical techniques, such as in vitro assays, may optionally be employed to help identify optimal dosage ranges. However, suitable dosage ranges for therapeutic nucleic acid for administration as described herein are typically about 0.001mg, 0.005mg, 0.01mg, 0.05mg, 0.1mg, 0.5mg, 1.0mg, 2.0mg, 3.0mg, 4.0mg, 5.0mg, 10.0mg, 0.001mg to 10.0mg, 0.01mg to 1.0mg, 0.1mg to 1mg, and 0.1mg to 5.0mg. The therapeutic nucleic acid or composition thereof may be administered to the subject as frequently as one, two, three, four or more times at intervals as desired. The effective dose can be inferred from dose response curves derived from in vitro or animal model test systems.
In certain embodiments, the therapeutic nucleic acid or composition thereof is administered to the subject in a single dose followed by a second dose after 1 to 6 weeks, 1 to 5 weeks, 1 to 4 weeks, 1 to 3 weeks, 1 to 2 weeks. According to these embodiments, the subject may be administered a booster vaccination at intervals of 6 to 12 months after the second vaccination.
In certain embodiments, the therapeutic nucleic acid or composition thereof may be repeatedly administered, and the administration may be at least 1 day, 2 days, 3 days, 5 days, 6 days, 7 days, 10 days, 14 days, 15 days, 21 days, 28 days, 30 days, 45 days, 2 months, 75 days, 3 months, or at least 6 months apart. In other embodiments, the therapeutic nucleic acid or composition thereof may be repeatedly administered, and the administration may be 1 to 14 days, 1 to 7 days, 7 to 14 days, 1 to 30 days, 15 to 45 days, 15 to 75 days, 15 to 90 days, 1 to 3 months, 3 to 6 months, 3 to 12 months, or 6 to 12 months apart. In some embodiments, the first therapeutic nucleic acid or composition thereof is administered to the subject followed by administration of the second therapeutic nucleic acid or composition thereof. In certain embodiments, the first and second therapeutic nucleic acids or compositions thereof may be separated by at least 1 day, 2 days, 3 days, 5 days, 6 days, 7 days, 10 days, 14 days, 15 days, 21 days, 28 days, 30 days, 45 days, 2 months, 75 days, 3 months, or at least 6 months. In other embodiments, the first and second therapeutic nucleic acids or compositions thereof may be spaced 1 to 14 days, 1 to 7 days, 7 to 14 days, 1 to 30 days, 15 to 45 days, 15 to 75 days, 15 to 90 days, 1 to 3 months, 3 to 6 months, 3 to 12 months, or 6 to 12 months apart.
In certain embodiments, the therapeutic nucleic acid or composition thereof is administered to the subject in combination with one or more additional therapies (such as the therapies described in section 6.5.2). The dosage of the other additional therapy or therapies will depend on a variety of factors including, for example, the therapy, the nature of the infectious disease, the route of administration, the general health of the subject, etc., and should be determined at the discretion of the physician. In particular embodiments, the dose of the other therapy is the dose and/or frequency of administration of the therapy recommended for use as a single dose of therapy according to the methods disclosed herein. In other embodiments, the dosage of the other therapy is a lower dosage and/or less frequent administration of the therapy than recommended for the therapy used as a single agent according to the methods disclosed herein. Recommended dosages for approved therapies can be found in the Physics' Desk Reference.
In certain embodiments, the therapeutic nucleic acid or composition thereof is administered to the subject concurrently with one or more additional therapies. In other embodiments, the therapeutic nucleic acid or composition thereof is administered to the subject every 3 to 7 days, 1 to 6 weeks, 1 to 5 weeks, 1 to 4 weeks, 2 to 4 weeks, 1 to 3 weeks, or 1 to 2 weeks, and one or more additional therapies (such as described in section 6.5.2) are administered every 3 to 7 days, 1 to 6 weeks, 1 to 5 weeks, 1 to 4 weeks, 1 to 3 weeks, or 1 to 2 weeks. In certain embodiments, the therapeutic nucleic acid or composition thereof is administered to the subject every 1-2 weeks, and one or more additional therapies (such as described in section 6.5.2) are administered every 2-4 weeks. In some embodiments, the therapeutic nucleic acid or composition thereof is administered to the subject weekly, and one or more additional therapies (such as described in section 6.5.2) are administered every 2 weeks.
7. Examples
The embodiments in this section (i.e., section 7) are provided by way of illustration and not limitation.
7.1 example 1: mRNA synthesis and purification.
DNA linearization. Will contain a coding coronavirus SDNA plasmid templates for the target sequences of the S1 subunit of ARS-CoV-2 spike (S) protein, the Receptor Binding Domain (RBD), some different versions or Receptor Binding Motifs (RBM), the 5 'and 3' -UTRs, and the polyA signal were linearized using restriction enzyme digestion. Mu.g of plasmid was mixed with 10U of Esp I/BsmBI and incubated at 37℃for 4 hours to ensure complete linearization. The reaction was stopped by adding 1/10 volume of 3M sodium acetate (pH 5.5) and 2.5 volumes of ethanol, thoroughly mixed and cooled at-20℃for 1 hour. The linearized DNA was precipitated by centrifugation at 13800g for 15 min at 4℃and washed twice with 70% ethanol and resuspended in nuclease H 2 O.
In vitro transcription of mRNA. The contents of a typical 20 μl reaction mixture are shown in the table below:
nuclease-free H 2 O Make up to 20 mu L
RNase inhibitor (40U/. Mu.L) 0.5μL
rNTP mixtures (100 mM each) 8 μL (final 10mM each)
10 XIVT reaction buffer 2μL
1M MgCl 2 0.8μL
0.1M DTT 2μL
100U/mL inorganic pyrophosphatase 0.8μL
100mM NaCl 1μL
Linearizing DNA 1μg
T7 RNA polymerase (50U/. Mu.L) 2μL
The reaction mixture was incubated at 37℃for 6 hours, then 1. Mu.l DNase I (no RNase, 1U/. Mu.L) was added to remove the DNA template and incubated at 37℃for 30 minutes. The synthesized RNA was purified by adding 0.5 volume of 7.5M LiCl, 50mM EDTA and incubating at-20℃for 45 minutes, followed by centrifugation at 13800g at 4℃for 15 minutes to precipitate mRNA. The supernatant was then removed and the pellet was washed twice with 500. Mu.L of ice-cold 70% ethanol and mRNA was resuspended in nuclease H-free 2 In O, the concentration was adjusted to 1mg/mL and stored at-20 ℃.
mRNA capping. Each 10 μg of uncapped mRNA was heated at 65 ℃ for 10 minutes, placed on ice for 5 minutes, then mixed with 10U vaccinia virus capping enzyme, 50U mRNA cap 2' -O-methyltransferase, 0.2mM SAM, 0.5mM GTP, and 1U rnase inhibitor, and incubated at 37 ℃ for 60 minutes to generate cap 1 modified structure. Modified mRNA was precipitated by LiCl as described before and RNA was resuspended in nuclease H-free 2 O, and stored at-20 ℃.
HPLC purification. RNA was purified by High Performance Liquid Chromatography (HPLC) using a C4 column (5 μm) (10 mm. Times.250 mm column). Buffer a contained 0.1M triethylammonium acetate (TEAA) (ph=7.0) and buffer B contained 0.1M TEAA (ph=7.0) and 25% acetonitrile.
FIGS. 1A and 1B show the purity of in vitro transcribed mRNA-001 (sample 3, 81.8%) and mRNA-002 (sample 4, 76.8%) tested by the BA method. As shown in fig. 1A and 1B, mRNA molecules were successfully produced by the in vitro transcription and maturation processes described above, and purified from the reaction system using HPLC (tested by BA method).
7.2 example 2: in vitro transfection and antigen expression analysis.
The different mRNA molecules encoding coronavirus S protein antigens produced in example 1 were transfected into expression cell lines such as HEK293 and Hela cultured cells to assess the in vitro expression efficiency of the mRNA molecules.
To assemble the mRNA-lipid complex, 1. Mu.L of Lipofectamine mixed with 30. Mu.L of Opti-MEM and 1. Mu.g of mRNA mixed with 30. Mu.L of Opti-MEM were added to each of the two separate tubes. The two samples were mixed and incubated for 5 minutes at room temperature. Fifty microliters of this complex was used to transfect cells present in 1 well of a 24 well plate and the cells were incubated in a humidified 37 ℃/5% CO2 incubator until analysis.
Expression analysis. Cells were transferred from the 24 hour post-transfection culture and centrifuged at 200RCF for 5 minutes at room temperature. Next, the cells were treated with 4% (v/v) paraformaldehyde for 30 minutes and washed with PBS. Next, the cells were treated with 0.2% (v/v) Triton X-100 for 10 minutes and washed with PBS. Next, the cells were blocked with 5% (w/v) bovine serum albumin for 1 hour and washed with PBS. Next, cells were incubated with several rabbit anti-SARS-CoV-2S protein antibodies for 1 hour at 4 ℃, labeled with FITC-labeled anti-rabbit antibody (1:200) as secondary antibody for 30 minutes, washed with PBS, and counterstained with DAPI. The signal was checked by confocal laser scanning microscopy.
In particular, FIG. 2 shows an exemplary confocal fluorescence microscopy image of Hela cells transfected with an mRNA construct encoding the RBD sequence of SARS-CoV-2S protein (RBD sample 1). The cells were incubated with 3 different monoclonal antibodies recognizing the S protein RBD of SARS-CoV-2, namely SARS-2-H014, SARS-2-mh001 and SARS-2-mh219, respectively.
As shown in FIG. 2, the in vitro transcribed mRNA molecule encoding the SARS-CoV-2S protein RBD was efficiently transfected into HeLa cells. Transfected Hela cells expressed the encoded viral antigen at satisfactory levels, as can be recognized by the three monoclonal antibodies used in this study. Transfected HeLa cells maintained normal cell morphology, indicating that expression of the encoded viral antigen did not cause cytotoxicity.
Western blot. For secreted proteins such as SARS-CoV-2S protein or fragments thereof, cultures of cells transfected with the mRNA molecules produced in example 1 were collected and analyzed by western blot 24 hours after transfection. After SDS-PAGE, proteins were transferred to blotting membranes. The blots were briefly rinsed with PBS and then incubated with added rabbit anti-spike RBD antibody for 2 hours at room temperature. The blots were washed well in PBS. HRP-conjugated anti-rabbit antibody was added and incubated for 1 hour at room temperature with gentle agitation. The membranes were washed with PBS and incubated with the addition of appropriate enzyme substrate solutions to visualize the protein bands.
FIG. 3 shows an exemplary Western blot analysis of culture supernatants of Hela cells transfected with mRNA molecules encoding the RBD sequence of SARS-CoV-2S protein. In particular, lanes labeled "RBD sample 1" and "RBD sample 2" were loaded with culture supernatants of Hela cells transfected with mRNA constructs encoding the different SARS-CoV-2S protein RBD sequences described herein, respectively. Lanes labeled "rRBD-His" were loaded with recombinantly produced SARS-CoV-2S protein RBD sequence fused to the C-terminal His-tag. Lanes labeled "NT" were loaded with cell culture supernatants of Hela cells transfected with unrelated mRNA constructs as a negative control.
As shown in FIG. 3, the in vitro transcribed mRNA construct encoding the SARS-CoV-2S protein RBD was efficiently transfected into HeLa cells. Transfected HeLa cells expressed and secreted the encoded viral antigen at satisfactory levels. A band around about 30kD corresponds to the secreted viral antigen in monomeric form. The band around about 60kD corresponds to the secreted viral antigen in dimeric form. Without being bound by theory, it is expected that the multimerized form of the secreted viral antigen may be more immunogenic and more effective in inducing a humoral immune response upon administration to a vaccinated subject than the monomeric form. As shown in fig. 3, the viral antigen encoded by the mRNA construct may multimerize upon expression, indicating the effectiveness of the mRNA construct in eliciting an immune response against the virus upon administration to a subject.
ELISA. The expression level of the viral peptide or protein encoded by the mRNA in the cell culture supernatant was determined by ELISA. In particular, for ELISA analysis, microtiter wells were coated with 100. Mu.l of a solution containing 5. Mu.g/ml SARS-CoV-2S protein RBD and incubated with a blocking plate membrane at 4℃for 12 hours. The plates were then washed 3 times in wash buffer. Next, 300 μl of 5% BSA in PBST was added to each well and incubated at 37 ℃ for 60 minutes. The plates were then washed 4 times in wash buffer. Next, culture supernatant samples and SARS-CoV-2S protein RBD standard were diluted in wash buffer and 100. Mu.l of the appropriately diluted samples and standard were added to the relevant wells in triplicate. Next, the wells were incubated at 37 ℃ for 60 minutes and washed 3 times in wash buffer. Next, 100. Mu.L of rabbit anti-SARS-CoV-2S protein antibody was added to each well of the plate. Next, the plates were covered and incubated at 37 ℃ for 60 minutes and washed 3 times in wash buffer. Next, 100 μl of diluted HRP-conjugated anti-rabbit antibody was added to each well and incubated for 1 hour at 37 ℃ and washed 3 times in wash buffer. Next, 100 μl of TMB substrate solution was added to each well and incubated at room temperature (and in the dark if necessary) for about 10 minutes. Next, 100 μl of the stop solution was added to each well and gently thoroughly mixed. Next, the OD at 450/620nm was read using a Molecular Devices microplate reader, and was deducted for detection.
FIG. 4 shows an exemplary ELISA assay that measures the protein concentration (ng/mL) of mRNA-encoded SARS-CoV-2S protein RBD (referred to as "RBD sample 1" and "RBD sample 2", respectively) in culture supernatants of cells transfected with two mRNA constructs. BSA was used as a negative control for ELISA. This study further demonstrates that cells transfected with the mRNA construct express and secrete the encoded viral antigen at satisfactory levels as quantified by ELISA.
FIG. 8 shows an exemplary ELISA assay measuring protein concentration (ng/ML) of mRNA-encoded SARS-CoV-2S protein RBD or mRNA-encoded SARS-CoV-2 B.1.351 variant S protein RBD (sample 4) in culture supernatants of cells transfected with the mRNA constructs. In particular, the mRNA construct encoding the SARS-CoV-2RBD fragment is identical to the sample known as "RBD sample 2" as depicted in FIG. 4. As shown in FIG. 8, the expression level of the variant B.1.351S protein RBD (sample 4) was comparable to that of the SARS-CoV-2S protein RBD.
7.3 example 3 production of neutralizing antibodies in mice vaccinated with LNP containing mRNA
BALB/c mice were vaccinated by intramuscular injection of 100. Mu.L of LNP formulation containing 10. Mu.g of mRNA encoding the SARS-CoV-2S protein RBD (RBD sample 1) and blood was collected from the tail vein on days 7, 14, 21 and 28, respectively, after vaccination. Mice in one group of vaccinated mice were also boosted by receiving a second intramuscular injection of the same dose of LNP formulation containing mRNA 14 days after the first injection and blood was collected from the tail vein on days 7, 14, 21 and 28 after the second boost injection. The 50% plaque reduction neutralization titer (PRNT 50) of the collected mouse serum was determined to assess neutralizing antibody production in vaccinated animals.
PRNT analysis. For Plaque Reduction Neutralization Titer (PRNT) analysis, the serum sample or antibody solution to be tested is diluted and mixed with a viral suspension. The mixture is then incubated to react the antibodies with the virus. Next, the mixture was poured onto a confluent monolayer of host cells. The surface of the cell layer is covered with a layer of agarose or carboxymethyl cellulose to prevent the virus from being transmitted by one person. The concentration of Plaque Forming Units (PFU) can be estimated by the number of plaques (areas of infected cells) formed after a few days. Depending on the virus, plaque forming units can be measured by microscopic observation of fluorescent antibodies or specific dyes that react with infected cells. A 50% reduction in plaque number compared to virus-free serum is a measure of the amount and effectiveness of antibodies present. This measurement is denoted PRNT 50 value (or simply NT 50 value).
In particular, in this study, mouse serum collected as described above was heat-inactivated at 55 ℃ for 30 minutes, then serially diluted to 1:50, 1:100, 1:200, 1:400, and 1:800 in PBS. To each serum dilution was added an equal volume of 100PFU containing SARS-CoV-2 or SARS-CoV-2 B.1.351 pseudovirus in PBS. Each mixture was incubated at 37 ℃ for 30 minutes, added to the confluent culture of Vero E6 monolayers, and allowed to incubate at 37 ℃ for 60 minutes. Cell monolayers were covered with 4ml of 0.8% agarose thawed in standard Vero E6 cell culture medium and plaques were resolved with neutral red staining after 2 days. The PRNT 50 value is then calculated and plotted in fig. 5. In particular, the Y-axis shows the inverse of the PRNT 50 value (i.e., 1/PRNT 50). The X-axis shows the following animal groups: in fig. 5, "RBD" means mice receiving only the first injection, and "RBD-B" means mice receiving the first injection and booster injection; "control" means a group of mice that received an intramuscular injection of 100 μl of LNP formulation without mRNA and were boosted with the same dose of blank LNP after 14 days. As shown in fig. 5, animals vaccinated with LNP containing therapeutic mRNA produced neutralizing antibodies that significantly reduced infection of cells with SARS-CoV-2. This study demonstrates that LNP compositions of the invention containing therapeutic mRNA can be used to treat, control or prevent infection by the coronavirus SARS-CoV-2.
7.4 example 4 production of neutralizing antibodies by mice vaccinated with LNP containing mRNA-comparative study
BALB/c mice were vaccinated by intramuscular injection of 100. Mu.L of LNP formulation or PBS containing 2. Mu.g of mRNA encoding the SARS-CoV-2S protein RBD (RBD-WT), SARS-CoV-2 B.1.351S protein RBD (RBD-SA) and blood was collected from the tail vein at days 7, 14, 21 and 28, respectively, after vaccination. Mice in one group of vaccinated mice were also boosted by receiving a second intramuscular injection of the same dose of LNP formulation containing mRNA 14 days after the first injection and blood was collected from the tail vein on days 7, 14, 21 and 28 after the second boost injection. The 50% neutralization titer (NT 50) of the collected mouse serum was measured to evaluate the production of neutralizing antibodies in vaccinated animals.
NT 50 analysis. Will be described above at post-vaccination stageMouse serum collected on day 21 was heat-inactivated at 56℃for 30 min and then diluted to 1:30, 1:90, 1:270, 1:810, 1:2430, 1:7290 and 1:21870. To each serum dilution was added an equal volume of PBS containing 500pfu of SARS-CoV-2 or SARS-CoV-2 B.1.351 pseudovirus. Each mixture was incubated at 37℃for 60 minutes and then added to a 96-well whiteboard containing 2X 10 4 Individual wells of live HEK293-ACE2 cells/well were incubated for 48 hours at 37 ℃. After incubation, luciferase reporter detection reagent was added to wells on a 96-well whiteboard and allowed to react in the dark at room temperature for 4 to 5 minutes. Chemiluminescent values (RLU) were detected using a microplate reader. The 50% Neutralization Titer (NT) was then calculated using Reed-Muench 50 ) Values. The results are summarized in the following table and plotted in fig. 10.
Sample 3:
sample 4:
in FIG. 10, "WT pseudovirus" represents an analysis of SARS-CoV-2 pseudovirus added to serum samples collected from mice immunized with SARS-CoV-2S protein RBD (upper triangle), SARS-CoV-2 B.1.351S protein RBD (sample 3 or sample 4, lower triangle) and PBS (circle), respectively; "SA pseudovirus" means an analysis in which SARS-CoV-2 B.1.351 pseudovirus was added to serum samples collected from mice immunized with SARS-CoV-2S protein RBD (upper triangle), SARS-CoV-2 B.1.351S protein RBD (sample 3 or sample 4, lower triangle) and PBS (circle), respectively.
As shown in FIG. 10, animals vaccinated with LNP blocking the therapeutic mRNA encoding the SARS-CoV-2S protein RBD or the SARS-CoV-2 B.1.351S protein RBD of sample 4 all produced neutralizing antibodies that significantly reduced infection of cells by either SARS-CoV-2 or the SARS-CoV-2 B.1.351 variant. This study demonstrates that LNP compositions of the invention containing therapeutic mRNA can be used to treat, control, or prevent infection by the coronavirus SARS-CoV-2 or variants thereof.
7.5 example 5: correlation study between RBD expression and mRNA content of mRNA-LNP samples in mice
The following experiments were conducted to establish a method for detecting RBD expression in animals in response to a finished coronavirus SARS-CoV-2mRNA vaccine in order to explore the correlation between RBD expression and mRNA content in the finished product.
The animals were grouped and dosed as follows:
/>
different test substances were administered to the experimental animals ICH mice by intravenous injection according to the above table. Blood was collected from the heart 6 hours after administration after carbon dioxide depth anesthesia. After about 30 minutes of standing at room temperature, serum was separated (4 ℃,8000rpm (5724 g), 10 minutes), split (three aliquots, greater than 110ul each; if all three aliquots were not guaranteed to be satisfactory, at least two aliquots were satisfactory and the blood volume per tube was noted), and stored in a refrigerator at-80 ℃. Serum samples were collected from the remaining 10 blank mice, thoroughly mixed, and then distributed into vials.
RBD expression in serum samples was detected by the following ELISA method:
all samples and reagents were returned to room temperature prior to use.
1) 100 μl of ACE2 coated stock solution was added to the ELISA plate and the plate was sealed with sealing membrane and incubated for 15 hours at 4 ℃.
2) The liquid in the wells was discarded and the plates were washed 3 times with wash buffer, 300 μl/well, 2 minutes each time.
3) 300. Mu.L/well blocking solution was added and the plate was sealed with a sealing membrane and incubated for 1 hour at 37 ℃.
4) The liquid in the wells was discarded and the plates were washed 3 times with wash buffer, 300 μl/well, 2 minutes each time.
5) 100. Mu.L of diluted sample to be tested and standard were added to ELISA plates, and the plates were sealed with sealing membrane and incubated for 1 hour at 37 ℃.
6) The liquid in the wells was discarded and the plates were washed 3 times with wash buffer, 300 μl/well, 2 minutes each time.
7) mu.L of the primary antibody stock solution was added to each well of the plate, and the plate was covered with a sealing film and incubated at 37℃for 1 hour.
8) The liquid in the wells was discarded and the plates were washed 3 times with wash buffer, 300 μl/well, 2 minutes each time.
9) mu.L of HRP secondary antibody stock solution was added to each well of the plate and the plate was covered with sealing film and incubated for 1 hour at 37 ℃.
10 The wells were discarded and the plates were washed 3 times with wash buffer, 300 μl/well, 2 minutes each.
11 100 μl of TMB substrate solution was added to each microwell and the plate incubated at room temperature for about 5 minutes in the dark.
12 100 μl of ELISA-stop solution was added to each microwell.
13 By using a multifunctional microplate reader, wherein the detection wavelength is set to 450nm and 620nm, a curve fitting/5-parameter regression model is set for the standard curve, and the dilution factor of the test sample is set to 2, the standard curve and sample setting are performed simultaneously (the template setting may be set before the start of reading), and wherein the absorbance value is determined.
14 Automatically calculating the results by software by using a 5-parameter regression model of the protein concentration (X) of the protein standard and its corresponding fluorescence value (Y) in order to calculate and obtain the protein concentration in the sample (nk-dilution/Adj results).
The results of the detection of RBD content in serum samples of experimental animals are shown in fig. 6 and table 6. In all mouse serum samples, no RBD concentrations were detected in the "blank serum" samples. A significant dose dependency was observed between 1ug and 5ug mRNA and the expressed RBD content was 0.14-2.18ng/mL.
TABLE 6
7.6 example 6: antigen immunogenicity analysis
The purpose of the following experiments was to evaluate the immunogenicity of the mRNA molecular liposome (RBD mRNA-LNP) loaded with the S-RBD protein of SARS-CoV-2 coronavirus of the present invention.
The number of animals in each group and the detailed immunization routes, dosages and protocols are shown in the table below. Experimental animals BALB/c mice received test antigen (10. Mu.g/50. Mu.L/mouse) on day 0 on the right hind limb by single point intramuscular injection. The same dose of test vaccine was vaccinated again on day 14. The detailed methods of administration, amounts of administration and routes of administration are as follows:
annotation: a: the day of first immunization was defined as day 0.
Prior to the first immunization, 4 mice were randomly selected to collect blood to prepare serum samples (150 μl or more) and the serum samples were collected without anticoagulant for monitoring as shown in the following table.
There were 52 samples in total, each as follows: 4 serum samples taken prior to the first immunization; 16 serum samples taken 14 days after the first immunization; 16 serum samples taken 21 days after the first immunization; and 16 serum samples taken 28 days after the first immunization. After serum collection was completed, coronavirus RBD IgG titers were measured together. In this experiment, igG titer detection was performed using the "mouse anti-novel coronavirus (2019-nCoV) S-RBD protein IgG antibody detection kit" developed by Wantai BioPharm. Test serum samples were diluted with sample diluent at a 10-fold gradient starting at 1:10 and gently shaken to mix thoroughly. 100 μl of each of the diluted sample, negative control, and positive control was added to each well. The plate is sealed with a sealing film. The sealing film was cut off for 30 minutes at 37 ℃ and the plates were washed 5 times, 300 μl each, and dried at the last time. 100. Mu.L of ELISA reagent was added to each well, except for blank wells. The sealing film was cut off for 30 minutes at 37 ℃ and the plates were washed 5 times, 300 μl each. 50mL of each of the color developers A and B was added to each well, gently shaken to mix well, and developed for 15 minutes at 37℃in the absence of light. To each well 50 μl of stop solution was added and gently mixed well. The results were measured within 10 minutes. The wavelength of the microplate reader was set at 450nm. The maximum dilution factor that detected as positive was selected, and the titer result was the OD value of the maximum positive dilution factor/0.1 x the corresponding dilution factor.
Specifically, mice were immunized with a single dose (10 μg) of mRNA vaccine on day 0, and a booster dose (10 μg) was given on day 14. anti-S-RBD IgG antibody levels were detected in mouse serum samples at days 14, 21 and 29 post-immunization. The results are shown in fig. 7. In the group of mice vaccinated with mRNA-LNP, the specific IgG titers increased from about 1/900 on day 14 to 1/70,000 on day 21 one week after the second immunization, and maintained the same level at day 29. In contrast, neither empty liposomes nor PBS control had RBD-specific IgG expression. This result clearly shows that the vaccine product described in the present invention is strongly immunogenic and is capable of specifically inducing the production of relevant antibodies to achieve the effect of controlling or preventing coronavirus SARS-CoV-2 infection.
7.7 example 7: antigen immunogenicity analysis-comparison study
The purpose of the following study was to compare the immunogenicity of LNP substances loaded with mRNA encoding the SARS-CoV-2S protein RBD (RBD-WT) and mRNA encoding the SARS-CoV-2 B.1.351S protein RBD (RBD-SA) (sample 3 or sample 4), respectively.
The number of animals in each group and the detailed immunization routes, dosages and protocols are shown in the table below. Experimental animals BALB/c mice received test antigen (2 μg/50 μl/mouse) by single point intramuscular injection on the right hind limb on day 0. The same dose of test vaccine was vaccinated again on day 14. The detailed methods of administration, amounts of administration and routes of administration are as follows:
Annotation: a: the day of first immunization was defined as day 0.
Serum samples were collected without anticoagulant for monitoring as shown in the following table.
/>
In total, 90 samples were present, each as follows: 30 serum samples taken 14 days after the first immunization; 30 serum samples taken 21 days after the first immunization; and 30 serum samples taken 28 days after the first immunization. After serum collection was completed, coronavirus RBD IgG titers were measured together. In this experiment, igG titer detection was performed using the "mouse anti-novel coronavirus (2019-nCoV) S-RBD protein IgG antibody detection kit" developed by Wantai BioPharm. Test serum samples were diluted with sample diluent at a 10-fold gradient starting at 1:10 and gently shaken to mix thoroughly. 100 μl of each of the diluted sample, negative control, and positive control was added to each well. The plate is sealed with a sealing film. The sealing film was cut off for 30 minutes at 37 ℃ and the plates were washed 5 times, 300 μl each, and dried at the last time. 100. Mu.L of ELISA reagent was added to each well, except for blank wells. The sealing film was cut off for 30 minutes at 37 ℃ and the plates were washed 5 times, 300 μl each. 50mL of each of the color developers A and B was added to each well, gently shaken to mix well, and developed for 15 minutes at 37℃in the absence of light. To each well 50 μl of stop solution was added and gently mixed well. The results were measured within 10 minutes. The wavelength of the microplate reader was set at 450nm. The maximum dilution factor that detected as positive was selected, and the titer result was the OD value of the maximum positive dilution factor/0.1 x the corresponding dilution factor.
Fig. 9A and 9B show the levels of IgG antibodies detected by ELISA. First, different forms of RBD proteins were coated on ELISA plates, then mouse serum and RBD proteins were combined, and binding values of serum and proteins were detected by HRP-conjugated secondary antibodies to calculate antibody levels. From fig. 9A and 9B it can be concluded that south african vaccines can stimulate better antibody levels, not weaker or even stronger than wild type vaccines.
Specifically, mice were immunized with a single dose (10 μg) of mRNA vaccine on day 0, and a booster dose (10 μg) was given on day 14. anti-S-RBD IgG antibody levels in mouse serum samples were detected by ELISA 14 days and 21 days after immunization, and the results are shown in fig. 9A and 9B. In particular, in the first ELISA assay, the anti-S-RBD IgG antibody level was measured using recombinant SARS-CoV-2S protein RBD immobilized on ELISA plates (FIG. 9A), and in the second ELISA assay, the anti-S-RBD IgG antibody level was measured using recombinant SARS-CoV-2 B.1.351S protein RBD (FIG. 9B). The results indicate that the S-RBD specific antibodies produced by immunized animals are capable of binding to the S protein RBD derived from SARS-CoV-2 coronavirus and the B.1.351 variant. Furthermore, antibody titers in animals immunized with both mRNA-LNP were at comparable levels. In particular, animals immunized with mRNA-LNP of sample 4 encoding the B.1.351 variant S-RBD protein produced higher antibody titers (day 14 of FIG. 9A; days 14 and 21 of FIG. 9B) or equivalent antibody titers (day 21 of FIG. 9A) than animals immunized with mRNA-LNP encoding SARS-CoV-2S-RBD. This study demonstrates that LNP compositions of the invention containing therapeutic mRNA can be used to treat, control, or prevent infection by the coronavirus SARS-CoV-2 or variants thereof.
8. Sequence listing
This specification is presented with a Computer Readable Form (CRF) copy of the sequence listing. CRFs named 14639-010-228_sequence_list. Txt were created at 2021, 7, 27 and sized 257,733 bytes and revised at 2022, 7, 18 and sized 260,759 bytes and are incorporated herein by reference in their entirety.

Claims (15)

1. A non-naturally occurring nucleic acid encoding a viral peptide or protein derived from coronavirus SARS-CoV-2b.1.351, said nucleic acid comprising a coding region, wherein said coding region comprises one or more Open Reading Frames (ORFs), and wherein at least one ORF encodes a fusion protein comprising a Receptor Binding Domain (RBD) fused to a human IgE signal peptide.
2. The non-naturally occurring nucleic acid of claim 1, wherein said at least one ORF comprises a coding sequence selected from the group consisting of SEQ ID NOs 61 and 62.
3. The non-naturally occurring nucleic acid of claim 1 or 2, wherein said at least one ORF consists of a coding sequence selected from the group consisting of SEQ ID NOs 67 and 68.
4. The non-naturally occurring nucleic acid of any one of claims 1 to 3, further comprising:
a 5' untranslated region (5 ' -UTR), wherein said 5' -UTR comprises a sequence selected from the group consisting of SEQ ID NOS: 46-51, in particular SEQ ID NO:48, and/or
A 3' untranslated region (3 ' -UTR), wherein said 3' -UTR comprises a sequence selected from the group consisting of SEQ ID NOS: 52-57, in particular SEQ ID NO: 52; and optionally a poly-A tail or polyadenylation signal.
5. The non-naturally occurring nucleic acid of any one of claims 1 to 4, wherein the nucleic acid is DNA or mRNA.
6. A vector comprising the non-naturally occurring nucleic acid of any one of claims 1 to 5.
7. A cell comprising the non-naturally occurring nucleic acid of any one of claims 1 to 5 or the vector of claim 6.
8. A pharmaceutical composition comprising the non-naturally occurring nucleic acid of any one of claims 1 to 5.
9. The pharmaceutical composition of claim 8, further comprising at least a first lipid,
wherein the first lipid is a compound according to formulae (1) to (4), or
Wherein the first lipid is according to the formula (1-A), (1-B '), (1-B "), (1-C), (1-D), (1-E), (1-F) (1-F '), (1-F"), (1-G), (1-H), (1-I), (1-J '), (1-J "), (1-K), (1-L), (1-M), and (1-G) (1-N), (1-N '), (1-N"), (1-O), (1-P), (1-Q), (1-R '), (1-R "), (1-S), (1-T) (1-U), (2-A), (2-B '), (2-B"), (2-C), (2-D), (2-E), (2-F '), (2-F "), and (2-B") (2-G), (2-H), (2-I), (2-J '), (2-K), (2-L), (2-M), (2-N'), (2-N "), (2-O), (2-P), (2-Q), (2-R '), (2-R"), (2-S), (2-T), (2-U), and (2-N) (3-A), (3-B'), (3-B "), (3-C), (3-D), (3-E), (3-F '), (3-F"), (3-G), (3-H), (3-I), (3-J'), (3-K), (3-L), (3-M), (3-N '), a (3-G), (3-H), (3-I), (3-J'), (3-N "), (3-O), (3-P), (3-Q), (3-R '), (3-R"), (3-S), (3-T), (3-U), (4-A), (4-B'), (4-B "), (4-C), (4-D), (4-E), (4-F '), (4-F"), (4-G), (4-H), (4-I), (4-J'), (4-J "), (4-K), (4-L), (4-M), (4-N '), (4-N"), (4-O), (4-P), (4-Q), (4-R'), (4-R "), (4-S), (4-T) or (4-U), or alternatively
Wherein the first lipid is a compound listed in Table 7, or
Wherein the first lipid is a compound according to formulae (5) to (9), or
Wherein the first lipid is a compound according to formula (5-A), (5-B), (7-A) or (8-A), or
Wherein the first lipid is a compound listed in Table 8, or
Wherein the first lipid is a compound according to formulae (10) to (17), or
Wherein the first lipid is a compound listed in Table 9, or
Wherein the first lipid is a compound according to formulae (18) to (26), or
Wherein the first lipid is a compound according to formula (21-A), (21-B), (21-C), (21-D), (21-E), (21-F), (21-G), (21-H), (22-A), (22-B), (22-C), (22-D), (22-E), (22-F), (22-G) or (22-H), or
Wherein the first lipid is a compound listed in Table 10, or
Wherein the first lipid is a compound according to formulae (27) to (40), or
Wherein the first lipid is a compound according to formula (30-A), (30-B), (30-C), (30-D), (30-E), (30-F), (30-G), (30-H), (31-A), (31-B), (31-C), (31-D), (31-E), (31-F), (31-G), (31-H), (32-A), (32-B), (32-C) or (32-D), or
Wherein the first lipid is a compound listed in table 12.
10. The pharmaceutical composition of claim 9, further comprising at least a second lipid,
wherein the second lipid is a compound according to formulae (41) to (46), or
Wherein the second lipid is a compound according to formula (41-A), (41-B), (41-C), (41-D), (41-E), (42-A), (42-B), (42-C), (42-D), (42-E), (43-A), (43-B), (43-C), (44-A), (44-B), (44-C), (45-A), (45-B), (45-C), (46-A), (46-B) or (46-C), or
Wherein the second lipid is a compound listed in table 14.
11. The pharmaceutical composition of any one of claims 8 to 10, wherein the composition is formulated as a lipid nanoparticle encapsulating the nucleic acid in a lipid shell.
12. The pharmaceutical composition of any one of claims 8 to 11, wherein the composition is a vaccine.
13. A method for controlling, preventing or treating an infectious disease caused by a coronavirus in a subject, the method comprising administering to the subject a therapeutically effective amount of the non-naturally occurring nucleic acid of any one of claims 1 to 5 or the pharmaceutical composition of any one of claims 8 to 12; wherein the coronavirus is SARS-CoV-2 or a variant thereof.
14. The method of claim 13, wherein the variant is SARS-CoV-2b.1.351.
15. The method of claim 13 or 14, wherein an immune response is elicited against the coronavirus in the subject, wherein the immune response comprises generating antibodies that specifically bind to the viral peptide or protein encoded by the nucleic acid.
CN202280005623.0A 2021-07-30 2022-07-29 Nucleic acid vaccine for mutant coronaviruses Pending CN117043343A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CNPCT/CN2021/109704 2021-07-30
CN2021109704 2021-07-30
PCT/CN2022/108920 WO2023006062A1 (en) 2021-07-30 2022-07-29 Nucleic acid vaccines for mutant coronavirus

Publications (1)

Publication Number Publication Date
CN117043343A true CN117043343A (en) 2023-11-10

Family

ID=85086299

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202280005623.0A Pending CN117043343A (en) 2021-07-30 2022-07-29 Nucleic acid vaccine for mutant coronaviruses

Country Status (2)

Country Link
CN (1) CN117043343A (en)
WO (1) WO2023006062A1 (en)

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113151312B (en) * 2020-03-02 2022-12-09 中国科学院微生物研究所 Novel coronavirus SARS-CoV-2mRNA vaccine and its preparation method and application
US10906944B2 (en) * 2020-06-29 2021-02-02 The Scripps Research Institute Stabilized coronavirus spike (S) protein immunogens and related vaccines
CN111926040B (en) * 2020-10-12 2021-01-26 天津中逸安健生物科技有限公司 Novel coronavirus RBD nucleotide sequence, optimization method and application
CN112480217B (en) * 2020-11-30 2022-04-08 广州阿格纳生物医药制造有限公司 Vaccines and compositions based on S antigen protein of SARS-CoV-2
CN113018449B (en) * 2021-05-14 2021-09-07 苏州艾博生物科技有限公司 Cationic lipid compounds, compositions containing the same and uses thereof
CN112980852B (en) * 2021-05-18 2021-08-13 北京华芢生物技术有限公司 Novel coronavirus B.1.351 south Africa mutant RBD gene and application thereof

Also Published As

Publication number Publication date
WO2023006062A1 (en) 2023-02-02

Similar Documents

Publication Publication Date Title
US11510977B2 (en) Nucleic acid vaccines for coronavirus
US20230053437A1 (en) Lipid compounds and lipid nanoparticle compositions
CN117580587A (en) Coronavirus nucleic acid vaccine based on sequences derived from SARS-CoV-2 Omikovia strain
TW202342753A (en) Nucleic acid vaccines for rabies
CN116940685A (en) Coronavirus multivalent nucleic acid vaccine based on sequences derived from SARS-CoV-2Beta and Delta strains
CN116670267A (en) Tetravalent mRNA vaccine for influenza virus
WO2023056915A1 (en) Polynucleotides encoding interleukin-12 (il-12) and related composition and methods thereof
TW202330457A (en) Lipid compounds and lipid nanoparticle compositions
TW202329986A (en) Lipid compounds and lipid nanoparticle compositions
CN117043343A (en) Nucleic acid vaccine for mutant coronaviruses
CN116064598B (en) Nucleic acid vaccine for coronavirus
US20240131150A1 (en) Nucleic acid vaccines for coronavirus
CN117083291A (en) Coronavirus nucleic acid vaccine based on sequences derived from SARS-CoV-2Delta strain
WO2024067861A1 (en) MULTIVALENT NUCLEIC ACID VACCINES FOR CORONAVIRUS BASED ON SEQUENCES DERIVED FROM SARS-CoV-2 DELTA AND OMICRON STRAINS
WO2023056912A1 (en) Nucleic acid vaccines for vzv
WO2024083171A1 (en) Lipid compound and lipid nanoparticle composition
CN117069785A (en) Lipid compounds and lipid nanoparticle compositions
TW202340229A (en) Coronavirus immunogen compositions and their uses
TW202340228A (en) Varicella-zoster virus immunogen compositions and their uses
JP2023532707A (en) Lipid compounds and lipid nanoparticle compositions
JP2024517529A (en) Lipid Compounds and Lipid Nanoparticle Compositions
CN115747223A (en) Nucleic acid compositions of anti-coronavirus antibodies
CN115724920A (en) Nucleic acid vaccine for coronavirus and influenza virus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination