CN113186203B - Vaccine agent for treating or preventing coronavirus diseases - Google Patents

Abstract

The present invention provides a vaccine agent for the treatment or prevention of a coronavirus disease, which agent comprises an mRNA fragment of a coronavirus antigen, or relates to an improved nucleic acid fragment for use in the preparation of a coronavirus vaccine agent.

Description

Vaccine agent for treating or preventing coronavirus diseases

Related document

The present application claims priority, application number, of the following prior applications: 202010090564.4; application date 2020, 2 month 13; application No.: 202010418211.2, filing date 2020, 5/18; application No.: 202010767364.8, filing date 2020, 8/03; the disclosure of these documents is made as part of the present invention.

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a vaccine or a vaccine reagent for treating and preventing coronavirus infection.

Background

The description of the background art is intended to be merely a general description of the invention in order to facilitate an understanding of the invention and is not intended to limit the invention in any way.

Coronavirus infection is distributed in many areas throughout the world, and infection by the virus occurs mainly in winter and early spring. Human diseases caused by coronaviruses are mainly respiratory infections, which are very temperature sensitive and grow well at 33 ℃ but are inhibited at 35 ℃. Due to this property, winter and early spring are the epidemic seasons of the viral disease. Coronavirus is one of the main pathogens of common cold of adults and also an important pathogen for acute exacerbation of adult chronic tracheitis patients.

There is a need to develop a prophylactic as well as a therapeutic vaccine agent that can produce antibodies in humans or mammals against coronavirus infection or to treat humans or mammals infected with coronavirus.

Disclosure of Invention

The present invention provides a coronavirus vaccine agent having preventive and therapeutic effects, which can exert both the preventive and therapeutic effects on a coronavirus disease and the therapeutic effects on the disease.

In one aspect, the present invention provides a vaccine agent comprising an mRNA fragment of a coronavirus antigen, wherein the mRNA fragment comprises one or a combination of S, S1, RBD, N, E, M, etc. antigen sequences. In some embodiments, the fragment portions are optimized or modified manually.

The coronavirus herein is a human or mammalian coronavirus. In some embodiments, the coronavirus is one of Severe Acute Respiratory Syndrome (SARS), middle East Respiratory Syndrome (MERS), and new coronary pneumonia (COVID-19). In some embodiments, the coronavirus virus is one or more of HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU 1.

In some forms, the mRNA sequence is selected from SEQ NOs: 1.1-1.9. In some forms, the sequence is SEQ NO:1.1. in some embodiments, the mRNA sequence is modified by nucleic acid, the ratio of modification being 20-100%. In some embodiments, the modification is modification of uridine with 1-methylpseudouracil. The structure of 1-methyl pseudouracil is as follows:

in some embodiments, the modification is a modification of uridine with 1-methylpseudouracil at a ratio of 50%.

In some embodiments, the nucleic acid further comprises a cap structure. In some aspects, the cap structure is as follows:

the additional cap is at the 5' end. In some embodiments, capping may also be performed at the 3' end.

In some embodiments, the nucleic acid is encapsulated, and the encapsulated structure comprises a core structure formed by mixing the nucleic acid with a polymer or protein. In some embodiments, the core structure further comprises a shell structure, such as a shell structure formed by a phospholipid.

In another aspect, the invention provides a DNA sequence as set forth in SEQ NO:1. the amino acid sequence of SEQ NO:2. the amino acid sequence of SEQ NO:3. the amino acid sequence of SEQ NO:4. the amino acid sequence of SEQ NO:5. the amino acid sequence of SEQ NO:6. the amino acid sequence of SEQ NO:7. The amino acid sequence of SEQ NO:8 or SEQ NO:9, or a sequence having 60% to 100% homology to one of said arbitrary sequences, or a sequence functionally identical thereto. Or the sequences may be complementary.

In some embodiments, the sequence is SEQ NO:1, SEQ NO:2. the amino acid sequence of SEQ NO:4. the amino acid sequence of SEQ NO:5. The amino acid sequence of SEQ NO:8 or SEQ NO: 9; or a sequence functionally equivalent thereto.

In some forms, the sequence is SEQ NO:1, or a fragment thereof.

In some embodiments, the sequence further comprises at the 5' end the sequence as set forth in SEQ NO:11, and (c) the sequence shown in fig. 11.

In some embodiments, the sequence further comprises at the 5' end the sequence as set forth in SEQ NO:12, or a sequence shown in figure 12.

In some embodiments, the sequence further comprises at the 3' end the sequence as set forth in SEQ NO:13, or a sequence shown in figure 13.

In some embodiments, the sequence further comprises at the 3' end the sequence as set forth in SEQ NO:14, or a sequence shown in fig. 14.

In some embodiments, a tail sequence is also included. In some preferred forms, the tail sequence is SEQ NO:15, or a pharmaceutically acceptable salt thereof.

In some embodiments, the homology is 65-100%. In some embodiments, the homology is 70-100%. In some embodiments, the homology is 71-100%. In some embodiments, the homology is 73-100%. In some embodiments, the homology is 74-100%. In some embodiments, the homology is 100%.

In some forms, the polypeptide has a sequence identical to SEQ NO:1, the homology of the sequence shown in the formula 1 is 70-100%; and SEQ NO:3, the homology of the sequence shown in the sequence is 74-100 percent; and SEQ NO:5, sequences with 70-100% homology; and SEQ NO:6 with 65-100% homology; and SEQ NO:7, and 65-100% of the sequence shown in the sequence table; and SEQ NO:8, the sequence with 70-100% of homology; or with SEQ NO:9 said sequence homology is 70-100% sequence.

In another aspect, the present invention provides an RNA sequence as set forth in SEQ NO:1.1, SEQ NO:2.2, SEQ NO:3.3, SEQ NO:4.4, SEQ NO:5.5, SEQ NO:6.6, SEQ NO:7.7, SEQ NO:8.8 or SEQ NO:9.9, or 60% to 100% homologous to one of said sequences; or a sequence functionally identical thereto, or a sequence complementary thereto. In some preferred forms, the sequence is SEQ NO:1.1, SEQ NO:2.2, SEQ NO:4.4, SEQ NO:5.5, SEQ NO:8.8 or SEQ NO:9.9 one or more of the sequences shown; or 60% to 100% homology to one of said sequences.

In some preferred forms, the sequence is SEQ NO:1 or a sequence having 60% to 100% homology to said sequence. In some preferred forms, the homology is between 65 and 100%. In some preferred modes, the homology is 75 to 100%. In some preferred forms, the homology is between 85 and 100%. In some preferred forms, the homology is 95 to 100%. In some preferred forms, the homology is between 98 and 100%. In some preferred forms, wherein the homology is 99-100%. In some preferred forms, the homology is 100%.

In some preferred modes, the sequence further comprises a sequence such as UTR at the 5 'end of the sequence and/or a sequence such as UTR at the 3' end of the sequence. In some embodiments, the 5-terminal further comprises a promoter region. In some embodiments, the 3-end further comprises a tail structure. In some preferred forms, the sequence further comprises at the 5' end the sequence as set forth in SEQ NO:36-1 to SEQ NO: 36-12. In some preferred forms, the sequence further comprises at the 5' end thereof a sequence as set forth in SEQ NO:36-11 or SEQ NO: 36-12. In some preferred forms, the sequence further comprises at the 3' end the sequence as set forth in SEQ NO:37-1 to SEQ NO: 37-12. In some preferred forms, the sequence further comprises at the 3' end the sequence as set forth in SEQ NO:37-11 or SEQ NO: 37-12. In some embodiments, the sequence may also be at the 5' end as set forth in SEQ NO:11, and (c) the sequence shown in fig. 11. In some embodiments, the sequence may also be at the 5' end as set forth in SEQ NO:12, the sequence shown in figure. In some embodiments, the sequence may also be, at the 3' end of the sequence, as set forth in SEQ NO:13, or a sequence shown in figure 13.

In some embodiments, the sequence further comprises at the 3' end the sequence as set forth in SEQ NO:14, or a sequence shown in fig. 14.

In some embodiments, the 3-terminal further comprises a tail sequence of SEQ NO:15, or a pharmaceutically acceptable salt thereof.

In some modes, the 5-end also comprises a promoter, and in some modes, the sequence of the promoter is the sequence shown in SEQ ID NO. 12.

In some embodiments, the sequence further includes the additional sequence shown in SEQ ID NO 38 or SEQ ID NO 39. In some forms, these sequences are inserted after the AUG nucleotide. In some embodiments, the additional sequence is at the 5-terminus.

In some embodiments, the RNA sequence comprises an ORF sequence, a promoter sequence, a 5'UTR sequence and/or a 3' UTR sequence. In some embodiments, the ORF sequence comprises the additional sequence. In some modes, the following modes are sequentially adopted according to the sequencing mode from the 5 end to the 3' end: promoter sequence-5 'end UTR sequence-ORF sequence-3' end UTR sequence-tail sequence.

In another aspect, the invention provides a coronavirus mRNA vaccine agent, said vaccine agent comprising an mRNA sequence according to any of the claims, or an mRNA sequence obtained from the in vitro inversion rate of a DNA sequence according to any of the preceding claims.

In some embodiments, the mRNA includes modified nucleotides, wherein the modified nucleotides are selected from one or more of the following nucleotides: 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O (6) -methylguanine, pseudouridine, N-1-methyl-pseudouridine, 2-thiouridine, and 2-thiocytidine; a methylated base; an insertion base; 2 '-fluororibose, ribose, 2' -deoxyribose, arabinose, and hexose; a phosphorothioate group and a 5' -N-phosphoramidite linkage. And modified nucleotides as described in PCT/CN2020/074825, PCT/CN 2020/106696. In some forms, the mRNA includes a modified nucleotide, the modified nucleotide being N-1-methyl-pseudouridine.

In some embodiments, the modification ratio is 0.1% to 100%. In some embodiments, the modification ratio is 2% to 90%. In some embodiments, the modification ratio is 5% to 80%. In some embodiments, the modification ratio is 20% to 80%. In some embodiments, the modification ratio is 40% to 70%. In some embodiments, the modification ratio is 50%.

In some embodiments, the reagent further comprises a polymer, the polymer and the nucleotide form a nanoparticle, and the polymer is selected from one or more of the following polymers: polyacrylate, polyalkylcyanoacrylate, polylactide-polyglycolide copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, polyethyleneimine (PEI), or branched PEI. In some embodiments, the agent further comprises a liposome, and the core structure comprising the nucleotide polymer is encapsulated in the liposome to form a nanoparticle.

In some embodiments, the agent further comprises a liposome, and the nucleotide is encapsulated by the liposome to form a nanoparticle. In some embodiments, the liposome is selected from one or more of the following liposomes: cationic lipids, non-cationic lipids, sterol-based lipids, and/or PEG-modified lipids. In some embodiments, the cationic lipid comprises: c12-200, MC3, DLInDMA, DLinkC2DMA, cKK-E12, ICE (imidazolyl), HGT5000, HGT5001, OF-02, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, cpLinDMA, DMOBA, DOcarDAP, DLinDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA and HGT4003, or a combination thereof. In some ways, non-limiting examples of the non-cationic lipid may include ceramide, cephalin, cerebroside, diacylglycerol, 1,2-dipalmitoyl-sn-glycero-3-phosphoryl glycerol sodium salt (DPPG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-distearoyl-sn-glycerol-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine (DPPC), 1,2-dioleyl-sn-glycerol-3-phosphoethanolamine (DOPE), 1,2-dioleyl-sn-glycerol-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DOPC), and DMxft 5364' -dipalmitoyl-sn-3-glycero-3-phosphoethanolamine (DOPC), 1-palmitoyl-2-oleoyl-phosphatidylethanolamine (POPE), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), sphingomyelin, or a combination thereof. In some forms, the sterol-based cationic lipid can comprise no more than 70% of the total lipid in the lipid nanoparticle. In some embodiments, the sterol-based cationic lipid comprises a phosphatidyl compound, phosphatidyl glycerol, phosphatidyl choline, phosphatidyl serine, phosphatidyl ethanolamine, sphingolipids, cerebrosides, and gangliosides, or a combination thereof. In some embodiments, PEG-modified lipids are also included, such as DMG-PEG, DMG-PEG2K, C-PEG, DOGPEG, ceramide PEG, and DSPE-PEG, or combinations thereof.

In some embodiments, the vaccine agent further comprises protamine sulfate, DOPE, DSPE-mPEG2000, and M5, wherein M5 has the structure:

in some embodiments, the M5: DOPE: DSPE-mPEG2000= 49.

The present invention provides a DNA vaccine agent comprising the NDA sequence of any of the preceding claims. In some embodiments, the sequence is selected from the group consisting of SEQ id NO: one or more of 1-9 sequences.

In one aspect, the invention provides a UTR sequence comprising a sequence as set forth in SEQ NO:36-1 to 36-12 of 5'UTR, or' SEQ NO: one or more of the 3' UTR sequences from 37-1 to 37-12. In some forms, the 5' sequence is SEQ NO:36-11,3 is SEQ NO: 37-11; or the 5' sequence is SEQ NO:36-12,3 is SEQ NO: 37-12.

In another aspect, the invention provides a 3' UTR sequence, said sequence comprising; the amino acid sequence of SEQ NO:37-11 or SEQ NO: 37-12.

In another aspect of the invention, there is provided an additional sequence of an RNA for an ORF, said additional sequence being as set forth in SEQ NO:38 or SEQ NO:39, or a sequence shown in seq id no. In some embodiments, the additional sequence is at the 5-terminus. In some forms, the additional sequence is inserted from an AUG sequence. In some embodiments, the ORF sequence of the RNA is one of any of the sequences in any of the preceding embodiments.

Drawings

FIG. 1 is a schematic diagram of the structure of a DNA template in a plasmid, showing that the DNA sequence includes a T1 promoter, a UTR sequence and a joining schematic diagram of an ORF sequence of DNA.

FIG. 2 is a diagram of the structure of an RNA sequence transcribed from a DNA template, and also contains a T7, UTR sequence and PolyA sequence transcribed from a DNA sequence.

FIG. 3 is a graph of the results of antigen expression at the level of liposome-infected cells using the 9 RNA sequences.

FIG. 4 is a comparison of the immunogenicity of 9 mRNA vaccines in mice, where PBS is a blank control, and other nucleocapsid-structured nanoparticles containing different RNA Sequences (ORFs) can be compared in mice, and some are found to be higher than the blank control, some are lower than the blank control, and some are not immunogenic, i.e., they do not cause the production of antibodies or the amount or titer of antibodies by the mammal is low.

FIG. 5 is a graph showing the effect of the vaccine agents screened on the change in body weight of mice (different concentrations of COVID-19-LPP-mRNA immunization C57BL/6 mouse assay).

FIG. 6 is a BALB/c mouse antibody assay dilution curve (for different doses of vaccine reagents)

FIG. 7 is a dilution curve of the C57BL/6 mouse antibody assay (for different doses of vaccine agent).

Figure 8 comparison of specific IgG titers (for different doses of vaccine agent).

Figure 9 is a BALB/c mouse neutralizing antibody titer curve (for different doses of vaccine agents)).

FIG. 10 is a curve of neutralizing antibody titers (for different doses of vaccine agent) for C57BL/6 mice.

Figure 11 is a summary of pseudovirus neutralizing antibody titers (for different doses of vaccine agent) in two mice.

FIG. 12 is a graph of BALB/c mouse neutralizing antibody titers (for different doses of vaccine agents).

FIG. 13 is a graph of neutralizing antibody titers (for various doses of vaccine agent) in C57BL/6 mice

Figure 14 is a summary plot of antibody titers (for different doses of vaccine agent).

Figure 15 is a graph of antibody titer results for different antibody subtypes (different concentrations or different doses of vaccine agent). Wherein FIG. 15A is IgM, FIG. 15B is IgG, and FIG. 15C is IgM.

FIG. 16A is a graph showing the results of the evaluation of the level of antigen-specific T cell responses in mice following immunization with different doses of COVID-LPP-mRNA. FIG. 16B is a graph showing the results of evaluating the level of neutralizing antibodies in the serum of mice after immunization with different doses of COVID-LPP-mRNA (dot-blot).

FIG. 17 is a graph showing the results of the evaluation of the level of neutralizing antibodies in the mouse serum after immunization with different doses of COVID-LPP-mRNA.

FIG. 18 evaluation of the protective effect of the mice against SARS-CoV-2 infection after immunization with COVID-19-LPP-mRNA (Balb/C mouse weight Change)

FIG. 19 is an evaluation of the protective effect of COVID-19-LPP-mRNA immunization on mice against SARS-CoV-2 infection (C57 mouse body weight change).

FIG. 20 is the lung tissue viral load of Balb/C mice on day 4 post challenge, where FIG. 20A shows RNA copy number and FIG. 20B is a comparison of TCID50 titer data.

FIG. 21 is the lung tissue viral load of C57BL/6 mice at day 4 after challenge, where FIG. 21A shows RNA copy number and FIG. 21B is a comparison of TCID50 titer data.

Figure 22 is a pathological section of Balb/C mice lung tissue at day 4 post challenge (different experimental treatments, HD for high dose (top), LD for low dose (middle), and coronavirus comparison (bottom)).

FIG. 23 is a pathological section of C57BL/6 mice lung tissue at day 4 post challenge (different experimental treatments, HD for high dose (double needle DD-up), HD for high dose (single needle SD-up), LD for low dose double needle (DD) and single needle (SD), and contrast with coronavirus (down)).

FIG. 24 shows the results of gRNA detection in lung tissue, trachea and bronchi after experimental monkeys were infected with SARS-CoV-2.

FIG. 25 is a graph showing the results of gRNA detection in lung lavage fluid of experimental monkey infected with SARS-CoV-2.

FIG. 26 is a graph showing the results of gRNA detection in nasal swabs after experimental monkeys were infected with SARS-CoV-2.

FIG. 27 is a graph showing the results of gRNA detection in pharyngeal swabs after experimental monkeys were infected with SARS-CoV-2.

FIG. 28 is a photograph of a lung histological section of control PBS numbered 16139 showing local thickening of the lung septum, mild bleeding, lymphocyte nodules, local thickening of the vessel wall, intraluminal thrombosis, and tracheal intraluminal blood cell-like exudation.

FIG. 29 is a photograph of a histological section of lung tissue from control PBS numbered 16113 showing mild bleeding of the lung space, inflammatory cell infiltration, pigmentation, local vessel wall thickening and intraluminal thrombosis.

FIG. 30 is a photograph of a lung tissue section of control PBS numbered 16217 showing a large thickening of the lung septum, mild to moderate bleeding, lymphocyte nodules, local thickening of the vessel wall, thrombosis in the vessel lumen, histiocyte sloughing in the tracheal lumen, and local carbon deposits.

FIG. 31 is a photograph of a histological section of lung from vaccine group numbered 16145 showing relatively intact alveolar architecture, mild to moderate bleeding of the lung septum and inflammatory cell infiltration.

Fig. 32 is a photograph of a tissue section of the lungs of vaccine group number 16045, showing relatively intact alveolar structure, mild thickening of lung spaces and small inflammatory infiltration of fine lines.

FIG. 33 is a photograph of a histological section of lung from the vaccine group numbered 16175 showing relatively intact alveolar structures, mild thickening of the pulmonary septum, bleeding, and lymphocyte nodules.

Fig. 34 is a photograph of a lung histological section of vaccine group numbered 16249 showing a mild thickening of the lung compartment, mild bleeding, focal dust cell distribution, vascular congestion, inflammatory cell infiltration.

Fig. 35 is a native sequence numbering of SEQ NO:1-1-1 and the optimized sequence SEQ NO:1.1 results of RNA homology comparison.

Figure 36 is the native sequence numbering of SEQ NO:2-2-2 and the optimized sequence SEQ NO:2.2 comparison of RNA homology.

Figure 37 is a native sequence numbering of SEQ NO:3-3-3 and the optimized sequence SEQ NO:3.3 results of RNA homology comparison. Figure 38 is a native sequence numbering of SEQ NO:4-4-4 and the optimized sequence SEQ NO:4.4 comparative result chart of RNA homology.

FIG. 39 is a natural sequence numbering SEQ NO:5-5-5 and the optimized sequence SEQ NO:5.5 results of RNA homology comparison.

Figure 40 is the native sequence numbering SEQ NO:6-6-6 and the optimized sequence SEQ NO:7.7 RNA homology comparison results.

Figure 41 is the native sequence numbering of SEQ NO:7-7-7 and the optimized sequence SEQ NO:7.7 results of RNA homology comparison.

Figure 42 is the native sequence numbering SEQ NO:8-8-8 and the optimized sequence SEQ NO:8.8 comparison of RNA homology.

Figure 43 is the native sequence numbering of SEQ NO:9-9-9 and the optimized sequence SEQ NO:9.1 results of RNA homology comparison.

Detailed Description

Definition of

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The following references provide those skilled in the art with a general definition of many of the terms used in the present invention: the Dictionary of Biochemistry and Molecular Biology (Dictionary of Biochemistry and Molecular Biology), (2 nd edition) j. Stenesh (eds.), wiley-Interscience (1989); the Dictionary of Microbiology and Molecular Biology (Dictionary of Microbiology and Molecular Biology) (3 rd edition), p.singleton and d.sainsbury (eds.), wiley-inter (2007); the Chambers Dictionary of Science and Technology (version 2), P.Walker (eds.), chambers (2007); the vocabulary of Genetics (Glossary of Genetics) (5 th edition), R.Rieger et al (eds.), springer-Verlag (1991); and The Harper collins Dictionary of Biology (The Harper collins Dictionary of Biology), W.G.Hale and J.P. Margham, (eds.), harper collins (1991).

Although any methods and compositions similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and compositions are described herein. For purposes of the present invention, the following terms are defined below for clarity and ease of reference: in accordance with established patent statutory convention, when reference is made to the use of items in this application, including the claims, without numerical designations, it is intended to mean "one or more". The terms "about" and "approximately" are used interchangeably herein and are generally understood to refer to a range of numbers around a given number, as well as all numbers within the recited range of numbers (e.g., "about 5 to 15" means "about 5 to about 15" unless otherwise specified). Moreover, all numerical ranges herein should be understood to include each integer within the range.

As used herein, an "antigenic polypeptide" or "immunogenic polypeptide" is a polypeptide that, when introduced into a vertebrate, reacts with, i.e., is antigenic, and/or induces an immune response in, i.e., is immunogenic, the vertebrate's immune system molecules.

By "biocompatible" is meant a substance that, when exposed to living cells, will support the appropriate cellular activity of the cells without causing undesirable effects in the cells such as changes in the cell life cycle, changes in the rate of cell proliferation, or cytotoxic effects.

The term "biofunctionally equivalent" is well known in the art and is defined herein in further detail. Thus, sequences having from about 85% to about 90%, or more preferably from about 91% to about 95%, or even more preferably from about 96% to about 99% nucleotides that are identical or functionally equivalent to one or more of the nucleotide sequences provided herein are specifically contemplated for use in the practice of the methods and compositions set forth herein.

As used herein, the term "buffer" includes one or more compositions or aqueous solutions thereof that resist fluctuations in pH when an acid or base is added to a solution or composition containing the buffer. This resistance to pH changes is due to the buffer properties of such solutions and may be a function of the particular compound or compounds included in the composition. Thus, a solution or other composition exhibiting buffering activity is referred to as a buffer or buffer solution. Buffers generally do not have the unlimited ability to maintain the pH of a solution or composition; rather, they are generally capable of maintaining a pH within a range, for example, a pH of about 5 to 7.

As used herein, the term "carrier" is intended to include any solvent, dispersion medium, coating, diluent, buffer, isotonic agent, solution, suspension, colloid, inert entity, and the like, or combinations thereof, that is pharmaceutically acceptable for administration to the relevant animal or, if applicable, for therapeutic or diagnostic purposes.

As used herein, the term "DNA segment" refers to a DNA molecule that has been isolated from the total genomic DNA of a particular species. Thus, a DNA segment obtained from a biological sample using one of the compositions disclosed herein refers to one or more DNA segments that have been isolated or purified from the total genomic DNA of the particular species from which they were obtained. Included within the term "DNA segment" are DNA segments and smaller fragments of such segments, as well as recombinant vectors, including, for example, plasmids, cosmids, phages, viruses, and the like.

The term "effective amount," as used herein, refers to an amount capable of treating or ameliorating a disease or condition or capable of producing a desired therapeutic effect.

As used herein, the term "epitope" refers to a portion of a given immunogenic agent that is the target of, i.e., bound by, an antibody or cell surface receptor of the host immune system that has mounted an immune response to the given immunogenic agent, as determined by any method known in the art. Further, an epitope can be defined as a portion of an immunogenic substance that elicits an antibody response or induces a T cell response in an animal, as determined by any method available in the art (see, e.g., geysen et al, 1984). The epitope may be part of any immunogenic substance, such as a protein, polynucleotide, polysaccharide, organic or inorganic chemical, or any combination thereof. The term "epitope" may also be used interchangeably with "antigenic determinant" or "antigenic determinant site".

The term "for example" as used herein is intended to be exemplary only and not intended to be limiting, and should not be construed as referring only to those items explicitly recited in the specification.

As used herein, "heterologous" is defined with respect to a predetermined reference nucleic acid sequence. For example, for a structural gene sequence, a heterologous promoter is defined as a promoter that does not occur naturally adjacent to the reference structural gene, but is placed by laboratory manipulation. Likewise, a heterologous gene or nucleic acid segment is defined as a gene or segment that does not naturally occur adjacent to a reference promoter and/or enhancer element.

As used herein, "homologous," when referring to a polynucleotide, refers to a sequence that, although from a different source, has the same or substantially the same nucleotide sequence. Typically, homologous nucleic acid sequences are derived from closely related genes or organisms having one or more substantially similar genomic sequences. In contrast, "homologous" polynucleotides are polynucleotides that share the same function as polynucleotides from different species or organisms, but may have significantly different primary nucleotide sequences, encoding one or more proteins or polypeptides that perform similar functions or have similar biological activities. An isopolynucleotide can often be derived from two or more (e.g., genetically or phylogenetically) closely related organisms.

As used herein, the term "homology" refers to the degree of complementarity between two or more polynucleotide or polypeptide sequences. The word "identity" may replace the word "homology" when a first nucleic acid or amino acid sequence has a primary sequence that is identical to a second nucleic acid or amino acid sequence. Sequence homology and sequence identity can be determined by analyzing two or more sequences using algorithms and computer programs known in the art. Such methods can be used to assess whether a given sequence has identity or homology to another selected sequence.

The term "identical" or percent "identity," in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, using one of the sequence comparison algorithms described below (or other algorithms available to the skilled artisan), or as measured by visual inspection.

As used herein, the phrase "in need of treatment" refers to the judgment made by a caregiver, such as a doctor or veterinarian, that a patient is in need of (or will benefit from in one or more ways) treatment. Such a determination may be made based on various factors in the area of expertise of the caregiver, and may include the realization that the patient is ill with a disease state that may be treated by one or more compounds or pharmaceutical compositions, such as those set forth herein.

The phrases "isolated" or "biologically pure" refer to a substance that is substantially or essentially free of components that normally accompany the substance in its natural state. Thus, isolated polynucleotides or polypeptides according to the present disclosure preferably do not contain materials normally associated with those polynucleotides or polypeptides in their native or in situ environment.

As used herein, the term "kit" may be used to describe a variation of a portable self-contained housing that includes at least one set of reagents, components or pharmaceutically formulated compositions of the invention. Optionally, such kits may include one or more sets of instructions for using the encapsulated compositions, for example, in a laboratory or clinical application.

"linkage" or "joining" refers to any method known in the art for functionally linking one or more proteins, peptides, nucleic acids, or polynucleotides, including, but not limited to, recombinant fusion, covalent bonding, disulfide bonding, ionic bonding, hydrogen bonding, electrostatic bonding, and the like.

The term "naturally occurring" as used herein when applied to an object refers to the fact that the object may exist in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses), that can be isolated from a source in nature, and that has not been intentionally modified by man in the laboratory, is naturally occurring. As used herein, rodent laboratory species that have been selectively bred according to classical genetics are considered naturally occurring animals.

As used herein, the term "nucleic acid" includes one or more of the following types: polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), and any other type of polynucleotide that is an N-glycoside of a purine or pyrimidine base or a modified purine or pyrimidine base (including abasic sites). The term "nucleic acid", as used herein, also includes covalently bonded polymers of ribonucleosides or deoxyribonucleosides, typically through phosphodiester linkages between subunits, but in some cases through phosphorothioate, methylphosphonate, and the like. "nucleic acid" includes single-and double-stranded DNA and single-and double-stranded RNA. Exemplary nucleic acids include, but are not limited to, gDNA; hnRNA; mRNA; rRNA, tRNA, microrna (miRNA), small interfering RNA (siRNA), small nucleolar RNA (snoRNA), small nuclear RNA (snRNA), and small temporal RNA (stRNA), and the like, and any combination thereof.

The term "operably linked", as used herein, means that the nucleic acid sequences being linked are generally contiguous or substantially contiguous, and, where necessary to join two protein coding regions, contiguous and in reading frame. However, because enhancers generally function when separated from a promoter by thousands of bases, and intronic sequences may be of variable length, some polynucleotide elements may be operably linked but not contiguous.

As used herein, the term "patient" (also interchangeably referred to as "recipient", "subject", "host" or "subject") refers to any host that can be the recipient of one or more vascular access devices discussed herein. In certain aspects, the recipient will be a vertebrate, which is intended to mean any animal species (and preferably, mammalian species, e.g., humans). In certain embodiments, a "patient" refers to any animal host, including, but not limited to, human and non-human primates, avians, reptiles, amphibians, cattle, dogs, goats (caprines), cavines, crow, epines, equines, felines, goats (hircines), rabbits, hares (leporines), wolvens (lupines), murines, sheep, pigs, racines, foxes, and the like, including, but not limited to, domestic livestock, grazing or migratory animals or birds, exotic or zoo specimens, as well as companion animals, pets, and any animal cared by a licensed veterinarian.

The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human, particularly when administered to the human eye. The preparation of aqueous compositions containing proteins as active ingredients is well known in the art. Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions. Alternatively, they may be prepared in solid form suitable for dissolution in, or suspension in, a liquid prior to injection.

As used herein, "pharmaceutically acceptable salt" refers to a salt that retains the desired biological activity of the parent compound and does not produce any undesired toxicological effects. Examples of such salts include, but are not limited to, acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like; and salts with organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, pamoic acid (methylenepamoic acid), alginic acid, naphthoic acid, polyglutamic acid, naphthalenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid; salts with polyvalent metal cations such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, and the like; salts with organic cations formed from N, N' -dibenzylethylenediamine or ethylenediamine; and combinations thereof.

As used herein, the term "plasmid" or "vector" refers to a genetic construct composed of genetic material (i.e., a nucleic acid). Typically, the plasmid or vector contains an origin of replication functional in a bacterial host cell, such as E.coli, and a selectable marker for detecting a bacterial host cell containing the plasmid. Plasmids and vectors of the invention may comprise one or more genetic elements as described herein arranged such that the inserted coding sequence can be transcribed and translated in a suitable expression cell. In addition, the plasmid or vector may include one or more nucleic acid segments, genes, promoters, enhancers, activators, multiple cloning regions, or any combination thereof, including segments obtained or derived from one or more natural and/or artificial sources.

As used herein, the term "polypeptide" is intended to encompass both singular "polypeptides" and plural "polypeptides" and includes any chain of two or more amino acids. Thus, as used herein, terms including, but not limited to, "peptide," "dipeptide," "tripeptide," "protein," "enzyme," "amino acid chain," and "contiguous amino acid sequence" are all encompassed within the definition of "polypeptide," and the term "polypeptide" may be used in place of or interchangeably with any of these terms. The term also includes polypeptides that have undergone or modified by inclusion of one or more non-naturally occurring amino acids, such as, but not limited to, saccharification, acetylation, phosphorylation, amidation, derivatization, proteolytic cleavage, post-translational processing. Conventional nomenclature for polynucleotide and polypeptide structures exists in the art.

For example, the one-and three-letter abbreviations are widely used to describe amino acids: alanine (A; ala), arginine (R; arg), asparagine (N; asn), aspartic acid (D; asp), cysteine (C; cys), glutamine (Q; gln), glutamic acid (E; glu), glycine (G; gly), histidine (H; his), isoleucine (I; ile), leucine (L; leu), methionine (M; met), phenylalanine (F; phe), proline (P; pro), serine (S; ser), threonine (T; thr), tryptophan (W; trp), tyrosine (Y; tyr), valine (V; val), and lysine (K; lys). The amino acid residues described herein are preferably in the "1" isomeric form. However, residues in the "d" isomeric form may be substituted for the l amino acid residue, provided that the desired polypeptide properties are retained.

As used herein, the terms "prevent" and "inhibiting" as used herein refer to the administration of a compound, alone or contained in a pharmaceutical composition, prior to the onset of a clinical symptom of a disease state, to prevent any symptom, aspect or feature of the disease state. Such prevention and inhibition need not be absolutely considered medically useful.

"protein" is used interchangeably herein with "peptide" and "polypeptide" and includes both synthetically, recombinantly or in vitro produced peptides and polypeptides, as well as peptides and polypeptides that are expressed in vivo following administration of a nucleic acid sequence to a host animal or human subject. The term "polypeptide" preferably means any amino acid chain length, including short peptides from about 2 to about 20 amino acid residues in length, oligopeptides from about 10 to about 100 amino acid residues in length, and longer polypeptides including about 100 amino acid residues in length or more. Furthermore, the term is also intended to include enzymes, i.e. functional biomolecules comprising at least one amino acid polymer. The polypeptides and proteins of the invention also include polypeptides and proteins that are or have been post-translationally modified, and include any saccharide or other derivative or conjugate added to the backbone amino acid chain.

"purified", as used herein, means separated from many other compounds or entities. The compound or entity may be partially purified, substantially purified, or pure. A compound or entity is considered pure when it is removed from substantially all other compounds or entities, i.e., preferably at least about 90%, more preferably at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater than 99% pure. A partially or substantially purified compound or entity may remove at least 50%, at least 60%, at least 70%, or at least 80% of the material that is naturally present with it, e.g., cellular material such as cellular proteins and/or nucleic acids.

The term "recombinant" indicates a substance (e.g., a polynucleotide or polypeptide) that has been altered by human intervention, either artificially or by (non-natural) synthesis. The alteration may be made to the substance in its natural environment or state, or to the substance removed from its natural environment or state. Specifically, for example, a promoter sequence is "recombinant" when it is produced by expression of an artificially engineered nucleic acid segment. For example, "recombinant nucleic acids" are made by nucleic acid recombination during, e.g., cloning, DNA shuffling or other procedures, or by chemical or other mutagenesis; a "recombinant polypeptide" or "recombinant protein" is a polypeptide or protein produced by expression of a recombinant nucleic acid; and "recombinant viruses," such as recombinant AAV viruses, are produced by expression of recombinant nucleic acids.

The term "regulatory element", as used herein, refers to a region of a nucleic acid sequence that regulates transcription. Exemplary regulatory elements include, but are not limited to, enhancers, post-transcriptional elements, transcriptional control sequences, and the like.

The term "RNA segment" refers to an RNA molecule that has been isolated from the total cellular RNA of a particular species. Thus, an RNA segment can refer to one or more RNA segments (of natural or synthetic origin) that have been isolated or purified from other RNAs. The term "RNA segment" includes RNA segments and smaller fragments of such segments.

When referring to amino acids, the term "sequence" refers to all or a portion of a linear N-terminal to C-terminal order of amino acids within a given amino acid chain, e.g., a polypeptide or protein; "subsequence" means any contiguous stretch of amino acids within a sequence, e.g., at least 3 contiguous amino acids within a given protein or polypeptide sequence. With respect to nucleotide strands, "sequences" and "subsequences" have similar meanings as related to 5 'to 3' nucleotide sequences.

The term "substantially as set forth in SEQ ID NO: by "the sequence shown by X is meant that the sequence substantially corresponds to SEQ ID NO: x and has relatively few nucleotides (or amino acids in the case of a polypeptide sequence) that are complementary to SEQ ID NO: x is not identical in nucleotide (or amino acid) or is SEQ ID NO: a biological functional equivalent of a nucleotide (or amino acid) of X. The term "biologically functional equivalent" is well known in the art and is defined herein in further detail. Thus, sequences having from about 65% to about 90%, or more preferably from about 85% to about 95%, or even more preferably from about 96% to about 99% nucleotides that are identical or functionally equivalent to one or more of the nucleotide sequences provided herein are specifically contemplated for use in the practice of the present invention. When referring to a sequence as indicated by a certain numbered sequence, the sequence complementary to that sequence is also included. For example as shown in SEQ ID NO: the sequence represented by X includes not only the sequence characteristics of the sequence itself but also naturally the sequence characteristics complementary to the sequence, and "complementary" herein means that substantially all sequences are in one-to-one correspondence, in terms of complementary sequences under the basic common knowledge of biology. For example as shown in SEQ ID NO: x represents a DNA sequence and naturally also includes another DNA sequence complementary to the sequence unless the other sequence is specifically excluded.

Suitable standard nucleic acid hybridization conditions for use in the present invention include, for example, hybridization in 50% formamide, 5X Deng Bo tex (Denhardt's) solution, 5 XSSC, 25mM sodium phosphate, 0.1% SDS and 100. Mu.g/mL denatured salmon sperm DNA for 16 hours at 42 ℃ followed by successive washes with 0.1 XSSC, 0.1% SDS solution at 60 ℃ for 1 hour to remove the desired amount of background signal. The hybridization conditions of the present invention, which are less stringent, include, for example, hybridization in 35% formamide, 5X Deng Bote solution, 5X SSC, 25mM sodium phosphate, 0.1% SDS and 100. Mu.g/mL denatured salmon sperm DNA or E.coli DNA at 42 ℃ for 16 hours, followed by continuous washing with 0.8X SSC, 0.1% SDS at 55 ℃. One of ordinary skill in the art will recognize that such hybridization conditions can be readily adjusted to achieve the desired level of stringency for a particular application.

As used herein, the term "structural gene" is intended to generally describe a polynucleotide, e.g., a gene, that is expressed to produce an encoded peptide, polypeptide, protein, ribozyme, catalytic RNA molecule, or antisense molecule.

The term "subject", as used herein, describes an organism, including mammals such as primates, to which treatment using the compositions of the present invention can be provided. Mammalian species that may benefit from the disclosed treatment methods include, but are not limited to, apes; a chimpanzee; an orangutan; a human being; a monkey; domestic animals such as dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and other animals such as mice, rats, guinea pigs, and hamsters.

The term "substantially complementary", when used to define an amino acid or nucleic acid sequence, means that a particular target sequence, such as an oligonucleotide sequence, is substantially complementary to all or a portion of a selected sequence and, thus, will specifically bind to a portion of the mRNA encoding the selected sequence. Thus, typically the sequence will be highly complementary to an mRNA "target" sequence, and will have no more than about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10, etc., base mismatches in the complementary portion of the sequence. In many cases, it may be desirable for the sequences to be exact matches, i.e., completely complementary to the sequence to which the oligonucleotide specifically binds, and thus have zero mismatches along the complementary segment. Thus, a highly complementary sequence will typically bind rather specifically to a target sequence region of an mRNA and will therefore efficiently reduce and/or even inhibit translation of the target mRNA sequence into a polypeptide product.

A substantially complementary nucleic acid sequence will be greater than about 80% complementary (or "exact match") to a corresponding nucleic acid target sequence that specifically binds to the nucleic acid, and will more preferably be greater than about 85% complementary to a corresponding target sequence that specifically binds to the nucleic acid. In certain aspects, as described above, it would be desirable to have an even more substantially complementary nucleic acid sequence for use in the practice of the present invention, and in such cases, the nucleic acid sequence would be greater than about 90% complementary to a corresponding target sequence that specifically binds to the nucleic acid, and in certain embodiments may be greater than about 95% complementary to a corresponding target sequence that specifically binds to the nucleic acid, and even up to and including about 96%, about 97%, about 98%, about 99%, and even about 100% exact match complementary to all or part of the target sequence that specifically binds to the designed nucleic acid.

The percent similarity or percent complementarity of any of the disclosed nucleic acid sequences can be determined, for example, by comparing sequence information using the GAP Computer program available from the University of Wisconsin Genetics Computer Group (University of Wisconsin Genetics Computer Group, UWGCG), version 6.0. The GAP program utilizes the alignment method of Needleman and Wunsch (1970). Briefly, the GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids) that are similar divided by the total number of symbols in the shorter of the two sequences. Preferred default parameters for the GAP program include: (1) Unary comparison matrices of nucleotides (containing a value of 1 for identity and a value of 0 for non-identity), and weighted comparison matrices of Gribskov and Burgess (1986), 2) a penalty of 3.0 per gap and an additional 0.10 penalty per symbol in each gap; and (3) no penalty for end gap.

Naturally, the invention also encompasses nucleic acid segments that are complementary, essentially complementary, and/or substantially complementary to at least one or more of the specific nucleotide sequences specifically set forth herein. A "complementary" nucleic acid sequence is one that is capable of base pairing according to standard Watson-Crick complementarity rules. As used herein, the term "complementary sequence" refers to a substantially complementary nucleic acid sequence, which can be assessed by the same nucleotide comparison set forth above, or defined as capable of hybridizing to one or more of the specific nucleic acid segments disclosed herein under comparatively stringent conditions, such as those described immediately above.

As used herein, the term "substantially free" or "essentially free" in relation to the amount of a component preferably means that the composition contains less than about 10% by weight, preferably less than about 5% by weight, more preferably less than about 1% by weight of the compound. In preferred embodiments, these terms refer to less than about 0.5 wt%, less than about 0.1 wt%, or less than about 0.01 wt%.

Probes and primers for use in the present invention may be of any suitable length. By assigning values to sequences, e.g., a first residue is 1, a second residue is 2, etc., an algorithm can be proposed that defines all probes or primers contained within a given sequence: n to n + y, wherein n is an integer from 1 to the last number of sequences and y is the length of the probe or primer minus 1, wherein n + y does not exceed the last number of sequences. Thus, for a 25 base pair probe or primer (i.e., a "25 mer"), the collection of probes or primers corresponds to bases 1 to 25, bases 2 to 26, bases 3 to 27, bases 4 to 28, etc., over the entire length of the sequence. Similarly, for a 35 base pair probe or primer (i.e., "35 mer"), exemplary primer or probe sequences include, but are not limited to, sequences corresponding to bases 1 to 35, bases 2 to 36, bases 3 to 37, bases 4 to 38, and the like, over the entire length of the sequence. Likewise, for a 40 mer, such probes or primers may correspond to nucleotides from the first base pair to bp 40, from the second bp to bp 41, from the third bp to bp 42 of the sequence, and so on, while for a 50 mer, such probes or primers may correspond to nucleotide sequences extending from bp 1 to bp 50, from bp 2 to bp 51, from bp 3 to bp 52, from bp 4 to bp 53, and so on.

The terms "substantially corresponds to", "substantially homologous", or "substantial identity", as used herein, refer to a characteristic of a nucleic acid or amino acid sequence, wherein a selected nucleic acid or amino acid sequence has at least about 70 or about 75% sequence identity as compared to a selected reference nucleic acid or amino acid sequence. More typically, the selected sequence and the reference sequence will have at least about 76, 77, 78, 79, 80, 81, 82, 83, 84 or even 85% sequence identity, more preferably at least about 86, 87, 88, 89, 90, 91, 92, 93, 94 or 95% sequence identity. Still more preferably, highly homologous sequences often share greater than at least about 96, 97, 98, or 99% sequence identity between the selected sequence and the reference sequence to which it is compared.

As used herein, "synthetic" shall mean that the material is not of human or animal origin.

The term "treatment-practical period" refers to the period of time necessary for one or more active agents to be effective for treatment. The term "therapeutically effective" refers to reducing the severity and/or frequency of one or more symptoms, eliminating one or more symptoms and/or underlying causes, preventing the occurrence of symptoms and/or underlying causes thereof, and improving or repairing damage.

A "therapeutic agent" can be any physiologically or pharmacologically active substance that can produce a desired biological effect at a targeted site in a subject. The therapeutic agent may be a chemotherapeutic agent, an immunosuppressive agent, a cytokine, a cytotoxic agent, a nucleolytic compound, a radioisotope, a receptor, and a prodrug-activating enzyme, which may be naturally occurring or produced by synthetic or recombinant methods, or any combination thereof. Drugs that are affected by classical multidrug resistance, such as vinca alkaloids (e.g., vinblastine and vincristine), anthracyclines (e.g., doxorubicin and daunorubicin), RNA transcription inhibitors (e.g., actinomycin-D), and microtubule stabilizing drugs (e.g., paclitaxel), may have particular utility as therapeutic agents. Cytokines may also be used as therapeutic agents. Examples of such cytokines are lymphokines, monokines, and traditional polypeptide hormones. Cancer chemotherapeutic agents may be preferred therapeutic agents. For a more detailed description of anticancer and other therapeutic agents, those skilled in the art may refer to a number of instructional manuals, including, but not limited to, physician's Desk Reference and Goodman and Gilman's "Pharmacological Basis of Therapeutics", tenth edition, hardman et al (eds.) (2001).

As used herein, "transcription factor recognition site" and "transcription factor binding site" refer to a polynucleotide sequence or sequence motif that is identified as a site of sequence-specific interaction of one or more transcription factors, often in the form of direct protein-DNA binding. In general, transcription factor binding sites can be identified by DNA footprinting, gel mobility shift analysis, and the like, and/or can be predicted based on known consensus sequence motifs or by other methods known to one of ordinary skill in the art.

A transcriptional regulatory element "refers to a polynucleotide sequence that activates transcription, either alone or in combination with one or more other nucleic acid sequences. The transcriptional regulatory element may, for example, comprise one or more promoters, one or more response elements, one or more negative regulatory elements, and/or one or more enhancers.

"transcriptional unit" refers to a polynucleotide sequence comprising at least a first structural gene operably linked to at least a first cis-acting promoter sequence and optionally to one or more other cis-acting nucleic acid sequences necessary for efficient transcription of the structural gene sequence, as well as at least a first distal regulatory element as may be necessary to operably place proper tissue-specific and developmental transcription of the structural gene sequence under the control of a promoter and/or enhancer element, as well as any additional cis-sequences necessary for efficient transcription and translation (e.g., polyadenylation sites, mRNA stability control sequences, etc.).

As used herein, the term "transformation" is intended to generally describe a method of introducing an exogenous polynucleotide sequence (e.g., a viral vector, plasmid, or recombinant DNA or RNA molecule) into a host cell or protoplast in which the exogenous polynucleotide is incorporated into at least a first chromosome or is capable of autonomous replication within the transformed host cell. Transfection, electroporation, and "naked" nucleic acid uptake all represent examples of techniques for transforming a host cell with one or more polynucleotides.

As used herein, the term "transformed cell" means a host cell whose nucleic acid complementarity has been altered by the introduction into the cell of one or more exogenous polynucleotides.

"treating" as used herein refers to providing any type of medical or surgical management to a subject. Treatment may include, but is not limited to, administering to a subject a composition comprising a therapeutic agent. "treating" includes administering or applying a compound or composition of the invention to a subject for a purpose such as curing, reversing, alleviating, lessening the severity of, inhibiting the progression of, or reducing the likelihood of one or more symptoms or manifestations of a disease, disorder, or condition. In certain aspects, the compositions of the invention may also be administered prophylactically, i.e., prior to the development of any symptom or manifestation of the condition, where such prevention is warranted. Typically, in such cases, the subject will be one who has been diagnosed as "at risk" for developing such a disease or disorder as a result of a family history, medical history, or the performance of one or more diagnostic or prognostic tests indicative of a predisposition to subsequently develop such a disease or disorder.

The term "vector" as used herein refers to a nucleic acid molecule (usually consisting of DNA) that is capable of replication in a host cell and/or is operably linked to another nucleic acid segment so as to cause replication of the linked segment. Plasmids, cosmids, or viruses are exemplary vectors.

The expression "zero order" or "near zero order" as applied to the release kinetics of an active agent from the disclosed vaccine delivery compositions is intended to encompass the rate at which the active agent is released in a controlled manner over a therapeutically practical time period following administration of the composition, thereby to achieve a therapeutically effective plasma concentration of the active agent.

In certain embodiments, it will be advantageous to use one or more nucleic acid segments of the invention in combination with a suitable detectable marker (i.e., a "label"), for example where a labeled polynucleotide probe is used in a hybridization assay to determine the presence of a given target sequence. A variety of suitable indicator compounds and compositions are known in the art for labeling oligonucleotide probes, including but not limited to fluorescent ligands, radioligands, enzymatic ligands or other ligands, e.g., avidin/biotin, etc., which can be detected in a suitable assay. In particular embodiments, one or more fluorescent labels or enzyme tags, such as urease, alkaline phosphatase, or peroxidase, may also be used in place of radioactive or other environmentally less desirable reagents. In the case of enzyme tags, colorimetric, chromogenic or fluorescent indicator substrates are known to be useful in providing a means for detecting a sample visible to the human eye or by analytical methods such as scintigraphy, fluorimetry, spectrophotometry, and the like, to identify specific hybridization with a sample containing one or more complementary or substantially complementary nucleic acid sequences. In the case of so-called "multiplexed" assays, in which two or more labeled probes are detected simultaneously or sequentially, it may be desirable to label a first oligonucleotide probe with a first label having a first detection property or parameter (e.g., emission and/or excitation spectrum maximum) that also labels a second oligonucleotide with a second label having a different (i.e., unrelated to or distinguishable from the first label) second detection property or parameter. The use of multiplex assays, particularly in the context of genetic amplification/detection schemes, is well known to those of ordinary skill in the art of molecular genetics.

Nucleic acids

The term "nucleic acid" includes any compound and/or substance that can be incorporated into an oligonucleotide chain. Exemplary nucleic acids for use according to the present application include, but are not limited to, DNA, RNA including messenger mRNA (mRNA), hybrids thereof, RNAi-inducing agents, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA inducing triple helix formation, aptamers, vectors, and the like, described in detail herein.

The term "deoxyribonucleic acid", "DNA" or "DNA molecule" refers to a molecule consisting of two strands (polynucleotides), each strand comprising a single unit of nucleotides. Nucleotides are linked to each other in the chain by covalent bonds between the sugar of one nucleotide and the phosphate group of the next nucleotide, creating an alternating sugar-phosphate backbone. The nitrogen-containing bases of the two separate polynucleotide strands are bonded together with hydrogen bonds to prepare double-stranded DNA.

The term "ribonucleic acid", "RNA" or "RNA molecule" refers to a strand composed of at least 2 base-glycosyl-phosphate groups in combination. In one embodiment, the term includes compounds consisting of nucleotides, wherein the sugar moiety is ribose. In another embodiment, the terminus includes RNA and RNA derivatives in which the backbone is modified. In one example, the RNA may be in the form of tRNA (transfer RNA), snRNA (small nuclear RNA), rRNA (ribosomal RNA), mRNA (messenger RNA), antisense RNA, small inhibitory RNA (siRNA), micro-RNA (miRNA), and ribozymes. The use of siRNA and miRNA has been described (Caudy A et al, genes & Dedevel 16: 2491-96and drefferencecitytherein). In addition, these forms of RNA may be single-stranded, double-stranded, triple-stranded, or quadruple stranded. In another embodiment, the term also includes other types of backbones but with the same base of the artificial nucleic acid. In another embodiment, the artificial nucleic acid is PNA (peptide nucleic acid). PNAs contain a peptide backbone and nucleotide bases and are capable of binding to DNA and RNA molecules in another embodiment. In another embodiment, the nucleotide is a modified oxetane. In another embodiment, the nucleotides are modified by replacing one or more phosphodiester linkages with phosphorothioate linkages. In another embodiment, the modified nucleic acid comprises any other variant of the phosphate backbone of a native nucleic acid known in the art. One of ordinary skill in the art is familiar with the use of phosphorothioate-based nucleic acids and PNA, which are described, for example, in Neilsen P E, currOpin Struct Biol 9:353-57 parts of; [0280] and Raz N Ket al biochem Biophys Res Commun.297:1075-84. The production and use of nucleic acids is well known to those skilled in the art and the description, molecular cloning, (2001), sambrookon and Russell, eds. And methods in enzymology: methods f or molecular cloning of eukaryotic cells (2003) purification and G.C.Fared each represents a separate embodiment of the invention.

Modified nucleic acids

Disclosed herein are modified nucleic acids, such as mRNA, and methods for synthesizing the same. Nucleic acids used according to the present application may be according to any prior art including, but not limited to, chemical synthesis, enzymatic synthesis, terminal in vitro transcription of typically longer precursors, enzymatic or chemical cleavage, and the like. Methods for synthesizing RNA are well known in the art (see, e.g., goett, M.J. (Gait, M.J.) (eds.) Oligonucleotide Synthesis: A practical method (Oligonucleotide synthesis: a practical proproach), oxford [ Oxford county ], washington, columbia region: IRL Press, 1984; and Herdwijn, P. (Herdeviwijn, P.) (eds.) Oligonucleotide Synthesis: methods and applications (Oligonucleotide synthesis: methods and applications), methods of Molecular Biology, v.288 (Kyoff, N.J.), totoro, N.J.: 8978 zx8978 Press (Humana Press), 2005; both of which are incorporated by reference in their entirety). mRNA can be produced using a reaction mixture that includes RNA polymerase, a linear DNA template, and an RNA polymerase reaction buffer (e.g., nucleotides such as ribonucleotides). U.S. patent publication No. US20120195936 and international publication No. WO2011012316, both of which are incorporated by reference in their entirety, disclose the use of RNA. RNA polymerase reaction buffers typically include salts/buffers such as Tris, HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, sodium chloride, and magnesium chloride. The pH of the reaction mixture may be about 6 to 8.5, 6.5 to 8.0, 7.0 to 7.5, and in some embodiments, the pH is 7.5. In one example, the reaction mixture includes NTP at a concentration ranging from 1-10mM, DNA template at a concentration ranging from 0.01-0.5mg/ml, and RNA polymerase at a concentration ranging from 0.01-0.1mg/ml, e.g., the reaction mixture includes NTP at a concentration of 5mM, DNA template at a concentration of 0.1mg/ml, and RNA polymerase at a concentration of 0.05 mg/ml. In some embodiments, the DNA template is optimized or modified to differ from native DNA by differences in homology analysis. This modified DNA is inverted in vitro to yield the optimized sequence. In some embodiments, the optimized DNA sequence is double-stranded, or may be a single-stranded sequence synthesized in vitro. Such optimized or improved DNA sequences have less than 40%, or less than 45%, less than 50%, less than 55%, less than 58%, less than 60%, less than 65%, less than 70%, less than 69%, less than 75%, less than 77%, less than 78%, less than 80%, less than 90% or less than 95% homology to the native sequence. Even though the optimized DNA sequence is only 95-99.9% homologous to the native sequence, and varies by 1-2 nucleotides, it is considered that the optimized DNA sequence is functionally different, and is an embodiment of the present invention.

Similarly, the RNA sequence translated or transcribed from the optimized or modified DNA has less than 40%, or less than 45%, less than 50%, less than 55%, less than 58%, less than 60%, less than 65%, less than 70%, less than 69%, less than 75%, less than 77%, less than 78%, less than 80%, less than 90% or less than 95% homology to the native RNA sequence. Even though the optimized RNA sequence is only less than 95-99.9% homologous and varies by 1-2 nucleotides from the natural sequence, it is considered that the optimized RNA sequence has a difference in function, and is also an embodiment of the present invention.

Naturally occurring or modified nucleosides and/or nucleotides, or optimized nucleotides, can be used to prepare modified nucleic acids, such as modified mrnas, according to the invention. For example, the modified mRNA can include one or more natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); modified nucleosides (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O (6) -methylguanine, pseudouridine, (e.g., N-1-methyl-pseudouridine), 2-thiouridine, and 2-thiocytidine); chemically modifying the base; biologically modified bases (e.g., methylated bases); an insertion base; modified sugars (e.g., 2 '-fluororibose, ribose, 2' -deoxyribose, arabinose, and hexose); modified phosphate groups (e.g., phosphorothioate and 5' -N-phosphoramidite linkages), or any combination thereof. These modified nucleotides may be natural nucleotides, or may be artificially optimized or modified nucleotides.

An RNA molecule (e.g., mRNA) can include at least two nucleotides. The nucleotide may be a naturally occurring nucleotide or a modified nucleotide. In some embodiments, the RNA molecule comprises from about 5 nucleotides to about 5,000 nucleotides. In some embodiments, the RNA molecule comprises at least about 5 nucleotides. In some embodiments, the RNA molecule comprises up to about 5,000 nucleotides. In some embodiments of the present invention, the, RNA molecules include from about 5 nucleotides to about 20 nucleotides, from about 5 nucleotides to about 40 nucleotides, from about 5 nucleotides to about 60 nucleotides, from about 5 nucleotides to about 80 nucleotides, from about 5 nucleotides to about 100 nucleotides, from about 5 nucleotides to about 200 nucleotides, from about 5 nucleotides to about 500 nucleotides, from about 5 nucleotides to about 1,000 nucleotides, from about 5 nucleotides to about 2,000 nucleotides, from about 5 nucleotides to about 5,000 nucleotides, from about 20 nucleotides to about 40 nucleotides, from about 20 nucleotides to about 60 nucleotides, from about 20 nucleotides to about 80 nucleotides, from about 20 nucleotides to about 100 nucleotides, from about 20 nucleotides to about 200 nucleotides, from about 20 nucleotides to about 500 nucleotides, from about 20 nucleotides to about 1,000 nucleotides about 20 nucleotides to about 2,000 nucleotides, about 20 nucleotides to about 5,000 nucleotides, about 40 nucleotides to about 60 nucleotides, about 40 nucleotides to about 80 nucleotides, about 40 nucleotides to about 100 nucleotides, about 40 nucleotides to about 200 nucleotides, about 40 nucleotides to about 500 nucleotides, about 40 nucleotides to about 1,000 nucleotides, about 40 nucleotides to about 2000 nucleotides, about 40 nucleotides to about 5,000 nucleotides, about 60 nucleotides to about 80 nucleotides, about 60 nucleotides to about 100 nucleotides, about 60 nucleotides to about 200 nucleotides, about 60 nucleotides to about 500 nucleotides, about 60 nucleotides to about 1,000 nucleotides, about 60 nucleotides to about 2,000 nucleotides, about 60 nucleotides to about 5,000 nucleotides, about 80 nucleotides to about 100 nucleotides, about 60 nucleotides to about 100 nucleotides, from about 80 nucleotides to about 200 nucleotides, from about 80 nucleotides to about 500 nucleotides, from about 80 nucleotides to about 1,000 nucleotides, from about 80 nucleotides to about 2,000 nucleotides, from about 80 nucleotides to about 5,000 nucleotides, from about 100 nucleotides to about 200 nucleotides, from about 100 nucleotides to about 500 nucleotides, from about 100 nucleotides to about 1,000 nucleotides, from about 100 nucleotides to about 2000 nucleotides, from about 100 nucleotides to about 5,000 nucleotides, from about 200 nucleotides to about 500 nucleotides, from about 200 nucleotides to about 1,000 nucleotides, from about 200 nucleotides to about 2000 nucleotides, from about 200 nucleotides to about 5000 nucleotides, from about 500 nucleotides to about 1,000 nucleotides, from about 500 nucleotides to about 2000 nucleotides, from about 500 nucleotides to about 5,000 nucleotides, from about 1,000 nucleotides to about 2000 nucleotides, from about 1,000 nucleotides to about 5,000 nucleotides, or from about 5,000 nucleotides to about 2000 nucleotides. In some embodiments, the RNA molecule comprises about 5 nucleotides, about 20 nucleotides, about 40 nucleotides, about 60 nucleotides, about 80 nucleotides, about 100 nucleotides, about 200 nucleotides, about 500 nucleotides, about 1,000 nucleotides, about 2000 nucleotides, or about 5000 nucleotides.

An RNA molecule (e.g., mRNA) can include at least one modified nucleotide as described herein. In some embodiments, the RNA molecule comprises from about 1 modified nucleotide to about 100 modified nucleotides. In some embodiments, the RNA molecule comprises at least about 1 modified nucleotide. In some embodiments, the RNA molecule comprises up to about 100 modified nucleotides. In some embodiments, the RNA molecule comprises from about 1 modified nucleotide to about 2 modified nucleotides, from about 1 modified nucleotide to about 3 modified nucleotides, from about 1 modified nucleotide to about 4 modified nucleotides, from about 1 modified nucleotide to about 5 modified nucleotides, from about 1 modified nucleotide to about 10 modified nucleotides, from about 1 modified nucleotide to about 20 modified nucleotides, from about 1 modified nucleotide to about 100 modified nucleotides, from about 2 modified nucleotides to about 3 modified nucleotides, from about 2 modified nucleotides to about 4 modified nucleotides, from about 2 modified nucleotides to about 5 modified nucleotides, from about 2 modified nucleotides to about 10 modified nucleotides, from about 2 modified nucleotides to about 20 modified nucleotides, from about 2 modified nucleotides to about 100 modified nucleotides, from about 3 modified nucleotides to about 4 modified nucleotides, from about 3 modified nucleotides to about 5 modified nucleotides, from about 3 modified nucleotides to about 10 modified nucleotides, from about 3 modified nucleotides to about 20 modified nucleotides, from about 3 modified nucleotides to about 100 modified nucleotides, from about 4 modified nucleotides to about 5 modified nucleotides, from about 4 modified nucleotides to about 10 modified nucleotides, from about 4 modified nucleotides to about 20 modified nucleotides, from about 4 modified nucleotides to about 100 modified nucleotides, from about 5 modified nucleotides to about 10 modified nucleotides, from about 5 modified nucleotides to about 20 modified nucleotides, from about 5 modified nucleotides to about 100 modified nucleotides, from about 10 modified nucleotides to about 20 modified nucleotides, from about 10 modified nucleotides to about 100 modified nucleotides, or from about 20 modified nucleotides to about 100 modified nucleotides. In some embodiments, the RNA molecule comprises about 1 modified nucleotide, about 2 modified nucleotides, about 3 modified nucleotides, about 4 modified nucleotides, about 5 modified nucleotides, about 10 modified nucleotides, about 20 modified nucleotides, or about 100 modified nucleotides.

An RNA molecule (e.g., mRNA) can include at least 0.1% modified nucleotides. The fraction of modified nucleotides can be calculated as: number of modified nucleotides/total number of nucleotides 100%. In some embodiments, the RNA molecule comprises from about 0.1% modified nucleotides to about 100% modified nucleotides. In some embodiments, the RNA molecule comprises at least about 0.1% modified nucleotides. In some embodiments, the RNA molecule comprises up to about 100% modified nucleotides. In some embodiments of the present invention, the, the RNA molecule comprises from about 0.1% modified nucleotides to about 0.2% modified nucleotides, from about 0.1% modified nucleotides to about 0.5% modified nucleotides, from about 0.1% modified nucleotides to about 1% modified nucleotides, from about 0.1% modified nucleotides to about 2% modified nucleotides, from about 0.1% modified nucleotides to about 5% modified nucleotides, from about 0.1% modified nucleotides to about 10% modified nucleotides, from about 0.1% modified nucleotides to about 20% modified nucleotides, from about 0.1% modified nucleotides to about 50% modified nucleotides, from about 0.1% modified nucleotides to about 100% modified nucleotides, from about 0.2% modified nucleotides to about 0.5% modified nucleotides, from about 0.2% modified nucleotides to about 1% modified nucleotides, from about 0.2% modified nucleotides to about 2% modified nucleotides, from about 0.2% modified nucleotides to about 5% modified nucleotides, and from about 0.2% modified nucleotides to about 10% modified nucleotides, from about 0.2% modified nucleotides to about 20% modified nucleotides, from about 0.2% modified nucleotides to about 50% modified nucleotides, from about 0.2% modified nucleotides to about 100% modified nucleotides, from about 0.5% modified nucleotides to about 1% modified nucleotides, from about 0.5% modified nucleotides to about 2% modified nucleotides, from about 0.5% modified nucleotides to about 5% modified nucleotides, from about 0.5% modified nucleotides to about 10% modified nucleotides, from about 0.5% modified nucleotides to about 20% modified nucleotides, from about 0.5% modified nucleotides to about 50% modified nucleotides, from about 0.5% modified nucleotides to about 100% modified nucleotides, from about 1% modified nucleotides to about 2% modified nucleotides, from about 1% modified nucleotides to about 5% modified nucleotides, from about 1% modified nucleotides to about 10% modified nucleotides, or a pharmaceutically acceptable salt thereof, from about 1% modified nucleotides to about 20% modified nucleotides, from about 1% modified nucleotides to about 50% modified nucleotides, from about 1% modified nucleotides to about 100% modified nucleotides, from about 2% modified nucleotides to about 5% modified nucleotides, from about 2% modified nucleotides to about 10% modified nucleotides, from about 2% modified nucleotides to about 20% modified nucleotides, from about 2% modified nucleotides to about 50% modified nucleotides, from about 2% modified nucleotides to about 100% modified nucleotides, from about 5% modified nucleotides to about 10% modified nucleotides, from about 5% modified nucleotides to about 20% modified nucleotides, from about 5% modified nucleotides to about 50% modified nucleotides, from about 5% modified nucleotides to about 100% modified nucleotides, from about 10% modified nucleotides to about 20% modified nucleotides, from about 10% modified nucleotides to about 50% modified nucleotides, from about 10% modified nucleotides to about 100% modified nucleotides, from about 20% modified nucleotides to about 50% modified nucleotides, from about 20% modified nucleotides to about 100% modified nucleotides, or from about 50% modified nucleotides to about 100% modified nucleotides. In some embodiments, the RNA molecule comprises about 0.1% modified nucleotides, about 0.2% modified nucleotides, about 0.5% modified nucleotides, about 1% modified nucleotides, about 2% modified nucleotides, about 5% modified nucleotides, about 10% modified nucleotides, about 20% modified nucleotides, about 50% modified nucleotides, or about 100% modified nucleotides.

The total concentration of nucleotides, e.g., ribonucleotides (e.g., combined ATP, GTP, CTP, and UTP) used in the reaction is between 0.5mM to about 500mM. In some embodiments, the total concentration of nucleotides is about 0.5mM to about 500mM. In some embodiments, the total concentration of nucleotides is at least about 0.5mM. In some embodiments, the total concentration of nucleotides is up to about 500mM. In some embodiments of the present invention, the, the total concentration of nucleotides is about 0.5mM to about 1mM, about 0.5mM to about 5mM, about 0.5mM to about 10mM, about 0.5mM to about 50mM, about 0.5mM to about 100mM, about 0.5mM to about 200mM, about 0.5mM to about 300mM, about 0.5mM to about 500mM, about 1mM to about 5mM, about 1mM to about 10mM, about 1mM to about 50mM, about 1mM to about 100mM, about 1mM to about 200mM, about 1mM to about 300mM, about 1mM to about 500mM, about 5mM to about 10mM, about 5mM to about 50mM, about 5mM to about 100mM, about 5mM to about 200mM, about 5mM to about 300mM, about 5mM to about 500mM, about 10mM to about 50mM, about 10mM to about 100mM, about 10mM to about 200mM, about 10mM to about 300mM, about 10mM to about 500mM, about 50mM to about 100mM, about 50mM to about 200mM, about 50mM to about 300mM, about 50mM to about 500mM, about 100mM to about 200mM, about 100mM to about 300mM, about 100mM to about 500mM, about 200mM to about 300mM, about 200mM to about 500mM, or about 300mM to about 500mM. In some embodiments, the total concentration of nucleotides is about 0.5mM, about 1mM, about 5mM, about 10mM, about 50mM, about 100mM, about 200mM, about 300mM, or about 500mM.

Post-synthetic treatment

The 5 'cap and/or 3' tail may be added after synthesis. The presence of the cap may provide resistance to nucleases found in most eukaryotic cells. The presence of a "tail" may be used to protect mRNA from exonuclease degradation and/or to modulate protein expression levels.

The 5' cap can be added as follows: first, RNA end phosphatases remove one terminal phosphate group from the 5' nucleotide, leaving two terminal phosphate groups; guanosine Triphosphate (GTP) is then added to the terminal phosphate group by guanylyl transferase, yielding 5,5,5 triphosphate linkages; the 7-nitrogen of guanine is then methylated with methyltransferase. Examples of Cap structures include, but are not limited to, m7G (5 ') ppp (5' (A, G (5 ') ppp (5') A and G (5 ') ppp (5') G.) more Cap structures are described in published U.S. application No. US 2016/0032356, ashi Quickel (Ashiqul Haque) et al, "chemically modified hCFR mRNA restores lung function in the cystic fibrosis mouse model" (chemical modification CFTR mRNAs receptave function in a mouse model of cystic fibrosis), scientific Reports (Scientific Reports) (2018) 8 16776, and Kore et al, "Recent advances in 5 '-end Cap Analogs: synthetic and Biological branches" (Recent in 5' -Terminal Cap Analogs: synthetic and Biological research) Organic Mini-chemical read application Ser. No. 78, oryza-8978, incorporated by reference, oryza application Ser. No..

The tail structure may include a poly (a) and/or a poly (C) tail. The poly-a tail on the 3 'end of the mRNA (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides of the 3' end) can include at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides. The poly-a tail on the 3 'end of an mRNA (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides of the 3' end) can include at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides.

As described herein, the addition of a5 'cap and/or 3' tail can help detect invalid transcripts generated during in vitro synthesis, since without capping and/or tailing those prematurely aborted mRNA transcripts may be too small to be detected. Thus, in some embodiments, a5 'cap and/or 3' tail is added to the synthesized mRNA prior to testing for mRNA purity (e.g., the level of null transcripts present in the mRNA). In some embodiments, a5 'cap and/or 3' tail is added to the synthesized mRNA prior to purification of the mRNA as described herein. In other embodiments, a5 'cap and/or 3' tail is added to the synthesized mRNA after purification of the mRNA as described herein.

In addition to the above methods, the capping or tailing step is always performed during the transcription process from in vitro transcription of DNA to RNA, and these methods are freely selectable by one of ordinary skill in the art.

The mRNA synthesized according to the present invention can be used without further purification. In particular, the mRNA synthesized according to the present invention can be used without the step of removing the short polymer. In some embodiments, mRNA synthesized according to the present invention may be further purified. Various methods can be used to purify the synthesized mRNA according to the present invention. For example, purification of mRNA can be performed using centrifugation, filtration, and/or chromatographic methods. In some embodiments, the synthesized mRNA is purified by ethanol precipitation or filtration or chromatography, or gel purification or any other suitable method. In some embodiments, the mRNA is purified by HPLC. In some embodiments, in the standard phenol: chloroform: extraction of mRNA from an isoamyl alcohol solution is well known to those skilled in the art. In some embodiments, the mRNA is purified using tangential flow filtration. Suitable purification methods include the methods described in US 2016/0040154, US 2015/0376220, PCT application PCT/US18/19954 filed on 27.2.2018, entitled "method for purifying messenger RNA" and PCT application PCT/US18/19978 entitled "method for purifying messenger RNA" filed on 27.2.2018, all of which are incorporated herein by reference and can be used to carry out the present invention.

In some embodiments, mRNA is purified prior to capping and tailing. In some embodiments, mRNA is purified after capping and tailing. In some embodiments, mRNA is purified both before and after capping and tailing. In some embodiments, mRNA is purified by centrifugation either before or after capping and tailing or both. In some embodiments, the mRNA is purified by filtration either before or after capping and tailing or both. In some embodiments, mRNA is purified by Tangential Flow Filtration (TFF) either before or after capping and tailing or both. In some embodiments, mRNA is purified by chromatography either before or after capping and tailing or both.

In some embodiments, the tailing is accomplished simultaneously with transcription, and thus, the nucleic acid may also be purified after the tailing and capping steps are completed, as described above. Therefore, in some embodiments, the purification steps should all be after the tail-capping. Of course, mRNA can also be purified prior to capping. Purification can of course also be carried out after transcription.

Any method available in the art can be used to detect and quantify full-length or null transcripts of mRNA. In some embodiments, the synthesized mRNA molecules are detected using blotting, capillary electrophoresis, chromatography, fluorescence, gel electrophoresis, HPLC, silver staining, spectroscopy, ultraviolet (UV) or UPLC, or a combination thereof. Other detection methods known in the art are included in the present invention. In some embodiments, the synthesized mRNA molecules are detected by capillary electrophoresis separation using UV absorption spectroscopy. In some embodiments, the mRNA is denatured by glyoxal dye prior to gel electrophoresis ("glyoxal gel electrophoresis"). In some embodiments, the synthesized mRNA is characterized prior to capping or tailing. In some embodiments, the synthesized mRNA is characterized after capping and tailing.

In some embodiments, the mRNA produced by the methods disclosed herein comprises less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.1% of impurities other than full-length mRNA. Impurities include IVT contaminants such as proteins, enzymes, free nucleotides and/or short polymers.

In some embodiments, the mRNA prepared according to the invention is substantially free of short polymers or null transcripts. In particular, mRNA prepared according to the invention includes undetectable levels of short polymers or null transcripts by capillary electrophoresis or glyoxal gel electrophoresis. As used herein, the term "short polymer" or "null transcript" refers to any less than full-length transcript. In some embodiments, a "short polymer" or "null transcript" is less than 100 nucleotides in length, less than 90, less than 80, less than 70, less than 60, less than 50, less than 40, less than 30, less than 20, or less than 10 nucleotides in length. In some embodiments, the short polymer is detected or quantified after the addition of the 5 '-cap and/or the 3' -poly a tail.

UTR sequences

3 '-untranslated region (3' -UTR): generally, the term "3'-UTR" refers to a portion of an artificial nucleic acid molecule that is located 3' (i.e., "downstream") of the open reading frame and which is not translated into a protein. Typically, the 3' -UTR is a portion of the mRNA between the protein coding region (open reading frame (ORF) or coding sequence (CDS)) and the polyadenylation sequence of the mRNA. In the context of the present invention, the term 3' -UTR may also comprise elements which are not encoded in the template from which the RNA is transcribed, but which are added post-transcription during maturation, for example a poly-a sequence. The 3' -UTR of the mRNA is not translated into an amino acid sequence. The 3' UTR sequence is typically encoded by a gene that is transcribed into its respective mRNA during gene expression. The genomic sequence is first transcribed into mature pre-mRNA containing optional introns. The pre-mature mRNA is then further processed to mature mRNA during maturation. The maturation process comprises the following steps: 5' capping, splicing to mature pre-mRNA to excise optional introns and 3' end modifications (e.g., polyadenylation of the 3' end of mature pre-mRNA and optional endonuclease/exonuclease cleavage, etc.). In the context of the present invention, the 3'-UTR corresponds to a position between the termination codon of the protein coding region, preferably immediately 3' of the termination codon of the protein coding region, and the polyadenylation sequence of the mRNA. The term "corresponding to" means that the 3'-UTR sequence can be an RNA sequence as in the mRNA sequence used to define the 3' -UTR sequence, or a DNA sequence corresponding to this RNA sequence. In the context of the present invention, the term "3'-UTR of a gene" is a sequence corresponding to the 3' -UTR of a mature mRNA derived from the gene, i.e.an mRNA obtained by transcription of the gene and maturation of a pre-mature mRNA. The term "3'-UTR of a gene" includes DNA sequences and RNA sequences (both sense and antisense strands as well as both mature and immature) of the 3' -UTR. Preferably 3' UTR has a length of more than 20, 30, 40 or 50 nucleotides. 3 '-untranslated region (3' UTR): 3' UTR is typically part of an mRNA, which is located between the protein coding region (i.e., open reading frame) and the polyadenylation sequence of the mRNA. The 3' UTR of mRNA is not translated into an amino acid sequence. Within the scope of the present invention, the 3' UTR corresponds to the mature mRNA sequence located 3' of, preferably immediately 3' of, the stop codon of the protein coding region and extending to the 5' side of, preferably to the nucleotide immediately 5' of, the polyadenylation sequence. The term "corresponding to" means that the 3'UTR sequence may be an RNA sequence as in the mRNA sequence defining the 3' UTR sequence, or in a DNA sequence corresponding to this RNA sequence. Within the scope of the present invention, the term "3' UTR of a gene", such as "3' UTR of an albumin gene", is a sequence corresponding to the 3' UTR of a mature mRNA derived from this gene, i.e.an mRNA obtained by gene transcription and maturation of a pre-mature mRNA. The term "3 'UTR of gene" includes DNA sequences and RNA sequences of 3' UTR.

5 '-untranslated region (5' -UTR): generally, the term "5'-UTR" refers to a portion of an artificial nucleic acid molecule that is 5' (i.e., "upstream") of an open reading frame and that is not translated into a protein. A 5'-UTR is generally understood to be a specific segment of a messenger RNA (mRNA) that is located 5' to the open reading frame of the mRNA. Typically, the 5' -UTR starts at the transcription start site and terminates one nucleotide before the start codon of the open reading frame. Preferably, the 5' UTR has a length of more than 20, 30, 40 or 50 nucleotides. The 5' -UTR may comprise elements for controlling gene expression, also referred to as regulatory elements. The regulatory element can be, for example, a ribosome binding site. The 5'-UTR may be post-transcriptionally modified, for example by the addition of a 5' -cap. The 5' -UTR of the mRNA is not translated into an amino acid sequence. The 5' -UTR sequence is usually encoded by a gene which is transcribed into the respective mRNA during gene expression. The genomic sequence is first transcribed as a mature pre-mRNA, which contains optional introns. The pre-mature mRNA is then further processed during maturation to mature mRNA. The maturation process comprises the steps of: 5' capping, splicing of the pre-mature mRNA to excise optional introns and 3' end modifications (e.g., polyadenylation of the 3' end of the pre-mature mRNA and optional endonuclease/exonuclease cleavage, etc.). Within the scope of the present invention, the 5'-UTR corresponds to the mature mRNA sequence located between the start codon and, for example, the 5' -cap. Preferably, the 5' -UTR corresponds to a sequence extending from a nucleotide located 3' of the 5' cap, more preferably from a nucleotide located 3' of the 5' cap, to a nucleotide located 5' of the initiation codon of the protein coding region, preferably to a nucleotide located 5' of the initiation codon of the protein coding region. The nucleotides immediately 3 'of the 5' cap of the mature mRNA typically correspond to the transcription start site. The term "corresponding to" means that the 5'-UTR sequence may be an RNA sequence as in the mRNA sequence used to define the 5' -UTR sequence, or a DNA sequence corresponding to this RNA sequence. Within the scope of the present invention, the term "5'-UTR of a gene" is a sequence corresponding to the 5' -UTR of a mature mRNA derived from the gene, i.e. an mRNA obtained by transcription of the gene and maturation of the pre-mature mRNA. The term "5'-UTR of a gene" includes DNA sequences and RNA sequences (both sense and antisense strands as well as both mature and immature) of the 5' -UTR.

The invention relates to artificial nucleic acid molecules comprising an open reading frame ORF, a 3 '-untranslated region element (3' -UTR element) and/or a5 '-untranslated region element (5' -UTR element) and optionally a polyadenylation sequence and/or a polyadenylation-signal.

The invention further relates to a vector comprising a 3'-UTR element and/or a 5' -UTR element, to a cell comprising said artificial nucleic acid molecule or said vector, to a pharmaceutical composition comprising said artificial nucleic acid molecule or said vector, and to a kit comprising said artificial nucleic acid molecule, said vector and/or said pharmaceutical composition, preferably for use in the field of gene therapy and/or gene vaccination.

As an alternative to mRNA stabilization, naturally occurring eukaryotic mRNA molecules have been found to contain characteristic stabilizing elements. For example, they may comprise a so-called untranslated region (UTR) at their 5 'end (5' -UTR) and/or at their 3 'end (3' -UTR) as well as other structural features, such as a5 'cap structure or a 3' -poly-A tail. Both the 5'-UTR and the 3' -UTR are typically transcribed from genomic DNA and are thus pre-mature (prematurity) mRNA elements. During mRNA processing, the characteristic structural features of mature mRNA, such as the 5 'cap and the 3' -poly A tail (also known as poly A tail or poly A sequence), are typically added to the transcribed (pre-mature) mRNA.

The 3 '-poly A tail is typically a monotonic sequence of adenosine nucleotides added to the 3' end of the transcribed mRNA. It may comprise up to about 400 adenosine nucleotides. The length of such a 3' -poly a tail was found to be a possible key element for the stability of individual mrnas. Furthermore, it has been shown that the 3' UTR of α -globulin mRNA may be an important factor for the stability of α -globulin mRNA known as such (Rodgers et al, regulated α -globulin mRNA decay is a cytoplastic evolving through 3' -to-5 ' exosome-dependent partitioning, RNA,8, pp. 1526-1537, 2002). The 3' UTR of alpha-globin mRNA is clearly involved in the formation of specific nucleoprotein-complexes (alpha-complexes), the presence of which is associated with mRNA in vitro stability (Wang et al, an mRNA stability complexes with poly (A) -binding protein to stability mRNA in vitro, molecular and Cellular biology, vol.19, no. 7, 7 months 1999, p.4552-4560). Interesting regulatory functions have been further demonstrated for UTR in ribosomal protein mRNA: while the 5'-UTR of ribosomal protein mRNAs controls the translation of growth-related mRNAs, the stringency of this regulation is conferred by the individual 3' -UTRs in ribosomal protein mRNAs (Ledda et al, effect of the 3'-UTR length on the translation of 5' -terminal oligopyridinine mRNAs, gene, vol. 344, 2005, p.213-220). This mechanism promotes specific Expression of ribosomal proteins, which are usually transcribed in a constant manner so that some ribosomal protein mrnas, such as ribosomal protein S9 or ribosomal protein L32, are called Housekeeping genes (Janovick-gurezky et al, housekeeping Gene Expression in human Liver deficiency by physiologic state, feed Intake, and Dietary Treatment, j.dairy sci., vol.90, 2007, p.2246-2252). The growth-related expression pattern of ribosomal proteins is therefore mainly due to the regulation of the translation level.

The term "3' -UTR element" refers to a nucleic acid sequence comprising or consisting of a nucleic acid sequence derived from a 3' -UTR or from a variant or fragment of a 3' -UTR.

A "3'-UTR element" preferably refers to an artificial nucleic acid sequence, such as a nucleic acid sequence comprised by the 3' -UTR of an artificial mRNA.

Thus, in the sense of the present invention, preferably, the 3'-UTR element can be comprised by the 3' -UTR of an mRNA, preferably an artificial mRNA, or the 3'-UTR element can be comprised by the 3' -UTR of the respective transcription template. Preferably, the 3' -UTR element is a nucleic acid sequence corresponding to the 3' -UTR of an mRNA, preferably an artificial mRNA, such as a 3' -UTR of an mRNA obtained by transcription of a genetically engineered vector construct. Preferably, a 3' -UTR element in the sense of the present invention functions as a 3' -UTR or encodes a nucleotide sequence which performs the function of a 3' -UTR.

Thus, the term "5' -UTR element" refers to a nucleic acid sequence comprising or consisting of a nucleic acid sequence derived from a 5' -UTR or a variant or fragment of a 5' -UTR. A "5'-UTR element" preferably refers to an artificial nucleic acid sequence, such as a nucleic acid sequence comprised by the 5' -UTR of an artificial mRNA. Thus, preferably, in the sense of the present invention, a 5'-UTR element can be comprised by the 5' -UTR of an mRNA, preferably an artificial mRNA, or a 5'-UTR element can be comprised by the 5' -UTR of the respective transcription template. Preferably, the 5' -UTR element is a nucleic acid sequence corresponding to the 5' -UTR of an mRNA, preferably an artificial mRNA, such as the 5' -UTR of an mRNA obtained by transcription of a genetically engineered vector construct. Preferably, a 5' -UTR element in the sense of the present invention functions as a 5' -UTR or encodes a nucleotide sequence which performs the function of a 5' -UTR.

The 3'-UTR element and/or the 5' -UTR element in the artificial nucleic acid molecule according to the invention extends and/or increases protein production from the artificial nucleic acid molecule. Thus, the artificial nucleic acid molecule according to the invention may comprise, inter alia, one or several of the following functional 3'-UTR elements and/or 5' -UTR elements: increasing the 3'-UTR element produced from the protein of the artificial nucleic acid molecule, extending the 3' -UTR element produced from the protein of the artificial nucleic acid molecule, increasing and extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule, increasing the 5' -UTR element produced from the protein of the artificial nucleic acid molecule, extending the 5'-UTR element produced from the protein of the artificial nucleic acid molecule, increasing and extending the 5' -UTR element produced from the protein of the artificial nucleic acid molecule, increasing the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and increasing the 5' -UTR element produced from the protein of the artificial nucleic acid molecule, increasing the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and extending the 5' -UTR element produced from the protein of the artificial nucleic acid molecule, increasing the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and increasing and extending the 5' -UTR element produced from the protein of the artificial nucleic acid molecule, extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and increasing the 5' -UTR element produced from the protein of the artificial nucleic acid molecule, extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and extending the 5' -UTR element produced from the protein of the artificial nucleic acid molecule, extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and increasing and extending the 5' -UTR element produced from the protein of the artificial nucleic acid molecule, increasing and extending the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and increasing the 5' -UTR element produced from the protein of the artificial nucleic acid molecule An element, an element that increases and extends the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and extends the 5' -UTR element produced from the protein of the artificial nucleic acid molecule, or an element that increases and extends the 3'-UTR element produced from the protein of the artificial nucleic acid molecule and increases and extends the 5' -UTR element produced from the protein of the artificial nucleic acid molecule. Preferably, the artificial nucleic acid molecule according to the invention comprises a 3'-UTR element that prolongs the production of the protein from the artificial nucleic acid molecule and/or a 5' -UTR element that increases the production of the protein from the artificial nucleic acid molecule. Preferably, the artificial nucleic acid molecule according to the invention comprises at least one 3'-UTR element and at least one 5' -UTR element, i.e. at least one 3'-UTR element that extends and/or increases the production of protein from the artificial nucleic acid molecule and is derived from a stable mRNA and at least one 5' -UTR element that extends and/or increases the production of protein from the artificial nucleic acid molecule and is derived from a stable mRNA. "extending and/or increasing the protein production from said artificial nucleic acid molecule" generally refers to the amount of protein produced from an artificial nucleic acid molecule according to the invention having individual 3'-UTR elements and/or 5' -UTR elements compared to the amount of protein produced from an individual reference nucleic acid lacking a 3'-UTR and/or 5' -UTR or comprising a reference 3'-UTR and/or reference 5' -UTR (such as a 3'-UTR and/or 5' -UTR that is naturally present in combination with an ORF). In particular, at least one 3'-UTR element and/or 5' -UTR element of the artificial nucleic acid molecule according to the invention prolongs protein production from the artificial nucleic acid molecule according to the invention, e.g. from an mRNA according to the invention, compared to individual nucleic acids lacking a 3'-UTR and/or 5' -UTR or comprising a reference 3'-UTR and/or 5' -UTR, such as a 3 '-and/or 5' -UTR naturally present in combination with an ORF. In particular, the at least one 3'-UTR element and/or 5' -UTR element of the artificial nucleic acid molecule according to the invention increases protein production, in particular protein expression and/or total protein production, from the artificial nucleic acid molecule according to the invention, for example from an mRNA according to the invention, compared to the respective nucleic acid lacking a 3 '-and/or 5' -UTR or comprising a reference 3 '-and/or 5' -UTR, such as a 3 '-and/or 5' -UTR naturally present in combination with an ORF. Preferably, said at least one 3'-UTR element and/or said at least one 5' -UTR element of the artificial nucleic acid molecule according to the invention does not negatively influence the translation efficiency of the nucleic acid compared to the translation efficiency of the respective nucleic acid lacking the 3'-UTR and/or the 5' -UTR or comprising a reference 3'-UTR and/or a reference 5' -UTR, such as a 3'-UTR and/or a 5' -UTR, which is naturally present in combination with an ORF. Even more preferably, the translational efficiency is enhanced by the 3'-UTR and/or the 5' -UTR compared to the translational efficiency of the protein encoded by the respective ORF in its natural case. The term "individual nucleic acid molecule" or "reference nucleic acid molecule" as used herein means-apart from a different 3'-UTR and/or 5' -UTR-that the reference nucleic acid molecule is comparable, preferably identical, to the artificial nucleic acid molecule of the invention comprising a 3'-UTR element and/or a 5' -UTR element.

In some embodiments, the 5 'and 3' ends of the ORFs of the invention comprise a UTR sequence comprising a sequence as set forth in SEQ NO:36-1 to 36-12 of 5'UTR, or' SEQ NO: (ii) one or more of the 3' UTR sequences from 37-1 to 37-12. In some embodiments, the 5' sequence is SEQ NO:36-11,3 is SEQ NO: 37-11; or the 5' sequence is SEQ NO:36-12,3 is SEQ NO: 37-12. Alternatively, in some forms, the 3' end of the ORF sequence of the invention comprises SEQ NO:37-11 or SEQ NO: 37-12.

Pharmaceutical composition

Also disclosed are pharmaceutical compositions comprising the compounds, modified nucleosides, modified nucleotides, or modified nucleic acids provided herein.

In some embodiments, the pharmaceutical compositions of the invention may be administered to a subject by any method known to those of skill in the art, e.g., parenterally, orally, transmucosally, transdermally, intramuscularly, intravenously, intradermally, subcutaneously, intraperitoneally, intraventricularly, intracranially, intravaginally, or intratumorally.

The pharmaceutical composition may be administered by intravenous, intraarterial or intramuscular injection of a liquid formulation. Suitable liquid formulations include solutions, suspensions, dispersions, emulsions, oils, and the like. In some embodiments, the pharmaceutical composition is administered intravenously, and is therefore formulated in a form suitable for intravenous administration. In some embodiments, the pharmaceutical composition is administered intraarterially, and is therefore formulated in a form suitable for intraarterial administration. In some embodiments, the pharmaceutical composition is administered intramuscularly, and is therefore formulated in a form suitable for intramuscular administration.

Pharmaceutical compositions can be administered using vesicles, for example, liposomes (see Langer, science 249, 1527-1533 (1990); treatetal, liposomessitive therapeutics of infection diseases and profiler, lopez-BeresteinandFidler (eds.), liss, newYork, pp.353-365 (1989); lopez-Berestein, ibid., pp.317-327.

The pharmaceutical compositions may be administered orally and may therefore be formulated in a form suitable for oral administration, i.e. as a solid or liquid preparation. Suitable solid oral formulations may include tablets, capsules, granules, pills, and the like. Suitable liquid oral formulations may include solutions, suspensions, dispersions, emulsions, oils.

The pharmaceutical composition may be administered topically to a body surface and may therefore be formulated in a form suitable for topical administration. Suitable topical formulations may include gels, ointments, creams, lotions, drops and the like. For topical administration, the compositions or physiologically tolerable derivatives thereof may be prepared and administered as a solution, suspension or emulsion in a physiologically acceptable diluent, with or without a pharmaceutical carrier. The pharmaceutical compositions may be administered as suppositories, for example rectal suppositories or urethral suppositories. In some embodiments, the pharmaceutical composition is administered by subcutaneous implantation of particles. In some embodiments, the particles provide controlled release of the pharmaceutical agent over a period of time. The pharmaceutical compositions may additionally include pharmaceutically acceptable excipients, as used herein, including any and all solvents, dispersion media, diluents or other liquid carriers, dispersion or suspension aids, surfactants, isotonicity agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as appropriate for the particular dosage form desired. The pharmaceutical science and practice of remington, 21 st edition, a.r. gennaro (Lippincott, williams & Wilkins, baltimore, md.,2006 incorperated herein byyreference) discloses various excipients used in formulating pharmaceutical compositions and known techniques for their preparation.

In some embodiments, the pharmaceutically acceptable excipient has a purity of at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the U.S. food and drug administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient conforms to the standards of the United States Pharmacopeia (USP), european Pharmacopeia (EP), british pharmacopeia, and/or international pharmacopeia.

Pharmaceutically acceptable carriers for liquid formulations may be aqueous or non-aqueous solutions, suspensions, emulsions or oils. Examples of non-aqueous solvents may be propylene glycol, polyethylene glycol and injectable organic esters, such as ethyl oleate. Aqueous carriers can include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Examples of oils may be those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, olive oil, sunflower oil and cod liver oil.

Parenteral vehicles (for subcutaneous, intravenous, intraarterial, or intramuscular injection) may include sodium chloride solution, ringer's dextrose and sodium chloride, lactated ringer's solution, and fixed oils. Intravenous vehicles include liquid and nutritional supplements, electrolyte supplements, such as ringer's dextrose-based electrolyte supplements, and the like. Examples may be sterile liquids, such as water and oil, with or without the addition of surfactants and other pharmaceutically acceptable adjuvants. In general, water, saline, aqueous dextrose and related sugar solutions, and glycols such as propylene glycol or polyethylene glycol are preferred liquid carriers, particularly for injectable solutions. Examples of oils may be those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, olive oil, sunflower oil and cod liver oil.

The pharmaceutical compositions may further include binders (e.g., acacia, corn starch, gelatin, carbomer, ethylcellulose, guar gum, hydroxypropylcellulose, hydroxypropylmethyl cellulose, povidone), disintegrants (e.g., corn starch, potato starch, alginic acid, silicon dioxide, croscarmellose sodium, crospovidone, guar gum, sodium starch glycolate), buffering agents of various pH and ionic strength (e.g., tris-HCl, acetate, phosphate groups), additives such as albumin or gelatin to prevent absorption to surfaces, detergents (e.g., tween 20, tween 80, pluronic F68, bile acid salts), protease inhibitors, surfactants (e.g., sodium lauryl sulfate), penetration enhancers, solubilizers (e.g., glycerol, polyethylene glycol glycerol), antioxidants (e.g., ascorbic acid, sodium metabisulfite, butylated hydroxyanisole), stabilizers (e.g., hydroxypropyl cellulose, hydroxypropylmethyl cellulose), viscosity enhancers (e.g., carbomer, colloidal silicon dioxide, ethyl cellulose, guar gum), sweeteners (e.g., aspartame, citric acid), preservatives (e.g., thiolcarbamate, lubricants (e.g., sodium parabens), lubricants (e.g., sodium stearate, magnesium stearate, triethyl stearate), flow aids such as colloidal sodium phthalate, colloidal sodium lauryl sulfate, colloidal sodium phthalate, colloidal sodium salicylate, colloidal sodium stearate, colloidal sodium phthalate, colloidal sodium stearate, colloidal adjuvants (e.g., sodium salicylate), sweetening agents such as sodium salicylate, sodium stearate), and the like, polymeric coatings (e.g., poloxamers or poloxamines), coatings and film formers (e.g., ethylcellulose, acrylates, polymethacrylates), and/or adjuvants.

The pharmaceutical compositions provided herein can be controlled release compositions, i.e., compositions in which the compound is released over a period of time after administration. Controlled or sustained release compositions may include formulations in lipophilic depots (e.g., fatty acids, waxes, oils). In some embodiments, the pharmaceutical composition may be an immediate release composition, i.e., a composition in which the entire compound is released immediately after administration.

Suitable devices for delivering the intradermal pharmaceutical compositions described herein may include short needle devices such as those described in U.S. Pat. Nos. 4,886,499, 5,190,521, 5,328,483, 5,527,288, 4,270,537, 5,015,235, 5,141,496, and 5,417,662. The intradermal compositions may be administered by a device that limits the effective penetration length of the needle into the skin, such as those described in PCT publication WO 99/34850 and functional equivalents thereof. A jet injection device that delivers the liquid composition to the dermis by means of a liquid jet injector and/or by means of a needle that pierces the stratum corneum and produces a jet that reaches the dermis may be suitable. Jet injection devices are described, for example, in U.S. patents 5,480,381, 5,599,302, 5,334,144, 5,993,412, 5,649,912, 5,569,189, 5,704,911, 5,383,851, 5,893,397, 5,466,220, 5,339,163, 5,312,335, 5,503,627, 5,064,413, 5,520,639, 4,596,556, 4,790,824, 4,941,880, 4,940,460, and PCT WO 97/37705 and WO 97/13537. Ballistic powder/particle delivery devices that use compressed gas to accelerate vaccine in powder form through the outer layers of the skin to the dermis may be suitable. Alternatively or additionally, conventional syringes may be used in the classical tuberculin intradermal method of intradermal administration.

Delivery vehicle

Any method may be used to formulate and deliver mRNA synthesized according to the invention for in vivo protein production. In some embodiments, the mRNA is encapsulated into a transfer vector, such as a nanoparticle. In addition, one purpose of such encapsulation is generally to protect the nucleic acids from the environment of enzymes or chemicals that may contain systems or receptors that degrade the nucleic acids and/or cause rapid excretion of the nucleic acids. Thus, in some embodiments, suitable delivery vehicles are capable of enhancing the stability of the mRNA included therein and/or facilitating the delivery of the mRNA to a target cell or tissue. In some embodiments, the nanoparticle may be a lipid-based nanoparticle, for example including a liposome or a polymer-based nanoparticle. In some embodiments, the nanoparticles may have a diameter of less than about 40-100 nm. The nanoparticle can include at least 1 μ g, 10 μ g, 100 μ g, 1mg, 10mg, 100mg, 1g, or more mRNA.

Of course, the nanoparticle can also be a core-shell type particle, and if the nucleic acid is mixed with the polymer to form a core, and then the liposome is wrapped outside the core structure, the mixing can also be completed by the mixer of the present invention. The nucleic acid and the polymer may be formed into a microparticle structure by a mixer, and then the microparticle and the lipid component may be formed into a microparticle structure by a mixer. All core materials and shell materials of this so-called core-shell structure, such as in patent application No. 201880001680.5, can be formed using the mixer of the present invention, and all sets of core materials and shell-forming materials of this patent are embodiments of the present invention.

In some embodiments, the delivery vehicle is a liposome vesicle, or other means of facilitating transfer of nucleic acids to target cells and tissues. Suitable delivery vehicles may include, but are not limited to, liposomes, nanoliposomes containing ceramides, proteoliposomes, nanoparticles, calcium phosphate-silicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline particles, semiconductor nanoparticles, poly (D-arginine), nanotrids, starch-based delivery systems, micelles, emulsions, vesicles, plasmids, viruses, calcium phosphate-based nucleotides, aptamers, peptides, and other carrier tags. The use of bio-ionic capsules and other viral capsid protein assemblies as suitable transfer vehicles is also contemplated. (hum. Gene Ther.2008September;19 (9): 887-95).

Liposomes can include one or more cationic lipids, one or more non-cationic lipids, one or more sterol-based lipids, and/or one or more PEG-modified lipids. The liposomes can include three or more different lipid components, one different component of the lipid being a sterol-based cationic lipid. In some embodiments, the sterol-based cationic lipid is an imidazole cholesterol ester or "ICE" lipid (see WO2011/068810, which is incorporated by reference herein). In some embodiments, the sterol-based cationic lipid can constitute no more than 70% (e.g., no more than 65% and 60%) of the total lipid in the lipid nanoparticle (e.g., liposome). Examples of suitable lipids can include, for example, phosphatidyl compounds (e.g., phosphatidyl glycerols, phosphatidyl cholines, phosphatidyl serines, phosphatidyl ethanolamines, sphingolipids, cerebrosides, and gangliosides.

Non-limiting examples OF cationic lipids can include C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazolyl), HGT5000, HGT5001, OF-02, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, cpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA and HGT4003, or a combination thereof.

Non-limiting examples of non-cationic lipids may include ceramide, cephalin, cerebroside, diacylglycerol, 1,2-dipalmitoyl-sn-glycero-3-phosphoryl glycerol sodium salt (DPPG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-distearoyl-sn-glycerol-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine (DPPC), 1,2-dioleyl-sn-glycerol-3-phosphoethanolamine (DOPE), 1,2-dioleyl-sn-glycerol-3-phosphatidylcholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DOPG), and DMxft 5364' -glycero-sn-3-phosphoethanolamine (DOPE), 1-palmitoyl-2-oleoyl-phosphatidylethanolamine (POPE), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), sphingomyelin, or a combination thereof.

In some embodiments, the PEG-modified lipid may be a poly (ethylene) glycol chain up to 5kDa in length, covalently attached to a lipid having an alkyl chain of C6-C20 length. Non-limiting examples of PEG-modified lipids can include DMG-PEG, DMG-PEG2K, C-PEG, DOGPEG, ceramide PEG, and DSPE-PEG, or combinations thereof.

It is also contemplated to use the polymer as a transfer vehicle, either alone or in combination with other transfer vehicles. Suitable polymers may include, for example, polyacrylates, polyalkylcyanoacrylates, polylactides, polylactide-polyglycolide copolymers, polycaprolactones, dextrans, albumins, gelatins, alginates, collagen, chitosan, cyclodextrins, and polyethyleneimines. The polymer-based nanoparticles may include Polyethylenimine (PEI), such as branched PEI.

The core-shell structure of the support is another specific embodiment. In some embodiments, the vaccine agent comprises a nucleic acid as described above that is capable of translating, expressing an antigen or antigen fragment of a coronavirus, such nucleic acid being contained within a plurality of multimeric complexes or protein core particles, and wherein the plurality of multimeric complexes or protein core particles are themselves encapsulated within a first biocompatible lipid bilayer shell. In some embodiments, the multimeric complex or protein core particle comprises at least a first positively charged polymer or protein. Wherein the first biocompatible lipid bilayer shell promotes macropinocytosis of the plurality of multimeric complexes or protein nucleosomes by one or more mammalian antigen presenting cells. In some embodiments, the vaccine agent further comprises an adjuvant selected from the group consisting of CpG, poly (I: C), alum, and any combination thereof encapsulated within the biocompatible lipid bilayer. In some embodiments, the vaccine agent further comprises an immunomodulatory compound, such as an IL-12p70 protein, FLT3 ligand, or indoleamine 2,3-dioxygenase (IDO-1) inhibitor, encapsulated within the space between the biocompatible lipid bilayers. In some embodiments, wherein the indoleamine 2,3-dioxygenase (IDO-1) inhibitor is GDC-0919, INCB24360, or a combination thereof. In some forms, wherein the positively charged polymer or protein comprises protamine, polyethyleneimine, poly (β -amino ester), or any combination thereof. In some embodiments, the biocompatible lipid bilayer comprises one or more of: 1,2-dioleoyl-sn-glycero-3-Ethylphosphocholine (EDOPC); 1,2 dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE); 1,2-distearoyl-sn-glycerol-3-phosphoethanolamine-N- [ amino (polyethylene glycol) -2000] (DSPE-PEG); and combinations thereof. In some embodiments, the biocompatible lipid bilayer comprises: (a)

About 30% to about 70% 1,2-dioleoyl-sn-glycero-3-Ethylphosphocholine (EDOPC); (b) About 70% to about 30% 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE); or (c) about 0.5% to about 5% 1,2-distearoyl-sn-glycerol-3-phosphoethanolamine-N- [ amino (polyethylene glycol) -2000] (DSPE-PEG). In some forms, the biocompatible lipid bilayer comprises: (a) About 45% to about 55% 1,2-dioleoyl-sn-glycero-3-Ethylphosphocholine (EDOPC); (b) About 55% to about 45% 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE); and (c) about 1% to about 2% 1,2-distearoyl-sn-glycerol-3-phosphoethanolamine-N- [ amino (polyethylene glycol) -2000] (DSPE-PEG).

Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. References cited herein are not admitted to be prior art to the claimed invention. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Detailed Description

The specific embodiments of the invention are merely limited examples of how the invention may be carried out within the spirit of the invention and should not be construed as limiting the invention in any way.

Example 1: mRNA candidate sequence design and preparation: mRNA sequence prepared by using SEQ ID NO 1NDA sequence as template

Experimental reagent: (1) SpeI endonuclease, (2) high-fidelity DNA polymerase, (3) DNA purification column, (4) thermofisher T7 RNA polymerase, (5) thermofisher 75mM rNTP, (6) 100mM N1-methylpseuduridine-5' -triphosphate, (7) yeasen vaccinia virus capping enzyme, (8) 32mM SAM (9) thermofisher dynabead-quenching enzyme, etc.

1.1 Total Gene Synthesis of template plasmids: DNA sequences of different antigens of interest ORF (open reading frame) sequenceSEQ ID NO:1ToSEQ ID NO:9) A template plasmid was obtained by whole gene synthesis using Puc57 (supplied by Nanjing Kingsler Biotech Co., ltd.) as a vector after being ligated to a T7 promoter sequence (SEQ ID NO: 11), a 5'UTR sequence, a 3' UTR sequence and a polyA sequence in tandem (see FIG. 1 below). Some of the DNA sequences are artificially modified sequences, the modified sequences are artificially synthesized and cloned on the vector, and some are not artificially optimized and modified.

1.2PCR to obtain transcription template DNA sequence: the transcription template DNA can be obtained by using the linearized template plasmid as a template and using raw materials such as poly T long primer, high-fidelity DNA polymerase, dNTP and the like and using a proper program on a PCR instrument. (as shown in figure 2 below).

An upstream primer: 5 'TTGGACCTCGTTACAGAAGCTAATACG3' (SEQ ID NO: 10);

a downstream long primer:

5’TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTAGTTCTAGACCCTCACTTCCTACTCAGG3’(SEQ ID NO:11)

table 1: for example, a PCR reaction system configuration to obtain SEQ ID NO:1.

Table 2: PCR procedure of SEQ ID NO 1.

1.3 in vitro transcription reaction to prepare mRNA (in the case of the 60uL reaction system) (SEQ ID NO: 1)): the prepared IVT template was mixed with T7 RNA polymerase, rNTPs mononucleotide and other materials in the following ratio in Table 3, and transcription reaction was performed at 37 ℃ for 8 hours. After the transcription reaction is completed, the IVT template is digested with DNase to reduce the risk of residual DNA template. Wherein, the modification ratio of the methyl pseudouracil nucleotide is 50%.

Table 3: and (3) proportioning an in vitro transcription system.

Reaction system	Dosage (mu L)
		10 XT 7 transcript buffer	6
T7 enzyme	4
		ATP(75mM)	4
CTP(75mM)	4
		GTP(75mM)	4
UTP(75mM)	2
		Methylpseudouracil nucleotide (100 mM)	1.5
DNA template	1μg
		H 2 O	Supplement to 60

And (3) capping reaction: the transcribed mRNA was subjected to 5' -end capping modification using vaccinia virus capping enzyme to generate cap 0-capped mRNA. The reaction system is shown in the following table 4:

table 4: capped reaction system

Components	Volume of
		RNA	15μL
10×Capping Buffer	2.0μL
		GTP(10mM)	1.0μL
SAM(2mM)	1.0μL
		Vaccinia Capping Enzyme(10U/μL)	1.0μL

1.5, purification: the capped mRNA was purified using thermo fisher dynabeads. The volume ratio of the mRNA to the magnetic bead purification buffer is 1:2, and the mass ratio of the magnetic bead to the mRNA is 1:1. The purified mRNA is dissolved in sodium citrate solution, and can be used for coating of subsequent preparations.

The above is only the process for preparing the final mRNA from the DNA shown in SEQ ID No. 1 (SEQ NO: 1), and the other 8 DNAs are similar to the above, except that the sequences in the open reading frame are different. It will be appreciated by those skilled in the art that the methods disclosed herein can be performed. The specific information of the present invention using 9 DNA new crown sequences is shown in the following table 5:

table 5: DNA sequence description (including optimized and non-optimized native sequences)

Serial number	Sequence name	Whether sequence optimization
			(SEQ NO：1)	S	Is that
(SEQ NO：2)	S RBD	No (Natural sequence)
			(SEQ NO：3)	M	Is that
(SEQ NO：4)	N	Whether or not
			(SEQ NO：5)	S-RBD	Is that
(SEQ NO：6)	S-RBD	Is that
			(SEQ NO：7)	E	Is that
(SEQ NO：8)	S partial	Is that
			(SEQ NO：9)	S1	Is that

The wild-type native sequences corresponding to the above optimized sequences are shown in Table 6 below. The sequence number 1,8,9 in Table 5 was optimized based on the natural sequence shown in sequence number 1-1 in Table 6; sequence number 5,6 in table 5 was optimized based on the native sequences shown in sequence numbers 3-3 in table 6; sequence number 3 in Table 5 was optimized based on the native sequences shown in sequence numbers 5-5 in Table 6; SEQ ID No. 7 in Table 5 was optimized based on the native sequences of SEQ ID Nos. 9 to 9 in Table 6. In fact, only sequences 4 and 2 are native sequences and are not optimized; thus, the native sequence has only 2 strands. The optimization may be complete optimization of the full-length sequence or partial sequence optimization, and for example, it is complete optimization or partial optimization of the S gene for number 1,8,9 in table 5, and only shows the length of the sequence or the partial sequence at a different position in the full-length sequence. The optimization process is to modify or design the nucleic acid DNA so that the transformed RNA sequence can express more target antigen in cells, or be more stable, or be functionally required in other aspects.

TABLE 6 list of native (wild type, WT) DNA sequences corresponding to the optimized sequences in Table 5.

Serial number	Sequence name
		(SEQ NO：1-1)	S
(SEQ NO：3-3)	S-RBD
		(SEQ NO：5-5)	M
(SEQ NO：6-6)	N
		(SEQ NO：7-7)	S-RBD
(SEQ NO：8-8)	S-RBD
		(SEQ NO：9-9)	E

The above DNA sequences, the DNA template sequences numbered 1 to 9 differ only in the sequence of the ORF region, and the remaining functional regions such as the T7 promoter sequence, UTR sequences at the 5 'and 3' ends and polyA sequences are completely identical.

The homology comparison is carried out on the optimized sequence and the corresponding natural wild type DNA sequence, and the comparison method is carried out as the method described by the website address: the results obtained by Clustal Omega (https:// www.ebi.ac.uk/Tools/msa/clustalo /) alignment are shown in Table 7 below. However, both sequences numbers 2 and 4 were not optimized, so the sequence homology was 100%.

Table 7: results of homology comparisons of native and optimized DNA sequences.

The sequences of the 9 mRNAs obtained by in vitro transcription according to the above method are shown in Table 8 below:

table 8: list of mRNA sequences obtained as described above.

Serial number	Sequence name	Sequence optimization
			(SEQ NO：1.1)	S	Is that
(SEQ NO：1.2)	S-RBD	No (Natural sequence)
			(SEQ NO：1.3)	M	Is that
(SEQ NO：1.4)	N	No (Natural sequence)
			(SEQ NO：1.5)	S-RBD	Is that
(SEQ NO：1.6)	S-RBD	Is that
			(SEQ NO：1.7)	E	Is that
(SEQ NO：1.8)	S partial	Is that
			(SEQ NO：1.9)	S1	Is that

The above obtained mRNA sequences of 9 as listed in table 8 differ only in the ORF region, and other functional regions such as UTR sequence and polyA sequence are completely identical: furthermore, the ORF regions are sequences transcribed with optimized or non-optimized DNA sequences. By non-optimized sequence is meant a sequence that is identical or has greater than or equal to 95% homology to a native wild-type nucleic acid sequence, e.g., SEQ NO:2 or SEQ NO:1.2; or SEQ NO:1.4 or SEQ NO:4, or a sequence shown in the figure.

A T7 promoter: TAATACGACTCACTATA (SEQ ID NO: 12)

5' UTR sequence:

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC(SEQ ID NO:13)；

3' UTR sequence:

GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAA CTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATA AAAAACATTTATTTTCATTGC(SEQ ID NO:14)；

polyA tail sequence:

AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA(SEQ ID NO:15)。

the DNA optimized sequences in table 7 correspond to the mRNA sequences of table 9. This is because the optimized DNA sequence is aligned with the analysis of the native sequence, and thus, following this logic, the optimized mRNA sequence obtained also exists in a similar relationship to the native sequence (wild type). See table 9 for a specific list. 1.1 indicated by sequence number in table 8; 1.8;1.9 sequences were optimized based on the 1-1-1 native sequences in Table 9; 1.5 indicated by sequence number in Table 8; 1.6 optimized based on native sequences numbered 5-5-5 in Table 9; sequence 1.3 shown by the sequence numbers in Table 8 was optimized based on the natural sequences numbered 3-3-3 in Table 9; the sequence shown in sequence number 1.7 in Table 8 was optimized based on the native sequence numbers 7-7-7 in Table 9; sequences 2 and 4 are native sequences and are not optimized; thus, the native sequence has only 2: the amino acid sequence of SEQ NO:2-2-2; the amino acid sequence of SEQ NO:4-4-4.

Table 9: native mRNA sequence.

Serial number	Sequence name
		(SEQ NO：1-1-1)	S
(SEQ NO：2-2-2)	S-RBD
		(SEQ NO：3-3-3)	M
(SEQ NO：4-4-4)	N
		(SEQ NO：5-5-5)	S-RBD
(SEQ NO：6-6-6)	S-RBD
		(SEQ NO：7-7-7)	E
(SEQ NO：8-8-8)	S partial (part)
		(SEQ NO：9-9-9)	S1

Table 10: the homology of the native mRNA sequence with the sequence optimized is compared.

It is understood here that the optimized RNA sequence can be obtained by means of an optimized DNA sequence, but it is of course also possible to generate the RNA sequence directly by means of sequence synthesis. The promoter can be prepared by adopting a conventional promoter sequence, and an untranslated region, such as a UTR sequence, can be added at the head and tail of the sequence to ensure that the RNA sequence is more stable. For the screening of sequences, particularly UTR sequences, detailed descriptions will be given in the detailed description of the invention. General UTR sequences are possible, and the specific sequences of these so-called promoters, suitable UTR sequences, poly sequences, and also for nucleic acid modifications and sequence optimization, are all intended to ensure stable transport of nucleic acid sequences in vivo and, at the same time, high expression levels. It will be understood by those skilled in the art that any other sequence is contemplated as being within the scope of the invention and is some preferred examples of the invention, but that without these elements, only the optimized new corona sequence is contemplated and the mere potential effect is not very desirable. It can also be seen from the experiments that, even if the sequences of these elements are identical, the key to good and bad functioning, or decisive, is also the nature of the ORF sequence itself. However, it is undeniable that these additional sequences, together with the ORF sequence, can have a better effect.

In some alternative embodiments, additional sequences may be inserted in front of the ORF sequence, which may also help to achieve functional improvements in RNA expression, such as reducing some enzyme cleavage sites, thereby making the protein more active, such sequences may be as follows: for example, the following sequence is inserted at the fourth nucleotide at the 5-terminus of the ORF sequence. For example, the 5' end is the nucleotide beginning with AUG, and the inserted sequence is found from the 4 th nucleotide into one or more of the following sequences.

5’－AUGUUCCUGCUGACUACAAAACGGACU－3’(SEQ NO：38)

5’-GACGCUAUGAAGAGGGGCCUGUGCUGUGUGCUGCUGCUGUGCGGAGCUG UGUUCGUGUCCAACAGC-3’(SEQ NO：39)。

The insertion site may be inserted after the first few nucleotides at the 5-terminal end, or may be inserted after the first few nucleotides at the 3-terminal end, or may be directly linked to an ORF (open reading frame) sequence, and these sequences have various functions and sequences for comprehensively improving the properties of RNA. These additional sequences may be inserted into the ORF sequence and become part of the ORF sequence. It is understood that sequences other than ORF sequences are a preferred embodiment of the present invention, but these preferred embodiments do not indicate that these sequences must be present to achieve the purpose and intent of the present invention.

Table 11: the amino acid sequences expressed in translation in table 8.

The amino acid sequences of the mRNA translation expression in Table 8 are all 100% homologous to the amino acid sequences of the native mRNA translation expression in Table 9. This indicates that the amino acid sequence of the finally expressed protein, i.e.the amino acid sequence of the protein, is the same, whether it is the optimized sequence or the native sequence. The sequence identity merely indicates that the material is the same in nature, but the content and activity are not equivalent concepts.

Example 2 of implementation: in vitro cell expression level validation of candidate mRNA sequences

1.1 test article:

9 new coronary mRNA vaccines: in order to detect protein products, 6 consecutive histidine codons (CAU, see table 12 in particular) are fused to the 3' end of each mRNA sequence, and a histidine tag (His-tag) formed by 6 consecutive histidines can be generated at the C-end of the protein product, so that the expression of the antigen of interest can be indirectly detected using an anti-histidine tag antibody.

Table 12: specific sequence characteristics of 9 new crown mRNA vaccines.

In the above table ". Star." represents the complete sequence containing 9 different RNAs in Table 8, the complete sequence including other functional regions such as promoter sequence, UTR sequence and polyA sequence are completely identical (without additional sequence), and total of 9 pieces are respectively named nCoV-N, wherein N is a natural number from 1 to 9, as shown in the table.

2.2 test reagents: HEK-293 cells (purchased from manufacturer:); DMEM complete medium (Gibco): 1% double antibody (Gibco), 10% FBS (Hyclone); PBS (solibao); transfection diluent: opti-MEM (Gibco); lipofectamine MessengerMAX (Invitrogen); RIPA lysate (strong) (protease inhibitor cocktail Pierce) ^TM Protein Concentrator PES,3K MWCO (Pierce); BCA protein concentration assay kit (enhanced) (cloudy day); tris-glycine running buffer (solibao); electrotransfer liquid (solibao); TBST:1 × TBS (Solebao) +1 ‰ Tween-20 (solibao); skim milk powder (An Jia); methanol (alatin); beyogel ^TM Plus PAGE precast gel (4-20%, 15 wells) (Biyun day); his Tag Antibody (HRP) (Solaibao); high-sig ECL Western Blotting Substrate (Tanon); development fixing kit (Biyun day).

2.3 test consumables: t75 cell culture flasks (Thermo); 15/50ml centrifuge tubes (Corning); pipettes (Corning); 1.5/0.5ml centrifuge tube (Axygen); PVDF membranes (cloudy days); transfer filter paper (bi yun day); X-OMAT BT film (5X 7 inches) (cloudy day); tablet cassette (cloudy day); 3.3 testing the instrument; CO2 ₂ Incubators (Panasonic); inverted microscopes (Leica); electrophoresis apparatus (Bio-Rad); electrophoresis tank (Bio-Rad); a transfer tank (Bio-Rad); centrifuge (Kubota); gel imaging Universal Hood II (Bio-Rad).

Test method

1. ) HEK293 cells were plated in six well plates, 1X 10 per well ⁶ The cells were incubated in an incubator at 37 ℃ for 16 hours.

2. ) The following steps were followed to transfect 2. Mu.g each of the 9 mRNA vaccine sequences in Table 1 (prepared in example 1) using Lipofectamine MessengerMAX transfection reagent: the solution A was incubated for 10 minutes, mixed with the solution B, and incubated at room temperature for 5 minutes before cell infection.

Table 13: reagent composition and content of solution A and solution B

3) After 24 hours of transfection, the culture medium supernatant was collected, added 1/100 volume protease inhibitor immediately and placed on ice; mu.L of RIPA lysate (to which 1/100 volume protease inhibitor has been added) is added to each well of cells, lysed on ice for 30 minutes, the lysate is transferred to a 1.5ml centrifuge tube, centrifuged at 18000rpm for 20 minutes at 4 ℃, and the supernatant is transferred to a new centrifuge tube.

4) Concentrate the culture supernatant using Protein Concentrator PES: the collected medium supernatant was pipetted 500. Mu.l into an adsorption column, centrifuged at 12000rpm for 30 minutes, and the concentrated medium supernatant was transferred to a new centrifuge tube.

5) Using the BCA kit to detect the protein concentration of the cell lysate.

Preparation of BSA standard: 0.8ml of the protein standard preparation solution was added to a tube of protein standard (20 mg BSA), and after sufficient dissolution, 25mg/ml BSA standard solution was prepared. Mu.l of 25mg/ml BSA standard solution was taken and added to 920. Mu.l PBS to prepare 2mg/ml BSA standard.

Preparing a BCA working solution: according to the number of samples, a proper amount of BCA working solution was prepared by adding 50 volumes of BCA reagent a to 1 volume of BCA reagent B (50.

The BSA standards were diluted to make a standard curve as follows (table 14):

each 100. Mu.l of 8 standards was added to a 96-well plate, and two wells were set. Sample well: add 100. Mu. L H per well in 96-well plate ₂ O, adding 1 μ l of sample and setting two multiple holes. Mu.l of BCA working solution was added to each well, and the mixture was left at 37 ℃ for 30 minutes. Assay A562 with microplate reader. And calculating the protein concentration of the sample according to the standard curve.

6) Protein sample preparation: according to the protein concentration of the sample, the cell lysates containing 45. Mu.g of protein were pipetted into 0.5ml centrifuge tubes, 3. Mu.l of 5 XSDS loading buffer was added, and H was used ₂ O adjusting each protein sample to a final volume of 15 μ l; the albumin sample in the culture medium is prepared according to the volume of the corresponding cell lysate, and the protein is denatured by boiling water for 5 minutes before loading (the protein containing the coded antigen is obtained).

7) Taking out the prefabricated gel, assembling the electrophoresis device, adding electrophoresis buffer solution, and loading. The wells to which no protein sample was added were loaded with 15. Mu.l of 1 XSDS loading buffer.

8) Electrophoresis: electrophoresis was carried out at a constant voltage of 80V for 30 minutes, followed by adjustment of voltage to 100V for 40 minutes. After electrophoresis, the gel plate was washed with H2O and carefully removed.

9) Turning the film: activating the PVDF membrane in methanol, and immersing the membrane, sponge and filter paper in the precooled membrane transferring liquid. And (3) putting the rotating membrane into the membrane transferring liquid downwards in a black state, and sequentially putting a sponge, two layers of filter paper, glue, a PVDF membrane, two layers of filter paper and the sponge on the rotating membrane, wherein bubbles cannot be generated in each step. Closing the transfer printing clamp, placing the transfer printing clamp into the transfer printing groove, making the black surface of the clamp face the black surface of the groove, making the white surface of the clamp face the red surface of the groove, placing the ice box into the transfer printing groove, pouring electric transfer liquid, and inserting the electrode. For nCoV-1/4/8/9 with larger molecular weight, constant pressure is 100V, and the membrane is rotated for 90 minutes; for nCoV-2/3/5/6/7 with smaller molecular weight, constant pressure 100V, and film transfer for 60 minutes. After the completion, the PVDF membrane is taken out, the direction of the membrane is marked, and the membrane is placed in a Western blot antibody incubation box.

10 Closed): 10% skimmed milk powder was prepared using 1 × TBST, the membrane was placed in the confining liquid and blocked on a shaker at room temperature for 1 hour.

11 Primary antibody incubation: 1% skim milk was prepared using 1 XTSST, the His-Tag (HRP) primary antibody was diluted 1:10000 and incubated for 2 hours at room temperature with shaking.

12 Membrane washing: primary antibody was recovered and the membrane was washed 4 times with 1 XTSST for 5 minutes each.

13 Chemiluminescence, development, fixation: and (3) carrying out detection by a chemiluminescence method, incubating the membrane with a chemiluminescence substrate, developing by X-ray film exposure, and scanning the film.

2.5 the results of the experiment are shown in FIG. 3. And (4) analyzing results: after 9 mRNA vaccine sequences are transfected by Lipofectamine MessengerMAX, the cell state is good; after the Western blot exposure result is scanned by gel imaging Universal Hood II, image J and Adobe Illustrator are used for mapping and analyzing, and the result shows that the exposure background is low, and the protein band is clear and specific (shown in figure 3). After HEK-293 cells are transfected by the 9 mRNA vaccine sequences respectively, a target band is detected in a culture medium supernatant or a cell lysate, wherein nCoV-5/6/8/9 protein secreted to the outside of the cells can be detected in the culture medium supernatant due to a signal peptide sequence in nCoV-5/6/8/9.

The molecular weight of each protein is compared with the expected molecular weight of the protein: the molecular weight of nCoV-2/4/5/7 protein was substantially consistent with that expected. The nCoV-1/6/8/9 protein molecular weight was slightly larger than expected, probably due to the fact that the S protein is highly glycosylated in vivo. In the culture supernatant, nCoV-8 has a band with smaller molecular weight below the expected band, and is probably S2 subunit formed by S protein in vivo shearing. nCoV-3 has a band with a smaller molecular weight below the expected band, and may have shear in vivo, and in addition, has a diffuse band at a higher molecular weight, suggesting that multimeric forms may exist in vivo.

In conclusion, the results show that 9 mRNA vaccines have correct sequence design and can be correctly expressed in vitro. RNA is a major role in gene expression, and the maintenance and expression of the entire genetic information is performed in the "RNA world", in which messenger RNA (mRNA) provides an information transfer intermediate representing the DNA sequence of a protein. Gene expression can be divided into two phases-transcription and translation. Transcription is carried out by taking DNA in cells as a template, generating a single-stranded mRNA as a direct template for protein biosynthesis according to the base complementary pairing principle, wherein the sequence of the single-stranded mRNA is complementary with a non-coding strand of the DNA and is the same as the coding strand; translation is a process of interpreting genetic information accumulated in a nucleotide sequence of mRNA and generating an amino acid sequence of protein, and a peptide chain of protein having a specific amino acid sequence is synthesized in the 5' → 3' direction from the start codon at the 5' end of mRNA according to the triplet coding rule that determines one amino acid for every three nucleotides. The mRNA vaccine is based on the characteristic that mRNA can be quickly translated into target protein, mRNA transcribed in vitro is conveyed to an antigen presenting cell (dendritic cell) through a delivery system, then the dendritic cell directly and efficiently expresses antigen, and an antigen specific T cell is stimulated and activated through MHC I or MHC II molecules, so that a B cell and the T cell are activated, and an organism generates antigen specific immune response. Therefore, correct expression of the target protein by mRNA is a prerequisite for the mRNA vaccine to function.

This also indicates that some other sequences, either before or after the ORF region, are possible and functionally capable of effecting expression of the antigen. Meanwhile, the successful expression of the antigen in vitro cells can also be realized by increasing the additional sequence (the specific experimental data is omitted). As mentioned above, the RNA itself that plays a determining role is the information of the core coding protein.

In eukaryotic cells, the mature mRNA directly used as a translation template needs to have one or several of the following structural features: (1) A protein coding sequence comprising an initiation codon and a stop codon, with continuity between codons and without any nucleotide separation; (2) The coding sequence has an untranslated region (UTR) on both ends, the 5'UTR located from the methylated guanine nucleotide cap at the start of mRNA to the start codon AUG, and the 3' UTR extending from the stop codon at the end of the coding region to the front of Poly a tail (Poly-a), which are important for translation efficiency and mRNA stability; (3) The 5 'end cap structure, namely a methylated guanine nucleotide (m 7 GpppNp) combined with the 5' end of mRNA in a distinctive 5'-5' combination mode, is helpful for the recognition of the mRNA by ribosome during the translation process, stabilizes the combination of the ribosome and the mRNA, promotes the initiation reaction and ensures that the translation is carried out along the correct direction; (4) The 3 'end poly A tail structure can collect key translation initiation factors to enable the key translation initiation factors to be tightly combined with the 3' end of mRNA, so that the mRNA maintains a circular conformation, translation initiation efficiency is improved, and the poly A tail structure has a promotion effect on reinitiating a translation process. In addition, the Poly a tail and the proteins bound thereto help protect the mRNA from exonuclease degradation, thereby enhancing the stability of the mRNA.

By the present invention, more effective UTR sequences, which have different effects on the expression of the same ORF region, were also screened, and the present invention also improved UTR sequences, thereby improving stable lines of mRNA. It will be appreciated by those of ordinary skill in the art that UTR sequences may have effects not only on new crown mRNA but also on other non-mRNA sequences.

Therefore, to ensure that the in vitro transcribed mRNA can be expressed in cells with high efficiency and stability like the mature mRNA molecules, the test is optimized in a series of processes of vaccine design and synthesis, including: 1) Modifying nucleotide to reduce the inherent immune response of human body to mRNA; 2) Optimizing codons, and changing rare codons in mRNA into more common synonymous codons to improve the protein expression amount; 3) 5'UTR and 3' UTR sequences are optimized, the translation efficiency of mRNA is improved, the stability of mRNA is enhanced, and the half-life period of the mRNA is prolonged; 4) 5' capping to enhance the stability of mRNA and increase the protein expression; 5) 3' poly-A tail is added to enhance the stability and translation efficiency of mRNA; 6) The prepared mRNA is purified, double-chain by-products are reduced, and unnecessary immune stimulation is prevented. Any of these optimizations may be an improvement over conventional techniques.

From the present invention, it is apparent that 1 to 9 mRNs of Xinguan are identical in sequence to 5'UTR and 3' UTR used in the specific embodiment, and therefore all of the nucleic acids are expressed in cells, indicating that all of the genes to be screened are likely to produce antigens in vivo and thus cause antibodies in the host.

In order to detect whether the designed 9 new crown mRNA vaccines can be correctly expressed, the experiment utilizes Lipofectamine MessengerMAX transfection to enable mRNA to enter HEK293 cells for expression, after 24 hours of transfection, the expression level of exogenous proteins reaches a peak value, meanwhile, culture medium supernatant and cell lysate are collected, and the Western blot technology is utilized to detect the target antigen expression. The HEK-293 cell rarely expresses endogenous receptors required by an extracellular ligand, is easy to transfect, and is a very common tool cell strain for expressing and researching exogenous genes, so that the HEK-293 cell is selected as a host cell, and mRNA can be ensured to smoothly enter the cell. Since some mRNA sequences have signal peptides, the protein products are secreted to the outside of the cell, so the test detects the protein expression in the cell lysate and the protein expression in the culture medium supernatant. The Western blot technique is to stain the protein sample treated by gel electrophoresis through specific antibody, and obtain the information of the expression of specific protein in the analyzed cell or tissue through analyzing the stained position and stained depth. In the absence of specific antibodies, 6 consecutive histidine Codons (CAU) were fused to the 3' end of each mRNA sequence in this assay, and a histidine tag consisting of 6 consecutive histidines could be generated at the C-terminus of the protein product, thereby allowing indirect detection of the expression of the antigen of interest using an anti-histidine-tag antibody. In fact, histidine tags formed by amino acids are used to indirectly detect whether an antigenic substance is produced in the cell (the antigen is actually the protein information encoded by the mRNA).

Experiment 3: comparison of immunogenicity of 9 mRNA vaccines in mice

3.1 purpose of the experiment

After 9 different new coronavirus mRNA vaccines are used for immunizing mice, the ELISA method is used for detecting the antigen-specific antibody titer in the mice, and the optimal vaccine reagent is screened by comparing the antibody titer level.

3.2 information on the test article

The drug was supplied directly from Shimi (Shanghai) Biotechnology Co., ltd., the department of preparation, and adjusted to a predetermined concentration. Carried to the model biology research center of the Shanghai south at 2-8 ℃ and is specially delivered to the intrabarrier administration.

Table 15: various concentrations and dosages of administration and modes of injection.

Note that the sequences numbered 1-9 correspond to the sequences of mRNA1-9 in Table 8 above, where 2019-nCoV-1-9 corresponds to SEQ NO: 1.1-1.9.

3.3 preparation of LPP for delivery vehicles.

Materials: pbAE (protamine sulfate, sigma), DOPE (Avanti), M5 (pharmacomond), DSPE-mPEG2000 (lipoid), mRNA (containing complete sequences of different mRNAOFR in Table 8, numbered 2019-nCoV-1.1-1.9;

the structural formula of M5 is as follows:

the preparation process comprises the following steps:

3.3.1 preparation of solution:

preparation of PbAE solution: dissolving a proper amount of PbAE in a proper amount of aqueous solution to prepare 1mg/ml of PbAE solution;

preparing a lipid solution: preparing a lipid solution with the concentration of 40mg/ml according to the mass ratio of M5 to DOPE to DSPE-mPEG2000= 49;

mRNA solution: diluting the appropriate solution to 1mg/ml;

3.3.2 preparation of core nanoparticles:

preparation of PbAE phase: taking a proper amount of PbAE solution, and diluting with purified water to 0.60mg/ml;

preparation of mRNA phase: taking a proper amount of mRNA solution, and diluting the mRNA solution to 0.20mg/ml by using purified water;

adding the PbAE solution into the mRNA solution while stirring, wherein the mixing volume ratio is that the PbAE solution: mRNA solution =5:1.

Preparation of 3.3.3LPP lipid nanoparticles:

volume =12.0mL as parameter; start water =0.35ml, end water =0.10ml, flow rate ratio =3 (core nanoparticle solution): 1 (lipid solution), flow rate =20ml/min, temperature =37 ℃ mixing; the operation is carried out on a microflow chip device, and the device is a fishbone chip of a commercial factory PNI for preparing the lipid nano-particles.

4. Purification of LPP lipid nanoparticles:

and (3) diluting the LPP lipid nanoparticles with a PBS solution, and performing centrifugal purification by using an ultrafiltration centrifugal tube to obtain a purified lipid nanoparticle solution.

3.3 Experimental reagents

0.01M PBS buffer (PH = 7.4) (solibao); cleaning solution: 0.05% Tween-20 (Solibao) + PBS blocking solution: 10% adult bovine serum (ilex purpurea) plus PBS; sample diluent: 10% adult bovine serum +0.05% Tween-20 + PBS; color development liquid: 3,3',5,5' -tetramethylbenzidine TMB (Thermo); stopping liquid: 2N h2so4; secondary antibody: anti-mouse IgG-HRP (Abcam); envelope antigen (antigen to antibody):

table 16: list of different antigens

3.4 administration of drugs

The administration route is intramuscular injection, and the administration mode similar to the route planned in the clinical test is selected. The volume of administration was 100. Mu.l/mouse, and 50. Mu.l of each of the left and right hind leg thigh muscles was injected with the drug. Blood was collected on day 10 after immunization for antibody titer detection.

3.5 Observation and inspection

During the test period, the animal room manager collaborates the state of the mice and observes the state of the mice according to the test specification every day. The experimenter makes regular observations of the mouse status including, but not limited to: behavioral activity, food intake, weight change (3 weight measurements per week), appearance signs, or other abnormal conditions. The number of deaths and side effects of animals in the groups were recorded based on the number of animals in each group. Mouse abnormalities include, but are not limited to: obviously emaciation, weight loss greater than 20%; the food and the water can not be taken by oneself; and the following clinical manifestations and sustained deterioration of the animals appeared: erecting wool; an arch back; the color of ears, nose, eyes or feet is whitish; short breath; twitching; continuous diarrhea; dehydrating; bradykinesia; and (6) sounding.

3.5.3 antibody titer detection

1) Antigen coating: antigen coating was performed according to table 15 for the antigens corresponding to the different vaccines, and the antigen list is shown in table 16. The antigen was diluted with PBS and coated at a concentration of 5. Mu.g/ml, 50. Mu.l was added to each well of a 96-well plate, and incubated for 12 hours at 4 ℃ in an air bath.

2) Washing: washing was carried out three times by adding 200. Mu.l of washing solution to each well.

3) Sealing: blocking of 96-well plates was performed using blocking solution, 200. Mu.l per well, and incubation for 2 hours at 27 ℃ in an air bath. The plate after sealing is washed three times by adding 200 mul of washing liquid into each hole.

4) Sample dilution: the samples were diluted with the same volume of serum dilution gradient (200/600/1800/5400/16200/48600/145800/437400) using sample dilutions, and each sample was assayed in duplicate wells with 50. Mu.l of sample added to each well and incubated at 27 ℃ in an air bath for 2 hours.

5) Washing: the plate was washed 3 times with 200. Mu.l each time using a wash solution.

6) Secondary antibody incubation (HRP-labeled goat anti-mouse IgG secondary antibody): using the sample dilution, the secondary antibody was diluted at a dilution of 1.

7) Washing: the ELISA plates were washed 4 times, 200. Mu.l per well each time, and the final wash removed the liquid from the plates to dryness.

8) Color development: 50 mul of TMB color development liquid is added into each hole of the cleaned plate for color development, and the color development state is observed in real time.

9) Terminating: the wells were stopped by adding 50. Mu.l of stop buffer, followed by machine detection.

10 Dual wavelength detection index of microplate reader: OD values were read using a wavelength of 450nm and a wavelength of 610 nm.

11 Data analysis: 1) The sample dilution was curve-fitted to the detected OD values. 2) The logarithmic curve equation Y = M X ln (X) + Z was obtained, where the value of Y was substituted into the negative control OD value, confirming R2. 3) The negative control (Cut off) 2.1-fold OD value was substituted into equation X = EXP ((Y-Z)/M), and the antibody titer was calculated.

The results are shown in fig. 4, which shows: the detection of antigen-specific IgG antibodies in the serum of mice at day 10 after the administration of the vaccine revealed that the serum titer of mice administered with vaccine No. 1 was the highest, the vaccine No. 2/5/9 had almost no antibody production, and the vaccine No. 4/8 had a lower level of antibody production. The titer level of the No. 1 vaccine antibody reaches 10 ⁴ Can effectively stimulate the immune response of the body fluid. Vaccine No. 1 ((SEQ NO: 1), SEQ NO: 1-1) (named COVID-19-LPP-mRNA) is able to stimulate the body to produce higher levels of antigen-specific antibodies in a short time compared to other vaccines. So as to determine the vaccine No. 1 (named as COVID-19-LPP-mRNA) for subsequent process development and clinical research.

The new crown mRNA vaccine is used for immunizing mice in a muscle administration mode, and during the experiment, except for one experiment group of 2019-nCoV-2, no animal is dying/dead. The mice do not show obvious physical and behavioral abnormalities through daily observation. The body weight of the mice in the test group slightly decreased 1 to 2 days after the administration, but they were within the acceptable range, and the body weight was recovered 1 to 2 days later.

And on the 10 th day after immunization, the immunogenicity strength of different mRNA vaccines is evaluated by detecting the antibody titer in the mouse serum, so that the mRNA vaccines which have stronger immunogenicity and effectively activate the in-vivo antigen specific immune response are screened. According to the results, it was found that the antibody titer was highest in mice of the nCoV-1 vaccine administration group, almost no antigen-specific antibody was produced in mice of the nCoV-2/5/9 vaccine administration group, and the nCoV-4/8 vaccine was able to activate the body to produce antigen-specific antibody, but the antibody titer was low. It can be known that nCoV-1 new crown mRNA vaccine can effectively activate humoral immune response in organism, including germinal center B cell formation, antibody type conversion and high affinity antibody maturation.

Promotion of

B cells differentiate into memory B cells and plasma cells, producing higher levels of antigen-specific antibodies. The other vaccines, no. 2, no. 4, no. 5, no. 8 and No. 9 vaccines, can not activate the humoral immune response in the organism well, and the antigen-specific antibody titer is low and can not reach the ideal standard. The vaccines No. 3, no. 6and No. 7 fail to carry out vaccine immunogenicity detection due to antigen synthesis reasons, and data thereof are not shown in antibody titer detection tests, but after detection, the three vaccines also have antibody production, and the antibody titer is not high but is higher than that of a control, which indicates that all the vaccines have antibody production and can cause organism immunity.

From the above experimental results, it was shown that the reagent No. 1 has a good effect, but the reagent No. 4 or 8 has the production of antibodies. These differences may be due to the different antibody production resulting from the differences in the design and optimization of the nucleic acid sequences, thereby collectively representing the differences in titer.

Experiment 4 COVID-19-LPP-mRNA immunization of C57BL/6 mice at different concentrations

1 purpose of the test: injecting COVID-19-LPP-mRNA with different concentrations twice into muscles of a C57BL/6 mouse, wherein the COVID-19-LPP-mRNA is injected once on the 0 th day and the 7 th day respectively, observing the weight change of the mouse, collecting blood on the 10 th day after the second immunization, and centrifuging to obtain serum; spleen tissue was harvested at day 14 after the second immunization and spleen cells were processed.

2. Test drug information

Table 17: name: concentration dilution table of COVID-19-LPP-mRNA

3. Test animals and management

3.1 test animals: species/strain: c57BL/6 mice; grade: an SPF level; female: 30 are provided; weight: about 18-20g; the week age is as follows: 8-9 weeks. On the day of animal grouping, the ears of the mice are marked by using a perforator, wherein the upper, middle and lower parts of the left ear represent No. 1/2/3, and the upper, middle and lower parts of the right ear represent No. 4/5/6 respectively.

3.2 animal feeding: the quarantine period is three days, and animals in the animal house and veterinarians perform quarantine on the batch of animals according to specified sampling in the quarantine period. Mice were housed in IVC cages, with no more than five per cage. Environmental parameters of the animal house (411) are recorded during the rearing period. All the feed and drinking water are purchased and provided by the Shanghai's Square model biology research center. Warp beam ⁶⁰ The SPF-level mouse feed sterilized by Co irradiation is provided by cooperative medical biological responsibility limited company in Jiangsu province, and each batch of feed provides a quality detection report containing detection indexes such as nutrition, pesticides and microorganisms. Deionized water, feeding containers and bedding were autoclaved into the barrier and replaced twice a week.

4 test method

Administration: the administration was performed on day 0 and day 7, respectively (day 0 was recorded on the day of the first administration). The dose was 100. Mu.l/mouse, and 50. Mu.l of each drug was injected into the thigh muscle of the left and right hind limbs.

4.1 Observation and inspection: mice status was co-checked and observed daily by south model animal house animal care personnel as specified during the trial. The experimenter regularly observes mouse status as prescribed, including but not limited to: behavioral activity, intake of water, weight change (3 weight measurements per week), appearance signs or other abnormal conditions. The number of deaths and side effects of animals in the groups were recorded based on the number of animals in each group. Mouse abnormalities include, but are not limited to: obviously emaciation, the weight is reduced by more than 20 percent; the food and the water can not be taken freely; and the following clinical manifestations and sustained deterioration of the animals appeared: erecting wool; the back of the bow; the color of ears, nose, eyes or feet is whitish; short breath; twitching; continuous diarrhea; dehydrating; retardation of locomotion; and (6) sounding.

4.2 blood collection preparation and blood sample treatment: after day 10 of the second immunization, we will bleed all mice within the trial. The orbital plexus vein will be used to collect blood, approximately 500uL per mouse. The collected whole blood was allowed to stand at room temperature for 2 hours, centrifuged at 8000rpm for 10 minutes, and serum was collected and stored at-20 ℃.

4.3 spleen harvesting and cell processing: on day 14 of the second immunization, the mice were euthanized and spleens were dissected and spleen single cell suspensions were prepared.

Test results

5.1 death and clinical observations

During the test, no death/moribund condition of the animals was observed. During the test period, no obvious abnormal phenomenon was observed in all the test mice.

5.2 body weight

No significant weight fluctuations occurred during the test period. Because of random grouping, the mean values of basal body weight of each group of mice are not at the same baseline, so the percent change in body weight is compared to measure the change in body weight of animals. The specific weight percentage trend is shown in figure 5 below. During the test period, the mice were observed daily, and no obvious abnormality in posture and behavior was found. The test mice all had slight weight loss 1-2 days after immunization, but no weight loss of more than 10% was observed, and the body weight was recovered after 1-2 days. The weight loss degree and the concentration of the test article basically correspond, but the difference is not obvious. Preliminary presumption, weight loss is caused by immune system stress.

Discussion and conclusions

In summary, under the test conditions, the C57BL/6 mice were administered COVID-19-LPP-mRNA twice by intramuscular injection, once on day 0 and once on day 7, at a dose of 30/15/7.5/2.5/1. Mu.g/mouse, and the results showed that no drug-related dying/death was observed. The behavior and activity of the mice, the amount of water intake for food intake, the weight change (3 weight measurements per week), the physical signs of the appearance and the like are not abnormal. The data above preliminarily indicate that COVID-19-LPP-mRNA is not significantly toxic.

Experiment 6: evaluation of the Effect of mouse antibody response after immunization with COVID-19-LPP-mRNA

6.1 purpose of experiment: the level of specific binding and neutralizing antibodies induced in mice by the novel corona mRNA vaccine COVID-19-LPP-mRNA was evaluated using indirect ELISA, SARS-CoV-2 pseudovirus neutralization, live virus plaque assay.

6.2, test article information: name: mRNA vaccine COVID-19-LPP-mRNA (vaccine No. 1 screened in example 3) size: 0.5mg/ml; the characteristics are as follows: a milky white liquid; the validity period is as follows: can be stored at 2-8 deg.C for 28 days

6.3 Experimental animals: name: SPF grade inbred mice; quantity: BALB/C mice 18; 30C 57BL/6 mice (white-variant laboratory mice, as well as numerous common subfamilies, originated in mice (Mus musculus.) since 1920 their birth in New York, BALB/C mice have propagated over 200 generations in global research institutions and are widely used in immunological, physiological animal experiments); sex: a female; age: 6-8 weeks old.

4.4 Experimental reagents and consumables: SARS-CoV-2 (2019-nCoV) Spike Protein (S1 + S2 ECD, his tag) (the S1+ S2 ECD is called S1+ S2 extra-cellular domain, namely the extracellular domain of S Protein, the full-length molecular weight of S Protein is 141.20kDa, the molecular weight of S1+ S2 ECD Protein is 134.36 kDa); purchased from Beijing Yi Qiao Shenzhou science and technology, inc.

EIA/RIA 96 pore plates; 0.05M pH9.6 carbonate buffer (coating solution); 0.5% Tween-20 PBS (PBST lotion); 10% goat serum PBS (blocking solution); 2% goat serum PBST (antibody dilution); HRP-labeled goat anti-mouse IgG secondary antibody; single-component TMB color development liquid; 2M H2SO4 solution (stop solution); a cell culture flask; 96-well cell culture plates; 12-well cell culture plates (Corning); DMEM medium (Hyclone); fetal bovine serum (Gibco; GEMINI); streptomycin qing mixed solution (Gibco); avicel RC-581 (FMC Biopolymer); crystal violet (solibao); bright-Glo luciferase assay reagent (Promega) SARS-CoV-2 virus: SARS-CoV-2 (C-Tan-nCoV-HB-01strain, GISAID access No. EPI _ ISL _ 402119)

SARS-CoV-2 pseudovirus: this laboratory prepared the SARS-CoV-2 pseudovirus of HIV-1 core (i.e., a virus that contains HIV-1 antigens rather than a neocorona).

4.5 Experimental methods

4.5.1. Animal immunization: in this experiment, we used BALB/C and C57BL/6 mice for vaccine immunogenicity testing, using 2 immunization doses: 30 μ g (high dose)/3 μ g (low dose); 2 immune cycles: single-needle immunization (day 0 immunization) and double-needle immunization ( day 0, 21 immunization), for 8 groups. After the vaccine was diluted to a prescribed concentration with PBS, intramuscular injection was performed through the thigh site in a volume of 30. Mu.l per side, and bilateral injection was performed. BALB/C and C57BL/6 strain mice each group consisted of 6 mice, 18 BALB/C mice, and 30C 57BL/6 mice (see Table 18 for details).

4.5.2. Obtaining a serum sample: at 5 weeks after immunization, 500. Mu.L of blood was collected from the orbit, centrifuged 2 times at 10000 Xg, and the serum was separated and stored at-30 ℃.

4.5.3. Indirect ELISA:

antigen coating SARS-CoV-2Spike antigen protein was diluted to 0.5. Mu.g/mL using coating solution, added to 100. Mu.L to EIA/RIA 96 well plate, and antigen was coated overnight at 4 ℃.

Sealing the detection plate: the coated EIA plate was washed 3 times with wash solution, 250. Mu.L of 10% goat serum PBS blocking solution was added to each well, and blocking was performed at 37 ℃ for 2 hours.

Serum sample dilution: the serum is diluted with antibody diluent, and the sample is diluted from 1.

Serum antibody adsorption: washing the sealed detection plate with washing solution for 3 times, adding 100 μ L diluted serum sample into each well, incubating at 37 deg.C for 1h, setting blank control, and adding antibody diluent only

And (3) binding of a secondary antibody: the assay plate was washed 5 times with wash solution and 100 μ L of HRP-labeled goat anti-mouse IgG secondary antibody diluted 1 10000 was added to each well and incubated for 1h at room temperature.

Color development and termination: washing the detection plate with lotion for 5 times, adding 100 μ L of single component TMB color development solution into each well, developing at room temperature for about 5min, and adding 50 μ L of stop solution.

And (3) absorbance detection and titer determination: the 450-wavelength absorption peak was measured using a microplate reader (the measurement at 630 was used as a reference value, and only stability determination was performed), and 2.1 times of blank wells were determined to be positive on the basis of OD450 in the blank wells of the detection plate. The highest dilution rate at which a sample is judged to be positive is the titer of the bound antibody of the sample.

4.5.4. neutralization assay for SARS-CoV-2 pseudovirus

Cell preparation: huh7.5 cells were passaged one day before infection at 1X 10 ⁵ The cells are inoculated into a 96-well plate in a cell/mL amount, and cultured in a CO2 incubator until the cell confluence is 60-80%.

Serum dilution and virus pre-mixing: serum samples were diluted to 50 μ L using DMEM medium, 2-fold diluted 9 dilutions from 1.

Viral infection: the cell supernatants prepared the previous day were aspirated, the serum virus mixture was added, the incubate was incubated overnight, and the next day was changed to 2% FBS DMEM and incubation continued for 48h.

And (3) neutralization detection: the expression of Fluc in cells was measured using the Bright-Glo Luciferase Assay System and reported as Relative Light Units (RLU) and the neutralization was calculated as follows, percent neutralization = (blank RLU-serum neutralization RLU)/blank RLU 100%.

Calculating the half effective concentration: EC50 log = highest dilution log of percentage of positives greater than 50% + distance ratio x log of dilution factor (distance ratio = (percentage of positives greater than 50% — 50)/(percentage of positives greater than 50% — percentage of positives less than 50%))

4.5.5. neutralization assay for reducing plaques of SARS-CoV-2 live virus

Cell preparation: vero cells were passaged one day before infection at 1X 10 ⁴ Cells/100. Mu.L, were seeded in 1mL to 12 well plates and placed in CO ₂ Culturing in incubator until 80-90% of cells are in pieces.

Serum dilution: inactivating the serum to be detected at 56 ℃ for 30 minutes, diluting the serum by serum-free DMEM under aseptic conditions, and diluting by 4 times to obtain 3 dilutions.

And (3) washing the cells: the next day before entering the P3 laboratory, the cell culture medium was discarded, and 2% FBS-DMEM maintenance medium was added at 500. Mu.L/well, and the operator brought the cell culture medium to the P3 laboratory.

Preparation of the virus: the virus was removed from a refrigerator at-70 ℃, dissolved in a P3 biosafety cabinet and diluted with serum-free DMEM medium.

Serum/antibody and virus neutralization: mixing each dilution of serum/antibody with an equal volume of virus, 37 ℃,5% CO ₂ Incubate in incubator for 1h.

Virus-serum/antibody infected cells: discarding the medium, adding the diluted virus-antibody mixture, 37 ℃,5% ₂ Incubate for 1h.

Adding a covering liquid: discard the infection solution, add 1mL Avicel-2% FBS-DMEM medium per well, 37 ℃,5% CO ₂ And (5) carrying out incubator culture for 72h.

Fixing: after 72h, 12 well plates were removed from the CO ₂ The incubator is taken out, 1mL of precooled 4% paraformaldehyde is added into each hole, and the mixture is fixed for 30min at room temperature.

Dyeing: paraformaldehyde was removed by blotting and 500. Mu.L of 0.1% crystal violet was added to each well and stained for 5min.

Washing: and absorbing and discarding the staining solution, washing 1-2 times by using 1mL of double distilled water, airing and counting.

And (4) observation and counting: the number of plaques was counted from the staining results and the neutralization rate was calculated from the number of plaques in the virus control wells and the experimental wells.

Neutralization rate = (number of viral well plaques-number of experimental well plaques)/number of viral well plaques = 100%

Calculating the half effective concentration: the logarithm of EC50 = the highest dilution logarithm of the percentage of positives greater than 50% + the distance ratio x the logarithm of the dilution factor (distance ratio = (percentage of positives greater than 50% — 50)/(percentage of positives greater than 50% — percentage of positives less than 50%).

4.6 results of the experiment

4.6.1 animal immunization, grouping and time points

Table 18: dosage and different breed mice inoculation table

4.6.2. Bound antibody titer detection

Vaccine immunized mouse serum samples were diluted from 1. Control mouse serum samples were diluted from 1.

The results of the serum test of BALB/C mice are shown in Table 4-1 and FIG. 6, and the results of C57BL/6 mice are shown in Table 4-2 and FIG. 7. High-level antigen-specific IgG can be detected by the high-dose two-needle group of two strains of mice, so that the vaccine has good immunogenicity, the low-dose two-needle group can also detect the generation of antibodies, the titer is relatively low, the high-dose single-injection group can generate certain specific antibodies, and the low-dose single-injection group cannot effectively induce the generation of the specific antibodies.

TABLE 4-1 BALB/c mouse antibody assay titers

TABLE 4-2.C57BL/6 mouse antibody assay titers

BALB/c&Serum antibody titers of C57BL/6 mice are shown in FIG. 8: vaccine immunization of 2 strain miceAfter epidemic, antibodies against the S protein of the novel coronavirus can be produced. After high dose priming, both strains of mice developed over 1 ⁵ Titers of specific IgG, wherein BALB/c mice produce antibody titers averaging 1; the antibody titers generated by C57BL/6 mice averaged 1. Low dose 2 immunizations also induced approximately 10 in BALB/c mice ⁴ Specific antibodies in titer; the antibody levels of the C57BL/6 mice generated by the high-dose single immunization and the low-dose 2-immunization are similar and both exceed 10 ³ . After the vaccine is immunized, the specific humoral immune response can be activated, and the vaccine has good immunogenicity.

4.6.3. Serum neutralizing antibody titer detection based on SARS-CoV-2 pseudovirus

High dose two-needle vaccine immunized mouse serum samples were diluted from 1; serum samples from mice immunized with the high-dose single-needle and low-dose double-needle vaccines were diluted from 1. Serum samples of low-dose single-needle vaccine immunized mice were diluted from 1; control mouse serum samples were diluted from 1.

The results of BALB/C mouse neutralizing antibody detection are shown in Table 4-3 and FIG. 9, and the results of C57BL/6 mouse are shown in Table 4-4 and FIG. 10. Except for low-dose single-needle immunization, other immunization groups all induce a certain level of neutralizing antibodies, and high-dose double-needle immunization of two mice induces higher-titer neutralizing antibodies.

TABLE 4-3 BALB/c mouse neutralizing antibody Titers

TABLE 4-4C 57BL/6 mouse neutralizing antibody titers

* Serum-free

BALB/c&The neutralizing antibody titers of the C57BL/6 mouse serum pseudovirus assay are shown in FIG. 11: both strains of mice, after vaccine immunization, can produce neutralizing antibodies against the novel coronavirus. After high dose priming, both strains of mice developed over 1 ⁴ Titres of neutralizing antibodies, wherein BALB/c mice produce neutralizing antibody titres averaging 1; the antibody titers generated by C57BL/6 mice averaged 1. In BALB/c mice, 2 times of low-dose immunization can also induce the generation of neutralizing antibodies, and the neutralizing antibodies can be stably detected; in C57BL/6 mice, the neutralizing antibody titer induced by the high dose single needle was superior to that induced by the low dose two-needle immunization. After the vaccine is immunized, neutralizing antibodies aiming at SARS-CoV-2 can be generated, the dosage and the immunization strategy are proper, and the generation of the neutralizing antibodies with high level can be induced.

4.6.5.SARS-CoV-2 plaque reduction neutralizing antibody assay results

The samples were used for virus serum mixing at 1, 50, 1. The results of detection of BALB/C mouse neutralizing antibody are shown in tables 4-5 and FIG. 12, and the results of C57BL/6 mouse are shown in tables 4-6 and FIG. 13. The high-dose double-needle group of two strains of mice induces high-titer neutralizing antibodies to inhibit infection of SARS-CoV-2 live virus.

TABLE 4-5 BALB/c mouse live virus neutralizing antibody titers

TABLE 4-6.C57BL/6 mouse neutralizing antibody titers

* Serum-free

The neutralizing antibody titer of the BALB/C & C57BL/6 mouse serum live virus assay is shown in FIG. 14.

The live virus plaque reduction test results show that both strains of mice with high doses of both needles produce nearly or more than 1 ⁴ Titres of neutralizing antibodies, among those produced by BALB/c miceTiter mean 1; the antibody titers generated by C57BL/6 mice averaged 1. The neutralizing antibody titer of most serum samples of the low-dose and high-dose single-needle immunization groups is not enough to reach half effective concentration under test dilution, but the test results show that virus infection can be partially inhibited under the low dilution, and the virus infection is obviously different from that of the control group.

4.7. Conclusion of the experiment

After mice are immunized by the novel coronavirus mRNA vaccine SW0123, specific IgG can be induced to generate, and the induced antibody has good neutralizing activity. A 30 μ g dose, two immunization regimens 3 weeks apart, can be effective in inducing the production of high titer specific antibodies, wherein the detectable antibody titers in BALB/c mice are on average 1; the antibody titers detected in C57BL/6 mice averaged 1. Binding antibody titers exceed 1 ⁵ The humoral immunity inducing ability is excellent. Both strains of mice, after vaccine immunization, can produce neutralizing antibodies against the novel coronavirus. Two needles immunized at a high dose of 30 μ g, both strains of mice produced nearly 1 ⁴ The neutralizing antibody with titer can effectively inhibit the infection of virus cell level.

Experiments prove that the SW0123 vaccine can effectively induce BALB/C and C57BL/6 mice to generate specific humoral immune response, and antigen-specific IgG has good neutralizing activity; high-dose double-needle immunization can induce strong neutralizing active antibodies in animals.

Experiment 7: evaluation of the level of antigen-specific T cell response in mice following immunization with different doses of COVID-LPP-mRNA

7.1. Purpose of the experiment: after the mice are immunized by the COVID-LPP-mRNA, the level of cellular immune response in the mice is detected by using an ELISPOT method.

7.2, test article information: name: mRNA vaccine COVID-19-LPP-mRNA; specification: 0.5mg/ml; the characteristics are as follows: a milky white liquid; and (3) validity period: can be stored at 2-8 deg.C for 28 days

7.3 Experimental animals: species, strain, grade, quantity and weight, week age;

species/strain: c57BL/6 mice, female

Grade: SPF stage

Weight: about 18-20g

The week age is as follows: 8-9 weeks.

The quarantine period is three days, and animals in the batch are quarantined by sampling in the quarantine period by animal house veterinarians. Mice were fed in IVC cages, with no more than five per cage. Environmental parameters of the animal house (411) are recorded during the rearing period. All feed and drinking water were purchased and provided with assistance from the Shanghai Square model Bioresearch center. The SPF-level mouse feed sterilized by 60Co irradiation is provided by cooperative medical biological responsibility Limited company in Jiangsu province, and each batch of feed provides a quality detection report containing detection indexes such as nutrition, pesticides and microorganisms. Deionized water, feeding containers and bedding were autoclaved into the barrier and replaced twice a week.

7.4 Experimental reagent and consumable

0.01M PBS buffer (PH = 7.4) (solibao); erythrocyte lysate (diligent kang biol); RPMI-1640 medium (Gibco); fetal bovine serum; ELISPOT detection: elispot assay kit (Mabtech), OVA antigen (Kinsry), PMA (David); coating antigen: the extracellular domain of the S protein (Yi Qiao Shen state); a centrifuge; 2. carbon oxide cell culture incubator (Panasonic); ELISPOT plate reader (Germany ai Di)

7.5 Experimental methods

5.5.1 mice immunization

C57BL/6 mice were injected intramuscularly with the novel coronavirus pneumonia vaccine of mRNA at different concentrations twice, once on day 0 and day 7, and prepared with spleen cells 14 days after the second immunization.

5.5.2 preparation of spleen cells

Grinding spleens to prepare a single spleen cell suspension, and adding 5ml of erythrocyte lysate into each sample of spleen cells to perform erythrocyte lysis.

Then 25ml 1640 medium was added for termination, the cell suspension was filtered using a cell screen and the contaminating tissue pieces were filtered off.

The cells were centrifuged at 1500rpm for 5min, the supernatant was discarded, and 5ml of medium was added to resuspend the cells for counting.

5.5.3 antigen-specific T cell immune response detection

The concentration of the counted cells was adjusted to 3 × 10E6 cells/ml.

The cell suspension was added to the test plate and 100. Mu.l of cell suspension (30 ten thousand cells) was added per well.

The cells were resuspended in a solution of the corresponding antigenic polypeptide (20. Mu.g/ml) in culture medium, PMA-Ionomycin as a positive control, OVA (20. Mu.g/ml) as a negative control and the cell suspension without any additional stimulus as a blank control. Mu.l of antigen dilution (concentration: 10. Mu.g/ml) was added to each well, and the cells were stimulated for 24 hours.

The next day after the end of stimulation, the procedure was performed according to the kit instructions:

(1) The cell culture medium in the detection plate was discarded, washed with PBS at 200. Mu.l/well for 5 times.

(2) The anti-mouse IFN-. Gamma.antibody was diluted to 1. Mu.g/ml, and 100. Mu.l was added to each well for incubation, and incubated for 2 hours at 27 degrees in an air bath.

(3) After the incubation, the sample was washed with PBS at 200. Mu.l/well for 5 times.

(4) Secondary antibody was added, diluted at 1.

(5) After the incubation, the sample was washed with PBS at 200. Mu.l/well for 5 times.

(6) Color development: 100. Mu.l of a developer was added to each well to develop color.

(7) And (4) terminating: and after the color development is finished, discarding the color development liquid, cleaning by using double distilled water, airing and scanning.

5.6 results of the experiment

According to the results (fig. 15A-15C), after two vaccine immunizations, the mice were blood-taken and tested, and then the IgM, igG, and IgG1 type antibodies were found to have high antibody titers, with the IgG antibody titer being the highest. According to the results of different vaccine doses, igM antibody titer is reduced along with the reduction of the administration dose, and IgG1 antibody titer is gradually reduced along with the reduction of the vaccine dose, but the reduction range is not obvious. In addition, igG1 titers were found to be lower than IgG antibody titers, compared to IgG antibody titers.

The results show (fig. 16A-16B) that COVID-LPP-mRNA was able to significantly activate antigen-specific T cell response and was dose dependent. The results show that after the vaccine immunization, the spleen of the mice in the high dose group and the low dose group has obviously increased antigen-specific T cells. According to different dosage results, the antigen-specific T cell response intensity is gradually reduced along with the reduction of the vaccine dosage, wherein the antigen response of the 30 mu g immunization dosage group is the strongest. The COVID-19-LPP-mRNA vaccine is used for immunizing a mouse by adopting a muscle administration mode, and after entering an organism, the mRNA vaccine can activate antigen presenting cells including macrophages, dendritic cells, B lymphocytes and the like. Meanwhile, the vaccine is phagocytized by antigen presenting cells, and mRNA is released to cytoplasm through lysosome escape and is combined with ribosome to be translated into antigen protein in the cells. Subsequently, most of the antigenic proteins are degraded into antigenic polypeptides by proteasome and lysosomal degradation pathways, and a small portion of the undegraded proteins are expressed on the cell surface. The degraded antigen polypeptide is combined with MHC-I molecules and MHC-II molecules in cells and presented to the surface of the cells, and different T cells are stimulated to be activated by combining with TCR molecules on the surfaces of different subgroups of T cells. The activated antigen presenting cell stimulates an organism to generate antigen-specific CTL immune response through the interaction of MHC-I molecules and TCR on the surface of a CD 8T cell, and activates different CD 4T cell immune responses through the interaction of MHC-II molecules and TCR on the surface of a CD 4T cell. Different CD 4T cells exhibit different functions, on the one hand, capable of interacting with CD 8T cells to maintain a CTL immune response, and on the other hand, follicular helper T cells, capable of interacting with germinal center B cells to promote secretion of antigen-specific high affinity antibodies by B cells.

Partial expression of antigen on the surface of antigen presenting cells (macrophages, dendritic cells) by reaction with

B cell surface BCR binding activates B cells. The activated B cells gradually differentiate and develop to form germinal center B cells,under the interaction with follicular helper T cells activated by the same antigen, germinal center B cells are finally differentiated to form memory B cells and plasma cells through processes of somatic cell high-frequency mutation, antibody type conversion, high-affinity antibody maturation and the like.

According to IgM and IgG detection results, the antigen-specific IgG type antibodies in the serum of the mice are at a higher level and the antigen-specific IgM antibodies are at a lower level in the tenth day after the second immunization. Mainly, the IgM antibodies are mainly secreted by the body at the initial stage of vaccine immunization, and along with the time, the IgM antibodies are gradually converted to different types of antibodies under the interaction of the B cells and the T cells and the action of different cytokines on the B cells at the germinal center. In the later stage of immunity, the IgM antibody titer in the organism is at a lower level, mainly taking IgG type antibodies as main components.

According to the detection results of IgG and IgG1 antibodies, the IgG1 type antibodies in the serum of the mice are at a higher level, slightly lower than the total IgG antibodies. The results of this experiment indicate that the IgG type antibodies in mice are mainly IgG1 antibodies. After the vaccine is immunized, the interaction between germinal center B cells and follicular helper T cells is promoted, and a large amount of interleukin-4 (IL-4) is secreted. IL-4 binds to an IL-4 receptor on the surface of a B cell, and activates a downstream signal path related to the switching of the IgG1 type antibody in the B cell, thereby promoting the switching of the IgM type antibody to the IgG1 type antibody in an organism. Therefore, it can be known that the antigen-specific antibodies generated by the new coronary mRNA vaccine activating body are mainly of IgG1 type, and IgG1 type antibodies have a strong effect on resisting virus infection.

According to different dosage results, the IgM type antibody secretion presents a remarkable dose-effect relationship, and the antibody titer is gradually reduced along with the gradual reduction of the vaccine dosage. The total IgG and IgG1 antibodies did not show a significant dose-effect relationship, but differences in antibody titers between the high dose and low dose groups were also seen. Among them, 30. Mu.g of the administered group showed the highest antibody titer, 1. Mu.g of the administered group showed the lowest antibody titer, and 7.5. Mu.g was not significantly different from 15. Mu.g. The difference is not obvious mainly because the test adopts the tenth day after two times of administration to detect the antibody titer, the detection time point is in the later stage of immunity, the secretion level of the IgG type antibody is in the highest stage, and the obvious difference before the strength of the immune response caused by the difference of the micro-dose is difficult to observe. Therefore, it was found that the antibody titer produced in the body tends to increase with increasing dose, and the highest antibody titer was exhibited at the highest dose.

According to the result of the antigen-specific T cell immune response, the antigen-specific T cell immune response in the mice after the vaccine immunization is obviously improved, and the dose-effect relationship is shown. This result indicates that the vaccine is phagocytized by antigen-presenting cells after entering the body, and activates the body through a series of immune responses

CD4 and CD 8T cells activate and differentiate to form effector T cells and memory T cells. In vitro re-stimulation of spleen cells with the same antigen rapidly activated antigen-specific effector T cells and memory T cells in a short time and secreted the corresponding cytokines (e.g., IFN-. Gamma.) (FIG. 16A). According to the results of different administration doses, the T cell immune response intensity is gradually reduced along with the reduction of the dose, and a dose-effect relationship is presented. Among them, there was no significant difference between the 15. Mu.g-administered group and the 7.5. Mu.g-administered group, and there was no significant difference between the 1. Mu.g-administered group and the 2.5. Mu.g-administered group. No significant change in T cell immune response was elicited, probably due to smaller dose differences. Taken together, the vaccines are capable of activating antigen-specific T cell immune responses in vivo.

In conclusion, the COVID-19-LPP-mRNA vaccine can activate body fluid and cell immune response in an organism, and stimulate the organism to generate high-titer antigen-specific IgM, igG and IgG1 type antibodies and strong antigen-specific T cell immune response. Therefore, the COVID-19-LPP-mRNA vaccine can be considered to have better immunogenicity and immune reactivity.

Test 8 detection of neutralizing antibody titres in the serum of mice immunized with the COVID-19-LPP-mRNA vaccine

And (3) testing article information:

c57BL/6 mice were injected intramuscularly with COVID-19-LPP-mRNA of different concentrations twice, once each on day 0 and 7, and blood was collected 10 days after the second immunization and centrifuged to obtain serum, the specific procedures are reported in "COVID-19-LPP-mRNA immunized C57BL/6 mice". In the test, the serum of mice in three dose groups of 30 mug, 7.5 mug and 1 mug is selected for detecting the neutralizing antibody.

Test reagents: huh-7cell (from midrange); pseudovirus (from midhouse) DMEM complete medium (Gibco): 1% double antibody (Gibco), 10% fbs (Hyclone) Luciferase assay kit (PerkinElmer) PBS (solibao); 0.25% pancreatin (Gibco)

Test consumables: t75 cell culture flasks (Thermo); 96-well white cell culture plates (Corning); 15/50ml centrifuge tubes (Corning); 3.3 testing the instrument; inverted microscopes (Leica); CO2 ₂ Incubator (Panasonic) microplate reader (BioTek)

Test procedure

1. Serum sample dilution: the serum samples were diluted with complete medium at a dilution of 20X,60X,180X, 540X,1620X,4860X.

2. Virus was diluted to 2 x 10 using complete medium ⁴ TCID ₅₀ /ml。

3. 100ul of diluted serum and 50ul of virus diluent were added to each well of the test group; blank control 150ul complete medium; the virus control group was added with 100ul complete medium, 50ul virus dilution.

4. 37℃，5％CO ₂ And incubated for 1 hour.

Adding pancreatin to the Huh-7 cells for 1 min, adding complete medium for neutralization, centrifuging at 210g for 5min, suspending the cells using the complete medium, counting, adjusting the cell concentration to 2 x 10 ⁵ One per ml.

6. After 1 hour incubation of serum and pseudovirus, cells were added to 96-well flash plates, 100ul per well, 37 ℃,5% ₂ Culturing for 20-28 hr.

7. Cell supernatants were aspirated and washed once with PBS. After washing, 100ul PBS per well was added.

8. Then 100ul of luciferase assay reagent was added. The reaction was carried out at room temperature for 2min in the dark.

9. After the reaction was completed, the fluorescence value was measured using a microplate reader.

10. Calculation of inhibition and median inhibition dilution ID ₅₀ . Inhibition rate = [ ((1- (sample group mean-blank control group mean)/(virus group mean-blank control group mean) ] 100%. Half inhibition dilution ID was calculated using Reed-Muench from inhibition rate data ₅₀ The specific calculation formula is as follows:

ID50＝10 ^{lg(X)+lg(1/K)×(0.5-B)/(A-B)}

a: inhibition of wells above 50% fluorescence value ratio; b: inhibition of wells at a fluorescence value ratio of less than 50%; x: dilution factor of less than 50% fluorescence value ratio; k: serial dilution factor.

4 results of the test

5.1 inhibition of pseudovirus-infected cells by sera from mice in different dose groups (FIG. 17)

5.2 half Inhibitory Dilutions (ID) of mouse sera in different dose groups ₅₀ )

Mice were bled by intramuscular administration on day 10 after secondary immunization with the COVID-19-LPP-mRNA vaccine and the serum neutralizing antibody levels were measured using pseudoviruses. The result shows that the mouse serum generates a high-level neutralizing antibody after secondary immunization, can effectively neutralize the pseudovirus constructed by SARS-CoV-2S protein, has stronger inhibition effect on pseudovirus infected cells, and presents an obvious dose-effect relationship. Low dose group (1. Mu.g/mouse) mouse serum neutralizing antibody half inhibition dilution ID ₅₀ Less than 20; medium dose group (7.5. Mu.g/mouse) divided by one mouse serum ID ₅₀ Less than 20, remaining mouse serum ID ₅₀ An average value of 990; high dose group (30. Mu.g/mouse) mouse serum ID ₅₀ The average value was 2918. The above results indicate that COVID-19-LPP-mRNA can induce after two immunizationsHigh-level neutralizing antibodies are generated, and the infection of pseudoviruses is effectively inhibited.

The neutralizing antibody is an important index for measuring the immune protection effect of the vaccine and is also an important basis for the evaluation and quality control of the vaccine. The in vitro neutralizing antibody detection by utilizing the live virus has high requirements on laboratory grade, needs to be carried out in a biosafety three-grade laboratory, and brings great difficulty to research. Therefore, researchers can also use a pseudovirus system to perform the detection of neutralizing antibodies, the pseudovirus infected cells refer to simulating the infection and replication process of viruses by infecting susceptible cells with a pseudovirus constructed by using the spinous process protein (S protein) containing the target virus, and a reporter gene such as Luciferase (Luciferase) with high sensitivity and easy detection is usually introduced to optimize the detection system. The test uses a pseudovirus containing Spike protein (S) of SARS-CoV-2 virus and a Luciferase reporter gene to detect the serum neutralizing antibody titer of the immunized mice.

The basic principle of the Luciferase reporter gene pseudovirus detection system is as follows: after the pseudovirus infects susceptible cell Huh-7cell, the luciferase can be translated, and the luciferase is in Mg ²⁺ 、ATP、O ₂ Under the participation of the fluorescent probe, the oxidation decarboxylation of the fluorescein (D-luciferin) is catalyzed, the activated oxyfluorescein is generated, photons are emitted, fluorescence of 550-580 nm is generated, the fluorescence intensity is detected by using an enzyme-labeling instrument, and the obtained detection value can reflect the infection efficiency of the pseudovirus on cells.

In the experiment, a COVID-19-LPP-mRNA vaccine which codes SARS-CoV-2 virus S protein antigen is used for immunizing a mouse, and a neutralizing antibody aiming at SARS-CoV-2 virus S protein is generated in the mouse. After the immune mouse serum and the pseudovirus are incubated together, the neutralizing antibody in the serum can be combined with the S protein on the pseudovirus particles to prevent the combination of the S protein and the receptor ACE2, so that the pseudovirus is prevented from entering host cells, and the expression of luciferase is reduced. The method comprises the steps of setting a series of concentration gradients to dilute mouse serum, incubating the diluted mouse serum with pseudoviruses, adding the pseudoviruses into susceptible cells Huh-7, culturing for 20-28 hours, and detecting the infection efficiency of the viruses on the cells by using a luciferase detection kit. Pseudovirus by calculating neutralizing antibodiesThe inhibition rate of infection was calculated from the inhibition rate data by using Reed-Muench to calculate the ID ₅₀ 。

The COVID-19-LPP-mRNA vaccine can stimulate the organism to generate high-level neutralizing antibodies and prevent pseudovirus from infecting cells, and the COVID-19-LPP-mRNA vaccine has better prevention effect on SARS-CoV-2 virus infection. And through analyzing the neutralizing antibody levels of mice of three different dose groups, the COVID-19-LPP-mRNA is found to have a remarkable dose-effect relationship, which provides a reference for subsequent challenge tests and clinical application.

Experiment 9: evaluation of protective Effect of COVID-19-LPP-mRNA immunized on mice against SARS-CoV-2 infection

The purpose of the experiment is as follows: SARS-CoV-2 was used to infect Ad-hACE2 transduced mouse model to evaluate the protective effect of the novel coronavirus mRNA vaccine.

Information of test article

Name: mRNA vaccine COVID-19-LPP-mRNA

A provider: sciao (Shanghai) Biotech Co., ltd

Specification: 0.5mg/ml

The characteristics are as follows: milky white liquid

And (3) validity period: can be stored at 2-8 deg.C for 28 days

Laboratory animal

Name: ad-hACE2 transduced mice

Quantity: BALB/C mice 12; c57BL/6 mice 19

Sex: female

Age: 18-20 weeks old

Animal sources: witonglihua Co Ltd

Animal production license number: SCXK (Jing) 2016-006

Experimental reagent and consumable

Screw mouth 1.5 (SCT-150-C-S) and 2.0ml (SCT-200-C-S) EP tube; pentobarbital sodium anesthetic; 4% paraformaldehyde; DMEM medium; 75% ethanol; sterile PBS;1ml pipette, 200ul pipette;

one metal bath can be put into the spiral pipe; foam boxes for 50ml tubes, foam boxes for 15ml tubes, 2 each. Body weight record form, lung weight record form. 200ul of gun heads with filter elements and 2 boxes; 1ml filter-element-contained gun head 1 box. A grinder; a high speed centrifuge in the core region; 1ml syringe; anatomical plate-foam; 3 sets of sterile scissors and tweezers;

experimental methods

Mouse grouping condition and immunization method

In this experiment, we used BALB/C and C57BL/6 two mice to jointly complete immunogenicity detection test, and 2 immune doses are adopted: (high dose) 30 μ g/3 μ g (low dose); 2 immune cycles: single needle immunization (day 0 dosing) and double needle immunization ( day 0, 21 dosing), for a total of 8 groups.

The vaccine was diluted to a defined concentration in PBS and injected intramuscularly at the thigh site in a volume of 30 μ l per side, bilaterally.

The specific groupings and experimental dates are shown in the following table:

note: c: c57BL/6; b: balb/C; DD double-needle immunization; SD: single-needle immunization; LD: low dose; HD: high dose

Transduction of Ad5-hACE2

5 days before challenge, 45. Mu.l of the solution containing 2.5X 10 cells was subjected to mild anesthesia ⁸ The mouse respiratory system was transfected with the DMEM culture solution of pfu Ad5-hACE2 by nasal drip. Then the mice are transferred to an ABSL3 biological safety laboratory, raised and observed for 5 days and are ready for SARS-CoV-2 infection experiments.

Virus challenge experiments

Day 0: SARS-CoV-2 infection

(1) Weighing: after confirming that Ad5-hACE2 transfected mice are in good condition, body weight is weighed.

(2) Anesthesia: anesthesia was performed with sodium pentobarbital at a dose of 60 mg/Kg.

(3) Nasal drop infection: after deep anesthesia, the mice will contain 5X 10 ⁵ TCID ₅₀ The mice were infected with 50. Mu.l nasal drops of virus.

Day 1-3: observing, weighing and preparing articles

(1) Observing and weighing: observing mice every day, recording body weight condition, and continuously observing for 3 days

(2) The following experimental supplies were prepared according to the number of mice and experimental groups:

1XPBS buffer: 1000ml, high pressure ready for use: 500ml is divided, and double antibody PS (10000U) is added according to the proportion of 1.

A dissecting instrument: 2 sets of instruments, each set of instruments comprising: 2 pieces of elbow tweezers, tooth tweezers, small scissors, flat-end tweezers, elbow scissors and surgical forceps are used for standby after high pressure.

1.5ml screw port EP tube: 2, and standing after high pressure.

1.5ml spiral port EP pipe (filled with bright beads): 1, and standing after high pressure.

5ml centrifuge tube: 2, and standing after high pressure.

50ml centrifuge tube: 25 (30ml 4% paraformaldehyde packaged in advance)

Anticoagulation 1.5ml centrifuge tube: 1 box (goods condition preparation)

High flux tissue homogenate instrument

Mouse blood, dissection and tissue extraction organ

(1) Blood sampling and sacrifice: 3 mice were collected from each group, blood was collected from the orbit in a biosafety cabinet, and the mice were euthanized by dislocation of the cervical vertebrae.

(2) Dissection and lung harvest: the mice were sprayed with 75% ethanol, fixed with the abdomen facing up, and dissected in a biosafety cabinet. The left hand takes the elbow forceps to clamp the skin of the abdomen, the right hand shears off subcutaneous tissues with scissors to strip the muscles, and the skin is sheared forwards to the neck; turning over the skin to expose the chest, cutting the two ribs with a pair of sterilized scissors, turning the sternum and the ribs upwards, and putting the cut sternum and ribs into the joint of the lung and trachea with curved ophthalmic forceps to hold out the whole lung.

(4) And (3) lung tissue treatment:

(A) Left lung: the cells were placed in 2ml PBS (PS +), washed 2 times and then directly soaked in 10ml 4% paraformaldehyde for pathological sectioning and histochemistry. The specimen is subjected to conventional tissue treatment, paraffin embedding, sectioning, H.E. staining, sectioning and digital image acquisition.

(B) Right lung: the weight record, placed in 2ml PBS (PS +), after 2 washes, resuspended in 1. Freeze-stored overnight at-70, and prepare lung homogenate the next day (K4 laboratory).

(5) Sample transfer: all samples were placed in sealed cryopreservation tubes and containers, and the container surfaces were thoroughly sterilized before being transferred to the K4 laboratory.

Homogenization treatment of lung tissue and measurement of virus titer

(1) Lung tissue homogenization: the lung tissue was removed from the-70 freezer and homogenized after digestion.

(2) Centrifuging: the homogenate was centrifuged at 4000rpm at 4 ℃ for 5 minutes, and the supernatant was transferred to a new 1.5ml screw-port EP tube.

(3) Lung tissue homogenate nucleic acid copy number assay (2020.5.12): nucleic acid was extracted from 100. Mu.l of the supernatant, and the number of copies of the virus in lung tissue was determined by RT-PCR.

(4) Lung tissue homogenate TCID ₅₀ Titer assay (2020.5.12-5.15): 100. Mu.l of the supernatant was collected and diluted 10-fold from 10-1 to give 4 dilutions (10 dilutions) ^-1 ，10 ^-2 ，10 ^-3 ，10 ^-4 ) 100ul of Vero cells prepared in advance are infected, 8 multiple wells are made for each dilution, and TCID is determined after 72-96 h of observation ₅₀ 。

Viral nucleic acid extraction and real-time qpcr detection

200 mul of mouse lung suspension is taken from a biosafety cabinet and added into lysis solution of an Ex-DNA/RNA virus (CDC) nucleic acid extraction kit (T104, xian Tianlong science and technology limited company) for lysis, after complete inactivation, nucleic acid is extracted according to the instructions of a full-automatic rotary nucleic acid extractor (GeneRotex 96, xian Tianlong science and technology limited company), and finally 80 mul of eluent is used for elution. And (3) taking 5 mul of nucleic acid to prepare a system, and carrying out real-time fluorescence RT-PCR reaction on an ABI Q5 fluorescence quantitative PCR instrument. Forward primer (F): CCCTGTGGGTTTTACACTTAA; reverse primer (R): ACGATTGTGCATCAGCTGA; fluorescent probe (P):

5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3', the reaction system is as follows: mu.L of 2 Xone Step SYBR RT-PCR Buffer III, 0.5. Mu.L Takara Ex Taq HS, 0.5. Mu.L of L PrimeScript RT Enzyme Mix II, 1. Mu.L of the upstream primer, 1. Mu.L of the downstream primer, 1. Mu.L of the probe, 5. Mu.L of the RNA template, and made up to 25. Mu.L with sterile double distilled water. The reaction parameters are as follows: circulating at 42 deg.C for 5min and 95 deg.C for 10 s; circulating for 40 times at 95 ℃ for 10s and 60 ℃ for 30s, and collecting fluorescence signals after extension.

6.6 results of the experiment

6.6.1 mouse body weight: the raw data of the daily mouse body weight are shown in Table 6-1. The body weight of the mice on the first day was used as an initial body weight, and the body weight change tendency of the mice per day was analyzed. The results for Balb/C mice are shown in Table 6-1 and FIG. 18. The Balb/C mice are infected with the novel coronavirus on the 5 th day after being transduced with Ad-hACE2, the continuous observation is carried out for 4 days, the state is good, and the weight is not obviously reduced. The results for C57 mice are shown in Table 6-2 and FIG. 19. The C57 mice are infected with the novel coronavirus on the 5 th day after being transduced with Ad-hACE2, and the condition is good and the weight is not obviously reduced after continuous observation for 4 days.

TABLE 6-1 Balb/C mice body weight raw data

TABLE 6-2 initial weight data of C57 mice

6.6.2 mouse lung tissue viral load titration: the lung tissue taken out of the dissect was subjected to weighing, grinding, RNA extraction and quantitative PCR analysis, and the original data of Ct value obtained by the weight of the lung tissue used for grinding and quantitative PCR and the determination result of TCID50 are shown in tables 6-3, tables 6-4 and FIG. 20, FIG. 21.Balb/C mice are infected with a novel coronavirus after being transduced with Ad-hACE2, and the replication and proliferation of the virus in the lung can be detected (average Copies/g = 10) ^9.12 ； logTCID ₅₀ Ml = 4.75). The high-dose mRNA vaccine immunization group can effectively protect Balb/C against the attack of new coronavirus, and the average Copies/g =10 of double-needle immunization ^7.84 ；logTCID ₅₀ Ml =2.54, statistically different from the control group (table 6-3, fig. 20).

After transduction of Ad-hACE2 in C57 mice, infection with the novel coronavirus detected replication and proliferation of the virus in the lung (mean Copies/g = 10) ^9.03 ；logTCID ₅₀ Ml = 4.06). The high-dose mRNA vaccine immunization group can effectively protect C57 mice from the attack of new coronavirus, and the single-needle immunization has the average Copies/g =10 ^6.67 ；logTCID ₅₀ Ml =2.79; mean two-needle immunization Copies/g =10 ^4.56 ；logTCID ₅₀ Ml =1.96, statistically different from the control group (table 6-4, fig. 21).

TABLE 6-3 Balb/C mice Lung tissue viral load titration related raw data

TABLE 6-4 C57 mice Lung tissue viral load titration related raw data

6.6.3 pathological mechanism of lung tissue

Lungs of 3 mice were taken from each of the immunized group and the control group, and embedded in paraffin for tissue section. Then staining was performed with hematoxin and eosin (H & E). FIGS. 22 to 23 show the results of Balb/C groups of mice, and FIGS. 6 to 6 show the results of C57 groups of mice. Control group: pulmonary venulitis and interstitial pneumonia. Large-area alveolar rupture of lung, infiltration of a large amount of inflammatory cells, serious lung pathology and inflammatory exudation in alveolar cavity. Vaccine groups: pulmonary venulitis and interstitial pneumonia. The alveoli were partially ruptured and partially infiltrated with inflammatory cells. Only partial alveolar fusion, small thickening of alveolar walls, and small infiltration of inflammatory cells.

6.7 conclusion of the experiment

The body weight of the Balb/C mouse control group did not drop significantly after challenge. The number of RNA Copies of the lung tissue virus titer reaches Copies/g =10 per gram ^9.12 Viral TCID ₅₀ Up to logTCID per gram ₅₀ Ml =4.75. The lung lesions are obvious and severe interstitial pneumonia exists.

After the Balb/C mice immunization group is attacked, the weight of the mice in the high-dose mRNA vaccine 2-needle immunization group is not obviously reduced. Lung tissue virus titer RNA copy number per gram Copies/g =10 ^7.84 Average decrease by a factor of 1.28Log (19.1 times); virus TCID ₅₀ Titre of logTCID per gram ₅₀ The/ml =2.54 decreased by a factor of 2.21Log on average (161 times). The lung lesions are mild with mild interstitial pneumonia. The mRNA vaccine high-dose two-needle vaccine immunization is prompted to have an obvious protective effect.

There was no significant weight loss after challenge in the control group of C57 mice. The number of RNA Copies of the lung tissue virus titer reaches Copies/g =10 per gram ^9.03 Virus TCID ₅₀ Up to logTCID per gram ₅₀ Ml =4.06. The lung has obvious pathological changes and severe interstitial pneumonia.

After the C57 mouse immunization group is attacked, the weight of the mouse of the high-dose mRNA vaccine 2-needle immunization group is not obviously reduced. Lung tissue virus titer RNA copy number per gram Copies/g =10 ^4.56 The average is reduced by 4.47Log times (29211 times); virus TCID ₅₀ Titre of logTCID per gram ₅₀ The average of the drops was 2.1Log fold (120 fold) for/ml = 1.96. The lung lesions are mild with mild interstitial pneumonia.

The mRNA vaccine high-dose two-needle vaccine immunization is prompted to have an obvious protective effect.

Experiment 10: verification of anti-novel coronavirus infection effect of rhesus monkey after immunization by COVID-19-LPP-mRNA

Purpose of the experiment: the P3/P4 laboratory of the national Kunming high-grade biosafety primate animal experiment center of the institute of medical biology of Chinese academy of medical sciences is used for evaluating the immunogenicity in rhesus monkeys and the protection effect after the novel coronavirus mRNA vaccine (COVID-19-LPP-mRNA) is immunized.

And (3) test article information: name: mRNA vaccine COVID-19-LPP-mRNA; a provider: smi (shanghai) biotechnology limited; specification: 0.2mg/ml; the characteristics are as follows: a milky white liquid; the validity period is as follows: can be stored at 2-8 deg.C for 28 days.

Experimental animals: 7 Male Experimental rhesus monkeys were provided by the institute of medical biology of Chinese academy of medicine (laboratory animal production license: SCXK (Dian) K2015-0004), aged 4 years, and divided into 2 groups, PBS group (3), and vaccine group (4). Transferring the strain to a P4 large animal laboratory for adaptive breeding 3 days before the challenge. All animal experiments are carried out according to biological safety operation regulations and animal ethics, and the animals are given humanistic care to ensure animal welfare. The experimental operation is carried out under the anesthesia state, and the biological safety and animal ethics criteria can be considered. The animal experiment passes the examination and approval of the ethical committee of experimental animals of the institute of medical and biology of the Chinese medical science institute, and the approval number is as follows: DWSP202004042.

Experimental strains: the novel coronavirus (SARS-CoV-2) is originated from the Guangdong province disease prevention and control center, and one strain used is a strain named as 'GD 108# strain'. The national Kunming high-grade biological safety experiment center obtains the approval of the national Wei Jian Commission on the introduction and transportation of the virus, and the virus is amplified and stored in the center.

Reagent for experiment

Laboratory apparatus

Experimental methods

0.7.1 vaccine immunization

Monkeys are taken under the same feeding condition, grouped according to grouping requirements, and are immunized.

Experimental groups	Required amount of
		Vaccine groups: COVID-19-LPP-mRNA	Male sex	4
PBS injection group (model control group)	Male 3 male

Primary immunization: day 0; and (3) secondary immunization: day 14; three times of immunization: day 33;

10.7.2 immunization regimen and dosage

The immunization mode comprises the following steps: intramuscular injection is carried out, and two-point injection is carried out on the left arm and the right arm;

dosage: adjuvant-free vaccine group: 200 μ g of COVID-19-LPP-mRNA;

volume: 1.0mL;

concentration: 200 mu g/mL;

10.7.3SARS-CoV-2 Virus culture, concentration, titration

SARS-CoV-2 virus has better adaptability in VERO-E6 cell, after 20T 225 cell culture bottles are used for inoculating virus, obvious CPE is observed by microscope, virus is collected for about 72h and frozen at-80 ℃. Slowly thawing at 4 ℃ the next day, centrifuging, taking the supernatant, concentrating by ultrafiltration, filtering for 3 times by PBS, and eluting the virus with the total volume of 200mL to obtain 200mL virus concentrate. The virus titer was then determined using plaque assay.

10.7.4 monkey toxin counteracting and detecting method

1) And (3) performing toxicity counteracting in a nasal drop and tracheal injection mode 15 days after the third immunization. GD108# strain (titer 1X 10) was used ⁶ Pfu/mL), and the virus is attacked by nasal drip and tracheal injection inoculation of 500 μ L each, and the toxic attacking amount of each monkey is 1 × 106Pfu.

2) And (3) weight detection: starting 3 days before challenge, carrying out weight detection every day, and carrying out weight detection every day after challenge.

3) Detecting body temperature change: the body temperature is tested by using the electronic body temperature measuring instrument, and the test part is an anus. Before attacking, each monkey is subjected to body temperature detection, and data are recorded. After the challenge, the body temperature of the monkeys was monitored every day, and the body temperature change data was recorded.

4) Sample treatment: before the experiment monkey attacks the poison, the animals are anesthetized on 1,3,5,7 days after the attack, and nasal swabs, pharyngeal swabs and anal swabs are collected. The swab was lysed with 800. Mu.L Trizol, 400. Mu.L of the extracted RNA template was washed with 50. Mu.L of water to prepare an RNA template, which was stored at-80 ℃ for use in the one-step method of qRT-PCR. At the time of dissection, about 50mg of lung tissue per leaf of the animal was taken, homogenized with 500. Mu.L of Trizol, and 300. Mu.L of the extracted RNA template was taken, washed with 50. Mu.L of water to prepare an RNA template, and stored at-80 ℃ for use. For subsequent real-time qRT-PCR analysis of viral load.

5) On day 7 post challenge, lung samples were collected using bronchoalveolar lavage.

6) The lungs of the monkeys were imaged using X-rays.

7) And 7 days after the virus attack, dissecting and observing the gross pathological changes of the lung, and respectively taking the lung (left-upper, middle and lower, right-upper, middle and lower), trachea and bronchus to perform virus load detection and tissue section HE staining diagnosis, and mainly performing pathology detection on lung tissues.

10.7.5 viral load assay

Viral genomic RNA (gRNA) was determined using quantitative real-time reverse transcription PCR (qRT-PCR). Viral load amounts of lung tissue, throat swab, anal swab, nasal swab, etc. were determined using qRT-PCR. Primer and probe sequences were derived from the N gene, referenced to sequences recommended by WHO and CDC in china. Forward direction: 5'-GGGGAACTTCTCCTGCTAGAAT-3' of the formula,

and (3) reversing: 5'-CAGACATTTTGCTCTCAAGCTG-3' of the formula,

and (3) probe: 5'-FAMTTGCTGCTGCTTGACAGATT-TAMRA-3'

10.7.6 rhesus immune serum virus neutralization titer determination

Serum 0dpi before challenge (45 days after immunization) was subjected to SARS-CoV-2 live virus neutralization test by VeroE6 cells, and antibody neutralizing antibody titer of the mRNA vaccine of the new coronary pneumonia was preliminarily evaluated by CPE method. The virus titer of the neutralizing antibody in the serum is detected, corresponding SARS-CoV-2 virus infection is carried out on VEROE6 cells according to different serum dilution ratios by taking 0.05MOI as a standard, and the titer of the neutralizing antibody in the serum is judged by cell CPE after 72h. Detection of neutralizing antibody: the neutralizing antibodies of the immune serum are determined by an in vitro euvirus neutralization method.

10.7.7 pathological analysis

Collecting the organs of the whole body tissue to perform the tissue tropism and pathological analysis of the novel coronavirus. After the animals are euthanized, lung tissues of each lobe (6 lobes in the left and right lungs, and frontal lobe of the right lung is too small and is not taken for material drawing analysis) are respectively collected for formalin fixation and then used for histological observation. Histopathological changes of the lung were observed under a microscope, double blind by two pathologists. And (5) evaluating the vaccine effect.

10.8 results of the experiment

10.8.1 rhesus immune serum virus neutralization titer

The neutralizing titer of the rhesus monkey immune serum virus is shown in table 7-1, and as can be seen from table 7-1, the neutralizing titer was not detected in the PBS group at the time of challenge, and the neutralizing titers of the vaccine group monkeys were 16249 (1 16), 16175 (1:8), 16145 (1 64), 16045 (1:8.

TABLE 7-1 rhesus monkey immune serum Virus neutralizing antibody titers

7.8.2 Experimental monkey Change in viral load after infection with SARS-CoV-2

7.8.2.1 viral load in Lung tissue

The results of the viral load detection in lung tissue after experimental monkey infection with SARS-CoV-2 are shown in FIG. 24 (gRNA detection). As can be seen in figure 24, the mean viral load vaccine group in trachea decreased by 3 log values compared to the PBS group after euthanasia of animals on day 7 post challenge; none of the 4 animals immunized in the bronchi detected viral load; none of the 6-lobe lung tissues from 4 animals in the vaccine group detected grnas. High levels of gRNA were detected in the multilobal lung tissue of all animals in the PBS group.

After infection, alveolar lavage fluid from the left and right lungs was taken from each animal to determine viral gRNA content, as shown in fig. 25. None of the left alveolar lavage samples from 4 animals in the vaccine group detected virus; whereas high levels of viral load were detected in all the left alveolar lavage samples of 3 animals in the model group.

10.8.2.2 nasal swab viral load

In the nasal swab viral load assay, all experimental monkeys detected a higher viral load on day 1 post-virus inoculation, and the viral load in the initial vaccine group was significantly reduced by at least 3 log values compared to the PBS group on day 3 (see figure 26). The viral load of the PBS group was kept at a high level all the time. At day 3, the viral load of one animal in the vaccine group was 0, although a small rebound was small at day 5, but again 0 in the day 7 test. On day 7, the mean viral load was reduced by 3.3 log values for the vaccine group compared to the model group.

7.8.2.3 pharyngeal swab viral load

The results of the viral load detection in throat swabs after experimental monkeys were infected with SARS-CoV-2 are shown in FIG. 27 (gRNA detection). As can be seen from fig. 27, grnas were detected in each experimental group starting on day 1 after challenge. From day 3 post challenge, vaccine immunization groups were all lower than PBS. The viral load was 0 in 3 of the 4 animals in the vaccine group on day 7, and the PBS group still had a higher level of viral load.

7.8.3 pathological changes

7.8.3.1 pathological analysis and seven days after challenge, lung tissues (left and right lungs are 6 leaves in total) were collected respectively after euthanasia of each group of rhesus monkeys, and formalin-fixed for histological observation. After a strict procedure for preparation of pathological tissue sections, the histopathological changes of the lung were observed under a microscope, double-blind by two pathologists.

7.8.3.2 Lung tissue lesion assessment

Lung tissues at different parts are fixed by paraformaldehyde, embedded by paraffin, and stained by HE, and histopathological changes of the lung are observed under a microscope.

The results of the comprehensive evaluation of monkey 6-lobe lung in PBS group were: local thickening and bleeding of lung septum, lymphocyte nodules, local thickening of blood vessel wall, thrombus formation in cavity, hematocytic exudate in tracheal lumen, local carbon terminal deposition and other pathological changes.

The results of the comprehensive evaluation of monkey 6 leaf lung in the vaccine group were: the alveolar structure is relatively intact, the pulmonary septum is slightly thickened and slightly bleeds, the focal dust cells are distributed, and a small amount of inflammatory cells infiltrate.

7.8.3.2 pulmonary tissue pathology score

All lung tissue sections were stained with hematoxylin-eosin (H & E) (Bar value represents 100 μm) rhesus lung inflammation, lung structure changes, bleeding and the like were graded according to the method reported in the literature (Liu L, et al, anti-spike IgG mice lung cancer lung in therapy by bone lifting surgery shock responses SARS-CoV infection JCI insight.2019;4 (4): E123158), and the scoring criteria for each index are shown in the following table. The lung histopathology evaluation of this batch of experiments was scored against the scoring criteria table.

Rhesus monkey lung pathological change scoring table

(see: liu L, et al. JCI insight.2019;4 (4): e 123158)

Grading pathological slices of each lobe lung of each monkey lung tissue pathology according to a grading table, firstly randomly selecting at least 5 visual fields for grading each rhesus monkey lung tissue (6 lobe lungs in total, namely, upper left, middle left, lower left, upper right, middle right and lower right), wherein the average number of pathological scores of all the lobe lungs is the comprehensive pathological score result of the whole lung of the monkey, and the comprehensive pathological score result of the lung of each monkey in each group is shown in the statistical table. The results indicated that the lung tissue composite pathology scores for the vaccine group were all significantly lower than those for the PBS group (see table below and figures 28-34). The mean value of the pathological damage scores of the lungs of the animals in the PBS model control group is 6.28 points, and the mean value of the pathological damage scores of the lungs of the animals in the vaccine group is 2.04 points. The result shows that the vaccine has obvious protective effect on the lung tissue damage of the rhesus monkey after immunization.

Statistic of pathological scoring of lung tissue of each lung lobe of rhesus monkey

7.8 conclusion of the experiment

No viral load was detected in the vaccine group (3/3) on day 7 after challenge, but the PBS group (3/3) still had viral loads above 5 log values; nasal swabs of the vaccine group significantly reduced the viral load by 3.3 log values compared to the PBS group. Thus, the vaccine can effectively eliminate SARS-CoV-2. On day 7 after challenge, no viral load was detected in both bronchial and left lower lung lavage of vaccinated animals; no viral load was detected in the lungs of 3/4 experimental monkeys. The vaccine has the function of clearing lung SARS-CoV-2.

Example 11: screening experiments for UTR sequences

In order to obtain better UTR sequences on the basis of optimizing the sequences, the UTR sequences are screened, and a plurality of UTR sequence pairs used in the invention are obtained through screening of the UTR sequences. The screening was performed by selecting ORF sequences of NDA's in Nos. 1 and 9, and then, by transcription of the sequences, the following UTR sequence was ligated to the 5-terminal and PloyA sequence was ligated to the 3-terminal, respectively, and these sequences were not modified with nucleic acids.

The RNA of the sequences is used for liposome encapsulation, and the specific steps are as follows: an appropriate amount of lipid solution (an ionizable lipid MC3, DSPC, cholesterol, mPEG2000-DMG prepared as a 10mg/ml lipid solution at a molar ratio of 50: 38.5) was mixed with eGFP-mRNA (dissolved in 1mM citrate-sodium citrate buffer ph 6.4) at a mixing flow rate of 12, fixed mixing ratio of 3 (mRNA solution): 1 (lipid solution), fixed at 37 ℃, to give lipid nanoparticles with a particle size of 90.6 ± 5.4 nanometers (nm) as measured.

Then, in vitro cell experiments were performed in the same manner as in example 2, and the control of blank experiments using UTR-free sequences and PBS was found to improve the expression level of RNA with UTR sequences having the following sequences. UTR pairs are paired one by one according to the number, and a UTR-1 at the 5 'end and a UTR sequence at the 3' end are used as a pair.

5' UTR sequence

>5’UTR-1(SEQ NO：36-1)

GTCTCAGTCGCCGCTGCCAGCTCTCGCACTCTGTTCTTCCGCCGCTCCGCCGTCG CGTTTCTCTGCCGGTCGCA

>5’UTR-2(SEQ NO：36-2)

ACCCGGCGCTCCATTAAATAGCCGTAGACGGAACTTCGCCTTTCTCTCGGCCTTA GCGCCATTTTTTTGGAAACCTCTGCGCC

>5’UTR-3(SEQ NO：36-3)

CTCTCTTCCACAGGAGGCCTACACGCCGCCGCTTGTGCTGCAGCC

>5’UTR-4(SEQ NO：36-4)

GGGACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC

>5’UTR-5(SEQ NO：36-5)

GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC

>5’UTR-6(SEQ NO：36-6)

CCCCCCGAGCGCCGCTCCGGCTGCACCGCGCTCGCTCCGAGTTTCAGGCTCGTG CTAAGCTAGCGCCGTCGTCGTCTCCCTTCAGTCGCCATC

>5’UTR-7(SEQ NO：36-7)

CTTTCCGGCGGTGACGACCTACGCACACGAGAAC

>5’UTR-8(SEQ NO：36-8)

CGCCTGGCCGGCGGGCTGAGGCGTACGGGTCGCACGCAGCGCC

>5’UTR-9(SEQ NO：36-9)

CGCTCTTATTGGCCAGGGGACGGTAGCTGCAGGACTCTGCTCTCCTGCGGCC

>5’UTR-10(SEQ NO：36-10)

TTCCATTTGGCTGCAGCTTCTGGAGGGAGCCGACAGGAGACGTGGGGAGACG

>5’UTR-11(SEQ NO：36-11)

GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC

>5’UTR-12(SEQ NO：36-12)

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC

3' sequence of UTR:

>3’UTR-1(SEQ NO：37-1)

GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAA CTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATA AAAAACATTTATTTTCATTGC

>3’UTR-2(SEQ NO：37-2)

ATGGAAGCATTAATTGTTTTGAACATGTAAATATAAATCTGTCAGCCACTACAGC CATCAAAAGAGAGCATCTGGAAGAACAGCCAGCTTGGAAGTTTTACAGCAATAA TGTTGCAGTGGAATATTATTTGTAGTTAAGGTCATCCTCCTCCCCTTTCTGTTTTTT TAAATCAAGAACTACGTTCTGCCCCTCTCTTGGGCTTCAGAAGCATCTAAGAAA AGCAGTCATCAATTATAATTAACTTTCAAAGGGCAAGTCAGAAGTTGTTTATAAA TTACAAAATAAAGGCATATTATGAACTCTTA

>3’UTR-3(SEQ NO：37-3)

GAAAAGACTTCTTCCATCAAGCTTAATTGTTTTGTTATTCATTTAATGACTTTCCC TGCTGTTACCTAATTACAAATTGGATGGAACTGTGTTTTTTTCTGCTTTGTTTTTT CAGTTTGCTGTTTCTGTAGCCATATTGTATTCTGTGTCAAATAAAGTCCAGTTGGA TTCTGGAA

>3’UTR-4(SEQ NO：37-4)

CAAATGTGGCAATTATTTTGGATCTATCACCTGTCATCATAACTGGCTTCTGCTTG TCATCCACACAACACCAGGACTTAAGACAAATGGGACTGATGTCATCTTGAGCT CTTCATTTATTTTGACTGTGATTTATTTGGAGTGGAGGCATTGTTTTTAAGAAAAA CATGTCATGTAGGTTGTCTAAAAATAAAATGCATTTAAACTCATTTGAGAG

>3’UTR-5(SEQ NO：37-5)

AAGCACTCTGAGTCAAGATGAGTGGGAAACCATCTCAATAAACACATTTTGGAT AAATCCTG

>3’UTR-6(SEQ NO：37-6)

GCGCTGGGCTGTTTTAGTGCCAGGCTGCGGTGGGCAGCCATGAGAACAAAACC TCTTCTGTATTTTTTTTTTCCATTAGTAAAACACAAGACTTCAGATTCAGCCGAAT TGTGGTGTCTTACAAGGCAGGCCTTTCCTACAGGGGGTGGAGAGACCAGCCTTT CTTCCTTTGGTAGGAATGGCCTGAGTTGGCGTTGTGGGCAGGCTACTGGTTTGTA TGATGTATTAGTAGAGCAACCCATTAATCTTTTGTAGTTTGTATTAAACTTGAACT GAGACCTTGATGAGTCTTTA

>3’UTR-7(SEQ NO：37-7)

GAAAAATGAAAGGAAGTTCTGCTGTCAGAGGCAAAACATCTGTTTATCATAGAC ATCAACATGACCTATAAGTAAAGTGCGTGTCTAGTGTCTTCTATTGAGAGTACTA CTATTAATTAAGCTTATTTCCAATGTGCCTTTTTAATGCTTGAAGTTTTATCTACAT ACACAGGTAACAGAGGACAGTAGTCTGTAAACATATAAATCGGTCATAACTATCG TGGTCTTTATTTCTGTGAGGATCTAGGGAAATTTCATGTCACTTCCCTCCTTCACT GCATCACAATCATATTCCCTTTTTTTTTTCTTGGATTTGTGTCAGTTGGATGATATC CCCTCCAGATAGTATCAATAAAATGTTAAAATT

>3’UTR-8(SEQ NO：37-8)

ACTCCCTCCTCCTGCCACTGGTGCCTCGAGTAGCCATGGCAACGGGCCCAGTGT CCAGTCACTTAGAAGTTCCCCCCTTGGCCAAAAACCCAATTCACATTGAGAGCT GGTGTTGTCTGAAGTTTTCGTATCACAGTGTTAACCTGTACTCTCTCCTGCAAAC CTACACACCAAAGCTTTATTTATATCATTCCAGTATCAATGCTACACAGTGTTGTC CCGAGCGCCGGGAGGCGTTGGGCAGAAACCCTCGGGAATGCTTCCGAGCACGC TGTAGGGTATGGGAAGAACCCAGCACCACTAATAAAGCTGCTGCTTGGCTGGA

>3’UTR-9(SEQ NO：37-9)

GGTGACCCGGCTGGGTCGGCCCTGCCCAAGGGCCTCCCACCAGAGACTGGGAT GGGAACACTGGTGGGCAGCTGAGGACACACCCCACACCCCAGCCCACCCTGCT CCTCCTGCCCTGTCCCTGTCCCCCTCCCCTCCCAGTCCTCCAGACCACCAGCCGC CCCAGCCCCTTCTCCCAGCACACGGCTGCCTGACACTGAGCCCCACCTCTCCAA GTCTCTCTGTGAATACAATTAAAGGTCCTGCCCTCCC

>3’UTR-10(SEQ NO：37-10)

ACCGCTAGCTTGTTGCACCGTGGAGGCCACAGGAGCAGAAACATGGAATGCCA GACGCTGGGGATGCTGGTACAAGTTGTGGGACTGCATGCTACTGTCTAGAGCTT GTCTCAATGGATCTAGAACTTCATCGCCCTCTGATCGCCGATCACCTCTGAGACC CACCTTGCTCATAAACAAAATGCCCATGTTGGTCCTCTGCCCTGGACCTGTGACA TTCTGGACTATTTCTGTGTTTATTTGTGGCCGAGTGTAACAACCATATAATAAATC ACCTCTTCCGCTGTTTTAGCTGAAGAATTAAATCA

>3’UTR-11(SEQ NO：37-11)

GCUGCCUUCUGCGGGGCUUGCCUUCUGGCCAUGCCCUUCUUCUCUCCCUUGC ACCUGUACCUCUUGGUCUUUGAAUAAAGCCUGAGUAGGAAGUGAGGGUCUA GAACU

>3’UTR-12(SEQ NO：37-12)

GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAA CTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATA AAAAACATTTATTTTCATTGC

the mRNA sequence used was the GFP sequence ((SEQ NO: 40):

the specific process is to connect the sequence of UTR-5 'before the 5 sequence of GFP, then select the sequence of UTR-3' to connect to the 3 end of GFP, the specific connection method is to connect in the process of inversion ratio by implementing the connection method in example 1, then to obtain better experimental pairing by the cell experiment as in example 2.

Specifically, the sequences correspond to the above sequences, namely 5' UTR SEQ NO: 36-1) corresponding to the code number of 3' UTR, obtaining 12 pairs of sequences, simultaneously expressing fluorescent protein, and showing that the expression amount of each pair is not obvious from the expression result, the sequences can be used for the non-coding region of messenger RNA (the specific data is omitted).

In order to clearly illustrate the correspondence between the accounting sequence cited in the present invention and the accounting sequence number automatically generated by software, the table is specially made for clear illustration, and the following table is specifically shown.

The invention shown and described herein may be practiced in the absence of any element or elements, limitation or limitations, which is specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, and it is recognized that various modifications are possible within the scope of the invention. It should therefore be understood that although the present invention has been specifically disclosed by various embodiments and optional features, modification and variation of the concepts herein described may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims. The contents of the articles, patents, patent applications, and all other documents and electronically available information described or cited herein are hereby incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right to incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other documents.

Sequence listing

<110> Si micro (Shanghai) Biotech Co., ltd

<120> vaccine agent for treating or preventing coronavirus disease

<160> 78

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3822

<212> DNA

<213> coronavirus (coronavirus)

<400> 1

atgtttgttt ttcttgtttt attgccacta gtctctagtc agtgtgttaa tcttacaacc 60

agaactcaat taccccctgc atacactaat tctttcacac gtggtgttta ttaccctgac 120

aaagttttca gatcctcagt tttacattca actcaggact tgttcttacc tttcttttcc 180

aatgttactt ggttccatgc tatacatgtc tctgggacca atggtactaa gaggtttgat 240

aaccctgtcc taccatttaa tgatggtgtt tattttgctt ccactgagaa gtctaacata 300

ataagaggct ggatttttgg tactacttta gattcgaaga cccagtccct acttattgtt 360

aataacgcta ctaatgttgt tattaaagtc tgtgaatttc aattttgtaa tgatccattt 420

ttgggtgttt attaccacaa aaacaacaaa agttggatgg aaagtgagtt cagagtttat 480

tctagtgcga ataattgcac ttttgaatat gtctctcagc cttttcttat ggaccttgaa 540

ggaaaacagg gtaatttcaa aaatcttagg gaatttgtgt ttaagaatat tgatggttat 600

tttaaaatat attctaagca cacgcctatt aatttagtgc gtgatctccc tcagggtttt 660

tcggctttag aaccattggt agatttgcca ataggtatta acatcactag gtttcaaact 720

ttacttgctt tacatagaag ttatttgact cctggtgatt cttcttcagg ttggacagct 780

ggtgctgcag cttattatgt gggttatctt caacctagga cttttctatt aaaatataat 840

gaaaatggaa ccattacaga tgctgtagac tgtgcacttg accctctctc agaaacaaag 900

tgtacgttga aatccttcac tgtagaaaaa ggaatctatc aaacttctaa ctttagagtc 960

caaccaacag aatctattgt tagatttcct aatattacaa acttgtgccc ttttggtgaa 1020

gtttttaacg ccaccagatt tgcatctgtt tatgcttgga acaggaagag aatcagcaac 1080

tgtgttgctg attattctgt cctatataat tccgcatcat tttccacttt taagtgttat 1140

ggagtgtctc ctactaaatt aaatgatctc tgctttacta atgtctatgc agattcattt 1200

gtaattagag gtgatgaagt cagacaaatc gctccagggc aaactggaaa gattgctgat 1260

tataattata aattaccaga tgattttaca ggctgcgtta tagcttggaa ttctaacaat 1320

cttgattcta aggttggtgg taattataat tacctgtata gattgtttag gaagtctaat 1380

ctcaaacctt ttgagagaga tatttcaact gaaatctatc aggccggtag cacaccttgt 1440

aatggtgttg aaggttttaa ttgttacttt cctttacaat catatggttt ccaacccact 1500

aatggtgttg gttaccaacc atacagagta gtagtacttt cttttgaact tctacatgca 1560

ccagcaactg tttgtggacc taaaaagtct actaatttgg ttaaaaacaa atgtgtcaat 1620

ttcaacttca atggtttaac aggcacaggt gttcttactg agtctaacaa aaagtttctg 1680

cctttccaac aatttggcag agacattgct gacactactg atgctgtccg tgatccacag 1740

acacttgaga ttcttgacat tacaccatgt tcttttggtg gtgtcagtgt tataacacca 1800

ggaacaaata cttctaacca ggttgctgtt ctttatcagg atgttaactg cacagaagtc 1860

cctgttgcta ttcatgcaga tcaacttact cctacttggc gtgtttattc tacaggttct 1920

aatgtttttc aaacacgtgc aggctgttta ataggggctg aacatgtcaa caactcatat 1980

gagtgtgaca tacccattgg tgcaggtata tgcgctagtt atcagactca gactaattct 2040

cctcggcggg cacgtagtgt agctagtcaa tccatcattg cctacactat gtcacttggt 2100

gcagaaaatt cagttgctta ctctaataac tctattgcca tacccacaaa ttttactatt 2160

agtgttacca cagaaattct accagtgtct atgaccaaga catcagtaga ttgtacaatg 2220

tacatttgtg gtgattcaac tgaatgcagc aatcttttgt tgcaatatgg cagtttttgt 2280

acacaattaa accgtgcttt aactggaata gctgttgaac aagacaaaaa cacccaagaa 2340

gtttttgcac aagtcaaaca aatttacaaa acaccaccaa ttaaagattt tggtggtttt 2400

aatttttcac aaatattacc agatccatca aaaccaagca agaggtcatt tattgaagat 2460

ctacttttca acaaagtgac acttgcagat gctggcttca tcaaacaata tggtgattgc 2520

cttggtgata ttgctgctag agacctcatt tgtgcacaaa agtttaacgg ccttactgtt 2580

ttgccacctt tgctcacaga tgaaatgatt gctcaataca cttctgcact gttagcgggt 2640

acaatcactt ctggttggac ctttggtgca ggtgctgcat tacaaatacc atttgctatg 2700

caaatggctt ataggtttaa tggtattgga gttacacaga atgttctcta tgagaaccaa 2760

aaattgattg ccaaccaatt taatagtgct attggcaaaa ttcaagactc actttcttcc 2820

acagcaagtg cacttggaaa acttcaagat gtggtcaacc aaaatgcaca agctttaaac 2880

acgcttgtta aacaacttag ctccaatttt ggtgcaattt caagtgtttt aaatgatatc 2940

ctttcacgtc ttgacaaagt tgaggctgaa gtgcaaattg ataggttgat cacaggcaga 3000

cttcaaagtt tgcagacata tgtgactcaa caattaatta gagctgcaga aatcagagct 3060

tctgctaatc ttgctgctac taaaatgtca gagtgtgtac ttggacaatc aaaaagagtt 3120

gatttttgtg gaaagggcta tcatcttatg tccttccctc agtcagcacc tcatggtgta 3180

gtcttcttgc atgtgactta tgtccctgca caagaaaaga acttcacaac tgctcctgcc 3240

atttgtcatg atggaaaagc acactttcct cgtgaaggtg tctttgtttc aaatggcaca 3300

cactggtttg taacacaaag gaatttttat gaaccacaaa tcattactac agacaacaca 3360

tttgtgtctg gtaactgtga tgttgtaata ggaattgtca acaacacagt ttatgatcct 3420

ttgcaacctg aattagactc attcaaggag gagttagata aatattttaa gaatcataca 3480

tcaccagatg ttgatttagg tgacatctct ggcattaatg cttcagttgt aaacattcaa 3540

aaagaaattg accgcctcaa tgaggttgcc aagaatttaa atgaatctct catcgatctc 3600

caagaacttg gaaagtatga gcagtatata aaatggccat ggtacatttg gctaggtttt 3660

atagctggct tgattgccat agtaatggtg acaattatgc tttgctgtat gaccagttgc 3720

tgtagttgtc tcaagggctg ttgttcttgt ggatcctgct gcaaatttga tgaagacgac 3780

tctgagccag tgctcaaagg agtcaaatta cattacacat aa 3822

<210> 2

<211> 3825

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgttcgtct tcctggtgct gctgcctctg gtgtcttccc agtgcgtgaa tctgactacc 60

aggacccagc tgccccctgc ctataccaat tccttcacac ggggcgtgta ctatcccgac 120

aaggtgttta gaagctccgt gctgcactct acacaggatc tgtttctgcc tttctttagc 180

aacgtgacct ggttccacgc catccacgtg agcggcacca atggcacaaa gcggttcgac 240

aatccagtgc tgccctttaa cgatggcgtg tacttcgcct ctaccgagaa gagcaacatc 300

atcagaggct ggatctttgg caccacactg gactccaaga cacagtctct gctgatcgtg 360

aacaatgcca ccaacgtggt catcaaggtg tgcgagttcc agttttgtaa tgatccattc 420

ctgggcgtgt actatcacaa gaacaataag agctggatgg agtccgagtt tcgcgtgtat 480

tctagcgcca acaattgcac atttgagtac gtgtcccagc ccttcctgat ggacctggag 540

ggcaagcagg gcaatttcaa gaacctgagg gagttcgtgt ttaagaatat cgatggctac 600

ttcaagatct actctaagca caccccaatc aacctggtgc gcgacctgcc acagggcttc 660

agcgccctgg agccactggt ggatctgccc atcggcatca acatcacccg gtttcagaca 720

ctgctggccc tgcacagaag ctacctgaca ccaggcgact cctctagcgg atggaccgca 780

ggagcagcag cctactatgt gggctatctg cagcccagga ccttcctgct gaagtacaac 840

gagaatggca ccatcacaga cgccgtggat tgcgccctgg atcccctgag cgagacaaag 900

tgtacactga agtcctttac cgtggagaag ggcatctatc agacatccaa tttcagggtg 960

cagcctaccg agtctatcgt gcgctttccc aatatcacaa acctgtgccc ttttggcgag 1020

gtgttcaacg caaccaggtt cgcaagcgtg tacgcatgga ataggaagcg catctctaac 1080

tgcgtggccg actatagcgt gctgtacaac tccgcctctt tcagcacctt taagtgctat 1140

ggcgtgtccc ccacaaagct gaatgacctg tgctttacca acgtgtacgc cgattctttc 1200

gtgatcaggg gcgacgaggt gcgccagatc gcaccaggac agacaggcaa gatcgcagac 1260

tacaattata agctgcctga cgatttcacc ggctgcgtga tcgcctggaa cagcaacaat 1320

ctggattcca aagtgggcgg caactacaat tatctgtacc ggctgtttag aaagagcaat 1380

ctgaagccat tcgagaggga catctctaca gagatctacc aggcaggaag caccccatgc 1440

aatggagtgg agggctttaa ctgttatttc cctctgcagt cctacggctt ccagccaacc 1500

aacggcgtgg gctatcagcc ctaccgcgtg gtggtgctga gctttgagct gctgcacgca 1560

cctgcaacag tgtgcggacc aaagaagtcc accaatctgg tgaagaacaa gtgcgtgaac 1620

ttcaacttca acggcctgac cggaacaggc gtgctgaccg agtccaacaa gaagttcctg 1680

ccttttcagc agttcggcag ggacatcgca gataccacag acgccgtgcg cgaccctcag 1740

accctggaga tcctggatat cacaccatgc tctttcggcg gcgtgagcgt gatcacacca 1800

ggcaccaata caagcaacca ggtggccgtg ctgtatcagg acgtgaattg taccgaggtg 1860

ccagtggcaa tccacgcaga tcagctgacc cctacatggc gggtgtacag caccggctcc 1920

aacgtgttcc agacaagagc aggatgtctg atcggagcag agcacgtgaa caattcctat 1980

gagtgcgaca tccctatcgg cgccggcatc tgtgcctctt accagaccca gacaaactct 2040

ccaaggagag cacggagcgt ggcatcccag tctatcatcg cctataccat gtccctgggc 2100

gccgagaatt ctgtggccta ctctaacaat agcatcgcca tccctaccaa cttcacaatc 2160

tctgtgacca cagagatcct gccagtgtcc atgaccaaga catctgtgga ctgcacaatg 2220

tatatctgtg gcgattctac cgagtgcagc aacctgctgc tgcagtacgg cagcttttgt 2280

acccagctga atagagccct gacaggcatc gccgtggagc aggataagaa cacacaggag 2340

gtgttcgccc aggtgaagca gatctacaag accccaccca tcaaggactt tggcggcttc 2400

aatttttccc agatcctgcc cgatccttcc aagccctcta agcggagctt tatcgaggac 2460

ctgctgttca acaaggtgac cctggccgat gccggcttca tcaagcagta tggcgattgc 2520

ctgggcgaca tcgcagcacg ggacctgatc tgtgcccaga agtttaatgg cctgaccgtg 2580

ctgcctccac tgctgacaga tgagatgatc gcacagtaca caagcgccct gctggcagga 2640

accatcacat ccggatggac cttcggcgca ggagccgccc tgcagatccc ctttgccatg 2700

cagatggcct atcggttcaa cggcatcggc gtgacccaga atgtgctgta cgagaaccag 2760

aagctgatcg ccaatcagtt taactccgcc atcggcaaga tccaggacag cctgtcctct 2820

acagcctccg ccctgggcaa gctgcaggat gtggtgaatc agaacgccca ggccctgaat 2880

accctggtga agcagctgag ctccaacttc ggcgccatct ctagcgtgct gaatgatatc 2940

ctgagccggc tggacaaggt ggaggcagag gtgcagatcg accggctgat cacaggcaga 3000

ctgcagtctc tgcagaccta tgtgacacag cagctgatca gggcagcaga gatcagggca 3060

agcgccaatc tggcagcaac caagatgtcc gagtgcgtgc tgggccagtc taagagagtg 3120

gacttttgtg gcaagggcta tcacctgatg tccttcccac agtctgcccc tcacggagtg 3180

gtgtttctgc acgtgaccta cgtgccagcc caggagaaga acttcaccac agcaccagca 3240

atctgccacg atggcaaggc acactttcct agggagggcg tgttcgtgtc caacggcacc 3300

cactggtttg tgacacagcg caatttctac gagccacaga tcatcaccac agacaatacc 3360

ttcgtgagcg gcaactgtga cgtggtcatc ggcatcgtga acaataccgt gtatgatcct 3420

ctgcagccag agctggacag ctttaaggag gagctggata agtacttcaa gaatcacacc 3480

tcccccgacg tggatctggg cgacatcagc ggcatcaatg cctccgtggt gaacatccag 3540

aaggagatcg acaggctgaa cgaggtggcc aagaatctga acgagagcct gatcgatctg 3600

caggagctgg gcaagtatga gcagtacatc aagtggcctt ggtacatctg gctgggcttc 3660

atcgccggcc tgatcgccat cgtgatggtg accatcatgc tgtgctgtat gacatcctgc 3720

tgttcttgcc tgaagggctg ctgtagctgc ggctcctgtt gtaaattcga tgaggatgat 3780

tccgagcctg tgctgaaggg cgtgaaactg cattatacct aatag 3825

<210> 3

<211> 768

<212> DNA

<213> coronavirus (coronavirus)

<400> 3

atgcctaata ttacaaactt gtgccctttt ggtgaagttt ttaacgccac cagatttgca 60

tctgtttatg cttggaacag gaagagaatc agcaactgtg ttgctgatta ttctgtccta 120

tataattccg catcattttc cacttttaag tgttatggag tgtctcctac taaattaaat 180

gatctctgct ttactaatgt ctatgcagat tcatttgtaa ttagaggtga tgaagtcaga 240

caaatcgctc cagggcaaac tggaaagatt gctgattata attataaatt accagatgat 300

tttacaggct gcgttatagc ttggaattct aacaatcttg attctaaggt tggtggtaat 360

tataattacc tgtatagatt gtttaggaag tctaatctca aaccttttga gagagatatt 420

tcaactgaaa tctatcaggc cggtagcaca ccttgtaatg gtgttgaagg ttttaattgt 480

tactttcctt tacaatcata tggtttccaa cccactaatg gtgttggtta ccaaccatac 540

agagtagtag tactttcttt tgaacttcta catgcaccag caactgtttg tggacctaaa 600

aagtctacta atttggttaa aaacaaatgt gtcaatttca acttcaatgg tttaacaggc 660

acaggtgttc ttactgagtc taacaaaaag tttctgcctt tccaacaatt tggcagagac 720

attgctgaca ctactgatgc tgtccgtgat ccacagacac ttgagtaa 768

<210> 4

<211> 771

<212> DNA

<213> coronavirus (coronavirus)

<400> 4

atgcctaata ttacaaactt gtgccctttt ggtgaagttt ttaacgccac cagatttgca 60

tctgtttatg cttggaacag gaagagaatc agcaactgtg ttgctgatta ttctgtccta 120

tataattccg catcattttc cacttttaag tgttatggag tgtctcctac taaattaaat 180

gatctctgct ttactaatgt ctatgcagat tcatttgtaa ttagaggtga tgaagtcaga 240

caaatcgctc cagggcaaac tggaaagatt gctgattata attataaatt accagatgat 300

tttacaggct gcgttatagc ttggaattct aacaatcttg attctaaggt tggtggtaat 360

tataattacc tgtatagatt gtttaggaag tctaatctca aaccttttga gagagatatt 420

tcaactgaaa tctatcaggc cggtagcaca ccttgtaatg gtgttgaagg ttttaattgt 480

tactttcctt tacaatcata tggtttccaa cccactaatg gtgttggtta ccaaccatac 540

agagtagtag tactttcttt tgaacttcta catgcaccag caactgtttg tggacctaaa 600

aagtctacta atttggttaa aaacaaatgt gtcaatttca acttcaatgg tttaacaggc 660

acaggtgttc ttactgagtc taacaaaaag tttctgcctt tccaacaatt tggcagagac 720

attgctgaca ctactgatgc tgtccgtgat ccacagacac ttgagtaata g 771

<210> 5

<211> 669

<212> DNA

<213> Coronavirus (coronavirus)

<400> 5

atggcagatt ccaacggtac tattaccgtt gaagagctta aaaagctcct tgaacaatgg 60

aacctagtaa taggtttcct attccttaca tggatttgtc ttctacaatt tgcctatgcc 120

aacaggaata ggtttttgta tataattaag ttaattttcc tctggctgtt atggccagta 180

actttagctt gttttgtgct tgctgctgtt tacagaataa attggatcac cggtggaatt 240

gctatcgcaa tggcttgtct tgtaggcttg atgtggctca gctacttcat tgcttctttc 300

agactgtttg cgcgtacgcg ttccatgtgg tcattcaatc cagaaactaa cattcttctc 360

aacgtgccac tccatggcac tattctgacc agaccgcttc tagaaagtga actcgtaatc 420

ggagctgtga tccttcgtgg acatcttcgt attgctggac accatctagg acgctgtgac 480

atcaaggacc tgcctaaaga aatcactgtt gctacatcac gaacgctttc ttattacaaa 540

ttgggagctt cgcagcgtgt agcaggtgac tcaggttttg ctgcatacag tcgctacagg 600

attggcaact ataaattaaa cacagaccat tccagtagca gtgacaatat tgctttgctt 660

gtacagtaa 669

<210> 6

<211> 672

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atggccgata gcaacggcac catcaccgtg gaagaactga agaaactgct ggaacagtgg 60

aacctcgtga tcggcttcct gttcctgacc tggatctgcc tgctgcagtt cgcctacgcc 120

aaccggaaca gattcctgta tattatcaag ctgatcttcc tgtggctgct gtggcccgtg 180

acactggcct gttttgtgct ggccgccgtg taccggatca actggatcac aggcggaatc 240

gccattgcca tggcctgtct cgttggcctg atgtggctga gctactttat cgccagcttc 300

cggctgttcg cccggaccag atccatgtgg tccttcaatc ccgagacaaa catcctgctg 360

aacgtgcccc tgcacggcac aatcctgaca agacctctgc tggaaagcga gctggttatc 420

ggcgccgtga tcctgagagg ccacctgaga attgccggac accacctggg cagatgcgac 480

atcaaggacc tgcctaaaga aatcacagtg gccaccagca gaaccctgtc ctactataag 540

ctgggcgcca gccagagagt ggccggcgat tctggatttg ccgcctacag cagataccgg 600

atcggcaact acaagctgaa caccgaccac agctccagca gcgacaatat cgcactgctg 660

gtgcagtaat ag 672

<210> 7

<211> 1260

<212> DNA

<213> coronavirus (coronavirus)

<400> 7

atgtctgata atggacccca aaatcagcga aatgcacccc gcattacgtt tggtggaccc 60

tcagattcaa ctggcagtaa ccagaatgga gaacgcagtg gggcgcgatc aaaacaacgt 120

cggccccaag gtttacccaa taatactgcg tcttggttca ccgctctcac tcaacatggc 180

aaggaagacc ttaaattccc tcgaggacaa ggcgttccaa ttaacaccaa tagcagtcca 240

gatgaccaaa ttggctacta ccgaagagct accagacgaa ttcgtggtgg tgacggtaaa 300

atgaaagatc tcagtccaag atggtatttc tactacctag gaactgggcc agaagctgga 360

cttccctatg gtgctaacaa agacggcatc atatgggttg caactgaggg agccttgaat 420

acaccaaaag atcacattgg cacccgcaat cctgctaaca atgctgcaat cgtgctacaa 480

cttcctcaag gaacaacatt gccaaaaggc ttctacgcag aagggagcag aggcggcagt 540

caagcctctt ctcgttcctc atcacgtagt cgcaacagtt caagaaattc aactccaggc 600

agcagtaggg gaacttctcc tgctagaatg gctggcaatg gcggtgatgc tgctcttgct 660

ttgctgctgc ttgacagatt gaaccagctt gagagcaaaa tgtctggtaa aggccaacaa 720

caacaaggcc aaactgtcac taagaaatct gctgctgagg cttctaagaa gcctcggcaa 780

aaacgtactg ccactaaagc atacaatgta acacaagctt tcggcagacg tggtccagaa 840

caaacccaag gaaattttgg ggaccaggaa ctaatcagac aaggaactga ttacaaacat 900

tggccgcaaa ttgcacaatt tgcccccagc gcttcagcgt tcttcggaat gtcgcgcatt 960

ggcatggaag tcacaccttc gggaacgtgg ttgacctaca caggtgccat caaattggat 1020

gacaaagatc caaatttcaa agatcaagtc attttgctga ataagcatat tgacgcatac 1080

aaaacattcc caccaacaga gcctaaaaag gacaaaaaga agaaggctga tgaaactcaa 1140

gccttaccgc agagacagaa gaaacagcaa actgtgactc ttcttcctgc tgcagatttg 1200

gatgatttct ccaaacaatt gcaacaatcc atgagcagtg ctgactcaac tcaggcctaa 1260

<210> 8

<211> 1263

<212> DNA

<213> Coronavirus (coronavirus)

<400> 8

atgtctgata atggacccca aaatcagcga aatgcacccc gcattacgtt tggtggaccc 60

tcagattcaa ctggcagtaa ccagaatgga gaacgcagtg gggcgcgatc aaaacaacgt 120

cggccccaag gtttacccaa taatactgcg tcttggttca ccgctctcac tcaacatggc 180

aaggaagacc ttaaattccc tcgaggacaa ggcgttccaa ttaacaccaa tagcagtcca 240

gatgaccaaa ttggctacta ccgaagagct accagacgaa ttcgtggtgg tgacggtaaa 300

atgaaagatc tcagtccaag atggtatttc tactacctag gaactgggcc agaagctgga 360

cttccctatg gtgctaacaa agacggcatc atatgggttg caactgaggg agccttgaat 420

acaccaaaag atcacattgg cacccgcaat cctgctaaca atgctgcaat cgtgctacaa 480

cttcctcaag gaacaacatt gccaaaaggc ttctacgcag aagggagcag aggcggcagt 540

caagcctctt ctcgttcctc atcacgtagt cgcaacagtt caagaaattc aactccaggc 600

agcagtaggg gaacttctcc tgctagaatg gctggcaatg gcggtgatgc tgctcttgct 660

ttgctgctgc ttgacagatt gaaccagctt gagagcaaaa tgtctggtaa aggccaacaa 720

caacaaggcc aaactgtcac taagaaatct gctgctgagg cttctaagaa gcctcggcaa 780

aaacgtactg ccactaaagc atacaatgta acacaagctt tcggcagacg tggtccagaa 840

caaacccaag gaaattttgg ggaccaggaa ctaatcagac aaggaactga ttacaaacat 900

tggccgcaaa ttgcacaatt tgcccccagc gcttcagcgt tcttcggaat gtcgcgcatt 960

ggcatggaag tcacaccttc gggaacgtgg ttgacctaca caggtgccat caaattggat 1020

gacaaagatc caaatttcaa agatcaagtc attttgctga ataagcatat tgacgcatac 1080

aaaacattcc caccaacaga gcctaaaaag gacaaaaaga agaaggctga tgaaactcaa 1140

gccttaccgc agagacagaa gaaacagcaa actgtgactc ttcttcctgc tgcagatttg 1200

gatgatttct ccaaacaatt gcaacaatcc atgagcagtg ctgactcaac tcaggcctaa 1260

tag 1263

<210> 9

<211> 600

<212> DNA

<213> coronavirus (coronavirus)

<400> 9

atgattacaa acttgtgccc ttttggtgaa gtttttaacg ccaccagatt tgcatctgtt 60

tatgcttgga acaggaagag aatcagcaac tgtgttgctg attattctgt cctatataat 120

tccgcatcat tttccacttt taagtgttat ggagtgtctc ctactaaatt aaatgatctc 180

tgctttacta atgtctatgc agattcattt gtaattagag gtgatgaagt cagacaaatc 240

gctccagggc aaactggaaa gattgctgat tataattata aattaccaga tgattttaca 300

ggctgcgtta tagcttggaa ttctaacaat cttgattcta aggttggtgg taattataat 360

tacctgtata gattgtttag gaagtctaat ctcaaacctt ttgagagaga tatttcaact 420

gaaatctatc aggccggtag cacaccttgt aatggtgttg aaggttttaa ttgttacttt 480

cctttacaat catatggttt ccaacccact aatggtgttg gttaccaacc atacagagta 540

gtagtacttt cttttgaact tctacatgca ccagcaactg tttgtggacc taaaaagtaa 600

<210> 10

<211> 603

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atgatcacca atctgtgccc cttcggcgag gtgttcaacg ccacaagatt cgcctctgtg 60

tacgcctgga accggaagcg gatcagcaat tgcgtggccg actacagcgt gctgtacaac 120

agcgccagct tcagcacctt caagtgctac ggcgtgtccc ctaccaagct gaacgacctg 180

tgcttcacca acgtgtacgc cgacagcttc gtgatcagag gcgacgaagt gcggcagatt 240

gcccctggac agacaggcaa gatcgccgat tacaactaca agctgcccga cgacttcacc 300

ggctgtgtga ttgcctggaa cagcaacaac ctggacagca aagtcggcgg caactacaac 360

tacctgtacc ggctgttccg gaagtccaac ctgaagcctt tcgagcggga catcagcacc 420

gagatctatc aggccggcag caccccttgc aatggcgtgg aaggcttcaa ctgctacttc 480

ccactgcagt cctacggctt ccagcctaca aacggcgtgg gctaccagcc ttacagagtg 540

gtggtgctga gcttcgagct gctgcatgct cctgccacag tgtgcggacc taagaagtaa 600

tag 603

<210> 11

<211> 600

<212> DNA

<213> coronavirus (coronavirus)

<400> 11

atgattacaa acttgtgccc ttttggtgaa gtttttaacg ccaccagatt tgcatctgtt 60

tatgcttgga acaggaagag aatcagcaac tgtgttgctg attattctgt cctatataat 120

tccgcatcat tttccacttt taagtgttat ggagtgtctc ctactaaatt aaatgatctc 180

tgctttacta atgtctatgc agattcattt gtaattagag gtgatgaagt cagacaaatc 240

gctccagggc aaactggaaa gattgctgat tataattata aattaccaga tgattttaca 300

ggctgcgtta tagcttggaa ttctaacaat cttgattcta aggttggtgg taattataat 360

tacctgtata gattgtttag gaagtctaat ctcaaacctt ttgagagaga tatttcaact 420

gaaatctatc aggccggtag cacaccttgt aatggtgttg aaggttttaa ttgttacttt 480

cctttacaat catatggttt ccaacccact aatggtgttg gttaccaacc atacagagta 540

gtagtacttt cttttgaact tctacatgca ccagcaactg tttgtggacc taaaaagtaa 600

<210> 12

<211> 603

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

atgatcacca atctgtgccc cttcggcgag gtgttcaacg ccacaagatt cgcctctgtg 60

tacgcctgga accggaagcg gatcagcaat tgcgtggccg actacagcgt gctgtacaac 120

agcgccagct tcagcacctt caagtgctac ggcgtgtccc ctaccaagct gaacgacctg 180

tgcttcacca acgtgtacgc cgacagcttc gtgatcagag gcgacgaagt gcggcagatt 240

gcccctggac agacaggcaa gatcgccgat tacaactaca agctgcccga cgacttcacc 300

ggctgtgtga ttgcctggaa cagcaacaac ctggacagca aagtcggcgg caactacaac 360

tacctgtacc ggctgttccg gaagtccaac ctgaagcctt tcgagcggga catcagcacc 420

gagatctatc aggccggcag caccccttgc aatggcgtgg aaggcttcaa ctgctacttc 480

ccactgcagt cctacggctt ccagcctaca aacggcgtgg gctaccagcc ttacagagtg 540

gtggtgctga gcttcgaact gctgcacgcc aatgccacag tgtgcggccc taagaaataa 600

tag 603

<210> 13

<211> 228

<212> DNA

<213> coronavirus (coronavirus)

<400> 13

atgtactcat tcgtttcgga agagacaggt acgttaatag ttaatagcgt acttcttttt 60

cttgctttcg tggtattctt gctagttaca ctagccatcc ttactgcgct tcgattgtgt 120

gcgtactgct gcaatattgt taacgtgagt cttgtaaaac cttcttttta cgtttactct 180

cgtgttaaaa atctgaattc ttctagagtt cctgatcttc tggtctaa 228

<210> 14

<211> 231

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

atgtacagct tcgtgtccga ggaaaccggc acactgatcg tgaacagcgt gctgctgttc 60

ctggccttcg tggtgtttct gctggtcacc ctggccatcc tgacagccct gagactgtgc 120

gcctactgct gcaacatcgt gaacgtgtcc ctggtcaagc ccagcttcta cgtgtacagc 180

agagtgaaga acctgaacag ctccagagtg cccgacctgc tggtgtaata g 231

<210> 15

<211> 3612

<212> DNA

<213> coronavirus (coronavirus)

<400> 15

atgtctagtc agtgtgttaa tcttacaacc agaactcaat taccccctgc atacactaat 60

tctttcacac gtggtgttta ttaccctgac aaagttttca gatcctcagt tttacattca 120

actcaggact tgttcttacc tttcttttcc aatgttactt ggttccatgc tatacatgtc 180

tctgggacca atggtactaa gaggtttgat aaccctgtcc taccatttaa tgatggtgtt 240

tattttgctt ccactgagaa gtctaacata ataagaggct ggatttttgg tactacttta 300

gattcgaaga cccagtccct acttattgtt aataacgcta ctaatgttgt tattaaagtc 360

tgtgaatttc aattttgtaa tgatccattt ttgggtgttt attaccacaa aaacaacaaa 420

agttggatgg aaagtgagtt cagagtttat tctagtgcga ataattgcac ttttgaatat 480

gtctctcagc cttttcttat ggaccttgaa ggaaaacagg gtaatttcaa aaatcttagg 540

gaatttgtgt ttaagaatat tgatggttat tttaaaatat attctaagca cacgcctatt 600

aatttagtgc gtgatctccc tcagggtttt tcggctttag aaccattggt agatttgcca 660

ataggtatta acatcactag gtttcaaact ttacttgctt tacatagaag ttatttgact 720

cctggtgatt cttcttcagg ttggacagct ggtgctgcag cttattatgt gggttatctt 780

caacctagga cttttctatt aaaatataat gaaaatggaa ccattacaga tgctgtagac 840

tgtgcacttg accctctctc agaaacaaag tgtacgttga aatccttcac tgtagaaaaa 900

ggaatctatc aaacttctaa ctttagagtc caaccaacag aatctattgt tagatttcct 960

aatattacaa acttgtgccc ttttggtgaa gtttttaacg ccaccagatt tgcatctgtt 1020

tatgcttgga acaggaagag aatcagcaac tgtgttgctg attattctgt cctatataat 1080

tccgcatcat tttccacttt taagtgttat ggagtgtctc ctactaaatt aaatgatctc 1140

tgctttacta atgtctatgc agattcattt gtaattagag gtgatgaagt cagacaaatc 1200

gctccagggc aaactggaaa gattgctgat tataattata aattaccaga tgattttaca 1260

ggctgcgtta tagcttggaa ttctaacaat cttgattcta aggttggtgg taattataat 1320

tacctgtata gattgtttag gaagtctaat ctcaaacctt ttgagagaga tatttcaact 1380

gaaatctatc aggccggtag cacaccttgt aatggtgttg aaggttttaa ttgttacttt 1440

cctttacaat catatggttt ccaacccact aatggtgttg gttaccaacc atacagagta 1500

gtagtacttt cttttgaact tctacatgca ccagcaactg tttgtggacc taaaaagtct 1560

actaatttgg ttaaaaacaa atgtgtcaat ttcaacttca atggtttaac aggcacaggt 1620

gttcttactg agtctaacaa aaagtttctg cctttccaac aatttggcag agacattgct 1680

gacactactg atgctgtccg tgatccacag acacttgaga ttcttgacat tacaccatgt 1740

tcttttggtg gtgtcagtgt tataacacca ggaacaaata cttctaacca ggttgctgtt 1800

ctttatcagg atgttaactg cacagaagtc cctgttgcta ttcatgcaga tcaacttact 1860

cctacttggc gtgtttattc tacaggttct aatgtttttc aaacacgtgc aggctgttta 1920

ataggggctg aacatgtcaa caactcatat gagtgtgaca tacccattgg tgcaggtata 1980

tgcgctagtt atcagactca gactaattct cctcggcggg cacgtagtgt agctagtcaa 2040

tccatcattg cctacactat gtcacttggt gcagaaaatt cagttgctta ctctaataac 2100

tctattgcca tacccacaaa ttttactatt agtgttacca cagaaattct accagtgtct 2160

atgaccaaga catcagtaga ttgtacaatg tacatttgtg gtgattcaac tgaatgcagc 2220

aatcttttgt tgcaatatgg cagtttttgt acacaattaa accgtgcttt aactggaata 2280

gctgttgaac aagacaaaaa cacccaagaa gtttttgcac aagtcaaaca aatttacaaa 2340

acaccaccaa ttaaagattt tggtggtttt aatttttcac aaatattacc agatccatca 2400

aaaccaagca agaggtcatt tattgaagat ctacttttca acaaagtgac acttgcagat 2460

gctggcttca tcaaacaata tggtgattgc cttggtgata ttgctgctag agacctcatt 2520

tgtgcacaaa agtttaacgg ccttactgtt ttgccacctt tgctcacaga tgaaatgatt 2580

gctcaataca cttctgcact gttagcgggt acaatcactt ctggttggac ctttggtgca 2640

ggtgctgcat tacaaatacc atttgctatg caaatggctt ataggtttaa tggtattgga 2700

gttacacaga atgttctcta tgagaaccaa aaattgattg ccaaccaatt taatagtgct 2760

attggcaaaa ttcaagactc actttcttcc acagcaagtg cacttggaaa acttcaagat 2820

gtggtcaacc aaaatgcaca agctttaaac acgcttgtta aacaacttag ctccaatttt 2880

ggtgcaattt caagtgtttt aaatgatatc ctttcacgtc ttgacaaagt tgaggctgaa 2940

gtgcaaattg ataggttgat cacaggcaga cttcaaagtt tgcagacata tgtgactcaa 3000

caattaatta gagctgcaga aatcagagct tctgctaatc ttgctgctac taaaatgtca 3060

gagtgtgtac ttggacaatc aaaaagagtt gatttttgtg gaaagggcta tcatcttatg 3120

tccttccctc agtcagcacc tcatggtgta gtcttcttgc atgtgactta tgtccctgca 3180

caagaaaaga acttcacaac tgctcctgcc atttgtcatg atggaaaagc acactttcct 3240

cgtgaaggtg tctttgtttc aaatggcaca cactggtttg taacacaaag gaatttttat 3300

gaaccacaaa tcattactac agacaacaca tttgtgtctg gtaactgtga tgttgtaata 3360

ggaattgtca acaacacagt ttatgatcct ttgcaacctg aattagactc attcaaggag 3420

gagttagata aatattttaa gaatcataca tcaccagatg ttgatttagg tgacatctct 3480

ggcattaatg cttcagttgt aaacattcaa aaagaaattg accgcctcaa tgaggttgcc 3540

aagaatttaa atgaatctct catcgatctc caagaacttg gaaagtatga gcagtatata 3600

aaatggccat aa 3612

<210> 16

<211> 3615

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

atgagcagcc agtgcgtgaa cctgaccacc agaactcagc tgcctccagc ctacaccaac 60

agcttcacca gaggcgtgta ctaccccgac aaggtgttca gatccagcgt gctgcactct 120

acccaggacc tgttcctgcc tttcttcagc aacgtgacct ggttccacgc catccacgtg 180

tccggcacca atggcaccaa gagattcgac aaccccgtgc tgcccttcaa cgacggggtg 240

tactttgcca gcaccgagaa gtccaacatc atcagaggct ggatcttcgg caccacactg 300

gacagcaaga cccagagcct gctgatcgtg aacaacgcca ccaacgtggt catcaaagtg 360

tgcgagttcc agttctgcaa cgaccccttc ctgggcgtct actaccacaa gaacaacaag 420

agctggatgg aaagcgagtt ccgggtgtac agcagcgcca acaactgcac cttcgagtac 480

gtgtcccagc ctttcctgat ggacctggaa ggcaagcagg gcaacttcaa gaacctgcgc 540

gagttcgtgt tcaagaacat cgacggctac ttcaagatct acagcaagca cacccctatc 600

aacctcgtgc gggatctgcc tcagggcttc tctgctctgg aacccctggt ggatctgccc 660

atcggcatca acatcacccg gtttcagaca ctgctggccc tgcacagaag ctacctgaca 720

cctggcgata gcagctctgg atggacagct ggcgccgctg cctactatgt gggatacctg 780

cagcctcgga ccttcctgct gaagtacaac gagaacggca ccatcaccga cgccgtggat 840

tgtgctctgg atcctctgag cgagacaaag tgcaccctga agtccttcac cgtggaaaag 900

ggcatctacc agaccagcaa cttccgggtg cagcccaccg aatccatcgt gcggttcccc 960

aatatcacca atctgtgccc cttcggcgag gtgttcaatg ccaccagatt cgcctctgtg 1020

tacgcctgga accggaagcg gatcagcaat tgcgtggccg actactccgt gctgtacaac 1080

tccgccagct tcagcacctt caagtgctac ggcgtgtccc ctaccaagct gaacgacctg 1140

tgcttcacaa acgtgtacgc cgacagcttc gtgatccggg gagatgaagt gcggcagatt 1200

gcccctggac agacaggcaa gatcgccgac tacaactaca agctgcccga cgacttcacc 1260

ggctgtgtga ttgcctggaa cagcaacaac ctggactcca aagtcggcgg caactacaat 1320

tacctgtacc ggctgttccg gaagtccaat ctgaagccct tcgagcggga catctccacc 1380

gagatctatc aggccggcag caccccttgt aacggcgtgg aaggcttcaa ctgctacttc 1440

ccactgcagt cctacggctt tcagcccaca aatggcgtgg gctaccagcc ttacagagtg 1500

gtggtgctga gcttcgagct gctgcatgct cctgccacag tgtgcggccc taagaaaagc 1560

accaatctcg tgaagaacaa atgcgtgaac ttcaacttca acggcctgac cggcaccggc 1620

gtgctgacag agagcaacaa gaagttcctg ccattccagc agttcggccg ggatatcgcc 1680

gataccacag acgccgttag agatccccag acactggaaa tcctggacat caccccttgc 1740

agcttcggcg gagtgtctgt gatcacccct ggcaccaaca ccagcaatca ggtggcagtg 1800

ctgtaccagg acgtgaactg taccgaagtg cccgtggcca ttcacgccga tcagctgaca 1860

cctacatggc gggtgtactc caccggcagc aatgtgtttc agaccagagc cggctgtctg 1920

atcggagccg agcacgtgaa caatagctac gagtgcgaca tccccatcgg cgctggcatc 1980

tgtgccagct accagacaca gacaaacagc cccagacggg ccagatctgt ggccagccag 2040

agcatcattg cctacacaat gtctctgggc gccgagaaca gcgtggccta ctccaacaac 2100

tctatcgcta tccccaccaa cttcaccatc agcgtgacca cagagatcct gcctgtgtcc 2160

atgaccaaga ccagcgtgga ctgcaccatg tacatctgcg gcgattccac cgagtgctcc 2220

aacctgctgc tgcagtacgg cagcttctgc acccagctga atagagccct gacagggatc 2280

gccgtggaac aggacaagaa cacccaagag gtgttcgccc aagtgaagca gatctacaag 2340

acccctccta tcaaggactt cggcggcttc aatttcagcc agattctgcc cgatcctagc 2400

aagcccagca agcggagctt catcgaggac ctgctgttca acaaagtgac actggccgac 2460

gccggcttca tcaagcagta tggcgattgt ctgggcgaca ttgccgccag ggatctgatt 2520

tgcgcccaga agtttaacgg actgacagtg ctgcctcctc tgctgaccga tgagatgatc 2580

gcccagtaca catctgccct gctggccggc acaatcacaa gcggctggac atttggagct 2640

ggcgctgccc tgcagatccc ctttgctatg cagatggcct accggttcaa cggcatcgga 2700

gtgacccaga atgtgctgta cgagaaccag aagctgatcg ccaaccagtt caacagcgcc 2760

atcggcaaga tccaggacag cctgagcagc acagcaagcg ccctgggaaa gctgcaggac 2820

gtggtcaacc agaatgccca ggcactgaac accctggtca agcagctgtc tagcaacttc 2880

ggcgccatca gctctgtgct gaacgatatc ctgagcagac tggacaaggt ggaagccgag 2940

gtgcagatcg acagactgat caccggaagg ctgcagtccc tgcagaccta cgttacccag 3000

cagctgatca gagccgccga gattagagcc tctgccaatc tggccgccac caagatgtct 3060

gagtgtgtgc tgggccagag caagagagtg gacttttgcg gcaagggcta ccacctgatg 3120

agcttccctc agtctgcccc tcacggcgtg gtgtttctgc acgtgacata cgtgcccgct 3180

caagagaaga atttcaccac cgctccagcc atctgccacg acggcaaagc ccactttcct 3240

agagaaggcg tgttcgtcag caacggcacc cattggttcg tgacccagcg gaacttctac 3300

gagccccaga tcatcaccac cgacaacacc ttcgtgtctg gcaactgcga cgtcgtgatc 3360

ggcattgtga acaataccgt gtacgaccct ctgcagcccg agctggacag cttcaaagag 3420

gaactggata agtactttaa gaaccacaca agccccgacg tggacctggg cgatatcagc 3480

ggaatcaatg ccagcgtcgt gaacatccag aaagagatcg accggctgaa cgaggtggcc 3540

aagaatctga acgagagcct gatcgacctg caagaactgg ggaagtacga gcagtacatc 3600

aagtggccct aatag 3615

<210> 17

<211> 2028

<212> DNA

<213> coronavirus (coronavirus)

<400> 17

atgtctagtc agtgtgttaa tcttacaacc agaactcaat taccccctgc atacactaat 60

tctttcacac gtggtgttta ttaccctgac aaagttttca gatcctcagt tttacattca 120

actcaggact tgttcttacc tttcttttcc aatgttactt ggttccatgc tatacatgtc 180

tctgggacca atggtactaa gaggtttgat aaccctgtcc taccatttaa tgatggtgtt 240

tattttgctt ccactgagaa gtctaacata ataagaggct ggatttttgg tactacttta 300

gattcgaaga cccagtccct acttattgtt aataacgcta ctaatgttgt tattaaagtc 360

tgtgaatttc aattttgtaa tgatccattt ttgggtgttt attaccacaa aaacaacaaa 420

agttggatgg aaagtgagtt cagagtttat tctagtgcga ataattgcac ttttgaatat 480

gtctctcagc cttttcttat ggaccttgaa ggaaaacagg gtaatttcaa aaatcttagg 540

gaatttgtgt ttaagaatat tgatggttat tttaaaatat attctaagca cacgcctatt 600

aatttagtgc gtgatctccc tcagggtttt tcggctttag aaccattggt agatttgcca 660

ataggtatta acatcactag gtttcaaact ttacttgctt tacatagaag ttatttgact 720

cctggtgatt cttcttcagg ttggacagct ggtgctgcag cttattatgt gggttatctt 780

caacctagga cttttctatt aaaatataat gaaaatggaa ccattacaga tgctgtagac 840

tgtgcacttg accctctctc agaaacaaag tgtacgttga aatccttcac tgtagaaaaa 900

ggaatctatc aaacttctaa ctttagagtc caaccaacag aatctattgt tagatttcct 960

aatattacaa acttgtgccc ttttggtgaa gtttttaacg ccaccagatt tgcatctgtt 1020

tatgcttgga acaggaagag aatcagcaac tgtgttgctg attattctgt cctatataat 1080

tccgcatcat tttccacttt taagtgttat ggagtgtctc ctactaaatt aaatgatctc 1140

tgctttacta atgtctatgc agattcattt gtaattagag gtgatgaagt cagacaaatc 1200

gctccagggc aaactggaaa gattgctgat tataattata aattaccaga tgattttaca 1260

ggctgcgtta tagcttggaa ttctaacaat cttgattcta aggttggtgg taattataat 1320

tacctgtata gattgtttag gaagtctaat ctcaaacctt ttgagagaga tatttcaact 1380

gaaatctatc aggccggtag cacaccttgt aatggtgttg aaggttttaa ttgttacttt 1440

cctttacaat catatggttt ccaacccact aatggtgttg gttaccaacc atacagagta 1500

gtagtacttt cttttgaact tctacatgca ccagcaactg tttgtggacc taaaaagtct 1560

actaatttgg ttaaaaacaa atgtgtcaat ttcaacttca atggtttaac aggcacaggt 1620

gttcttactg agtctaacaa aaagtttctg cctttccaac aatttggcag agacattgct 1680

gacactactg atgctgtccg tgatccacag acacttgaga ttcttgacat tacaccatgt 1740

tcttttggtg gtgtcagtgt tataacacca ggaacaaata cttctaacca ggttgctgtt 1800

ctttatcagg atgttaactg cacagaagtc cctgttgcta ttcatgcaga tcaacttact 1860

cctacttggc gtgtttattc tacaggttct aatgtttttc aaacacgtgc aggctgttta 1920

ataggggctg aacatgtcaa caactcatat gagtgtgaca tacccattgg tgcaggtata 1980

tgcgctagtt atcagactca gactaattct cctcggcggg cacgttaa 2028

<210> 18

<211> 2031

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

atgagcagcc agtgcgtgaa cctgaccacc agaactcagc tgcctccagc ctacaccaac 60

agcttcacca gaggcgtgta ctaccccgac aaggtgttca gatccagcgt gctgcactct 120

acccaggacc tgttcctgcc tttcttcagc aacgtgacct ggttccacgc catccacgtg 180

tccggcacca atggcaccaa gagattcgac aaccccgtgc tgcccttcaa cgacggggtg 240

tactttgcca gcaccgagaa gtccaacatc atcagaggct ggatcttcgg caccacactg 300

gacagcaaga cccagagcct gctgatcgtg aacaacgcca ccaacgtggt catcaaagtg 360

tgcgagttcc agttctgcaa cgaccccttc ctgggcgtct actaccacaa gaacaacaag 420

agctggatgg aaagcgagtt ccgggtgtac agcagcgcca acaactgcac cttcgagtac 480

gtgtcccagc ctttcctgat ggacctggaa ggcaagcagg gcaacttcaa gaacctgcgc 540

gagttcgtgt tcaagaacat cgacggctac ttcaagatct acagcaagca cacccctatc 600

aacctcgtgc gggatctgcc tcagggcttc tctgctctgg aacccctggt ggatctgccc 660

atcggcatca acatcacccg gtttcagaca ctgctggccc tgcacagaag ctacctgaca 720

cctggcgata gcagctctgg atggacagct ggcgccgctg cctactatgt gggatacctg 780

cagcctcgga ccttcctgct gaagtacaac gagaacggca ccatcaccga cgccgtggat 840

tgtgctctgg atcctctgag cgagacaaag tgcaccctga agtccttcac cgtggaaaag 900

ggcatctacc agaccagcaa cttccgggtg cagcccaccg aatccatcgt gcggttcccc 960

aatatcacca atctgtgccc cttcggcgag gtgttcaatg ccaccagatt cgcctctgtg 1020

tacgcctgga accggaagcg gatcagcaat tgcgtggccg actactccgt gctgtacaac 1080

tccgccagct tcagcacctt caagtgctac ggcgtgtccc ctaccaagct gaacgacctg 1140

tgcttcacaa acgtgtacgc cgacagcttc gtgatccggg gagatgaagt gcggcagatt 1200

gcccctggac agacaggcaa gatcgccgac tacaactaca agctgcccga cgacttcacc 1260

ggctgtgtga ttgcctggaa cagcaacaac ctggactcca aagtcggcgg caactacaat 1320

tacctgtacc ggctgttccg gaagtccaat ctgaagccct tcgagcggga catctccacc 1380

gagatctatc aggccggcag caccccttgt aacggcgtgg aaggcttcaa ctgctacttc 1440

ccactgcagt cctacggctt tcagcccaca aatggcgtgg gctaccagcc ttacagagtg 1500

gtggtgctga gcttcgagct gctgcatgct cctgccacag tgtgcggccc taagaaaagc 1560

accaatctcg tgaagaacaa atgcgtgaac ttcaacttca acggcctgac cggcaccggc 1620

gtgctgacag agagcaacaa gaagttcctg ccattccagc agttcggccg ggatatcgcc 1680

gataccacag acgccgttag agatccccag acactggaaa tcctggacat caccccttgc 1740

agcttcggcg gagtgtctgt gatcacccct ggcaccaaca ccagcaatca ggtggcagtg 1800

ctgtaccagg acgtgaactg taccgaagtg cccgtggcca ttcacgccga tcagctgaca 1860

cctacatggc gggtgtactc caccggcagc aatgtgtttc agaccagagc cggctgtctg 1920

atcggagccg agcacgtgaa caatagctac gagtgcgaca tccccatcgg cgctggcatc 1980

tgtgccagct accagacaca gacaaacagc cccagacggg ccagataata g 2031

<210> 19

<211> 3822

<212> RNA

<213> coronavirus (coronavirus)

<400> 19

auguuuguuu uucuuguuuu auugccacua gucucuaguc aguguguuaa ucuuacaacc 60

agaacucaau uacccccugc auacacuaau ucuuucacac gugguguuua uuacccugac 120

aaaguuuuca gauccucagu uuuacauuca acucaggacu uguucuuacc uuucuuuucc 180

aauguuacuu gguuccaugc uauacauguc ucugggacca augguacuaa gagguuugau 240

aacccugucc uaccauuuaa ugaugguguu uauuuugcuu ccacugagaa gucuaacaua 300

auaagaggcu ggauuuuugg uacuacuuua gauucgaaga cccagucccu acuuauuguu 360

aauaacgcua cuaauguugu uauuaaaguc ugugaauuuc aauuuuguaa ugauccauuu 420

uuggguguuu auuaccacaa aaacaacaaa aguuggaugg aaagugaguu cagaguuuau 480

ucuagugcga auaauugcac uuuugaauau gucucucagc cuuuucuuau ggaccuugaa 540

ggaaaacagg guaauuucaa aaaucuuagg gaauuugugu uuaagaauau ugaugguuau 600

uuuaaaauau auucuaagca cacgccuauu aauuuagugc gugaucuccc ucaggguuuu 660

ucggcuuuag aaccauuggu agauuugcca auagguauua acaucacuag guuucaaacu 720

uuacuugcuu uacauagaag uuauuugacu ccuggugauu cuucuucagg uuggacagcu 780

ggugcugcag cuuauuaugu ggguuaucuu caaccuagga cuuuucuauu aaaauauaau 840

gaaaauggaa ccauuacaga ugcuguagac ugugcacuug acccucucuc agaaacaaag 900

uguacguuga aauccuucac uguagaaaaa ggaaucuauc aaacuucuaa cuuuagaguc 960

caaccaacag aaucuauugu uagauuuccu aauauuacaa acuugugccc uuuuggugaa 1020

guuuuuaacg ccaccagauu ugcaucuguu uaugcuugga acaggaagag aaucagcaac 1080

uguguugcug auuauucugu ccuauauaau uccgcaucau uuuccacuuu uaaguguuau 1140

ggagugucuc cuacuaaauu aaaugaucuc ugcuuuacua augucuaugc agauucauuu 1200

guaauuagag gugaugaagu cagacaaauc gcuccagggc aaacuggaaa gauugcugau 1260

uauaauuaua aauuaccaga ugauuuuaca ggcugcguua uagcuuggaa uucuaacaau 1320

cuugauucua agguuggugg uaauuauaau uaccuguaua gauuguuuag gaagucuaau 1380

cucaaaccuu uugagagaga uauuucaacu gaaaucuauc aggccgguag cacaccuugu 1440

aaugguguug aagguuuuaa uuguuacuuu ccuuuacaau cauaugguuu ccaacccacu 1500

aaugguguug guuaccaacc auacagagua guaguacuuu cuuuugaacu ucuacaugca 1560

ccagcaacug uuuguggacc uaaaaagucu acuaauuugg uuaaaaacaa augugucaau 1620

uucaacuuca augguuuaac aggcacaggu guucuuacug agucuaacaa aaaguuucug 1680

ccuuuccaac aauuuggcag agacauugcu gacacuacug augcuguccg ugauccacag 1740

acacuugaga uucuugacau uacaccaugu ucuuuuggug gugucagugu uauaacacca 1800

ggaacaaaua cuucuaacca gguugcuguu cuuuaucagg auguuaacug cacagaaguc 1860

ccuguugcua uucaugcaga ucaacuuacu ccuacuuggc guguuuauuc uacagguucu 1920

aauguuuuuc aaacacgugc aggcuguuua auaggggcug aacaugucaa caacucauau 1980

gagugugaca uacccauugg ugcagguaua ugcgcuaguu aucagacuca gacuaauucu 2040

ccucggcggg cacguagugu agcuagucaa uccaucauug ccuacacuau gucacuuggu 2100

gcagaaaauu caguugcuua cucuaauaac ucuauugcca uacccacaaa uuuuacuauu 2160

aguguuacca cagaaauucu accagugucu augaccaaga caucaguaga uuguacaaug 2220

uacauuugug gugauucaac ugaaugcagc aaucuuuugu ugcaauaugg caguuuuugu 2280

acacaauuaa accgugcuuu aacuggaaua gcuguugaac aagacaaaaa cacccaagaa 2340

guuuuugcac aagucaaaca aauuuacaaa acaccaccaa uuaaagauuu uggugguuuu 2400

aauuuuucac aaauauuacc agauccauca aaaccaagca agaggucauu uauugaagau 2460

cuacuuuuca acaaagugac acuugcagau gcuggcuuca ucaaacaaua uggugauugc 2520

cuuggugaua uugcugcuag agaccucauu ugugcacaaa aguuuaacgg ccuuacuguu 2580

uugccaccuu ugcucacaga ugaaaugauu gcucaauaca cuucugcacu guuagcgggu 2640

acaaucacuu cugguuggac cuuuggugca ggugcugcau uacaaauacc auuugcuaug 2700

caaauggcuu auagguuuaa ugguauugga guuacacaga auguucucua ugagaaccaa 2760

aaauugauug ccaaccaauu uaauagugcu auuggcaaaa uucaagacuc acuuucuucc 2820

acagcaagug cacuuggaaa acuucaagau guggucaacc aaaaugcaca agcuuuaaac 2880

acgcuuguua aacaacuuag cuccaauuuu ggugcaauuu caaguguuuu aaaugauauc 2940

cuuucacguc uugacaaagu ugaggcugaa gugcaaauug auagguugau cacaggcaga 3000

cuucaaaguu ugcagacaua ugugacucaa caauuaauua gagcugcaga aaucagagcu 3060

ucugcuaauc uugcugcuac uaaaauguca gaguguguac uuggacaauc aaaaagaguu 3120

gauuuuugug gaaagggcua ucaucuuaug uccuucccuc agucagcacc ucauggugua 3180

gucuucuugc augugacuua ugucccugca caagaaaaga acuucacaac ugcuccugcc 3240

auuugucaug auggaaaagc acacuuuccu cgugaaggug ucuuuguuuc aaauggcaca 3300

cacugguuug uaacacaaag gaauuuuuau gaaccacaaa ucauuacuac agacaacaca 3360

uuugugucug guaacuguga uguuguaaua ggaauuguca acaacacagu uuaugauccu 3420

uugcaaccug aauuagacuc auucaaggag gaguuagaua aauauuuuaa gaaucauaca 3480

ucaccagaug uugauuuagg ugacaucucu ggcauuaaug cuucaguugu aaacauucaa 3540

aaagaaauug accgccucaa ugagguugcc aagaauuuaa augaaucucu caucgaucuc 3600

caagaacuug gaaaguauga gcaguauaua aaauggccau gguacauuug gcuagguuuu 3660

auagcuggcu ugauugccau aguaauggug acaauuaugc uuugcuguau gaccaguugc 3720

uguaguuguc ucaagggcug uuguucuugu ggauccugcu gcaaauuuga ugaagacgac 3780

ucugagccag ugcucaaagg agucaaauua cauuacacau aa 3822

<210> 20

<211> 3825

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

auguucgucu uccuggugcu gcugccucug gugucuuccc agugcgugaa ucugacuacc 60

aggacccagc ugcccccugc cuauaccaau uccuucacac ggggcgugua cuaucccgac 120

aagguguuua gaagcuccgu gcugcacucu acacaggauc uguuucugcc uuucuuuagc 180

aacgugaccu gguuccacgc cauccacgug agcggcacca auggcacaaa gcgguucgac 240

aauccagugc ugcccuuuaa cgauggcgug uacuucgccu cuaccgagaa gagcaacauc 300

aucagaggcu ggaucuuugg caccacacug gacuccaaga cacagucucu gcugaucgug 360

aacaaugcca ccaacguggu caucaaggug ugcgaguucc aguuuuguaa ugauccauuc 420

cugggcgugu acuaucacaa gaacaauaag agcuggaugg aguccgaguu ucgcguguau 480

ucuagcgcca acaauugcac auuugaguac gugucccagc ccuuccugau ggaccuggag 540

ggcaagcagg gcaauuucaa gaaccugagg gaguucgugu uuaagaauau cgauggcuac 600

uucaagaucu acucuaagca caccccaauc aaccuggugc gcgaccugcc acagggcuuc 660

agcgcccugg agccacuggu ggaucugccc aucggcauca acaucacccg guuucagaca 720

cugcuggccc ugcacagaag cuaccugaca ccaggcgacu ccucuagcgg auggaccgca 780

ggagcagcag ccuacuaugu gggcuaucug cagcccagga ccuuccugcu gaaguacaac 840

gagaauggca ccaucacaga cgccguggau ugcgcccugg auccccugag cgagacaaag 900

uguacacuga aguccuuuac cguggagaag ggcaucuauc agacauccaa uuucagggug 960

cagccuaccg agucuaucgu gcgcuuuccc aauaucacaa accugugccc uuuuggcgag 1020

guguucaacg caaccagguu cgcaagcgug uacgcaugga auaggaagcg caucucuaac 1080

ugcguggccg acuauagcgu gcuguacaac uccgccucuu ucagcaccuu uaagugcuau 1140

ggcguguccc ccacaaagcu gaaugaccug ugcuuuacca acguguacgc cgauucuuuc 1200

gugaucaggg gcgacgaggu gcgccagauc gcaccaggac agacaggcaa gaucgcagac 1260

uacaauuaua agcugccuga cgauuucacc ggcugcguga ucgccuggaa cagcaacaau 1320

cuggauucca aagugggcgg caacuacaau uaucuguacc ggcuguuuag aaagagcaau 1380

cugaagccau ucgagaggga caucucuaca gagaucuacc aggcaggaag caccccaugc 1440

aauggagugg agggcuuuaa cuguuauuuc ccucugcagu ccuacggcuu ccagccaacc 1500

aacggcgugg gcuaucagcc cuaccgcgug guggugcuga gcuuugagcu gcugcacgca 1560

ccugcaacag ugugcggacc aaagaagucc accaaucugg ugaagaacaa gugcgugaac 1620

uucaacuuca acggccugac cggaacaggc gugcugaccg aguccaacaa gaaguuccug 1680

ccuuuucagc aguucggcag ggacaucgca gauaccacag acgccgugcg cgacccucag 1740

acccuggaga uccuggauau cacaccaugc ucuuucggcg gcgugagcgu gaucacacca 1800

ggcaccaaua caagcaacca gguggccgug cuguaucagg acgugaauug uaccgaggug 1860

ccaguggcaa uccacgcaga ucagcugacc ccuacauggc ggguguacag caccggcucc 1920

aacguguucc agacaagagc aggaugucug aucggagcag agcacgugaa caauuccuau 1980

gagugcgaca ucccuaucgg cgccggcauc ugugccucuu accagaccca gacaaacucu 2040

ccaaggagag cacggagcgu ggcaucccag ucuaucaucg ccuauaccau gucccugggc 2100

gccgagaauu cuguggccua cucuaacaau agcaucgcca ucccuaccaa cuucacaauc 2160

ucugugacca cagagauccu gccagugucc augaccaaga caucugugga cugcacaaug 2220

uauaucugug gcgauucuac cgagugcagc aaccugcugc ugcaguacgg cagcuuuugu 2280

acccagcuga auagagcccu gacaggcauc gccguggagc aggauaagaa cacacaggag 2340

guguucgccc aggugaagca gaucuacaag accccaccca ucaaggacuu uggcggcuuc 2400

aauuuuuccc agauccugcc cgauccuucc aagcccucua agcggagcuu uaucgaggac 2460

cugcuguuca acaaggugac ccuggccgau gccggcuuca ucaagcagua uggcgauugc 2520

cugggcgaca ucgcagcacg ggaccugauc ugugcccaga aguuuaaugg ccugaccgug 2580

cugccuccac ugcugacaga ugagaugauc gcacaguaca caagcgcccu gcuggcagga 2640

accaucacau ccggauggac cuucggcgca ggagccgccc ugcagauccc cuuugccaug 2700

cagauggccu aucgguucaa cggcaucggc gugacccaga augugcugua cgagaaccag 2760

aagcugaucg ccaaucaguu uaacuccgcc aucggcaaga uccaggacag ccuguccucu 2820

acagccuccg cccugggcaa gcugcaggau guggugaauc agaacgccca ggcccugaau 2880

acccugguga agcagcugag cuccaacuuc ggcgccaucu cuagcgugcu gaaugauauc 2940

cugagccggc uggacaaggu ggaggcagag gugcagaucg accggcugau cacaggcaga 3000

cugcagucuc ugcagaccua ugugacacag cagcugauca gggcagcaga gaucagggca 3060

agcgccaauc uggcagcaac caagaugucc gagugcgugc ugggccaguc uaagagagug 3120

gacuuuugug gcaagggcua ucaccugaug uccuucccac agucugcccc ucacggagug 3180

guguuucugc acgugaccua cgugccagcc caggagaaga acuucaccac agcaccagca 3240

aucugccacg auggcaaggc acacuuuccu agggagggcg uguucguguc caacggcacc 3300

cacugguuug ugacacagcg caauuucuac gagccacaga ucaucaccac agacaauacc 3360

uucgugagcg gcaacuguga cguggucauc ggcaucguga acaauaccgu guaugauccu 3420

cugcagccag agcuggacag cuuuaaggag gagcuggaua aguacuucaa gaaucacacc 3480

ucccccgacg uggaucuggg cgacaucagc ggcaucaaug ccuccguggu gaacauccag 3540

aaggagaucg acaggcugaa cgagguggcc aagaaucuga acgagagccu gaucgaucug 3600

caggagcugg gcaaguauga gcaguacauc aaguggccuu gguacaucug gcugggcuuc 3660

aucgccggcc ugaucgccau cgugauggug accaucaugc ugugcuguau gacauccugc 3720

uguucuugcc ugaagggcug cuguagcugc ggcuccuguu guaaauucga ugaggaugau 3780

uccgagccug ugcugaaggg cgugaaacug cauuauaccu aauag 3825

<210> 21

<211> 768

<212> RNA

<213> coronavirus (coronavirus)

<400> 21

augccuaaua uuacaaacuu gugcccuuuu ggugaaguuu uuaacgccac cagauuugca 60

ucuguuuaug cuuggaacag gaagagaauc agcaacugug uugcugauua uucuguccua 120

uauaauuccg caucauuuuc cacuuuuaag uguuauggag ugucuccuac uaaauuaaau 180

gaucucugcu uuacuaaugu cuaugcagau ucauuuguaa uuagagguga ugaagucaga 240

caaaucgcuc cagggcaaac uggaaagauu gcugauuaua auuauaaauu accagaugau 300

uuuacaggcu gcguuauagc uuggaauucu aacaaucuug auucuaaggu uggugguaau 360

uauaauuacc uguauagauu guuuaggaag ucuaaucuca aaccuuuuga gagagauauu 420

ucaacugaaa ucuaucaggc cgguagcaca ccuuguaaug guguugaagg uuuuaauugu 480

uacuuuccuu uacaaucaua ugguuuccaa cccacuaaug guguugguua ccaaccauac 540

agaguaguag uacuuucuuu ugaacuucua caugcaccag caacuguuug uggaccuaaa 600

aagucuacua auuugguuaa aaacaaaugu gucaauuuca acuucaaugg uuuaacaggc 660

acagguguuc uuacugaguc uaacaaaaag uuucugccuu uccaacaauu uggcagagac 720

auugcugaca cuacugaugc uguccgugau ccacagacac uugaguaa 768

<210> 22

<211> 771

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

augccuaaua uuacaaacuu gugcccuuuu ggugaaguuu uuaacgccac cagauuugca 60

ucuguuuaug cuuggaacag gaagagaauc agcaacugug uugcugauua uucuguccua 120

uauaauuccg caucauuuuc cacuuuuaag uguuauggag ugucuccuac uaaauuaaau 180

gaucucugcu uuacuaaugu cuaugcagau ucauuuguaa uuagagguga ugaagucaga 240

caaaucgcuc cagggcaaac uggaaagauu gcugauuaua auuauaaauu accagaugau 300

uuuacaggcu gcguuauagc uuggaauucu aacaaucuug auucuaaggu uggugguaau 360

uauaauuacc uguauagauu guuuaggaag ucuaaucuca aaccuuuuga gagagauauu 420

ucaacugaaa ucuaucaggc cgguagcaca ccuuguaaug guguugaagg uuuuaauugu 480

uacuuuccuu uacaaucaua ugguuuccaa cccacuaaug guguugguua ccaaccauac 540

agaguaguag uacuuucuuu ugaacuucua caugcaccag caacuguuug uggaccuaaa 600

aagucuacua auuugguuaa aaacaaaugu gucaauuuca acuucaaugg uuuaacaggc 660

acagguguuc uuacugaguc uaacaaaaag uuucugccuu uccaacaauu uggcagagac 720

auugcugaca cuacugaugc uguccgugau ccacagacac uugaguaaua g 771

<210> 23

<211> 669

<212> RNA

<213> coronavirus (coronavirus)

<400> 23

auggcagauu ccaacgguac uauuaccguu gaagagcuua aaaagcuccu ugaacaaugg 60

aaccuaguaa uagguuuccu auuccuuaca uggauuuguc uucuacaauu ugccuaugcc 120

aacaggaaua gguuuuugua uauaauuaag uuaauuuucc ucuggcuguu auggccagua 180

acuuuagcuu guuuugugcu ugcugcuguu uacagaauaa auuggaucac cgguggaauu 240

gcuaucgcaa uggcuugucu uguaggcuug auguggcuca gcuacuucau ugcuucuuuc 300

agacuguuug cgcguacgcg uuccaugugg ucauucaauc cagaaacuaa cauucuucuc 360

aacgugccac uccauggcac uauucugacc agaccgcuuc uagaaaguga acucguaauc 420

ggagcuguga uccuucgugg acaucuucgu auugcuggac accaucuagg acgcugugac 480

aucaaggacc ugccuaaaga aaucacuguu gcuacaucac gaacgcuuuc uuauuacaaa 540

uugggagcuu cgcagcgugu agcaggugac ucagguuuug cugcauacag ucgcuacagg 600

auuggcaacu auaaauuaaa cacagaccau uccaguagca gugacaauau ugcuuugcuu 660

guacaguaa 669

<210> 24

<211> 672

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

auggccgaua gcaacggcac caucaccgug gaagaacuga agaaacugcu ggaacagugg 60

aaccucguga ucggcuuccu guuccugacc uggaucugcc ugcugcaguu cgccuacgcc 120

aaccggaaca gauuccugua uauuaucaag cugaucuucc uguggcugcu guggcccgug 180

acacuggccu guuuugugcu ggccgccgug uaccggauca acuggaucac aggcggaauc 240

gccauugcca uggccugucu cguuggccug auguggcuga gcuacuuuau cgccagcuuc 300

cggcuguucg cccggaccag auccaugugg uccuucaauc ccgagacaaa cauccugcug 360

aacgugcccc ugcacggcac aauccugaca agaccucugc uggaaagcga gcugguuauc 420

ggcgccguga uccugagagg ccaccugaga auugccggac accaccuggg cagaugcgac 480

aucaaggacc ugccuaaaga aaucacagug gccaccagca gaacccuguc cuacuauaag 540

cugggcgcca gccagagagu ggccggcgau ucuggauuug ccgccuacag cagauaccgg 600

aucggcaacu acaagcugaa caccgaccac agcuccagca gcgacaauau cgcacugcug 660

gugcaguaau ag 672

<210> 25

<211> 1260

<212> RNA

<213> Coronavirus (coronavirus)

<400> 25

augucugaua auggacccca aaaucagcga aaugcacccc gcauuacguu ugguggaccc 60

ucagauucaa cuggcaguaa ccagaaugga gaacgcagug gggcgcgauc aaaacaacgu 120

cggccccaag guuuacccaa uaauacugcg ucuugguuca ccgcucucac ucaacauggc 180

aaggaagacc uuaaauuccc ucgaggacaa ggcguuccaa uuaacaccaa uagcagucca 240

gaugaccaaa uuggcuacua ccgaagagcu accagacgaa uucguggugg ugacgguaaa 300

augaaagauc ucaguccaag augguauuuc uacuaccuag gaacugggcc agaagcugga 360

cuucccuaug gugcuaacaa agacggcauc auauggguug caacugaggg agccuugaau 420

acaccaaaag aucacauugg cacccgcaau ccugcuaaca augcugcaau cgugcuacaa 480

cuuccucaag gaacaacauu gccaaaaggc uucuacgcag aagggagcag aggcggcagu 540

caagccucuu cucguuccuc aucacguagu cgcaacaguu caagaaauuc aacuccaggc 600

agcaguaggg gaacuucucc ugcuagaaug gcuggcaaug gcggugaugc ugcucuugcu 660

uugcugcugc uugacagauu gaaccagcuu gagagcaaaa ugucugguaa aggccaacaa 720

caacaaggcc aaacugucac uaagaaaucu gcugcugagg cuucuaagaa gccucggcaa 780

aaacguacug ccacuaaagc auacaaugua acacaagcuu ucggcagacg ugguccagaa 840

caaacccaag gaaauuuugg ggaccaggaa cuaaucagac aaggaacuga uuacaaacau 900

uggccgcaaa uugcacaauu ugcccccagc gcuucagcgu ucuucggaau gucgcgcauu 960

ggcauggaag ucacaccuuc gggaacgugg uugaccuaca caggugccau caaauuggau 1020

gacaaagauc caaauuucaa agaucaaguc auuuugcuga auaagcauau ugacgcauac 1080

aaaacauucc caccaacaga gccuaaaaag gacaaaaaga agaaggcuga ugaaacucaa 1140

gccuuaccgc agagacagaa gaaacagcaa acugugacuc uucuuccugc ugcagauuug 1200

gaugauuucu ccaaacaauu gcaacaaucc augagcagug cugacucaac ucaggccuaa 1260

<210> 26

<211> 1263

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

augucugaua auggacccca aaaucagcga aaugcacccc gcauuacguu ugguggaccc 60

ucagauucaa cuggcaguaa ccagaaugga gaacgcagug gggcgcgauc aaaacaacgu 120

cggccccaag guuuacccaa uaauacugcg ucuugguuca ccgcucucac ucaacauggc 180

aaggaagacc uuaaauuccc ucgaggacaa ggcguuccaa uuaacaccaa uagcagucca 240

gaugaccaaa uuggcuacua ccgaagagcu accagacgaa uucguggugg ugacgguaaa 300

augaaagauc ucaguccaag augguauuuc uacuaccuag gaacugggcc agaagcugga 360

cuucccuaug gugcuaacaa agacggcauc auauggguug caacugaggg agccuugaau 420

acaccaaaag aucacauugg cacccgcaau ccugcuaaca augcugcaau cgugcuacaa 480

cuuccucaag gaacaacauu gccaaaaggc uucuacgcag aagggagcag aggcggcagu 540

caagccucuu cucguuccuc aucacguagu cgcaacaguu caagaaauuc aacuccaggc 600

agcaguaggg gaacuucucc ugcuagaaug gcuggcaaug gcggugaugc ugcucuugcu 660

uugcugcugc uugacagauu gaaccagcuu gagagcaaaa ugucugguaa aggccaacaa 720

caacaaggcc aaacugucac uaagaaaucu gcugcugagg cuucuaagaa gccucggcaa 780

aaacguacug ccacuaaagc auacaaugua acacaagcuu ucggcagacg ugguccagaa 840

caaacccaag gaaauuuugg ggaccaggaa cuaaucagac aaggaacuga uuacaaacau 900

uggccgcaaa uugcacaauu ugcccccagc gcuucagcgu ucuucggaau gucgcgcauu 960

ggcauggaag ucacaccuuc gggaacgugg uugaccuaca caggugccau caaauuggau 1020

gacaaagauc caaauuucaa agaucaaguc auuuugcuga auaagcauau ugacgcauac 1080

aaaacauucc caccaacaga gccuaaaaag gacaaaaaga agaaggcuga ugaaacucaa 1140

gccuuaccgc agagacagaa gaaacagcaa acugugacuc uucuuccugc ugcagauuug 1200

gaugauuucu ccaaacaauu gcaacaaucc augagcagug cugacucaac ucaggccuaa 1260

uag 1263

<210> 27

<211> 600

<212> RNA

<213> coronavirus (coronavirus)

<400> 27

augauuacaa acuugugccc uuuuggugaa guuuuuaacg ccaccagauu ugcaucuguu 60

uaugcuugga acaggaagag aaucagcaac uguguugcug auuauucugu ccuauauaau 120

uccgcaucau uuuccacuuu uaaguguuau ggagugucuc cuacuaaauu aaaugaucuc 180

ugcuuuacua augucuaugc agauucauuu guaauuagag gugaugaagu cagacaaauc 240

gcuccagggc aaacuggaaa gauugcugau uauaauuaua aauuaccaga ugauuuuaca 300

ggcugcguua uagcuuggaa uucuaacaau cuugauucua agguuggugg uaauuauaau 360

uaccuguaua gauuguuuag gaagucuaau cucaaaccuu uugagagaga uauuucaacu 420

gaaaucuauc aggccgguag cacaccuugu aaugguguug aagguuuuaa uuguuacuuu 480

ccuuuacaau cauaugguuu ccaacccacu aaugguguug guuaccaacc auacagagua 540

guaguacuuu cuuuugaacu ucuacaugca ccagcaacug uuuguggacc uaaaaaguaa 600

<210> 28

<211> 603

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

augaucacca aucugugccc cuucggcgag guguucaacg ccacaagauu cgccucugug 60

uacgccugga accggaagcg gaucagcaau ugcguggccg acuacagcgu gcuguacaac 120

agcgccagcu ucagcaccuu caagugcuac ggcguguccc cuaccaagcu gaacgaccug 180

ugcuucacca acguguacgc cgacagcuuc gugaucagag gcgacgaagu gcggcagauu 240

gccccuggac agacaggcaa gaucgccgau uacaacuaca agcugcccga cgacuucacc 300

ggcuguguga uugccuggaa cagcaacaac cuggacagca aagucggcgg caacuacaac 360

uaccuguacc ggcuguuccg gaaguccaac cugaagccuu ucgagcggga caucagcacc 420

gagaucuauc aggccggcag caccccuugc aauggcgugg aaggcuucaa cugcuacuuc 480

ccacugcagu ccuacggcuu ccagccuaca aacggcgugg gcuaccagcc uuacagagug 540

guggugcuga gcuucgagcu gcugcaugcu ccugccacag ugugcggacc uaagaaguaa 600

uag 603

<210> 29

<211> 600

<212> RNA

<213> coronavirus (coronavirus)

<400> 29

augauuacaa acuugugccc uuuuggugaa guuuuuaacg ccaccagauu ugcaucuguu 60

uaugcuugga acaggaagag aaucagcaac uguguugcug auuauucugu ccuauauaau 120

uccgcaucau uuuccacuuu uaaguguuau ggagugucuc cuacuaaauu aaaugaucuc 180

ugcuuuacua augucuaugc agauucauuu guaauuagag gugaugaagu cagacaaauc 240

gcuccagggc aaacuggaaa gauugcugau uauaauuaua aauuaccaga ugauuuuaca 300

ggcugcguua uagcuuggaa uucuaacaau cuugauucua agguuggugg uaauuauaau 360

uaccuguaua gauuguuuag gaagucuaau cucaaaccuu uugagagaga uauuucaacu 420

gaaaucuauc aggccgguag cacaccuugu aaugguguug aagguuuuaa uuguuacuuu 480

ccuuuacaau cauaugguuu ccaacccacu aaugguguug guuaccaacc auacagagua 540

guaguacuuu cuuuugaacu ucuacaugca ccagcaacug uuuguggacc uaaaaaguaa 600

<210> 30

<211> 603

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

augaucacca aucugugccc cuucggcgag guguucaacg ccacaagauu cgccucugug 60

uacgccugga accggaagcg gaucagcaau ugcguggccg acuacagcgu gcuguacaac 120

agcgccagcu ucagcaccuu caagugcuac ggcguguccc cuaccaagcu gaacgaccug 180

ugcuucacca acguguacgc cgacagcuuc gugaucagag gcgacgaagu gcggcagauu 240

gccccuggac agacaggcaa gaucgccgau uacaacuaca agcugcccga cgacuucacc 300

ggcuguguga uugccuggaa cagcaacaac cuggacagca aagucggcgg caacuacaac 360

uaccuguacc ggcuguuccg gaaguccaac cugaagccuu ucgagcggga caucagcacc 420

gagaucuauc aggccggcag caccccuugc aauggcgugg aaggcuucaa cugcuacuuc 480

ccacugcagu ccuacggcuu ccagccuaca aacggcgugg gcuaccagcc uuacagagug 540

guggugcuga gcuucgaacu gcugcacgcc aaugccacag ugugcggccc uaagaaauaa 600

uag 603

<210> 31

<211> 228

<212> RNA

<213> coronavirus (coronavirus)

<400> 31

auguacucau ucguuucgga agagacaggu acguuaauag uuaauagcgu acuucuuuuu 60

cuugcuuucg ugguauucuu gcuaguuaca cuagccaucc uuacugcgcu ucgauugugu 120

gcguacugcu gcaauauugu uaacgugagu cuuguaaaac cuucuuuuua cguuuacucu 180

cguguuaaaa aucugaauuc uucuagaguu ccugaucuuc uggucuaa 228

<210> 32

<211> 231

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

auguacagcu ucguguccga ggaaaccggc acacugaucg ugaacagcgu gcugcuguuc 60

cuggccuucg ugguguuucu gcuggucacc cuggccaucc ugacagcccu gagacugugc 120

gccuacugcu gcaacaucgu gaacgugucc cuggucaagc ccagcuucua cguguacagc 180

agagugaaga accugaacag cuccagagug cccgaccugc ugguguaaua g 231

<210> 33

<211> 3612

<212> RNA

<213> coronavirus (coronavirus)

<400> 33

augucuaguc aguguguuaa ucuuacaacc agaacucaau uacccccugc auacacuaau 60

ucuuucacac gugguguuua uuacccugac aaaguuuuca gauccucagu uuuacauuca 120

acucaggacu uguucuuacc uuucuuuucc aauguuacuu gguuccaugc uauacauguc 180

ucugggacca augguacuaa gagguuugau aacccugucc uaccauuuaa ugaugguguu 240

uauuuugcuu ccacugagaa gucuaacaua auaagaggcu ggauuuuugg uacuacuuua 300

gauucgaaga cccagucccu acuuauuguu aauaacgcua cuaauguugu uauuaaaguc 360

ugugaauuuc aauuuuguaa ugauccauuu uuggguguuu auuaccacaa aaacaacaaa 420

aguuggaugg aaagugaguu cagaguuuau ucuagugcga auaauugcac uuuugaauau 480

gucucucagc cuuuucuuau ggaccuugaa ggaaaacagg guaauuucaa aaaucuuagg 540

gaauuugugu uuaagaauau ugaugguuau uuuaaaauau auucuaagca cacgccuauu 600

aauuuagugc gugaucuccc ucaggguuuu ucggcuuuag aaccauuggu agauuugcca 660

auagguauua acaucacuag guuucaaacu uuacuugcuu uacauagaag uuauuugacu 720

ccuggugauu cuucuucagg uuggacagcu ggugcugcag cuuauuaugu ggguuaucuu 780

caaccuagga cuuuucuauu aaaauauaau gaaaauggaa ccauuacaga ugcuguagac 840

ugugcacuug acccucucuc agaaacaaag uguacguuga aauccuucac uguagaaaaa 900

ggaaucuauc aaacuucuaa cuuuagaguc caaccaacag aaucuauugu uagauuuccu 960

aauauuacaa acuugugccc uuuuggugaa guuuuuaacg ccaccagauu ugcaucuguu 1020

uaugcuugga acaggaagag aaucagcaac uguguugcug auuauucugu ccuauauaau 1080

uccgcaucau uuuccacuuu uaaguguuau ggagugucuc cuacuaaauu aaaugaucuc 1140

ugcuuuacua augucuaugc agauucauuu guaauuagag gugaugaagu cagacaaauc 1200

gcuccagggc aaacuggaaa gauugcugau uauaauuaua aauuaccaga ugauuuuaca 1260

ggcugcguua uagcuuggaa uucuaacaau cuugauucua agguuggugg uaauuauaau 1320

uaccuguaua gauuguuuag gaagucuaau cucaaaccuu uugagagaga uauuucaacu 1380

gaaaucuauc aggccgguag cacaccuugu aaugguguug aagguuuuaa uuguuacuuu 1440

ccuuuacaau cauaugguuu ccaacccacu aaugguguug guuaccaacc auacagagua 1500

guaguacuuu cuuuugaacu ucuacaugca ccagcaacug uuuguggacc uaaaaagucu 1560

acuaauuugg uuaaaaacaa augugucaau uucaacuuca augguuuaac aggcacaggu 1620

guucuuacug agucuaacaa aaaguuucug ccuuuccaac aauuuggcag agacauugcu 1680

gacacuacug augcuguccg ugauccacag acacuugaga uucuugacau uacaccaugu 1740

ucuuuuggug gugucagugu uauaacacca ggaacaaaua cuucuaacca gguugcuguu 1800

cuuuaucagg auguuaacug cacagaaguc ccuguugcua uucaugcaga ucaacuuacu 1860

ccuacuuggc guguuuauuc uacagguucu aauguuuuuc aaacacgugc aggcuguuua 1920

auaggggcug aacaugucaa caacucauau gagugugaca uacccauugg ugcagguaua 1980

ugcgcuaguu aucagacuca gacuaauucu ccucggcggg cacguagugu agcuagucaa 2040

uccaucauug ccuacacuau gucacuuggu gcagaaaauu caguugcuua cucuaauaac 2100

ucuauugcca uacccacaaa uuuuacuauu aguguuacca cagaaauucu accagugucu 2160

augaccaaga caucaguaga uuguacaaug uacauuugug gugauucaac ugaaugcagc 2220

aaucuuuugu ugcaauaugg caguuuuugu acacaauuaa accgugcuuu aacuggaaua 2280

gcuguugaac aagacaaaaa cacccaagaa guuuuugcac aagucaaaca aauuuacaaa 2340

acaccaccaa uuaaagauuu uggugguuuu aauuuuucac aaauauuacc agauccauca 2400

aaaccaagca agaggucauu uauugaagau cuacuuuuca acaaagugac acuugcagau 2460

gcuggcuuca ucaaacaaua uggugauugc cuuggugaua uugcugcuag agaccucauu 2520

ugugcacaaa aguuuaacgg ccuuacuguu uugccaccuu ugcucacaga ugaaaugauu 2580

gcucaauaca cuucugcacu guuagcgggu acaaucacuu cugguuggac cuuuggugca 2640

ggugcugcau uacaaauacc auuugcuaug caaauggcuu auagguuuaa ugguauugga 2700

guuacacaga auguucucua ugagaaccaa aaauugauug ccaaccaauu uaauagugcu 2760

auuggcaaaa uucaagacuc acuuucuucc acagcaagug cacuuggaaa acuucaagau 2820

guggucaacc aaaaugcaca agcuuuaaac acgcuuguua aacaacuuag cuccaauuuu 2880

ggugcaauuu caaguguuuu aaaugauauc cuuucacguc uugacaaagu ugaggcugaa 2940

gugcaaauug auagguugau cacaggcaga cuucaaaguu ugcagacaua ugugacucaa 3000

caauuaauua gagcugcaga aaucagagcu ucugcuaauc uugcugcuac uaaaauguca 3060

gaguguguac uuggacaauc aaaaagaguu gauuuuugug gaaagggcua ucaucuuaug 3120

uccuucccuc agucagcacc ucauggugua gucuucuugc augugacuua ugucccugca 3180

caagaaaaga acuucacaac ugcuccugcc auuugucaug auggaaaagc acacuuuccu 3240

cgugaaggug ucuuuguuuc aaauggcaca cacugguuug uaacacaaag gaauuuuuau 3300

gaaccacaaa ucauuacuac agacaacaca uuugugucug guaacuguga uguuguaaua 3360

ggaauuguca acaacacagu uuaugauccu uugcaaccug aauuagacuc auucaaggag 3420

gaguuagaua aauauuuuaa gaaucauaca ucaccagaug uugauuuagg ugacaucucu 3480

ggcauuaaug cuucaguugu aaacauucaa aaagaaauug accgccucaa ugagguugcc 3540

aagaauuuaa augaaucucu caucgaucuc caagaacuug gaaaguauga gcaguauaua 3600

aaauggccau aa 3612

<210> 34

<211> 3615

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

augagcagcc agugcgugaa ccugaccacc agaacucagc ugccuccagc cuacaccaac 60

agcuucacca gaggcgugua cuaccccgac aagguguuca gauccagcgu gcugcacucu 120

acccaggacc uguuccugcc uuucuucagc aacgugaccu gguuccacgc cauccacgug 180

uccggcacca auggcaccaa gagauucgac aaccccgugc ugcccuucaa cgacggggug 240

uacuuugcca gcaccgagaa guccaacauc aucagaggcu ggaucuucgg caccacacug 300

gacagcaaga cccagagccu gcugaucgug aacaacgcca ccaacguggu caucaaagug 360

ugcgaguucc aguucugcaa cgaccccuuc cugggcgucu acuaccacaa gaacaacaag 420

agcuggaugg aaagcgaguu ccggguguac agcagcgcca acaacugcac cuucgaguac 480

gugucccagc cuuuccugau ggaccuggaa ggcaagcagg gcaacuucaa gaaccugcgc 540

gaguucgugu ucaagaacau cgacggcuac uucaagaucu acagcaagca caccccuauc 600

aaccucgugc gggaucugcc ucagggcuuc ucugcucugg aaccccuggu ggaucugccc 660

aucggcauca acaucacccg guuucagaca cugcuggccc ugcacagaag cuaccugaca 720

ccuggcgaua gcagcucugg auggacagcu ggcgccgcug ccuacuaugu gggauaccug 780

cagccucgga ccuuccugcu gaaguacaac gagaacggca ccaucaccga cgccguggau 840

ugugcucugg auccucugag cgagacaaag ugcacccuga aguccuucac cguggaaaag 900

ggcaucuacc agaccagcaa cuuccgggug cagcccaccg aauccaucgu gcgguucccc 960

aauaucacca aucugugccc cuucggcgag guguucaaug ccaccagauu cgccucugug 1020

uacgccugga accggaagcg gaucagcaau ugcguggccg acuacuccgu gcuguacaac 1080

uccgccagcu ucagcaccuu caagugcuac ggcguguccc cuaccaagcu gaacgaccug 1140

ugcuucacaa acguguacgc cgacagcuuc gugauccggg gagaugaagu gcggcagauu 1200

gccccuggac agacaggcaa gaucgccgac uacaacuaca agcugcccga cgacuucacc 1260

ggcuguguga uugccuggaa cagcaacaac cuggacucca aagucggcgg caacuacaau 1320

uaccuguacc ggcuguuccg gaaguccaau cugaagcccu ucgagcggga caucuccacc 1380

gagaucuauc aggccggcag caccccuugu aacggcgugg aaggcuucaa cugcuacuuc 1440

ccacugcagu ccuacggcuu ucagcccaca aauggcgugg gcuaccagcc uuacagagug 1500

guggugcuga gcuucgagcu gcugcaugcu ccugccacag ugugcggccc uaagaaaagc 1560

accaaucucg ugaagaacaa augcgugaac uucaacuuca acggccugac cggcaccggc 1620

gugcugacag agagcaacaa gaaguuccug ccauuccagc aguucggccg ggauaucgcc 1680

gauaccacag acgccguuag agauccccag acacuggaaa uccuggacau caccccuugc 1740

agcuucggcg gagugucugu gaucaccccu ggcaccaaca ccagcaauca gguggcagug 1800

cuguaccagg acgugaacug uaccgaagug cccguggcca uucacgccga ucagcugaca 1860

ccuacauggc ggguguacuc caccggcagc aauguguuuc agaccagagc cggcugucug 1920

aucggagccg agcacgugaa caauagcuac gagugcgaca uccccaucgg cgcuggcauc 1980

ugugccagcu accagacaca gacaaacagc cccagacggg ccagaucugu ggccagccag 2040

agcaucauug ccuacacaau gucucugggc gccgagaaca gcguggccua cuccaacaac 2100

ucuaucgcua uccccaccaa cuucaccauc agcgugacca cagagauccu gccugugucc 2160

augaccaaga ccagcgugga cugcaccaug uacaucugcg gcgauuccac cgagugcucc 2220

aaccugcugc ugcaguacgg cagcuucugc acccagcuga auagagcccu gacagggauc 2280

gccguggaac aggacaagaa cacccaagag guguucgccc aagugaagca gaucuacaag 2340

accccuccua ucaaggacuu cggcggcuuc aauuucagcc agauucugcc cgauccuagc 2400

aagcccagca agcggagcuu caucgaggac cugcuguuca acaaagugac acuggccgac 2460

gccggcuuca ucaagcagua uggcgauugu cugggcgaca uugccgccag ggaucugauu 2520

ugcgcccaga aguuuaacgg acugacagug cugccuccuc ugcugaccga ugagaugauc 2580

gcccaguaca caucugcccu gcuggccggc acaaucacaa gcggcuggac auuuggagcu 2640

ggcgcugccc ugcagauccc cuuugcuaug cagauggccu accgguucaa cggcaucgga 2700

gugacccaga augugcugua cgagaaccag aagcugaucg ccaaccaguu caacagcgcc 2760

aucggcaaga uccaggacag ccugagcagc acagcaagcg cccugggaaa gcugcaggac 2820

guggucaacc agaaugccca ggcacugaac acccugguca agcagcuguc uagcaacuuc 2880

ggcgccauca gcucugugcu gaacgauauc cugagcagac uggacaaggu ggaagccgag 2940

gugcagaucg acagacugau caccggaagg cugcaguccc ugcagaccua cguuacccag 3000

cagcugauca gagccgccga gauuagagcc ucugccaauc uggccgccac caagaugucu 3060

gagugugugc ugggccagag caagagagug gacuuuugcg gcaagggcua ccaccugaug 3120

agcuucccuc agucugcccc ucacggcgug guguuucugc acgugacaua cgugcccgcu 3180

caagagaaga auuucaccac cgcuccagcc aucugccacg acggcaaagc ccacuuuccu 3240

agagaaggcg uguucgucag caacggcacc cauugguucg ugacccagcg gaacuucuac 3300

gagccccaga ucaucaccac cgacaacacc uucgugucug gcaacugcga cgucgugauc 3360

ggcauuguga acaauaccgu guacgacccu cugcagcccg agcuggacag cuucaaagag 3420

gaacuggaua aguacuuuaa gaaccacaca agccccgacg uggaccuggg cgauaucagc 3480

ggaaucaaug ccagcgucgu gaacauccag aaagagaucg accggcugaa cgagguggcc 3540

aagaaucuga acgagagccu gaucgaccug caagaacugg ggaaguacga gcaguacauc 3600

aaguggcccu aauag 3615

<210> 35

<211> 2028

<212> RNA

<213> coronavirus (coronavirus)

<400> 35

augucuaguc aguguguuaa ucuuacaacc agaacucaau uacccccugc auacacuaau 60

ucuuucacac gugguguuua uuacccugac aaaguuuuca gauccucagu uuuacauuca 120

acucaggacu uguucuuacc uuucuuuucc aauguuacuu gguuccaugc uauacauguc 180

ucugggacca augguacuaa gagguuugau aacccugucc uaccauuuaa ugaugguguu 240

uauuuugcuu ccacugagaa gucuaacaua auaagaggcu ggauuuuugg uacuacuuua 300

gauucgaaga cccagucccu acuuauuguu aauaacgcua cuaauguugu uauuaaaguc 360

ugugaauuuc aauuuuguaa ugauccauuu uuggguguuu auuaccacaa aaacaacaaa 420

aguuggaugg aaagugaguu cagaguuuau ucuagugcga auaauugcac uuuugaauau 480

gucucucagc cuuuucuuau ggaccuugaa ggaaaacagg guaauuucaa aaaucuuagg 540

gaauuugugu uuaagaauau ugaugguuau uuuaaaauau auucuaagca cacgccuauu 600

aauuuagugc gugaucuccc ucaggguuuu ucggcuuuag aaccauuggu agauuugcca 660

auagguauua acaucacuag guuucaaacu uuacuugcuu uacauagaag uuauuugacu 720

ccuggugauu cuucuucagg uuggacagcu ggugcugcag cuuauuaugu ggguuaucuu 780

caaccuagga cuuuucuauu aaaauauaau gaaaauggaa ccauuacaga ugcuguagac 840

ugugcacuug acccucucuc agaaacaaag uguacguuga aauccuucac uguagaaaaa 900

ggaaucuauc aaacuucuaa cuuuagaguc caaccaacag aaucuauugu uagauuuccu 960

aauauuacaa acuugugccc uuuuggugaa guuuuuaacg ccaccagauu ugcaucuguu 1020

uaugcuugga acaggaagag aaucagcaac uguguugcug auuauucugu ccuauauaau 1080

uccgcaucau uuuccacuuu uaaguguuau ggagugucuc cuacuaaauu aaaugaucuc 1140

ugcuuuacua augucuaugc agauucauuu guaauuagag gugaugaagu cagacaaauc 1200

gcuccagggc aaacuggaaa gauugcugau uauaauuaua aauuaccaga ugauuuuaca 1260

ggcugcguua uagcuuggaa uucuaacaau cuugauucua agguuggugg uaauuauaau 1320

uaccuguaua gauuguuuag gaagucuaau cucaaaccuu uugagagaga uauuucaacu 1380

gaaaucuauc aggccgguag cacaccuugu aaugguguug aagguuuuaa uuguuacuuu 1440

ccuuuacaau cauaugguuu ccaacccacu aaugguguug guuaccaacc auacagagua 1500

guaguacuuu cuuuugaacu ucuacaugca ccagcaacug uuuguggacc uaaaaagucu 1560

acuaauuugg uuaaaaacaa augugucaau uucaacuuca augguuuaac aggcacaggu 1620

guucuuacug agucuaacaa aaaguuucug ccuuuccaac aauuuggcag agacauugcu 1680

gacacuacug augcuguccg ugauccacag acacuugaga uucuugacau uacaccaugu 1740

ucuuuuggug gugucagugu uauaacacca ggaacaaaua cuucuaacca gguugcuguu 1800

cuuuaucagg auguuaacug cacagaaguc ccuguugcua uucaugcaga ucaacuuacu 1860

ccuacuuggc guguuuauuc uacagguucu aauguuuuuc aaacacgugc aggcuguuua 1920

auaggggcug aacaugucaa caacucauau gagugugaca uacccauugg ugcagguaua 1980

ugcgcuaguu aucagacuca gacuaauucu ccucggcggg cacguuaa 2028

<210> 36

<211> 2031

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

augagcagcc agugcgugaa ccugaccacc agaacucagc ugccuccagc cuacaccaac 60

agcuucacca gaggcgugua cuaccccgac aagguguuca gauccagcgu gcugcacucu 120

acccaggacc uguuccugcc uuucuucagc aacgugaccu gguuccacgc cauccacgug 180

uccggcacca auggcaccaa gagauucgac aaccccgugc ugcccuucaa cgacggggug 240

uacuuugcca gcaccgagaa guccaacauc aucagaggcu ggaucuucgg caccacacug 300

gacagcaaga cccagagccu gcugaucgug aacaacgcca ccaacguggu caucaaagug 360

ugcgaguucc aguucugcaa cgaccccuuc cugggcgucu acuaccacaa gaacaacaag 420

agcuggaugg aaagcgaguu ccggguguac agcagcgcca acaacugcac cuucgaguac 480

gugucccagc cuuuccugau ggaccuggaa ggcaagcagg gcaacuucaa gaaccugcgc 540

gaguucgugu ucaagaacau cgacggcuac uucaagaucu acagcaagca caccccuauc 600

aaccucgugc gggaucugcc ucagggcuuc ucugcucugg aaccccuggu ggaucugccc 660

aucggcauca acaucacccg guuucagaca cugcuggccc ugcacagaag cuaccugaca 720

ccuggcgaua gcagcucugg auggacagcu ggcgccgcug ccuacuaugu gggauaccug 780

cagccucgga ccuuccugcu gaaguacaac gagaacggca ccaucaccga cgccguggau 840

ugugcucugg auccucugag cgagacaaag ugcacccuga aguccuucac cguggaaaag 900

ggcaucuacc agaccagcaa cuuccgggug cagcccaccg aauccaucgu gcgguucccc 960

aauaucacca aucugugccc cuucggcgag guguucaaug ccaccagauu cgccucugug 1020

uacgccugga accggaagcg gaucagcaau ugcguggccg acuacuccgu gcuguacaac 1080

uccgccagcu ucagcaccuu caagugcuac ggcguguccc cuaccaagcu gaacgaccug 1140

ugcuucacaa acguguacgc cgacagcuuc gugauccggg gagaugaagu gcggcagauu 1200

gccccuggac agacaggcaa gaucgccgac uacaacuaca agcugcccga cgacuucacc 1260

ggcuguguga uugccuggaa cagcaacaac cuggacucca aagucggcgg caacuacaau 1320

uaccuguacc ggcuguuccg gaaguccaau cugaagcccu ucgagcggga caucuccacc 1380

gagaucuauc aggccggcag caccccuugu aacggcgugg aaggcuucaa cugcuacuuc 1440

ccacugcagu ccuacggcuu ucagcccaca aauggcgugg gcuaccagcc uuacagagug 1500

guggugcuga gcuucgagcu gcugcaugcu ccugccacag ugugcggccc uaagaaaagc 1560

accaaucucg ugaagaacaa augcgugaac uucaacuuca acggccugac cggcaccggc 1620

gugcugacag agagcaacaa gaaguuccug ccauuccagc aguucggccg ggauaucgcc 1680

gauaccacag acgccguuag agauccccag acacuggaaa uccuggacau caccccuugc 1740

agcuucggcg gagugucugu gaucaccccu ggcaccaaca ccagcaauca gguggcagug 1800

cuguaccagg acgugaacug uaccgaagug cccguggcca uucacgccga ucagcugaca 1860

ccuacauggc ggguguacuc caccggcagc aauguguuuc agaccagagc cggcugucug 1920

aucggagccg agcacgugaa caauagcuac gagugcgaca uccccaucgg cgcuggcauc 1980

ugugccagcu accagacaca gacaaacagc cccagacggg ccagauaaua g 2031

<210> 37

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

ttggaccctc gtacagaagc taatacg 27

<210> 38

<211> 149

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt 60

tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt 120

tagttctaga ccctcacttc ctactcagg 149

<210> 39

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

taatacgact cactata 17

<210> 40

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

acatttgctt ctgacacaac tgtgttcact agcaacctca aacagacacc 50

<210> 41

<211> 132

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

gctcgctttc ttgctgtcca atttctatta aaggttcctt tgttccctaa gtccaactac 60

taaactgggg gatattatga agggccttga gcatctggat tctgcctaat aaaaaacatt 120

tattttcatt gc 132

<210> 42

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 60

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 120

<210> 43

<211> 1273

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 43

Met Pro Val Pro Leu Val Leu Leu Pro Leu Val Ser Ser Gly Cys Val

1 5 10 15

Ala Leu Thr Thr Ala Thr Gly Leu Pro Pro Ala Thr Thr Ala Ser Pro

20 25 30

Thr Ala Gly Val Thr Thr Pro Ala Leu Val Pro Ala Ser Ser Val Leu

35 40 45

His Ser Thr Gly Ala Leu Pro Leu Pro Pro Pro Ser Ala Val Thr Thr

50 55 60

Pro His Ala Ile His Val Ser Gly Thr Ala Gly Thr Leu Ala Pro Ala

65 70 75 80

Ala Pro Val Leu Pro Pro Ala Ala Gly Val Thr Pro Ala Ser Thr Gly

85 90 95

Leu Ser Ala Ile Ile Ala Gly Thr Ile Pro Gly Thr Thr Leu Ala Ser

100 105 110

Leu Thr Gly Ser Leu Leu Ile Val Ala Ala Ala Thr Ala Val Val Ile

115 120 125

Leu Val Cys Gly Pro Gly Pro Cys Ala Ala Pro Pro Leu Gly Val Thr

130 135 140

Thr His Leu Ala Ala Leu Ser Thr Met Gly Ser Gly Pro Ala Val Thr

145 150 155 160

Ser Ser Ala Ala Ala Cys Thr Pro Gly Thr Val Ser Gly Pro Pro Leu

165 170 175

Met Ala Leu Gly Gly Leu Gly Gly Ala Pro Leu Ala Leu Ala Gly Pro

180 185 190

Val Pro Leu Ala Ile Ala Gly Thr Pro Leu Ile Thr Ser Leu His Thr

195 200 205

Pro Ile Ala Leu Val Ala Ala Leu Pro Gly Gly Pro Ser Ala Leu Gly

210 215 220

Pro Leu Val Ala Leu Pro Ile Gly Ile Ala Ile Thr Ala Pro Gly Thr

225 230 235 240

Leu Leu Ala Leu His Ala Ser Thr Leu Thr Pro Gly Ala Ser Ser Ser

245 250 255

Gly Thr Thr Ala Gly Ala Ala Ala Thr Thr Val Gly Thr Leu Gly Pro

260 265 270

Ala Thr Pro Leu Leu Leu Thr Ala Gly Ala Gly Thr Ile Thr Ala Ala

275 280 285

Val Ala Cys Ala Leu Ala Pro Leu Ser Gly Thr Leu Cys Thr Leu Leu

290 295 300

Ser Pro Thr Val Gly Leu Gly Ile Thr Gly Thr Ser Ala Pro Ala Val

305 310 315 320

Gly Pro Thr Gly Ser Ile Val Ala Pro Pro Ala Ile Thr Ala Leu Cys

325 330 335

Pro Pro Gly Gly Val Pro Ala Ala Thr Ala Pro Ala Ser Val Thr Ala

340 345 350

Thr Ala Ala Leu Ala Ile Ser Ala Cys Val Ala Ala Thr Ser Val Leu

355 360 365

Thr Ala Ser Ala Ser Pro Ser Thr Pro Leu Cys Thr Gly Val Ser Pro

370 375 380

Thr Leu Leu Ala Ala Leu Cys Pro Thr Ala Val Thr Ala Ala Ser Pro

385 390 395 400

Val Ile Ala Gly Ala Gly Val Ala Gly Ile Ala Pro Gly Gly Thr Gly

405 410 415

Leu Ile Ala Ala Thr Ala Thr Leu Leu Pro Ala Ala Pro Thr Gly Cys

420 425 430

Val Ile Ala Thr Ala Ser Ala Ala Leu Ala Ser Leu Val Gly Gly Ala

435 440 445

Thr Ala Thr Leu Thr Ala Leu Pro Ala Leu Ser Ala Leu Leu Pro Pro

450 455 460

Gly Ala Ala Ile Ser Thr Gly Ile Thr Gly Ala Gly Ser Thr Pro Cys

465 470 475 480

Ala Gly Val Gly Gly Pro Ala Cys Thr Pro Pro Leu Gly Ser Thr Gly

485 490 495

Pro Gly Pro Thr Ala Gly Val Gly Thr Gly Pro Thr Ala Val Val Val

500 505 510

Leu Ser Pro Gly Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Leu

515 520 525

Leu Ser Thr Ala Leu Val Leu Ala Leu Cys Val Ala Pro Ala Pro Ala

530 535 540

Gly Leu Thr Gly Thr Gly Val Leu Thr Gly Ser Ala Leu Leu Pro Leu

545 550 555 560

Pro Pro Gly Gly Pro Gly Ala Ala Ile Ala Ala Thr Thr Ala Ala Val

565 570 575

Ala Ala Pro Gly Thr Leu Gly Ile Leu Ala Ile Thr Pro Cys Ser Pro

580 585 590

Gly Gly Val Ser Val Ile Thr Pro Gly Thr Ala Thr Ser Ala Gly Val

595 600 605

Ala Val Leu Thr Gly Ala Val Ala Cys Thr Gly Val Pro Val Ala Ile

610 615 620

His Ala Ala Gly Leu Thr Pro Thr Thr Ala Val Thr Ser Thr Gly Ser

625 630 635 640

Ala Val Pro Gly Thr Ala Ala Gly Cys Leu Ile Gly Ala Gly His Val

645 650 655

Ala Ala Ser Thr Gly Cys Ala Ile Pro Ile Gly Ala Gly Ile Cys Ala

660 665 670

Ser Thr Gly Thr Gly Thr Ala Ser Pro Ala Ala Ala Ala Ser Val Ala

675 680 685

Ser Gly Ser Ile Ile Ala Thr Thr Met Ser Leu Gly Ala Gly Ala Ser

690 695 700

Val Ala Thr Ser Ala Ala Ser Ile Ala Ile Pro Thr Ala Pro Thr Ile

705 710 715 720

Ser Val Thr Thr Gly Ile Leu Pro Val Ser Met Thr Leu Thr Ser Val

725 730 735

Ala Cys Thr Met Thr Ile Cys Gly Ala Ser Thr Gly Cys Ser Ala Leu

740 745 750

Leu Leu Gly Thr Gly Ser Pro Cys Thr Gly Leu Ala Ala Ala Leu Thr

755 760 765

Gly Ile Ala Val Gly Gly Ala Leu Ala Thr Gly Gly Val Pro Ala Gly

770 775 780

Val Leu Gly Ile Thr Leu Thr Pro Pro Ile Leu Ala Pro Gly Gly Pro

785 790 795 800

Ala Pro Ser Gly Ile Leu Pro Ala Pro Ser Leu Pro Ser Leu Ala Ser

805 810 815

Pro Ile Gly Ala Leu Leu Pro Ala Leu Val Thr Leu Ala Ala Ala Gly

820 825 830

Pro Ile Leu Gly Thr Gly Ala Cys Leu Gly Ala Ile Ala Ala Ala Ala

835 840 845

Leu Ile Cys Ala Gly Leu Pro Ala Gly Leu Thr Val Leu Pro Pro Leu

850 855 860

Leu Thr Ala Gly Met Ile Ala Gly Thr Thr Ser Ala Leu Leu Ala Gly

865 870 875 880

Thr Ile Thr Ser Gly Thr Thr Pro Gly Ala Gly Ala Ala Leu Gly Ile

885 890 895

Pro Pro Ala Met Gly Met Ala Thr Ala Pro Ala Gly Ile Gly Val Thr

900 905 910

Gly Ala Val Leu Thr Gly Ala Gly Leu Leu Ile Ala Ala Gly Pro Ala

915 920 925

Ser Ala Ile Gly Leu Ile Gly Ala Ser Leu Ser Ser Thr Ala Ser Ala

930 935 940

Leu Gly Leu Leu Gly Ala Val Val Ala Gly Ala Ala Gly Ala Leu Ala

945 950 955 960

Thr Leu Val Leu Gly Leu Ser Ser Ala Pro Gly Ala Ile Ser Ser Val

965 970 975

Leu Ala Ala Ile Leu Ser Ala Leu Ala Leu Val Gly Ala Gly Val Gly

980 985 990

Ile Ala Ala Leu Ile Thr Gly Ala Leu Gly Ser Leu Gly Thr Thr Val

995 1000 1005

Thr Gly Gly Leu Ile Ala Ala Ala Gly Ile Ala Ala Ser Ala Ala Leu

1010 1015 1020

Ala Ala Thr Leu Met Ser Gly Cys Val Leu Gly Gly Ser Leu Ala Val

1025 1030 1035 1040

Ala Pro Cys Gly Leu Gly Thr His Leu Met Ser Pro Pro Gly Ser Ala

1045 1050 1055

Pro His Gly Val Val Pro Leu His Val Thr Thr Val Pro Ala Gly Gly

1060 1065 1070

Leu Ala Pro Thr Thr Ala Pro Ala Ile Cys His Ala Gly Leu Ala His

1075 1080 1085

Pro Pro Ala Gly Gly Val Pro Val Ser Ala Gly Thr His Thr Pro Val

1090 1095 1100

Thr Gly Ala Ala Pro Thr Gly Pro Gly Ile Ile Thr Thr Ala Ala Thr

1105 1110 1115 1120

Pro Val Ser Gly Ala Cys Ala Val Val Ile Gly Ile Val Ala Ala Thr

1125 1130 1135

Val Thr Ala Pro Leu Gly Pro Gly Leu Ala Ser Pro Leu Gly Gly Leu

1140 1145 1150

Ala Leu Thr Pro Leu Ala His Thr Ser Pro Ala Val Ala Leu Gly Ala

1155 1160 1165

Ile Ser Gly Ile Ala Ala Ser Val Val Ala Ile Gly Leu Gly Ile Ala

1170 1175 1180

Ala Leu Ala Gly Val Ala Leu Ala Leu Ala Gly Ser Leu Ile Ala Leu

1185 1190 1195 1200

Gly Gly Leu Gly Leu Thr Gly Gly Thr Ile Leu Thr Pro Thr Thr Ile

1205 1210 1215

Thr Leu Gly Pro Ile Ala Gly Leu Ile Ala Ile Val Met Val Thr Ile

1220 1225 1230

Met Leu Cys Cys Met Thr Ser Cys Cys Ser Cys Leu Leu Gly Cys Cys

1235 1240 1245

Ser Cys Gly Ser Cys Cys Leu Pro Ala Gly Ala Ala Ser Gly Pro Val

1250 1255 1260

Leu Leu Gly Val Leu Leu His Thr Thr

1265 1270

<210> 44

<211> 255

<212> PRT

<213> coronavirus (coronavirus)

<400> 44

Met Pro Ala Ile Thr Ala Leu Cys Pro Pro Gly Gly Val Pro Ala Ala

1 5 10 15

Thr Ala Pro Ala Ser Val Thr Ala Thr Ala Ala Leu Ala Ile Ser Ala

20 25 30

Cys Val Ala Ala Thr Ser Val Leu Thr Ala Ser Ala Ser Pro Ser Thr

35 40 45

Pro Leu Cys Thr Gly Val Ser Pro Thr Leu Leu Ala Ala Leu Cys Pro

50 55 60

Thr Ala Val Thr Ala Ala Ser Pro Val Ile Ala Gly Ala Gly Val Ala

65 70 75 80

Gly Ile Ala Pro Gly Gly Thr Gly Leu Ile Ala Ala Thr Ala Thr Leu

85 90 95

Leu Pro Ala Ala Pro Thr Gly Cys Val Ile Ala Thr Ala Ser Ala Ala

100 105 110

Leu Ala Ser Leu Val Gly Gly Ala Thr Ala Thr Leu Thr Ala Leu Pro

115 120 125

Ala Leu Ser Ala Leu Leu Pro Pro Gly Ala Ala Ile Ser Thr Gly Ile

130 135 140

Thr Gly Ala Gly Ser Thr Pro Cys Ala Gly Val Gly Gly Pro Ala Cys

145 150 155 160

Thr Pro Pro Leu Gly Ser Thr Gly Pro Gly Pro Thr Ala Gly Val Gly

165 170 175

Thr Gly Pro Thr Ala Val Val Val Leu Ser Pro Gly Leu Leu His Ala

180 185 190

Pro Ala Thr Val Cys Gly Pro Leu Leu Ser Thr Ala Leu Val Leu Ala

195 200 205

Leu Cys Val Ala Pro Ala Pro Ala Gly Leu Thr Gly Thr Gly Val Leu

210 215 220

Thr Gly Ser Ala Leu Leu Pro Leu Pro Pro Gly Gly Pro Gly Ala Ala

225 230 235 240

Ile Ala Ala Thr Thr Ala Ala Val Ala Ala Pro Gly Thr Leu Gly

245 250 255

<210> 45

<211> 222

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 45

Met Ala Ala Ser Ala Gly Thr Ile Thr Val Gly Gly Leu Leu Leu Leu

1 5 10 15

Leu Gly Gly Thr Ala Leu Val Ile Gly Pro Leu Pro Leu Thr Thr Ile

20 25 30

Cys Leu Leu Gly Pro Ala Thr Ala Ala Ala Ala Ala Pro Leu Thr Ile

35 40 45

Ile Leu Leu Ile Pro Leu Thr Leu Leu Thr Pro Val Thr Leu Ala Cys

50 55 60

Pro Val Leu Ala Ala Val Thr Ala Ile Ala Thr Ile Thr Gly Gly Ile

65 70 75 80

Ala Ile Ala Met Ala Cys Leu Val Gly Leu Met Thr Leu Ser Thr Pro

85 90 95

Ile Ala Ser Pro Ala Leu Pro Ala Ala Thr Ala Ser Met Thr Ser Pro

100 105 110

Ala Pro Gly Thr Ala Ile Leu Leu Ala Val Pro Leu His Gly Thr Ile

115 120 125

Leu Thr Ala Pro Leu Leu Gly Ser Gly Leu Val Ile Gly Ala Val Ile

130 135 140

Leu Ala Gly His Leu Ala Ile Ala Gly His His Leu Gly Ala Cys Ala

145 150 155 160

Ile Leu Ala Leu Pro Leu Gly Ile Thr Val Ala Thr Ser Ala Thr Leu

165 170 175

Ser Thr Thr Leu Leu Gly Ala Ser Gly Ala Val Ala Gly Ala Ser Gly

180 185 190

Pro Ala Ala Thr Ser Ala Thr Ala Ile Gly Ala Thr Leu Leu Ala Thr

195 200 205

Ala His Ser Ser Ser Ser Ala Ala Ile Ala Leu Leu Val Gly

210 215 220

<210> 46

<211> 419

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 46

Met Ser Ala Ala Gly Pro Gly Ala Gly Ala Ala Ala Pro Ala Ile Thr

1 5 10 15

Pro Gly Gly Pro Ser Ala Ser Thr Gly Ser Ala Gly Ala Gly Gly Ala

20 25 30

Ser Gly Ala Ala Ser Leu Gly Ala Ala Pro Gly Gly Leu Pro Ala Ala

35 40 45

Thr Ala Ser Thr Pro Thr Ala Leu Thr Gly His Gly Leu Gly Ala Leu

50 55 60

Leu Pro Pro Ala Gly Gly Gly Val Pro Ile Ala Thr Ala Ser Ser Pro

65 70 75 80

Ala Ala Gly Ile Gly Thr Thr Ala Ala Ala Thr Ala Ala Ile Ala Gly

85 90 95

Gly Ala Gly Leu Met Leu Ala Leu Ser Pro Ala Thr Thr Pro Thr Thr

100 105 110

Leu Gly Thr Gly Pro Gly Ala Gly Leu Pro Thr Gly Ala Ala Leu Ala

115 120 125

Gly Ile Ile Thr Val Ala Thr Gly Gly Ala Leu Ala Thr Pro Leu Ala

130 135 140

His Ile Gly Thr Ala Ala Pro Ala Ala Ala Ala Ala Ile Val Leu Gly

145 150 155 160

Leu Pro Gly Gly Thr Thr Leu Pro Leu Gly Pro Thr Ala Gly Gly Ser

165 170 175

Ala Gly Gly Ser Gly Ala Ser Ser Ala Ser Ser Ser Ala Ser Ala Ala

180 185 190

Ser Ser Ala Ala Ser Thr Pro Gly Ser Ser Ala Gly Thr Ser Pro Ala

195 200 205

Ala Met Ala Gly Ala Gly Gly Ala Ala Ala Leu Ala Leu Leu Leu Leu

210 215 220

Ala Ala Leu Ala Gly Leu Gly Ser Leu Met Ser Gly Leu Gly Gly Gly

225 230 235 240

Gly Gly Gly Gly Thr Val Thr Leu Leu Ser Ala Ala Gly Ala Ser Leu

245 250 255

Leu Pro Ala Gly Leu Ala Thr Ala Thr Leu Ala Thr Ala Val Thr Gly

260 265 270

Ala Pro Gly Ala Ala Gly Pro Gly Gly Thr Gly Gly Ala Pro Gly Ala

275 280 285

Gly Gly Leu Ile Ala Gly Gly Thr Ala Thr Leu His Thr Pro Gly Ile

290 295 300

Ala Gly Pro Ala Pro Ser Ala Ser Ala Pro Pro Gly Met Ser Ala Ile

305 310 315 320

Gly Met Gly Val Thr Pro Ser Gly Thr Thr Leu Thr Thr Thr Gly Ala

325 330 335

Ile Leu Leu Ala Ala Leu Ala Pro Ala Pro Leu Ala Gly Val Ile Leu

340 345 350

Leu Ala Leu His Ile Ala Ala Thr Leu Thr Pro Pro Pro Thr Gly Pro

355 360 365

Leu Leu Ala Leu Leu Leu Leu Ala Ala Gly Thr Gly Ala Leu Pro Gly

370 375 380

Ala Gly Leu Leu Gly Gly Thr Val Thr Leu Leu Pro Ala Ala Ala Leu

385 390 395 400

Ala Ala Pro Ser Leu Gly Leu Gly Gly Ser Met Ser Ser Ala Ala Ser

405 410 415

Thr Gly Ala

<210> 47

<211> 221

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 47

Met Ala Ala Met Leu Ala Gly Leu Cys Cys Val Leu Leu Leu Cys Gly

1 5 10 15

Ala Val Pro Val Ser Ala Ser Ile Thr Ala Leu Cys Pro Pro Gly Gly

20 25 30

Val Pro Ala Ala Thr Ala Pro Ala Ser Val Thr Ala Thr Ala Ala Leu

35 40 45

Ala Ile Ser Ala Cys Val Ala Ala Thr Ser Val Leu Thr Ala Ser Ala

50 55 60

Ser Pro Ser Thr Pro Leu Cys Thr Gly Val Ser Pro Thr Leu Leu Ala

65 70 75 80

Ala Leu Cys Pro Thr Ala Val Thr Ala Ala Ser Pro Val Ile Ala Gly

85 90 95

Ala Gly Val Ala Gly Ile Ala Pro Gly Gly Thr Gly Leu Ile Ala Ala

100 105 110

Thr Ala Thr Leu Leu Pro Ala Ala Pro Thr Gly Cys Val Ile Ala Thr

115 120 125

Ala Ser Ala Ala Leu Ala Ser Leu Val Gly Gly Ala Thr Ala Thr Leu

130 135 140

Thr Ala Leu Pro Ala Leu Ser Ala Leu Leu Pro Pro Gly Ala Ala Ile

145 150 155 160

Ser Thr Gly Ile Thr Gly Ala Gly Ser Thr Pro Cys Ala Gly Val Gly

165 170 175

Gly Pro Ala Cys Thr Pro Pro Leu Gly Ser Thr Gly Pro Gly Pro Thr

180 185 190

Ala Gly Val Gly Thr Gly Pro Thr Ala Val Val Val Leu Ser Pro Gly

195 200 205

Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Leu Leu

210 215 220

<210> 48

<211> 221

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 48

Met Ala Ala Met Leu Ala Gly Leu Cys Cys Val Leu Leu Leu Cys Gly

1 5 10 15

Ala Val Pro Val Ser Ala Ser Ile Thr Ala Leu Cys Pro Pro Gly Gly

20 25 30

Val Pro Ala Ala Thr Ala Pro Ala Ser Val Thr Ala Thr Ala Ala Leu

35 40 45

Ala Ile Ser Ala Cys Val Ala Ala Thr Ser Val Leu Thr Ala Ser Ala

50 55 60

Ser Pro Ser Thr Pro Leu Cys Thr Gly Val Ser Pro Thr Leu Leu Ala

65 70 75 80

Ala Leu Cys Pro Thr Ala Val Thr Ala Ala Ser Pro Val Ile Ala Gly

85 90 95

Ala Gly Val Ala Gly Ile Ala Pro Gly Gly Thr Gly Leu Ile Ala Ala

100 105 110

Thr Ala Thr Leu Leu Pro Ala Ala Pro Thr Gly Cys Val Ile Ala Thr

115 120 125

Ala Ser Ala Ala Leu Ala Ser Leu Val Gly Gly Ala Thr Ala Thr Leu

130 135 140

Thr Ala Leu Pro Ala Leu Ser Ala Leu Leu Pro Pro Gly Ala Ala Ile

145 150 155 160

Ser Thr Gly Ile Thr Gly Ala Gly Ser Thr Pro Cys Ala Gly Val Gly

165 170 175

Gly Pro Ala Cys Thr Pro Pro Leu Gly Ser Thr Gly Pro Gly Pro Thr

180 185 190

Ala Gly Val Gly Thr Gly Pro Thr Ala Val Val Val Leu Ser Pro Gly

195 200 205

Leu Leu His Ala Ala Ala Thr Val Cys Gly Pro Leu Leu

210 215 220

<210> 49

<211> 75

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 49

Met Thr Ser Pro Val Ser Gly Gly Thr Gly Thr Leu Ile Val Ala Ser

1 5 10 15

Val Leu Leu Pro Leu Ala Pro Val Val Pro Leu Leu Val Thr Leu Ala

20 25 30

Ile Leu Thr Ala Leu Ala Leu Cys Ala Thr Cys Cys Ala Ile Val Ala

35 40 45

Val Ser Leu Val Leu Pro Ser Pro Thr Val Thr Ser Ala Val Leu Ala

50 55 60

Leu Ala Ser Ser Ala Val Pro Ala Leu Leu Val

65 70 75

<210> 50

<211> 1225

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 50

Met Ala Ala Met Leu Ala Gly Leu Cys Cys Val Leu Leu Leu Cys Gly

1 5 10 15

Ala Val Pro Val Ser Ala Ser Ser Ser Gly Cys Val Ala Leu Thr Thr

20 25 30

Ala Thr Gly Leu Pro Pro Ala Thr Thr Ala Ser Pro Thr Ala Gly Val

35 40 45

Thr Thr Pro Ala Leu Val Pro Ala Ser Ser Val Leu His Ser Thr Gly

50 55 60

Ala Leu Pro Leu Pro Pro Pro Ser Ala Val Thr Thr Pro His Ala Ile

65 70 75 80

His Val Ser Gly Thr Ala Gly Thr Leu Ala Pro Ala Ala Pro Val Leu

85 90 95

Pro Pro Ala Ala Gly Val Thr Pro Ala Ser Thr Gly Leu Ser Ala Ile

100 105 110

Ile Ala Gly Thr Ile Pro Gly Thr Thr Leu Ala Ser Leu Thr Gly Ser

115 120 125

Leu Leu Ile Val Ala Ala Ala Thr Ala Val Val Ile Leu Val Cys Gly

130 135 140

Pro Gly Pro Cys Ala Ala Pro Pro Leu Gly Val Thr Thr His Leu Ala

145 150 155 160

Ala Leu Ser Thr Met Gly Ser Gly Pro Ala Val Thr Ser Ser Ala Ala

165 170 175

Ala Cys Thr Pro Gly Thr Val Ser Gly Pro Pro Leu Met Ala Leu Gly

180 185 190

Gly Leu Gly Gly Ala Pro Leu Ala Leu Ala Gly Pro Val Pro Leu Ala

195 200 205

Ile Ala Gly Thr Pro Leu Ile Thr Ser Leu His Thr Pro Ile Ala Leu

210 215 220

Val Ala Ala Leu Pro Gly Gly Pro Ser Ala Leu Gly Pro Leu Val Ala

225 230 235 240

Leu Pro Ile Gly Ile Ala Ile Thr Ala Pro Gly Thr Leu Leu Ala Leu

245 250 255

His Ala Ser Thr Leu Thr Pro Gly Ala Ser Ser Ser Gly Thr Thr Ala

260 265 270

Gly Ala Ala Ala Thr Thr Val Gly Thr Leu Gly Pro Ala Thr Pro Leu

275 280 285

Leu Leu Thr Ala Gly Ala Gly Thr Ile Thr Ala Ala Val Ala Cys Ala

290 295 300

Leu Ala Pro Leu Ser Gly Thr Leu Cys Thr Leu Leu Ser Pro Thr Val

305 310 315 320

Gly Leu Gly Ile Thr Gly Thr Ser Ala Pro Ala Val Gly Pro Thr Gly

325 330 335

Ser Ile Val Ala Pro Pro Ala Ile Thr Ala Leu Cys Pro Pro Gly Gly

340 345 350

Val Pro Ala Ala Thr Ala Pro Ala Ser Val Thr Ala Thr Ala Ala Leu

355 360 365

Ala Ile Ser Ala Cys Val Ala Ala Thr Ser Val Leu Thr Ala Ser Ala

370 375 380

Ser Pro Ser Thr Pro Leu Cys Thr Gly Val Ser Pro Thr Leu Leu Ala

385 390 395 400

Ala Leu Cys Pro Thr Ala Val Thr Ala Ala Ser Pro Val Ile Ala Gly

405 410 415

Ala Gly Val Ala Gly Ile Ala Pro Gly Gly Thr Gly Leu Ile Ala Ala

420 425 430

Thr Ala Thr Leu Leu Pro Ala Ala Pro Thr Gly Cys Val Ile Ala Thr

435 440 445

Ala Ser Ala Ala Leu Ala Ser Leu Val Gly Gly Ala Thr Ala Thr Leu

450 455 460

Thr Ala Leu Pro Ala Leu Ser Ala Leu Leu Pro Pro Gly Ala Ala Ile

465 470 475 480

Ser Thr Gly Ile Thr Gly Ala Gly Ser Thr Pro Cys Ala Gly Val Gly

485 490 495

Gly Pro Ala Cys Thr Pro Pro Leu Gly Ser Thr Gly Pro Gly Pro Thr

500 505 510

Ala Gly Val Gly Thr Gly Pro Thr Ala Val Val Val Leu Ser Pro Gly

515 520 525

Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Leu Leu Ser Thr Ala

530 535 540

Leu Val Leu Ala Leu Cys Val Ala Pro Ala Pro Ala Gly Leu Thr Gly

545 550 555 560

Thr Gly Val Leu Thr Gly Ser Ala Leu Leu Pro Leu Pro Pro Gly Gly

565 570 575

Pro Gly Ala Ala Ile Ala Ala Thr Thr Ala Ala Val Ala Ala Pro Gly

580 585 590

Thr Leu Gly Ile Leu Ala Ile Thr Pro Cys Ser Pro Gly Gly Val Ser

595 600 605

Val Ile Thr Pro Gly Thr Ala Thr Ser Ala Gly Val Ala Val Leu Thr

610 615 620

Gly Ala Val Ala Cys Thr Gly Val Pro Val Ala Ile His Ala Ala Gly

625 630 635 640

Leu Thr Pro Thr Thr Ala Val Thr Ser Thr Gly Ser Ala Val Pro Gly

645 650 655

Thr Ala Ala Gly Cys Leu Ile Gly Ala Gly His Val Ala Ala Ser Thr

660 665 670

Gly Cys Ala Ile Pro Ile Gly Ala Gly Ile Cys Ala Ser Thr Gly Thr

675 680 685

Gly Thr Ala Ser Pro Ala Ala Ala Ala Ser Val Ala Ser Gly Ser Ile

690 695 700

Ile Ala Thr Thr Met Ser Leu Gly Ala Gly Ala Ser Val Ala Thr Ser

705 710 715 720

Ala Ala Ser Ile Ala Ile Pro Thr Ala Pro Thr Ile Ser Val Thr Thr

725 730 735

Gly Ile Leu Pro Val Ser Met Thr Leu Thr Ser Val Ala Cys Thr Met

740 745 750

Thr Ile Cys Gly Ala Ser Thr Gly Cys Ser Ala Leu Leu Leu Gly Thr

755 760 765

Gly Ser Pro Cys Thr Gly Leu Ala Ala Ala Leu Thr Gly Ile Ala Val

770 775 780

Gly Gly Ala Leu Ala Thr Gly Gly Val Pro Ala Gly Val Leu Gly Ile

785 790 795 800

Thr Leu Thr Pro Pro Ile Leu Ala Pro Gly Gly Pro Ala Pro Ser Gly

805 810 815

Ile Leu Pro Ala Pro Ser Leu Pro Ser Leu Ala Ser Pro Ile Gly Ala

820 825 830

Leu Leu Pro Ala Leu Val Thr Leu Ala Ala Ala Gly Pro Ile Leu Gly

835 840 845

Thr Gly Ala Cys Leu Gly Ala Ile Ala Ala Ala Ala Leu Ile Cys Ala

850 855 860

Gly Leu Pro Ala Gly Leu Thr Val Leu Pro Pro Leu Leu Thr Ala Gly

865 870 875 880

Met Ile Ala Gly Thr Thr Ser Ala Leu Leu Ala Gly Thr Ile Thr Ser

885 890 895

Gly Thr Thr Pro Gly Ala Gly Ala Ala Leu Gly Ile Pro Pro Ala Met

900 905 910

Gly Met Ala Thr Ala Pro Ala Gly Ile Gly Val Thr Gly Ala Val Leu

915 920 925

Thr Gly Ala Gly Leu Leu Ile Ala Ala Gly Pro Ala Ser Ala Ile Gly

930 935 940

Leu Ile Gly Ala Ser Leu Ser Ser Thr Ala Ser Ala Leu Gly Leu Leu

945 950 955 960

Gly Ala Val Val Ala Gly Ala Ala Gly Ala Leu Ala Thr Leu Val Leu

965 970 975

Gly Leu Ser Ser Ala Pro Gly Ala Ile Ser Ser Val Leu Ala Ala Ile

980 985 990

Leu Ser Ala Leu Ala Leu Val Gly Ala Gly Val Gly Ile Ala Ala Leu

995 1000 1005

Ile Thr Gly Ala Leu Gly Ser Leu Gly Thr Thr Val Thr Gly Gly Leu

1010 1015 1020

Ile Ala Ala Ala Gly Ile Ala Ala Ser Ala Ala Leu Ala Ala Thr Leu

1025 1030 1035 1040

Met Ser Gly Cys Val Leu Gly Gly Ser Leu Ala Val Ala Pro Cys Gly

1045 1050 1055

Leu Gly Thr His Leu Met Ser Pro Pro Gly Ser Ala Pro His Gly Val

1060 1065 1070

Val Pro Leu His Val Thr Thr Val Pro Ala Gly Gly Leu Ala Pro Thr

1075 1080 1085

Thr Ala Pro Ala Ile Cys His Ala Gly Leu Ala His Pro Pro Ala Gly

1090 1095 1100

Gly Val Pro Val Ser Ala Gly Thr His Thr Pro Val Thr Gly Ala Ala

1105 1110 1115 1120

Pro Thr Gly Pro Gly Ile Ile Thr Thr Ala Ala Thr Pro Val Ser Gly

1125 1130 1135

Ala Cys Ala Val Val Ile Gly Ile Val Ala Ala Thr Val Thr Ala Pro

1140 1145 1150

Leu Gly Pro Gly Leu Ala Ser Pro Leu Gly Gly Leu Ala Leu Thr Pro

1155 1160 1165

Leu Ala His Thr Ser Pro Ala Val Ala Leu Gly Ala Ile Ser Gly Ile

1170 1175 1180

Ala Ala Ser Val Val Ala Ile Gly Leu Gly Ile Ala Ala Leu Ala Gly

1185 1190 1195 1200

Val Ala Leu Ala Leu Ala Gly Ser Leu Ile Ala Leu Gly Gly Leu Gly

1205 1210 1215

Leu Thr Gly Gly Thr Ile Leu Thr Pro

1220 1225

<210> 51

<211> 697

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 51

Met Ala Ala Met Leu Ala Gly Leu Cys Cys Val Leu Leu Leu Cys Gly

1 5 10 15

Ala Val Pro Val Ser Ala Ser Ser Ser Gly Cys Val Ala Leu Thr Thr

20 25 30

Ala Thr Gly Leu Pro Pro Ala Thr Thr Ala Ser Pro Thr Ala Gly Val

35 40 45

Thr Thr Pro Ala Leu Val Pro Ala Ser Ser Val Leu His Ser Thr Gly

50 55 60

Ala Leu Pro Leu Pro Pro Pro Ser Ala Val Thr Thr Pro His Ala Ile

65 70 75 80

His Val Ser Gly Thr Ala Gly Thr Leu Ala Pro Ala Ala Pro Val Leu

85 90 95

Pro Pro Ala Ala Gly Val Thr Pro Ala Ser Thr Gly Leu Ser Ala Ile

100 105 110

Ile Ala Gly Thr Ile Pro Gly Thr Thr Leu Ala Ser Leu Thr Gly Ser

115 120 125

Leu Leu Ile Val Ala Ala Ala Thr Ala Val Val Ile Leu Val Cys Gly

130 135 140

Pro Gly Pro Cys Ala Ala Pro Pro Leu Gly Val Thr Thr His Leu Ala

145 150 155 160

Ala Leu Ser Thr Met Gly Ser Gly Pro Ala Val Thr Ser Ser Ala Ala

165 170 175

Ala Cys Thr Pro Gly Thr Val Ser Gly Pro Pro Leu Met Ala Leu Gly

180 185 190

Gly Leu Gly Gly Ala Pro Leu Ala Leu Ala Gly Pro Val Pro Leu Ala

195 200 205

Ile Ala Gly Thr Pro Leu Ile Thr Ser Leu His Thr Pro Ile Ala Leu

210 215 220

Val Ala Ala Leu Pro Gly Gly Pro Ser Ala Leu Gly Pro Leu Val Ala

225 230 235 240

Leu Pro Ile Gly Ile Ala Ile Thr Ala Pro Gly Thr Leu Leu Ala Leu

245 250 255

His Ala Ser Thr Leu Thr Pro Gly Ala Ser Ser Ser Gly Thr Thr Ala

260 265 270

Gly Ala Ala Ala Thr Thr Val Gly Thr Leu Gly Pro Ala Thr Pro Leu

275 280 285

Leu Leu Thr Ala Gly Ala Gly Thr Ile Thr Ala Ala Val Ala Cys Ala

290 295 300

Leu Ala Pro Leu Ser Gly Thr Leu Cys Thr Leu Leu Ser Pro Thr Val

305 310 315 320

Gly Leu Gly Ile Thr Gly Thr Ser Ala Pro Ala Val Gly Pro Thr Gly

325 330 335

Ser Ile Val Ala Pro Pro Ala Ile Thr Ala Leu Cys Pro Pro Gly Gly

340 345 350

Val Pro Ala Ala Thr Ala Pro Ala Ser Val Thr Ala Thr Ala Ala Leu

355 360 365

Ala Ile Ser Ala Cys Val Ala Ala Thr Ser Val Leu Thr Ala Ser Ala

370 375 380

Ser Pro Ser Thr Pro Leu Cys Thr Gly Val Ser Pro Thr Leu Leu Ala

385 390 395 400

Ala Leu Cys Pro Thr Ala Val Thr Ala Ala Ser Pro Val Ile Ala Gly

405 410 415

Ala Gly Val Ala Gly Ile Ala Pro Gly Gly Thr Gly Leu Ile Ala Ala

420 425 430

Thr Ala Thr Leu Leu Pro Ala Ala Pro Thr Gly Cys Val Ile Ala Thr

435 440 445

Ala Ser Ala Ala Leu Ala Ser Leu Val Gly Gly Ala Thr Ala Thr Leu

450 455 460

Thr Ala Leu Pro Ala Leu Ser Ala Leu Leu Pro Pro Gly Ala Ala Ile

465 470 475 480

Ser Thr Gly Ile Thr Gly Ala Gly Ser Thr Pro Cys Ala Gly Val Gly

485 490 495

Gly Pro Ala Cys Thr Pro Pro Leu Gly Ser Thr Gly Pro Gly Pro Thr

500 505 510

Ala Gly Val Gly Thr Gly Pro Thr Ala Val Val Val Leu Ser Pro Gly

515 520 525

Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Leu Leu Ser Thr Ala

530 535 540

Leu Val Leu Ala Leu Cys Val Ala Pro Ala Pro Ala Gly Leu Thr Gly

545 550 555 560

Thr Gly Val Leu Thr Gly Ser Ala Leu Leu Pro Leu Pro Pro Gly Gly

565 570 575

Pro Gly Ala Ala Ile Ala Ala Thr Thr Ala Ala Val Ala Ala Pro Gly

580 585 590

Thr Leu Gly Ile Leu Ala Ile Thr Pro Cys Ser Pro Gly Gly Val Ser

595 600 605

Val Ile Thr Pro Gly Thr Ala Thr Ser Ala Gly Val Ala Val Leu Thr

610 615 620

Gly Ala Val Ala Cys Thr Gly Val Pro Val Ala Ile His Ala Ala Gly

625 630 635 640

Leu Thr Pro Thr Thr Ala Val Thr Ser Thr Gly Ser Ala Val Pro Gly

645 650 655

Thr Ala Ala Gly Cys Leu Ile Gly Ala Gly His Val Ala Ala Ser Thr

660 665 670

Gly Cys Ala Ile Pro Ile Gly Ala Gly Ile Cys Ala Ser Thr Gly Thr

675 680 685

Gly Thr Ala Ser Pro Ala Ala Ala Ala

690 695

<210> 52

<211> 74

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 52

gtctcagtcg ccgctgccag ctctcgcact ctgttcttcc gccgctccgc cgtcgcgttt 60

ctctgccggt cgca 74

<210> 53

<211> 83

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 53

acccggcgct ccattaaata gccgtagacg gaacttcgcc tttctctcgg ccttagcgcc 60

atttttttgg aaacctctgc gcc 83

<210> 54

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 54

ctctcttcca caggaggcct acacgccgcc gcttgtgctg cagcc 45

<210> 55

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 55

gggacatttg cttctgacac aactgtgttc actagcaacc tcaaacagac acc 53

<210> 56

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 56

gggaaataag agagaaaaga agagtaagaa gaaatataag agccacc 47

<210> 57

<211> 93

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 57

ccccccgagc gccgctccgg ctgcaccgcg ctcgctccga gtttcaggct cgtgctaagc 60

tagcgccgtc gtcgtctccc ttcagtcgcc atc 93

<210> 58

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 58

ctttccggcg gtgacgacct acgcacacga gaac 34

<210> 59

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 59

cgcctggccg gcgggctgag gcgtacgggt cgcacgcagc gcc 43

<210> 60

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 60

cgctcttatt ggccagggga cggtagctgc aggactctgc tctcctgcgg cc 52

<210> 61

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 61

ttccatttgg ctgcagcttc tggagggagc cgacaggaga cgtggggaga cg 52

<210> 62

<211> 47

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 62

gggaaauaag agagaaaaga agaguaagaa gaaauauaag agccacc 47

<210> 63

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 63

acatttgctt ctgacacaac tgtgttcact agcaacctca aacagacacc 50

<210> 64

<211> 132

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 64

gctcgctttc ttgctgtcca atttctatta aaggttcctt tgttccctaa gtccaactac 60

taaactgggg gatattatga agggccttga gcatctggat tctgcctaat aaaaaacatt 120

tattttcatt gc 132

<210> 65

<211> 306

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 65

atggaagcat taattgtttt gaacatgtaa atataaatct gtcagccact acagccatca 60

aaagagagca tctggaagaa cagccagctt ggaagtttta cagcaataat gttgcagtgg 120

aatattattt gtagttaagg tcatcctcct cccctttctg tttttttaaa tcaagaacta 180

cgttctgccc ctctcttggg cttcagaagc atctaagaaa agcagtcatc aattataatt 240

aactttcaaa gggcaagtca gaagttgttt ataaattaca aaataaaggc atattatgaa 300

ctctta 306

<210> 66

<211> 176

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 66

gaaaagactt cttccatcaa gcttaattgt tttgttattc atttaatgac tttccctgct 60

gttacctaat tacaaattgg atggaactgt gtttttttct gctttgtttt ttcagtttgc 120

tgtttctgta gccatattgt attctgtgtc aaataaagtc cagttggatt ctggaa 176

<210> 67

<211> 217

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 67

caaatgtggc aattattttg gatctatcac ctgtcatcat aactggcttc tgcttgtcat 60

ccacacaaca ccaggactta agacaaatgg gactgatgtc atcttgagct cttcatttat 120

tttgactgtg atttatttgg agtggaggca ttgtttttaa gaaaaacatg tcatgtaggt 180

tgtctaaaaa taaaatgcat ttaaactcat ttgagag 217

<210> 68

<211> 62

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 68

aagcactctg agtcaagatg agtgggaaac catctcaata aacacatttt ggataaatcc 60

tg 62

<210> 69

<211> 294

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 69

gcgctgggct gttttagtgc caggctgcgg tgggcagcca tgagaacaaa acctcttctg 60

tatttttttt ttccattagt aaaacacaag acttcagatt cagccgaatt gtggtgtctt 120

acaaggcagg cctttcctac agggggtgga gagaccagcc tttcttcctt tggtaggaat 180

ggcctgagtt ggcgttgtgg gcaggctact ggtttgtatg atgtattagt agagcaaccc 240

attaatcttt tgtagtttgt attaaacttg aactgagacc ttgatgagtc ttta 294

<210> 70

<211> 367

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 70

gaaaaatgaa aggaagttct gctgtcagag gcaaaacatc tgtttatcat agacatcaac 60

atgacctata agtaaagtgc gtgtctagtg tcttctattg agagtactac tattaattaa 120

gcttatttcc aatgtgcctt tttaatgctt gaagttttat ctacatacac aggtaacaga 180

ggacagtagt ctgtaaacat ataaatcggt cataactatc gtggtcttta tttctgtgag 240

gatctaggga aatttcatgt cacttccctc cttcactgca tcacaatcat attccctttt 300

ttttttcttg gatttgtgtc agttggatga tatcccctcc agatagtatc aataaaatgt 360

taaaatt 367

<210> 71

<211> 325

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 71

actccctcct cctgccactg gtgcctcgag tagccatggc aacgggccca gtgtccagtc 60

acttagaagt tccccccttg gccaaaaacc caattcacat tgagagctgg tgttgtctga 120

agttttcgta tcacagtgtt aacctgtact ctctcctgca aacctacaca ccaaagcttt 180

atttatatca ttccagtatc aatgctacac agtgttgtcc cgagcgccgg gaggcgttgg 240

gcagaaaccc tcgggaatgc ttccgagcac gctgtagggt atgggaagaa cccagcacca 300

ctaataaagc tgctgcttgg ctgga 325

<210> 72

<211> 252

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 72

ggtgacccgg ctgggtcggc cctgcccaag ggcctcccac cagagactgg gatgggaaca 60

ctggtgggca gctgaggaca caccccacac cccagcccac cctgctcctc ctgccctgtc 120

cctgtccccc tcccctccca gtcctccaga ccaccagccg ccccagcccc ttctcccagc 180

acacggctgc ctgacactga gccccacctc tccaagtctc tctgtgaata caattaaagg 240

tcctgccctc cc 252

<210> 73

<211> 308

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 73

accgctagct tgttgcaccg tggaggccac aggagcagaa acatggaatg ccagacgctg 60

gggatgctgg tacaagttgt gggactgcat gctactgtct agagcttgtc tcaatggatc 120

tagaacttca tcgccctctg atcgccgatc acctctgaga cccaccttgc tcataaacaa 180

aatgcccatg ttggtcctct gccctggacc tgtgacattc tggactattt ctgtgtttat 240

ttgtggccga gtgtaacaac catataataa atcacctctt ccgctgtttt agctgaagaa 300

ttaaatca 308

<210> 74

<211> 108

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 74

gcugccuucu gcggggcuug ccuucuggcc augcccuucu ucucucccuu gcaccuguac 60

cucuuggucu uugaauaaag ccugaguagg aagugagggu cuagaacu 108

<210> 75

<211> 132

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 75

gctcgctttc ttgctgtcca atttctatta aaggttcctt tgttccctaa gtccaactac 60

taaactgggg gatattatga agggccttga gcatctggat tctgcctaat aaaaaacatt 120

tattttcatt gc 132

<210> 76

<211> 720

<212> RNA

<213> Fluorescent protein (Fluorescent protein)

<400> 76

auggugagca agggcgagga gcuguucacc gggguggugc ccauccuggu cgagcuggac 60

ggcgacguaa acggccacaa guucagcgug uccggcgagg gcgagggcga ugccaccuac 120

ggcaagcuga cccugaaguu caucugcacc accggcaagc ugcccgugcc cuggcccacc 180

cucgugacca cccugaccua cggcgugcag ugcuucagcc gcuaccccga ccacaugaag 240

cagcacgacu ucuucaaguc cgccaugccc gaaggcuacg uccaggagcg caccaucuuc 300

uucaaggacg acggcaacua caagacccgc gccgagguga aguucgaggg cgacacccug 360

gugaaccgca ucgagcugaa gggcaucgac uucaaggagg acggcaacau ccuggggcac 420

aagcuggagu acaacuacaa cagccacaac gucuauauca uggccgacaa gcagaagaac 480

ggcaucaagg ugaacuucaa gauccgccac aacaucgagg acggcagcgu gcagcucgcc 540

gaccacuacc agcagaacac ccccaucggc gacggccccg ugcugcugcc cgacaaccac 600

uaccugagca cccaguccgc ccugagcaaa gaccccaacg agaagcgcga ucacaugguc 660

cugcuggagu ucgugaccgc cgccgggauc acucucggca uggacgagcu guacaaguaa 720

<210> 77

<211> 27

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 77

auguuccugc ugacuacaaa acggacu 27

<210> 78

<211> 66

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 78

gacgcuauga agaggggccu gugcugugug cugcugcugu gcggagcugu guucgugucc 60

aacagc 66

Claims (34)

1. A DNA sequence shown in SEQ NO:1 (SEQ ID NO:2 in the sequence Listing) or a sequence complementary thereto.

2. The DNA sequence of claim 1, further added with a sequence at the 5' end of the sequence, the added sequence being as set forth in SEQ NO:12 (SEQ ID NO:39 in the sequence Listing) or a sequence complementary thereto.

3. The DNA sequence of claim 1, further added with a sequence at the 5' end of the sequence, the added sequence being as set forth in SEQ NO:13 (SEQ ID NO:40 in the sequence Listing) or a sequence complementary thereto.

4. The DNA sequence of claim 1, further comprising an added sequence at the 3' end of the sequence, wherein the added sequence is as set forth in SEQ NO:14 (SEQ ID NO: 41 in the sequence Listing) or a sequence complementary thereto.

5. The DNA sequence of claim 1, further comprising an added sequence at the 3' end of the sequence, wherein the added sequence is as set forth in SEQ NO:15 (SEQ ID NO: 42 in the sequence Listing) or a sequence complementary thereto.

6. A DNA sequence as shown below: from the 5'-3' direction, the following are: as shown in SEQ NO:12 (SEQ ID NO:39 in the sequence Listing), a sequence shown as SEQ NO:13 (SEQ ID NO:40 in the sequence Listing), as shown in SEQ ID NO:1 (SEQ ID NO:2 in the sequence Listing), as shown in SEQ ID NO:14 (SEQ ID NO: 41 in the sequence Listing), a sequence shown as SEQ NO:15 (SEQ ID NO: 42 in the sequence Listing), or a sequence complementary thereto.

7. An mRNA sequence as shown in SEQ NO:1.1 (SEQ ID NO: 20 in the sequence Listing).

8. The mRNA sequence of claim 7, further comprising an added sequence at the 5' end of the sequence, wherein the added sequence is as set forth in SEQ NO:36-11 (SEQ ID NO: 62 in the sequence Listing).

9. The mRNA sequence of claim 7, further comprising an added sequence at the 5' end of the sequence, wherein the added sequence is as set forth in SEQ NO:36-12 (SEQ ID NO: 63 in the sequence Listing).

10. The mRNA sequence of claim 7, further comprising an added sequence at the 3' end of the sequence, wherein the added sequence is as set forth in SEQ NO:37-11 (SEQ ID NO: 74 in the sequence Listing).

11. The mRNA sequence of claim 7, further comprising an added sequence at the 3' end of the sequence, wherein the added sequence is as set forth in SEQ NO:37-12 (SEQ ID NO: 75 in the sequence Listing).

12. An mRNA sequence, said mRNA sequence being represented by: from the 5'-3' direction, the following are sequentially: as shown in SEQ NO:36-11 (SEQ ID NO: 62 in the sequence Listing), as shown in SEQ ID NO:1.1 (SEQ ID NO: 20 in the sequence Listing), a sequence shown as SEQ NO:37-11 (SEQ ID NO: 74 in the sequence Listing), and a polyA sequence.

13. An mRNA sequence, said mRNA sequence being as shown below: as shown in SEQ NO:36-12 (SEQ ID NO: 63 in the sequence Listing), as shown in SEQ NO:1.1 (SEQ ID NO: 20 in the sequence Listing), a sequence shown as SEQ NO:37-12 (SEQ ID NO: 75 in the sequence Listing), and a polyA sequence.

14. The mRNA sequence according to claim 12 or 13, wherein the polyA sequence is set forth in SEQ NO:15 (SEQ ID NO: 42 in the sequence Listing).

15. A coronavirus mRNA vaccine agent, said vaccine agent comprising mRNA, wherein the sequence of said mRNA is as defined in the mRNA sequence of any one of claims 7 to 14 or as defined in an mRNA sequence obtained by transcription of a DNA sequence of any one of claims 1 to 6.

16. The vaccine agent of claim 15, wherein the mRNA comprises modified nucleotides, wherein the modifications are selected from one or more of the following: 2-aminoadenosine, 2-thiothymidine, 3-methyladenosine, 5-methylcytidine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O (6) -methylguanine, pseudouridine, 2-thiouridine, and 2-thiocytidine; 2 '-fluororibose, 2' -deoxyribose; a phosphorothioate group and a 5' -N-phosphoramidite bond.

17. The vaccine agent of claim 15, wherein the mRNA comprises modified nucleotides, wherein the modifications are selected from one or more of the following: n-1-methyl-pseudouridine and C5-methylcytidine.

18. The vaccine agent of claim 15, wherein the mRNA comprises modified nucleotides, wherein the modification is N-1-methyl-pseudouridine.

19. The vaccine agent according to claim 18, wherein the modification ratio is 50%.

20. The vaccine agent of claim 15, further comprising a polymer that forms a core structure with the mRNA comprising a nucleotide polymer, the polymer being selected from one or more of the following polymers: polyacrylate, polyalkylcyanoacrylate, polylactide-polyglycolide copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, polyethyleneimine (PEI), or branched PEI.

21. The vaccine agent of claim 20, further comprising a liposome, wherein the core structure comprising the nucleotide polymer is encapsulated in the liposome to form a nanoparticle.

22. The vaccine agent of claim 15, further comprising a liposome, wherein the mRNA is liposome-encapsulated to form a nanoparticle.

23. The vaccine agent according to claim 21 or 22, wherein the liposome comprises one or more of the following lipids: cationic lipids, non-cationic lipids, sterol-based lipids, and PEG-modified lipids.

24. The vaccine agent of claim 23, wherein the cationic lipid comprises: c12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazolyl), HGT5000, HGT5001, OF-02, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA, DMDMA, DLenDMA, CLinDMA, cpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA or HGT4003; or a combination thereof.

25. The vaccine agent of claim 23, wherein the cationic lipid comprises DLin-K-XTC2-DMA.

26. The vaccine agent of claim 23, wherein the non-cationic lipid comprises ceramide, cephalin, cerebroside, diacylglycerol, 1,2-dipalmitoyl-sn-glycero-3-phosphorylglycerol sodium salt (DPPG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-distearoyl-sn-glycerol-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine (DPPC), 1,2-dioleyl-sn-glycerol-3-phosphoethanolamine (DOPE), 1,2-dioleyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), 4234 zxft-glycero-sn-glycero-3-phosphoethanolamine (DPE), phosphatidylglycerol-3-phosphatidylcholine-1' -phosphatidylethanolamine (DPE), phosphatidylglycerol-sn-3-phosphatidylethanolamine (DPE), or phosphatidylglycerol-3-phosphatidylethanolamine (DPE), or phosphatidylglycerol-1-3-phosphate (DPG-4264), or a combination thereof.

27. The vaccine agent of claim 23, the sterol-based lipids constituting no more than 70% of the total lipid in the lipid nanoparticle.

28. The vaccine agent of claim 23, wherein the sterol-based lipid comprises a phosphatidyl compound, a sphingolipid, or a combination thereof.

29. The vaccine agent of claim 23, wherein the sterol-based lipid comprises phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, or combinations thereof.

30. The vaccine agent of claim 23, the sterol-based lipid comprising a cerebroside, a ganglioside, or a combination thereof.

31. The vaccine agent of claim 23, wherein the PEG-modified lipid comprises DMG-PEG, DMG-PEG2K, C-PEG, DOGPEG, ceramide PEG, DSPE-PEG, or combinations thereof.

32. The vaccine agent of claim 15, further comprising:

protamine sulfate, DOPE, DSPE-mPEG2000 and M5, wherein the structure of M5 is as follows:

(M5)。

33. the vaccine agent of claim 32, wherein the mass ratio of M5: DOPE: DSPE-mPEG2000 is 49.

34. A DNA vaccine agent, said agent comprising DNA, wherein the sequence of said DNA is as set forth in the DNA sequence of any one of claims 1-6.

Images