WO2021153873A1 - Live attenuated vaccine strain for porcine epidemic diarrhea virus, composition comprising same, and method for preparing same - Google Patents

Abstract

The present invention relates to a live attenuated vaccine strain for porcine epidemic diarrhea virus, a composition comprising same, and a method for preparing same. More specifically, the present invention relates to: a live attenuated vaccine strain for porcine epidemic diarrhea virus, which is a monoclonal virus strain established by co-inoculating host cells with a plurality of gene-deficient virus strains derived from wild-type porcine epidemic diarrhea virus; a vaccine composition containing same; a method for producing same; and uses of same.

Description

Live swine epidemic diarrhea virus attenuated vaccine, composition comprising same, and method for preparing same

[Cross-reference to related applications]

This application claims priority to Korean Patent Application No. 10-2020-0012261 (application date: January 31, 2020), the contents of which are incorporated herein by reference in their entirety.

The present invention relates to a live attenuated swine epidemic diarrhea virus vaccine strain, a composition comprising the same, and a method for producing the same, and more particularly, a plurality of gene-defective virus strains derived from wild-type swine epidemic diarrhea virus are co-inoculated into host cells ( Co-inoculaton) and to a live attenuated swine epidemic diarrhea virus, a monoclonal virus strain, a vaccine composition containing the same, a method for preparing the same, and a use thereof.

Porcine Epidemic Diarrhea Virus (PEDV) is an RNA virus belonging to the coronavirus family and is an etiologic agent that causes Porcine Epidemic Diarrhea (PED). In general, the range of hosts infected with swine epidemic diarrhea virus is wide, such as humans, mice, pigs (wild boar), dogs, and cattle, and is mainly transmitted through respiratory infections.

Porcine epidemic diarrhea virus-infected disease occurs in pigs regardless of age. In addition, the swine epidemic diarrhea virus infection is characterized by inducing vomiting and weeping diarrhea in young pigs, especially suckling piglets, and in severe cases of infection, it may cause death of the piglets.

Pigs infected with the swine epidemic diarrhea virus show diarrhea for 1 to 2 days and heal themselves. Newborn piglets under 2 weeks of age infected with the swine epidemic diarrhea virus are known to have a high mortality rate.

The swine epidemic diarrhea virus proliferates in the mucous epithelial cells of the small intestine of young piglets after an incubation period of 1 to 2 days and causes diarrhea. In young piglets infected with swine epidemic diarrhea virus, when watery diarrhea progresses, the mucosal epithelial cells of the small intestine are removed, so even if the mother pig's milk is ingested, it is not absorbed well in the intestine and leads to diarrhea. If diarrhea continues in this way, malabsorption of nutrients in the small intestine of young piglets may occur, leading to dehydration and death. In order to alleviate symptoms such as malabsorption of nutrients and dehydration and to lower the mortality rate, young piglets must receive maternal antibody from gilts through colostrum of gilts.

The protective method of the swine epidemic diarrhea virus related to viral intestinal disease in piglets is to induce passive immunity of piglets with colostrum produced during childbirth by inoculating sows with a vaccine. In other words, it is possible to minimize diarrhea damage by inducing passive immunity of piglets with colostrum of sows.

Currently, a vaccine program frequently used in case of swine epidemic diarrhea in pig farms consists of artificial infection in which small intestine collected from piglets confirmed for swine epidemic diarrhea is ground and mixed with milk and administered orally to pregnant sows.

Artificial infection induces an immune response by administering Wild-type Porcine Epidemic Diarrhea Virus to pregnant sows. However, when the swine epidemic diarrhea virus is not completely eradicated and resides in pig farms and the antibody titer of young piglets born from pregnant sows that have acquired immunity is reduced, swine epidemic diarrhea disease is transmitted to pig farms. may recur in

Therefore, in order to eradicate the circulating infection and persistent infection caused by the swine epidemic diarrhea virus in pig farms, the need to prepare a live vaccine by attenuating the recently popular genotype G2b type swine epidemic diarrhea virus is emerging.

In general, continuous passage cultivation of a virus is performed for the production of a live attenuated vaccine, but it cannot be said that attenuation of the virus is necessarily achieved just because a large number of continuous passages are performed. Live attenuated vaccines must be produced by performing several hundred passages in host cells for many years, usually 3 to 4 years. However, it should be attenuated through animal testing every time so that it does not show pathogenic symptoms such as diarrhea. That is, a live attenuated vaccine is created when the specific gene sequence of a virus related to diarrheal disease (pathogenicity) is mutated, so the selection of the live attenuated vaccine takes a very long time.

The spike protein of the swine epidemic diarrhea virus includes an S1 domain and an S2 domain, and each domain plays a role in mediating the entry of the swine epidemic diarrhea virus into a host cell. Specifically, the S1 domain of the spike protein is involved in receptor binding of the host cell, and the S2 domain of the spike protein is involved in fusion with the host cell.

On the other hand, the spike protein serves to stimulate the induction of neutralizing antibodies in the native host. Therefore, the spike protein is a primary target for the development of an effective vaccine against swine epidemic diarrhea virus.

Under this technical background, the present inventors have been earnestly trying to develop a vaccine suitable for the genotype of the recently prevalent swine epidemic diarrhea virus. As a result, two gene-defective virus strains established by serial passage of wild-type swine epidemic diarrhea virus were co-inoculated into host cells by mixing them at a specific ratio based on the virus titer, and the single clone virus strain was attenuated. A chemical live vaccine strain (HSGP strain: KCTC14057BP) could be established. As a result of the gene sequence analysis, it was confirmed that the live attenuated vaccine strain was an attenuated genotype G2b virus produced by selectively deleting (deleting) a portion of the base sequence encoding each of the S1 and S2 domains of the spike gene. In addition, pigs orally administered (inoculated) with an optimized viral titer by successive passages of the live attenuated vaccine strain at a specific passage number have low proliferation of the swine epidemic diarrhea virus, diarrhea and vomiting, symptoms of infection with the swine epidemic diarrhea virus, and Since the same pathogenicity was not observed, it was confirmed that it was suitable as a live attenuated vaccine strain. In addition, it was confirmed that the neutralizing antibody titer in the blood was significantly increased in pigs inoculated with the live attenuated vaccine and maintained for a long period of time, so that the protective effect against the swine epidemic diarrhea virus was very excellent, and the present invention was completed.

[Prior art literature]

[Non-patent literature]

(Non-Patent Document 1) Lin et. al., Vet Microbiol., 201:62-71, 2017

(Non-Patent Document 2) Duarte et al., J Gen Virol., 75 (Pt 5): 1195-200, 1994

(Non-Patent Document 3) Kim et al., Arch Virol., 160(4):1055-64, 2015

(Non-Patent Document 4) Yang et al., J Vet Sci., 19(1):71-78, 2018

(Non-Patent Document 5) Lee et al., Virus Res., 149(2):175-82, 2010

An object of the present invention is to provide an effective novel swine epidemic diarrhea virus vaccine strain against the wild-type swine epidemic diarrhea virus that is frequently prevalent in Korea, more specifically the G2b genotype swine epidemic diarrhea virus, which is difficult to effectively protect with the existing vaccine strains. there is

Another object of the present invention is to provide a vaccine composition for preventing or treating porcine epidemic diarrhea virus comprising the novel porcine epidemic diarrhea virus vaccine strain of the present invention.

Another object of the present invention is to provide a method for preparing a novel swine epidemic diarrhea virus vaccine strain.

Another object of the present invention is to provide the use of a novel live swine epidemic diarrhea virus attenuated vaccine strain for the manufacture of a vaccine.

In order to achieve the above object, the present invention provides a live attenuated swine epidemic diarrhea virus virus strain, which is a monoclonal virus strain established by co-inoculating a host cell with a plurality of gene deletion strains derived from wild-type swine epidemic diarrhea virus.

The present invention also provides a vaccine composition for preventing infection of swine epidemic diarrhea virus comprising the live attenuated vaccine strain as an active ingredient.

The present invention also provides a method for preparing a live swine epidemic diarrhea virus attenuated vaccine,

(a) collecting a plurality of wild-type swine epidemic diarrhea virus;

(b) inoculating a host cell with one of the collected plurality of wild-type swine epidemic diarrhea virus, followed by successive subculture;

(c) establishing a gene-defective virus strain by confirming the cytopathic effect in the host cells of the porcine epidemic diarrhea virus obtained by the continuous subculture, the nucleotide sequence mutation of the spike gene, and the infection symptoms in the inoculated pig;

(d) repeating steps (b) and (c) to establish a plurality of gene-defective virus lines;

(e) co-inoculating the host cells with the plurality of gene-defective virus strains established in step (d); and

(f) the cytopathic effect in the host cell of the monoclonal viral strain obtained by plaque picking after the co-inoculation, the base sequence mutation of the spike gene, the virus titer in the host cell, the neutralizing antibody value in the inoculated pig, It provides a method for producing a live attenuated swine epidemic diarrhea virus vaccine comprising; establishing a live attenuated vaccine by checking whether the virus is propagated in the inoculated pig and the symptoms of infection in the inoculated pig.

The present invention also relates to the use of the live attenuated swine epidemic diarrhea virus vaccine strain in the production of a vaccine, preferably the virus of the live swine epidemic diarrhea virus attenuated vaccine strain for the production of antibodies to the swine epidemic diarrhea virus in mammals other than humans. Use as an antigen or as an immune response inducer of the live attenuated swine epidemic diarrhea virus vaccine in mammals other than humans is provided.

The live attenuated vaccine prepared by the manufacturing method according to the present invention, and a vaccine composition containing the same, can replace the artificial infection currently used in piggy farms to prevent infection with the swine epidemic diarrhea virus. There is an effect that can significantly improve the infection phenomenon of the resident wild-type swine epidemic diarrhea virus.

1 shows a gene tree diagram of a live attenuated vaccine strain (HSGP strain) and two gene deletion virus strains (HS strain and SGP-M1 strain) of the swine epidemic diarrhea virus according to the present invention.

2 shows a schematic diagram used to select the live attenuated vaccine strain (HSGP strain) according to the present invention. Specifically, two gene-defective virus strains (HS strain and SGP-M1 strain) were co-inoculated into host cells at a specific virus titer ratio and then cloned live attenuated vaccine strain candidates through plaque picking A schematic diagram of the selection is shown.

3 is a genomic structure (FIG. 3(a)) of the live attenuated vaccine strain (HSGP strain) according to the present invention, and HS, SGP-M1 and HSGP strains for the S1 domain and S2 domain of the spike protein, respectively. It is shown by numbering the amino acid sequence (brown marking: GE, FEKVHVQ) (FIG. 3(b)) and amino acid positions.

4 is a cytopathic effect (CPE) of the host cells inoculated with the live attenuated vaccine strain (HSGP strain) according to the present invention and the host cells inoculated with the gene-defective virus strain (HS strain and SGP-M1 strain) according to the present invention. It shows a syncytial plaque formed by syncytium formation according to.

5 shows the nucleus and cytoplasm of the host cells inoculated with the live attenuated vaccine strain (HSGP strain) according to the present invention and the host cells inoculated with the gene-defective virus strain (HS strain and SGP-M1 strain).

6 shows the virus titer according to the number of passages of the live attenuated vaccine strain (HSGP strain) according to the present invention.

7 (A) and (B) show changes in diarrhea and body weight of piglets (before inoculation: negative PEDV antibody reaction) inoculated with the live attenuated vaccine strain (HSGP strain) according to the present invention.

8 (A) and (B) are fecal matter and small intestine samples of mammalian piglets (before inoculation: PEDV antibody negative reaction) inoculated with the live attenuated vaccine strain (HSGP strain) according to the present invention. It shows the RNA copy number (RNA copy number) of the swine epidemic diarrhea virus.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is those well known and commonly used in the art.

As used herein, the term “about” used to express length, area, volume, time (period), concentration, content, etc. means that there is a tolerance of up to 10% in the corresponding numerical value or numerical range .

In one aspect, the present invention relates to a live attenuated swine epidemic diarrhea virus virus strain, which is a monoclonal virus strain established by co-inoculating a host cell with a plurality of gene deletion strains derived from a wild-type swine epidemic diarrhea virus.

"Virus strain with variant genes" according to the present invention is an S-INDEL PEDV (Spike-Insertion Deletion PEDV) strain in which a part of the base sequence of the spike gene among wild-type swine epidemic diarrhea viruses is mutated. The gene deletion virus strain may be a wild-type swine epidemic diarrhea virus isolated from the field, or it may be established by successive subculture of a wild-type swine epidemic diarrhea virus. The gene-defective virus strain exhibits a cytopathic effect and is a virus strain that exhibits infection (inoculation) symptoms in pigs.

"Live attenuated virus strain" according to the present invention is a virus strain without pathogenicity. The live attenuated vaccine strain is a strain established by co-inoculating host cells with a plurality of gene-defective strains. The live attenuated vaccine strain exhibits a different cytopathic effect (ie, a different plaque morphology upon inoculation of host cells) from the gene-defective strain, and is a viral strain that does not show symptoms of infection (inoculation) in pigs.

The live attenuated vaccine is subjected to serial passages at least once, preferably at least 5 times, more preferably at least 10 times, and most preferably at least 30 times in a host cell to 1 X 10 ^5.6 TCID ₅₀ /ml or more, preferably 1 X 10 ^6.4 TCID ₅₀ /ml or more, more preferably 1 X 10 ^6.6 TCID ₅₀ /ml or more, most preferably 1 X 10 ^7.5 TCID ₅₀ /ml or more It may be characterized in that it exhibits a higher virus titer.

The gene-deleted virus strain is a wild-type swine epidemic diarrhea virus in which a part of the nucleotide sequence of a virus gene is deleted, or optionally wild-type swine epidemic diarrhea virus is used 10 or more times, preferably 50 or more times, more preferably 80 times or more in a host cell. , most preferably, it may be characterized in that the porcine epidemic diarrhea virus is serially passaged in which some of the nucleotide sequences of the virus genes are deleted by serial passage of 100 or more times.

The nucleotide sequence of the viral gene may be a nucleotide sequence of a spike gene, preferably a nucleotide sequence encoding the S1 domain of the spike protein and/or a nucleotide sequence encoding the S2 domain of the spike protein.

The co-inoculation may be characterized in that it is inoculated with two or more gene deletion virus strains.

When the co-inoculation consists of two or more strains of the gene deletion virus, the mixing ratio between the strains of the gene deletion or more is TCID ₅₀ They can be characterized as being the same or different based on virus titer.

When the co-inoculation consists of two strains of the gene deletion virus, the mixing ratio between the two strains of the gene deletion virus is TCID ₅₀ Virus titer, preferably 1-9:9-1, more preferably 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1: based on _{TCID 50/ml} 7, 1 : 8, 1 : 9, or 2 : 1, 2 : 2, 2 : 3, 2 : 4, 2 : 5, 2 : 6, 2 : 7, 2 : 8, 2 : 9, or 3 : 1, 3 : 2, 3 : 3, 3 : 4, 3 : 5, 3 : 6, 3 : 7, 3 : 8, 3 : 9, or 4 : 1, 4 : 2, 4 : 3, 4: 4 , 4 : 5, 4 : 6, 4 : 7, 4 : 8, 4 : 9, or 5 : 1, 5 : 2, 5 : 3, 5 : 4, 5: 5, 5 : 6, 5: 7, 5: 8, 5:9, or 6: 1, 6: 2, 6: 3, 6: 4, 6: 5, 6: 6, 6: 7, 6: 8, 6:9, or 7: 1, 7: 2, 7: 3, 7: 4, 7: 5, 7: 6, 7: 7, 7: 8, 7: 9, or 8: 1, 8: 2, 8: 3, 8: 4, 8 : 5, 8 : 6, 8 : 7, 8 : 8, 8 : 9, or 9: 1, 9: 2, 9: 3, 9: 4, 9: 5, 9: 6, 9: 7, 9: 8, 9: 9, but is not limited thereto.

The co-inoculation may be characterized in that it is inoculated with the gene deletion virus strain deposited with the accession number KCTC14058BP and the gene deletion virus strain deposited with the accession number KCTC14056BP at the Korea Research Institute of Bioscience and Biotechnology Biological Resources Center (KCTC).

The live attenuated vaccine strain may have a nucleotide sequence of the S1 domain of the spike gene represented by SEQ ID NO: 1 and the nucleotide sequence of the S2 domain of the spike gene represented by SEQ ID NO: 2.

The live attenuated vaccine may be characterized in that it has the base sequence of the spike gene represented by SEQ ID NO: 3.

The live attenuated vaccine strain may have an amino acid sequence of the S1 domain of the spike protein represented by SEQ ID NO: 4 and the amino acid sequence of the S2 domain of the spike protein represented by SEQ ID NO: 5.

The live attenuated vaccine may be characterized in that it is entrusted with the accession number KCTC14057BP to the Korea Institute of Biotechnology and Biotechnology Biological Resources Center (KCTC).

Said host cells are monkey cells or porcine germ cells, preferably Vero cells (ATCC ^® CCL-81™), MARC-145 cells (ATCC ^® CRL-12231) and Swine testicular cells (ATCC ^® CRL-1746™). ) may be characterized in that at least one selected from the group consisting of.

In another aspect, the present invention relates to a vaccine composition for preventing infection with a swine epidemic diarrhea virus comprising the live attenuated vaccine strain or a viral antigen inactivated by the attenuated vaccine strain as an active ingredient.

The inactivation of the live attenuated vaccine can be accomplished through a known inactivation treatment method. For example, treatment with BEI (binary ethyleneimine) used for virus inactivation, or inactivation (inactivation) using formalin, glutaraldehyde, heating, irradiation, BPL or other inactivating agent (inactivating agent) known in the art )can do.

The inactivated viral antigen of the present invention is characterized in that it does not show a cytopathic effect after inoculation into monkey kidney cells or pig germ cells, preferably monkey kidney cells, most preferably Vero cells, and subculture for 3 days or more. can

As used herein, the term "vaccine" refers to a composition or formulation containing an immunogenic composition in a form that can be administered to an animal such as a vertebrate, preferably a mammal.

"Immunogenicity" of the immunogenic composition means the ability of the swine epidemic diarrhea virus to induce an immune response in the target animal (host animal) against the swine epidemic diarrhea virus, in particular the genotype G2b type swine epidemic diarrhea virus (action as an antigen). do. The immune response may be a cellular immune response mediated primarily by cytotoxic T-cells, or a humoral immune response mediated primarily by helper T-cells that activate B-cells to induce antibody production.

In particular, the term "immunogenic" refers to substances such as nucleic acids and polypeptides constituting the swine epidemic diarrhea virus that induce an immune response in the target animal (host animal), and humoral type (B cell) and/or cellular Substances capable of inducing a type (T cell) immune response have this property.

The composition may be characterized for the prevention, defense, prevention, improvement or treatment of infectious diseases caused by the swine epidemic diarrhea virus.

In addition to the live attenuated vaccine, the composition further comprises one or more commonly used pharmaceutically and/or veterinary acceptable carriers, diluents, adjuvants, antibiotics, immunomodulators (eg, cytokines), etc. can do.

The composition may be characterized for inducing an immune response to the swine epidemic diarrhea virus in mammals other than humans, preferably pigs.

The term "pig" includes all, but not limited to, male pigs, female pigs, male pigs, female piglets, mammalian pigs, pregnant pigs, lactating female pigs, pregnant pig fetuses, etc., but is not limited thereto. All included.

Whether pigs are infected (inoculated) with the swine epidemic diarrhea virus can be confirmed by Symptomology. Common symptoms of pigs infected (inoculated) with the swine epidemic diarrhea virus may include watery diarrhea, depression, loss of appetite, dehydration, etc., and preferably may be watery diarrhea, but is not limited thereto.

The precise dose of the live attenuated vaccine for inducing an immune response included in the composition means a dose (effective amount) capable of effectively inducing an immune response in pigs, and the term "effective amount (effective amount)" means that the composition is administered. A dose of the live attenuated vaccine sufficient to induce an immune response in pigs.

The immune response refers to induction of cellular immunity and/or humoral immunity, but is not limited thereto. The therapeutically effective dose of the live attenuated vaccine may vary depending on the condition and/or the degree of infection of the pig to be vaccinated, and may be determined by a skilled veterinarian.

As used herein, the term 'treatment' means alleviation or amelioration of symptoms, reduction of the scope of disease, delay or alleviation of disease progression, amelioration, alleviation or stabilization of disease state, partial or complete recovery, prolongation of survival, and other beneficial therapeutic results. is used in the meaning of including all

The composition may be administered through one or more routes of administration selected from the group consisting of oral, nasal, skin, muscle, rectal, vaginal, abdominal cavity, blood vessel, lymphatic, eye and brain, but is not limited thereto.

The "TCID ₅₀ (Tissue Culture Infective Dose 50%)" is an "infective unit" of a virus, and is defined as an amount necessary to infect or kill 50% of a cell or tissue culture. Briefly describing the calculation method of the TCID ₅₀ , first, a virus sample is serially diluted, and each diluted virus sample is cultured in the same number in each well of a cell culture plate (eg, 96-well plate). After infection by addition to host cells, the number of wells exhibiting cell lesions is checked, and the TCID ₅₀ value of the final virus is calculated as the reciprocal of the dilution rate representing cell lesions at 50% of the number of wells.

In another aspect, the present invention provides a method for producing a live swine epidemic diarrhea virus attenuated vaccine,

(a) collecting a plurality of wild-type swine epidemic diarrhea virus;

(b) inoculating a host cell with one of the collected plurality of wild-type swine epidemic diarrhea virus, followed by successive subculture;

(c) establishing a gene-defective virus strain by confirming the cytopathic effect in the host cells of the porcine epidemic diarrhea virus obtained by the continuous subculture, the nucleotide sequence mutation of the spike gene, and the infection symptoms in the inoculated pig;

(d) repeating steps (b) and (c) to establish a plurality of gene-defective virus lines;

(e) co-inoculating the host cells with the plurality of gene-defective virus strains established in step (d); and

(f) the cytopathic effect in the host cell of the monoclonal viral strain obtained by plaque picking after the co-inoculation, the base sequence mutation of the spike gene, the virus titer in the host cell, the neutralizing antibody value in the inoculated pig, It relates to a method for producing a live attenuated swine epidemic diarrhea virus vaccine comprising; establishing a live attenuated vaccine by confirming whether the virus is propagated in the inoculated pig and the symptoms of infection in the inoculated pig.

The host cells inoculated with the live attenuated vaccine may be characterized in that they exhibit a different cytopathic effect (ie, a different plaque form upon inoculation of the host cells) than the gene-defective virus strain.

The live attenuated vaccine strain can form a syncytial plaque by syncytial formation according to a unique cytopathic effect different from the gene-defective virus strain. As an example, as shown in FIG. 4 of the present specification, the gene-defective virus strain can form a syncytial plaque composed of elongated cells or a syncytial plaque composed of bead-like cells, and live attenuated vaccine The strain may form other unstructured syncytium plaques with these.

The live attenuated vaccine is subjected to serial passages at least once, preferably at least 5 times, more preferably at least 10 times, and most preferably at least 30 times in a host cell to 1 X 10 ^5.6 TCID ₅₀ /ml or more, preferably 1 X 10 ^6.4 TCID ₅₀ /ml or more, more preferably 1 X 10 ^6.6 TCID ₅₀ /ml or more, and most preferably 1 X 10 ^7.5 TCID ₅₀ /ml or more. can

The gene-deleted virus strain is a wild-type swine epidemic diarrhea virus in which a part of the nucleotide sequence of a virus gene is deleted, or optionally wild-type swine epidemic diarrhea virus is used 10 or more times, preferably 50 or more times, more preferably 80 times or more in a host cell. , most preferably, it may be characterized in that the porcine epidemic diarrhea virus is serially passaged in which some of the nucleotide sequences of the virus genes are deleted by serial passage of 100 or more times.

The nucleotide sequence of the viral gene may be a nucleotide sequence of a spike gene, preferably a nucleotide sequence encoding the S1 domain of the spike protein and/or a nucleotide sequence encoding the S2 domain of the spike protein.

The co-inoculation may be characterized in that it is inoculated with two or more gene deletion virus strains.

When the co-inoculation consists of two or more strains of the gene deletion virus, the mixing ratio between the strains of the gene deletion or more is TCID ₅₀ They can be characterized as being the same or different based on virus titer.

When the co-inoculation consists of two strains of the gene deletion virus, the mixing ratio between the two strains of the gene deletion virus is TCID ₅₀ Virus titer, preferably 1-9:9-1, more preferably 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1: based on _{TCID 50/ml} 7, 1 : 8, 1 : 9, or 2 : 1, 2 : 2, 2 : 3, 2 : 4, 2 : 5, 2 : 6, 2 : 7, 2 : 8, 2 : 9, or 3 : 1, 3 : 2, 3 : 3, 3 : 4, 3 : 5, 3 : 6, 3 : 7, 3 : 8, 3 : 9, or 4 : 1, 4 : 2, 4 : 3, 4: 4 , 4 : 5, 4 : 6, 4 : 7, 4 : 8, 4 : 9, or 5 : 1, 5 : 2, 5 : 3, 5 : 4, 5: 5, 5 : 6, 5: 7, 5: 8, 5:9, or 6: 1, 6: 2, 6: 3, 6: 4, 6: 5, 6: 6, 6: 7, 6: 8, 6:9, or 7: 1, 7: 2, 7: 3, 7: 4, 7: 5, 7: 6, 7: 7, 7: 8, 7: 9, or 8: 1, 8: 2, 8: 3, 8: 4, 8 : 5, 8 : 6, 8 : 7, 8 : 8, 8 : 9, or 9: 1, 9: 2, 9: 3, 9: 4, 9: 5, 9: 6, 9: 7, 9: 8, 9: 9, but is not limited thereto.

The plurality of gene deletion virus strains may be characterized in that they are two or more types of gene deletion virus strains having different nucleotide sequences of the spike gene.

The live attenuated vaccine is the accession number KCTC14057BP established by co-inoculating host cells with the gene deletion virus strain deposited with the accession number KCTC14056BP and the gene deletion virus strain deposited with the accession number KCTC14058BP at the Korea Institute of Biotechnology and Biotechnology Biological Resources Center (KCTC). It may be characterized as a deposited live, attenuated vaccine.

Said host cells are monkey cells or porcine germ cells, preferably Vero cells (ATCC ^® CCL-81™), MARC-145 cells (ATCC ^® CRL-12231) and Swine testicular cells (ATCC ^® CRL-1746™). ) may be characterized in that at least one selected from the group consisting of.

In another aspect, the present invention provides a method for producing a live swine epidemic diarrhea virus attenuated vaccine,

(a) Among the swine epidemic diarrhea viruses that cause infection symptoms in pigs, the first strain having a mutation in the nucleotide sequence encoding the S1 domain of the spike protein and the nucleotide sequence encoding the S2 domain of the spike protein Mixing the second virus strain with a TCID ₅₀ /ml of 1 to 9: 9 to 1 based on the virus titer, and then co-inoculating the host cells; and

(b) mutation of the base sequence encoding the S1 domain of the spike protein in the first strain among the virus strains obtained by plaque picking after the co-inoculation and the spike protein in the second strain It has all the mutations of the nucleotide sequence encoding the S2 domain, and exhibits a viral titer of ^{1 X 10 5.6} TCID ₅₀ /ml or more, preferably 1 X 10 ^5.6 ~ 1 X 10 ^7.5 TCID _{50 /ml in the host cell, and inoculated} The neutralizing antibody titer in pigs is improved 4 times or more, preferably 4 to 32 times compared to before inoculation, virus proliferation in inoculated pigs is suppressed, and a virus strain that does not cause infection symptoms in inoculated pigs is attenuated live vaccine Including;

The infection symptom relates to a method for producing a live attenuated swine epidemic diarrhea virus vaccine, characterized in that at least one selected from the group consisting of watery diarrhea, vomiting, depression, anorexia and dehydration symptoms.

The first virus strain having a base mutation in the nucleotide sequence encoding the S1 domain of the spike protein is a gene-defective virus strain entrusted to the Korea Research Institute of Bioscience and Biotechnology (KCTC) with accession number KCTC14058BP, and the S2 domain of the spike protein is The second virus strain having a base mutation in the coding nucleotide sequence may be characterized as a gene deletion virus strain deposited with accession number KCTC14056BP, but is not limited thereto.

The live attenuated vaccine is the accession number KCTC14057BP established by co-inoculating host cells with the gene deletion virus strain deposited with the accession number KCTC14056BP and the gene deletion virus strain deposited with the accession number KCTC14058BP at the Korea Institute of Biotechnology and Biotechnology Biological Resources Center (KCTC). It may be characterized as a deposited live, attenuated vaccine.

Said host cells are monkey cells or porcine germ cells, preferably Vero cells (ATCC ^® CCL-81™), MARC-145 cells (ATCC ^® CRL-12231) and Swine testicular cells (ATCC ^® CRL-1746™). ) may be characterized in that at least one selected from the group consisting of.

The live attenuated vaccine may be characterized in that it has the base sequence of the spike gene represented by SEQ ID NO: 3,

The live attenuated vaccine line may be characterized in that it has the nucleotide sequence of the S1 domain of the spike gene represented by SEQ ID NO: 1 and the nucleotide sequence of the S2 domain of the spike gene represented by SEQ ID NO: 2,

The live attenuated vaccine strain may have an amino acid sequence of the S1 domain of the spike protein represented by SEQ ID NO: 4 and the amino acid sequence of the S2 domain of the spike protein represented by SEQ ID NO: 5.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

[Example 1]: Establishment of live swine epidemic diarrhea virus attenuated vaccine strain

[1-1]: Recently popular wild type swine epidemic diarrhea virus Isolation and establishment of gene-defective strains

Establishment of HS strain, a gene-defective virus strain

The wild-type swine epidemic diarrhea virus used to establish the HS strain was filtered by mixing the small intestine of piglets that showed swine epidemic diarrhea disease at a pig farm in Hongseong-gun, Chungcheongnam-do in 2017, when a swine epidemic diarrhea occurred, and Vero cells (ATCC ^® CCL) after trypsinization. -81™) was a genotype G2b type strain isolated by inoculation.

Specifically, as shown in FIG. 3, the HS line has 6 base sequences (TTGGTG) in the 164 to 169 bp region of the S1 domain included in the spike gene from the time of isolation after inoculation of the wild-type swine epidemic diarrhea virus into Vero cells (TTGGTG). deletion) was confirmed. The isolated wild-type swine epidemic diarrhea virus was passaged 10 times to secure a sufficient amount of virus for deposit, and then deposited as PEDV HS strain at the Korea Research Institute of Bioscience and Biotechnology (KCTC) as follows. In addition, it was confirmed that even if the wild-type swine epidemic diarrhea virus was passed 100 successively, the base sequence was continuously maintained in a deleted state. That is, the amino acid sequence according to the spike base sequence (SEQ ID NO: 6) of the standard PEDV Strain USA/Colorado/2013 (GenBank number: KF272920.1; https://www.ncbi.nlm.nih.gov/nuccore/KF272920) As a reference, the HS strain is a genotype G2b type isolate characterized by a deletion in two amino acids included in the S1 domain of the spike protein, namely, glycine (G) at the 55th amino acid and glutamic acid (E) at the 56th amino acid. On the other hand, even if the HS strain was inoculated into Vero cells and passaged up to 130 generations, no additional base mutation was confirmed for the genes of the HS strain.

The gene-defective virus strain (HS strain) was named 'Porcine Epidemic Diarrhea Virus (HS) strain' and deposited at the Korea Institute of Biotechnology and Biotechnology Biological Resources Center (KCTC). has been registered

In addition, a Viability Statement for HS stocks listed as KCTC14058BP was also issued by KCTC on January 3, 2020.

Establishment of SGP-M1 strain, a gene-defective virus strain

The wild-type swine epidemic diarrhea virus used to establish the SGP-M1 strain was isolated from the small intestine and feces of piglets exhibiting swine epidemic diarrhea at a farm in Gimpo, Gyeonggi-do in 2018, when the swine epidemic diarrhea occurred, and trypsinized and inoculated into Vero cells. It was a G2b type week.

Specifically, as shown in FIG. 3, the SGP-M1 strain was established by inoculating Vero cells with the wild-type swine epidemic diarrhea virus and then establishing 80 successive passages as follows. ) was deposited. As a result of the gene sequence analysis, unlike the nucleotide sequence of the S2 domain included in the spike gene of the isolated wild-type swine epidemic diarrhea virus, the SGP-M1 strain has 2 nucleotide sequences ( TT) was confirmed to be missing (deletion). That is, the amino acid sequence according to the spike nucleotide sequence (SEQ ID NO: 6) of the standard PEDV Strain USA/Colorado/2013 (GenBank number: KF272920.1; https://www.ncbi.nlm.nih.gov/nuccore/KF272920) As a standard, the SGP-M1 strain contains seven amino acids included in the S2 domain of the spike protein, namely, the 1380 amino acid phenylalanine (F), the 1381 amino acid glutamic acid (E), the 1382 amino acid lysine (K), the 1383 amino acid It is a genotype G2b type isolate characterized by deletion of valine (V), histidine (H) at the 1384th amino acid, valine (V) at the 1385th amino acid, and glutamine (Q) at the 1386th amino acid. On the other hand, even if the SGP-M1 strain was inoculated into Vero cells and passaged up to 140 generations, no additional base mutation was confirmed for the genes of the SGP-M1 strain.

The gene-defective virus strain (SGP-M1 strain) was named 'Porcine Epidemic Diarrhea Virus SGP-M1 strain' and deposited at the Korea Research Institute of Biotechnology and Biotechnology Biological Resources Center (KCTC). It was registered as KCTC14056BP.

In addition, the survival certificate of the SGP-M1 strain registered as KCTC14056BP was also issued by KCTC on December 17, 2019.

It was Lin et. al., Vet Microbiol ., 201:62-71, 2017. According to the above paper, it is described that live attenuated vaccine candidates for swine epidemic diarrhea virus have a spike gene in which a part of the base sequence is deleted in common.

The medium used for the establishment of the gene deletion strain of the wild-type swine epidemic diarrhea virus above was TPB (Tryptose Phosphate Broth solution, Sigma Cat no. T8159), YES (Yeast Extract Solution, Gibco Cat no. 18180-059) and 2.5% trypsin ( α-MEM (alpha-Minimum Essential Medium, Gibco Cat no. 12561-056) containing 10X Trypsin; Gibco Cat no. 15090-046).

[1-2]: Confirmation of the cytopathic effect of the established gene-defective strain

In order to confirm the difference in cytopathic effect (CPE) between the HS strain and the SGP-M1 strain, which are the gene-defective virus strains established in [1-1] of Example 1, the HS strains and the SGP-M1 strains were injected into Vero cells 1 X, respectively. After inoculation with a virus titer of 10 ^5.0 TCID ₅₀ /ml, the cytopathic effect was observed under an optical microscope (EVOS, Thermofisher) at 100X magnification.

As a result, as shown in FIG. 4, the HS strain formed syncytial plaques composed of elongated cells, while the SGP-M1 strain was shown to form syncytial plaques composed of bead-shaped cells. It was confirmed that there was a difference in the cytopathic effect between weeks.

[1-3]: Plaque assay for the selection of live attenuated vaccines

In order to select a live attenuated vaccine strain, the HS strain and SGP-M1 strain established in [1-1] of Example 1 were co-inoculated into Vero cells at a specific virus titer ratio, and then the attenuated strain was performed through plaque picking. was selected by cloning (see Table 1 and FIG. 2 below).

First, materials necessary for the plaque assay were prepared as shown in (1) to (3) below.

(1) agarose gel: agarose solution (25ml) in 2X medium (50ml), antibiotic-antimycotic (100X Antibiotic-Antimycotic; Gibco Cat no. 15240-062), MEM NEAAS (MEM Non-Essential Amino Acids Solution; Gibco Cat no. 11140-076) and 2.5% Trypsin (10X Trypsin [10 μg/ml]; Gibco Cat no. 15090-046).

(2) Agarose solution: 0.75 g of agarose (UltraPure™ LMP Agarose, Invitrogen Cat no. 16520-100) was added to 25 ml purified water (UltraPure™ DNase/RNase-Free Distilled Water, Invitrogen Cat no. 10977-015). After autoclaving at about 120° C. for about 15 minutes, it was prepared by storing it in a water bath adjusted to a temperature of 45° C.

(3) 2X medium was prepared by dissolving 13.4g DMEM (Dulbecco's Modified Eagle Medium, Gibco Cat no. 12100-046) and 3.75g sodium bicarbonate (Sodium bicarbonate, Sigma Cat no. S5761) in 500ml purified water and then filtering .

Specifically, as shown in Figure 2, based on the virus titer (TCID ₅₀ /ml) HS strain: SGP-M1 strain = 1: 1, 1: 2, 1: 3, 1: 4, 1: 5, 1: 6, 1 : 7, 1 : 8, 1 : 9, or 2 : 1, 2 : 2, 2 : 3, 2 : 4, 2 : 5, 2 : 6, 2 : 7, 2 : 8, 2 : 9 , or 3 : 1, 3 : 2, 3 : 3, 3 : 4, 3 : 5, 3 : 6, 3 : 7, 3 : 8, 3 : 9, or 4 : 1, 4: 2, 4: 3 , 4 : 4, 4 : 5, 4 : 6, 4 : 7, 4 : 8, 4 : 9, or 5 : 1, 5 : 2, 5 : 3, 5: 4, 5: 5, 5: 6, 5 : 7, 5 : 8, 5 : 9, or 6 : 1, 6 : 2, 6: 3, 6 : 4, 6: 5, 6 : 6, 6: 7, 6: 8, 6 : 9, or 7: 1, 7: 2, 7: 3, 7: 4, 7: 5, 7: 6, 7: 7, 7: 8, 7: 9, or 8: 1, 8: 2, 8: 3, 8 : 4, 8 : 5, 8 : 6, 8 : 7, 8 : 8, 8 : 9, or 9: 1, 9: 2, 9: 3, 9: 4, 9: 5, 9: 6, 9: Each of the mixed virus samples was prepared at 7, 9: 8, and 9: 9 (Table 1 below is an example, and only a part of the HS strain: SGP-M1 strain virus titer mixing ratio shown in FIG. 2) shown). Then, each of the mixed virus samples was co-inoculated into Vero cells seeded in a 6-well plate. One hour after inoculation, the supernatant containing the mixed virus sample was removed, and Vero cells were washed once with PBS (Phosphate buffered saline). Then, 5 ml of agarose gel (agarose gel: agarose solution, 2X medium, antibiotic-antifungal solution, MEM NEAAS and 2.5% trypsin mixture) per well is put on the Vero cells and applied until it hardens for 1 hour at room temperature. After standing, it was cultured for 3 days in a 37°C/5% incubator. After 3 days of culture, when a cytopathic effect (CPE) appeared in Vero cells inoculated with a mixed virus sample, plaque picking was performed.

Mixing ratio of virus titers for HS strains and SGP-M1 strains	Virus titer of SGP-M1 strain (TCID 50 /ml)	Virus titer of HS strain (TCID 50 /ml)
HS strain: SGP-M1 strain = 1:1	1.0 X 10 5	1.0 X 10 5
HS strain: SGP-M1 strain = 1: 2	1.0 X 10 5	2.0 X 10 5
HS stock: SGP-M1 stock = 1: 3	1.0 X 10 5	3.0 X 10 5
HS stock: SGP-M1 stock = 1: 4	1.0 X 10 5	4.0 X 10 5
HS stock: SGP-M1 stock = 1: 5	1.0 X 10 5	5.0 X 10 5
HS strain: SGP-M1 strain = 1 : 6	1.0 X 10 5	6.0 X 10 5
HS stock: SGP-M1 stock = 1: 7	1.0 X 10 5	7.0 X 10 5
HS stock: SGP-M1 stock = 1: 8	1.0 X 10 5	8.0 X 10 5
HS strain: SGP-M1 strain = 1 : 9	1.0 X 10 5	9.0 X 10 5
SGP-M1 strain: HS strain = 1:1	1.0 X 10 5	1.0 X 10 5
SGP-M1 strain: HS strain = 1: 2	1.0 X 10 5	2.0 X 10 5
SGP-M1 strain: HS strain = 1:3	1.0 X 10 5	3.0 X 10 5
SGP-M1 strain : HS strain = 1 : 4	1.0 X 10 5	4.0 X 10 5
SGP-M1 strain: HS strain = 1: 5	1.0 X 10 5	5.0 X 10 5
SGP-M1 strain : HS strain = 1 : 6	1.0 X 10 5	6.0 X 10 5
SGP-M1 strain : HS strain = 1 : 7	1.0 X 10 5	7.0 X 10 5
SGP-M1 strain: HS strain = 1:8	1.0 X 10 5	8.0 X 10 5
SGP-M1 strain: HS strain = 1 : 9	1.0 X 10 5	9.0 X 10 5

As a result, as shown in FIG. 4, SGP-M1 strain: HS strain was 1 : 9 (SGP-M1 strain: 1 X 10 ⁵ TCID ₅₀ /ml, HS strain: 9 X 10 ⁵ TCID ₅₀ /ml), it was confirmed that various types of cytopathic effect (CPE) appeared in the inoculated Vero cells. Among the various types of cytopathic effects, CPE plaques with cytopathic effects specific to each of the HS and SGP-M1 strains were excluded. Picking (stock solution collection) was performed. The stock solution, and a solution diluted 10-fold, 100-fold, and 1,000-fold in the stock solution (dilution solvent: DMEM (Dulbecco's Modified Eagle Medium, Gibco Cat no. 12100-046)) was used as an inoculum and 6- 1 day before inoculation Vero cells seeded in well plates were inoculated.

After 1 hour of inoculation, the supernatant containing the inoculum was removed, and 5 ml of agarose gel per well was applied and left to harden for 1 hour at room temperature, and then cultured for 3 days in a 37° C./5% incubator. . After 3 days of culture, CPE plaques were picked again, and after this picking-inoculation was performed 4 to 5 times in a row, the final CPE plaques (single clones) were picked with the live attenuated vaccine strain. The nuclei of cells contained in CPE plaques (single clones) picked with the live attenuated vaccine were stained with DAPI (Cat no. After staining, the overall appearance of the cells under an optical microscope (EVOS, Thermofisher) at 100X magnification was observed in differential interference contrast (DIC) mode, and two images of DAPI and FA were merged and observed under a fluorescence microscope (Nikon). did.

As a result, as shown in FIGS. 4 and 5 , the live attenuated vaccine strain (hereinafter referred to as the HSGP strain) has elongated cells due to the formation of syncytium according to CPE, which is a unique aspect different from the HS and SGP-M1 strains. It was confirmed to form unstructured syncytium plaques, not syncytial plaques composed of or bead-like cells.

In addition, as a result of the analysis of the gene sequence, as shown in FIG. 3, the standard PEDV Strain USA/Colorado/2013 (GenBank number: KF272920.1; https://www.ncbi.nlm.nih.gov/nuccore/KF272920) The HSGP strain, a live attenuated vaccine strain based on the spike sequence (SEQ ID NO: 6) of As a result, it was confirmed that two amino acids included in the S1 domain of the spike protein, that is, glycine (G) at the 55th amino acid and glutamic acid (E) at the 56th amino acid were deleted. In addition, the HSGP strain has a deletion (deletion) of two nucleotide sequences (TT) in the 4,136-4,137 bp region of the S2 domain included in the spike gene in the same way as in the SGP-M1 strain, resulting in 7 included in the S2 domain of the spike protein. amino acids: phenylalanine at the 1380th amino acid (F), glutamic acid at the 1381th amino acid (E), lysine at the 1382th amino acid (K), valine at the 1383th amino acid (V), histidine at the 1384th amino acid (H), 1385 It was confirmed that the th amino acid valine (V) and the 1386 th amino acid glutamine (Q) were deleted.

The live attenuated vaccine strain (HSGP) was named 'Porcine Epidemic Diarrhea Virus HSGP strain' and deposited at the Korea Institute of Biotechnology and Biotechnology Biological Resources Center (KCTC).

In addition, the survival certificate of HSGP listed as KCTC14057BP was also issued by KCTC on December 26, 2019.

[Example 2]: Animal test evaluation of live attenuated vaccine

[2-1]: attenuation of live vaccine (HSGP) according to cell adaptability elevated virus titer Confirm

Viral passage using the live attenuated vaccine strain (HSGP) selected/established through plaque picking in Example 1 as a master seed virus for vaccine production (passage at intervals of 3 to 4 days after inoculation of the live attenuated vaccine) The change in the virus titer (virus content) according to each passage was confirmed by the following virus titer measurement method.

Virus titer assay

For confirmation of the viral titer against the live attenuated vaccine strain (HSGP strain), Vero cells seeded as a monolayer in a 96-well plate were prepared, and then the live attenuated vaccine strain (HSGP strain) was treated with a decimal 100 μl of the diluted solution was put into a well containing Vero cells and incubated in a 37° C./5% incubator for 1 hour to inoculate Vero cells. Then, the inoculated Vero cells were washed twice with PBS, and 100 μl of serum-free DMEM was added per well. After 2-3 days, the cytopathic effect (CPE) was observed to measure the virus titer. .

As a result, as shown in FIG. 6 , it was confirmed that the virus titer significantly increased as the number of passages of the live attenuated vaccine strain (HSGP strain) increased. Specifically, the live attenuated vaccine strain (HSGP ^{strain) exhibited a virus titer of 1 X 10 5.6} TCID ₅₀ /ml at one passage (1st passage), but 5 passages (5th passage) ) exhibited a virus titer of 1 X 10 ^6.4 TCID ₅₀ / ml when 10 times passaged (10 passages: when the 10th passage) exhibited a virus titer of _{^{1 X 10 6.6 TCID 50 / ml}} , 30 times passaged ( Passage 30: It was confirmed that the virus titer of ^{1 X 10 7.5} TCID ₅₀ /ml when the 30th passage) was performed.

In addition, according to the analysis result of the gene sequencing of the live attenuated vaccine strain (HSGP strain) passed every 5 generations, the S1 domain included in the spike gene of the live attenuated vaccine strain (HSGP strain) passed over 1 to 30 generations It was confirmed that the deletion nucleotide sequence included in each domain of the S2 domain was kept constant.

[2-2]: Confirmation of pathogenicity of live attenuated vaccine strain (HSGP strain) for piglets

The vaccine suitability of the live attenuated vaccine (HSGP strain) was reviewed by orally administered to 5-day-old piglets (pre-administration: PEDV antibody negative reaction) to determine the presence or absence of pathogenicity.

As an experimental group, a live attenuated vaccine strain (HSGP strain) passaged 30 times in [2-1] of Example 2 (30th passage) was used, and as a comparative group, 100 passages of HS strain and 100 passages were used. Each passaged SGP-M1 strain was used. 10 lactating piglets (5 days old) were divided into 5 groups (2 heads/group), and 4 groups of them were each HSGP strain (final virus antigen amount: 1 x 10 ⁶ TCID ₅₀ /dose, 1 x 10 ⁵ TCID ₅₀ /dose) , HS strain (final viral antigen amount: 1 X 10 ⁵ TCID ₅₀ /dose) and SGP-M1 strain (final viral antigen amount: 1 X 10 ⁵ TCID ₅₀ /dose) were orally administered, and the remaining 1 group was treated as a negative control (Negative Control). [NC]: virus non-administered group) (see Table 2). During clinical observation of orally administered piglets for 6 days after oral administration, the weight of the piglets was measured and feces were collected. After 7 days of inoculation, the piglets were autopsied and the lesions were observed clinically (diarrhea, weight change, and activity). change), and feces and small intestine were collected.

inoculated virus strain	pig head	Inoculation (TCID 50 /dose)	Inoculation method (inoculation volume)	observation period
HSGP(10 6 )	2	1.0 X 10 6	Oral (3ml)	7 days
HSGP(10 5 )	2	1.0 X 10 5	Oral (3ml)	7 days
HS	2	1.0 X 10 5	Oral (3ml)	7 days
SGP-M1	2	1.0 X 10 5	Oral (3ml)	7 days
N.C.	2	1.0 X 10 5	Oral (3ml)	7 days

[2-2-1]: Attenuation for piglets After inoculation of vaccines shares (HSGP State) confirm the presence or absence of diarrhea

Whether diarrhea was induced in 5-day-old piglets orally administered with the live attenuated vaccine (HSGP) was confirmed by scoring the degree of diarrhea.

The degree of diarrhea was determined by a Diarrhea scoring of 0 to 3 points. Here, 0 indicates normal feces (no diarrhea), 1 indicates mild diarrhea, 2 indicates moderate diarrhea, and 3 indicates strong diarrhea (watery diarrhea). it has been shown

As a result, as shown in FIG. 7A, the group of piglets (1 X 10 ⁶ TCID ₅₀ /dose, 1.0 X 10 ⁵ TCID ₅₀ /dose) orally administered the live attenuated vaccine (HSGP strain) was orally administered It was confirmed that there was no diarrhea (0 points) for 5 days after administration (negative control group (NC: non-administered group): no diarrhea [0 points]).

On the other hand, it was confirmed that the group of piglets orally administered the HS strain had watery diarrhea (3 points) for 2 to 4 days after oral administration (similar to the diarrheal disease-inducing form of wild-type swine epidemic diarrhea virus). In addition, it was confirmed that the group of piglets orally administered SGP-M1 had watery diarrhea up to 3 days after oral administration (3 points), and mild diarrhea from the 4th day after oral administration (1 point) ), and the degree of diarrhea was alleviated.

[2-2-2]: Attenuation for piglets Check weight change and activity after inoculation of live vaccine (HSGP)

First, the weight gain and loss trend of 5-day-old piglets orally administered with the live attenuated vaccine (HSGP strain) was examined.

As a result, as shown in (B) of FIG. 7 , it was confirmed that the weight gain rate of the piglets group to which the live attenuated vaccine strain (HSGP strain) was orally administered was 20.63% at 6 days after oral administration ( Weight gain of negative control group (NC: untreated group = 19.68%).

On the other hand, in the group of piglets orally administered with the HS strain, the weight loss rate was 25.96% at 6 days after oral administration. In addition, in the group of piglets administered orally with SGP-M1, the weight loss rate was 20.08% at 6 days after oral administration. That is, unlike the group of piglets to which the live attenuated vaccine (HSGP strain) was orally administered, the group of piglets administered orally administered the HS strain and the group administered SGP-M1 orally administered the SGP-M1 strain caused severe weight loss, resulting in the health of piglets. It was confirmed that the condition worsened.

Next, the health status of each group of piglets administered orally with the live attenuated vaccine (HSGP strain), HS strain and SGP-M1 strain was compared in terms of appetite and activity.

As a result, the piglets group and the negative control group, which were orally administered with the live attenuated vaccine (HSGP strain), showed strong appetite and activity during the experiment period. On the other hand, the group of piglets that were orally administered HS strain and the group of piglets that were orally administered SGP-M1 showed a marked decrease in activity 2 to 3 days after oral administration, did not properly consume the fed feed, and the swine epidemic. It was confirmed that the symptoms of diarrhea and vomiting, which are typical symptoms of infection with the diarrhea virus, were shown.

[2-3]: in a piglet About attenuation live vaccine collected after inoculation feces /Diarrhea and contained in small intestine tissue swine epidemic diarrhea virus Identification of RNA copy number

Quantitative Real-Time (qRT-PCR) in order to detect the presence or absence of swine epidemic diarrhea virus or the proliferation status of samples (feces, small intestine) of each group of piglets orally administered in [2-2] of Example 2 Polymerase Chain Reaction) was used to determine the number of RNA copies of swine epidemic diarrhea virus present in the feces (collected as swab) and small intestine of each group of piglets orally administered orally administered according to the number of days.

< qRT-PCR analysis method >

RNA extraction kit (RNeasy Mini Kit (Cat.No.74104), Qiagen Inc., USA) required for qRT-PCR analysis, PCR Premix Kit (AccuPower Profi Taq PCR Premix (Cat.No.K-2632), Bioneer Inc.) South Korea) and a cDNA synthesis kit (HelixCript Easy cDNA Synthesis Kit (Cat.No.ECDNA100), Nanohelx Inc., South Korea) were prepared.

First, RNA from the feces or small intestine of each piglet group was isolated using an RNA extraction kit, and cDNA was synthesized (RT, Reverse Transcription) from the isolated RNA using a cDNA synthesis kit. After adding the synthesized cDNA and the swine epidemic diarrhea virus-specific primer (see Table 3 below) to the PCR Premix Tube (Taq Polymerase is included in the test drug), the following reaction conditions were performed in the Thermal Cycler Dice™ Real Time System (TaKaRa, Japan). PCR was performed to confirm the positive/negative reaction and proliferation amount for the swine epidemic diarrhea virus.

PCR reaction conditions

Using the synthesized cDNA, PCR reaction was performed at 50° C. for 30 minutes 1 cycle, at 95° C. for 15 minutes 1 cycle, and at 95° C. for 10 seconds and at 60° C. for 1 minute 40 cycles. Then, based on the Ct (cycle threshold) value according to the standard curve of the positive control group, the positive/negative response and proliferation amount for the swine epidemic diarrhea virus was confirmed.

Table 3 shows the primer pairs for amplification of the swine epidemic diarrhea virus spike gene.

Primer name	Primer sequence (5' to 3')	gene size	gene	SEQ ID NO:
J1129F	CTTCTGGTTGYTCTTACCAGT	485bp or 494bp		Spike	7
J1128R					CATTATCCCATGTTATGCCGAC	8

As a result, as shown in (A) of FIG. 8, the live attenuated vaccine strain (HSGP strain), HS strain and SGP-M1 strain orally administered to the group of piglets was orally administered 3 days after oral administration, virus shedding ( Due to viral shedding), similar levels of RNA copy number of swine epidemic diarrhea virus were all shown in collected piglet feces. On the other hand, when the live attenuated vaccine strain (HSGP strain) was orally administered to the piglet group for more than 3 days, the RNA copy number of the orally administered live attenuated vaccine strain (HSGP strain) was significantly reduced in the collected piglet feces. confirmed that On the other hand, in the collected feces of the group of piglets that were orally administered with the HS and SGP-M1 strains, the number of RNA copies of the HS and SGP-M1 strains increased even after 3 days after oral administration. Proliferation was confirmed in the piglet group.

Next, the small intestine collected by autopsy on the 7th day after oral administration of the group of piglets orally administered with the live attenuated vaccine strain (HSGP strain), HS strain and SGP-M1 strain in [2-2] of Example 2 was collected with PBS After mixing, RNA was extracted from the supernatant of the small intestine tissue harvested by centrifugation, and the virus content of the swine epidemic diarrhea virus was confirmed by the number of RNA copies.

As a result, as shown in FIG. 8B, the RNA copy number of the swine epidemic diarrhea virus was 2.71 (log10) and 2.16 (log10) in the small intestine collected from the group of piglets orally administered with the live attenuated vaccine strain (HSGP strain). ) was confirmed (negative control: RNA of swine epidemic diarrhea virus not detected). On the other hand, the RNA copy number of the swine epidemic diarrhea virus was 4.56 (log10) in the small intestine collected from the group of piglets orally administered with the HS strain. In addition, the RNA copy number of swine epidemic diarrhea virus was 4.71 (log10) in the small intestine collected from the group of piglets orally administered with SGP-M1 strain.

In the end, unlike HS and SGP-M1 strains, when the live attenuated vaccine strain (HSGP strain) was orally administered to pigs, the proliferation of the swine epidemic diarrhea virus was low, and pathogenicity such as diarrhea and vomiting, which are symptoms of infection, did not appear. That is, it was confirmed that the live attenuated vaccine strain (HSGP strain) was suitable as the live attenuated vaccine strain.

[2-4]: Immunogenicity evaluation after oral inoculation of live attenuated vaccines in growing pigs

To confirm the immunogenicity of the HSGP strain, the live attenuated vaccine strain established through [2-1] to [2-3] of Examples 1 and 2, 8 growing pigs (about 100 days old) were grouped into 3 groups. The breeding pigs of each group were orally inoculated (Oral inoculation [OI]) with the HSGP strain. At the time of the first oral inoculation, group 1 (3 heads) was orally inoculated with 10ml of HSGP strain (working concentration: 1 X 10 ^7.0 TCID ₅₀ /10ml), and group 2 (3 heads) received HSGP strain orally. 10ml (concentration used: 1 X 10 ^6.0 TCID ₅₀ /10ml) was inoculated, and group 3 (2 heads) was an untreated (gastric inoculation [Mock]: no virus administration) as a negative control (Negative Control [NC]). A second oral inoculation was performed 2 weeks after the first oral inoculation under the same conditions as above. Before oral inoculation, 2 weeks after the first oral inoculation, and 2 weeks after the second oral inoculation, blood from each group of growing pigs was collected and the neutralization antibody titer was measured by a neutralization test of the collected serum.

Table 4 shows the titer change of neutralization antibody of serum collected from blood after oral inoculation of the HSGP strain to growing pigs.

group	pig number	Inoculation method	Final vaccine content	neutralizing antibody
				before inoculation	2 weeks after the first inoculation	2 weeks after the second inoculation
Group 1 (HSGP inoculation group)	OI-03	oral inoculation	1 X 10 7.0 TCID 50 /10ml	8	32	256
	OI-17	oral inoculation	1 X 10 7.0 TCID 50 /10ml	16	32	128
	OI-20	oral inoculation	1 X 10 7.0 TCID 50 /10ml	8	32	128
Group 2 (HSGP inoculation group)	OI-21	oral inoculation	1 X 10 6.0 TCID 50 /10ml	16	32	64
	OI-25	oral inoculation	1 X 10 6.0 TCID 50 /10ml	8	32	64
	OI-29	oral inoculation	1 X 10 6.0 TCID 50 /10ml	16	32	128
Group 3 (control)	CON-41	Gastric inoculation (Mock)	-	8	8	4
	CON-43	Gastric inoculation (Mock)	-	16	8	8

The neutralizing antibody titers of blood-derived sera collected 2 weeks after the first inoculation followed by the second inoculation after the first inoculation by oral administration of the HSGP strain to growing pigs were compared. As a result, in group 1, the neutralizing antibody titer increased 8 to 32 times compared to before inoculation, and in group 2, the neutralizing antibody titer increased 4 to 8 times compared to before inoculation. It was confirmed that the antibody immunity is highly formed.

[2-5]: in foster money attenuation live vaccine Immunogenicity assessment after intramuscular inoculation

In order to confirm the immunogenicity of the HSGP strain, the live attenuated vaccine strain established through [2-1] to [2-3] of Examples 1 and 2, 8 breeding pigs (about 100 days old) were divided into 3 groups, each The group's growing pigs were intramuscularly inoculated (Intramuscular inoculation [IM]) with the HSGP strain. At the time of the first intramuscular inoculation, group 1 (3 heads ^{) inoculated 2ml of HSGP strain intramuscularly (concentration used: 1 X 10 7.0} TCID ₅₀ /ml), and group 2 (3 heads) injected 2ml of HSGP strain intramuscularly (use concentration: 1 X 10 7.0 TCID 50 /ml). : 1 X 10 ^6.0 TCID ₅₀ /ml) and group 3 (two heads) was a negative control group ([NC]) untreated (above inoculation: no virus administration). Under the same conditions as above, the second intramuscular inoculation was performed 2 weeks after the first intramuscular inoculation. Before intramuscular inoculation, 2 weeks after the 1st intramuscular inoculation, and 2 weeks after the 2nd intramuscular inoculation, blood from each group of growing pigs was collected and the neutralizing antibody titer was measured by a neutralization test of the collected serum.

Table 5 shows changes in neutralizing antibodies in serum collected from blood collected after intramuscular inoculation of HSGP strains into growing pigs.

group	pig number	Inoculation method	Final vaccine content	neutralizing antibody
				before inoculation	2 weeks after the first inoculation	2 weeks after the second inoculation
Group 1 (HSGP inoculation group)	IM-07	intramuscular inoculation	2 X 10 7.0 TCID 50 /2ml	16	32	128
	IM-18	intramuscular inoculation	2 X 10 7.0 TCID 50 /2ml	16	64	128
	IM-19	intramuscular inoculation	2 X 10 7.0 TCID 50 /2ml	8	32	128
Group 2 (HSGP inoculation group)	IM-24	intramuscular inoculation	2 X 10 6.0 TCID 50 /2ml	16	64	128
	IM-28	intramuscular inoculation	2 X 10 6.0 TCID 50 /2ml	8	64	128
	IM-31	intramuscular inoculation	2 X 10 6.0 TCID 50 /2ml	16	32	128
Group 3 (control)	CON-41	Gastric inoculation (Mock)	-	8	8	4
	CON-43	Gastric inoculation (Mock)	-	16	8	8

The neutralizing antibody titer of blood-derived serum collected two weeks after the first inoculation and then the second inoculation was compared with the HSGP strain as an intramuscular inoculation into growing pigs. As a result, in group 1 and group 2, the neutralizing antibody titer increased 8 to 16 times compared to before inoculation, and it was confirmed that the antibody immunity of growing pigs was high when HSGP was administered by intramuscular inoculation.

In the end, when the HSGP strain, which is the live attenuated vaccine according to the present invention, is orally inoculated (oral administration) or intramuscular inoculation (muscular administration) into pigs, the neutralizing antibody formation of pigs is increased, thereby preventing the infectious disease of swine epidemic diarrhea virus. It can effectively prevent, prevent, improve or treat, or relieve diarrhea and vomiting, symptoms of infectious diseases caused by swine epidemic diarrhea virus infection.

As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Accordingly, it is intended that the substantial scope of the present invention be defined by the appended claims and their equivalents.

[Accession Number]

Name of deposit institution: Korea Research Institute of Bioscience and Biotechnology

Accession number: KCTC14056BP

Deposit date: 20191203

Name of deposit institution: Korea Research Institute of Bioscience and Biotechnology

Accession number: KCTC14057BP

Deposit date: 20191203

Name of deposit institution: Korea Research Institute of Bioscience and Biotechnology

Accession number: KCTC14058BP

Deposit date: 20191203

[Certificate of deposit of microorganisms]

Claims (22)

1. A live attenuated swine epidemic diarrhea virus vaccine strain, a monoclonal virus strain established by co-inoculation of multiple gene deletion strains derived from wild-type Porcine Epidemic Diarrhea Virus (PEDV) into host cells.
2. The live attenuated swine epidemic diarrhea virus vaccine strain according to claim 1, wherein the live attenuated vaccine ^{strain exhibits a viral titer of 1 X 10 5.6} TCID _{50 /ml or more in host cells.}
3. The attenuated swine epidemic diarrhea virus according to claim 1, wherein the gene-deleted virus strain is a wild-type swine epidemic diarrhea virus or a porcine epidemic diarrhea virus that is serially passaged 10 or more times in a host cell with a wild-type swine epidemic diarrhea virus. live vaccine.
4. According to claim 1, wherein the co-inoculation is characterized in that the inoculation with two or more gene deletion virus strains, live swine epidemic diarrhea virus attenuated vaccine strain.
5. 5. The method of claim 4, wherein when the co-inoculation consists of two strains of the gene deletion virus, the mixing ratio between the strains of the gene deletion virus is TCID ₅₀ Based on the virus titer, 1-9: 9-1, characterized in that the live attenuated swine epidemic diarrhea virus vaccine.
6. According to claim 4, wherein the co-inoculation is a live swine epidemic diarrhea virus attenuated vaccine, characterized in that the inoculation with the gene deletion virus strain deposited with the accession number KCTC14056BP and the gene deletion virus strain deposited with the accession number KCTC14058BP.
7. The live attenuated swine epidemic diarrhea virus vaccine strain according to claim 1, wherein the live attenuated vaccine strain has the base sequence of the spike gene represented by SEQ ID NO: 3.
8. The live attenuated swine epidemic diarrhea virus vaccine strain according to claim 1, wherein the live attenuated vaccine strain is deposited under the accession number KCTC14057BP.
9. The live swine epidemic diarrhea virus attenuated vaccine strain according to any one of claims 1 to 8, wherein the host cell is a monkey cell or a porcine germ cell.
10. A vaccine composition for preventing infection of a swine epidemic diarrhea virus comprising the live attenuated vaccine strain of the swine epidemic diarrhea virus according to any one of claims 1 to 8 as an active ingredient.
11. The vaccine composition of claim 10, wherein the composition is for inducing an immune response to the swine epidemic diarrhea virus in mammals other than humans.
12. The vaccine according to claim 10, wherein the composition is administered via one or more routes of administration selected from the group consisting of oral, nasal, dermal, muscle, rectal, vaginal, abdominal, vascular, lymphatic, eye and brain. composition.
13. A method for producing a live swine epidemic diarrhea virus attenuated vaccine, the method comprising:

    (a) collecting a plurality of wild-type swine epidemic diarrhea virus;

    (b) inoculating a host cell with one of the collected plurality of wild-type swine epidemic diarrhea virus, followed by successive subculture;

    (c) establishing a gene-defective virus strain by confirming the cytopathic effect in the host cells of the porcine epidemic diarrhea virus obtained by the continuous subculture, the nucleotide sequence mutation of the spike gene, and the infection symptoms in the inoculated pig;

    (d) repeating steps (b) and (c) to establish a plurality of gene-defective virus lines;

    (e) co-inoculating the host cells with the plurality of gene-defective virus strains established in step (d); and

    (f) the cytopathic effect in the host cell of the monoclonal viral strain obtained by plaque picking after the co-inoculation, the base sequence mutation of the spike gene, the virus titer in the host cell, the neutralizing antibody value in the inoculated pig, A method for producing a live attenuated vaccine strain of swine epidemic diarrhea virus, comprising the step of establishing a live attenuated vaccine by checking whether the virus is propagated in the inoculated pig and the symptoms of infection in the inoculated pig.
14. The method according to claim 13, wherein the live attenuated vaccine strain exhibits a viral titer of ^{1 X 10 5.6} TCID _{50 /ml or more in host cells.}
15. The attenuated swine epidemic diarrhea virus according to claim 13, wherein the gene-deleted virus strain is a wild-type porcine epidemic diarrhea virus or a porcine epidemic diarrhea virus that is serially passaged 10 or more times in a host cell with a wild-type swine epidemic diarrhea virus. A method for producing a live vaccine.
16. [Claim 14] The method of claim 13, wherein the co-inoculation is performed with two or more gene deletion virus strains.
17. The method according to claim 16, wherein, when the co-inoculation consists of two strains of the gene deletion virus, the mixing ratio between the strains of the gene deletion virus is TCID ₅₀ A method for producing a live attenuated vaccine for swine epidemic diarrhea virus, characterized in that it is 1 to 9: 9 to 1 based on the virus titer.
18. The method according to claim 13, wherein the plurality of genetically deleted virus strains are two or more types of genetically deleted virus strains having different nucleotide sequences of the spike gene.
19. The live attenuated vaccine of claim 13, wherein the live attenuated vaccine is established by co-inoculating host cells with the gene-defective virus strain deposited with accession number KCTC14056BP and the gene-defective virus strain deposited with accession number KCTC14058BP into host cells. A method for producing a live attenuated swine epidemic diarrhea virus vaccine, characterized in that the main.
20. The method according to any one of claims 13 to 19, wherein the host cell is a monkey cell or a pig germ cell.
21. Use as a viral antigen of the live attenuated swine epidemic diarrhea virus virus strain according to any one of claims 1 to 8 for the production of antibodies in mammals other than humans in the manufacture of a vaccine.
22. Use of the live attenuated vaccine strain of swine epidemic diarrhea virus according to any one of claims 1 to 8 as an immune response inducer in mammals other than humans in the manufacture of a vaccine.

Images