CN117083291A - Coronavirus nucleic acid vaccine based on sequences derived from SARS-CoV-2Delta strain - Google Patents

Coronavirus nucleic acid vaccine based on sequences derived from SARS-CoV-2Delta strain Download PDF

Info

Publication number
CN117083291A
CN117083291A CN202280006935.3A CN202280006935A CN117083291A CN 117083291 A CN117083291 A CN 117083291A CN 202280006935 A CN202280006935 A CN 202280006935A CN 117083291 A CN117083291 A CN 117083291A
Authority
CN
China
Prior art keywords
nucleic acid
lipid
protein
acid molecule
present disclosure
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202280006935.3A
Other languages
Chinese (zh)
Inventor
路希山
英博
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Aibo Biotechnology Co ltd
Original Assignee
Suzhou Aibo Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Aibo Biotechnology Co ltd filed Critical Suzhou Aibo Biotechnology Co ltd
Publication of CN117083291A publication Critical patent/CN117083291A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/5005—Wall or coating material
    • A61K9/5063—Compounds of unknown constitution, e.g. material from plants or animals
    • A61K9/5068—Cell membranes or bacterial membranes enclosing drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
    • A61K47/14—Esters of carboxylic acids, e.g. fatty acid monoglycerides, medium-chain triglycerides, parabens or PEG fatty acid esters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/24—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing atoms other than carbon, hydrogen, oxygen, halogen, nitrogen or sulfur, e.g. cyclomethicone or phospholipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5123—Organic compounds, e.g. fats, sugars
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5176—Compounds of unknown constitution, e.g. material from plants or animals
    • A61K9/5184—Virus capsids or envelopes enclosing drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Abstract

Provided herein are therapeutic nucleic acid molecules for controlling, preventing and/or treating infectious diseases caused by coronaviruses. Also provided herein are therapeutic compositions, including vaccines and lipid nanoparticles, comprising the therapeutic nucleic acids, and related therapeutic methods and uses. In particular, provided herein are mRNA vaccines based on sequences derived from SARS-CoV-2delta strains.

Description

Coronavirus nucleic acid vaccine based on sequences derived from SARS-CoV-2Delta strain
1. Cross-reference to related applications
The present application claims the benefit and priority of PCT patent application numbers PCT/CN2021/122702 filed on 8 10 2021 and PCT patent application number PCT/CN2022/118782 filed on 14 9 2022, which are hereby incorporated by reference in their entireties for all purposes.
2. Technical field
The present disclosure relates generally to nucleic acid molecules useful in the control, prevention, and treatment of coronavirus infections. The disclosure also relates to lipid-containing compositions (including vaccines) of the nucleic acid molecules, and related methods of delivery. In particular, the present disclosure relates to mRNA vaccines based on sequences derived from SARS-CoV-2delta strain.
3. Background art
Coronaviruses pose a serious health threat to humans and other animals. From 2002 to 2003, severe acute respiratory syndrome coronavirus (SARS-CoV) infects 8,000 people with a mortality rate of about 9%. Since 2012, the middle east respiratory syndrome coronavirus (MERS-CoV) infects 1,700 more people with a mortality rate of about 36%. Porcine epidemic diarrhea coronavirus (PEDV) has rolled throughout the united states since 2013, resulting in almost 100% mortality of piglets and over 10% of american swine herds being destroyed in less than one year. In month 3 of 2020, the World Health Organization (WHO) announced a pandemic caused by a 2019 coronavirus disease (covd-19) outbreak, which has been coiled for more than 180 countries and caused 80,000 deaths in the first months of the outbreak. In general, the disease is caused by the newly discovered coronavirus SARS-CoV-2, which shows symptoms of a wide range of respiratory, gastrointestinal and central nervous system diseases in humans and other animals, thereby threatening the human health and causing economic loss. Thus, there is a need for effective therapeutic agents, including vaccines, for inhibiting coronavirus infection. The present disclosure meets this need.
4. Summary of the invention
In one aspect, provided herein are non-naturally occurring nucleic acid molecules useful for the prevention, control, and treatment of infectious diseases.
In some embodiments, the non-naturally occurring nucleic acid comprises a nucleotide sequence encoding a Receptor Binding Domain (RBD) of spike (S) protein of a Delta strain of SARS-CoV-2 or a fragment thereof. In some embodiments, the RBD consists of, consists essentially of, or comprises: the amino acid sequence set forth in SEQ ID NO. 60. In some embodiments, the coding nucleotide sequence consists of, consists essentially of, or comprises: a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the nucleotide sequence set forth in SEQ ID NO. 61. In some embodiments, the coding nucleotide sequence consists of, consists essentially of, or comprises: the nucleotide sequence set forth in SEQ ID NO. 61 or 62. In some embodiments, the coding nucleotide sequence has been codon optimized for expression in a cell of the subject. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a human. In some embodiments, the coding nucleotide sequence consists of, consists essentially of, or comprises: a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the nucleotide sequence set forth in SEQ ID NO. 63. In some embodiments, the RBD is fused to a heterologous polypeptide. In some embodiments, the heterologous polypeptide is selected from the group consisting of an Fc region of a human immunoglobulin, a signal peptide, and a peptide that promotes multimerization of a fusion protein. In some embodiments, the multimerization is dimerization or trimerization. In some embodiments, the non-naturally occurring nucleic acid molecule further comprises a 5' untranslated region (5 ' -UTR), wherein the 5' -UTR comprises the sequence set forth in any one of SEQ ID NOS: 46-51. In some embodiments, the non-naturally occurring nucleic acid molecule further comprises a 3' untranslated region (3 ' -UTR), wherein the 3' -UTR comprises the sequences set forth in any one of SEQ ID NOS 52-57. In some embodiments, the 3' -UTR further comprises a poly-a tail or polyadenylation signal. In some embodiments, the non-naturally occurring nucleic acid comprises one or more functional nucleotide analogs selected from the group consisting of pseudouridine, 1-methyl-pseudouridine, and 5-methylcytosine. In some embodiments, the non-naturally occurring nucleic acid is combined with at least one other non-naturally occurring nucleic acid comprising at least one other coding nucleotide sequence encoding at least one other peptide or polypeptide, optionally encoding a Receptor Binding Domain (RBD) of spike (S) protein of a SARS-CoV-2 strain other than Delta strain, or a fragment thereof. In some embodiments, the non-naturally occurring nucleic acid comprises at least one other coding nucleotide sequence encoding at least one other peptide or polypeptide, optionally encoding a Receptor Binding Domain (RBD) or fragment thereof of a spike (S) protein of a SARS-CoV-2 strain other than the Delta strain. In some embodiments, the nucleic acid is DNA or mRNA.
In some embodiments, disclosed herein are vectors or cells comprising a non-naturally occurring nucleic acid molecule as described herein. In some embodiments, disclosed herein are compositions comprising non-naturally occurring nucleic acid molecules as described herein.
In some embodiments of the compositions described herein, the composition further comprises at least one lipid described herein. In some embodiments of the compositions described herein, the composition further comprises at least a first lipid described herein (e.g., a cationic lipid) and optionally a second lipid described herein (e.g., a polymeric lipid).
In some embodiments, the first lipid is a compound of series 01, e.g., a compound according to formula (01-I) or (01-II). In some embodiments, the first lipid is a compound listed in table 01-1. In some embodiments, the first lipid is a compound of series 02, e.g., a compound according to formula (02-I). In some embodiments, the first lipid is a compound listed in table 02-1. In some embodiments, the first lipid is a compound of series 03, e.g., a compound according to formula (03-I). In some embodiments, the first lipid is a compound listed in table 03-1. In some embodiments, the first lipid is a compound of series 04, e.g., a compound according to formula (04-I). In some embodiments, the first lipid is a compound listed in table 04-1. In some embodiments, the second lipid is a compound of series 05, e.g., a compound according to formula (05-I).
In some embodiments, the composition is formulated as a lipid nanoparticle that encapsulates a nucleic acid in a lipid shell. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition is a vaccine.
In one aspect, provided herein is a method for controlling, preventing, or treating an infectious disease caused by a coronavirus in a subject, the method comprising administering to the subject a therapeutically effective amount of a non-naturally occurring nucleic acid described herein or a therapeutically effective amount of a composition as described herein.
In some embodiments of the methods described herein, the subject is a human or non-human mammal. In some embodiments, the subject is a human adult, a human child, or a human infant. In some embodiments, the subject has an infectious disease. In some embodiments, the subject is at risk for or susceptible to a coronavirus infection. In some embodiments, the subject is an elderly person. In some embodiments, the subject has been diagnosed as positive for coronavirus infection. In some embodiments, the subject is asymptomatic.
In some embodiments of the methods described herein, the method comprises administering to the subject a lipid nanoparticle encapsulating the nucleic acid, and wherein the lipid nanoparticle is endocytosed by a cell in the subject. In some embodiments, the nucleic acid is expressed by a cell in the subject.
In some embodiments of the methods described herein, an immune response against a coronavirus is elicited in the subject. In some embodiments, the immune response includes the generation of antibodies that specifically bind to the viral RBD encoded by the nucleic acid. In some embodiments, the antibody is a neutralizing antibody to a coronavirus or a cell infected with a coronavirus. In some embodiments, the serum titer of the antibodies in the subject is increased.
In some embodiments, the antibodies specifically bind to one or more epitopes of the RBD of the S protein. In some embodiments of the methods described herein, one or more functions or activities of the S protein are reduced. In some embodiments, the decrease in S protein function or activity is measured by: (a) reduced binding of the S protein to a host cell receptor; (b) reduced attachment of coronavirus to host cells; (c) Reduction of host cell membrane fusion induced by coronavirus; or (d) a reduction in the number of cells infected with coronavirus in the subject. In some embodiments, the host receptor is selected from the group consisting of angiotensin converting enzyme 2 (ACE 2), aminopeptidase N (APN), dipeptidyl peptidase 4 (DPP 4), carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM 1), and a saccharide. In some embodiments, the function or activity of the S protein is reduced by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%.
In some embodiments of the methods described herein, the antibody binds to a viral particle or an infected cell, and the viral particle of the infected cell is labeled for destruction by the immune system of the subject. In some embodiments, endocytosis of the virus particle bound by the antibody is induced or enhanced. In some embodiments, antibody-dependent cell-mediated cytotoxicity (ADCC) against the infected cells in the subject is induced or enhanced. In some embodiments, antibody-dependent cell phagocytosis (ADCP) is induced or enhanced in a subject against an infected cell. In some embodiments, complement Dependent Cytotoxicity (CDC) against the infected cells in the subject is induced or enhanced.
In some embodiments of the methods described herein, the infectious disease is a respiratory tract infection, a lung infection, a kidney infection, a liver infection, an intestinal infection, a nervous system infection, a respiratory syndrome, bronchitis, pneumonia, gastroenteritis, encephalomyelitis, encephalitis, sarcoidosis, diarrhea, hepatitis, and a demyelinating disease. In some embodiments, the infectious disease is a respiratory tract infection. In some embodiments, the infectious disease is a lung infection. In some embodiments, the infectious disease is respiratory syndrome. In some embodiments, the infectious disease is pneumonia.
In some embodiments, the coronavirus is SARS-CoV-2, including initial, alpha (earliest recorded in the United kingdom, B.1.1.7), beta (earliest recorded in south Africa, B.1.351), gamma (earliest recorded in Brazil, P.1), delta (earliest recorded in India, B.1.617.2), eta (earliest recorded in B.1.525), iota (earliest recorded in the United states, B.1.526), kappa (earliest recorded in India, B.1.617.1), lambda (earliest recorded in Peru, C.37), and mu (earliest recorded in Columbia, B.1.621) strains, particularly delta strains.
5. Description of the drawings
FIG. 1 illustrates HPLC analysis and purification of an exemplary in vitro transcribed mRNA construct according to the present disclosure. The main peak (b) represents an in vitro transcribed mRNA molecule, and the minor peak (a) represents an impurity entity.
FIG. 2 shows confocal fluorescence microscopy images of HeLa cells transfected with exemplary mRNA constructs according to the present disclosure. The RBD-FITC channel shows staining of cells with 3 different monoclonal antibodies (H014, mh001 and mh 219) that recognize the SARS-CoV-2S protein RBD, respectively. DAPI channel shows staining of cells with blue fluorescent DNA stain DAPI (4', 6-diamidino-2-phenylindole). The bright channels display bright field images of the cells. Untransfected Hela cells (mock) were included as negative controls. The scale bar is 50mm.
FIG. 3 shows Western blot analysis of samples derived from Hela cells transfected with an exemplary mRNA construct encoding the SARS-CoV-2S protein RBD according to the present disclosure. Monomers and dimers of the encoded RBD fragments are shown on the blot.
FIG. 4 shows quantification of mRNA encoded S protein RBD concentration (ng/mL) in cell culture supernatants as determined by ELISA.
FIG. 5 shows neutralizing antibody titers in serum collected from mice vaccinated with Lipid Nanoparticle (LNP) vaccines containing an exemplary mRNA encoding the SARS-CoV-2S protein RBD. In particular, neutralizing antibody titers were measured as PRNT50 values.
Fig. 6 shows neutralizing antibody titers in serum collected from mice vaccinated with Lipid Nanoparticle (LNP) vaccines containing mRNA encoding the S protein RBD. In particular, neutralizing antibody titers were measured as NT50 values.
Fig. 7 shows the results of detection of RBD-specific IgG antibody titers in immunized mice on day 21 as measured by ELISA.
6. Detailed description of the preferred embodiments
Provided herein are therapeutic nucleic acid molecules useful for the prevention, control and treatment of infectious diseases or disorders caused by coronaviruses. Also provided herein are pharmaceutical compositions, including pharmaceutical compositions formulated as lipid nanoparticles, comprising therapeutic nucleic acid molecules, and related therapeutic methods and uses for preventing, controlling, and treating infectious diseases or disorders caused by coronaviruses, including pathogens causing pandemic disease known as covd-19. Additional features of the present disclosure will become apparent to those skilled in the art upon consideration of the following detailed description of specific embodiments.
6.1 general technique
Techniques and procedures described or referenced herein include those commonly employed by those skilled in the art to which the general understanding and/or use of conventional methods are well suited, such as, for example, sambrook et al Molecular Cloning: A Laboratory Manual (3 rd edition, 2001); current Protocols in Molecular Biology (Ausubel et al, 2003).
6.2 terminology
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For the purposes of explaining the present specification, the following description of terms will be applied, and terms used in the singular will also include the plural and vice versa, where appropriate. All patents, applications, published applications, and other publications are incorporated by reference in their entirety. If any description of a stated term conflicts with any document incorporated by reference herein, the description of the stated term shall govern as follows.
As used herein and unless otherwise indicated, the term "lipid" refers to a group of organic compounds that include, but are not limited to, fatty acid esters and are generally characterized as poorly soluble in water but soluble in many nonpolar organic solvents. Although lipids generally have poor water solubility, certain classes of lipids (e.g., lipids modified with polar groups, such as DMG-PEG 2000) have limited water solubility and are soluble in water under certain conditions. Known lipid types include biomolecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides and phospholipids. Lipids can be divided into at least three classes: (1) "simple lipids" including fats and oils, and waxes; (2) "complex lipids" including phospholipids and glycolipids (e.g., DMPE-PEG 2000); and (3) "derived lipids", such as steroids. Furthermore, as used herein, lipids also include lipid compounds. The term "lipid compound" is also referred to simply as "lipid" and refers to lipid-like compounds (e.g., amphiphilic compounds having lipid-like physical properties).
The term "lipid nanoparticle" or "LNP" refers to particles having at least one nanometer (nm) scale size (e.g., 1 to 1,000 nm) that contain one or more types of lipid molecules. The LNPs provided herein can further comprise at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules). In some embodiments, the LNP comprises a non-lipid payload molecule partially or fully encapsulated within a lipid shell. In particular, in some embodiments, wherein the payload is a negatively charged molecule (e.g., mRNA encoding a viral protein), and the lipid component of the LNP comprises at least one cationic lipid. Without being bound by theory, it is expected that cationic lipids can interact with negatively charged payload molecules and facilitate incorporation and/or encapsulation of the payload into the LNP during LNP formation. Other lipids that may form part of the LNP as provided herein include, but are not limited to, neutral lipids and charged lipids, such as steroids, polymer-bound lipids, and various zwitterionic lipids. In certain embodiments, LNPs according to the present disclosure comprise one or more of the series 01, 02, 03, and 04 of lipids, e.g., one or more of the formula 01-I, 01-II, 02-I, 03-I, and 04-I (and sub-types thereof) as described herein.
The term "cationic lipid" refers to a lipid that is positively charged at any pH or hydrogen ion activity of its environment, or that is capable of being positively charged in response to the pH or hydrogen ion activity of its environment (e.g., the environment in which it is intended to be used). Thus, the term "cation" encompasses both "permanent cations" and "cationizable". In certain embodiments, the positive charge in the cationic lipid is caused by the presence of a quaternary nitrogen atom. In certain embodiments, the cationic lipid comprises a zwitterionic lipid that is positively charged in the environment in which it is intended to be used (e.g., at physiological pH). In certain embodiments, the cationic lipid is one or more of the series 01, 02, 03, and 04 lipids, e.g., one or more of the formula 01-I, 01-II, 02-I, 03-I, and 04-I (and sub-types thereof) as described herein. The term "anionic lipid" refers to a lipid that is negatively charged at any pH or hydrogen ion activity of its environment, or that is capable of being negatively charged in response to the pH or hydrogen ion activity of its environment (e.g., the environment in which it is intended to be used). Exemplary anionic lipids include one or more negatively charged phosphate groups, for example, at physiological pH.
The term "polymer-bound lipid" refers to a molecule that comprises both a lipid moiety and a polymer moiety. An example of a polymer-bound lipid is a pegylated lipid (PEG-lipid), wherein the polymer moiety comprises polyethylene glycol.
The term "neutral lipid" encompasses any lipid molecule that exists in an uncharged form or in a neutral zwitterionic form at or within a selected pH range. In some embodiments, the useful pH or range selected corresponds to a pH condition in the environment of the intended lipid use, such as a physiological pH. As non-limiting examples, neutral lipids that may be used in connection with the present disclosure include, but are not limited to, phosphatidylcholine, such as 1, 2-distearoyl-sn-glycero-3-phosphorylcholine (DSPC), 1, 2-dipalmitoyl-sn-glycero-3-phosphorylcholine (DPPC), 1, 2-dimyristoyl-sn-glycero-3-phosphorylcholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphorylcholine (POPC), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (DOPC); phosphatidylethanolamine such as 1, 2-dioleoyl-sn-glycero-3-phosphate ethanolamine (DOPE), ethyl 2- ((2, 3-bis (oleoyloxy) propyl) dimethylammonium) phosphate (DOCP); sphingomyelin (SM); a ceramide; steroids such as sterols and derivatives thereof. Neutral lipids provided herein may be synthetic or derived from (isolated or modified from) natural sources or compounds.
The term "charged lipid" encompasses any lipid molecule that exists in a positively or negatively charged form at or within a selected pH. In some embodiments, the selected pH value or range corresponds to a pH condition in the environment of the intended lipid use, such as a physiological pH value. As non-limiting examples, charged lipids that may be used in connection with the present disclosure include, but are not limited to, phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, sterol hemisuccinate, dialkyltrimethylammonium-propane (e.g., DOTAP, DOTMA), dialkyldimethylaminopropane, ethylcholine phosphate, dimethylaminoethane carbamoyl sterols (e.g., DC-Chol), 1, 2-dioleoyl-sn-glycerol-3-phosphate-L-serine sodium salt (DOPS-Na), 1, 2-dioleoyl-sn-glycerol-3-phosphate- (1' -rac-glycerol) sodium salt (DOPG-Na), and 1, 2-dioleoyl-sn-glycerol-3-phosphate sodium salt (DOPA-Na). Charged lipids provided herein may be synthetic or derived from (isolated or modified from) natural sources or compounds.
As used herein and unless otherwise indicated, the term "alkyl" refers to a saturated straight or branched hydrocarbon chain group consisting of only carbon and hydrogen atoms. In one embodiment, the alkyl group has, for example, 1 to 24 carbon atoms (C 1 -C 24 Alkyl), 4 to 20 carbon atoms (C 4 -C 20 Alkyl), 6 to 16 carbon atoms (C 6 -C 16 Alkyl), 6 to 9 carbon atoms (C 6 -C 9 Alkyl), 1 to 15 carbon atoms (C 1 -C 15 Alkyl), 1 to 12 carbon atoms (C 1 -C 12 Alkyl), 1 to 8 carbon atoms (C 1 -C 8 Alkyl) or 1 to 6 carbon atoms (C 1 -C 6 Alkyl) and is attached to the remainder of the molecule by a single bond. Examples of alkyl groups include, but are not limited to, methyl, ethylA group, n-propyl group, 1-methylethyl group (isopropyl group), n-butyl group, n-pentyl group, 1-dimethylethyl group (t-butyl group), 3-methylhexyl group, 2-methylhexyl group, and the like. Unless otherwise indicated, alkyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "alkenyl" refers to a straight or branched hydrocarbon chain group consisting of only carbon and hydrogen atoms, which contains one or more carbon-carbon double bonds. As understood by one of ordinary skill in the art, the term "alkenyl" also encompasses groups having "cis" and "trans" configurations or, alternatively, "E" and "Z" configurations. In one embodiment, the alkenyl group has, for example, 2 to 24 carbon atoms (C 2 -C 24 Alkenyl), 4 to 20 carbon atoms (C 4 -C 20 Alkenyl), 6 to 16 carbon atoms (C 6 -C 16 Alkenyl), 6 to 9 carbon atoms (C 6 -C 9 Alkenyl), 2 to 15 carbon atoms (C 2 -C 15 Alkenyl), 2 to 12 carbon atoms (C 2 -C 12 Alkenyl), 2 to 8 carbon atoms (C 2 -C 8 Alkenyl) or 2 to 6 carbon atoms (C 2 -C 6 Alkenyl) and is linked to the remainder of the molecule by a single bond. Examples of alkenyl groups include, but are not limited to, vinyl, prop-1-enyl, but-1-enyl, pent-1, 4-dienyl, and the like. Unless otherwise indicated, alkenyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "alkynyl" refers to a straight or branched hydrocarbon chain group consisting of only carbon and hydrogen atoms, which contains one or more carbon-carbon triple bonds. In one embodiment, the alkynyl group has, for example, 2 to 24 carbon atoms (C 2 -C 24 Alkynyl), 4 to 20 carbon atoms (C 4 -C 20 Alkynyl), 6 to 16 carbon atoms (C 6 -C 16 Alkynyl), 6 to 9 carbon atoms (C 6 -C 9 Alkynyl), 2 to 15 carbon atoms (C 2 -C 15 Alkynyl), 2 to 12 carbon atoms (C 2 -C 12 Alkynyl), 2 to 8 carbon atoms (C 2 -C 8 Alkynyl) or 2 to 6 carbon atoms (C 2 -C 6 Alkynyl) and is attached to the remainder of the molecule by a single bond. Examples of alkynyl groups include, but are not limited toLimited to ethynyl, propynyl, butynyl, pentynyl, and the like. Unless otherwise indicated, alkynyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "alkylene" or "alkylene chain" refers to a straight or branched divalent hydrocarbon chain that connects the remainder of the molecule to a group, consisting of only carbon and hydrogen, and being saturated. In one embodiment, the alkylene group has, for example, 1 to 24 carbon atoms (C 1 -C 24 Alkylene), 1 to 15 carbon atoms (C 1 -C 15 Alkylene), 1 to 12 carbon atoms (C 1 -C 12 Alkylene), 1 to 8 carbon atoms (C 1 -C 8 Alkylene), 1 to 6 carbon atoms (C 1 -C 6 Alkylene), 2 to 4 carbon atoms (C 2 -C 4 Alkylene), 1 to 2 carbon atoms (C 1 -C 2 An alkylene group). Examples of alkylene groups include, but are not limited to, methylene, ethylene, propylene, n-butylene, and the like. The alkylene chain is linked to the rest of the molecule by a single bond and to the group by a single bond. The point of attachment of the alkylene chain to the remainder of the molecule and to the group may be through one carbon or any two carbons within the chain. Unless otherwise indicated, the alkylene chain is optionally substituted.
As used herein and unless otherwise indicated, the term "alkenylene" refers to a straight or branched divalent hydrocarbon chain that connects the rest of the molecule to a group, consisting of only carbon and hydrogen and containing one or more carbon-carbon double bonds. In one embodiment, the alkenylene group has, for example, 2 to 24 carbon atoms (C 2 -C 24 Alkenylene), 2 to 15 carbon atoms (C 2 -C 15 Alkenylene), 2 to 12 carbon atoms (C 2 -C 12 Alkenylene), 2 to 8 carbon atoms (C 2 -C 8 Alkenylene), 2 to 6 carbon atoms (C 2 -C 6 Alkenylene) or 2 to 4 carbon atoms (C 2 -C 4 Alkenylene). Examples of alkenylene groups include, but are not limited to, ethenylene, propenylene, n-butenylene, and the like. Alkenylene is attached to the remainder of the molecule by a single or double bond and to a group by a single or double bond. Alkenylene groups to the remainder of the molecule and to the radicals The point of attachment may be through one carbon or any two carbons within the chain. Unless otherwise indicated, alkenylene groups are optionally substituted.
As used herein and unless otherwise indicated, the term "cycloalkyl" refers to a non-aromatic saturated monocyclic or polycyclic hydrocarbon group consisting of only carbon and hydrogen atoms. Cycloalkyl groups may include fused or bridged ring systems. In one embodiment, cycloalkyl groups have, for example, 3 to 15 ring carbon atoms (C 3 -C 15 Cycloalkyl), 3 to 10 ring carbon atoms (C 3 -C 10 Cycloalkyl) or 3 to 8 ring carbon atoms (C 3 -C 8 Cycloalkyl). Cycloalkyl groups are linked to the rest of the molecule by single bonds. Examples of monocyclic cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic cycloalkyl groups include, but are not limited to, adamantyl, norbornyl, decalinyl, 7-dimethyl-bicyclo [2.2.1]Heptyl, and the like. Unless otherwise indicated, cycloalkyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "cycloalkylene" is a divalent cycloalkyl group. Unless otherwise indicated, cycloalkylene groups are optionally substituted.
As used herein and unless otherwise indicated, the term "cycloalkenyl" refers to a non-aromatic monocyclic or polycyclic hydrocarbon group consisting of only carbon and hydrogen atoms and including one or more carbon-carbon double bonds. Cycloalkenyl groups may include fused or bridged ring systems. In one embodiment, cycloalkenyl groups have, for example, 3 to 15 ring carbon atoms (C 3 -C 15 Cycloalkenyl), 3 to 10 ring carbon atoms (C 3 -C 10 Cycloalkenyl) or 3 to 8 ring carbon atoms (C 3 -C 8 Cycloalkenyl group). The cycloalkenyl group is linked to the rest of the molecule by a single bond. Examples of monocyclic cycloalkenyl groups include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, and the like. Unless otherwise indicated, cycloalkenyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "cycloalkenyl" is a divalent cycloalkenyl group. Unless otherwise indicated, cycloalkenyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "heterocyclyl" refers to a monocyclic or polycyclic moiety of a non-aromatic radical containing one or more (e.g., one or two, one to three, or one to four) heteroatoms independently selected from nitrogen, oxygen, phosphorus, and sulfur. The heterocyclyl may be attached to the main structure at any heteroatom or carbon atom. The heterocyclyl may be a monocyclic, bicyclic, tricyclic, tetracyclic or other polycyclic ring system, wherein the polycyclic ring system may be a fused, bridged or spiro ring system. The heterocyclyl-based multicyclic system may contain one or more heteroatoms in one or more rings. The heterocyclyl groups may be saturated or partially unsaturated. Saturated heterocycloalkyl groups may be referred to as "heterocycloalkyl groups". Partially unsaturated heterocycloalkyl groups may be referred to as "heterocycloalkenyl" when the heterocyclyl contains at least one double bond, or as "heterocycloalkynyl" when the heterocyclyl contains at least one triple bond. In one embodiment, the heterocyclic group has, for example, 3 to 18 ring atoms (3-to 18-membered heterocyclic group), 4 to 18 ring atoms (4-to 18-membered heterocyclic group), 5 to 18 ring atoms (3-to 18-membered heterocyclic group), 4 to 8 ring atoms (4-to 8-membered heterocyclic group), or 5 to 8 ring atoms (5-to 8-membered heterocyclic group). When appearing herein, a numerical range, such as "3 to 18" refers to each integer in the given range; for example, "3 to 18 ring atoms" means that the heterocyclic group may consist of 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, and the like (up to and including 18 ring atoms). Examples of heterocyclyl groups include, but are not limited to, imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thienyl, pyridyl, piperidyl, quinolinyl, and isoquinolinyl. Unless otherwise indicated, the heterocyclyl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "heterocyclyl" is a divalent heterocyclyl. Unless otherwise indicated, the heterocyclylene groups are optionally substituted.
As used hereinAnd unless otherwise indicated, the term "aryl" refers to a monocyclic aromatic group and/or a polycyclic monovalent aromatic group containing at least one aromatic hydrocarbon ring. In certain embodiments, aryl groups have 6 to 18 ring carbon atoms (C 6 -C 18 Aryl), 6 to 14 ring carbon atoms (C 6 -C 14 Aryl) or 6 to 10 ring carbon atoms (C 6 -C 10 Aryl). Examples of aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthracenyl, phenanthrenyl, pyrenyl, biphenyl, and biphenyl. The term "aryl" also refers to bicyclic, tricyclic, or other polycyclic hydrocarbon rings in which at least one ring is aromatic, and the other rings may be saturated, partially unsaturated, or aromatic, such as dihydronaphthyl, indenyl, indanyl, or tetrahydronaphthyl (tetrahydroaphthayl/tetralinyl). Unless otherwise indicated, aryl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "arylene" is a divalent aryl group. Unless otherwise indicated, arylene groups are optionally substituted.
As used herein and unless otherwise indicated, the term "heteroaryl" refers to a monocyclic aromatic group and/or polycyclic aromatic group containing at least one aromatic ring, wherein at least one aromatic ring contains one or more (e.g., one or two, one to three, or one to four) heteroatoms independently selected from O, S and N. Heteroaryl groups may be attached to the main structure at any heteroatom or carbon atom. In certain embodiments, heteroaryl groups have 5 to 20, 5 to 15, or 5 to 10 ring atoms. The term "heteroaryl" also refers to bicyclic, tricyclic, or other polycyclic rings in which at least one ring is aromatic, and the other rings may be saturated, partially unsaturated, or aromatic, in which at least one aromatic ring contains one or more heteroatoms independently selected from O, S and N. Examples of monocyclic heteroaryl groups include, but are not limited to, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furanyl, thienyl, oxadiazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl. Examples of bicyclic heteroaryl groups include, but are not limited to, indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, isobenzofuranyl, chromonyl, coumarin, cinnolinyl, quinoxalinyl, indazolyl, purinyl, pyrrolopyridinyl, furopyridinyl, thienopyridinyl, dihydroisoindolyl, and tetrahydroquinolinyl. Examples of tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzindolyl, phenanthrolinyl, acridinyl, phenanthridinyl, and xanthenyl. Unless otherwise indicated, heteroaryl groups are optionally substituted.
As used herein and unless otherwise indicated, the term "heteroarylene" is a divalent heteroaryl group. Unless otherwise indicated, heteroarylene is optionally substituted.
When a group described herein is referred to as "substituted," it may be substituted with one or more of any suitable substituents. Illustrative examples of substituents include, but are not limited to, those found in the exemplary compounds and embodiments provided herein, and: halogen atoms such as F, cl, br or I; cyano group; oxo (=o); hydroxyl (-OH); an alkyl group; alkenyl groups; alkynyl; cycloalkyl; an aryl group; - (c=o) OR'; -O (c=o) R'; -C (=o) R'; -OR'; s (O) x R’；-S-SR’；-C(＝O)SR’；-SC(＝O)R’；-NR’R’；-NR’C(＝O)R’；-C(＝O)NR’R’；-NR’C(＝O)NR’R’；-OC(＝O)NR’R’；-NR’C(＝O)OR’；-NR’S(O) x NR’R’；-NR’S(O) x R'; -S (O) x NR 'R', wherein: r' is independently at each occurrence H, C 1 -C 15 Alkyl or cycloalkyl, and x is 0, 1 or 2. In some embodiments, the substituent is C 1 -C 12 An alkyl group. In other embodiments, the substituent is cycloalkyl. In other embodiments, the substituent is a halo group, such as a fluoro group. In other embodiments, the substituent is oxo. In other embodiments, the substituent is hydroxy. In other embodiments, the substituent is an alkoxy (-OR'). In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amino group (-NR 'R').
As used herein and unless otherwise indicated, the term "optionally present" or "optionally" (e.g., optionally substituted) means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. For example, "optionally substituted alkyl" means that the alkyl group may or may not be substituted, and the description includes both substituted alkyl groups and unsubstituted alkyl groups.
As used herein and unless otherwise indicated, the term "prodrug" of a bioactive compound refers to a compound that can be converted to the bioactive compound under physiological conditions or by solvolysis. In one embodiment, the term "prodrug" refers to a pharmaceutically acceptable metabolic precursor of a biologically active compound. Prodrugs may be inactive when administered to a subject in need thereof, but are converted in vivo to the biologically active compound. Prodrugs are often rapidly transformed in vivo to produce the parent bioactive compound, for example, by hydrolysis in the blood. Prodrug compounds generally provide solubility, histocompatibility or delayed release advantages in mammalian organisms (see Bundgard, h., design of Prodrugs (1985), pages 7-9, pages 21-24 (Elsevier, amsterdam)). Discussion of prodrugs is provided in Higuchi, t et al, a.c. s. Symposium Series, volume 14; and Bioreversible Carriers in Drug Design, edward b.roche edit, american Pharmaceutical Association and Pergamon Press, 1987.
In one embodiment, the term "prodrug" is also intended to include any covalently bonded carrier that releases the active compound in vivo when such prodrug is administered to a mammalian subject. Prodrugs of the compounds may be prepared by modifying functional groups present in the compound in such a way that the modification may be cleaved, either in routine manipulation or in vivo, to yield the parent compound. Prodrugs include compounds wherein a hydroxyl, amino, or sulfhydryl group is bonded to any group that, when the prodrug of the compound is administered to a mammalian subject, cleaves to form a free hydroxyl, free amino, or free sulfhydryl group, respectively.
Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol functional groups or amide derivatives of amine functional groups in the compounds provided herein.
As used herein and unless otherwise indicated, the term "pharmaceutically acceptable salt" includes both acid addition salts and base addition salts.
Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; and organic acids such as, but not limited to, acetic acid, 2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, 10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclic acid, dodecylsulfuric acid, ethane-1, 2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactose diacid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxoglutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1, 5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, lactic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, glutamic acid, salicylic acid, 4-sulfamic acid, succinic acid, tartaric acid, succinic acid, thioundecylenic acid, and the like.
Examples of pharmaceutically acceptable base addition salts include, but are not limited to, salts prepared by adding an inorganic or organic base to the free acid compound. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum, and the like. In one embodiment, the inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, the following: primary, secondary and tertiary amines; substituted amines, including naturally occurring substituted amines; cyclic amines and basic ion exchange resins such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, dantol (deanol), 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine (procaine), hydramine, choline, betaine, phenethylamine (bennethamine), benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine (theobromine), triethanolamine, tromethamine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like. In one embodiment, the organic base is isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.
The compounds provided herein may contain one or more asymmetric centers and thus may produce enantiomers, diastereomers, and other stereoisomeric forms, which may be defined as (R) -or (S) -or (D) -or (L) -for amino acids, depending on the absolute stereochemistry. Unless otherwise indicated, the compounds provided herein are intended to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R) -and (S) -or (D) -and (L) -isomers can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, such as chromatography and fractional crystallization. Conventional techniques for preparing/separating individual enantiomers include chiral synthesis from suitable optically pure precursors or resolution of the racemate (or of a salt or derivative) using, for example, chiral High Pressure Liquid Chromatography (HPLC). When a compound described herein contains an olefinic double bond or other geometric asymmetric center, the compound is intended to include both the E and Z geometric isomers unless specified otherwise. Also, all tautomeric forms are intended to be included.
As used herein and unless otherwise indicated, the term "isomer" refers to different compounds having the same formula. "stereoisomers" are isomers that differ only in the arrangement of atoms in space. "atropisomers" are stereoisomers resulting from a hindered rotation about a single bond. "enantiomers" are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of any ratio of a pair of enantiomers may be referred to as a "racemic" mixture. "diastereomers" are stereoisomers which have at least two asymmetric atoms and which are not mirror images of each other.
"stereoisomers" may also include E and Z isomers or mixtures thereof, as well as cis and trans isomers or mixtures thereof. In certain embodiments, the compounds described herein are isolated as the E or Z isomer. In other embodiments, the compounds described herein are mixtures of E and Z isomers.
"tautomer" refers to the isomeric forms of a compound that are balanced with each other. The concentration of the isomeric forms will depend on the environment in which the compound is located and may vary depending on, for example, whether the compound is solid or in an organic or aqueous solution.
It should also be noted that the compounds described herein may contain non-natural proportions of atomic isotopes at one or more atoms. For example, the compounds may be administered using a radioisotope, such as tritium @, for example 3 H) Iodine-125% 125 I) Sulfur-35% 35 S) or C-14% 14 C) Radiolabelling or may be isotopically enriched, such as deuterium # 2 H) Carbon-13% 13 C) Or nitrogen-15% 15 N). As used herein, "isotopologue" is an isotopically enriched compound. The term "isotopically enriched" refers to an atom whose isotopic composition differs from the natural isotopic composition of the atom. "isotopically enriched" may also mean that the isotopic composition of at least one atom contained in a compound is different from the natural isotopic composition of that atom. The term "isotopic composition" refers to the amount of each isotope present for a given atom. Radiolabeled and isotopically enriched compounds are useful as therapeutic agents, for example, cancer therapeutic agents; research reagents, such as binding assay reagents; and diagnostic agents, such as in vivo imaging agents. All isotopic variations of the compounds described herein, whether radioactive or not, are intended to be encompassed within the scope of the embodiments provided herein. In some embodiments, isotopologues of the compounds described herein are provided, e.g., isotopologues are deuterium, carbon-13, and/or nitrogen-15 enriched. As used herein, "deuterated" refers to at least one of the compounds One hydrogen (H) has deuterium (in D or 2 H represents) substitution, i.e., the compound is deuterium-enriched in at least one position.
It should be noted that if there is a difference between the depicted structure and the name of the structure, the depicted structure should be subject to.
As used herein and unless otherwise indicated, the term "pharmaceutically acceptable carrier, diluent or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye/colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonicity agent, solvent or emulsifying agent approved by the U.S. food and drug administration (United States Food and Drug Administration) for use in humans or domestic animals.
The term "composition" is intended to encompass products containing the specified ingredients (e.g., mRNA molecules provided herein) in the specified amounts, optionally selected.
As used interchangeably herein, the term "polynucleotide" or "nucleic acid" refers to a polymer of nucleotides of any length, and includes, for example, DNA and RNA. The nucleotide may be a deoxyribonucleotide, a ribonucleotide, a modified nucleotide or base and/or analogue thereof, or any substrate that can be incorporated into the polymer by a DNA or RNA polymerase or by a synthetic reaction. Polynucleotides may comprise modified nucleotides, such as methylated nucleotides and analogs thereof. The nucleic acid may be in single-stranded or double-stranded form. As used herein and unless otherwise indicated, "nucleic acid" also includes nucleic acid mimics, such as Locked Nucleic Acids (LNAs), peptide Nucleic Acids (PNAs), and morpholino nucleic acids. As used herein, "oligonucleotide" refers to a short synthetic polynucleotide, typically but not necessarily less than about 200 nucleotides in length. The terms "oligonucleotide" and "polynucleotide" are not mutually exclusive. The above description of polynucleotides applies equally well to oligonucleotides. Unless otherwise indicated, the left hand end of any single stranded polynucleotide sequence disclosed herein is the 5' end; the left hand orientation of the double stranded polynucleotide sequence is referred to as the 5' orientation. The 5 'to 3' addition direction of nascent RNA transcripts is referred to as the transcription direction; the region of the DNA strand having the same sequence as the RNA transcript and located 5 'relative to the 5' end of the RNA transcript is referred to as the "upstream sequence"; the region of the DNA strand having the same sequence as the RNA transcript and located 3 'relative to the 3' end of the RNA transcript is referred to as the "downstream sequence".
As used herein, the term "non-naturally occurring" when used in reference to a nucleic acid molecule as described herein is intended to mean that the nucleic acid molecule is not present in nature. Non-naturally occurring nucleic acids encoding viral peptides or proteins contain at least one genetic alteration or chemical modification that is not normally present in a naturally occurring strain of a virus, including a wild-type strain of a virus. Genetic alterations include, for example, modifications that introduce expressible nucleic acid sequences encoding heterologous peptides or polypeptides of the virus, other nucleic acid additions, nucleic acid deletions, nucleic acid substitutions, and/or other functional disruption of the genetic material of the virus. Such modifications include, for example, modifications to coding regions of heterologous, homologous, or heterologous and homologous polypeptides of a viral species and functional fragments thereof. Additional modifications include, for example, modifications to non-coding regulatory regions, wherein the modifications alter expression of a gene or an operon. Additional modifications also include, for example, incorporation of the nucleic acid sequence into a vector such as a plasmid or artificial chromosome. Chemical modifications include, for example, one or more functional nucleotide analogs as described herein.
"isolated nucleic acid" refers to nucleic acids, such as RNA, DNA, or mixed nucleic acids, that are substantially isolated from other genomic DNA sequences that naturally accompany the native sequence, as well as from proteins or complexes such as ribosomes and polymerases. An "isolated" nucleic acid molecule is a nucleic acid molecule that is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid molecule. Furthermore, an "isolated" nucleic acid molecule, such as an mRNA molecule, may be substantially free of other cellular material or culture medium when manufactured by recombinant techniques, or it may be substantially free of chemical precursors or other chemicals when chemically synthesized. In particular embodiments, one or more nucleic acid molecules encoding an antigen described herein are isolated or purified. The term includes nucleic acid sequences that have been removed from their naturally occurring environment, and includes recombinant or cloned DNA or RNA isolates as well as chemically synthesized analogs or analogs biosynthesized by heterologous systems. Substantially pure molecules may include isolated forms of the molecule.
The term "encoding nucleic acid" or grammatical equivalents thereof when used in reference to a nucleic acid molecule includes: (a) Nucleic acid molecules which, when in a native state or when manipulated by methods well known to those skilled in the art, can be transcribed to produce mRNA and then translated into peptides and/or polypeptides; and (b) the mRNA molecule itself. The antisense strand is the complement of such a nucleic acid molecule and from which the coding sequence can be deduced. The term "coding region" refers to the portion of a coding nucleic acid sequence that is translated into a peptide or polypeptide. The term "untranslated region" or "UTR" refers to that portion of a coding nucleic acid that is not translated into a peptide or polypeptide. Depending on the orientation of the UTR relative to the coding region of the nucleic acid molecule, the UTR is referred to as a 5'-UTR if it is located at the 5' end of the coding region and the UTR is referred to as a 3'-UTR if it is located at the 3' end of the coding region.
As used herein, the term "mRNA" refers to a messenger RNA molecule comprising one or more Open Reading Frames (ORFs) that can be translated by a cell or organism having the mRNA to produce one or more peptide or protein products. The region containing one or more ORFs is referred to as the coding region of the mRNA molecule. In certain embodiments, the mRNA molecule further comprises one or more untranslated regions (UTRs).
In certain embodiments, the mRNA is a monocistronic mRNA comprising only one ORF. In certain embodiments, the monocistronic mRNA encodes a peptide or protein comprising at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor-associated antigen). In other embodiments, the mRNA is a polycistronic mRNA comprising two or more ORFs. In certain embodiments, polycistronic mRNA encodes two or more peptides or proteins that may be the same or different from each other. In certain embodiments, each peptide or protein encoded by the polycistronic mRNA comprises at least one epitope of the selected antigen. In certain embodiments, the different peptides or proteins encoded by the polycistronic mRNA each comprise at least one epitope of a different antigen. In any of the embodiments described herein, the at least one epitope may be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 epitopes of the antigen.
The term "nucleobase" encompasses purines and pyrimidines, including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural or synthetic analogs or derivatives thereof.
As used herein, the term "functional nucleotide analog" refers to a modified version of a classical nucleotide A, G, C, U or T that (a) retains the base pairing properties of the corresponding classical nucleotide and (b) contains at least one chemical modification to (i) a nucleobase, (ii) a glycosyl, (iii) a phosphate group, or (iv) any combination of (i) to (iii) of the corresponding natural nucleotide. As used herein, base pairing encompasses not only classical Watson-Crick (Watson-Crick) adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between a classical nucleotide and a functional nucleotide analogue or between a pair of functional nucleotide analogues, wherein the arrangement of the hydrogen bond donor and the hydrogen bond acceptor allows hydrogen bonding to be formed between a modified nucleobase and a classical nucleobase or between two complementary modified nucleobase structures. For example, functional analogs of guanosine (G) retain the ability to base pair with cytosine (C) or functional analogs of cytosine. An example of such non-classical base pairing is base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. As described herein, functional nucleotide analogs can be naturally occurring or non-naturally occurring. Thus, a nucleic acid molecule containing a functional nucleotide analog may have at least one modified nucleobase, sugar group, and/or internucleoside linkage. Exemplary chemical modifications to nucleobases, glycosyls, or internucleoside linkages of nucleic acid molecules are provided herein.
As used herein, the terms "translational enhancer element," "TEE," and "translational enhancer" refer to a region in a nucleic acid molecule that is used to facilitate translation of a coding sequence of a nucleic acid into a protein or peptide product, such as by cap-dependent or non-cap-dependent translation. TEE is typically located in the UTR region of a nucleic acid molecule (e.g., mRNA) and enhances the level of translation of coding sequences located upstream or downstream. For example, a TEE in the 5' -UTR of a nucleic acid molecule may be located between the promoter and the start codon of the nucleic acid molecule. Various TEE sequences are known in the art (Wellensiek et al, genome-wide profiling of human cap-independent translation-enhancing elements, nature Methods, month 8 of 2013; 10 (8): 747-750; chappell et al, PNAS, month 29 of 2004, 101 (26) 9590-9594). Some TEEs are known to be conserved across species (P anek et al, nucleic Acids Research, volume 41, 16, 2013, 9, 1, pages 7625-7634).
As used herein, the term "stem-loop sequence" refers to a single stranded polynucleotide sequence having at least two regions that are complementary or substantially complementary to each other when read in opposite directions, and thus are capable of base pairing with each other to form at least one duplex and unpaired loop. The resulting structure is known as a stem-loop structure, hairpin, or hairpin loop, which is a secondary structure found in many RNA molecules.
As used herein, the term "peptide" refers to a polymer containing from two to fifty (2-50) amino acid residues linked via one or more covalent peptide bonds. The term applies to naturally occurring amino acid polymers and amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs or non-natural amino acids).
The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer having more than fifty (50) amino acid residues joined by covalent peptide bonds. That is, the description for polypeptides applies equally to the description for proteins and vice versa. The term applies to naturally occurring amino acid polymers and amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs). As used herein, the term encompasses amino acid chains of any length, including full-length proteins (e.g., antigens).
In the case of a peptide or polypeptide, the term "derivative" as used herein refers to a peptide or polypeptide comprising the amino acid sequence of a viral peptide or protein or a fragment of a viral peptide or protein that has been altered by the introduction of amino acid residue substitutions, deletions or additions. As used herein, the term "derivative" also refers to a viral peptide or protein, or a fragment of a viral peptide or protein, which has been chemically modified, for example, by covalently linking any type of molecule to a polypeptide. For example, but not by way of limitation, a viral peptide or protein or fragment of a viral peptide or protein may be chemically modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, chemical cleavage, formulation, metabolic synthesis of tunicamycin, attachment to a cellular ligand or other protein, and the like. Derivatives are modified in a manner that differs from the naturally occurring or starting peptide or polypeptide in the type or position of the attached molecule. Derivatives also include the absence of one or more chemical groups naturally present on the viral peptide or protein. In addition, the viral peptide or protein or a derivative of a fragment of the viral peptide or protein may contain one or more non-classical amino acids. In particular embodiments, a derivative is a functional derivative of a native or unmodified peptide or polypeptide from which the derivative is derived.
The term "functional derivative" refers to a derivative that retains one or more functions or activities of a naturally occurring or starting peptide or polypeptide from which the derivative is derived. For example, functional derivatives of coronavirus S protein may retain the ability to bind to one or more of its receptors on a host cell. For example, functional derivatives of the coronavirus N protein may retain the ability to bind RNA or package the viral genome.
The term "identity" refers to the relationship between sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by aligning and comparing the sequences. "percent (%) amino acid sequence identity" with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical to amino acid residues in the reference polypeptide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and does not consider any conservative substitutions as part of the sequence identity. Alignment for the purpose of determining percent amino acid sequence identity may be accomplished in a variety of ways within the skill of the art, for example using publicly available computer software such as BLAST, BLAST-2, ALIGN, or megasign (DNAStar, inc.) software. One skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms needed to achieve maximum alignment over the full length of the compared sequences.
"modification" of an amino acid residue/position refers to a change in the primary amino acid sequence as compared to the starting amino acid sequence, wherein the change is caused by a sequence change involving the amino acid residue/position. For example, typical modifications include substitution of a residue with another amino acid (e.g., conservative or non-conservative substitutions), insertion of one or more (e.g., typically less than 5, 4, or 3) amino acids immediately adjacent to the residue/position, and/or deletion of the residue/position.
In the case of peptides or polypeptides, the term "fragment" as used herein refers to a peptide or polypeptide comprising less than the full length amino acid sequence. Such fragments may, for example, result from amino-terminal truncations, carboxy-terminal truncations and/or internal deletions of residues in the amino acid sequence. Fragments may be produced, for example, by alternative RNA splicing or by protease activity in vivo. In certain embodiments, a fragment refers to a polypeptide comprising at least 5 consecutive amino acid residues, at least 10 consecutive amino acid residues, at least 15 consecutive amino acid residues, at least 20 consecutive amino acid residues, at least 25 consecutive amino acid residues, at least 30 consecutive amino acid residues, at least 40 consecutive amino acid residues, at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 80 consecutive amino acid residues, at least 90 consecutive amino acid residues, at least 100 consecutive amino acid residues, at least 125 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 175 consecutive amino acid residues, at least 200 consecutive amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900 or at least 950 consecutive amino acid residues of the amino acid sequence of the polypeptide. In particular embodiments, fragments of a polypeptide retain at least 1, at least 2, at least 3, or more functions of the polypeptide.
As used herein in the context of a peptide or polypeptide (e.g., a protein), the term "immunogenic fragment" refers to a fragment of a peptide or polypeptide that retains the ability of the peptide or polypeptide to elicit an immune response (including an innate immune response and/or an adaptive immune response) upon contact with the immune system of a mammal. In some embodiments, the immunogenic fragment of a peptide or polypeptide may be an epitope.
The term "antigen" refers to a substance that is capable of being recognized by the immune system of a subject (including the adaptive immune system) and is capable of triggering an immune response (including an antigen-specific immune response) upon contacting the subject with the antigen. In certain embodiments, the antigen is a protein (e.g., a tumor-associated antigen (TAA)) associated with a diseased cell, such as a pathogen-infected cell, or a neoplastic cell.
An "epitope" is a site on the surface of an antigen molecule that binds to a single antibody molecule, such as a localized region on the surface of an antigen that is capable of binding to one or more antigen binding regions of an antibody and has antigenic or immunogenic activity in an animal, such as a mammal (e.g., a human being), capable of eliciting an immune response. An epitope with immunogenic activity is a portion of a polypeptide that elicits an antibody response in an animal. Epitopes having antigenic activity are part of the polypeptide to which the antibody binds, as determined by any method well known in the art, including, for example, by immunoassay. An epitope is not necessarily immunogenic. Epitopes are generally composed of chemically active surface groups of molecules such as amino acids or sugar side chains, and have specific three-dimensional structural features as well as specific charge characteristics. The antibody epitope may be a linear epitope or a conformational epitope. Linear epitopes are formed by contiguous amino acid sequences in proteins. Conformational epitopes are formed by amino acids that are discontinuous in the protein sequence, but which group together when the protein folds into its three-dimensional structure. An induced epitope is formed when the three-dimensional structure of a protein is in an altered conformation, such as upon activation or binding of another protein or ligand. In certain embodiments, the epitope is a three-dimensional surface feature of the polypeptide. In other embodiments, the epitope is a linear characteristic of the polypeptide. Typically, an antigen has several or many different epitopes and can react with many different antibodies.
The terms "Severe acute respiratory syndrome coronavirus 2" or "SARS-CoV-2" or "2019-nCoV" are used interchangeably herein to refer to a coronavirus that causes a pandemic of infectious disease in 2019. GenBank TM Accession number MN908947 provides an exemplary genomic sequence of SARS-CoV-2 (SEQ ID NO: 1).
The term "heterologous" refers to an entity that is not found in nature in association with (e.g., encoded and/or expressed by the genome of) a naturally occurring coronavirus. The term "homologous" refers to an entity found in nature that is associated with (e.g., encoded and/or expressed by the genome of) a naturally occurring coronavirus.
As used herein, the term "genetic vaccine" refers to a therapeutic or prophylactic composition comprising at least one nucleic acid molecule encoding an antigen associated with a target disease (e.g., an infectious disease or neoplastic disease). Administration of a vaccine to a subject ("vaccination") allows for the production of the encoded peptide or protein, thereby eliciting an immune response against the target disease in the subject. In certain embodiments, the immune response includes an adaptive immune response, such as the production of antibodies to the encoded antigen, and/or the activation and proliferation of immune cells capable of specifically eliminating diseased cells expressing the antigen. In certain embodiments, the immune response further comprises an innate immune response. According to the present disclosure, the vaccine may be administered to the subject either before or after the onset of clinical symptoms of the target disease. In some embodiments, vaccinating healthy or asymptomatic subjects renders the vaccinated subjects immune or less susceptible to the development of a target disease. In some embodiments, vaccinating a subject exhibiting symptoms of a disease improves the disease condition or treats the disease in the vaccinated subject.
The term "vector" refers to a substance used to carry or contain a nucleic acid sequence, including, for example, a nucleic acid sequence encoding a viral peptide or protein as described herein, in order to introduce the nucleic acid sequence into a host cell, or to serve as a transcription template to perform an in vitro transcription reaction in a cell-free system to produce mRNA. Vectors suitable for use include, for example, expression vectors, plasmids, phage vectors, viral vectors, episomes, and artificial chromosomes, which may include selection sequences or markers operable for stable integration into the chromosomes of a host cell. In addition, the vector may include one or more selectable marker genes and appropriate transcriptional or translational control sequences. For example, selectable marker genes may be included to provide resistance to antibiotics or toxins, to supplement auxotrophs for deficiency, or to provide key nutrients that are not in the medium. Transcriptional or translational control sequences may include constitutive and inducible promoters, transcriptional enhancers, transcriptional terminators, and the like, as are well known in the art. When two or more nucleic acid molecules (e.g., nucleic acid molecules encoding two or more different viral peptides or proteins) are co-transcribed or co-translated, the two nucleic acid molecules may be inserted, for example, into the same expression vector or into separate expression vectors. For single vector transcription and/or translation, the coding nucleic acids may be operably linked to one common transcriptional or translational control sequence, or to different transcriptional or translational control sequences, such as an inducible promoter and a constitutive promoter. The introduction of a nucleic acid molecule into a host cell can be confirmed using methods well known in the art. Such methods include, for example, nucleic acid analysis, such as Northern blot or Polymerase Chain Reaction (PCR) amplification of mRNA; immunoblots for expression of gene products; or other suitable analytical methods for testing the expression of the introduced nucleic acid sequence or its corresponding gene product. Those of skill in the art will understand that a nucleic acid molecule is expressed in sufficient amounts to produce a desired product (e.g., an mRNA transcript of a nucleic acid as described herein), and will further understand that the expression level can be optimized to obtain sufficient expression using methods well known in the art.
The terms "innate immune response" and "innate immunity" are well known in the art and refer to the non-specific defense mechanisms that the body's immune system initiates upon recognition of pathogen-associated molecular patterns, which involve different forms of cellular activity, including cytokine production and cell death through various pathways. As used herein, an innate immune response includes, but is not limited to, increased production of inflammatory cytokines (e.g., type I interferon or IL-10 production); activation of the nfkb pathway; proliferation, maturation, differentiation and/or survival of immune cells are increased, and in some cases induction of apoptosis. Activation of innate immunity can be detected using methods known in the art, such as measuring (NF) - κb activation.
The terms "adaptive immune response" and "adaptive immunity" are art-recognized and refer to antigen-specific defense mechanisms initiated by the body's immune system upon recognition of a particular antigen, including humoral and cell-mediated responses. As used herein, an adaptive immune response includes a cellular response triggered and/or enhanced by a vaccine composition, such as the genetic compositions described herein. In some embodiments, the vaccine composition comprises an antigen that is a target of an antigen-specific adaptive immune response. In other embodiments, the vaccine composition allows for the production of an antigen in the immunized subject after administration, which is a target of an antigen-specific adaptive immune response. Activation of the adaptive immune response may be detected using methods known in the art, such as measuring the production of antigen-specific antibodies or the level of antigen-specific cell-mediated cytotoxicity.
"antibody-dependent cell-mediated cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted immunoglobulins that bind to Fc receptors (fcrs) present on certain cytotoxic cells (e.g., natural Killer (NK) cells, neutrophils, and macrophages) enable these cytotoxic effector cells to specifically bind to antigen-bearing target cells and subsequently kill the target cells with cytotoxins. Antibodies "arm" cytotoxic cells and are absolutely required for such killing. NK cells (the primary cells used to mediate ADCC) express fcyriii only, whereas monocytes express fcyri, fcyrii and fcyriii. FcR expression on hematopoietic cells is known (see, e.g., ravetch and Kinet,1991, annu. Rev. Immunol. 9:457-92). To assess ADCC activity of a target molecule, an in vitro ADCC assay may be performed (see, e.g., U.S. Pat. nos. 5,500,362 and 5,821,337). Useful effector cells for such assays include Peripheral Blood Mononuclear Cells (PBMC) and Natural Killer (NK) cells. Alternatively or additionally, ADCC activity of the target molecule may be assessed in vivo, e.g., in animal models (see, e.g., clynes et al, 1998,Proc.Natl.Acad.Sci.USA 95:652-56). Antibodies with little or no ADCC activity may be selected for use.
"antibody-dependent cellular phagocytosis" or "ADCP" refers to the destruction of target cells via monocyte or macrophage-mediated phagocytosis when immunoglobulins bind to Fc receptors (fcrs) present on certain phagocytes (e.g., neutrophils, monocytes, and macrophages) so that these phagocytes can specifically bind to and subsequently kill antigen-bearing target cells. To assess ADCP activity of a target molecule, an in vitro ADCP assay may be performed (see, e.g., bracher et al, 2007, J. Immunol. Methods 323:160-71). Useful phagocytes for such assays include Peripheral Blood Mononuclear Cells (PBMCs), purified monocytes from PBMCs, or U937 cells differentiated into a mononuclear type. Alternatively or additionally, ADCP activity of the target molecule may be assessed in vivo, for example in animal models (see, e.g., wallace et al, 2001, J. Immunol. Methods 248:167-82). Antibodies with little or no ADCP activity may be selected for use.
"Fc receptor" or "FcR" describes a receptor that binds to the Fc region of an antibody. An exemplary FcR is a native sequence human FcR. Furthermore, exemplary fcrs are receptors that bind IgG antibodies (e.g., gamma receptors), and include receptors of fcγri, fcγrii, and fcγriii subclasses, including allelic variants and alternatively spliced forms of these receptors. Fcγrii receptors include fcγriia ("activating receptor") and fcγriib ("inhibiting receptor") which have similar amino acid sequences differing primarily in their cytoplasmic domains (see, e.g. 1997, annu. Rev. Immunol. 15:203-34). Various FcRs are known (see, e.g., ravetch and Kinet,1991, annu. Rev. Immunol.9:457-92; capel et al 1994,Immunomethods 4:25-34; and de Haas et al, 1995, J. Lab. Clin. Med. 126:330-41). The term "FcR" herein encompasses other fcrs, including those to be identified in the future. The term also includes the neonatal receptor FcRn, which is responsible for transferring maternal IgG to the fetus (see, e.g., guyer et al 1976, J.Immunol.117:587-93; and Kim et al 1994, eu.J.Immunol.24:2429-34). Antibody variants with improved or reduced binding to FcR have been described (see, e.g., WO 2000/42072; U.S. Pat. No. 7,183,387;7,332,581; and 7,335,742; shields et al, 2001, J.biol. Chem.9 (2): 6591-604).
"complement dependent cytotoxicity" or "CDC" refers to the lysis of target cells in the presence of complement. Activation of the classical complement pathway is initiated by binding of the first component of the complement system (C1 q) to antibodies (of the appropriate subclass) that bind to their cognate antigens. To assess complement activation, CDC analysis may be performed (see, e.g., gazzano-Santoro et al, 1996,J.Immunol.Methods 202:163). Polypeptide variants having altered amino acid sequences of the Fc region (polypeptides having variant Fc regions) and increased or decreased C1q binding capacity have been described (see, e.g., U.S. Pat. No. 6,194,551;WO 1999/51642; idusogie et al, 2000, J. Immunol. 164:4178-84). Antibodies with little or no CDC activity may be selected for use.
The term "antibody" is intended to include polypeptide products of B cells within polypeptides of the immunoglobulin class that are capable of binding to a particular molecular antigen and are composed of two pairs of identical polypeptide chains, wherein each pair has one heavy chain (about 50-70 kDa) and one light chain (about 25 kDa), each amino-terminal portion of each chain comprises a variable region of about 100 to about 130 amino acids or more, and each carboxy-terminal portion of each chain comprises a constant region. See, e.g., antibody Engineering (Borrebaeck edit, 2 nd edition, 1995); and Kuby, immunology (3 rd edition, 1997). In particular embodiments, specific molecular antigens may beThe antibody binding provided herein includes polypeptides, fragments or epitopes thereof. Antibodies also include, but are not limited to, synthetic antibodies, recombinantly produced antibodies, camelized antibodies, intracellular antibodies, anti-idiotype (anti-Id) antibodies, and functional fragments of any of the foregoing, which refer to a portion of an antibody heavy or light chain polypeptide that retains some or all of the binding activity of the antibody from which the fragment is derived. Non-limiting examples of functional fragments include single chain Fv (scFv) (e.g., including monospecific, bispecific, etc.), fab fragments, F (ab') fragments, F (ab) 2 Fragments, F (ab') 2 Fragments, disulfide-linked Fv (dsFv), fd fragments, fv fragments, diabodies, triabodies, tetrabodies, and minibodies. In particular, antibodies provided herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, such as antigen binding domains or molecules that contain an antigen binding site (e.g., one or more CDRs of an antibody). Such antibody fragments can be found, for example, in Harlow and Lane, antibodies: A Laboratory Manual (1989); mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers editions, 1995); huston et al, 1993,Cell Biophysics 22:189-224; pluckthun and Skerra,1989, meth. Enzymol.178:497-515; and Day, advanced Immunochemistry (2 nd edition, 1990). Antibodies provided herein can have any class (e.g., igG, igE, igM, igD and IgA) or any subclass (e.g., igG1, igG2, igG3, igG4, igA1, and IgA 2) of immunoglobulin molecules.
The term "administer" refers to an operation of injecting or otherwise physically delivering a substance present in vitro (e.g., a lipid nanoparticle composition described herein) into a patient, such as transmucosal, intradermal, intravenous, intramuscular delivery, and/or any other physical delivery method described herein or known in the art. When treating a disease, disorder, condition, or symptom thereof, administration of the substance is typically performed after the onset of the disease, disorder, condition, or symptom thereof. When preventing a disease, disorder, condition, or symptom thereof, administration of the substance is typically performed prior to onset of the disease, disorder, condition, or symptom thereof.
"chronic" administration is in contrast to acute mode, meaning that one or more agents are administered in a continuous mode (e.g., for a period of time, such as days, weeks, months, or years), thereby maintaining an initial therapeutic effect (activity) over a longer period of time. By "intermittent" administration is meant that the treatment is not carried out continuously without interruption, but rather is periodic in nature.
As used herein, the term "targeted delivery" or verb form "targeted" refers to a process that facilitates the delivery of an agent (such as a therapeutic payload molecule in a lipid nanoparticle composition described herein) to a particular organ, tissue, cell, and/or intracellular compartment (referred to as a target site) as compared to delivery to any other organ, tissue, cell, or intracellular compartment (referred to as a non-target site). Targeted delivery can be detected using methods known in the art, for example, by comparing the concentration of the delivered agent in the target cell population to the concentration of the delivered agent at the non-target cell population after systemic administration. In certain embodiments, targeted delivery results in a concentration at the target location that is at least 2 times higher than the concentration at the non-target location.
An "effective amount" is generally sufficient to reduce the severity and/or frequency of symptoms; elimination of symptoms and/or underlying causes; preventing the occurrence of symptoms and/or their underlying causes; and/or ameliorating or remediating the amount of damage caused by or associated with a disease, disorder or condition, including, for example, infection and neoplasia. In some embodiments, the effective amount is a therapeutically effective amount or a prophylactically effective amount.
As used herein, the term "therapeutically effective amount" refers to an amount of an agent (e.g., a vaccine composition) sufficient to reduce and/or ameliorate the severity and/or duration of a given disease, disorder or condition, and/or symptoms associated therewith (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as cancer). The "therapeutically effective amount" of a substance/molecule/agent of the present disclosure (e.g., a lipid nanoparticle composition described herein) can vary depending on a number of factors, such as the disease state, age, sex, and weight of the individual, as well as the ability of the substance/molecule/agent to elicit a desired response in the individual. A therapeutically effective amount comprises an amount of the therapeutically beneficial effect of the substance/molecule/agent that outweighs any toxic or detrimental effect thereof. In certain embodiments, the term "therapeutically effective amount" refers to an amount of a lipid nanoparticle composition as described herein or a therapeutic or prophylactic agent (e.g., therapeutic mRNA) contained therein that is effective to "treat" a disease, disorder, or condition in a subject or mammal.
A "prophylactically effective amount" is an amount of a pharmaceutical composition that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing a disease, disorder, condition, or related symptom (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as cancer), delaying the onset (or recurrence) thereof, or reducing the likelihood of onset (or recurrence) thereof. Typically, but not necessarily, since the prophylactic dose is for the subject prior to or at an early stage of the disease, disorder or condition, the prophylactically effective amount may be less than the therapeutically effective amount. The complete therapeutic or prophylactic effect does not necessarily occur by administration of one dose, but may occur only after administration of a series of doses. Thus, a therapeutically or prophylactically effective amount can be administered in one or more administrations.
The term "preventing" refers to reducing the likelihood of onset (or recurrence) of a disease, disorder, condition, or associated symptom (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as cancer).
The term "managing" refers to the beneficial effect a subject obtains from therapy (e.g., prophylactic or therapeutic agent) that does not cause a cure of the disease. In certain embodiments, one or more therapies (e.g., prophylactic or therapeutic agents, such as lipid nanoparticle compositions described herein) are administered to a subject to "control" an infectious or neoplastic disease, one or more symptoms thereof, thereby preventing progression or worsening of the disease.
The term "prophylactic agent" refers to any agent that can inhibit, in whole or in part, the development, recurrence, onset, or spread of a disease and/or symptoms associated therewith in a subject.
The term "therapeutic agent" refers to any agent that can be used to treat, prevent, or ameliorate a disease, disorder, or condition, including one or more symptoms of a disease, disorder, or condition and/or symptoms related thereto.
The term "therapy" refers to any regimen, method and/or agent that may be used to prevent, control, treat and/or ameliorate a disease, disorder or condition. In certain embodiments, the term "therapies" refers to biological therapies, supportive therapies, and/or other therapies known to those of skill in the art, such as medical personnel, that are useful in preventing, controlling, treating, and/or ameliorating a disease, disorder, or condition.
As used herein, a "prophylactically effective serum titer" is a serum titer of an antibody that completely or partially inhibits the development, recurrence, onset, or spread of a disease, disorder, or condition in a subject (e.g., a human) and/or symptoms associated therewith in the subject.
In certain embodiments, a "therapeutically effective serum titer" is a serum titer of an antibody in a subject (e.g., a human) that reduces the severity, duration, and/or symptoms associated with a disease, disorder, or condition in the subject.
The term "serum titer" refers to the average serum titer in a subject from multiple samples (e.g., at multiple time points) or in a population of at least 10, at least 20, at least 40 up to about 100, 1000, or more subjects.
The term "side effects" encompasses unwanted and/or adverse effects of a therapy (e.g., a prophylactic or therapeutic agent). The unwanted effect is not necessarily an adverse effect. Adverse effects of therapies (e.g., prophylactic or therapeutic agents) can be detrimental, uncomfortable, or risky. Examples of side effects include diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramps, fever, pain, weight loss, dehydration, alopecia, dyspnea, insomnia, dizziness, mucositis, nerve and muscle effects, fatigue, dry mouth, loss of appetite, rash or swelling at the site of administration, flu-like symptoms such as fever, coldness and fatigue, digestive tract problems and allergic reactions. Other undesirable effects experienced by patients are numerous and known in the art. There are many roles described in Physics's Desk Reference (68 th edition, 2014).
The term "subject" is used interchangeably with "patient". As used herein, in certain embodiments, the subject is a mammal, such as a non-primate (e.g., cow, pig, horse, cat, dog, rat, etc.) or a primate (e.g., monkey and human). In particular embodiments, the subject is a human. In one embodiment, the subject is a mammal (e.g., a human) having an infectious disease or neoplastic disease. In another embodiment, the subject is a mammal (e.g., a human) at risk of developing an infectious disease or neoplastic disease.
The term "elderly" refers to people over 65 years old. The term "human adult" refers to a person over 18 years of age. The term "human child" refers to a person aged 1 to 18 years. The term "human infant" refers to a person aged 1 to 3 years. The term "human infant" refers to a newborn to a person of 1 year old.
The term "detectable probe" refers to a composition that provides a detectable signal. The term includes, but is not limited to, any fluorophore, chromophore, radiolabel, enzyme, antibody or antibody fragment, etc. that provides a detectable signal by activity.
The term "detectable agent" refers to a substance that can be used to determine the presence of a desired molecule, such as an antigen encoded by an mRNA molecule described herein, in a sample or subject. The detectable agent may be a substance that can be visually detected or a substance that can be otherwise determined and/or measured (e.g., by quantification).
"substantially all" means at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.
As used herein and unless otherwise indicated, the term "about" or "approximately" means an acceptable error for a particular value determined by one of ordinary skill in the art, which depends in part on the manner in which the value is measured or determined. In certain embodiments, the term "about" or "approximately" means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the term "about" or "approximately" means within 20%, within 15%, within 10%, within 9%, within 8%, within 7%, within 6%, within 5%, within 4%, within 3%, within 2%, within 1%, within 0.5%, within 0.05% or less of a given value or range.
As used herein, the singular terms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.
All publications, patent applications, accession numbers, and other references cited in this specification are herein incorporated by reference in their entirety to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the application is not entitled to antedate such publication by virtue of prior application. In addition, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
Various embodiments of the present invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, the description in the experimental section and examples is intended to illustrate and not limit the scope of the invention as described in the claims.
6.3 therapeutic nucleic acids
In one aspect, provided herein are therapeutic nucleic acid molecules for the control, prevention, and treatment of coronavirus infections. In some embodiments, the therapeutic nucleic acid encodes a peptide or polypeptide that, when administered to a subject in need thereof, is expressed by cells in the subject to produce the encoded peptide or polypeptide. In some embodiments, the therapeutic nucleic acid molecule is a DNA molecule. In other embodiments, the therapeutic nucleic acid molecule is an RNA molecule. In particular embodiments, the therapeutic nucleic acid molecule is an mRNA molecule.
In some embodiments, the therapeutic nucleic acid molecule is formulated in a vaccine composition. In some embodiments, the vaccine composition is a genetic vaccine as described herein. In some embodiments, the vaccine composition comprises an mRNA molecule as described herein.
In some embodiments, the mRNA molecules of the present disclosure encode a peptide or polypeptide of interest, including any naturally or non-naturally occurring or otherwise modified polypeptide. The peptide or polypeptide encoded by the mRNA may be of any size and may have any secondary structure or activity. In some embodiments, the polypeptide encoded by the mRNA payload may have a therapeutic effect when expressed in a cell.
In some embodiments, the mRNA molecules of the present disclosure comprise at least one coding region (e.g., an Open Reading Frame (ORF)) encoding a peptide or polypeptide of interest. In some embodiments, the nucleic acid molecule further comprises at least one untranslated region (UTR). In certain embodiments, the untranslated region (UTR) is located upstream (5 'to) the coding region, and is referred to herein as the 5' -UTR. In certain embodiments, the untranslated region (UTR) is located downstream (3 'end) of the coding region, and is referred to herein as the 3' -UTR. In particular embodiments, the nucleic acid molecule comprises both a 5'-UTR and a 3' -UTR. In some embodiments, the 5'-UTR comprises a 5' -cap structure. In some embodiments, the nucleic acid molecule comprises a Kozak sequence (e.g., in the 5' -UTR). In some embodiments, the nucleic acid molecule comprises a poly-A region (e.g., in the 3' -UTR). In some embodiments, the nucleic acid molecule comprises a polyadenylation signal (e.g., in the 3' -UTR). In some embodiments, the nucleic acid molecule comprises a stabilizing region (e.g., in the 3' -UTR). In some embodiments, the nucleic acid molecule comprises a secondary structure. In some embodiments, the secondary structure is a stem-loop. In some embodiments, the nucleic acid molecule comprises a stem-loop sequence (e.g., in the 5'-UTR and/or 3' -UTR). In some embodiments, the nucleic acid molecule comprises one or more intron regions capable of excision during splicing. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from the group consisting of 5' -UTR and coding region. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from the group consisting of coding regions and 3' -UTRs. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from the group consisting of 5'-UTR, coding region and 3' -UTR.
6.3.1 coding region
In some embodiments, the nucleic acid molecules of the present disclosure comprise at least one coding region. In some embodiments, the coding region is an Open Reading Frame (ORF) encoding a single peptide or protein. In some embodiments, the coding region comprises at least two ORFs, each ORF encoding a peptide or protein. In embodiments where the coding region comprises more than one ORF, the peptides and/or proteins encoded may be the same or different from each other. In some embodiments, the multiple ORFs in the coding region are separated by a non-coding sequence. In a specific embodiment, the non-coding sequence separating the two ORFs comprises an Internal Ribosome Entry Site (IRES).
Without being bound by theory, it is contemplated that an Internal Ribosome Entry Site (IRES) can be used as the sole ribosome binding site, or as one of a plurality of ribosome binding sites of an mRNA. mRNA molecules containing more than one functional ribosome binding site can encode several peptides or proteins that are independently translated by the ribosome (e.g., polycistronic mRNA). Thus, in some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises one or more Internal Ribosome Entry Sites (IRES). Examples of IRES sequences that may be used in connection with the present disclosure include, but are not limited to, those from picornaviruses (e.g., FMDV), pestiviruses (CFFV), polioviruses (PV), encephalomyocarditis viruses (ECMV), foot and Mouth Disease Viruses (FMDV), hepatitis C Viruses (HCV), swine fever viruses (CSFV), murine Leukemia Viruses (MLV), monkey immunodeficiency viruses (SIV), or cricket paralysis viruses (CrPV).
In various embodiments, the nucleic acid molecules of the present disclosure encode at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 peptides or proteins. The peptides and proteins encoded by the nucleic acid molecules may be the same or different. In some embodiments, the nucleic acid molecules of the present disclosure encode dipeptides (e.g., carnosine and anserine). In some embodiments, the nucleic acid molecule encodes a tripeptide. In some embodiments, the nucleic acid molecule encodes a tetrapeptide. In some embodiments, the nucleic acid molecule encodes a pentapeptide. In some embodiments, the nucleic acid molecule encodes a hexapeptide. In some embodiments, the nucleic acid molecule encodes a heptapeptide. In some embodiments, the nucleic acid molecule encodes an octapeptide. In some embodiments, the nucleic acid molecule encodes a nonapeptide. In some embodiments, the nucleic acid molecule encodes a decapeptide. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 15 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 50 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 100 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 150 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 300 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 500 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 1000 amino acids.
In some embodiments, the nucleic acid molecules of the present disclosure are at least about 30 nucleotides (nt) in length. In some embodiments, the nucleic acid molecule is at least about 35nt in length. In some embodiments, the nucleic acid molecule is at least about 40nt in length. In some embodiments, the nucleic acid molecule is at least about 45nt in length. In some embodiments, the nucleic acid molecule is at least about 50nt in length. In some embodiments, the nucleic acid molecule is at least about 55nt in length. In some embodiments, the nucleic acid molecule is at least about 60nt in length. In some embodiments, the nucleic acid molecule is at least about 65nt in length. In some embodiments, the nucleic acid molecule is at least about 70nt in length. In some embodiments, the nucleic acid molecule is at least about 75nt in length. In some embodiments, the nucleic acid molecule is at least about 80nt in length. In some embodiments, the nucleic acid molecule is at least about 85nt in length. In some embodiments, the nucleic acid molecule is at least about 90nt in length. In some embodiments, the nucleic acid molecule is at least about 95nt in length. In some embodiments, the nucleic acid molecule is at least about 100nt in length. In some embodiments, the nucleic acid molecule is at least about 120nt in length. In some embodiments, the nucleic acid molecule is at least about 140nt in length. In some embodiments, the nucleic acid molecule is at least about 160nt in length. In some embodiments, the nucleic acid molecule is at least about 180nt in length. In some embodiments, the nucleic acid molecule is at least about 200nt in length. In some embodiments, the nucleic acid molecule is at least about 250nt in length. In some embodiments, the nucleic acid molecule is at least about 300nt in length. In some embodiments, the nucleic acid molecule is at least about 400nt in length. In some embodiments, the nucleic acid molecule is at least about 500nt in length. In some embodiments, the nucleic acid molecule is at least about 600nt in length. In some embodiments, the nucleic acid molecule is at least about 700nt in length. In some embodiments, the nucleic acid molecule is at least about 800nt in length. In some embodiments, the nucleic acid molecule is at least about 900nt in length. In some embodiments, the nucleic acid molecule is at least about 1000nt in length. In some embodiments, the nucleic acid molecule is at least about 1100nt in length. In some embodiments, the nucleic acid molecule is at least about 1200nt in length. In some embodiments, the nucleic acid molecule is at least about 1300nt in length. In some embodiments, the nucleic acid molecule is at least about 1400nt in length. In some embodiments, the nucleic acid molecule is at least about 1500nt in length. In some embodiments, the nucleic acid molecule is at least about 1600nt in length. In some embodiments, the nucleic acid molecule is at least about 1700nt in length. In some embodiments, the nucleic acid molecule is at least about 1800nt in length. In some embodiments, the nucleic acid molecule is at least about 1900nt in length. In some embodiments, the nucleic acid molecule is at least about 2000nt in length. In some embodiments, the nucleic acid molecule is at least about 2500nt in length. In some embodiments, the nucleic acid molecule is at least about 3000nt in length. In some embodiments, the nucleic acid molecule is at least about 3500nt in length. In some embodiments, the nucleic acid molecule is at least about 4000nt in length. In some embodiments, the nucleic acid molecule is at least about 4500nt in length. In some embodiments, the nucleic acid molecule is at least about 5000nt in length.
In particular embodiments, the therapeutic nucleic acids of the present disclosure are formulated into vaccine compositions (e.g., genetic vaccines) as described herein. In some embodiments, the therapeutic nucleic acid encodes a peptide or protein capable of eliciting an immunity against one or more target conditions or diseases. In some embodiments, the target disorder is associated with or caused by infection by a pathogen, such as coronavirus (e.g., covd-19), influenza virus, measles virus, human Papilloma Virus (HPV), rabies virus, meningitis virus, pertussis virus, tetanus virus, plague virus, hepatitis virus, and tuberculosis virus. In some embodiments, the therapeutic nucleic acid sequence (e.g., mRNA) encodes a pathogenic protein characteristic of a pathogen or an immunogenic fragment (e.g., epitope) or derivative thereof. The vaccine, upon administration to a vaccinated subject, allows expression of the encoded pathogenic protein (or immunogenic fragment or derivative thereof), thereby eliciting immunity against the pathogen in the subject.
In particular embodiments, provided herein are therapeutic compositions (e.g., vaccine compositions) for controlling, preventing, and treating infectious diseases or conditions caused by coronaviruses. Coronaviruses belong to the order nidoviridae (nidovirales) Coronaviridae (Coronaviridae) and are divided into four genera: alpha-coronavirus, beta-coronavirus, gamma-coronavirus and delta-coronavirus. Wherein the α -coronavirus and the β -coronavirus infect mammals, the γ -coronavirus infects birds, and the δ -coronavirus infects mammals and birds. Representative alpha-coronaviruses include human coronavirus NL63 (HCoV-NL 63), porcine transmissible gastroenteritis coronavirus (TGEV), PEDV, and Porcine Respiratory Coronavirus (PRCV). Representative beta-coronaviruses include SARS-CoV, MERS-CoV, bats coronavirus HKU4, mouse hepatitis coronavirus (MHV), bovine coronavirus (BCoV), and human coronavirus OC43. Representative gamma-coronaviruses and delta-coronaviruses include avian infectious bronchitis coronavirus (IBV) and porcine delta-coronavirus (PdCV), respectively. Li et al, annu Rev Virol.2016 3 (1): 237-261.
Without being bound by theory, it is contemplated that the coronavirus is an enveloped positive-stranded RNA virus. They have a large genome, typically ranging from 27kb to 32kb. The genome is stacked inside a helical capsid formed by a nucleocapsid (N) protein and further surrounded by an envelope. At least three structural proteins are associated with the viral envelope: the membrane (M) and envelope (E) proteins are involved in viral assembly, while the spike (S) proteins mediate viral entry into host cells. Some coronaviruses also encode envelope-associated Hemagglutinin Esterase (HE) proteins. Among these structural proteins, spike proteins form larger protrusions from the viral surface, making coronaviruses look like crowns. It is further contemplated that in addition to mediating viral entry, spike proteins may also play a role in determining viral host range and tissue tropism and are the primary inducers of host immune responses. Li et al, annu Rev Virol.20163 (1): 237-261.
Thus, in some embodiments, provided herein are therapeutic nucleic acids encoding viral peptides or proteins derived from coronaviruses. In some embodiments, the nucleic acid encodes a viral peptide or protein derived from a coronavirus, wherein the viral peptide or protein is selected from one or more of the following: (a) N protein; (b) M protein; (c) E protein; (d) S protein; (e) HE protein; (f) an immunogenic fragment of any one of (a) to (e); and (g) a functional derivative according to any one of (a) to (f).
Without being bound by theory, it is expected that the coronavirus S protein contains three segments: an extracellular domain, a single pass transmembrane anchor, and an intracellular tail. It is further contemplated that the extracellular domain comprises receptor binding subunit S1 and membrane fusion subunit S2. The S1 subunit also comprises two major domains: n-terminal domain (S1-NTD) and C-terminal domain (S1-CTD). It is further contemplated that one or both of these domains in the S1 subunit may bind to a receptor on a host cell and function as a Receptor Binding Domain (RBD). In particular, host receptors recognized by any of the domains in the S1 subunit are further contemplated to include angiotensin converting enzyme 2 (ACE 2), aminopeptidase N (APN), dipeptidylpeptidase 4 (DPP 4), carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM 1), and saccharides. It is further contemplated that S1-CTD contains two subdomains: core structure and Receptor Binding Motif (RBM). The RBM binds to ACE2 receptors on host cells.
Thus, in some embodiments, the therapeutic nucleic acids of the present disclosure encode a coronavirus S protein, or an immunogenic fragment of an S protein, or a functional derivative of an S protein or immunogenic fragment thereof. In specific embodiments, the immunogenic fragment of the S protein is selected from the group consisting of an extracellular domain, an S1 subunit, a Receptor Binding Domain (RBD), and a Receptor Binding Motif (RBM). In other embodiments, the immunogenic fragment of the S protein is selected from the group consisting of a transmembrane domain, an intracellular tail, an S2 subunit, an S1-NTD domain, and an S1-CTD domain. Table 1 shows exemplary SARS-CoV-2 natural antigen sequences.
Table 1 illustrates the natural SARS-CoV-2 antigen sequence.
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S protein of coronavirus SARS-CoV-2, wherein the S protein has the amino acid sequence of SEQ ID NO. 2. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 3. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 3. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the extracellular domain (ECD) of the S protein of coronavirus SARS-CoV-2, and wherein said extracellular domain has the amino acid sequence of SEQ ID NO. 4. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the ECD of the S protein of coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 5. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the ECD of the S protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 5. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S1 subunit of the S protein of coronavirus SARS-CoV-2, and wherein said S1 subunit has the amino acid sequence of SEQ ID NO. 6. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S1 subunit of the S protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 7. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S1 subunit of the S protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 7. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes an immunogenic fragment of the S protein of coronavirus SARS-CoV-2. In some embodiments, the immunogenic fragment is the Receptor Binding Domain (RBD) of the S protein of coronavirus SARS-CoV-2. In some embodiments, the therapeutic nucleic acids of the present disclosure encode an RBD sequence located at residues 319-541 of the S protein and having the amino acid sequence of SEQ ID NO. 8. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 9. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of the coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 9. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes an RBD sequence located at residues 331-529 of the S protein of the coronavirus SARS-CoV-2 and having the amino acid sequence of SEQ ID NO. 10. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 11. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of the coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 11. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of coronavirus SARS-CoV-2, and wherein said RBD sequence is located at residues 331-524 of the S protein and has the amino acid sequence of SEQ ID NO. 12. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 13. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of the coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 13. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of coronavirus SARS-CoV-2, and wherein said RBD domain is located at residues 319-529 of the S protein and has the amino acid sequence of SEQ ID NO. 14. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 15. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBD sequence of the S protein of the coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 15. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the Receptor Binding Motif (RBM) sequence of the S protein of the coronavirus SARS-CoV-2, and wherein said RBM has the amino acid sequence of SEQ ID NO. 16. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBM of the S protein of the coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 17. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the RBM of the S protein of the coronavirus SARS-CoV-2, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 17. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In some embodiments, the therapeutic nucleic acids of the present disclosure encode functional derivatives of RBD. In certain embodiments, the functional derivative of the RBD comprises one or more mutations that increase the binding affinity of the RBD to the host receptor as compared to the RBD without such mutations. In a particular embodiment, the coronavirus is SARS-CoV and wherein the mutation is K479N and/or S487T.
In some embodiments, the therapeutic nucleic acids of the present disclosure encode RBD mutants from a particular strain or isolate of coronavirus. In a particular embodiment, the coronavirus is SARS-CoV. In a particular embodiment, the coronavirus is SARS-CoV-2. In a particular embodiment, the coronavirus is a delta strain of SARS-CoV-2. In certain embodiments, the numbering is based on the sequence numbering of the full sequence of the S protein from the initial strain, the RBD mutant comprising the L452R and T478K mutations compared to the RBD from the initial strain. In particular embodiments, the RBD mutant consists of, consists essentially of, or comprises: the amino acid sequence set forth in SEQ ID NO. 60.
In a particular embodiment, the coronavirus is SARS-CoV-2, and wherein the mutation is N501T. Table 2 shows exemplary sequences of the S protein of coronavirus SARS-CoV-2 or antigenic fragment thereof having the N501T mutation.
Table 2 exemplary mutant sequences of SARS-CoV-2 antigen.
/>
/>
/>
In a particular embodiment, the therapeutic nucleic acid encodes a functional derivative of the S protein of the coronavirus SARS-CoV-2. In certain embodiments, the functional derivative of the encoded S protein comprises the amino acid substitution N501T. In a particular embodiment, the functional derivative of the encoded S protein comprises the amino acid sequence of SEQ ID NO. 20.
In a particular embodiment, the therapeutic nucleic acid encodes a functional derivative of the extracellular domain of the S protein of the coronavirus SARS-CoV-2. In a particular embodiment, the functional derivative of the encoded S protein extracellular domain comprises the amino acid substitution N501T. In a particular embodiment, the functional derivative of the extracellular domain of the encoded S protein comprises the amino acid sequence of SEQ ID NO. 21.
In a particular embodiment, the therapeutic nucleic acid encodes a functional derivative of the S1 subunit of the S protein of the coronavirus SARS-CoV-2. In a particular embodiment, the functional derivative of the S1 subunit of the encoded S protein comprises the amino acid substitution N501T. In a particular embodiment, the functional derivative of the S1 subunit of the encoded S protein comprises the amino acid sequence of SEQ ID NO. 22.
In particular embodiments, the therapeutic nucleic acid encodes a functional derivative of the Receptor Binding Domain (RBD) sequence of the S protein of the coronavirus SARS-CoV-2. In a particular embodiment, the functional derivative of the encoded S protein RBD sequence comprises the amino acid substitution N501T. In particular embodiments, the functional derivative of the encoded S protein RBD sequence comprises the amino acid sequence of SEQ ID NO. 23, SEQ ID NO. 24, SEQ ID NO. 25 or SEQ ID NO. 26. In a particular embodiment, the therapeutic nucleic acid encoding a functional derivative of the RBD sequence of the S protein of the coronavirus SARS-CoV-2 comprises the DNA coding sequence of SEQ ID NO. 27. In a particular embodiment, the therapeutic nucleic acid encoding a functional derivative of the RBD sequence of the S protein of the coronavirus SARS-CoV-2 comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 27. In some embodiments, the RNA sequence is transcribed in vitro. In certain embodiments, the therapeutic nucleic acid is an mRNA molecule.
TABLE 3 exemplary sequences of RBD of S protein of delta strain of SARS-CoV-2
/>
/>
Without being bound by theory, it is expected that in the spike structure of coronaviruses, three S1 heads are located on top of the trimeric S2 stem. Between the two major S1 domains, S1-CTD is located at the very top of the spike, while S1-NTD is in direct contact and structurally constrains S2. Thus, in some embodiments, the therapeutic nucleic acids of the present disclosure encode functional derivatives of S protein. In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising an S protein or fragment thereof fused to a trimerizing peptide such that the fusion protein is capable of forming a trimeric complex comprising three copies of the S protein or fragment thereof. In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising an extracellular domain of an S protein fused to a trimerizing peptide, wherein the fusion protein is capable of forming a trimeric complex comprising three copies of the extracellular domain. In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising an RBD of an S protein fused to a trimerizing peptide, wherein the fusion protein is capable of forming a trimeric complex comprising three copies of the RBD. In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising S1-CTD fused to a trimerizing peptide, wherein the fusion protein is capable of forming a trimeric complex comprising three copies of S1-CTD. In some embodiments, the S protein or fragment thereof is fused to the trimerized peptide via a peptide linker. Table 4 shows the sequences of exemplary trimeric and linker peptides, as well as fusion proteins, that can be used in connection with the present disclosure.
Table 4 shows the sequences of exemplary linker peptides, trimerized peptides and SARS-CoV-2 antigen.
/>
/>
/>
/>
/>
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the S protein of coronavirus SARS-CoV-2, or a functional derivative thereof, fused to a trimerized peptide. In some embodiments, the fusion between the S protein and the trimerized peptide is via a peptide linker. In a specific embodiment, the S protein or functional derivative thereof comprises the amino acid sequence of SEQ ID NO. 2 or SEQ ID NO. 20. In a specific embodiment, the peptide linker comprises the amino acid sequence of SEQ ID NO. 28. In some embodiments, the trimerized peptide comprises the amino acid sequence of SEQ ID NO. 30.
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the extracellular domain (ECD) of the S protein of coronavirus SARS-CoV-2 or a functional derivative thereof fused to a trimerization peptide. In some embodiments, the fusion between the extracellular domain of the S protein and the trimerized peptide is via a peptide linker. In a specific embodiment, the extracellular domain of the S protein or a functional derivative thereof comprises the amino acid sequence of SEQ ID NO. 4 or SEQ ID NO. 21. In a specific embodiment, the peptide linker comprises the amino acid sequence of SEQ ID NO. 28. In some embodiments, the trimerized peptide comprises the amino acid sequence of SEQ ID NO. 30.
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising an extracellular domain of an S protein of the coronavirus SARS-CoV-2, or a functional derivative thereof, fused to a trimerization peptide. In a particular embodiment, the fusion protein has the amino acid sequence of SEQ ID NO. 32. In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the extracellular domain of the S protein of SARS-CoV-2 fused to a trimerization peptide, wherein the nucleic acid comprises the DNA coding sequence of SEQ ID NO. 33. In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the extracellular domain of the S protein of SARS-CoV-2 fused to a trimerization peptide, wherein the nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 33. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the S1 subunit of the S protein of coronavirus SARS-CoV-2, or a functional derivative thereof, fused to a trimerized peptide. In some embodiments, the fusion between the extracellular domain of the S protein and the trimerized peptide is via a peptide linker. In a specific embodiment, the S1 subunit of the S protein, or a functional derivative thereof, comprises the amino acid sequence of SEQ ID NO. 6 or SEQ ID NO. 22. In a specific embodiment, the peptide linker comprises the amino acid sequence of SEQ ID NO. 28. In some embodiments, the trimerized peptide comprises the amino acid sequence of SEQ ID NO. 30.
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the Receptor Binding Domain (RBD) sequence of the S protein of coronavirus SARS-CoV-2, or a functional derivative thereof, fused to a trimerization peptide. In some embodiments, the fusion between the RBD sequence of the S protein and the trimerized peptide is via a peptide linker. In a specific embodiment, the RBD sequence of an S protein, or a functional derivative thereof, comprises an amino acid sequence selected from the group consisting of SEQ ID NOs 8, 10, 12, 14, 23, 24, 25 and 26. In a specific embodiment, the peptide linker comprises the amino acid sequence of SEQ ID NO. 28. In some embodiments, the trimerized peptide comprises the amino acid sequence of SEQ ID NO. 30.
In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the RBD sequence of the S protein of SARS-CoV-2 fused to a trimerization peptide, wherein said fusion protein has the amino acid sequence of SEQ ID NO. 34. In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the RBD of the S protein of SARS-CoV-2 fused to a trimerization peptide, wherein said nucleic acid comprises the DNA coding sequence of SEQ ID NO. 35. In a particular embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the RBD of the S protein of SARS-CoV-2 fused to a trimerization peptide, wherein said nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 35. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the Receptor Binding Motif (RBM) sequence of the S protein of coronavirus SARS-CoV-2, or a functional derivative thereof, fused to a trimerization peptide. In some embodiments, the fusion between the RBM sequence of the S protein and the trimerized peptide is via a peptide linker. In a specific embodiment, the RBM sequence of the S protein, or a functional derivative thereof, comprises the amino acid sequence of SEQ ID NO. 16. In a specific embodiment, the peptide linker comprises the amino acid sequence of SEQ ID NO. 28. In some embodiments, the trimerized peptide comprises the amino acid sequence of SEQ ID NO. 30.
Without being bound by theory, it is expected that the N protein of coronavirus comprises an N-terminal domain (N-NTD) and a C-terminal domain (N-CTD) interspersed with several regions of Inherent Disorder (IDRs). For example, SARS-CoV N protein has three IDRs at residues 1-44, 182-247 and 366-422, respectively, and N-NTD at residues 45-181 and N-CTD at residues 248-365.
Thus, in some embodiments, the therapeutic nucleic acids of the present disclosure encode a coronavirus N protein, or an immunogenic fragment of an N protein, or a functional derivative of an N protein or immunogenic fragment thereof. In particular embodiments, the therapeutic nucleic acid encodes a full-length N protein. In particular embodiments, the therapeutic nucleic acid encodes one or more immunogenic fragments of an N protein selected from the group consisting of N-NTD, N-CTD, and IDR.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the nucleocapsid (N) protein of coronavirus SARS-CoV-2, and wherein said N protein has the amino acid sequence of SEQ ID NO. 18. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the N protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 19. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the N protein of coronavirus SARS-CoV-2, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 19. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
Without being bound by theory, it is contemplated that fusion proteins comprising a viral peptide or polypeptide fused to an immunoglobulin Fc region may enhance the immunogenicity of the viral peptide or polypeptide. Thus, in some embodiments, the therapeutic nucleic acid molecules of the present disclosure encode fusion proteins comprising a viral peptide or protein derived from a coronavirus fused to the Fc region of an immunoglobulin. In particular embodiments, the viral peptide or protein is selected from one or more of the following: (a) N protein; (b) M protein; (c) E protein; (d) S protein; (e) HE protein; (f) an immunogenic fragment of any one of (a) to (e); and (g) a functional derivative according to any one of (a) to (f). In a particular embodiment, the immunoglobulin is a human immunoglobulin (Ig). In a particular embodiment, the immunoglobulin is human IgG, igA, igD, igE or IgM. In particular embodiments, the immunoglobulin is human IgG1, igG2, igG3, or IgG4. In some embodiments, the immunoglobulin Fc is fused to the N-terminus of a viral peptide or polypeptide. In other embodiments, the immunoglobulin Fc is fused to the C-terminus of a viral peptide or polypeptide.
Without being bound by theory, it is contemplated that the signal peptide may mediate transport of the polypeptide to which it is fused to a specific location of the cell. Thus, in some embodiments, the therapeutic nucleic acid molecules of the present disclosure encode fusion proteins comprising a viral peptide or protein fused to a signal peptide. In particular embodiments, the viral peptide or protein is selected from one or more of the following: (a) N protein; (b) M protein; (c) E protein; (d) S protein; (e) HE protein; (f) an immunogenic fragment of any one of (a) to (e); and (g) a functional derivative according to any one of (a) to (f). In some embodiments, the signal peptide is fused to the N-terminus of the viral peptide or polypeptide. In other embodiments, the signal peptide is fused to the C-terminus of the viral peptide or polypeptide. Table 5 shows exemplary sequences of signal peptides that can be used in conjunction with the present disclosure, as well as exemplary SARS-CoV-2 antigen sequences that comprise the signal peptides.
Table 5: exemplary sequences of signal peptide and SARS-CoV-2 antigen.
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
In particular embodiments, the signal peptide is encoded by a gene of a coronavirus from which the viral peptide or polypeptide is derived. In certain embodiments, the signal peptide encoded by a gene of a coronavirus is fused to a viral peptide or polypeptide encoded by a different gene of a coronavirus. In other embodiments, the signal peptide encoded by a gene of a coronavirus is fused to a viral peptide or polypeptide encoded by the same gene of a coronavirus. For example, in some embodiments, a signal peptide having the amino acid sequence of MFVFLVLLPLVSS (SEQ ID NO: 36) is fused to a viral peptide or polypeptide encoded by a nucleic acid molecule of the present disclosure. In various embodiments, the viral peptide or protein is selected from one or more of the following: (a) N protein; (b) M protein; (c) E protein; (d) S protein; (e) HE protein; (f) an immunogenic fragment of any one of (a) to (e); and (g) a functional derivative according to any one of (a) to (f).
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S protein of coronavirus SARS-CoV-2 without a natural signal peptide. In a particular embodiment, the encoded S protein comprises the amino acid sequence of SEQ ID NO. 40. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S protein of coronavirus SARS-CoV-2 having a signal peptide, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 41. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S protein of coronavirus SARS-CoV-2 having a signal peptide, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 41. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the extracellular domain (ECD) of the S protein of coronavirus SARS-CoV-2 with a signal peptide. In a particular embodiment, the extracellular domain of the encoded S protein comprises the amino acid sequence of SEQ ID NO. 42. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the extracellular domain of the S protein of coronavirus SARS-CoV-2 having a signal peptide, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 43. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the extracellular domain of the S protein of coronavirus SARS-CoV-2 having a signal peptide, and wherein said therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 43. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S1 subunit of the S protein of coronavirus SARS-CoV-2 with a signal peptide. In a particular embodiment, the S1 subunit of the encoded S protein comprises the amino acid sequence of SEQ ID NO. 44. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S1 subunit of the S protein of coronavirus SARS-CoV-2 having a signal peptide, and wherein said therapeutic nucleic acid comprises the DNA coding sequence of SEQ ID NO. 45. In a particular embodiment, the therapeutic nucleic acid of the present disclosure encodes the S1 subunit of the S protein of coronavirus SARS-CoV-2 having a signal peptide, and wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence of SEQ ID NO. 45. In some embodiments, the RNA sequence is transcribed in vitro. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In other embodiments, the signal peptide is encoded by a foreign gene sequence that is not present in the coronavirus from which the viral peptide or polypeptide is derived. In some embodiments, the heterologous signal peptide replaces a homologous signal peptide in a fusion protein encoded by a nucleic acid molecule of the present disclosure. In particular embodiments, the signal peptide is encoded by a mammalian gene. In a specific embodiment, the signal peptide is encoded by a human immunoglobulin gene. In a specific embodiment, the signal peptide is encoded by the human IgE gene. For example, in some embodiments, a signal peptide having the amino acid sequence of MDWTWILFLVAAATRVHS (SEQ ID NO: 38) is fused to a viral peptide or polypeptide encoded by a nucleic acid molecule of the present disclosure. In various embodiments, the viral peptide or protein is selected from one or more of the following: (a) N protein; (b) M protein; (c) E protein; (d) S protein; (e) HE protein; (f) an immunogenic fragment of any one of (a) to (e); and (g) a functional derivative according to any one of (a) to (f).
6.3.2 5' -cap structure
Without being bound by theory, it is expected that the 5' -cap structure of the polynucleotide participates in nuclear export and increases polynucleotide stability, and binds to mRNA Cap Binding Protein (CBP), which is responsible for polynucleotide stability in cells, and induces translational capacity by associating CBP with poly-a binding protein to form mature circular mRNA species. The 5 '-cap structure further facilitates removal of the 5' -proximal intron during mRNA splicing. Thus, in some embodiments, the nucleic acid molecules of the present disclosure comprise a 5' -cap structure.
The nucleic acid molecule may be capped at the 5 'end by a cellular endogenous transcription machinery, thereby creating a 5' -ppp-5 '-triphosphate linkage between the terminal guanosine cap residue of the polynucleotide and the 5' end transcribed sense nucleotide. The 5' -guanylate cap may then be methylated to produce an N7-methyl-guanylate residue. The ribose of the 5 'end of the polynucleotide and/or the pre-terminal (ante-terminal) transcribed nucleotide may also optionally be 2' -O-methylated. 5' -uncapping by hydrolysis and cleavage of guanylate cap structures can target nucleic acid molecules, such as mRNA molecules, for degradation.
In some embodiments, the nucleic acid molecules of the present disclosure comprise one or more alterations to the native 5' -cap structure produced by endogenous processes. Without being bound by theory, modification of the 5' -cap may increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and may increase the translational efficiency of the polynucleotide.
Exemplary alterations to the native 5' -cap structure include the creation of a non-hydrolyzable cap structure to prevent uncapping, thereby increasing the half-life of the polynucleotide. In some embodiments, because hydrolysis of the cap structure requires cleavage of the 5'-ppp-5' phosphodiester linkage, in some embodiments, modified nucleotides may be used during the capping reaction. For example, in some embodiments, vaccinia virus capping enzyme (Vaccinia Capping Enzyme) from New England Biolabs (Ipswich, mass.) can be used for α -thioguanosine nucleotides to produce phosphorothioate linkages in the 5' -ppp-5' cap according to the manufacturer's instructions. Additional modified guanosine nucleotides such as alpha-methylphosphonic acid and selenophosphate nucleotides may be used.
Additional exemplary alterations to the native 5' -cap structure also include birds that are cappedModification of the 2 '-and/or 3' -position of the Glycoside Triphosphate (GTP) and substitution of the sugar epoxy (resulting in carbocyclic oxygen) with a methylene moiety (CH 2 ) Modification at the triphosphate bridge portion of the cap structure or modification at the nucleobase (G) portion.
Additional exemplary alterations to the native 5' -cap structure include, but are not limited to, 2' -O-methylation of ribose of the 5' -end and/or 5' -end pre-nucleotides of the polynucleotide at the sugar 2' -hydroxyl (as described above). A variety of different 5 '-cap structures can be used to create a 5' -cap of a polynucleotide (such as an mRNA molecule). Additional exemplary 5 '-cap structures that may be used in connection with the present disclosure also include those 5' -cap structures described in international patent publications No. WO2008127688, no. WO 2008016473, and No. WO 2011015347, the entire contents of each of which are incorporated herein by reference.
In various embodiments, the 5' -end cap can comprise a cap analog. Cap analogs are also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs that differ in chemical structure from the natural (i.e., endogenous, wild-type, or physiological) 5' -cap while retaining cap function. Cap analogs can be chemically (i.e., non-enzymatically) or enzymatically synthesized and/or linked to a polynucleotide.
For example, an anti-reverse cap analogue (ARCA) cap contains two guanosine groups linked via a 5'-5' -triphosphate group, wherein one guanosine group contains an N7-methyl group and a 3 '-O-methyl group (i.e., N7,3' -O-dimethyl-guanosine-5 '-triphosphate-5' -guanosine, i.e., m 7 G-3'mppp-G, which may equivalently be referred to as 3' O-Me-m7G (5 ') ppp (5') G). The 3'-O atom of the other unchanged guanosine is attached to the 5' -terminal nucleotide of a capped polynucleotide (e.g.mRNA). N7-and 3' -O-methylated guanines provide the terminal portion of a capped polynucleotide (e.g., mRNA). Another exemplary cap structure is a mCAP, which is similar to ARCA, but has a 2 '-O-methyl group on guanosine (i.e., N7,2' -O-dimethyl-guanosine-5 '-triphosphate-5' -guanosine, i.e., m) 7 Gm-ppp-G)。
In some embodiments, the cap analog can be a dinucleotide cap analog. As non-limiting examples, dinucleotide cap analogs may be modified with a borane phosphate group (borophosphate) or a selenophosphate group (phosphoselenoate) at different phosphate positions, such as the dinucleotide cap analogs described in U.S. patent No. 8,519,110, the entire contents of which are incorporated herein by reference in their entirety.
In some embodiments, cap analogs can be N7- (4-chlorophenoxyethyl) -substituted dinucleotide cap analogs known in the art and/or described herein. Non-limiting examples of N7- (4-chlorophenoxyethyl) -substituted dinucleotide cap analogs include N7- (4-chlorophenoxyethyl) -G (5 ') ppp (5 ') G and N7- (4-chlorophenoxyethyl) -m3' -OG (5 ') ppp (5 ') G cap analogs (see, e.g., kore et al, bioorganic & Medicinal Chemistry 201321:4570-4574, methods of synthesizing cap analogs; the entire contents of this document are incorporated herein by reference). In other embodiments, the cap analogs that can be used in conjunction with the nucleic acid molecules of the present disclosure are 4-chloro/bromophenoxyethyl analogs.
In various embodiments, the cap analog can include a guanosine analog. Useful guanosine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2' -fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
Without being bound by theory, it is expected that although cap analogs allow for simultaneous capping of polynucleotides in an in vitro transcription reaction, up to 20% of transcripts remain uncapped. This and the structural differences in the native 5' -cap structure of the cap analogue and the polynucleotide produced by the endogenous transcriptional machinery of the cell may lead to reduced translational capacity and reduced cell stability.
Thus, in some embodiments, the nucleic acid molecules of the present disclosure may also be capped post-transcriptionally using enzymes in order to produce a more authentic (authentic) 5' -cap structure. As used herein, the phrase "more realistic" refers to a feature that closely reflects or mimics an endogenous or wild-type feature in structure or function. That is, a "more authentic" feature better represents an endogenous, wild-type, natural, or physiological cell function and/or structure, or it outperforms a corresponding endogenous, wild-type, natural, or physiological feature in one or more respects, as compared to a synthetic feature or analog of the prior art. Non-limiting examples of more realistic 5' -cap structures that can be used in conjunction with the nucleic acid molecules of the present disclosure are synthetic 5' -cap structures (or compared to wild-type, natural or physiological 5' -cap structures) as known in the art, particularly structures with enhanced binding to cap binding proteins, increased half-life, reduced sensitivity to 5' -endonucleases, and/or reduced 5' -uncapping. For example, in some embodiments, the recombinant vaccinia virus capping enzyme and the recombinant 2 '-O-methyltransferase can create a classical 5' -5 '-triphosphate linkage between a 5' -terminal nucleotide of a polynucleotide and a guanosine cap nucleotide, wherein the guanosine cap contains N7-methylation and the 5 '-terminal nucleotide of the polynucleotide contains a 2' -O-methyl group. This structure is referred to as the cap 1 structure. Such caps result in higher translational capacity, cell stability, and reduced activation of cellular pro-inflammatory cytokines than, for example, other 5' cap analog structures known in the art. Other exemplary cap structures include 7mG (5 ') ppp (5 ') N, pN2p (cap 0), 7mG (5 ') ppp (5 ') NlmpNp (cap 1), 7mG (5 ') -ppp (5 ') NlmpN2mp (cap 2), and m (7) Gpppm (3) (6,6,2 ') Apm (2 ') Cpm (2) (3, 2 ') Up (cap 4).
Without being bound by theory, it is contemplated that the nucleic acid molecules of the present disclosure may be capped post-transcriptionally, and since this approach is more efficient, nearly 100% of the nucleic acid molecules may be capped.
6.3.3 untranslated regions (UTR)
In some embodiments, the nucleic acid molecules of the present disclosure comprise one or more untranslated regions (UTRs). In some embodiments, the UTR is located upstream of the coding region in the nucleic acid molecule and is referred to as a 5' -UTR. In some embodiments, the UTR is located downstream of the coding region in the nucleic acid molecule and is referred to as a 3' -UTR. The sequence of the UTR may be homologous or heterologous to the sequence of the coding region found in the nucleic acid molecule. Multiple UTRs may be included in a nucleic acid molecule and may have the same or different sequences and/or genetic origins. According to the present disclosure, any portion (including none) of the UTRs in a nucleic acid molecule may be codon optimized, and any portion may independently contain one or more different structural or chemical modifications before and/or after codon optimization.
In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises UTR and coding regions that are homologous with respect to each other. In other embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise UTR and coding regions that are heterologous with respect to each other. In some embodiments, to monitor the activity of a UTR sequence, a nucleic acid molecule comprising a coding sequence of a UTR and a detectable probe may be administered in vitro (e.g., a cell or tissue culture) or in vivo (e.g., to a subject), and the effect of the UTR sequence (e.g., modulating expression levels, cellular localization of the encoded product, or half-life of the encoded product) may be measured using methods known in the art.
In some embodiments, the UTR of a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises at least one Translational Enhancer Element (TEE) that functions to increase the amount of polypeptide or protein produced by the nucleic acid molecule. In some embodiments, the TEE is located in the 5' -UTR of the nucleic acid molecule. In other embodiments, the TEE is located at the 3' -UTR of the nucleic acid molecule. In other embodiments, at least two TEEs are located at the 5'-UTR and 3' -UTR, respectively, of a nucleic acid molecule. In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure may comprise one or more copies of a TEE sequence or comprise more than one different TEE sequence. In some embodiments, the different TEE sequences present in the nucleic acid molecules of the disclosure may be homologous or heterologous with respect to each other.
Various TEE sequences are known in the art and may be used in connection with the present disclosure. For example, in some embodiments, the TEE may be an Internal Ribosome Entry Site (IRES), HCV-IRES, or IRES element. Chappell et al, proc.Natl. Acad. Sci. USA 101:9590-9594,2004; zhou et al Proc.Natl.Acad.Sci.102:6273-6278,2005. Additional Internal Ribosome Entry Sites (IRES) that can be used in conjunction with the present disclosure include, but are not limited to, IRES described in U.S. patent No. 7,468,275, U.S. patent publication No. 2007/0048776, and U.S. patent publication No. 2011/0123410, as well as international patent publication nos. WO2007/025008 and WO2001/055369, the contents of each of which are incorporated herein by reference in their entirety. In some embodiments, the TEE may be Wellensiek et al Genome-wide profiling of human cap-independent translation-enhancing elements, nature Methods, month 8 of 2013; 10 (8) supplement Table 1 and supplement Table 2 for 747-750; the content of this document is incorporated by reference in its entirety.
Additional exemplary TEEs that may be used in conjunction with the present disclosure include, but are not limited to, TEE sequences described in U.S. patent No. 6,310,197, U.S. patent No. 6,849,405, U.S. patent No. 7,456,273, U.S. patent No. 7,183,395, U.S. patent publication No. 2009/0226470, U.S. patent publication No. 2013/0177581, U.S. patent publication No. 2007/0048776, U.S. patent publication No. 2011/0127800, U.S. patent publication No. 2009/0093049, international patent publication No. WO2009/075886, international patent publication No. WO2012/009644 and international patent publication No. WO 1999/02455, international patent publication No. WO2007/025008, international patent publication No. WO2001/055371, european patent No. 2610341, european patent No. 2610340, the contents of each of which are incorporated herein by reference in their entirety.
In various embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises at least one UTR comprising at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. In some embodiments, the TEE sequence in the nucleic acid molecule UTR is a copy of the same TEE sequence. In other embodiments, at least two TEE sequences in a nucleic acid molecule UTR have different TEE sequences. In some embodiments, a plurality of different TEE sequences are arranged in one or more repeating patterns in the UTR region of the nucleic acid molecule. For illustration purposes only, the repeating pattern may be, for example, ABABAB, AABBAABBAABB, ABCABCABC, etc., wherein in these exemplary patterns each capital letter (A, B or C) represents a different TEE sequence. In some embodiments, at least two TEE sequences are contiguous with each other (i.e., without a spacer sequence therebetween) in the UTR of a nucleic acid molecule. In other embodiments, at least two TEE sequences are separated by a spacer sequence. In some embodiments, UTRs may comprise TEE sequence-spacer sequence modules that are repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times in UTRs. In any of the embodiments described in this paragraph, the UTR can be the 5'-UTR, the 3' -UTR, or both the 5'-UTR and the 3' -UTR of the nucleic acid molecule.
In some embodiments, the UTR of a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises at least one translational inhibiting element that functions to reduce the amount of polypeptide or protein produced by the nucleic acid molecule. In some embodiments, the UTR of the nucleic acid molecule comprises one or more miR sequences or fragments thereof (e.g., miR seed sequences) that are recognized by one or more micrornas. In some embodiments, the UTR of the nucleic acid molecule comprises one or more stem-loop structures that down-regulate the translational activity of the nucleic acid molecule. Other mechanisms for inhibiting translational activity associated with nucleic acid molecules are known in the art. In any of the embodiments described in this paragraph, the UTR can be the 5'-UTR, the 3' -UTR, or both the 5'-UTR and the 3' -UTR of the nucleic acid molecule. Table 6 shows exemplary 5'-UTR and 3' -UTR sequences that may be used in connection with the present disclosure.
Table 6 illustrates an exemplary untranslated region (UTR) sequence.
/>
In a specific embodiment, the nucleic acid molecules of the present disclosure comprise a 5' -UTR selected from the group consisting of SEQ ID NOS: 46-51. In a specific embodiment, the nucleic acid molecules of the present disclosure comprise a 3' -UTR selected from the group consisting of SEQ ID NOS: 52-57. In a specific embodiment, the nucleic acid molecules of the present disclosure comprise a 5'-UTR selected from SEQ ID NOS: 46-51 and a 3' -UTR selected from SEQ ID NOS: 52-57. In any of the embodiments described in this paragraph, the nucleic acid molecule may further comprise a coding region having a sequence as described herein, such as any of the DNA coding sequences in the tables herein or an equivalent RNA sequence thereof. In particular embodiments, the nucleic acid molecule of this paragraph may be an in vitro transcribed RNA molecule.
TABLE 7 exemplary mRNA constructs
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
A n 110 mer of e.g. a.
6.3.4 polyadenylation (Poly-A) region
Long-chain adenosine nucleotides (poly-a regions) are typically added to messenger RNA (mRNA) molecules during natural RNA processing to increase the stability of the molecules. Immediately after transcription, the 3 '-end of the transcript is cleaved to release the 3' -hydroxyl group. Next, a poly-A polymerase adds a series of adenosine nucleotides to the RNA. This process is called polyadenylation and adds a poly-A region between 100 and 250 residues in length. Without being bound by theory, it is contemplated that the poly-a region may confer a number of advantages to the nucleic acid molecules of the present disclosure.
Thus, in some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises a polyadenylation signal. In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises one or more polyadenylation (poly-A) regions. In some embodiments, the poly-A region consists entirely of adenine nucleotides or functional analogs thereof. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 3' end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5' end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5 'end and at least one poly-A region at its 3' end.
In accordance with the present disclosure, the poly-A regions may have different lengths in different embodiments. In particular, in some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 30 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 35 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 40 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 45 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 50 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 55 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 60 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 65 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 70 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 75 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 80 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 85 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 90 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 95 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 100 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 110 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 120 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 130 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 140 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 150 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 160 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 170 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 180 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 190 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 200 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 225 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 250 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 275 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 300 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 350 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 400 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 450 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 500 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 600 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 700 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 800 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 900 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1000 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1100 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1200 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 1300 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1400 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1500 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 1600 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 1700 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1800 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 1900 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2000 nucleotides in length. In some embodiments, the poly-a region of a nucleic acid molecule of the present disclosure is at least 2250 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2500 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2750 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 3000 nucleotides in length.
In some embodiments, the length of the poly-a region in a nucleic acid molecule can be selected based on the total length of the nucleic acid molecule or a portion thereof (such as the length of the coding region or the length of the open reading frame of the nucleic acid molecule, etc.). For example, in some embodiments, the poly-a region comprises about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the total length of the nucleic acid molecule comprising the poly-a region.
Without being bound by theory, it is contemplated that certain RNA binding proteins may bind to the poly-A region located at the 3' end of the mRNA molecule. These poly-A binding proteins (PABP) may regulate mRNA expression, such as interacting with translation initiation mechanisms in cells and/or protecting the 3' -poly-A tail from degradation. Thus, in some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises at least one binding site for a poly-a binding protein (PABP). In other embodiments, the nucleic acid molecule is allowed to form a conjugate or complex with the PABP prior to loading into a delivery vehicle (e.g., a lipid nanoparticle).
In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises a poly-A-G quadruplex. G quadruplets are circular arrays of four guanosine nucleotides that can form hydrogen bonds from G-rich sequences in DNA and RNA. In this embodiment, the G quadruplex is incorporated into one end of the poly-A region. The resulting polynucleotides (e.g., mRNA) can be analyzed for stability, protein yield, and other parameters, including half-life at various time points. It has been found that the poly-A-G quadruplex structure results in a protein yield corresponding to at least 75% of that observed with the 120 nucleotide poly-A region alone.
In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure may comprise a poly-a region and may be stabilized by the addition of a 3' -stabilizing region. In some embodiments, a 3' -stabilizing region useful for stabilizing nucleic acid molecules (e.g., mRNA) comprising a poly-a or poly-a-G quadruplet structure is described in international patent publication No. WO2013/103659, the contents of which are incorporated herein by reference in their entirety.
In other embodiments, the 3 '-stabilizing region that can be used in conjunction with the nucleic acid molecules of the present disclosure includes chain terminating nucleosides, such as, but not limited to, 3' -deoxyadenosine (cordycepin); 3' -deoxyuridine; 3' -deoxycytosine; 3' -deoxyguanosine; 3' -deoxythymine; 2',3' -dideoxynucleosides such as 2',3' -dideoxyadenosine, 2',3' -dideoxyuridine, 2',3' -dideoxycytosine, 2',3' -dideoxyguanosine, 2',3' -dideoxythymine; 2' -deoxynucleosides; or O-methyl nucleoside; 3' -deoxynucleosides; 2',3' -dideoxynucleosides; 3' -O-methyl nucleoside; 3' -O-ethyl nucleoside; 3' -arabinoside, as well as other alternative nucleosides known in the art and/or described herein.
6.3.5 secondary Structure
Without being bound by theory, it is contemplated that the stem-loop structure may guide RNA folding, preserve the structural stability of the nucleic acid molecule (e.g., mRNA), provide recognition sites for RNA binding proteins, and serve as substrates for enzymatic reactions. For example, the incorporation of miR sequences and/or TEE sequences will alter the shape of the stem-loop region, whereby translation can be increased and/or decreased (Kedde et al, APumilio-induced RNA structure switch in p-3'UTR controls miR-221and miR-222accessibility.Nat Cell Biol; 10. 2010; 12 (10): 1014-20), the contents of which are incorporated herein by reference in their entirety).
Thus, in some embodiments, a nucleic acid molecule (e.g., mRNA) described herein, or a portion thereof, may be in a stem-loop structure, such as, but not limited to, a histone stem-loop. In some embodiments, the stem-loop structure is formed from a stem-loop sequence of about 25 or about 26 nucleotides in length, such as, but not limited to, the structure described in international patent publication No. WO2013/103659, the contents of which are incorporated herein by reference in their entirety. Additional examples of stem-loop sequences include those described in international patent publication No. WO2012/019780 and international patent publication No. WO201502667, the contents of each of which are incorporated herein by reference. In some embodiments, the stem-loop sequence comprises a TEE as described herein. In some embodiments, the stem-loop sequence comprises a miR sequence as described herein. In particular embodiments, the stem-loop sequence can include a miR-122 seed sequence. In a specific embodiment, the nucleic acid molecule comprises a stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 58). In other embodiments, the nucleic acid molecule comprises a stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 59).
In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises a stem-loop sequence located upstream (at the 5' end) of the coding region in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 5' -UTR of the nucleic acid molecule. In some embodiments, a nucleic acid molecule (e.g., mRNA) of the present disclosure comprises a stem-loop sequence located downstream (at the 3' end) of the coding region in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 3' -UTR of the nucleic acid molecule. In some cases, the nucleic acid molecule may contain more than one stem-loop sequence. In some embodiments, the nucleic acid molecule comprises at least one stem-loop sequence in the 5'-UTR and at least one stem-loop sequence in the 3' -UTR.
In some embodiments, the nucleic acid molecule comprising a stem-loop structure further comprises a stabilizing region. In some embodiments, the stabilizing region comprises at least one chain terminating nucleoside that acts to slow degradation and thereby increase the half-life of the nucleic acid molecule. Exemplary chain terminating nucleosides that can be used in conjunction with the nucleic acid molecules of the present disclosure include, but are not limited to, 3' -deoxyadenosine (cordycepin); 3' -deoxyuridine; 3' -deoxycytosine; 3' -deoxyguanosine; 3' -deoxythymine; 2',3' -dideoxynucleosides such as 2',3' -dideoxyadenosine, 2',3' -dideoxyuridine, 2',3' -dideoxycytosine, 2',3' -dideoxyguanosine, 2',3' -dideoxythymine; 2' -deoxynucleosides; or O-methyl nucleoside; 3' -deoxynucleosides; 2',3' -dideoxynucleosides; 3' -O-methyl nucleoside; 3' -O-ethyl nucleoside; 3' -arabinoside, as well as other alternative nucleosides known in the art and/or described herein. In other embodiments, the stem-loop structure may be stabilized by altering the 3' -region of the polynucleotide, which may prevent and/or inhibit the addition of oligo (U) (international patent publication No. WO2013/103659, which is incorporated herein by reference in its entirety).
In some embodiments, the nucleic acid molecules of the present disclosure comprise at least one stem-loop sequence and a poly-A region or polyadenylation signal. Non-limiting examples of polynucleotide sequences comprising at least one stem-loop sequence and a poly-a region or polyadenylation signal include the sequences described in international patent publication No. WO2013/120497, international patent publication No. WO2013/120629, international patent publication No. WO2013/120500, international patent publication No. WO2013/120627, international patent publication No. WO2013/120498, international patent publication No. WO2013/120626, international patent publication No. WO2013/120499, and international patent publication No. WO2013/120628, the contents of each of which are incorporated herein by reference in their entirety.
In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-a region or polyadenylation signal may encode a pathogen antigen or fragment thereof, such as the polynucleotide sequences described in international patent publication No. WO2013/120499 and international patent publication No. WO2013/120628, the contents of each of which are incorporated herein by reference in their entirety.
In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-a region or polyadenylation signal may encode a therapeutic protein, such as the polynucleotide sequences described in international patent publication No. WO2013/120497 and international patent publication No. WO2013/120629, the contents of each of which are incorporated herein by reference in their entirety.
In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-a region or polyadenylation signal may encode a tumor antigen or fragment thereof, such as the polynucleotide sequences described in international patent publication No. WO2013/120500 and international patent publication No. WO2013/120627, the contents of each of which are incorporated herein by reference in their entirety.
In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-a region or polyadenylation signal may encode a sensitising antigen or an autoimmune autoantigen, such as the polynucleotide sequences described in international patent publication No. WO2013/120498 and international patent publication No. WO2013/120626, the contents of each of which are incorporated herein by reference in their entirety.
6.3.6 functional nucleotide analogues
In some embodiments, the payload nucleic acid molecules described herein contain only classical nucleotides selected from a (adenosine), G (guanosine), C (cytosine), U (uridine), and T (thymidine). Without being bound by theory, it is expected that certain functional nucleotide analogs may confer useful properties to a nucleic acid molecule. In the context of the present disclosure, examples of such useful properties include, but are not limited to, increased stability of the nucleic acid molecule, reduced immunogenicity of the nucleic acid molecule in inducing an innate immune response, increased production of proteins encoded by the nucleic acid molecule, increased intracellular delivery and/or retention of the nucleic acid molecule, and/or reduced cytotoxicity of the nucleic acid molecule, among others.
Thus, in some embodiments, the payload nucleic acid molecule comprises at least one functional nucleotide analog as described herein. In some embodiments, the functional nucleotide analog contains at least one chemical modification to a nucleobase, a sugar group, and/or a phosphate group. Thus, a payload nucleic acid molecule comprising at least one functional nucleotide analogue contains at least one chemical modification directed to nucleobases, sugar groups and/or internucleoside linkages. Exemplary chemical modifications to nucleobases, glycosyls, or internucleoside linkages of nucleic acid molecules are provided herein.
As described herein, nucleotides ranging from 0% to 100% of all nucleotides in a payload nucleic acid molecule can be functional nucleotide analogs as described herein. For example, in various embodiments, from about 1% to about 20%, from about 1% to about 25%, from about 1% to about 50%, from about 1% to about 60%, from about 1% to about 70%, from about 1% to about 80%, from about 1% to about 90%, from about 1% to about 95%, from about 10% to about 20%, from about 10% to about 25%, from about 10% to about 50%, from about 10% to about 60%, from about 10% to about 70%, from about 10% to about 80%, from about 10% to about 90%, from about 10% to about 95%, from about 10% to about 100%, from about 20% to about 25%, from about 20% to about 50%, from about 20% to about 60%, from about 20% to about 70%, from about 20% to about 80%, from about 20% to about 95%, from about 20% to about 100%, from about 50% to about 70%, from about 50% to about 80%, from about 50% to about 90%, from about 50% to about 95%, from about 50% to about 100%, from about 70%, from about 50% to about 80%, from about 95% to about 95%, from about 95% to about 100%, from about 80%, from about 95% to about 100% of the nucleotide in all nucleotides in a nucleic acid molecule. In any of these embodiments, the functional nucleotide analog may be present at any position of the nucleic acid molecule, including the 5 '-terminus, the 3' -terminus, and/or one or more internal positions. In some embodiments, a single nucleic acid molecule may contain different sugar modifications, different nucleobase modifications, and/or different types of internucleoside linkages (e.g., backbone structures).
As described herein, from 0% to 100% of the nucleotides in one type of all nucleotides in a payload nucleic acid molecule (e.g., as all purine-containing nucleotides of one type, or as all pyrimidine-containing nucleotides of one type, or as all A, G, C, T or U of one type) can be functional nucleotide analogs described herein. For example, in various embodiments, from about 1% to about 20%, from about 1% to about 25%, from about 1% to about 50%, from about 1% to about 60%, from about 1% to about 70%, from about 1% to about 80%, from about 1% to about 90%, from about 1% to about 95%, from about 10% to about 20%, from about 10% to about 25%, from about 10% to about 50%, from about 10% to about 60%, from about 10% to about 70%, from about 10% to about 80%, from about 10% to about 90%, from about 10% to about 95%, from about 10% to about 100%, from about 20% to about 25%, from about 20% to about 50%, from about 20% to about 60%, from about 20% to about 70%, from about 20% to about 80%, from about 20% to about 95%, from about 20% to about 100%, from about 50% to about 70%, from about 50% to about 80%, from about 50% to about 90%, from about 50% to about 95%, from about 50% to about 100%, from about 50% to about 70%, from about 80%, from about 95% to about 100%, from about 80% to about 95%, from about 95% to about 100% of the nucleotide in one type of nucleotide in the nucleic acid molecule. In any of these embodiments, the functional nucleotide analog may be present at any position of the nucleic acid molecule, including the 5 '-terminus, the 3' -terminus, and/or one or more internal positions. In some embodiments, a single nucleic acid molecule may contain different sugar modifications, different nucleobase modifications, and/or different types of internucleoside linkages (e.g., backbone structures).
Modification of 6.3.7 nucleobases
In some embodiments, the functional nucleotide analog contains a non-classical nucleobase. In some embodiments, classical nucleobases (e.g., adenine, guanine, uracil, thymine, and cytosine) in a nucleotide may be modified or substituted to provide one or more functional nucleotide analogs. Exemplary modifications of nucleobases include, but are not limited to, one or more substitutions or modifications including, but not limited to, alkyl, aryl, halo, oxo, hydroxy, alkoxy, and/or thio substitutions; one or more fused or open rings; oxidation and/or reduction.
In some embodiments, the non-classical nucleobase is a modified uracil. Exemplary nucleobases and nucleosides with modified uracils include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil(s) 2 U), 4-thiouracil(s) 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho) 5 U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil), 3-methyluracil (m) 3 U), 5-methoxy-uracil (mo) 5 U), uracil 5-oxyacetic acid (cmo) 5 U), uracil 5-oxyacetic acid methyl ester (mcmo) 5 U), 5-carboxymethyl-uracil (cm) 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm) 5 U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm) 5 U), 5-methoxycarbonylmethyl-uracil (mcm) 5 U), 5-methoxycarbonylmethyl-2-thio-uracil (mcm) 5 s 2 U), 5-aminomethyl-2-thio-uracil (nm) 5 s 2 U), 5-methylaminomethyl-uracil (mn) 5 U), 5-methylaminomethyl-2-thio-uracil (mn) 5 s 2 U), 5-methylaminomethyl-2-seleno-uracil (mn) 5 se 2 U), 5-carbamoylmethyl-uracil (ncm) 5 U), 5-carboxymethylaminomethyl-uracil (cmnm) 5 U), 5-carboxymethylaminomethyl-2-thio-uracil (cmnm) 5 s 2 U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurine methyl-uracil (τm) 5 U), 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thio-uracil (τm) 5 5s 2 U), 1-taurine methyl-4-thio-pseudouridine, 5-methyl-uracil (m) 5 U, i.e. having the nucleobase deoxythymine), 1-methyl-pseudouridine (m 1 Psi), 1-ethyl-pseudosUridine (Et) 1 Psi), 5-methyl-2-thiouracil (m) 5 s 2 U), 1-methyl-4-thio-pseudouridine (m) 1 s 4 Psi), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m) 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydro uracil (D), dihydro-pseudouridine, 5, 6-dihydro uracil, 5-methyl-dihydro-uracil (m) 5 D) 2-thio-dihydro-uracil, 2-thio-dihydro-pseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3- (3-amino-3-carboxypropyl) uracil (acp) 3 U), 1-methyl-3- (3-amino-3-carboxypropyl) pseudouridine (acp) 3 Psi), 5- (isopentenyl aminomethyl) uracil (m) 5 U), 5- (isopentenylaminomethyl) -2-thio-uracil (m) 5 s 2 U), 5,2' -O-dimethyl-uridine (m) 5 Um), 2-thio-2' -O-methyl-uridine(s) 2 Um), 5-methoxycarbonylmethyl-2' -O-methyl-uridine (mcm) 5 Um), 5-carbamoylmethyl-2' -O-methyl-uridine (ncm) 5 Um), 5-carboxymethylaminomethyl-2' -O-methyl-uridine (cmnm) 5 Um), 3,2' -O-dimethyl-uridine (m) 3 Um) and 5- (isopentenylaminomethyl) -2' -O-methyl-uridine (mm) 5 Um), 1-thio-uracil, deoxythymidine, 5- (2-methoxycarbonylvinyl) -uracil, 5- (carbamoylhydroxymethyl) -uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil and 5- [3- (1-E-propenyl amino ] ]Uracil.
In some embodiments, the non-classical nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosines include 5-azacytosine, 6-azacytosine, pseudoisocytosine, 3-methylcytosine (m 3C), N4-acetylcytosine (ac 4C), 5-formylcytosine (f 5C), N4-methyl-cytosine (m 4C), 5-methyl-cytosine (m 5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm 5C), 1-methyl-pseudoisocytosine, pyrrolo-cytosine, pyrrolo-pseudoisocytosine, 2-thiocytosine (s 2C) 2-thio-5-methylcytosine, 4-thio-pseudoisocytosine, 4-thio-1-methyl-1-deaza-pseudoisocytosine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudoisocytosine, 4-methoxy-1-methyl-pseudoisocytosine, risperidine (k 2C), 5,2' -O-dimethyl-cytidine (m 5 Cm), N4-acetyl-2 ' -O-methyl-cytidine (ac 4 Cm), N4,2' -O-dimethyl-cytidine (m 4 Cm), 5-formyl-2 ' -O-methyl-cytidine (fSCm), N4,2' -O-trimethyl-cytidine (m 42 Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5- (3-azidopropyl) -cytosine, and 5- (2-azidoethyl) -cytosine.
In some embodiments, the non-canonical nucleobase is a modified adenine. Exemplary nucleobases and nucleosides with substituted adenine include 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1-methyl-adenine (m 1A), 2-methyl-adenine (m 2A), N6-methyl-adenine (m 6A), 2-methylthio-N6-methyl-adenine (ms 2m 6A), N6-isopentenyl-adenine (i 6A), 2-methylthio-N6-isopentenyl-adenine (m 6A), cis-hydroxy-5-adenine (m 6A), N6-threonyl carbamoyl-adenine (t 6A), N6-methyl-N6-threonyl carbamoyl-adenine (m 6t 6A), 2-methylsulfanyl-N6-threonyl carbamoyl-adenine (ms 2g 6A), N6-dimethyl-adenine (m 62A), N6-hydroxy-N-valyl carbamoyl-adenine (hn 6A), 2-methylsulfanyl-N6-hydroxy-N-valyl carbamoyl-adenine (ms 2hn 6A), N6-acetyl-adenine (ac 6A), 7-methyl-adenine, 2-methylsulfanyl-adenine, 2-methoxy-adenine, N6,2' -O-dimethyl-adenine (m 6 Am), N6,2' -O-trimethyl-adenine (m 62A), 1,2' -O-dimethyl-adenine (m 1 Am), 2-amino-N6-methyl-adenine, N6-acetyl-adenine (ac 6A), 7-methyl-adenine, 2-methylsulfanyl-adenine, 2-methoxy-adenine, N6,2' -O-dimethyl-adenine (m 6 Am), 1,2' -O-dimethyl-adenine (m 1 Am), 2-amino-N6-methyl-adenine, N8-hydroxy-adenine, and nona-methyl adenine.
In some embodiments, the non-canonical nucleobase is a modified guanine. Exemplary nucleobases and nucleosides with modified guanines include inosine (I), 1-methyl-inosine (m 1I), bosyl (wyosine) (imG), methyl bosyl (mimG), 4-demethyl-bosyl (imG-14), isobornyl (imG), huai Dinggan (wybutosine) (yW), peroxy Huai Dinggan (o 2 yW), hydroxy Huai Dinggan (OHyW), hydroxy Huai Dinggan (OHyW) of undermodified (unrermodified), 7-deaza-guanosine, pigtail (queuosine) (Q), epoxy pigtail (oQ), galactosyl-pigtail (galQ), mannosyl-pigtail (manQ), 7-cyano-7-deaza-guanosine (preQO), 7-aminomethyl-7-deaza-guanosine (preQ 1), gulin (c) and guanosine) (G+), 7-deaza-guanosine-8, 6-deaza-guanosine (6-thioguanosine), 7-methyl-6-thioguanosine (G), 6-deaza-guanosine (6-thioguanosine) and methyl-6-thioguanosine (6-thioguanosine) are described herein N2-methyl-guanine (m 2G), N2-dimethyl-guanine (m 22G), N2, 7-dimethyl-guanine (m 2, 7G), N2, 7-dimethyl-guanine (m 2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thioguanine, N2-dimethyl-6-thioguanine, N2-methyl-2 ' -O-methyl-guanosine (m 2 Gm), N2-dimethyl-2 ' -O-methyl-guanosine (m 22 Gm), 1-methyl-2 ' -O-methyl-guanosine (m 1 Gm), N2, 7-dimethyl-2 ' -O-methyl-guanosine (m 2,7 Gm), 2' -O-methyl-inosine (Im), 1,2' -O-dimethyl-2 ' -O-methyl-guanosine (m) and 1-thioguanosine (Im).
In some embodiments, the non-classical nucleobases of the functional nucleotide analogs can independently be purines, pyrimidines, purine analogs, or pyrimidine analogs. For example, in some embodiments, the non-canonical nucleobase can be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, non-classical nucleobases may also include naturally occurring and synthetic derivatives of, for example, bases, including pyrazolo [3,4-d ] pyrimidines; 5-methylcytosine (5-me-C); 5-hydroxymethylcytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine and 2-thiocytosine; 5-propynyluracil and cytosine; 6-azo uracil, cytosine and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, and other 8-substituted adenine and guanine; 5-halo (especially 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azaadenine; deazaguanine, 7-deazaguanine, 3-deazaguanine; deazaadenine, 7-deazaadenine, 3-deazaadenine; pyrazolo [3,4-d ] pyrimidines; imidazo [1,5-a ]1,3, 5-triazinone; 9-deazapurine; imidazo [4,5-d ] pyrazines; thiazolo [4,5-d ] pyrimidine; pyrazin-2-one; 1,2, 4-triazine; pyridazine; or 1,3, 5-triazine.
6.3.8 modification of sugar
In some embodiments, the functional nucleotide analog contains a non-canonical glycosyl. In various embodiments, the non-classical sugar group may be a 5-carbon or 6-carbon sugar (such as pentose, ribose, arabinose, xylose, glucose, galactose, or deoxy derivatives thereof) having one or more substitutions such as halo, hydroxy, thiol, alkyl, alkoxy, alkenyloxy, alkynyloxy, cycloalkyl, aminoalkoxy, alkoxyalkoxy, hydroxyalkoxy, amino, azido, aryl, aminoalkyl, aminoalkenyl, aminoalkyl, and the like.
In general, RNA molecules contain ribosyl groups that are oxygen-containing 5-membered rings. Exemplary, non-limiting alternative nucleotides include substitution of oxygen in ribose (e.g., substitution with S, se or an alkylene group such as methylene or ethylene); adding a double bond (e.g., replacing ribose with cyclopentenyl or cyclohexenyl); ring shrinkage of ribose (e.g., 4 membered rings forming cyclobutane or oxetane); ring extension of ribose (e.g., forming a 6 or 7 membered ring with additional carbon or heteroatoms, such as for anhydrohexitol, altritol (altritol), mannitol, cyclohexyl, cyclohexenyl, and morpholino (which also has a phosphoramidate backbone)); polycyclic forms (e.g., tricyclic and "unlocked" forms, such as diol nucleic acids (GNAs) (e.g., R-GNAs or S-GNAs, wherein ribose is replaced by a diol unit attached to a phosphodiester linkage), threose nucleic acids (TNA, wherein ribose is replaced by an α -L-threofuranosyl- (3 '→2') linkage), and peptide nucleic acids (PNA, wherein 2-amino-ethyl-glycine linkages replace ribose and phosphodiester backbones)).
In some embodiments, the glycosyl group contains one or more carbons having a stereochemical configuration opposite to the corresponding carbon in ribose. Thus, a nucleic acid molecule may comprise a nucleotide containing, for example, arabinose or L-ribose as sugar. In some embodiments, the nucleic acid molecule comprises at least one nucleoside wherein the sugar is L-ribose, 2 '-O-methyl ribose, 2' -fluoro ribose, arabinose, hexitol, LNA, or PNA.
6.3.9 modification of internucleoside linkage
In some embodiments, the payload nucleic acid molecules of the present disclosure may contain one or more modified internucleoside linkages (e.g., phosphate backbones). The backbone phosphate group may be altered by replacing one or more oxygen atoms with different substituents.
In some embodiments, the functional nucleotide analogs can include substitution of an unchanged phosphate moiety with another internucleoside linkage described herein. Examples of alternative phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenos, boranophosphates (borophosphosphates/boranophosphate ester), hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates and phosphotriesters. Both non-linking oxygens of the dithiophosphate are replaced by sulfur. The phosphate linker can also be altered by replacing the linking oxygen with nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate) and carbon (bridged methylphosphonate).
Alternative nucleosides and nucleotides can include one or more non-bridging oxyborane moieties (BH 3 ) Sulfur (thio), methyl, ethyl, and/or methoxy substitution. As a non-limiting example, two non-bridging oxygens at the same position (e.g., the alpha, beta, or gamma (gamma) position) may be replaced with a thio (thio) and methoxy group. Replacement of one or more oxygen atoms at the phosphate moiety (e.g., alpha-phosphorothioate) position may impart RNA and DNA stability (such as stability against exonucleases and endonucleases) through non-natural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and therefore have a longer half-life in the cellular environment.
Other internucleoside linkages, including internucleoside linkages that do not contain a phosphorus atom, that can be used in accordance with the present disclosure are described herein.
Additional examples of nucleic acid molecules (e.g., mRNA), related compositions, formulations, and/or methods that can be used in conjunction with the present disclosure also include those of WO2002/098443, WO2003/051401, WO2008/052770, WO2009127230, WO2006122828, WO2008/083949, WO2010088927, WO2010/037539, WO2004/004743, WO2005/016376, WO 2006/024318, WO2007/095976, WO2008/014979, WO2008/077592, WO2009/030481, WO2009/095226, WO2011069586, WO 3835, WO2011/144358, WO2012019780, WO2012013326, WO2012089338, WO2012113513, WO2012116811, WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO2013143699, WO2013143700, WO 2013/626, WO2013120627, WO2013120628, WO 024/669, WO 66668, WO 024/024, WO2015/024, WO2015,2015, WO 2015/2013120628, WO 2015.
Therapeutic nucleic acid molecules as described herein can be isolated or synthesized by using methods known in the art. In some embodiments, the DNA or RNA molecules used in connection with the present disclosure are chemically synthesized. In other embodiments, the DNA or RNA molecules used in connection with the present disclosure are isolated from a natural source.
In some embodiments, mRNA molecules used in connection with the present disclosure are biosynthesized using host cells. In certain embodiments, the mRNA is produced by transcription of the corresponding DNA sequence using a host cell. In some embodiments, the DNA sequence encoding the mRNA sequence is incorporated into an expression vector using methods known in the art, and then the vector is introduced into a host cell (e.g., e.coli). The host cell is then cultured under suitable conditions to produce mRNA transcripts. Other methods of generating mRNA molecules from coding DNA are known in the art. For example, in some embodiments, mRNA transcripts may be produced using a cell-free (in vitro) transcription system comprising enzymes of the transcription machinery of the host cell. An exemplary cell-free transcription reaction system is described in this disclosure.
6.4 nanoparticle compositions
In one aspect, the nucleic acid molecules described herein are formulated for in vitro and in vivo delivery. In particular, in some embodiments, the nucleic acid molecule is formulated as a lipid-containing composition. In some embodiments, the lipid-containing composition forms a lipid nanoparticle that encapsulates the nucleic acid molecule within a lipid shell. In some embodiments, the lipid shell protects the nucleic acid molecule from degradation. In some embodiments, the lipid nanoparticle also facilitates transport of the encapsulated nucleic acid molecule into an intracellular compartment and/or mechanism to perform a desired therapeutic or prophylactic function. In certain embodiments, the nucleic acid, when present in the lipid nanoparticle, resists degradation by nucleases in aqueous solution. Lipid nanoparticles comprising nucleic acids and methods of making the same are known in the art, such as those disclosed in, for example, U.S. patent publication No. 2004/0142025, U.S. patent publication No. 2007/0042031, PCT publication No. WO 2017/004143, PCT publication No. WO 2015/199952, PCT publication No. WO 2013/016058, and PCT publication No. WO 2013/086373, the complete disclosure of each of which is incorporated herein by reference in its entirety for all purposes.
In some embodiments, nanoparticle compositions provided herein have a maximum dimension of 1 μm or less (e.g., 1 μm, 900nm, 800nm, 700nm, 600nm, 500nm, 400nm, 300nm, 200nm, 175nm, 150nm, 125nm, 100nm, 75nm, 50nm or less), such as when measured by Dynamic Light Scattering (DLS), transmission electron microscopy, scanning electron microscopy, or another method. In one embodiment, the lipid nanoparticle provided herein has at least one dimension in the range of about 40nm to about 200 nm. In one embodiment, the at least one dimension is in the range of about 40nm to about 100 nm.
Nanoparticle compositions that can be used in connection with the present disclosure include, for example, lipid Nanoparticles (LNP), nanolipoprotein particles, liposomes, lipid vesicles, and lipid complexes (lipoplex). In some embodiments, the nanoparticle composition is a vesicle comprising one or more lipid bilayers. In some embodiments, the nanoparticle composition comprises two or more concentric bilayers separated by an aqueous compartment. The lipid bilayers may be functionalized and/or crosslinked to each other. The lipid bilayer may include one or more ligands, proteins, or channels.
In some embodiments, the nanoparticle composition comprises a lipid component comprising at least one lipid, such as a compound according to one of the lipid families 01, 02, 03, and 04 as described herein, e.g., one or more lipids of formulas 01-I, 01-II, 02-I, 03-I, and 04-I (and sub-varieties thereof). For example, in some embodiments, the nanoparticle composition can comprise a lipid component comprising one of the compounds provided herein. The nanoparticle composition may also include one or more other lipid or non-lipid components as described below.
6.4.1 cationic lipid
Cationic lipids include the following lipid series 01-04 (and its subformulae).
Lipid series 01
In one embodiment, provided herein are compounds of formula (01-I):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
G 1 and G 2 Each independently is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene, wherein one or more of the alkylene or alkenylene groups are-CH 2 -optionally via-O-substitution;
L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 Or R is 2 ；
R 1 And R is 2 Each independently is C 6 -C 32 Alkyl or C 6 -C 32 Alkenyl groups;
R a 、R b 、R d and R is e Each independently is H, C 1 -C 24 Alkyl or C 2 -C 24 Alkenyl groups;
R c and R is f Each independently is C 1 -C 32 Alkyl or C 2 -C 32 Alkenyl groups;
G 3 is C 2 -C 24 Alkylene, C 2 -C 24 Alkenylene, C 3 -C 8 Cycloalkylene or C 3 -C 8 A cycloalkenyl group;
R 3 is-N (R) 4 )R 5 ；
R 4 Is C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, 4-to 8-membered heterocyclyl or C 6 -C 10 An aryl group; or R is 4 、G 3 Or G 3 Together with the nitrogen to which they are attached, form a cyclic moiety;
R 5 is C 1 -C 12 Alkyl or C 3 -C 8 Cycloalkyl; or R is 4 、R 5 Forms together with the nitrogen to which they are attached a cyclic moiety;
x is 0, 1 or 2; and is also provided with
Wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
In one embodiment, provided herein are compounds of formula (01-II):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
is a single bond or a double bond;
G 1 and G 2 Each independently is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene, wherein one or more of the alkylene or alkenylene groups are-CH 2 -optionally via-O-substitution;
L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 Or R is 2 ；
R 1 And R is 2 Each independently is C 6 -C 32 Alkyl or C 6 -C 32 Alkenyl groups;
R a 、R b 、R d and R is e Each independently ofThe floor is H, C 1 -C 24 Alkyl or C 2 -C 24 Alkenyl groups;
R c and R is f Each independently is C 1 -C 32 Alkyl or C 2 -C 32 Alkenyl groups;
G 4 is a bond, C 1 -C 23 Alkylene, C 2 -C 23 Alkenylene, C 3 -C 8 Cycloalkylene or C 3 -C 8 A cycloalkenyl group;
R 3 is-N (R) 4 )R 5 ；
R 4 Is C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, 4-to 8-membered heterocyclyl or C 6 -C 10 An aryl group; or R is 4 、G 3 Or G 3 Together with the nitrogen to which they are attached, form a cyclic moiety;
R 5 is C 1 -C 12 Alkyl or C 3 -C 8 Cycloalkyl; or R is 4 、R 5 Forms together with the nitrogen to which they are attached a cyclic moiety;
x is 0, 1 or 2; and is also provided with
Wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of table 01-1, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
Table 01-1.
Lipid series 02
In one embodiment, provided herein are compounds of formula (02-I):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
G 1 and G 2 Each independently is C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene group, wherein G 1 And G 2 One or more of-CH 2 -optionally via-O-, -C (=o) O-or-OC (=o) -substitution;
each L 1 Independently is-OC (=o) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-NR a P(＝O)(OR b )(OR c )；
Each L 2 Independently is-OC (=o) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-NR d P(＝O)(OR e )(OR f )；
R 1 And R is 2 Each independently is C 6 -C 24 Alkyl or C 6 -C 24 Alkenyl groups;
R a 、R b 、R d and R is e Each independently is H, C 1 -C 24 Alkyl or C 2 -C 24 Alkenyl groups;
R c and R is f Each independently is C 1 -C 24 Alkyl or C 2 -C 24 Alkenyl groups;
G 3 is C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene in which a part or all of the alkylene or alkenylene groups are optionally substituted by C 3 -C 8 Cycloalkylene or C 3 -C 8 Cycloalkenyl substitution;
R 3 is-N (R) 4 )R 5 、-OR 6 or-SR 6 ；
R 4 Is C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl;
R 5 is H, C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl;
R 6 is hydrogen, C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl or C 6 -C 10 An aryl group;
x is 0, 1 or 2; and is also provided with
Wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, alkylene, alkenylene, cycloalkylene, and cycloalkenylene is independently optionally substituted.
In one embodiment, the compound is a compound of table 02-1, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
Table 02-1.
Lipid series 03
In one embodiment, provided herein are compounds of formula (03-I):
Or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
G 1 and G 2 Each independently is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene group, wherein G 1 And G 2 One or more of-CH 2 -optionally via-O-substitution;
each L 1 Independently is-OC (=o) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-NR a P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 (4-to 8-membered heterocyclylene) -R 1 Or R is 1 ；
Each L 2 Independently is-OC (=o) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-NR d P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 (4-to 8-membered heterocyclylene) -R 2 Or R is 2 ；
R 1 And R is 2 Each independently is C 6 -C 24 Alkyl or C 6 -C 24 Alkenyl groups;
R a 、R b 、R d and R is e Each independently is H, C 1 -C 24 Alkyl or C 2 -C 24 Alkenyl groups;
R c and R is f Each independently is C 1 -C 24 Alkyl or C 2 -C 24 Alkenyl groups;
G 3 is C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene in which a part or all of the alkylene or alkenylene groups are optionally substituted by C 3 -C 8 Cycloalkylene, C 3 -C 8 Cycloalkenyl ene, C 3 -C 8 Cycloalkynylene, 4-to 8-membered heterocyclylene, C 6 -C 10 Arylene or 5 to 10 membered heteroarylene substitution;
R 3 is hydrogen, C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 2 -C 12 Alkynyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 3 -C 8 Cycloalkynyl, 4-to 8-membered heterocyclyl, C 6 -C 10 Aryl or 5 to 10 membered heteroaryl; or R is 3 、G 1 Or G 1 Together with the nitrogen to which they are attached, form a cyclic moiety; or R is 3 、G 3 Or G 3 Together with the nitrogen to which they are attached, form a cyclic moiety;
R 4 Is C 1 -C 12 Alkyl or C 3 -C 8 Cycloalkyl;
x is 0, 1 or 2;
n is 1 or 2;
m is 1 or 2; and is also provided with
Wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenyl, cycloalkynylene, heterocyclylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound of table 03-1, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
Table 03-1.
Lipid series 04
In one embodiment, provided herein are compounds of formula (04-I):
or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein:
G 1 and G 2 Each independently is a bond, C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
L 1 is-OC (=O) R 1 、-C(＝O)OR 1 、-OC(＝O)OR 1 、-C(＝O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(＝O)SR 1 、-SC(＝O)R 1 、-NR a C(＝O)R 1 、-C(＝O)NR b R c 、-NR a C(＝O)NR b R c 、-OC(＝O)NR b R c 、-NR a C(＝O)OR 1 、-SC(＝S)R 1 、-C(＝S)SR 1 、-C(＝S)R 1 、-CH(OH)R 1 、-P(＝O)(OR b )(OR c )、-(C 6 -C 10 Arylene) -R 1 (6-to 10-membered heteroarylene) -R 1 Or R is 1 ；
L 2 is-OC (=O) R 2 、-C(＝O)OR 2 、-OC(＝O)OR 2 、-C(＝O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(＝O)SR 2 、-SC(＝O)R 2 、-NR d C(＝O)R 2 、-C(＝O)NR e R f 、-NR d C(＝O)NR e R f 、-OC(＝O)NR e R f 、-NR d C(＝O)OR 2 、-SC(＝S)R 2 、-C(＝S)SR 2 、-C(＝S)R 2 、-CH(OH)R 2 、-P(＝O)(OR e )(OR f )、-(C 6 -C 10 Arylene) -R 2 (6-to 10-membered heteroarylene) -R 2 Or R is 2 ；
R 1 And R is 2 Each independently is C 5 -C 32 Alkyl or C 5 -C 32 Alkenyl groups;
R a 、R b 、R d and R is e Each independently is H, C 1 -C 24 Alkyl or C 2 -C 24 Alkenyl groups;
R c and R is f Each independently is C 1 -C 32 Alkyl or C 2 -C 32 Alkenyl groups;
R 0 is C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl;
G 3 Is C 2 -C 12 Alkylene or C 2 -C 12 Alkenylene;
R 4 is C 1 -C 12 Alkyl, C 2 -C 12 Alkenyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl;
R 5 is C 1 -C 12 Alkyl, C 3 -C 8 Cycloalkyl, C 3 -C 8 Cycloalkenyl, C 6 -C 10 Aryl or 4-to 8-membered heterocycloalkyl;
x is 0, 1 or 2;
s is 0 or 1; and is also provided with
Wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, alkylene, alkenylene, arylene, and heteroarylene is independently optionally substituted.
In one embodiment, the compound is a compound of table 04-1, or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof.
Table 04-1.
6.4.2 other ionizable lipids
As described herein, in some embodiments, nanoparticle compositions provided herein comprise one or more charged or ionizable lipids in addition to the lipids of the series 01, 02, 03, and 04, e.g., according to formulas 01-I, 01-II, 02-I, 03-I, and 04-I (and sub-formulae thereof). Without being bound by theory, it is expected that certain charged or zwitterionic lipid components of the nanoparticle composition are similar to the lipid components in the cell membrane, thereby improving cellular uptake of the nanoparticles. Exemplary charged or ionizable lipids that may form part of the nanoparticle compositions of the present invention include, but are not limited to, 3- (didodecylamino) -N1, 4-tris (dodecyl) -1-piperazineethylamine (KL 10), N1- [2- (didodecylamino) -1, 4-piperazinedieethylamine (KL 22), 14, 25-ditridecyl-15,18,21,24-tetraaza-trioctadecyl-amine (KL 25), 1, 2-dioleyloxy-N, N-dimethylaminopropane (DLinDMA), 2-dioleyl-4-dimethylaminomethyl- [1,3] -dioxolane (DLin-K-DMA), heptadec-6,9,28,31-tetraen-19-yl 4- (dimethylamino) butyrate (DLin-MC 3-DMA), 2-dioleyl-4- (2-dimethylaminoethyl) - [1,3] -dioxolane (DLin-KC 2-DMA), 1, 2-dioleyloxy-4-dimethylaminomethyl- [1,3] -dioleyl-4- [ (DLin-K-DMA), 2-dioleyl-4- (2-dimethylaminoethyl) - [1,3] -dioleyl-2- (-dioleyl-N-2-dioleyl-N-4-dioleyl-N-4- (. Beta.3-di-methyl) 2-dioleyl-N-dioride, n-dimethyl-3- [ (9Z, 12Z) -octadec-9, 12-dien-1-yloxy ] propan-1-amine (octyl-CLinDMA), (2R) -2- ({ 8- [ (3 beta) -cholest-5-en-3-yloxy ] octyl } oxy) -N, N-dimethyl-3- [ (9Z, 12Z) -octadec-9, 12-dien-1-yloxy ] propan-1-amine (octyl-CLinDMA (2R)), (2S) -2- ({ 8- [ (3 beta) -cholest-5-en-3-yloxy ] octyl } oxy) -N, N-dimethyl-3- [ (9Z-, 12Z) -octadec-9, 12-dien-1-yloxy ] propan-1-amine (octyl-CLinDMA (2S)), (12Z, 15Z) -N, N-dimethyl-2-nonyldi undec-12, 15-dien-1-amine, N-dimethyl-1-octylcyclopropyl-8-heptadecan-2-octyl-1-amine. Additional exemplary charged or ionizable lipids that may form part of the nanoparticle compositions of the present invention include those described in Sabnis et al, "A Novel Amino Lipid Series for mRNA Delivery: improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human matrices", molecular Therapy, volume 26, stage 6, 2018 (e.g., lipid 5), which is incorporated herein by reference in its entirety.
In some embodiments, suitable cationic lipids include N- [1- (2, 3-dioleyloxy) propyl chloride]-N, N-trimethylammonium (DOTMA); chlorinated N- [1- (2, 3-dioleoyloxy) propyl]-N, N-trimethylammonium (DOTAP); 1, 2-dioleoyl-sn-glycero-3-ethylPhosphorylcholine (DOEPC); 1, 2-dilauroyl-sn-glycero-3-ethyl phosphorylcholine (DLEPC); 1, 2-dimyristoyl-sn-glycero-3-ethyl phosphorylcholine (DMEPC); 1, 2-dimyristoyl-sn-glycero-3-ethyl phosphorylcholine (14:1); n1- [2- ((1S) -1- [ (3-aminopropyl) amino)]-4- [ bis (3-amino-propyl) amino group]Butyl carboxamide) ethyl]-3, 4-bis [ oleyloxy ]]-benzamide (MVL 5); dioctadecylamido-glycyl spermidine (DOGS); 3b- [ N- (N ', N' -dimethylaminoethyl) carbamoyl]Cholesterol (DC-Chol); dioctadecyl Dimethyl Ammonium Bromide (DDAB); SAINT-2, n-methyl-4- (dioleyl) methylpyridinium; 1, 2-dimyristoxypropyl-3-dimethylhydroxyethylammonium bromide (dmrii); 1, 2-dioleoyl-3-dimethyl-hydroxyethylammonium bromide (dorrie); 1, 2-dioleoyloxypropyl-3-dimethylhydroxyethyl ammonium chloride (DORI); dialkylated amino acids (DILA) 2 ) (e.g., C18:1-norArg-C16); dioleyldimethylammonium chloride (DODAC); 1-palmitoyl-2-oleoyl-sn-glycero-3-ethyl phosphorylcholine (poe pc); 1, 2-dimyristoyl-sn-glycero-3-ethyl phosphorylcholine (MOEPC); dioleate (R) -5- (dimethylamino) pentane-1, 2-diyl ester hydrochloride (DODAPEN-Cl); dioleate (R) -5-guanidinopentane-1, 2-diyl ester hydrochloride (DOPen-G); (R) -N, N, N-trimethyl-4, 5-bis (oleoyloxy) pentan-1-aminium chloride (DOTAPEN). Cationic lipids having a head group charged at physiological pH values are also suitable, such as primary amines (e.g., DODAG N ', N' -dioctadecyl-N-4, 8-diaza-10-aminodecanoylglycinamide) and guanidinium head groups (e.g., bis-guanidinium-spermidine-cholesterol (BGSC), bis-guanidinium-tren-cholesterol (BGTC), PONA and dioleate (R) -5-guanidinium-1, 2-diyl ester hydrochloride (DOPen-G)). Another suitable cationic lipid is dioleate (R) -5- (dimethylamino) pentane-1, 2-diyl ester hydrochloride (DODAPEN-Cl). In certain embodiments, the cationic lipids are in specific enantiomer or racemic forms, and include various salt forms (e.g., chloride or sulfate) of the cationic lipids described above. For example, in some embodiments, the cationic lipid is N- [1- (2, 3-dioleoyloxy) propyl chloride ]-N, N, N-trimethylammonium (DOTAP-Cl) or N- [1- (2, 3-dioleoyloxy) propyl sulfate]-N, N-trimethylammonium (DOTAP-sulfate).In some embodiments, the cationic lipid is an ionizable cationic lipid, such as Dioctadecyl Dimethyl Ammonium Bromide (DDAB); 1, 2-dioleyloxy-3-dimethylaminopropane (DLinDMA); 2, 2-Di-lino-4- (2-dimethylaminoethyl) - [1,3 ]]-dioxolane (DLin-KC 2-DMA); thirty-seven carbon-6,9,28,31-tetraen-19-yl 4- (dimethylamino) butyrate (DLin-MC 3-DMA); 1, 2-dioleoyloxy-3-dimethylaminopropane (DODAP); 1, 2-dioleyloxy-3-dimethylaminopropane (DODMA); morpholinyl cholesterol (Mo-CHOL). In certain embodiments, the lipid nanoparticle comprises a combination of two or more cationic lipids (e.g., two or more of the cationic lipids described above).
Furthermore, in some embodiments, the charged or ionizable lipid that may form part of the nanoparticle compositions of the present invention is a lipid comprising a cyclic amine group. Additional cationic lipids suitable for the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of each being incorporated herein by reference in their entirety. Furthermore, in some embodiments, the charged or ionizable lipid that may form part of the nanoparticle compositions of the present invention is a lipid comprising a cyclic amine group. Additional cationic lipids suitable for the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of each being incorporated herein by reference in their entirety.
6.4.3 Polymer-bound lipids
In some embodiments, the lipid component of the nanoparticle composition may comprise one or more polymer-bound lipids, such as pegylated lipids (PEG lipids). Without being bound by theory, it is expected that the polymer-bound lipid component in the nanoparticle composition may improve colloidal stability and/or reduce protein absorption of the nanoparticle. Exemplary polymer-bound lipids that can be used in conjunction with the present disclosure include, but are not limited to, PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, the PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, ceramide-PEG 2000, or Chol-PEG2000.
In one embodiment, the polymer-bound lipid is a pegylated lipid. For example, some embodiments include polyethylene glycol diacylglycerols (PEG-DAG), such as 1- (monomethoxy-polyethylene glycol) -2, 3-dimyristoylglycerol (PEG-DMG); polyethylene glycol phosphatidylethanolamine (PEG-PE); PEG succinyl glycerol (PEG-S-DAG) such as 4-O- (2 ',3' -di (tetradecyloxy) propyl-1-O- (omega-methoxy (polyethoxy) ethyl) succinate (PEG-S-DMG), polyethylene glycol ceramide (PEG-cer), or PEG dialkoxypropyl carbamate such as omega-methoxy (polyethoxy) ethyl-N- (2, 3-di (tetradecyloxy) propyl) carbamate or 2, 3-di (tetradecyloxy) propyl-N- (omega-methoxy) (polyethoxy) ethyl) carbamate.
In one embodiment, the polymer-bound lipid is present at a concentration in the range of 1.0mol% to 2.5 mol%. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.7 mol%. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mol%.
In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 35:1 to about 25:1. In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 100:1 to about 20:1.
In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 35:1 to about 25:1. In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 100:1 to about 20:1.
In one embodiment, the pegylated lipid has the formula:
or a pharmaceutically acceptable salt, tautomer, or stereoisomer thereof, wherein:
R 12 and R is 13 Each independently is a linear or branched saturated or unsaturated alkyl chain containing from 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester linkages; and is also provided with
w has an average value in the range of 30 to 60.
In one embodiment, R 12 And R is 13 Each independently is a straight saturated alkyl chain containing from 12 to 16 carbon atoms. In other embodiments, the w average value is in the range of 42 to 55, e.g., the w average value is 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55. In some embodiments, w average is about 49.
In one embodiment, the pegylated lipid has the formula:
wherein w average is about 49.
The polymer-bound lipids also include the following lipid series 05 (and its subformulae).
Lipid series 05
In one embodiment, provided herein are compounds of formula (05-I):
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
l is a lipid;
x is a linker;
each R 3 Independently H or C 1 -C 6 An alkyl group;
each Y 1 Independently is a bond, O, S or NR a ；
Each G 4 Independently is a bond or C 1 -C 12 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -S-or-NR a -substitution;
each G 5 Independently is a bond or C 1 -C 12 Alkylene groups, wherein one or more-CH 2 -independently optionally via-O-, -S-or-NR a -substitution;
each R a H, C independently 1 -C 12 Alkyl or C 2 -C 12 Alkenyl groups;
Z 1 and Z 2 One of which is a positively charged moiety, and Z 1 And Z 2 The other of which is a negatively charged moiety;
n is an integer from 2 to 100;
t is hydrogen, halogen, alkyl, alkenyl, -OR ', -SR', -COOR ', -OCOR', -NR 'R', -N + (R”) 3 、-P + (R”) 3 -S-C (=s) -S-R ", -S-C (=s) -O-R", -S-C (=s) -NR "R", -S-C (=s) -aryl, cyano, azido, aryl, heteroaryl, or a targeting group, wherein R "is independently hydrogen or alkyl at each occurrence; and is also provided with
Wherein each alkyl, alkenyl, alkylene, aryl, and heteroaryl is independently optionally substituted. It is to be understood that in this specification, combinations of the various substituents and/or variables depicted are permissible only if such contributions result in stable compounds.
6.4.4 structural lipids
In some embodiments, the lipid component of the nanoparticle composition may comprise one or more structural lipids. Without being bound by theory, it is expected that the structural lipids may stabilize the amphiphilic structure of the nanoparticle, such as, but not limited to, the lipid bilayer structure of the nanoparticle. Exemplary structural lipids that can be used in connection with the present disclosure include, but are not limited to, cholesterol, fecal sterols, sitosterols, ergosterols, campesterols, stigmasterols, brassicasterol, lycorine, lycoside, ursolic acid, alpha-tocopherol, and mixtures thereof. In certain embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipids include cholesterol and corticosteroids such as prednisolone (prednisolone), dexamethasone (dexamethasone), prednisone (prednisone), and hydrocortisone (hydrocortisone), or combinations thereof.
In one embodiment, the lipid nanoparticle provided herein comprises a steroid or steroid analogue. In one embodiment, the steroid or steroid analogue is cholesterol. In one embodiment, the steroid is present at a concentration in the range of 39mol% to 49mol%, 40mol% to 46mol%, 40mol% to 44mol%, 40mol% to 42mol%, 42mol% to 44mol%, or 44mol% to 46 mol%. In one embodiment, the steroid is present at a concentration of 40mol%, 41mol%, 42mol%, 43mol%, 44mol%, 45mol% or 46 mol%.
In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol is in the range of about 5:1 to 1:1. In one embodiment, the steroid is present at a concentration in the range of 32mol% to 40mol% steroid.
In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol is in the range of about 5:1 to 1:1. In one embodiment, the steroid is present at a concentration in the range of 32mol% to 40mol% steroid.
6.4.5 Phospholipids
In some embodiments, the lipid component of the nanoparticle composition may comprise one or more phospholipids, such as one or more (poly) unsaturated lipids. Without being bound by theory, it is contemplated that phospholipids may assemble into one or more lipid bilayer structures. Exemplary phospholipids that may form part of the nanoparticle compositions of the present invention include, but are not limited to, 1, 2-distearoyl-sn-glycero-3-phosphorylcholine (DSPC), 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (DLPC), 1, 2-dimyristoyl-sn-glycero-phosphorylcholine (DMPC), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (DOPC), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (DPPC), 1, 2-di (undecoyl) -sn-glycero-phosphorylcholine (DUPC), 1, 2-di (undecoyl) -sn-glycero-3-phosphorylcholine (ocpc), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphorylcholine (POPC), 1, 2-dioleoyl-sn-glycero-3-phosphorylcholine (18:, 1, 2-di-arachidonyl-sn-glycero-3-phosphorylcholine, 1, 2-di (docosahexaenoic acid) -sn-glycero-3-phosphorylcholine, 1, 2-di-phytanic acid-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1, 2-distearoyl-sn-glycero-3-phosphoethanolamine, 1, 2-di-oleoyl-sn-glycero-3-phosphoethanolamine, 1, 2-di-linolenoyl-sn-glycero-3-phosphoethanolamine, 1, 2-di-arachidonyl-sn-glycero-3-phosphoethanolamine, 1, 2-di (docosahexaenoic acid) -sn-glycero-3-phosphoethanolamine, 1, 2-dioleoyl-sn-glycero-3-phospho-racemic- (1-glycero) sodium salt (DOPG), and sphingomyelin. In certain embodiments, the nanoparticle composition comprises DSPC. In certain embodiments, the nanoparticle composition comprises DOPE. In some embodiments, the nanoparticle composition comprises both DSPC and DOPE.
Additional exemplary neutral lipids include, for example, dipalmitoyl phosphatidylglycerol (DPPG), palmitoyl Oleoyl Phosphatidylethanolamine (POPE), and dioleoyl phosphatidylethanolamine 4- (N-maleimidomethyl) -cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl phosphatidylethanolamine (SOPE), and 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (trans-DOPE). In one embodiment, the neutral lipid is 1, 2-distearoyl-sn-glycero-3-phosphorylcholine (DSPC). In one embodiment, the neutral lipid is selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM.
In one embodiment, the neutral lipid is Phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidic Acid (PA), or Phosphatidylglycerol (PG).
In addition, phospholipids that may form part of the nanoparticle compositions of the present invention also include those described in WO2017/112865, the entire contents of which are incorporated herein by reference.
6.4.6 formulations
According to the present disclosure, nanoparticle compositions described herein can comprise at least one lipid component and one or more additional components, such as therapeutic and/or prophylactic agents (e.g., therapeutic nucleic acids described herein). Nanoparticle compositions can be designed for one or more specific applications or targets. The components of the nanoparticle composition can be selected based on the particular application or target, and/or based on the efficacy, toxicity, cost, ease of use, availability, or other characteristics of one or more of the components. Similarly, the particular formulation of the nanoparticle composition can be selected for a particular application or target, depending on, for example, the efficacy and toxicity of the particular combination of each component.
The lipid component of the nanoparticle composition may comprise, for example, a lipid of one of the series 01, 02, 03, and 04 described herein, e.g., a lipid according to one of the formulas 01-I, 01-II, 02-I, 03-I, and 04-I (and its subformulae), a phospholipid (such as an unsaturated lipid, e.g., DOPE or DSPC), a PEG lipid, and a structural lipid. The ingredients of the lipid component may be provided at specific fractions.
In one embodiment, provided herein are nanoparticle compositions comprising a cationic or ionizable lipid compound provided herein, a therapeutic agent, and one or more excipients. In one embodiment, the cationic or ionizable lipid compound comprises a compound of one of the series 01, 02, 03, and 04 as described herein, e.g., a compound according to one of the formulas 01-I, 01-II, 02-I, 03-I, and 04-I (and sub-formulae thereof), and optionally one or more other ionizable lipid compounds. In one embodiment, the one or more excipients are selected from neutral lipids, steroids, and polymer-bound lipids. In one embodiment, the therapeutic agent is encapsulated within or associated with the lipid nanoparticle.
In one embodiment, provided herein is a nanoparticle composition (lipid nanoparticle) comprising:
i) Between 40mol% and 50mol% of cationic lipids;
ii) neutral lipids;
iii) A steroid;
iv) polymer-bound lipids; and
v) a therapeutic agent.
As used herein, "mol%" refers to the mole percent of a component relative to the total moles of all lipid components in the LNP (i.e., the total moles of cationic lipid, neutral lipid, steroid, and polymer-bound lipid).
In one embodiment, the lipid nanoparticle comprises 41mol% to 49mol%, 41mol% to 48mol%, 42mol% to 48mol%, 43mol% to 48mol%, 44mol% to 48mol%, 45mol% to 48mol%, 46mol% to 48mol%, or 47.2mol% to 47.8mol% of the cationic lipid. In one embodiment, the lipid nanoparticle comprises about 47.0mol%, 47.1mol%, 47.2mol%, 47.3mol%, 47.4mol%, 47.5mol%, 47.6mol%, 47.7mol%, 47.8mol%, 47.9mol%, or 48.0mol% cationic lipid.
In one embodiment, the neutral lipid is present at a concentration in the range of 5mol% to 15mol%, 7mol% to 13mol%, or 9mol% to 11 mol%. In one embodiment, the neutral lipid is present at a concentration of about 9.5mol%, 10mol%, or 10.5 mol%. In one embodiment, the molar ratio of cationic lipid to neutral lipid is in the range of about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.
In one embodiment, the steroid is present at a concentration in the range of 39mol% to 49mol%, 40mol% to 46mol%, 40mol% to 44mol%, 40mol% to 42mol%, 42mol% to 44mol%, or 44mol% to 46 mol%. In one embodiment, the steroid is present at a concentration of 40mol%, 41mol%, 42mol%, 43mol%, 44mol%, 45mol% or 46 mol%. In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2 or 1.0:1.0 to 1.0:1.2. In one embodiment, the steroid is cholesterol.
In one embodiment, the therapeutic to lipid ratio in the LNP (i.e., N/P, where N represents the moles of cationic lipid and P represents the moles of phosphate present as part of the nucleic acid backbone) is in the range of 2:1 to 30:1, e.g., 3:1 to 22:1. In one embodiment, N/P is in the range of 6:1 to 20:1 or 2:1 to 12:1. Exemplary N/P ranges include about 3:1, about 6:1, about 12:1, and about 22:1.
In one embodiment, provided herein are lipid nanoparticles comprising:
i) A cationic lipid having an effective pKa greater than 6.0;
ii) 5 to 15mol% neutral lipid;
iii) 1mol% to 15mol% of an anionic lipid;
iv) 30 to 45 mole% of a steroid;
v) polymer-bound lipids; and
vi) a therapeutic agent or a pharmaceutically acceptable salt or prodrug thereof,
wherein mol% is determined based on the total moles of lipids present in the lipid nanoparticle.
In one embodiment, the cationic lipid may be any of a variety of lipid species that carry a net positive charge at a selected pH (such as physiological pH). Exemplary cationic lipids are described below. In one embodiment, the cationic lipid has a pKa greater than 6.25. In one embodiment, the cationic lipid has a pKa greater than 6.5. In one embodiment, the cationic lipid has a pKa greater than 6.1, greater than 6.2, greater than 6.3, greater than 6.35, greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6, greater than 6.65, or greater than 6.7.
In one embodiment, the lipid nanoparticle comprises 40mol% to 45mol% cationic lipid. In one embodiment, the lipid nanoparticle comprises 45mol% to 50mol% cationic lipid.
In one embodiment, the molar ratio of cationic lipid to neutral lipid is in the range of about 2:1 to about 8:1. In one embodiment, the lipid nanoparticle comprises 5mol% to 10mol% neutral lipid.
Exemplary anionic lipids include, but are not limited to, phosphatidylglycerol, dioleoyl phosphatidylglycerol (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), or 1, 2-distearoyl-sn-glycerol-3-phosphate- (1' -rac-glycerol) (DSPG).
In one embodiment, the lipid nanoparticle comprises 1mol% to 10mol% of anionic lipid. In one embodiment, the lipid nanoparticle comprises 1mol% to 5mol% anionic lipid. In one embodiment, the lipid nanoparticle comprises 1mol% to 9mol%, 1mol% to 8mol%, 1mol% to 7mol%, or 1mol% to 6mol% of the anionic lipid. In one embodiment, the molar ratio of anionic lipid to neutral lipid is in the range of 1:1 to 1:10.
In one embodiment, the steroid is cholesterol. In one embodiment, the molar ratio of cationic lipid to cholesterol is in the range of about 5:1 to 1:1. In one embodiment, the lipid nanoparticle comprises 32mol% to 40mol% of a steroid.
In one embodiment, the sum of the mole% of neutral lipids and the mole% of anionic lipids is in the range of 5 mole% to 15 mole%. In one embodiment, wherein the sum of the mole% of neutral lipids and the mole% of anionic lipids is in the range of 7 mole% to 12 mole%.
In one embodiment, the molar ratio of anionic lipid to neutral lipid is in the range of 1:1 to 1:10. In one embodiment, the sum of the mole% of neutral lipids and the mole% of steroids is in the range of 35 mole% to 45 mole%.
In one embodiment, the lipid nanoparticle comprises:
i) 45mol% to 55mol% of a cationic lipid;
ii) 5 to 10mol% neutral lipid;
iii) 1 to 5mol% of an anionic lipid; and
iv) 32 to 40 mole% of a steroid.
In one embodiment, the lipid nanoparticle comprises 1.0mol% to 2.5mol% of the bound lipid. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mol%.
In one embodiment, the neutral lipid is present at a concentration in the range of 5mol% to 15mol%, 7mol% to 13mol%, or 9mol% to 11 mol%. In one embodiment, the neutral lipid is present at a concentration of about 9.5mol%, 10mol%, or 10.5 mol%. In one embodiment, the molar ratio of cationic lipid to neutral lipid is in the range of about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.
In one embodiment, the steroid is cholesterol. In some embodiments, the steroid is present at a concentration in the range of 39mol% to 49mol%, 40mol% to 46mol%, 40mol% to 44mol%, 40mol% to 42mol%, 42mol% to 44mol%, or 44mol% to 46 mol%. In one embodiment, the steroid is present at a concentration of 40mol%, 41mol%, 42mol%, 43mol%, 44mol%, 45mol% or 46 mol%. In certain embodiments, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2 or 1.0:1.0 to 1.0:1.2.
In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 5:1 to 1:1.
In one embodiment, the lipid nanoparticle comprises 1.0mol% to 2.5mol% of the bound lipid. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mol%.
In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 100:1 to about 20:1. In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 35:1 to about 25:1.
In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 100:1 to about 20:1. In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 35:1 to about 25:1.
In one embodiment, the lipid nanoparticle has an average diameter in the range of 50nm to 100nm or 60nm to 85 nm.
In one embodiment, the composition comprises a cationic lipid, DSPC, cholesterol, and PEG-lipid as provided herein, and mRNA. In one embodiment, the cationic lipid, DSPC, cholesterol, and PEG-lipid provided herein are in a molar ratio of 50:10:38.5:1.5.
Nanoparticle compositions can be designed for one or more specific applications or targets. For example, nanoparticle compositions can be designed for delivery of therapeutic and/or prophylactic agents, such as RNA, to a particular cell, tissue, organ or system or group thereof in a mammal. The physicochemical properties of the nanoparticle composition can be altered to increase selectivity for a particular body target. For example, particle size may be adjusted based on fenestration size of different organs. The therapeutic and/or prophylactic agents included in the nanoparticle composition may also be selected based on one or more desired delivery targets. For example, a therapeutic and/or prophylactic agent may be selected for a particular indication, disorder, disease, or condition and/or for delivery to a particular cell, tissue, organ, or system or group thereof (e.g., local or specific delivery). In certain embodiments, the nanoparticle composition can comprise an mRNA encoding a polypeptide of interest, which is capable of translation within a cell to produce the polypeptide of interest. Such compositions may be designed to specifically deliver to a particular organ. In certain embodiments, the composition may be designed for specific delivery to the liver of a mammal.
The amount of therapeutic and/or prophylactic agent in the nanoparticle composition can depend on the size, composition, desired target and/or application, or other characteristics of the nanoparticle composition, as well as the characteristics of the therapeutic and/or prophylactic agent. For example, the amount of RNA that can be used in the nanoparticle composition can depend on the size, sequence, and other characteristics of the RNA. The relative amounts of therapeutic and/or prophylactic agents and other ingredients (e.g., lipids) in the nanoparticle composition can also vary. In some embodiments, the wt/wt ratio of lipid component to therapeutic and/or prophylactic agent in the nanoparticle composition can be about 5:1 to about 60:1, such as about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 22:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. For example, the wt/wt ratio of lipid component to therapeutic and/or prophylactic agent may be about 10:1 to about 40:1. In certain embodiments, the wt/wt ratio is about 20:1. The amount of therapeutic and/or prophylactic agent in the nanoparticle composition can be measured, for example, using absorption spectroscopy (e.g., ultraviolet-visible spectroscopy).
In some embodiments, the nanoparticle composition comprises one or more RNAs, and the one or more RNAs, lipids, and amounts thereof can be selected to provide a particular N: P ratio. The N: P ratio of the composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in the RNA. In some embodiments, a lower N to P ratio is selected. The one or more RNAs, lipids, and amounts thereof may be selected to provide an N to P ratio of about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In certain embodiments, the N to P ratio may be from about 2:1 to about 8:1. In other embodiments, the N to P ratio is from about 5:1 to about 8:1. For example, the N to P ratio may be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0:1. For example, the N to P ratio may be about 5.67:1.
The physical properties of the nanoparticle composition may depend on its components. For example, nanoparticle compositions comprising cholesterol as a structural lipid may have different characteristics than nanoparticle compositions comprising a different structural lipid. Similarly, the characteristics of a nanoparticle composition may depend on the absolute or relative amounts of its components. For example, nanoparticle compositions comprising higher mole fractions of phospholipids may have different characteristics than nanoparticle compositions comprising lower mole fractions of phospholipids. The characteristics may also vary depending on the method and conditions of preparation of the nanoparticle composition.
Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the nanoparticle composition. Zeta potential can be measured using dynamic light scattering or potentiometry (e.g., potentiometry). Dynamic light scattering can also be used to determine particle size. An instrument such as Zetasizer Nano ZS (Malvem Instruments Ltd, malvem, worcestershire, UK) can also be used to measure various characteristics of the nanoparticle composition such as particle size, polydispersity index, and zeta potential.
In various embodiments, the average size of the nanoparticle composition may be between tens of nanometers and hundreds of nanometers. For example, the average size may be about 40nm to about 150nm, such as about 40nm, 45nm, 50nm, 55nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm, 105nm, 110nm, 115nm, 120nm, 125nm, 130nm, 135nm, 140nm, 145nm, or 150nm. In some embodiments, the nanoparticle composition can have an average size of about 50nm to about 100nm, about 50nm to about 90nm, about 50nm to about 80nm, about 50nm to about 70nm, about 50nm to about 60nm, about 60nm to about 100nm, about 60nm to about 90nm, about 60nm to about 80nm, about 60nm to about 70nm, about 70nm to about 100nm, about 70nm to about 90nm, about 70nm to about 80nm, about 80nm to about 100nm, about 80nm to about 90nm, or about 90nm to about 100nm. In certain embodiments, the nanoparticle composition can have an average size of about 70nm to about 100nm. In some embodiments, the average size may be about 80nm. In other embodiments, the average size may be about 100nm.
The nanoparticle composition can be relatively homogeneous. The polydispersity index may be used to indicate the homogeneity of the nanoparticle composition, such as the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The nanoparticle composition can have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the nanoparticle composition can have a polydispersity index of about 0.10 to about 0.20.
The zeta potential of the nanoparticle composition can be used to indicate the zeta potential of the composition. For example, the zeta potential may describe the surface charge of the nanoparticle composition. Nanoparticle compositions having relatively low positive or negative charges are generally desirable because the higher charged species can undesirably interact with cells, tissues, and other components in the body. In some embodiments, the zeta potential of the nanoparticle composition may be from about-10 to about +20mV, from about-10 to about +15mV, from about-10 to about +10mV, from about-10 to about +5mV, from about-10 to about 0mV, from about-10 to about-5 mV, from about-5 to about +20mV, from about-5 to about +15mV, from about-5 to about +10mV, from about-5 to about +5mV, from about-5 to about 0mV, from about 0 to about +20mV, from about 0 to about +15mV, from about 0 to about +10mV, from about 0 to about +5mV, from about +5 to about +20mV, from about +5 to about +15mV, or from about +5 to about +10mV.
Encapsulation efficiency of a therapeutic and/or prophylactic agent describes the amount of therapeutic and/or prophylactic agent that is encapsulated or otherwise associated with a nanoparticle composition after preparation relative to the initial amount provided. Encapsulation efficiency is desirably high (e.g., near 100%). Encapsulation efficiency may be measured, for example, by comparing the amount of therapeutic and/or prophylactic agent in a solution containing the nanoparticle composition before and after disruption of the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and/or prophylactic agent (e.g., RNA) in a solution. For nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and/or prophylactic agent can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.
The nanoparticle composition may optionally comprise one or more coatings. For example, the nanoparticle composition can be formulated as a capsule, film or tablet with a coating. Capsules, films or tablets comprising the compositions described herein may be of any useful size, tensile strength, hardness or density.
6.4.7 pharmaceutical composition
Nanoparticle compositions according to the present disclosure may be formulated in whole or in part as pharmaceutical compositions. The pharmaceutical composition may comprise one or more nanoparticle compositions. For example, the pharmaceutical composition may comprise one or more nanoparticle compositions comprising one or more different therapeutic and/or prophylactic agents. The pharmaceutical composition may also comprise one or more pharmaceutically acceptable excipients or auxiliary ingredients, such as those described herein. General guidelines for the formulation and manufacture of pharmaceutical compositions and agents can be found, for example, in Remington, the Science and Practice of Pharmacy, 21 st edition, a.r. gennaro; obtained in Lippincott, williams & Wilkins, baltimore, md., 2006. Conventional excipients and adjunct ingredients can be used in any pharmaceutical composition unless any conventional excipient or adjunct ingredient is incompatible with one or more components of the nanoparticle composition. The excipient or adjunct ingredient is incompatible with the components of the nanoparticle composition if the combination of the excipient or adjunct ingredient and the components of the nanoparticle composition can cause any undesirable biological or other deleterious effects.
In some embodiments, one or more excipients or adjunct ingredients can comprise greater than 50% of the total mass or volume of the pharmaceutical composition comprising the nanoparticle composition. For example, one or more excipients or adjunct ingredients can constitute 50%, 60%, 70%, 80%, 90% or higher percent of the pharmaceutical composition. In some embodiments, the pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% pure. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the U.S. food and drug administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopeia (USP), the European Pharmacopeia (EP), the british pharmacopeia, and/or the international pharmacopeia.
The relative amounts of one or more nanoparticle compositions, one or more pharmaceutically acceptable excipients, and/or any additional ingredients in the pharmaceutical compositions according to the present disclosure will vary depending on the identity, constitution, and/or condition of the subject being treated and further depending on the route of administration of the composition. For example, the pharmaceutical composition may comprise between 0.1% and 100% (wt/wt) of one or more nanoparticle compositions.
In certain embodiments, nanoparticle compositions and/or pharmaceutical compositions of the present disclosure are stored and/or transported (e.g., stored at a temperature of 4 ℃ or less, such as between about-150 ℃ and about 0 ℃ or between about-80 ℃ and about-20 ℃ (e.g., about-5 ℃, -10 ℃, -15 ℃, -20 ℃, -25 ℃, -30 ℃, -40 ℃, -50 ℃, -60 ℃, -70 ℃, -80 ℃, -90 ℃, -130 ℃, or-150 ℃)) by refrigeration or freezing. For example, a pharmaceutical composition comprising a compound of any of the series 01, 02, 03 and 04, e.g., a compound of any of the formulas 01-I, 01-II, 02-I, 03-I and 04-I (and sub-formulae thereof), is a solution that is stored and/or transported refrigerated at, e.g., about-20 ℃, 30 ℃, -40 ℃, -50 ℃, -60 ℃, -70 ℃, or-80 ℃. In certain embodiments, the present disclosure also relates to a method of increasing the stability of nanoparticle and/or pharmaceutical compositions comprising a compound of any of the series 01, 02, 03, and 04, e.g., a compound of any of the formulas 01-I, 01-II, 02-I, 03-I, and 04-I (and sub-formulae thereof), by storing the nanoparticle and/or pharmaceutical composition at 4 ℃ or less, such as a temperature between about-150 ℃ and about 0 ℃ or between about-80 ℃ and about-20 ℃, e.g., about-5 ℃, -10 ℃, -15 ℃, -20 ℃, -25 ℃, -30 ℃, -40 ℃, -50 ℃, -60 ℃, -70 ℃, -80 ℃, -90 ℃, -130 ℃, or-150 ℃. For example, nanoparticle compositions and/or pharmaceutical compositions disclosed herein are stable for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months, at a temperature of, for example, 4 ℃ or less (e.g., between about 4 ℃ and-20 ℃). In one embodiment, the formulation is stable for at least 4 weeks at about 4 ℃. In certain embodiments, the pharmaceutical compositions of the present disclosure comprise a nanoparticle composition disclosed herein and a pharmaceutically acceptable carrier selected from one or more of the following: tris, acetate (e.g., sodium acetate), citrate (e.g., sodium citrate), physiological saline, PBS, and sucrose. In certain embodiments, the pharmaceutical compositions of the present disclosure have a pH of between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or between 7.5 and 8, or between 7 and 7.8). For example, the pharmaceutical compositions of the present disclosure comprise the nanoparticle compositions disclosed herein, tris, physiological saline, and sucrose, and have a pH of about 7.5-8, which is suitable for storage and/or transport at, for example, about-20 ℃. For example, the pharmaceutical compositions of the present disclosure comprise the nanoparticle compositions disclosed herein and PBS, and have a pH of about 7-7.8, which is suitable for storage and/or transportation at, for example, about 4 ℃ or less. In the context of the present disclosure, "stability," "stabilized," and "stable" refer to nanoparticle compositions and/or pharmaceutical compositions disclosed herein that are resistant to chemical or physical changes (e.g., degradation, particle size change, aggregation, change in encapsulation, etc.) under given manufacturing, transportation, storage, and/or use conditions, for example, when stress is applied, such as shear forces, freeze/thaw stresses, and the like.
The nanoparticle composition and/or pharmaceutical composition comprising one or more nanoparticle compositions can be administered to any patient or subject, including patients or subjects who may benefit from the therapeutic effect provided by delivery of a therapeutic and/or prophylactic agent to one or more specific cells, tissues, organs or systems or groups thereof, such as the renal system. Although the description provided herein of nanoparticle compositions and pharmaceutical compositions comprising nanoparticle compositions is primarily directed to compositions suitable for administration to humans, those skilled in the art will appreciate that such compositions are generally suitable for administration to any other mammal. Improvements to compositions suitable for administration to humans in order to render the compositions suitable for administration to a variety of animals are well known and veterinary pharmacologists of ordinary skill can design and/or make such improvements by mere routine experimentation, if any. It is contemplated that subjects to which the compositions are administered include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cows, pigs, horses, sheep, cats, dogs, mice, and/or rats.
Pharmaceutical compositions comprising one or more nanoparticle compositions may be prepared by any method known in the pharmacological arts or later developed. Generally, such methods of preparation involve combining the active ingredient with excipients and/or one or more other auxiliary ingredients and then, if desired or necessary, dividing, shaping and/or packaging the product into the desired single or multi-dose units.
Pharmaceutical compositions according to the present disclosure may be prepared, packaged and/or sold in bulk, as single unit doses and/or as multiple single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition comprising a predetermined amount of an active ingredient (e.g., a nanoparticle composition). The amount of active ingredient is generally equal to the dose of active ingredient and/or a convenient portion of this dose, such as half or one third of this dose, of the subject to be administered.
Pharmaceutical compositions may be prepared in a variety of forms suitable for a variety of routes and methods of administration. For example, pharmaceutical compositions may be prepared in liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders and granules), dosage forms for topical and/or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and patches), suspensions, powders and other forms.
Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and/or elixirs. In addition to the active ingredient, the liquid dosage form may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1, 3-butylene glycol, dimethylformamide, oils (in particular, cottonseed oil, groundnut oil)Oils, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerin, tetrahydrofurfuryl alcohol, polyethylene glycols, and fatty acid esters of sorbitan, and mixtures thereof. In addition to inert diluents, the oral compositions can also include additional therapeutic and/or prophylactic agents, additional agents, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring and/or perfuming agents. In certain embodiments for parenteral administration, the composition is mixed with a solubilizing agent, such as Cremophor TM Alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers and/or combinations thereof.
Injectable formulations, such as sterile injectable aqueous or oleaginous suspensions, may be formulated according to the known art using suitable dispersing, wetting and/or suspending agents. The sterile injectable preparation may be a sterile injectable solution, suspension and/or emulsion in a non-toxic parenterally acceptable diluent and/or solvent, for example, as a solution in 1, 3-butanediol. Acceptable vehicles and solvents that may be used include water, ringer's solution (u.s.p.) and isotonic sodium chloride solution. Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono-or diglycerides. Fatty acids such as oleic acid find use in the preparation of injectables.
The injectable formulation may be sterilized, for example, by filtration through a bacterial-retaining filter, and/or by incorporating sterilizing agents in the form of sterile solid compositions which may be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
The present disclosure provides methods of delivering a therapeutic and/or prophylactic agent to a mammalian cell or organ, producing a polypeptide of interest in a mammalian cell, and treating a disease or disorder in a mammal in need thereof, the methods comprising administering to the mammal a nanoparticle composition comprising the therapeutic and/or prophylactic agent and/or contacting the mammalian cell with the nanoparticle composition.
6.5 method
In one aspect, provided herein are also methods for controlling, preventing, and treating infectious diseases caused by coronavirus infection in a subject. In some embodiments, the infectious disease controlled, prevented or treated with the methods described herein is caused by a coronavirus infection selected from the group consisting of SARS-CoV-2, severe acute respiratory syndrome coronavirus (SARS-CoV), middle east respiratory syndrome coronavirus (MERS-CoV), human coronavirus NL63 (HCoV-NL 63), human coronavirus OC43, porcine epidemic diarrhea coronavirus (PEDV), porcine transmissible gastroenteritis coronavirus (TGEV), porcine Respiratory Coronavirus (PRCV), bat coronavirus HKU4, mouse hepatitis coronavirus (MHV), bovine coronavirus (BCoV), avian infectious bronchitis coronavirus (IBV), porcine delta coronavirus (PdCV).
In particular embodiments, the infectious disease controlled, prevented or treated with the methods described herein is caused by a coronavirus infection of the respiratory system, nervous system, immune system, digestive system, and/or major organs of a subject (e.g., a human or non-human mammal). In particular embodiments, the infectious disease that is controlled, prevented or treated by the methods described herein is a respiratory tract infection, a lung infection, a kidney infection, a liver infection, an intestinal infection, a nervous system infection, a respiratory syndrome, bronchitis, pneumonia, gastroenteritis, encephalomyelitis, encephalitis, sarcoidosis, diarrhea, hepatitis or a demyelinating disease. In specific embodiments, the infectious disease is a respiratory tract infection, a lung infection, a pneumonia, or a respiratory syndrome caused by a SARS-CoV-2 infection.
In some embodiments, the methods of the invention for controlling, preventing, and treating an infectious disease caused by a coronavirus infection in a subject comprise administering to the subject a therapeutically effective amount of a therapeutic nucleic acid as described herein. In specific embodiments, the therapeutic nucleic acid is an mRNA molecule as described herein.
In some embodiments, the methods of the invention for controlling, preventing, and treating an infectious disease caused by a coronavirus infection in a subject comprise administering to the subject a therapeutically effective amount of a therapeutic composition comprising a therapeutic nucleic acid as described herein. In specific embodiments, the therapeutic nucleic acid is an mRNA molecule as described herein.
In some embodiments, the methods of the invention for controlling, preventing, and treating an infectious disease caused by a coronavirus infection in a subject comprise administering to the subject a therapeutically effective amount of a vaccine composition comprising a therapeutic nucleic acid as described herein. In specific embodiments, the therapeutic nucleic acid is an mRNA molecule as described herein.
In some embodiments, the methods of the invention for controlling, preventing, and treating an infectious disease caused by a coronavirus infection in a subject comprise administering to the subject a therapeutically effective amount of a lipid-containing composition comprising a therapeutic nucleic acid as described herein. In specific embodiments, the therapeutic nucleic acid is an mRNA molecule as described herein.
In some embodiments, the methods of the invention for controlling, preventing, and treating an infectious disease caused by a coronavirus infection in a subject comprise administering to the subject a therapeutically effective amount of a lipid-containing composition comprising a therapeutic nucleic acid as described herein, wherein the lipid-containing composition is formulated as a lipid nanoparticle encapsulating the therapeutic nucleic acid in a lipid shell. In specific embodiments, the therapeutic nucleic acid is an mRNA molecule as described herein. In particular embodiments, cells in a subject are effective to ingest lipid-containing compositions (e.g., lipid nanoparticles) described herein after administration. In particular embodiments, the lipid-containing compositions (e.g., lipid nanoparticles) described herein are endocytosed by a cell of a subject.
In some embodiments, after administration of a therapeutic nucleic acid as described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein to a subject in need thereof, cells in the subject ingest and express the administered therapeutic nucleic acid to produce a peptide or polypeptide encoded by the nucleic acid. In some embodiments, the encoded peptide or polypeptide is derived from a coronavirus that causes an infectious disease that is controlled, prevented or treated by the method.
6.5.1 immune response
In some embodiments, one or more immune responses against coronaviruses are elicited in a subject in need thereof after administration of a therapeutic nucleic acid as described herein, a vaccine composition comprising a therapeutic nucleic acid as described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid as described herein to the subject. In some embodiments, the immune response elicited comprises one or more adaptive immune responses against coronaviruses. In some embodiments, the immune response elicited includes one or more innate immune responses against coronaviruses. The one or more immune responses may be in the form of, for example, an antibody response (humoral response) or a cellular immune response such as cytokine secretion (e.g., interferon-gamma), helper activity, or cytotoxicity. In some embodiments, expression of an activation marker on an immune cell, expression of a co-stimulatory receptor on an immune cell, expression of a ligand of a co-stimulatory receptor, cytokine secretion, infiltration of an infected cell by an immune cell (e.g., a T lymphocyte, a B lymphocyte, and/or an NK cell), production of antibodies that specifically recognize one or more viral proteins (e.g., viral peptides or proteins encoded by a therapeutic nucleic acid), effector function, T cell activation, T cell differentiation, T cell proliferation, B cell differentiation, B cell proliferation, and/or NK cell proliferation. In some embodiments, activation and proliferation of bone Marrow Derived Suppressor Cells (MDSCs) and Treg cells are inhibited.
In some embodiments, upon administration of a therapeutic nucleic acid as described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein to a subject in need thereof, one or more neutralizing antibodies are produced in the subject against a coronavirus or cells infected with a coronavirus.
In particular embodiments, the neutralizing antibodies specifically bind to one or more epitopes of the S protein of the coronavirus and inhibit or reduce the function or activity of one or more S proteins. In particular embodiments, binding of the S protein to its cellular receptor is reduced or inhibited. In specific embodiments, the binding of coronavirus S protein to angiotensin converting enzyme 2 (ACE 2), aminopeptidase N (APN), dipeptidyl peptidase 4 (DPP 4), carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM 1) and/or sugar on the surface of a host cell is reduced or inhibited. In particular embodiments, the attachment of the coronavirus to a host cell in the subject is reduced or inhibited. In particular embodiments, host cell membrane fusion induced by coronavirus is reduced or inhibited. In particular embodiments, infection (e.g., entry) of a host cell in a subject by a coronavirus is reduced or inhibited. In some embodiments, neutralizing antibodies reduce the function or activity of the S protein by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100%.
In another embodiment, neutralizing antibodies are raised against a coronavirus or cells infected with a coronavirus in a subject. In particular embodiments, neutralizing antibodies specifically bind to one or more epitopes of the N protein of the coronavirus and inhibit or reduce the function or activity of one or more N proteins. In particular embodiments, the binding of the coronavirus N protein to the replicating viral genomic sequence is reduced or inhibited. In particular embodiments, packaging of the replicated viral genomic sequences into the functional viral capsid is reduced or inhibited. In particular embodiments, the propagation of surviving progeny of coronavirus is reduced or inhibited. In some embodiments, neutralizing antibodies reduce the function or activity of the S protein by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100%.
In particular embodiments, the neutralizing antibodies bind to one or more viral proteins present on the surface of a viral particle or infected cell and label the viral particle or infected cell for destruction by the immune system of the subject. In some embodiments, endocytosis of the viral particle by the white blood cells (e.g., macrophages) is induced or enhanced. In some embodiments, antibody-dependent cell-mediated cytotoxicity (ADCC) against the infected cells in the subject is induced or enhanced. In some embodiments, antibody-dependent cell phagocytosis (ADCP) is induced or enhanced in a subject against an infected cell. In some embodiments, complement Dependent Cytotoxicity (CDC) against the infected cells in the subject is induced or enhanced.
6.5.2 combination therapy
In some embodiments, the compositions of the present disclosure may further comprise one or more additional therapeutic agents. In some embodiments, the additional therapeutic agent is an adjuvant capable of enhancing the immunogenicity of the composition (e.g., a genetic vaccine). In some embodiments, the additional therapeutic agent is an immunomodulatory agent that enhances an immune response in the subject. In some embodiments, the adjuvant and therapeutic nucleic acid in the composition may have a synergistic effect in eliciting an immune response in a subject.
In some embodiments, the additional therapeutic agent and the therapeutic nucleic acid of the present disclosure may be co-formulated in one composition. For example, the additional therapeutic agent may be formulated as part of a composition comprising a therapeutic nucleic acid of the present disclosure. Alternatively, in some embodiments, the additional therapeutic agent and therapeutic nucleic acid of the present disclosure may be formulated as separate compositions or dosage units for co-administration to a subject sequentially or simultaneously.
In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated as part of a lipid-containing composition as described in section 6.4, and the additional therapeutic agent is formulated as a separate composition. In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated as part of a lipid-containing composition as described in section 6.4, wherein the additional therapeutic agent is also formulated as part of the lipid-containing composition.
In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated such that the therapeutic nucleic acids are encapsulated in the lipid shell of the lipid nanoparticle as described in section 6.4, and the additional therapeutic agent is formulated as a separate composition. In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated such that the therapeutic nucleic acids are encapsulated in the lipid shell of a lipid nanoparticle as described in section 6.4, wherein the lipid nanoparticle also encapsulates an additional therapeutic molecule or a nucleic acid encoding an additional therapeutic molecule. In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated such that the therapeutic nucleic acids are encapsulated in the lipid shell of the lipid nanoparticle as described in section 6.4, wherein the lipid nanoparticle and the additional therapeutic agent are formulated as a single composition.
In particular embodiments, the additional therapeutic agent is an adjuvant. In some embodiments, the adjuvant comprises an agent that promotes Dendritic Cell (DC) maturation in the vaccinated subject, such as, but not limited to, lipopolysaccharide, TNF-a, or CD40 ligand. In some embodiments, the adjuvant is an agent recognized as a "danger signal" by the immune system of the vaccinated subject, such as LPS, GP96, and the like.
In some embodiments, the adjuvant comprises an immunostimulatory cytokine such as, but not limited to, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, INF-alpha, IFN-beta, INF-gamma, GM-CSF, G-CSF, M-CSF, LT-beta, or TNF-alpha, a growth factor such as hGH.
In some embodiments, the adjuvant comprises a compound known to be capable of eliciting an innate immune response. An exemplary class of such compounds are Toll-like receptor ligands, such as those of the human Toll-like receptors TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, and murine Toll-like receptors TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11, TLR12 or TLR 13. Another exemplary class of such compounds are immunostimulatory nucleic acids, such as oligonucleotides containing CpG motifs. The CpG-containing nucleic acid may be a DNA (CpG-DNA) or RNA (CpG-RNA) molecule. The CpG-RNA or CpG-DNA may be single-stranded CpG-DNA (ss CpG-DNA), double-stranded CpG-DNA (dsDNA), single-stranded CpG-RNA (ss CpG-RNA) or double-stranded CpG-RNA (ds CpG-RNA). In some embodiments, the CpG nucleic acid is in the form of CpG-RNA. In particular embodiments, the CpG nucleic acid is in the form of single stranded CpG-RNA (ss CpG-RNA). In some embodiments, the CpG nucleic acid contains at least one or more (mitogenic) cytosine/guanine dinucleotide sequences (CpG motifs). In some embodiments, at least one CpG motif contained in these sequences (i.e., C (cytosine) and/or G (guanine) forming the CpG motif) is unmethylated.
In some embodiments, the additional therapeutic agent is an immunomodulatory agent that activates, boosts, or resumes normal immune function. In particular embodiments, the immunomodulator is an agonist of a costimulatory signal of an immune cell, such as a T lymphocyte, NK cell, or antigen presenting cell (e.g., a dendritic cell or macrophage). In particular embodiments, the immunomodulator is an antagonist of an inhibitory signal of an immune cell, such as a T lymphocyte, NK cell, or antigen presenting cell (e.g., a dendritic cell or macrophage).
Various immune cell stimulators known to those of skill in the art may be used in conjunction with the present disclosure. In certain embodiments, the agonist of the costimulatory signal is an agonist of a costimulatory molecule (e.g., a costimulatory receptor) found on an immune cell such as a T lymphocyte (e.g., a cd4+ or cd8+ T lymphocyte), an NK cell, and/or an antigen-presenting cell (e.g., a dendritic cell or macrophage). Specific examples of co-stimulatory molecules include glucocorticoid-induced tumor necrosis factor receptor (GITR), inducible T-cell co-stimulators (ICOS or CD 278), OX40 (CD 134), CD27, CD28, 4-IBB (CD 137), CD40, lymphotoxin alpha (lta), LIGHT (lymphotoxoid, which exhibits inducible expression and competes with herpes simplex virus glycoprotein D for HVEM (receptor expressed by T lymphocytes)), CD226, cytotoxic and regulatory T-cell molecules (CRT AM), death receptor 3 (DR 3), lymphotoxin beta receptor (LTBR), transmembrane activator and CAML interactive factor (transmembrane activator and CAML interactor, TACI), B-cell activator receptor (BAFFR) and B-cell maturation protein (BCMA).
In particular embodiments, the agonist of a co-stimulatory receptor is an antibody or antigen binding fragment thereof that specifically binds to the co-stimulatory receptor. Specific examples of co-stimulatory receptors include GITR, ICOS, OX, CD27, CD28, 4-1BB, CD40, LT alpha, LIGHT, CD226, CRT AM, DR3, LTBR, TACI, BAFFR, and BCMA. In certain embodiments, the antibody is a monoclonal antibody. In other embodiments, the antibody is sc-Fv. In a specific embodiment, the antibody is a bispecific antibody that binds to two receptors on immune cells. In other embodiments, the bispecific antibody binds to a receptor on an immune cell and another receptor on a virus-infected diseased cell. In specific embodiments, the antibody is a human or humanized antibody.
In another embodiment, the agonist of the co-stimulatory receptor is a ligand of the co-stimulatory receptor or a functional derivative thereof. In certain embodiments, the ligand is a fragment of a natural ligand. Specific examples of natural ligands include ICOSL, B7RP1, CD137L, OX40L, CD, herpes virus invasion mediator (HVEM), CD80 and CD86. Nucleotide sequences encoding natural ligands and amino acid sequences of natural ligands are known in the art.
In particular embodiments, the antagonist is an antagonist of an inhibitory molecule (e.g., an inhibitory receptor) found on immune cells such as T lymphocytes (e.g., cd4+ or cd8+ T lymphocytes), NK cells, and/or antigen presenting cells (e.g., dendritic cells or macrophages). Specific examples of inhibitory molecules include cytotoxic T lymphocyte-associated antigen 4 (CTLA-4 or CD 52), programmed cell death protein 1 (PD 1 or CD 279), B and T lymphocyte attenuation agents (BTLA), killer cell immunoglobulin-like receptor (KIR), lymphocyte activating gene 3 (LAG 3), T cell membrane protein 3 (TIM 3), CD 160, adenosine A2a receptor (A2 aR), T cell immune receptor (TIGIT) with immunoglobulin and ITIM domains, leukocyte-associated immunoglobulin-like receptor 1 (LAIR 1) and CD 160.
In another embodiment, the antagonist of the inhibitory receptor is an antibody (or antigen-binding fragment) that specifically binds to the natural ligand of the inhibitory receptor and prevents the natural ligand from binding to the inhibitory receptor and transducing an inhibitory signal. In certain embodiments, the antibody is a monoclonal antibody. In other embodiments, the antibody is sc-Fv. In a specific embodiment, the antibody is a bispecific antibody that binds to two receptors on immune cells. In other embodiments, the bispecific antibody binds to a receptor on an immune cell and another receptor on a virus-infected diseased cell. In specific embodiments, the antibody is a human or humanized antibody.
In another embodiment, the antagonist of the inhibitory receptor is a soluble receptor or a functional derivative thereof that specifically binds to the natural ligand of the inhibitory receptor and prevents the natural ligand from binding to the inhibitory receptor and transducing an inhibitory signal. Specific examples of natural ligands for inhibitory receptors include PDL-1, PDL-2, B7-H3, B7-H4, HVEM, gal9 and adenosine. Specific examples of inhibitory receptors that bind to natural ligands include CTLA-4, PD-1, BTLA, KIR, LAG3, TIM3 and A2aR.
In another embodiment, an antagonist of an inhibitory receptor is an antibody (or antigen binding fragment) or ligand that binds to the inhibitory receptor but does not transduce an inhibitory signal. Specific examples of inhibitory receptors include CTLA-4, PD1, BTLA, KIR, LAG3, TIM3 and A2aR. In certain embodiments, the antibody is a monoclonal antibody. In other embodiments, the antibody is an scFv. In particular embodiments, the antibody is a human or humanized antibody. A specific example of an antibody to an inhibitory receptor is an anti-CTLA-4 antibody (Leach DR, et al, science 1996; 271:1734-1736). Another example of an antibody to an inhibitory receptor is an anti-PD-1 antibody (Topalian SL, NEJM 2012; 28:3167-75).
6.5.3 patient population
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a subject in need thereof.
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a human subject. In some embodiments, the subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is an elderly human. In some embodiments, the subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is a human adult. In some embodiments, the subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is a human child. In some embodiments, the subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is a human pediatric. In some embodiments, the subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is a human infant.
In some embodiments, a subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is a non-human mammal.
In some embodiments, the subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is a subject exhibiting at least one symptom associated with a coronavirus infection. In some embodiments, a subject receiving administration of a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein exhibits one or more symptoms of an upper respiratory tract infection, a lower respiratory tract infection, a pulmonary infection, a kidney infection, a liver infection, an intestinal infection, a liver infection, a nervous system infection, a respiratory syndrome, pneumonia, gastroenteritis, encephalomyelitis, encephalitis, sarcoidosis, diarrhea, hepatitis, and demyelinating disease.
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy as described herein is administered to a subject without symptoms of a coronavirus infection.
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a subject at risk of or susceptible to a coronavirus infection. In some embodiments, the subject at risk of or susceptible to a coronavirus infection is an elderly. In some embodiments, the subject at risk of or susceptible to a coronavirus infection is a human adult. In some embodiments, the subject at risk of or susceptible to a coronavirus infection is a human child. In some embodiments, the subject at risk of or susceptible to a coronavirus infection is a human pediatric. In some embodiments, the subject at risk of or susceptible to a coronavirus infection is a human infant. In some embodiments, the subject at risk of or susceptible to a coronavirus infection is a human subject having an existing healthy condition affecting the immune system of the subject. In some embodiments, the subject at risk for or susceptible to coronavirus infection is a human subject having an existing healthy condition affecting a major organ of the subject. In some embodiments, the subject at risk for or susceptible to a coronavirus infection is a human subject having an existing healthy condition affecting the lung function of the subject. In some embodiments, the subject at risk for or susceptible to coronavirus infection is an elderly subject having an existing healthy condition affecting the subject's immune system or major organs (such as lung function). In various embodiments described in this paragraph, the subject at risk for or susceptible to a coronavirus infection may be a subject exhibiting symptoms of a coronavirus infection or free of symptoms of a coronavirus infection.
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a subject diagnosed as positive for a coronavirus infection. In some embodiments, the subject diagnosed as positive for a coronavirus infection is asymptomatic for the coronavirus infection, and the diagnosis is based on detecting the presence of viral nucleic acids or proteins from a sample from the subject. In some embodiments, the diagnosis is based on clinical symptoms exhibited by the patient. Exemplary symptoms that may serve as a basis for diagnosis include, but are not limited to, upper respiratory tract infection, lower respiratory tract infection, lung infection, kidney infection, liver infection, intestinal infection, liver infection, nervous system infection, respiratory syndrome, pneumonia, gastroenteritis, encephalomyelitis, encephalitis, sarcoidosis, diarrhea, hepatitis, and demyelinating diseases. In some embodiments, diagnosis is based on a history of clinical symptoms exhibited by the subject in combination with the subject's contact with a geographic location, population, and/or individual believed to be at high risk of carrying coronavirus (such as contact with another individual diagnosed as positive for coronavirus infection).
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a subject who has not previously received a therapeutic nucleic acid, a vaccine composition, a lipid-containing composition (e.g., a lipid nanoparticle), or a combination therapy administration.
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a subject that has previously received administration of a therapeutic nucleic acid, a vaccine composition, a lipid-containing composition (e.g., a lipid nanoparticle), or a combination therapy. In particular embodiments, the subject has previously been administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy as described herein one, two, three, or more times.
In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a subject that has received therapy prior to administration of the therapeutic nucleic acid, vaccine composition, lipid-containing composition (e.g., lipid nanoparticle), or combination therapy. In some embodiments, a subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., a lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein experiences adverse side effects of a prior therapy or terminates a prior therapy due to unacceptable levels of toxicity to the subject.
6.5.4 administration doses and frequency
The amount of therapeutic nucleic acid or composition thereof effective in controlling, preventing and/or treating an infectious disease will depend on the nature of the disease being treated, the route of administration, the general health of the subject, etc., and should be decided according to the judgment of the physician. Standard clinical techniques, such as in vitro analysis, may optionally be employed to help identify optimal dose ranges. However, suitable dosage ranges for therapeutic nucleic acid for administration as described herein are typically about 0.001mg, 0.005mg, 0.01mg, 0.05mg, 0.1mg, 0.5mg, 1.0mg, 2.0mg, 3.0mg, 4.0mg, 5.0mg, 10.0mg, 0.001mg to 10.0mg, 0.01mg to 1.0mg, 0.1mg to 1mg, and 0.1mg to 5.0mg. The therapeutic nucleic acid or composition thereof may be administered to the subject as frequently as one, two, three, four or more times at intervals as desired. The effective dose can be inferred from dose response curves derived from in vitro or animal model test systems.
In certain embodiments, the therapeutic nucleic acid or composition thereof is administered to the subject in a single dose followed by a second dose after 1 to 6 weeks, 1 to 5 weeks, 1 to 4 weeks, 1 to 3 weeks, 1 to 2 weeks. According to these embodiments, the subject may be administered a booster vaccination at intervals of 6 to 12 months after the second vaccination.
In certain embodiments, the therapeutic nucleic acid or composition thereof may be repeatedly administered, and the administration may be at least 1 day, 2 days, 3 days, 5 days, 6 days, 7 days, 10 days, 14 days, 15 days, 21 days, 28 days, 30 days, 45 days, 2 months, 75 days, 3 months, or at least 6 months apart. In other embodiments, the therapeutic nucleic acid or composition thereof may be repeatedly administered, and the administration may be 1 to 14 days, 1 to 7 days, 7 to 14 days, 1 to 30 days, 15 to 45 days, 15 to 75 days, 15 to 90 days, 1 to 3 months, 3 to 6 months, 3 to 12 months, or 6 to 12 months apart. In some embodiments, the first therapeutic nucleic acid or composition thereof is administered to the subject followed by administration of the second therapeutic nucleic acid or composition thereof. In certain embodiments, the first and second therapeutic nucleic acids or compositions thereof may be separated by at least 1 day, 2 days, 3 days, 5 days, 6 days, 7 days, 10 days, 14 days, 15 days, 21 days, 28 days, 30 days, 45 days, 2 months, 75 days, 3 months, or at least 6 months. In other embodiments, the first and second therapeutic nucleic acids or compositions thereof may be spaced 1 to 14 days, 1 to 7 days, 7 to 14 days, 1 to 30 days, 15 to 45 days, 15 to 75 days, 15 to 90 days, 1 to 3 months, 3 to 6 months, 3 to 12 months, or 6 to 12 months apart.
In certain embodiments, the therapeutic nucleic acid or composition thereof is administered to the subject in combination with one or more additional therapies (such as the therapies described in section 6.5.2). The dosage of the other additional therapy or therapies will depend on a variety of factors including, for example, the therapy, the nature of the infectious disease, the route of administration, the general health of the subject, etc., and should be determined at the discretion of the physician. In particular embodiments, the dose of the other therapy is the dose and/or frequency of administration of the therapy recommended for use as a single dose of therapy according to the methods disclosed herein. In other embodiments, the dosage of the other therapy is a lower dosage and/or less frequent administration of the therapy than recommended for the therapy used as a single agent according to the methods disclosed herein. Recommended dosages for approved therapies can be found in the Physics' Desk Reference.
In certain embodiments, the therapeutic nucleic acid or composition thereof is administered to the subject concurrently with one or more additional therapies. In other embodiments, the therapeutic nucleic acid or composition thereof is administered to the subject every 3 to 7 days, 1 to 6 weeks, 1 to 5 weeks, 1 to 4 weeks, 2 to 4 weeks, 1 to 3 weeks, or 1 to 2 weeks, and one or more additional therapies (such as described in section 6.5.2) are administered every 3 to 7 days, 1 to 6 weeks, 1 to 5 weeks, 1 to 4 weeks, 1 to 3 weeks, or 1 to 2 weeks. In certain embodiments, the therapeutic nucleic acid or composition thereof is administered to the subject every 1-2 weeks, and one or more additional therapies (such as described in section 6.5.2) are administered every 2-4 weeks. In some embodiments, the therapeutic nucleic acid or composition thereof is administered to the subject weekly, and one or more additional therapies (such as described in section 6.5.2) are administered every 2 weeks.
7. Examples
The embodiments in this section are provided by way of illustration and not limitation.
The following examples are provided to illustrate the preparation of cationic lipid series 01.
General preparative HPLC method: HPLC purification was performed on Waters 2767 equipped with a Diode Array Detector (DAD), on an inortsil Pre-C8 OBD column, typically using water with 0.1% TFA as solvent a and acetonitrile as solvent B.
General LCMS method: LCMS analysis was performed on a Shimadzu (LC-MS 2020) system. Chromatography is performed on SunFire C18, typically using water with 0.1% formic acid as solvent a and acetonitrile with 0.1% formic acid as solvent B.
Example 01-1: preparation of Compound 01-1 (i.e., compound 1 in the scheme below).
Compound 1
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,12H),1.27(s,52H),1.46-1.67(m,12H),1.95-2.10(m,5H),2.29-2.34(m,5H),2.44-2.77(m,9H),3.30(s,1H),3.66(s,2H),3.96(d,J＝6.0Hz,4H)。LCMS:Rt:1.285min；MS m/z(ESI):835.7[M+H]。
Example 01-2: preparation of Compound 01-2 (i.e., compound 2 in the scheme below).
Compound 2
1 H NMR(400MHz,CDCl 3 )δ:0.80-0.83(m,12H),0.91-1.20(m,4H),1.25(s,56H),1.54-1.59(m,8H),1.70(s,3H),1.79-1.86(m,6H),2.22-2.34(m,4H),2.74-3.06(m,6H),3.06-3.20(m,2H),3.69(s,1H),3.88-4.05(m,4H)。LCMS:Rt:1.989min；MS m/z(ESI):863.7[M+H]。
Examples 01-3: preparation of Compounds 01-20 (i.e., compound 20 in the scheme below).
Compound 20
1 H NMR(400MHz,CDCl 3 ):δ0.87(t,J＝8Hz,12H),1.30-1.36(m,54H),1.45-1.52(m,4H),1.56-1.68(m,6H),1.83-1.88(m,4H),1.97-2.01(m,2H),2.21-2.23(m,4H),2.43-2.56(m,9H),3.14-3.16(m,1H),3.51-3.54(m,2H),4.03-4.07(m,4H)。LCMS:Rt:1.930min；MS m/z(ESI):835.7[M+H]。
Examples 01 to 4: preparation of Compounds 01-21 (i.e., compound 21 in the scheme below).
Compound 21
1 H NMR(400MHz,CDCl 3 )δ:0.88(t,J＝6.8Hz,12H),1.26(s,56H),1.32-1.53(m,4H),1.60-1.68(m,7H),1.72-1.89(m,3H),1.99-2.04(m,1H),2.31(t,J＝7.4Hz,4H),2.43-2.49(m,6H),2.50-2.65(m,4H),3.49-3.56(m,3H),3.97(d,J＝5.6Hz,4H)。LCMS:Rt:1.02min；MS m/z(ESI):879.7[M+H] + 。
Examples 01 to 5: preparation of Compounds 01-102 (i.e., compound 102 in the scheme below)
Compound 102-4
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.89(m,6H),1.26(s,28H),2.60-2.63(m,2H),3.52-3.66(m,5H),3.75-3.78(m,2H),3.98(d,J＝5.6Hz,2H),4.56(s,2H),7.27-7.34(m,5H)。
Compound 102-5
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.89(m,6H),1.26(s,30H),2.60(t,J＝6.0Hz,2H),3.57-3.59(m,2H),3.71-3.78(m,4H),4.02(d,J＝6.0Hz,2H)。
Compound 102
1 H NMR(400MHz,CDCl 3 )δ:0.79-0.83(m,12H),1.25(s,58H),1.47-1.60(m,4H),1.88-1.95(m,4H),2.49-2.52(m,9H),2.64-2.67(m,4H),3.01(s,1H),3.46-3.49(m,6H),3.61-3.64(m,4H),3.91(d,J＝6.4Hz,4H)。LCMS:Rt:1.510min；MS m/z(ESI):895.7[M+H]。
The following compounds were prepared in a similar manner to compounds 01-102 using the corresponding starting materials.
Examples 01 to 6: preparation of Compounds 01-108 (i.e., compound 108 in the scheme below)
Compound 108
1 H NMR(400MHz,CDCl 3 )δ:0.87(t,J＝8Hz,12H),1.29-1.35(m,53H),1.51-1.68(m,10H),1.82-1.88(m,4H),1.97-2.07(m,4H),2.21-2.23(m,2H),2.45-2.56(m,10H),3.14-3.27(m,3H),3.52-3.55(m,2H),4.04-4.07(m,2H),5.91-5.94(m,1H)。LCMS:Rt:1.009min；MS m/z(ESI):834.7[M+H]。
The following compounds were prepared in a similar manner to compounds 01-108 using the corresponding starting materials.
Examples 01 to 7: preparation of Compounds 01-106 (i.e., compound 106 in the scheme below).
Compound 106
1 H NMR(400MHz,CDCl 3 )δ:0.87(t,J＝8Hz,12H),1.22-1.46(m,53H),1.47-1.52(m,6H),1.53-1.67(m,6H),1.83-1.87(m,3H),1.98-2.01(m,2H),2.15-2.19(m,2H),2.29-2.32(m,2H),2.42-2.55(m,10H),3.13-3.19(m,2H),3.51-3.53(m,2H),3.95-3.97(m,2H),5.56-5.57(m,1H)。LCMS:Rt:0.999min；MS m/z(ESI):834.8[M+H]。
The following compounds were prepared in a similar manner to compounds 01-106 using the corresponding starting materials.
The following examples are provided to illustrate the preparation of cationic lipid series 02.
General preparative HPLC method: HPLC purification was performed on Waters 2767 equipped with a Diode Array Detector (DAD), on an inortsil Pre-C8 OBD column, typically using water with 0.1% TFA as solvent a and acetonitrile as solvent B.
General LCMS method: LCMS analysis was performed on a Shimadzu (LC-MS 2020) system. Chromatography is performed on SunFire C18, typically using water with 0.1% formic acid as solvent a and acetonitrile with 0.1% formic acid as solvent B.
Example 02-1: preparation of Compound 02-1 (i.e., compound 1 in the scheme below).
/>
Compound 1
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,12H),1.27-1.63(m,53H),1.97-2.01(m,2H),2.28-2.64(m,14H),3.52-3.58(m,2H),4.00-4.10(m,8H)。LCMS:Rt:1.080min；MS m/z(ESI):826.0[M+H] + 。
The following compounds were prepared in a similar manner to compound 02-1 using the corresponding starting materials.
Example 02-2: preparation of Compound 02-2 (i.e., compound 2 in the scheme below).
Compound 2
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,12H),1.28-1.67(m,54H),1.88-2.01(m,7H),2.28-2.56(m,18H),3.16-3.20(m,1H),3.52-3.54(m,2H),4.00-4.10(m,8H)。LCMS:Rt:1.060min；MS m/z(ESI):923.0[M+H] + 。
Example 02-3: preparation of Compound 02-4 (i.e., compound 4 in the scheme below).
Compound 4
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,9H),1.26-1.32(m,34H),1.41-1.49(m,4H),1.61-1.66(m,15H),2.00-2.03(m,1H),2.21-2.38(m,8H),2.43-2.47(m,4H),2.56-2.60(m,2H),3.50-3.54(m,2H),4.03-4.14(m,8H)。LCMS:Rt:1.030min；MS m/z(ESI):798.0[M+H] + 。
Examples 02 to 4: preparation of Compounds 02-9 (i.e., compound 9 in the scheme below).
Compound 9
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,12H),1.28-1.30(m,33H),1.58-2.01(m,18H),2.30-2.54(m,18H),3.10-3.19(m,1H),3.52-3.68(m,8H),4.09-4.20(m,8H)。LCMS:Rt:1.677min；MS m/z(ESI):927.7[M+H] + 。
The following compounds were prepared in a similar manner to compounds 02-9 using the corresponding starting materials.
Examples 02 to 5: preparation of Compounds 02-10 (i.e., compound 10 in the scheme below).
Compound 10
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,12H),1.26-1.41(m,48H),1.51-1.72(m,11H),1.94-2.03(m,1H),2.29-2.32(m,6H),2.41-2.91(m,5H),3.51-3.76(m,2H),3.96-4.10(m,6H)。LCMS:Rt:1.327min；MS m/z(ESI):782.6[M+H] + 。
The following compounds were prepared in a similar manner to compounds 02-10 using the corresponding starting materials.
Examples 02 to 6: preparation of Compounds 02-12 (i.e., compound 12 in the scheme below).
Compound 12
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.89(m,18H),1.25-1.35(m,53H),1.41-1.48(m,8H),1.56-1.61(m,20H),1.95-2.01(m,2H),2.28-2.35(m,6H),2.43-2.46(m,4H),2.56-2.58(m,2H),3.51-3.54(m,2H),4.00-4.10(m,8H)。LCMS:Rt:0.080min；MS m/z(ESI):1050.8[M+H] + 。
Examples 02 to 7: preparation of Compounds 02-20 (i.e., compound 20 in the scheme below).
Compound 20
1 H NMR(400MHz,CDCl3)δ：0.86-0.90(m,9H),1.25-1.36(m,48H),1.41-1.48(m,5H),1.60-1.62(m,8H),1.97-2.00(m,1H),2.27-2.32(m,6H),2.43-2.46(m,4H),2.56-2.59(m,2H),3.52-3.54(m,2H),4.01-4.10(m,6H)。LCMS：Rt:0.093min；MS m/z(ESI):782.6[M+H] + 。
The following examples are provided to illustrate the preparation of cationic lipid series 03.
Example 03-1: preparation of starting materials and intermediates.
Preparation of Compound A
Preparation of Compound B
Preparation of Compound C
Preparation of Compound D
Preparation of Compound E
Compound E
1 H NMR(400MHz,CDCl 3 ):3.97(d,J＝6Hz,2H),3.58(s,1H),2.73-2.58(m,3H),2.45-2.40(m,1H),2.33-2.29(m,2H),1.66-1.60(m,2H),1.51-1.40(m,2H),1.39-1.34(m,4H),1.26(s,46H),0.90-0.86(m,9H)。LCMS:Rt:1.083min；MS m/z(ESI):568.5[M+H] + 。
Preparation of Compound F
Preparation of Compound G
Preparation of Compound H
Preparation of Compound K
Preparation of Compound L
Preparation of SM 2:
LCMS:Rt:1.427min；MS m/z(ESI):428.5[M+H] + 。
preparation of SM 4:
LCMS:Rt:1.000min；MS m/z(ESI):442.4[M+H] + 。
preparation of SM 9:
/>
preparation of SM 10:
compounds SM10-4
LCMS:Rt:0.830min；MS m/z(ESI):481.4[M+H] + 。
SM10
LCMS:Rt:0.860min；MS m/z(ESI):499.3[M+H] + 。
Preparation of SM 11:
compound SM11
LCMS:Rt:0.890min；MS m/z(ESI):428.3[M+H] + 。
Preparation of SM:
compound SM-2
1 H NMR(400MHz,CCl 3 D):3.71(s,6H),1.88-1.84(m,4H),1.59(s,1H),1.25(s,19H),1.14-1.10(m,4H),0.89-0.86(m,6H)。
Compound SM-3
1 H NMR(400MHz,CCl 3 D):0.89-0.86(m,6H),1.25(s,22H),1.45-1.40(m,2H),1.59(s,4H),2.36-2.30(m,1H),3.67(s,3H)。
Compound SM
1 H NMR(400MHz,CCl 3 D):0.90-0.86(m,6H),1.27(s,27H),1.43(s,3H),3.54(d,J＝5.2Hz,2H)。
Preparation of SM 15:
LCMS:Rt:0.900min；MS m/z(ESI):442.3[M+H] + 。
preparation of SM 16:
LCMS:Rt:0.810min；MS m/z(ESI):444.3[M+H] + 。
preparation of SM 18:
LCMS:Rt:0.870min；MS m/z(ESI):526.5[M+H] + 。
preparation of SM 20:
compound SM20-1
LCMS:Rt:0.950min；MS m/z(ESI):482.4[M+H] + 。
Compound SM20
LCMS:Rt:1.330min；MS m/z(ESI):500.3[M+H] + 。
Preparation of SM 22:
compound SM22
1 H NMR(400MHz,CCl 3 D):0.87(t,J＝8Hz,6H),1.22-1.46(m,24H),1.85-1.95(m,2H),2.22-2.34(m,1H)。
Preparation of SM 23:
compound SM23
LCMS:Rt:0.898min；MS m/z(ESI):400.3[M+H] + 。
Preparation of SM 24:
preparation of SM 26:
preparation of SM 30:
compound SM30
LCMS:Rt:1.010min；MS m/z(ESI):402.4[M+H] + 。
Preparation of SM 34:
compound SM34
LCMS:Rt:1.620min；MS m/z(ESI):399.5[M+H] + 。
Preparation of SM 38:
/>
preparation of SM 39:
compound SM39
LCMS:Rt:0.880min；MS m/z(ESI):400.3[M+H]。
Example 03-2: preparation of Compound 03-1 (i.e., compound 1 in the scheme below).
Compound 03-1
1 H NMR(400MHz,CDCl 3 )δ:0.83-0.93(m,12H),1.04-1.16(m,2H),1.18-1.39(m,60H),1.40-1.55(m,3H),1.56-1.74(m,9H),1.86(s,2H),2.25-2.39(m,5H),2.56(s,3H),2.70(s,3H),3.62(s,2H),3.89-4.04(m,4H)。LCMS:Rt:2.000min；MS m/z(ESI):863.7[M+H] + 。
Examples 03-3: preparation of Compound 03-3.
Compound 03-3
1 H NMR(400MHz,CDCl 3 )δ:0.48-0.50(m,4H),0.86-0.90(m,9H),1.26-1.30(m,45H),1.49-1.66(m,11H),1.72-1.77(m,1H),2.28-2.32(m,4H),2.52-2.76(m,10H),3.52-3.58(m,2H),3.96-3.98(m,2H),4.04-4.07(m,2H)。LCMS:Rt:1.250min；MS m/z(ESI):751.6[M+H] + 。
The following compounds were prepared in a similar manner to compound 03-3 using the corresponding starting materials.
Examples 03 to 4: preparation of Compounds 03-10 (i.e., compound 10 in the scheme below).
Compound 10-1
LCMS:Rt:0.942min；MS m/z(ESI):428.3[M+H] + 。
Compound 10-2
LCMS:Rt:0.950min；MS m/z(ESI):482.4[M+H] + 。
Compound 10-3
LCMS:Rt:1.330min；MS m/z(ESI):500.3[M+H] + 。
Compound 10
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.89(m,12H),1.26-1.32(m,61H),1.41-1.65(m,12H),1.85-2.02(m,4H),2.28-2.61(m,14H),3.00-3.12(m,1H),3.53-3.55(m,2H),3.97(d,J＝5.6Hz,4H)。LCMS:Rt:2.520min；MS m/z(ESI):891.7[M+H] + 。
Examples 03 to 5: preparation of Compounds 03-11 (i.e., compound 11 in the scheme below).
Compound 11-A
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,6H),1.26-1.32(m,29H),3.00(s,3H),4.11-4.13(m,2H)。
Compound 11-1
1 H NMR(400MHz,CDCl 3 )δ:0.85-0.88(m,6H),1.24-1.29(m,28H),1.82-1.89(m,1H),3.56-3.58(m,2H),7.72-7.72(m,2H),7.83-7.85(m,2H)。
Compound 11-2
LCMS:Rt:1.260min；MS m/z(ESI):270.3[M+H] + 。
Compound 11-4
LCMS:Rt:0.920min；MS m/z(ESI):481.4[M+H] + 。
Compound 11-5
LCMS:Rt:0.980min；MS m/z(ESI):499.3[M+H] + 。
Compounds 11-6
LCMS:Rt:0.96min；MS m/z(ESI):427.3[M+H] + 。
Compound 11
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,12H),1.26-1.34(m,64H),1.41-1.54(m,6H),1.59-1.77(m,6H),1.99-2.07(m,2H),2.17-2.21(m,4H),2.47-2.71(m,10H),3.15-3.18(m,4H),3.55-3.62(m,2H),5.73-5.84(m,2H)。LCMS:Rt:1.610min；MS m/z(ESI):889.8[M+H] + 。
Examples 03 to 6: preparation of Compounds 03-15 (i.e., compound 15 in the scheme below).
Compound 15
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.92(m,12H),1.26-1.30(m,67H),1.46-1.72(m,12H),1.98-2.09(m,2H),2.15-2.19(m,2H),2.31-2.71(m,8H),3.16-3.23(m,2H),3.56-3.66(m,2H),3.95-4.03(m,2H),7.30(s,1H)。LCMS:Rt:1.68min；MS m/z(ESI):890.7[M+H] + 。
The following compounds were prepared in a similar manner to compounds 03-15 using the corresponding starting materials.
Examples 03 to 7: preparation of Compounds 03-71 (i.e., compound 71 in the scheme below).
Compound 71-2
1 H NMR(400MHz,CDCl 3 )δ:1.72-1.80(m,2H),1.94-2.01(m,2H),3.43(t,J＝6.8Hz,2H),3.50(t,J＝6.2Hz,2H),4.50(s,2H),7.27-7.37(m,5H)。
Compound 71-4
1 H NMR(400MHz,CDCl 3 )δ:1.20-1.24(m,2H),1.36-1.44(m,2H),1.57-1.68(m,2H),1.72-1.75(m,1H),3.33(s,2H),3.45-3.49(m,2H),3.57-3.61(m,2H),3.73-3.76(m,2H),4.49(s,2H),7.27-7.34(m,5H)。
Compound 71-5
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,6H),1.27-1.29(m,13H),1.36-1.48(m,4H),1.58-1.64(m,9H),1.92-2.02(m,1H),2.29(t,J＝7.6Hz,4H),3.46(t,J＝6.4Hz,2H),4.00-4.10(m,4H),4.49(s,2H),7.28-7.37(m,5H)。
Compound 71-6
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,6H),1.27-1.39(m,15H),1.41-1.51(m,6H),1.58-1.65(m,6H),1.96-2.05(m,1H),2.30(t,J＝7.6Hz,4H),3.65(t,J＝6.4Hz,2H),4.02-4.11(m,4H)。
Compound 71-7
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,6H),1.27-1.37(m,14H),1.41-1.46(m,4H),1.53-1.63(m,6H),1.73-1.80(m,2H),1.96-2.03(m,1H),2.30(t,J＝6.2Hz,4H),3.01(s,3H),4.02-4.10(m,4H),4.23(t,J＝6.4Hz,2H)。
Compound 71-8
LCMS:Rt:0.830min；MS m/z(ESI):498.4[M+H] + 。
Compounds 71-9
LCMS:Rt:0.870min；MS m/z(ESI):516.3[M+H] + 。
Compound 71
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,12H),1.27-1.50(m,44H),1.57-1.67(m,10H),1.85-2.05(m,6H),2.28-2.36(m,8H),2.45-3.13(m,12H),3.52-3.60(m,2H),4.01-4.10(m,8H)。LCMS:Rt:1.110min；MS m/z(ESI):923.7[M+H] + 。
The following compounds were prepared in a similar manner to compounds 03-71 using the corresponding starting materials.
/>
Examples 03 to 8: preparation of Compounds 03-72 (i.e., compound 72 in the scheme below).
Compounds 03-72
1 H NMR(400MHz,CDCl 3 )δ:0.81-0.93(m,12H),1.07-1.38(m,62H),1.39-1.57(m,9H),1.58-1.90(m,11H),1.96-2.10(m,3H),2.16-2.26(m,2H),2.42-2.68(m,8H),3.18-3.32(m,2H),3.49-3.61(m,2H),3.99-4.12(m,2H)。LCMS:Rt:1.510min；MS m/z(ESI):904.7[M+H] + 。
The following compounds were prepared in a similar manner to compounds 03-72 using the corresponding starting materials.
Examples 03 to 9: preparation of Compounds 03-190 (i.e., compound 190 in the scheme below).
Compound 190
1 H NMR(400MHz,CDCl 3 )δ:0.51-0.86(m,12H),1.28-1.39(m,48H),1.60-1.68(m,24H),2.28-2.31(m,8H),2.32-2.69(m,6H),3.96-4.06(m,6H)。LCMS:Rt:1.150min；MS m/z(ESI):893.7[M+H] + 。
Examples 03 to 10: preparation of Compounds 03-195 (i.e., compound 195 in the scheme below).
Compound 195
1 H NMR(400MHz,CDCl 3 )δ:0.36-0.45(m,4H),0.86-0.90(m,12H),1.26-1.35(m,46H),1.40-1.55(m,8H),0.60-1.77(m,9H),1.97-2.00(m,1H),2.15-2.19(m,2H),2.29-2.32(m,4H),2.43-2.59(m,10H),3.16-3.19(m,2H),3.51-3.54(m,2H),4.00-4.10(m,4H),5.50(s,1H)。LCMS:Rt:0.080min；MS m/z(ESI):892.6[M+H] + 。
The following compounds were prepared in a similar manner to compounds 03-195 using the corresponding starting materials.
The following examples are provided to illustrate the preparation of cationic lipid series 04.
General preparative HPLC method: HPLC purification was performed on Waters 2767 equipped with a Diode Array Detector (DAD), on an inortsil Pre-C8 OBD column, typically using water with 0.1% TFA as solvent a and acetonitrile as solvent B.
General LCMS method: LCMS analysis was performed on a Shimadzu (LC-MS 2020) system. Chromatography is performed on SunFire C18, typically using water with 0.1% formic acid as solvent a and acetonitrile with 0.1% formic acid as solvent B.
Example 04-1: preparation of starting materials and intermediates.
Preparation of Compound A
Preparation of Compound B
Preparation of Compound C
Preparation of Compound D
Preparation of Compound E
Preparation of Compound F
Preparation of Compound G
Compound G-1
LCMS:Rt:0.824min；MS m/z(ESI):394.3[M+H] + 。
Compound G
LCMS:Rt:1.750min；MS m/z(ESI):732.6[M+H] + 。
Compound H
/>
Compound I
Compound J
LCMS:Rt:1.070min；MS m/z(ESI):584.4[M+H] + 。
Preparation of Compound K
Preparation of Compound L
Preparation of Compound M
Preparation of Compound N
/>
Preparation of Compound O
Preparation of Compound P
Preparation of Compound Q
Compound Q-1
1 H NMR(400MHz,CCl 3 D):δ:3.70(s,6H),1.88-1.84(m,4H),1.63(s,1H),1.27(s,10H),1.13(s,5H),0.88-0.86(m,6H)。
Compound Q-2
1 H NMR(400MHz,CCl 3 D):δ:3.67(s,3H),2.35-2.31(m,1H),1.61-1.54(m,2H),1.47-1.40(m,2H),1.26(s,16H),0.89-0.86(m,6H)。
Compound Q-3
1 H NMR(400MHz,CCl 3 D):δ:3.54(d,J＝5.2Hz,2H),1.47-1.43(m,2H),1.28(s,20H),0.90-0.87(m,6H)。
Preparation of Compound SM2
Preparation of Compound R
Preparation of Compound S
Preparation of Compound SM5
Preparation of Compound SM6
Example 04-2: preparation of Compound 04-1 (i.e., compound 1 in the scheme below).
Compounds 1-1
LCMS:Rt:0.750min；MS m/z(ESI):206.2[M+H] + 。
Compounds 1-2
LCMS:Rt:0.870min；MS m/z(ESI):448.3[M+H] + 。
Compounds 1-3
LCMS:Rt:1.360min；MS m/z(ESI):616.5[M+H] + 。
Compound 1
1 H NMR(400MHz,CDCl 3 )δ：0.79-0.83(m,6H),1.14-1.26(m,38H),1.47-1.61(m,6H),1.86-1.96(m,4H),2.51-2.58(m,4H),3.17(s,1H),3.32-3.44(m,5H),3.51-3.66(m,3H)。LCMS:Rt:0.94min；MS m/z(ESI):526.5[M+H] + 。
Example 04-3: preparation of Compound 04-2 (i.e., compound 2 in the scheme below).
Compound 2-1
LCMS:Rt:1.340min；MS m/z(ESI):630.5[M+H] + 。
Compound 2
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,6H),1.25-1.33(m,35H),1.50-1.69(m,7H),1.87-1.99(m,1H),2.00-2.08(m,2H),2.33(t,J＝7.6Hz,2H),2.56-2.81(m,4H),3.17-3.27(m,1H),3.38-3.48(m,3H),3.50-3.65(m,3H),5.08-5.14(m,1H)。LCMS:Rt:1.180min；MS m/z(ESI):540.4[M+H] + 。
Examples 04-4: preparation of Compound 04-7 (i.e., compound 7 in the scheme below).
Compound 7-1
LCMS:Rt:0.780min；MS m/z(ESI):427.4[M+H] + 。
Compound 7
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,9H),1.26-1.35(m,45H),1.41-1.67(m,7H),2.28-2.32(m,3H),2.36-2.70(m,11H),2.79-2.83(m,2H),3.35-3.46(m,4H),3.77-3.85(m,1H),3.96-3.97(m,2H)。LCMS:Rt:1.220min；MS m/z(ESI):669.6[M+H] + 。
Examples 04-5: preparation of Compound 04-8 (i.e., compound 8 in the scheme below).
Compound 8-1
LCMS:Rt:0.730min；MS m/z(ESI):371.3[M+H] + 。
Step 2: preparation of Compound 8
1 H NMR(400MHz,CDCl 3 )δ:0.86-0.90(m,9H),1.25-1.27(m,47H),1.40-1.49(m,4H),1.56-1.73(m,8H),2.30(t,J＝7.6Hz,3H),2.40-2.82(m,10H),3.32-3.38(m,1H),3.43-3.46(m,3H),3.70-3.80(m,1H),3.92-3.97(m,2H)。LCMS:Rt:1.090min；MS m/z(ESI):709.6[M+H] + 。
Examples 04-6: preparation of Compound 04-65 (i.e., compound 65 in the scheme below).
Compound 65
1 H NMR(400MHz,CCl 3 D):δ:0.79-0.83(m,12H),1.23-1.27(m,62H),1.29-1.37(m,2H),1.51-1.61(m,2H),1.76-1.93(m,7H),2.13-2.16(m,4H),2.17-2.25(m,3H),2.41-2.51(m,7H),3.05-3.06(m,1H),3.52-3.54(m.2H),3.92-4.03(m,4H)。LCMS:Rt:0.588min；MS m/z(ESI):863.6[M+H] + 。
The following compounds were prepared in a similar manner to compounds 04-65 using the corresponding starting materials.
Examples 04-7: preparation of Compounds 04-68 (i.e., compound 68 in the scheme below).
Compound 68-2
1 H NMR(400MHz,CDCl3)δ:0.86-0.90(m,12H),1.26-1.46(m,53H),1.56-1.62(m,2H),1.83(s,2H),1.96-2.02(m,1H),2.23-2.24(m,4H),3.64(s,2H),4.02-4.11(m,4H)。
Compound 68
1 H NMR(400MHz,CDCl3)δ:0.83-0.92(m,12H),1.17-1.37(m,56H),1.38-1.45(m,2H),1.64-1.67(m,2H),1.70-1.86(m,6H),1.92-2.04(m,2H),2.19-2.26(m,4H),2.40-2.49(m,3H),2.57-2.65(m,2H),3.41-3.51(m,2H),3.97-4.12(m,4H)。LCMS:Rt:0.080min；MS m/z(ESI):778.5[M+H] + 。
Examples 04-8: preparation of Compounds 04-69 (i.e., compound 69 in the scheme below).
Compound 69-1
LCMS:Rt:1.290min；MS m/z(ESI):750.7[M+H] + 。
Compound 69
1 H NMR(400MHz,CDCl3)δ:0.83-0.92(m,12H),0.98-1.06(m,3H),1.17-1.47(m,52H),1.54-1.72(m,5H),1.78-2.06(m,8H),2.20-2.27(m,4H),2.37-2.46(m,4H),2.49-2.66(m,5H),3.01-3.12(m,1H),3.52-3.59(m,2H),3.98-4.11(m,4H)。LCMS:Rt:0.093min；MS m/z(ESI):821.6[M+H] + 。
The following compounds were prepared in a similar manner to compounds 04-69 using the corresponding starting materials.
/>
Example 05: preparation and characterization of lipid nanoparticles
Briefly, the cationic lipids, DSPC, cholesterol and PEG-lipids provided herein were dissolved in ethanol at a molar ratio of 50:10:38.5:1.5, and mRNA was diluted in 10 to 50mM citrate buffer (ph=4). Alternatively, the cationic lipid, DSPC, cholesterol, and polymer-bound lipid provided herein are dissolved in ethanol at a molar ratio of 50:10:38.5:1.5, and mRNA is diluted in 10 to 50mM citrate buffer (ph=4). LNP was prepared by mixing an ethanol lipid solution with an aqueous mRNA solution at a volume ratio of 1:3 using a microfluidic device with a total flow rate in the range of 9-30mL/min at a total lipid to mRNA weight ratio of about 10:1 to 30:1. Ethanol was removed using dialysis and replaced with DPBS. Finally, the lipid nanoparticles were filtered through a 0.2 μm sterile filter.
Lipid nanoparticle size was determined by dynamic light scattering using Malvern Zetasizer Nano ZS (Malvern UK) using 173 ° backscatter detection mode. The encapsulation efficiency of lipid nanoparticles was determined using a Quant-it Ribogreen RNA quantitative analysis kit (Thermo Fisher Scientific, UK) according to the manufacturer's instructions.
As reported in the literature, the apparent pKa of an LNP formulation correlates with the efficiency of LNP delivery to nucleic acids in vivo. The apparent pKa of each formulation was determined using an analysis based on fluorescence of 2- (p-toluylamino) -6-naphthalene sulfonic acid (TNS). LNP formulations comprising cationic lipid/DSPC/cholesterol/DMG-PEG (50/10/38.5/1.5 mol%) in PBS were prepared as described above. TNS was prepared as a 300uM stock solution in distilled water. LNP formulations were diluted to 0.1mg/mL total lipid in 3mL of buffer solution containing 50mM sodium citrate, 50mM sodium phosphate, 50mM sodium borate and 30mM sodium chloride, where the pH was in the range of 3 to 9. An aliquot of the TNS solution was added to give a final concentration of 0.1mg/ml and after vortexing, fluorescence intensity was measured at room temperature in a Molecular Devices Spectramax iD3 spectrometer using an excitation wavelength of 325nm and an emission wavelength of 435 nm. The sigmoid curve best fit analysis was applied to the fluorescence data and the pKa value was measured as the pH value that produced half maximum fluorescence intensity.
Example B1: mRNA synthesis and purification.
DNA linearization. Plasmid pJ241 (developed in-house) for IVT containing kanamycin (kanamycin) resistance gene, T7 promoter sequence, 5'-UTR and 3' -UTR, poly (A) tag and unique type IIS restriction site downstream of poly (A) sequence containing target sequence (e.g., SEQ ID NO:62 or 63), 5'-UTR and 3' -UTR of spike (S) protein encoding SARS-CoV-2delta strain (RBD) (e.g., SEQ ID NO: 60) and polyA signal was linearized using type IIS restriction enzyme digestion. Mu.g of plasmid was mixed with 10U of Esp I/BsmBI and incubated at 37℃for 4 hours to ensure complete linearization. The reaction was stopped by adding 1/10 volume of 3M sodium acetate (pH 5.5) and 2.5 volumes of ethanol, thoroughly mixed and cooled at-20℃for 1 hour. The linearized DNA was precipitated by centrifugation at 13800g for 15 min at 4℃and washed twice with 70% ethanol and resuspended in nuclease H 2 O.
In vitro transcription of mRNA. The contents of a typical 20 μl reaction mixture are shown in the table below:
the reaction mixture was incubated at 37℃for 6 hours, then 1. Mu.l DNase I (no RNase, 1U/. Mu.L) was added to remove the DNA template and incubated at 37℃for 30 minutes. The synthesized RNA was purified by adding 0.5 volume of 7.5M LiCl, 50mM EDTA and incubating at-20℃for 45 minutes, followed by centrifugation at 13800g at 4℃for 15 minutes to precipitate mRNA. The supernatant was then removed and the pellet was washed twice with 500. Mu.L of ice-cold 70% ethanol and mRNA was resuspended in nuclease H-free 2 In O, the concentration was adjusted to 1mg/mL and stored at-20 ℃.
mRNA capping. Each 10. Mu.g of uncapped mRNA was heated at 65℃for 10 minutes, placed on ice for 5 minutes, and then capped with 10U of vaccinia virus capping enzyme, 50U of mRNA with 2' -O-methylTransferase, 0.2mM SAM, 0.5mM GTP and 1U RNase inhibitor were mixed and incubated at 37℃for 60 minutes to generate a cap 1 modified structure. Modified mRNA was precipitated by LiCl as described before and RNA was resuspended in nuclease H-free 2 O, and stored at-20 ℃. The resulting mRNA was designed to have the sequences as set forth in SEQ ID NO 64 (for RBD from the initial strain), 66 (for non-optimized RBD from the delta strain) and 67 (for optimized RBD from the delta strain).
HPLC purification. RNA was purified by High Performance Liquid Chromatography (HPLC) using a C4 column (5 μm) (10 mm. Times.250 mm column). Buffer a contained 0.1M triethylammonium acetate (TEAA) (ph=7.0) and buffer B contained 0.1M TEAA (ph=7.0) and 25% acetonitrile.
FIG. 1 shows HPLC purification of exemplary in vitro transcribed mRNA. As shown in FIG. 1, an exemplary mRNA molecule encoding the SARS-CoV-2S protein RBD was successfully produced by the in vitro transcription and maturation process described above, and purified from the reaction system using HPLC.
Example B2: in vitro transfection and antigen expression analysis.
The different mRNA molecules encoding RBD produced in example B1 were transfected into expression cell lines such as HEK293T cultured cells to assess the in vitro expression efficiency of the mRNA molecules.
To assemble the mRNA-lipid complex, 1. Mu.L and 30. Mu.L Opti-MEM were added to each of the two separate tubes TM Mixed with serum-reduced media (Gibco, # 11058021)2000 (Gibco, # 11668019), and 1 μg mRNA mixed with 30 μl Opti-MEM. The two samples were mixed and incubated for 5 minutes at room temperature. Fifty microliters of this complex was used to transfect cells present in 1 well of a 24-well plate and the cells were humidified at 37 ℃/5% CO 2 Incubate in incubator until analysis.
Expression analysis by FACS. The amount of viral peptide or protein encoded by mRNA expressed on the cell surface can be determined by FACS. Cells were transferred from the 24 hour post-transfection culture and at room temperatureCentrifuge at 200RCF for 5 min. Next, the cells were treated with 4% (v/v) paraformaldehyde for 30 minutes and washed with PBS. Next, the cells were treated with 0.2% (v/v) Triton X-100 for 10 minutes and washed with PBS. Next, the cells were blocked with 5% (w/v) bovine serum albumin for 1 hour and washed with PBS. Cells were then incubated with several rabbit anti-SARS-CoV-2S protein antibodies for 1 hour at 4℃and labeled with FITC-labeled anti-rabbit antibody as secondary antibody (1:200) for 30 minutes, washed with PBS, and counterstained with DAPI. The signal was checked by confocal laser scanning microscopy.
In particular, FIG. 2 shows confocal fluorescence microscopy images of Hela cells transfected with an exemplary mRNA construct encoding the SARS-CoV-2S protein RBD. Cells were incubated with 3 different monoclonal antibodies recognizing the S protein RBD of SARS-CoV-2, namely SARS-2-H014, SARS-2-mh001 and SARS-2-mh219 (all from Sinobiological), respectively.
As shown in FIG. 2, the in vitro transcribed mRNA molecule encoding the SARS-CoV-2S protein RBD was efficiently transfected into HeLa cells. Transfected Hela cells expressed the encoded viral antigen at satisfactory levels, as can be recognized by the three monoclonal antibodies used in this study. Transfected HeLa cells maintained normal cell morphology, indicating that expression of the encoded viral antigen did not cause cytotoxicity.
Expression analysis by western blot. The amount of viral peptide or protein encoded by the mRNA expressed in the cell culture supernatant was determined by western blotting. For secreted proteins such as SARS-CoV-2S protein RBD, cultures of cells transfected with the mRNA molecules produced in example B1 were collected and analyzed by Western blotting 24 hours after transfection. After SDS-PAGE, proteins were transferred to blotting membranes. The blots were briefly rinsed with PBS and then incubated with added rabbit anti-spike RBD antibody for 2 hours at room temperature. The blots were washed well in PBS. HRP-conjugated anti-rabbit antibody was added and incubated for 1 hour at room temperature with gentle agitation. The membranes were washed with PBS and incubated with the addition of appropriate enzyme substrate solutions to visualize the protein bands.
FIG. 3 shows Western blot analysis of samples derived from Hela cells transfected with an exemplary mRNA molecule encoding the SARS-CoV-2S protein RBD. In particular, lanes labeled "RBD sample 1" and "RBD sample 2" (membrane bound or secreted) were loaded with samples derived from Hela cells transfected with the mRNA constructs encoding SARS-CoV-2S protein RBD described herein. Lanes labeled "rRBD-His" were loaded with recombinantly produced SARS-CoV-2S protein RBD sequence fused to the C-terminal His-tag. Lanes labeled "NT" were loaded with cell culture supernatants of Hela cells transfected with unrelated mRNA constructs as a negative control.
As shown in FIG. 3, an exemplary in vitro transcribed mRNA construct encoding the SARS-CoV-2S protein RBD was efficiently transfected into HeLa cells. Transfected HeLa cells expressed and secreted the encoded viral antigen at satisfactory levels. A band around about 30kD corresponds to the secreted viral antigen in monomeric form. The band around about 60kD corresponds to the secreted viral antigen in dimeric form. Without being bound by theory, it is expected that the multimerized form of the secreted viral antigen may be more immunogenic and more effective in inducing a humoral immune response upon administration to a vaccinated subject than the monomeric form. As shown in fig. 3, the viral antigen encoded by the mRNA construct may multimerize upon expression, indicating the effectiveness of the mRNA construct in eliciting an immune response against the virus upon administration to a subject.
Expression analysis by ELISA. The amount of viral peptide or protein encoded by mRNA expressed in cell culture supernatants was determined by ELISA using SARS-CoV-2 (2019-nCoV) spike RBD ELISA kit (SinoBiological, KIT 40592). In particular, 96-well microplates coated with capture antibodies were washed 3 times with wash buffer. Subsequently, a sample of the culture supernatant, appropriately diluted, and a SARS-CoV-2S protein RBD standard were added to the relevant wells in duplicate at 100 μl/well. Next, the microwell plates were incubated at room temperature for 2 hours and washed 3 times with wash buffer. Next, 100 μl of HRP-conjugated detection antibody diluted to working concentration was added to each well of the microplate. Next, the microwell plates were covered and incubated for 1 hour at room temperature, and washed 3 times with wash buffer. Then, to eachTo each well was added 200. Mu.l of a substrate solution prepared from a chromogenic reagent A and a chromogenic reagent B, and the microwell plate was incubated at room temperature in the dark for 20 minutes. Next, 50. Mu.L of stop solution was added to each well and gently mixed well. Next, the absorbance at 450/620nm was read on SpectraMax ID5 (Molecular Devices) and the data was subjected to four-parameter fitting to calculate the expression level of mRNA encoded RBD.
FIG. 4A shows ELISA assays measuring protein concentration (ng/mL) of mRNA-encoded S-RBD in culture supernatants of cells transfected with two exemplary mRNA constructs, respectively designated "delta RBD" (SEQ ID NO: 67) and "wild-type RBD" (SEQ ID NO: 64). This study further demonstrates that cells transfected with the mRNA construct express and secrete the encoded viral antigen at satisfactory levels as quantified by ELISA.
Example B2a: in vitro transfection and antigen expression analysis.
Different mRNA molecules encoding RBDs were transfected into expression cell lines such as HEK293T culture cells to assess the in vitro expression efficiency of the mRNA molecules.
To assemble the mRNA-lipid complex, 3. Mu.L and 47. Mu.L Opti-MEM were added to each of the two separate tubes TM Mixed with serum-reduced media (Gibco, # 11058021)2000 (Gibco, # 11668019), and 3. Mu.g mRNA in 50. Mu.L Opti-MEM. The two samples were mixed and incubated for 5 minutes at room temperature. One hundred microliters of this complex was used to transfect cells present in 1 well of a 6 well plate and the cells were humidified at 37 ℃/5% CO 2 Incubate in incubator until analysis.
Expression analysis by ELISA. The amount of viral peptide or protein encoded by the mRNA expressed in the cell culture supernatant is determined by ELISA. In particular, 96-well microplates coated with human ACE2 (Kactus, ACE-HM 401) were washed 3 times with wash buffer. After 1 hour of blocking, the appropriately diluted culture supernatant samples and SARS-CoV-2S protein RBD standard were added to the relevant wells in duplicate at 100 μl/well and Incubate for 1 hour at room temperature. After 3 washes, 100. Mu.L of anti-SARS-CoV-2S protein RBD antibody was added to each well and incubated at 37℃for 1 hour. After 3 washes, HRP-conjugated detection antibodies diluted to working concentration were added to each well of the microplate. Next, the microwell plates were covered and incubated at 37℃for 1 hour, and washed 3 times with wash buffer. Next, 100. Mu.l of TMB substrate solution was added to each well, and the microwell plate was incubated in the dark at room temperature for 5 minutes. Next, 100. Mu.L of stop solution was added to each well and gently mixed well. Next, the absorbance at 450/620nm was read on SpectraMax ID5 (Molecular Devices) and the data was subjected to four-parameter fitting to calculate the expression level of mRNA encoded RBD.
FIG. 4A shows ELISA assays measuring protein concentration (μg/mL) of mRNA encoded S-RBD in culture supernatants of cells transfected with 12 exemplary mRNA constructs, respectively. This study further demonstrates that cells transfected with the mRNA construct express and secrete the encoded viral antigen at satisfactory levels as quantified by ELISA.
EXAMPLE B3 preparation of mRNA-containing LNP
LNP containing mRNA was prepared according to the procedure provided in example 05 above, wherein lipids were prepared according to the procedure provided in examples 01 to 04 above, and mRNA was prepared according to the procedure provided in example B1 above.
Example B4. production of neutralizing antibodies in mice vaccinated with LNP containing mRNA
BALB/c mice were vaccinated by intramuscular injection of 100. Mu.L of LNP formulation containing 10. Mu.g of mRNA encoding the SARS-CoV-2S protein RBD, and blood was collected from the tail vein on days 7, 14, 21 and 28, respectively, after vaccination. One group of vaccinated mice was also boosted by receiving a second intramuscular injection of the same dose of LNP formulation containing mRNA 14 days after the first injection and blood was collected from the tail vein on days 7, 14, 21 and 28 after the second boost injection. The 50% plaque reduction neutralization titer (PRNT 50) value of the collected mouse serum was determined to assess neutralizing antibody production in vaccinated animals.
PRNT assay. For Plaque Reduction Neutralization Titer (PRNT) assays, the serum samples or antibody solutions to be tested are diluted and mixed with a viral suspension. The mixture is then incubated to react the antibodies with the virus. Next, the mixture was poured onto a confluent monolayer of host cells. The surface of the cell layer is covered with a layer of agarose or carboxymethyl cellulose to prevent the virus from being transmitted by one person. The concentration of Plaque Forming Units (PFU) can be estimated by the number of plaques (areas of infected cells) formed after a few days. Depending on the virus, plaque forming units can be measured by microscopic observation of fluorescent antibodies or specific dyes that react with infected cells. A 50% reduction in plaque number compared to serum-free virus can be a measure of the amount or effectiveness of antibodies present. This measurement is denoted as PRNT 50 value.
In particular, in this study, mouse serum collected as described above was heat-inactivated at 55 ℃ for 30 minutes, then serially diluted to 1:50, 1:100, 1:200, 1:400, and 1:800 in PBS. To each serum dilution was added an equal volume of PBS containing 100PFU of SARS-CoV-2 pseudovirus. Each mixture was incubated at 37 ℃ for 30 minutes, added to the confluent culture of Vero E6 monolayers, and allowed to incubate at 37 ℃ for 60 minutes. Cell monolayers were covered with 4ml of 0.8% agarose thawed in standard Vero E6 cell culture medium and plaques were resolved with neutral red staining after 2 days. The PRNT 50 value is then calculated and plotted in fig. 5. In particular, the Y-axis shows the inverse of the PRNT 50 value (i.e., 1/PRNT 50). The X-axis shows the following animal groups: "RBD" means mice that received only the first injection, and "RBD-B" means mice that received both the first injection and booster injection. "control" means a group of mice that received an intramuscular injection of 100 μl of LNP formulation without mRNA and were boosted with the same dose of blank LNP after 14 days.
As shown in fig. 5, animals vaccinated with LNP containing exemplary therapeutic mRNA produced neutralizing antibodies that significantly reduced infection of cells with SARS-CoV-2. This study demonstrates that LNP compositions of the invention containing therapeutic mRNA can be used to treat, control or prevent infection by the coronavirus SARS-CoV-2.
Example B5. production of neutralizing antibodies in mice vaccinated with LNP containing mRNA
BALB/c mice were vaccinated by intramuscular injection of 100. Mu.L of LNP formulation containing 2. Mu.g of mRNA encoding the SARS-CoV-2S protein RBD from the initial (SEQ ID NO: 64) or delta (SEQ ID NO: 67) strain (PBS as a blank) and blood was taken from the tail vein on day 21 after vaccination. The 50% neutralization titer (NT 50) value of the collected mouse serum was determined to evaluate neutralizing antibody production in vaccinated animals.
NT50 determination. Mouse serum collected on day 21 post-vaccination as described above was heat-inactivated at 56 ℃ for 30 minutes, then diluted 1:30, 1:90, 1:270, 1:810, 1:2430, 1:7290 and 1:21870. To each serum dilution was added an equal volume of PBS containing 500pfu of pseudovirus (Vazyme) of wild-type or delta strain of SARS-CoV-2. Each mixture was incubated at 37 ℃ for 60 minutes and then added to 96-well whiteboards containing 2 x 10 each 4 Individual wells of live HEK293-ACE2 cells (Vazyme) were incubated for 48 hours at 37 ℃. After incubation, luciferase reporter detection reagent was added to wells on a 96-well whiteboard and allowed to react in the dark at room temperature for 4 to 5 minutes. A microplate reader was used to detect chemiluminescence (RLU). The 50% Neutralization Titer (NT) was then calculated using Reed-Muench 50 ) Values. The results are summarized in the following table and plotted in fig. 6.
As shown in fig. 6, animals vaccinated with LNP containing therapeutic mRNA produced neutralizing antibodies that significantly reduced infection of cells with SARS-CoV-2 (both the initial strain and the delta strain). In particular, the mRNA vaccine encoding RBD from the mutant sequence of the delta strain (SEQ ID NO: 67) was stronger in inducing neutralizing antibodies against both the pseudovirus having RBD from the wild type sequence of the initial strain and the pseudovirus having RBD from the mutant sequence of the delta strain than the mRNA vaccine encoding RBD from the wild type sequence of the initial strain (SEQ ID NO: 64). This study demonstrates that LNP compositions of the invention containing therapeutic mRNA can be used to treat, control, or prevent infection by coronavirus SARS-CoV-2 (including both the initial strain and the delta strain).
Example B6: antigen immunogenicity analysis
The purpose of the following experiments was to assess the immunogenicity of the SARS-CoV-2S protein RBD expressed by the RBD-mRNA-LNP of the invention.
The number of animals in each group and the detailed immunization routes, dosages and protocols are shown in the table below. Experimental animals BALB/c mice received test antigen (10. Mu.g/50. Mu.L/mouse) on day 0 on the right hind limb by single point intramuscular injection. The same dose of test vaccine was vaccinated again on day 14. The detailed methods of administration, amounts of administration and routes of administration are as follows:
Annotation: a: the day of first immunization was defined as day 0.
Serum samples were collected on day 21 for determination of RBD-specific IgG titers. In this experiment, igG titer detection was performed using the "mouse anti-novel coronavirus (2019-nCoV) S-RBD protein IgG antibody detection kit" developed by Wantai BioPharm. Test serum samples were diluted with sample diluent at a 10-fold gradient starting at 1:10 and gently shaken to mix thoroughly. 100 μl of each of the diluted sample, negative control, and positive control was added to each well. The plate is sealed with a sealing film. After incubation at 37 ℃ for 30 minutes, the sealing film was removed and the plate was washed 5 times, 300 μl each, and dried at the last time. 100. Mu.L of ELISA reagent was added to each well, except for blank wells. After incubation at 37 ℃ for 30 minutes, the sealing membrane was removed and the plates were washed 5 times, 300 μl each. 50mL of each of the color developers A and B was added to each well, gently shaken to mix well, and developed for 15 minutes at 37℃in the absence of light. To each well 50 μl of stop solution was added and gently mixed well. The results were measured within 10 minutes. The wavelength of the microplate reader was set at 450nm. The maximum dilution factor that detected as positive was selected, and the titer result was the OD value of the maximum positive dilution factor/0.1 x the corresponding dilution factor.
Specifically, mice were immunized with a single dose (10 μg) of mRNA vaccine on day 0, and a booster dose (10 μg) was given on day 14. anti-S-RBD IgG antibody levels were detected in mouse serum samples 21 days post-immunization. The results are shown in fig. 7 and the following table.
The results clearly demonstrate that the vaccine products described in the present invention are strongly immunogenic and are capable of specifically inducing the production of relevant antibodies to achieve the effect of controlling or preventing infection by SARS-CoV-2 (including both the initial strain and the delta strain). In particular, mRNA vaccines encoding RBDs from mutant sequences of delta strains (SEQ ID Nos: 66 and 67) induced higher titers of IgG binding to RBDs from wild type sequences of the initial strain and higher titers of IgG binding to RBDs from mutant sequences of delta strains than mRNA vaccines encoding RBDs from wild type sequences of the initial strain (SEQ ID NO: 64). Furthermore, an mRNA vaccine (SEQ ID NO: 67) with an optimized nucleotide sequence encoding RBD from the mutant sequence of the delta strain induced even higher titers of IgG binding to RBD from the wild-type sequence of the original strain and higher titers of IgG binding to RBD from the mutant sequence of the delta strain than an mRNA vaccine (SEQ ID NO: 66) with an un-optimized nucleotide sequence encoding RBD from the mutant sequence of the delta strain.

Claims (19)

1. A non-naturally occurring nucleic acid comprising a nucleotide sequence encoding a Receptor Binding Domain (RBD) of a spike (S) protein of a Delta strain of SARS-CoV-2 or a fragment thereof, wherein the RBD consists essentially of, or comprises: the amino acid sequence set forth in SEQ ID NO. 60.
2. The non-naturally occurring nucleic acid of claim 1, wherein the coding nucleotide sequence consists of, consists essentially of, or comprises: a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the nucleotide sequence set forth in SEQ ID NO. 61.
3. The non-naturally occurring nucleic acid of claim 2, wherein the coding nucleotide sequence consists of, consists essentially of, or comprises: the nucleotide sequence set forth in SEQ ID NO. 61 or 62.
4. The non-naturally occurring nucleic acid of claim 1, wherein the coding nucleotide sequence has been codon optimized for expression in a cell of a subject, wherein the subject is a human.
5. The non-naturally occurring nucleic acid of claim 4, wherein the coding nucleotide sequence consists of, consists essentially of, or comprises: a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the nucleotide sequence set forth in SEQ ID NO. 63.
6. The non-naturally occurring nucleic acid of any one of claims 1 to 5, wherein the RBD is fused to a heterologous polypeptide, wherein the heterologous polypeptide is a signal peptide.
7. The non-naturally occurring nucleic acid of any one of claims 1 to 6, further comprising a 5' untranslated region (5 ' -UTR), wherein said 5' -UTR comprises a sequence set forth in any one of SEQ ID NOs 46-51; and/or the non-naturally occurring nucleic acid further comprises a 3 'untranslated region (3' -UTR), wherein the 3'-UTR comprises the sequence set forth in any one of SEQ ID NOS: 52-57, optionally wherein the 3' -UTR further comprises a poly-A tail or a polyadenylation signal.
8. The non-naturally occurring nucleic acid of any one of claims 1 to 7, in combination with at least one other non-naturally occurring nucleic acid comprising at least one other coding nucleotide sequence encoding at least one other peptide or polypeptide, optionally encoding a Receptor Binding Domain (RBD) of spike (S) protein of a SARS-CoV-2 strain other than the Delta strain, or a fragment thereof.
9. The non-naturally occurring nucleic acid of any one of claims 1 to 7, comprising at least one other encoding nucleotide sequence encoding at least one other peptide or polypeptide, optionally encoding a Receptor Binding Domain (RBD) of spike (S) protein of a SARS-CoV-2 strain other than the Delta strain, or fragment thereof.
10. The non-naturally occurring nucleic acid of any one of claims 1 to 9, wherein the nucleic acid is DNA or mRNA.
11. A vector comprising the non-naturally occurring nucleic acid of any one of claims 1 to 10.
12. A cell comprising the non-naturally occurring nucleic acid of any one of claims 1 to 10 or the vector of claim 11.
13. A pharmaceutical composition comprising the non-naturally occurring nucleic acid of any one of claims 1 to 10 and at least a first lipid, wherein the first lipid is a compound according to formula 01-I or 01-II; or a compound listed in Table 01-1; or a compound according to formula 02-I; or a compound listed in Table 02-1; or a compound according to formula 03-I; or a compound listed in Table 03-1; or a compound according to formula 04-I; or the compounds listed in Table 04-1.
14. The pharmaceutical composition of claim 13, further comprising a second lipid, wherein the second lipid is a compound according to formula 05-I.
15. The pharmaceutical composition of claim 13 or 14, formulated as a lipid nanoparticle encapsulating the nucleic acid in a lipid shell.
16. The pharmaceutical composition of any one of claims 13 to 15, wherein the composition is a vaccine.
17. A method for controlling, preventing or treating an infectious disease caused by a coronavirus in a subject, the method comprising administering to the subject a therapeutically effective amount of the non-naturally occurring nucleic acid of any one of claims 1 to 10 or the composition of any one of claims 13 to 16.
18. The method of claim 17, wherein an immune response against the coronavirus is elicited in the subject.
19. The method of claim 18, wherein the immune response comprises generating antibodies that specifically bind to the viral RBD encoded by the nucleic acid.
CN202280006935.3A 2021-10-08 2022-10-07 Coronavirus nucleic acid vaccine based on sequences derived from SARS-CoV-2Delta strain Pending CN117083291A (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
CNPCT/CN2021/122702 2021-10-08
CN2021122702 2021-10-08
CN2022118782 2022-09-14
CNPCT/CN2022/118782 2022-09-14
PCT/CN2022/123720 WO2023056913A1 (en) 2021-10-08 2022-10-07 NUCLEIC ACID VACCINES FOR CORONAVIRUS BASED ON SEQUENCES DERIVED FROM SARS-CoV-2 DELTA STRAIN

Publications (1)

Publication Number Publication Date
CN117083291A true CN117083291A (en) 2023-11-17

Family

ID=85803170

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202280006935.3A Pending CN117083291A (en) 2021-10-08 2022-10-07 Coronavirus nucleic acid vaccine based on sequences derived from SARS-CoV-2Delta strain

Country Status (3)

Country Link
CN (1) CN117083291A (en)
AR (1) AR127311A1 (en)
WO (1) WO2023056913A1 (en)

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA3167611A1 (en) * 2020-02-13 2021-08-19 Etienne Simon-Loriere Nucleic acid vaccine against the sars-cov-2 coronavirus
CN111393532B (en) * 2020-02-26 2021-10-12 北京丹大生物技术有限公司 Novel coronavirus dominant epitope fusion protein, diagnostic reagent and application
CN111218458B (en) * 2020-02-27 2020-11-20 珠海丽凡达生物技术有限公司 mRNAs encoding SARS-CoV-2 virus antigen and vaccine and preparation method of vaccine
CN113151312B (en) * 2020-03-02 2022-12-09 中国科学院微生物研究所 Novel coronavirus SARS-CoV-2mRNA vaccine and its preparation method and application
CA3170575A1 (en) * 2020-03-06 2021-09-10 Michael Gordon Joyce Vaccines against sars-cov-2 and other coronaviruses
CN113018449B (en) * 2021-05-14 2021-09-07 苏州艾博生物科技有限公司 Cationic lipid compounds, compositions containing the same and uses thereof
CN112979483B (en) * 2021-05-14 2021-08-06 苏州艾博生物科技有限公司 Cationic lipid compound, composition containing same and application
CN113046369B (en) * 2021-05-24 2021-08-10 中国科学院微生物研究所 Novel mRNA vaccine of coronavirus

Also Published As

Publication number Publication date
AR127311A1 (en) 2024-01-10
WO2023056913A1 (en) 2023-04-13

Similar Documents

Publication Publication Date Title
US11510977B2 (en) Nucleic acid vaccines for coronavirus
US11472766B2 (en) Lipid nanoparticle composition
US20230053437A1 (en) Lipid compounds and lipid nanoparticle compositions
CN116940685A (en) Coronavirus multivalent nucleic acid vaccine based on sequences derived from SARS-CoV-2Beta and Delta strains
CN117580587A (en) Coronavirus nucleic acid vaccine based on sequences derived from SARS-CoV-2 Omikovia strain
CN117460827A (en) Nucleic acid vaccine for rabies
US11964052B2 (en) Lipid compounds and lipid nanoparticle compositions
CN116670267A (en) Tetravalent mRNA vaccine for influenza virus
CN116829578A (en) Polynucleotides encoding interleukin-12 (IL-12) and compositions and methods related thereto
CN116064598B (en) Nucleic acid vaccine for coronavirus
CN117083291A (en) Coronavirus nucleic acid vaccine based on sequences derived from SARS-CoV-2Delta strain
WO2024067861A1 (en) MULTIVALENT NUCLEIC ACID VACCINES FOR CORONAVIRUS BASED ON SEQUENCES DERIVED FROM SARS-CoV-2 DELTA AND OMICRON STRAINS
WO2023056912A1 (en) Nucleic acid vaccines for vzv
WO2023006062A1 (en) Nucleic acid vaccines for mutant coronavirus
CN114391008B (en) Lipid compounds and lipid nanoparticle compositions
US20220331414A1 (en) Lipid compounds and lipid nanoparticle compositions
CN117069785A (en) Lipid compounds and lipid nanoparticle compositions

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination