WO2021152113A1 - Substituted 2,3-benzodiazepines derivatives - Google Patents

Substituted 2,3-benzodiazepines derivatives Download PDF

Info

Publication number
WO2021152113A1
WO2021152113A1 PCT/EP2021/052142 EP2021052142W WO2021152113A1 WO 2021152113 A1 WO2021152113 A1 WO 2021152113A1 EP 2021052142 W EP2021052142 W EP 2021052142W WO 2021152113 A1 WO2021152113 A1 WO 2021152113A1
Authority
WO
WIPO (PCT)
Prior art keywords
dihydro
ethoxy
dioxopiperidin
isoindol
dioxo
Prior art date
Application number
PCT/EP2021/052142
Other languages
French (fr)
Inventor
Stephan Siegel
Philipp CROMM
Bernard Haendler
Laura Martina LUH
Katrin JÜNEMANN
Patrick STEIGEMANN
Matyas GORJANACZ
Detlef STÖCKIGT
Original Assignee
Bayer Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Aktiengesellschaft filed Critical Bayer Aktiengesellschaft
Publication of WO2021152113A1 publication Critical patent/WO2021152113A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings

Definitions

  • the present invention covers derivatives of 2,3- benzodiazepines as inhibitors of Bromodomain and extra C-terminal domain (BET) proteins, in particular the BRD4 family member, methods of preparing said compounds, intermediate compounds useful for preparing said compounds, pharmaceutical compositions and combinations comprising said compounds, and the use of said compounds for manufacturing pharmaceutical compositions for the treatment or prophylaxis of diseases for hyperproliferative disorders, in particular for tumor disorders.
  • BET Bromodomain and extra C-terminal domain
  • 2,3- benzodiazepines derivatives according to the invention are active as inhibitors as well as degraders of BET proteins.
  • the present invention furthermore relates to the use of these BET protein inhibitors for benign hyperplasia, atherosclerotic disorders, sepsis, autoimmune disorders, vascular disorders, viral infections, fungal infections, for neurodegenerative disorders, for inflammatory disorders, for atherosclerotic disorders and for the control of male fertility.
  • the present invention covers derivatives of 2,3- benzodiazepines as BET protein inhibitors, particularly BRD4 inhibitors, as such and as protein degraders.
  • the human BET family has the four members BRD2, BRD3, BRD4 and BRDT. They each contain two related bromodomains and one extra C-terminal domain (Wu and Chiang, J.
  • the bromodomains are protein regions that recognize acetyl ated lysine residues.
  • Acetylated lysines are often found in the N-terminal region of histones (e.g. histone 3 or histone 4) and are characteristic features of an open chromatin structure which is permissive for active gene transcription (Kuo and Allis, Bioessays, 1998, 20:615-626).
  • histones e.g. histone 3 or histone 4
  • the various acetylation patterns bound by BET proteins in histones were studied in detail (Umehara et al., J. Biol.
  • bromodomains can recognize other acetylated proteins.
  • BRD4 binds to RelA to stimulated NF-KB and transcriptional activity of inflammatory genes (Huang et al. , Mol. Cell. Biol., 2009, 29:1375-1387; Zhang et al. , J. Biol. Chem., 2012, 287:28840-28851 ; Hajmirza et al., Biomedicine, 2018, 6:pii E16).
  • the extraterminal domain of BRD2, BRD3 and BRD4 interacts with several proteins having a role in chromatin modulation and regulation of gene expression (Rahman et al., Mol. Cell. Biol., 2011, 31:2641-2652).
  • BET proteins play important roles in cell growth and in the cell cycle (Taniguchi, Int. J. Mol. Sci. , 2016, 17:pii E1849). They are associated with mitotic chromosomes, suggesting a role in epigenetic memory (Dey et al., Mol. Biol. Cell, 2009, 20:4899-4909; Yang et al., Mol. Cell. Biol., 2008, 28:967-976). BRD4 is important for the post-mitotic reactivation of gene transcription (Zhao et al., Nat. Cell. Biol., 2011, 13:1295- 1304).
  • RNA polymerase II consists of CDK9 and cyclin T1
  • P- TEFb which consists of CDK9 and cyclin T1
  • RNA polymerase II Yang et al., Mol. Cell, 2005, 19:535-545; Schroder et al., J. Biol. Chem., 2012, 287:1090- 1099; Li et al., Transcription, 2018, 9:88-94.
  • the expression of genes involved in cell proliferation such as, for example, c-Myc and aurora B, is stimulated (You et al., Mol. Cell. Biol., 2009, 29:5094-5103; Zuber et al., Nature, 2011, 478:524-528).
  • BRD2 and BRD3 bind to transcribed genes in hyperacetylated chromatin regions and promote transcription by RNA polymerase II (LeRoy et al., Mol. Cell, 2008, 30:51-60).
  • BRD4 Knocking-down BRD4 expression or inhibiting its interaction with acetyl ated histones in various cell lines leads to G1 arrest and to cell death by apoptosis (Mochizuki et al., J. Biol. Chem., 2008, 283:9040-9048; Mertz et al., Proc. Natl. Acad. Sci. USA, 2011, 108:16669- 16674). It has also been shown that BRD4 binds to promoter regions of several genes that are activated in the G1 phase, for example cyclin D1 and D2 (Mochizuki et al., J. Biol.
  • BRD2 and BRD4 knockout mice die early during embryogenesis (Gyuris et al., Biochim. Biophys. Acta, 2009, 1789:413-421; Houzelstein et al., Mol. Cell. Biol., 2002, 22:3794-3802). Heterozygous BRD4 mice have various growth defects, which can be attributed to reduced cellular proliferation (Houzelstein et al., Mol. Cell. Biol., 2002, 22:3794-3802).
  • BET proteins play an important role in various types of tumors. Fusion between the BET proteins BRD3 or BRD4 and NUT, a protein that normally is only expressed in the testis, leads to NUT midline carcinoma (French, Cancer Genet. Cytogenet, 2010, 203:16-20). The fusion protein prevents cellular differentiation and promotes proliferation (Yan et al., J. Biol. Chem., 2011, 286:27663-27675). The growth of derived in vivo models is reduced by a BRD4 inhibitor (Filippakopoulos et al., Nature, 2010, 468:1067-1073).
  • BET inhibitors show efficacy in solid tumors including prostate cancer (Urbanucci and Mills, Mol Cell Endocrinol, 2018, 462:31-40), breast cancer (Sahni and Keri, Pharmacol. Res., 2018, 129:156-176; Park et a!.
  • BET proteins are also involved in viral infections.
  • BRD4 binds to the E2 protein of various papilloma viruses and is important for the survival of the viruses in latently infected cells (Wu et al., Genes Dev., 2006, 20:2383-2396; Vosa et al., J. Virol., 2012, 86:348-357; Morse et al., Antivir. Res., 2018, 154:158-165).
  • the herpes virus that is responsible for Kaposi's sarcoma also interacts with various BET proteins, which is important for disease resistance (Viejo-Borbolla et al., J.
  • BRD4 By binding to P-TEFb, BRD4 also plays an important role in HIV replication (Bisgrove et al., Proc. Natl Acad. Sci. USA, 2007, 104:13690-13695).
  • BET proteins are also involved in fungal infections (F. Montgomeryton et al., Nat. Comm., 2017, 8:15482).
  • the BET protein Bdf1 is essential for viability and virulence of Candida albicans and selective inhibitors, that do not interact with human BET bromodomains have been described (F. Montgomeryton et al., Nat. Comm., 2017, 8:15482).
  • BET proteins are in addition involved in inflammatory processes.
  • BRD2-hypomorphic mice display reduced inflammation in fat tissue (Wang et al., Biochem. J., 2009, 425:71-83).
  • the infiltration of macrophages in white fat tissue is also reduced in BRD2-deficient mice (Wang et al., Biochem. J., 2009, 425:71-83).
  • BRD4 regulates a number of genes that are involved in inflammation.
  • a BRD4- inhibitor prevents the expression of inflammatory genes, for example IL-1 or IL-6 (Nicodeme et al., Nature, 2010, 468:1119-1123).
  • Apolipoprotein A1 (ApoA1) is a main component of high density lipoproteins (HDL), and an elevated expression of ApoA1 leads to increased blood cholesterol levels (Degoma and Rader, Nat. Rev. Cardiol., 2011, 8:266-277).
  • the BET family member BRDT is expressed exclusively in the testis and plays an essential role in spermatogenesis (Zdrojewicz et al., Adv. Clin. Exp. Med., 2015, 24:705-714; Barda et al., Gene Expr. Patterns, 2016, 20:130-137). Blockade of BRDT function leads to reversible infertility without impact on the endocrine system (Shang et al., Development, 2007, 139:3507-3515).
  • 2,3- benzodiazepines derivatives are known in the state of the art as potent inhibitors of BET proteins, in particular as BRD4 inhibitors. Their synthesis and activity were described for example in the patent applications: WO2014/026997, WO2014/128067, WO2014/202578, WO2015/121226, W02015/121230, WO2015/121227, WO2015/121268, WO2016/062688.
  • the compounds according to the invention differ from those disclosed in the state of the art for the fact that they possess a specific substitution comprising a linker and an E3 ligase binder on the (hetero)cyclic moiety.
  • Such specific substitution does not only modify the activity on BET, but also provides the possibility to engage the ubiquitin proteasome system by means of recruitment of E3 ligases such as von Hippel-Lindau (VHL) or Cereblon (CRBN).
  • VHL von Hippel-Lindau
  • CRBN Cereblon
  • T argeted protein degradation refers to small molecule-induced ubiquitination and degradation of disease targets, in which the small molecule simultaneously recruits both the target protein and a ubiquitin E3 ligase into close proximity of each other which leads to ubiquitination of the target protein at specific lysine residues.
  • a clinical proof of concept for targeted protein degradation is provided by the recent discovery that the potent anti-cancer drugs thalidomide, lenalidomide and pomalidomide (collectively known as IMiDs) exert their therapeutic effects through induced degradation of key efficacy targets, such as IKZF1, IKZF3, ZFP91, or casein kinase 1 alpha (An et al., Nat.
  • IMiDs recruit CRBN, which belongs to an E3 ubiquitin ligase complex, and act by redirecting the activity of this complex to ubiquitinate the protein bound by the other moiety of the chimeric compound, ultimately leading to degradation.
  • CRBN belongs to an E3 ubiquitin ligase complex
  • ARV-110 and ARV-471 are clinical chimeric compounds targeting the androgen receptor or estrogen receptor, respectively, and coupled to a moiety that recruits the E3 ligase complex (Neklesa et al., Cancer Res, 2018, 78:abstract 5236 ; Flanagan et al., Cancer Res., 2019, 74: abstract P5-04-18).
  • BET degraders differ from BET inhibitors in their cellular potency, phenotypic effects, pharmacokinetic proper-ties and toxicity profiles. Furthermore, differential outcomes are observed in the cellular and animal models for BET degraders in comparison to BET inhibitors (Yang et al., Drug Discov. Today, 2019, 31:43-51; Scheepstra M et al., Comput. Struct. Biotechnol. J., 2019, 17:160-176).
  • the present invention covers compounds of general formula (I): in which: R 1 represents cyclopropyl, -(CrC 2 )-alkyl, m ethoxy or methylamino,
  • A represents a group from: wherein ** represents the connection point to R L ,
  • Ri_ is a (C1-C20) alkyl chain, in which one or more carbon atom can be optionally replaced by -0-, or -N(R LI )- or -C(O)-, or by a 4, 5 or 6 membered carbocyclic or heterocyclic ring, excluding combinations such as, -0-0-, -N(Ru)-N(Ru)-, -C(0)-C(0)-, -N(R LI )-0-, -C(0)-0- 0(0), and in which Ru is hydrogen or -(CrC 6 )-alkyl
  • E3 LB represents a group selected from: wherein *** indicates the point of attachment of a group with Ri_; and stereoisomers, tautomers, N-oxides, hydrates, solvates, and salts thereof, and mixtures of the same.
  • the present invention covers compounds of general formula (la):
  • R 1 represents cyclopropyl, -(CrC2)-alkyl, m ethoxy or methylamino,
  • R L is a (C1-C20) alkyl chain, in which one or more carbon atom can be optionally replaced by -0-, or -N(R LI )- or -C(O)-, or by a 4, 5 or 6 membered carbocyclic or heterocyclic ring, excluding combinations such as, -0-0-, -N(Ru)-N(Ru)-, -C(0)-C(0)-, -N(R LI )-0-, -C(0)-0- 0(0), and in which R LI is hydrogen or -(CrC 6 )-alkyl
  • E3 LB represents a group selected from: wherein *** indicates the point of attachment of a group with R L ; and stereoisomers, tautomers, N-oxides, hydrates, solvates, and salts thereof, and mixtures of the same.
  • the present invention covers compounds of general formula (lb): in which:
  • R 1 represents cyclopropyl, -(CrC 2 )-alkyl, m ethoxy or methylamino,
  • R L is a (C1-C20) alkyl chain, in which one or more carbon atom can be optionally replaced by -0-, or -N(R LI )- or -C(0)-, or by a 4, 5 or 6 membered carbocyclic or heterocyclic ring, excluding combinations such as, -0-0-, -N(Ru)-N(Ru)-, -C(0)-C(0)-, -N(R LI )-0-, -C(0)-0- 0(0), and in which Ru is hydrogen or -(CrC 6 )-alkyl,
  • E3LB represents a group selected from: wherein *** indicates the point of attachment of a group with R L ; and stereoisomers, tautomers, N-oxides, hydrates, solvates, and salts thereof, and mixtures of the same.
  • R L is also defined as the linker between the E3 ligase binder (E3LB) and the BET Protein binding molecule which made by the core of general formula I together with the group A.
  • the present invention covers compounds of general formula (lb):
  • R 1 represents cyclopropyl, -(CrC 2 )-alkyl, m ethoxy or methylamino,
  • R L is a (C1-C20) alkyl chain, in which one or more carbon atom can be optionally replaced by -0-, or -N(R LI )- or -C(O)-, or by a 4, 5 or 6 membered carbocyclic or heterocyclic ring, excluding combinations such as, -0-0-, -N(Ru)-N(Ru)-, -C(0)-C(0)-, -N(R LI )-0-, -C(0)-0- 0(0), and in which R LI is hydrogen or -(CrC 6 )-alkyl,
  • E3LB represents a group selected from: wherein *** indicates the point of attachment of a group with R L ; and stereoisomers, tautomers, N-oxides, hydrates, solvates, and salts thereof, and mixtures of the same.
  • R L is also defined as the linker between the E3 ligase binder (E3LB) and the BET Protein binding molecule which made by the core of general formula I together with the group A.
  • the invention covers compounds of formula (I), (la) and (lb) are those in which R L is wherein ** and *** indicate the point of attachment of a Ri_ group with the BET Binding Molecule and E3 LB respectively.
  • compounds of formula (la) are those in which R L is wherein ** and *** indicate the point of attachment of a Ri_ group with the BET Binding Molecule and E3 LB respectively.
  • compounds of formula (lb) are those in which Ri_ is
  • compounds of formula (I), (la) and (lb) are those in which Ri_ is
  • Ri_ is wherein ** and *** indicate the point of attachment of a Ri_ group with the BET Binding Molecule and E3 LB respectively.
  • 5 or 6 membered carbocyclic or heterocyclic rings are: pyrrolidine, pyrazolidine, imidazolidine, pyrroline pyrazoline imidazoline, pyrrole, pyrazole, imidazole, isoxazole, oxazole, thiophene, isothiazole, thiazole, furan piperidine, hexahydropyridazine, hexahydropyrimidine, pyridine, pyrimidine, pyrazine, 2H-pyran, 4H-pyran.
  • -(CrC 6 )-alkyl means linear or branched pentyl, butyl, or propyl, more in particular -(CrC2)-alkyl which means methyl or ethyl.
  • the present invention covers the compounds of general formula (I) which are disclosed in the Example Section of this text, infra ; said specific compounds are: (4S)-1-(4- ⁇ 4-[15-( ⁇ 2-[2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl ⁇ amino)-
  • Compounds according to the invention are the compounds of the formula (I) and their salts, solvates and solvates of the salts, the compounds included in the formula (I) of the formulae mentioned in the following and their salts, solvates and solvates of the salts, and the compounds included in the formula (I) and mentioned in the following as embodiment examples and their salts, solvates and solvates of the salts, where the compounds included in the formula (I) and mentioned in the following are not already salts, solvates and solvates of the salts.
  • the present invention likewise embraces the use of the salts of the compounds according to the invention.
  • preferred salts are physiologically acceptable salts of the compounds according to the invention, these are also defined as pharmaceutical acceptable salts.
  • salts which for their part are not suitable for pharmaceutical applications but which can be used, for example, for isolating and purifying the compounds according to the invention are also included.
  • Physiologically acceptable salts of the compounds according to the invention include acid addition salts of mineral acids, carboxylic acids and sulphonic acids, e.g.
  • Physiologically acceptable salts of the compounds according to the invention furthermore embrace, for example, base addition salts, for example of alkali metals such as sodium or potassium, of alkaline earth metals such as calcium or magnesium, or of ammonium salts derived from ammonia or organic amines containing 1 to 16 carbon atoms, such as, for example, methylamine, ethylamine, diethylamine, triethylamine, ethyldiisopropylamine, monoethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, dimethylamino- ethanol, procaine, dibenzylamine, /V-methylmorpholine, arginine, lysine, ethylenediamine, N- methylpiperidine, /V-methylglucamine, dimethylglucamine, ethylglucamine, 1,6-hexadiamine, glucosamine, sarcosine, serinol, tris(hydroxymethyl
  • the compounds according to the invention can form base addition salts with quarternary ammonium ions which can be obtained, for example, by quarternization of appropriate amines with agents such as lower alkyl halides, for example methyl, ethyl, propyl and butyl chlorides, bromides and iodides, dialkyl sulphates such as dimethyl, diethyl, dibutyl and diamyl sulphate, long-chain halides such as decyl, lauryl, myristyl and stearyl chlorides, bromides and iodides, or arylalkyl halides such as benzyl bromide or phenethyl bromide.
  • agents such as lower alkyl halides, for example methyl, ethyl, propyl and butyl chlorides, bromides and iodides, dialkyl sulphates such as dimethyl, diethyl, dibutyl and diamyl s
  • quarternary ammonium ions are tetramethylammonium, tetraethylammonium, tetra(n-propyl)ammonium, tetra(n-butyl)ammonium, and also benzyltrimethylammonium.
  • the present invention furthermore provides all possible crystalline and polymorphic forms of the compounds according to the invention, the polymorphs being present either as individual polymorphs or as a mixture of a plurality of polymorphs in any concentration ranges.
  • the present invention furthermore provides medicaments comprising the compounds according to the invention and at least one or more other active compounds, in particular for the prophylaxis and/or therapy of tumour disorders.
  • Solvates in the context of the invention are designated as those forms of the compounds according to the invention which form a complex in the solid or liquid state by coordination with solvent molecules. Hydrates are a specific form of solvates, in which the coordination takes place with water. Hydrates are preferred solvates in the context of the present invention.
  • the compounds according to the invention can exist in different stereoisomeric forms depending on their structure, i.e. in the form of configuration isomers or optionally also as conformation isomers. At position 4, the compounds according to the invention have a centre of asymmetry.
  • the present invention therefore also includes the enantiomers and diastereomers and their particular mixtures.
  • the stereoisomerically uniform constituents can be isolated from such mixtures of enantiomers and/or diastereomers in a known manner; chromatography processes are preferably used for this, in particular HPLC chromatography on an achiral or chiral phase.
  • the enantiomers according to the invention inhibit the target with different potency and have different activity in the cancer cell lines investigated.
  • the present invention includes all the tautomeric forms.
  • the present invention also encompasses all suitable isotopic variants of the compounds according to the invention.
  • An isotopic variant of a compound according to the invention is understood here to mean a compound in which at least one atom within the compound according to the invention has been exchanged for another atom of the same atomic number, but with a different atomic mass than the atomic mass which usually or predominantly occurs in nature.
  • isotopes which can be incorporated into a compound according to the invention are those of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine, chlorine, bromine and iodine, such as 2 H (deuterium), 3 H (tritium), 13 C, 14 C, 15 N, 17 0, 18 0, 32 P, 33 P, 33 S, 34 S, 35 S, 36 S, 18 F, 36 CI, 82 Br, 123 l, 124 l, 129 l and 131 l.
  • Particular isotopic variants of a compound according to the invention may be beneficial, for example, for the examination of the mechanism of action or of the active compound distribution in the body; due to comparatively easy preparability and detectability, especially compounds labelled with 3 H or 14 C isotopes are suitable for this purpose.
  • the incorporation of isotopes, for example of deuterium can lead to particular therapeutic benefits as a consequence of greater metabolic stability of the compound, for example an extension of the half-life in the body or a reduction in the active dose required; such modifications of the compounds according to the invention may therefore in some cases also constitute a preferred embodiment of the present invention.
  • Isotopic variants of the compounds according to the invention can be prepared by generally used processes known to those skilled in the art, for example by the methods described below and the methods described in the working examples, by using corresponding isotopic modifications of the particular reagents and/or starting compounds therein.
  • the present invention moreover also includes prodrugs of the compounds according to the invention.
  • prodrugs here designates compounds which themselves can be biologically active or inactive but are converted (for example metabolically or hydrolytically) into compounds according to the invention during their dwell time in the body.
  • the compounds according to the invention can act systemically and/or locally.
  • they can be administered in a suitable manner, such as, for example, orally, parenterally, pulmonarily, nasally, sublingually, lingually, buccally, rectal ly, dermally, transdermally, conjunctivally, otically, as or as an implant or stent.
  • the compounds according to the invention can be administered in suitable administration forms.
  • Suitable for oral administration are administration forms working according to the prior art, which release the compounds according to the invention rapidly and/or in modified form and comprise the compounds according to the invention in crystalline and/ or amorphized and/or dissolved form, such as, for example, tablets (non-coated or coated tablets, for example coated with enteric, slowly dissolving or insoluble coats which control the release of the compound according to the invention), tablets which decompose rapidly in the oral cavity or films/wafers, films/lyophylizates, capsules (for example hard gelatin capsules or soft gelatin capsules), sugar-coated tablets, granules, pellets, powders, emulsions, suspensions, aerosols or solutions.
  • Parenteral administration can take place with circumvention of an absorption step (for example intravenous, intraarterial, intracardiac, intraspinal or intralumbar) or with involvement of an absorption (for example intramuscular, subcutaneous, intracutaneous, percutaneous or intraperitoneal).
  • an absorption step for example intravenous, intraarterial, intracardiac, intraspinal or intralumbar
  • suitable administration forms are, inter alia, injection and infusion preparations in the form of solutions, suspensions, emulsions, lyophilizates or sterile powders.
  • Suitable for the other administration routes are, for example, pharmaceutical forms for inhalation (inter alia powder inhalers, nebulizers), nasal drops, nasal solutions, nasal sprays; tablets, films/wafers or capsules to be applied lingually, sublingually or buccally, suppositories, ear or eye preparations, vaginal capsules, aqueous suspensions (lotions, shake lotions), lipophilic suspensions, ointments, creams, transdermal therapeutic systems (such as, for example, patches), milk, pastes, foams, dusting powders, implants or stents.
  • the compounds according to the invention can be converted into the administration forms mentioned.
  • auxiliaries include, inter alia, carriers (for example microcrystalline cellulose, lactose, mannitol), solvents (for example liquid polyethylene glycols), emulsifiers and dispersants or wetting agents (for example sodium dodecylsulphate, polyoxysorbitan oleate), binders (for example polyvinylpyrrolidone), synthetic and natural polymers (for example albumin), stabilizers (e.g. antioxidants such as, for example, ascorbic acid), colorants (e.g. inorganic pigments such as, for example, iron oxides) and taste and/or odour corrigents.
  • carriers for example microcrystalline cellulose, lactose, mannitol
  • solvents for example liquid polyethylene glycols
  • emulsifiers and dispersants or wetting agents for example sodium dodecylsulphate, polyoxysorbitan oleate
  • binders for example polyvinylpyrrolidone
  • synthetic and natural polymers
  • the present invention furthermore provides medicaments comprising the compounds according to the invention, usually together with one or more inert non-toxic, pharmaceutically suitable auxiliaries, and their use for the purposes mentioned above.
  • Formulation of the compounds according to the invention to give pharmaceutical products takes place in a manner known per se by converting the active compound(s) with the excipients customary in pharmaceutical technology into the desired administration form.
  • Auxiliaries which can be employed in this connection are, for example, carrier substances, fillers, disinteg rants, binders, humectants, lubricants, absorbents and adsorbents, diluents, solvents, cosolvents, emulsifiers, solubilizers, masking flavours, colorants, preservatives, stabilizers, wetting agents, salts to alter the osmotic pressure or buffers.
  • carrier substances for example, fillers, disinteg rants, binders, humectants, lubricants, absorbents and adsorbents, diluents, solvents, cosolvents, emulsifiers, solubilizers, masking flavours, colorants, preservatives, stabilizers, wetting agents, salts to alter the osmotic pressure or buffers.
  • the pharmaceutical formulations may be in solid form, for example as tablets, coated tablets, pills, suppositories, capsules, transdermal systems or in semisolid form, for example as ointments, creams, gels, suppositories, emulsions or in liquid form, for example as solutions, tinctures, suspensions or emulsions.
  • auxiliaries in the context of the invention may be, for example, salts, saccharides (mono-, di- , tri-, oligo-, and/or polysaccharides), proteins, amino acids, peptides, fats, waxes, oils, hydrocarbons and derivatives thereof, where the auxiliaries may be of natural origin or may be obtained by synthesis or partial synthesis.
  • Suitable for oral or peroral administration are in particular tablets, coated tablets, capsules, pills, powders, granules, pastilles, suspensions, emulsions or solutions.
  • Suitable for parenteral administration are in particular suspensions, emulsions and especially solutions.
  • the present invention relates to the use of the compounds according to the invention.
  • tumour disorders They can be used for the prophylaxis and therapy of human disorders, in particular tumour disorders.
  • the compounds according to the invention can be used in particular for inhibiting or reducing cell proliferation and/or cell division and/or to induce apoptosis.
  • the compounds according to the invention are suitable in particular for the treatment of hyper-proliferative disorders such as, for example, psoriasis, keloids and other skin hyperplasias, benign prostate hyperplasias (BPH), solid tumours and haematological tumours.
  • hyper-proliferative disorders such as, for example, psoriasis, keloids and other skin hyperplasias, benign prostate hyperplasias (BPH), solid tumours and haematological tumours.
  • Solid tumours which can be treated in accordance with the invention are, for example, tumours of the breast, the respiratory tract, the brain, the reproductive organs, the gastrointestinal tract, the urogenital tract, the eye, the liver, the skin, the head and the neck, the thyroid gland, the parathyroid gland, the bones and the connective tissue and metastases of these tumours.
  • Haematological tumours which can be treated are, for example, multiple myelomas, lymphomas or leukaemias.
  • Breast tumours which can be treated are, for example: breast carcinomas with positive hormone receptor status breast carcinomas with negative hormone receptor status Her-2 positive breast carcinomas hormone receptor and Her-2 negative breast carcinomas BRCA-associated breast carcinomas inflammatory breast carcinomas.
  • Tumours of the respiratory tract which can be treated are, for example, non-small-cell bronchial carcinomas such as squamous-cell carcinoma, adenocarcinoma, large-cell carcinoma and small-cell bronchial carcinomas.
  • Tumours of the brain which can be treated are, for example, gliomas, glioblastomas, astrocytomas, meningiomas and medulloblastomas.
  • Tumours of the male reproductive organs which can be treated are, for example: prostate carcinomas, malignant tumours of the epididymis, malignant testicular tumours and penis carcinomas.
  • Tumours of the female reproductive organs which can be treated are, for example: endometrial carcinomas cervix carcinomas ova rial carcinomas vaginal carcinomas vulvar carcinomas
  • Tumours of the gastrointestinal tract which can be treated are, for example: colorectal carcinomas anal carcinomas stomach carcinomas pancreas carcinomas oesophagus carcinomas gall bladder carcinomas carcinomas of the small intestine salivary gland carcinomas neuroendocrine tumours gastrointestinal stroma tumours
  • Tumours of the urogenital tract which can be treated are, for example: urinary bladder carcinomas kidney cell carcinomas carcinomas of the renal pelvis and lower urinary tract Tumours of the eye which can be treated are, for example: retinoblastomas intraocular melanomas
  • Tumours of the liver which can be treated are, for example: hepatocellular carcinomas cholangiocellular carcinomas
  • Tumours of the skin which can be treated are, for example: malignant melanomas basaliomas spinaliomas Kaposi sarcomas Merkel cell carcinomas
  • Tumours of the head and neck which can be treated are, for example: larynx carcinomas carcinomas of the pharynx and the oral cavity carcinomas of midline structures (e.g. NMC, C.A. French, Annu. Rev. Pathol. 2012, 7:247-265)
  • Sarcomas which can be treated are, for example: soft tissue sarcomas osteosarcomas Lymphomas which can be treated are, for example: non-Hodgkin lymphomas Hodgkin lymphomas cutaneous lymphomas lymphomas of the central nervous system - AIDS-associated lymphomas
  • Leukaemias which can be treated are, for example: acute myeloid leukaemias chronic myeloid leukaemias acute lymphatic leukaemias chronic lymphatic leukaemias hairy cell leukaemias
  • the compounds according to the invention can be used for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, cervix carcinomas, breast carcinomas, in particular of hormone receptor negative, hormone receptor positive or BRCA-associated breast carcinomas, pancreas carcinomas, kidney cell carcinomas, hepatocellular carcinomas, melanomas and other skin tumours, non-small-cell bronchial carcinomas, endometrial carcinomas and colorectal carcinomas.
  • leukaemias in particular acute myeloid leukaemias
  • prostate carcinomas in particular androgen receptor-positive prostate carcinomas
  • cervix carcinomas breast carcinomas
  • pancreas carcinomas in particular of hormone receptor negative, hormone receptor positive or BRCA-associated breast carcinomas
  • pancreas carcinomas kidney cell carcinomas, hepatocellular carcinomas, melanomas and other skin tumours, non-small-cell bronchial carcinomas
  • the compounds according to the invention can be employed for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, breast carcinomas, in particular oestrogen receptor alpha-negative breast carcinomas, melanomas or multiple myelomas.
  • the compounds according to the invention are also suitable for the prophylaxis and/or therapy of benign hyperproliferative diseases such as endometriosis, leiomyoma and benign prostate hyperplasia.
  • the compounds according to the invention are also suitable for controlling male fertility.
  • the compounds according to the invention are also suitable for the prophylaxis and/or therapy of systemic inflammatory diseases, in particular LPS-induced endotoxic shock and/or bacteria- induced sepsis.
  • the compounds according to the invention are also suitable for the prophylaxis and/or therapy of inflammatory or autoimmune disorders such as: pulmonary disorders associated with inflammatory, allergic and/or proliferative processes: chronic obstructive pulmonary disorders of any origin, especially bronchial asthma; bronchitis of varying origin; all types of restrictive pulmonary disorders, especially allergic alveolitis; all types of pulmonary oedema, especially toxic pulmonary oedema; sarcoidoses and granulomatoses, especially Boeck's disease rheumatic disorders/autoimmune diseases/joint disorders associated with inflammatory, allergic and/or proliferative processes: all types of rheumatic disorders, especially rheumatoid arthritis, acute rheumatic fever, polymyalgia rheumatic
  • angioedema hay fever, insect bite, allergic reactions to drugs, blood derivatives, contrast media etc.
  • anaphylactic shock urticaria, contact dermatitis vessel inflammations (vasculitides): panarterilitis nodosa, arterilitis temporalis, erythema nodosum dermatological disorders associated with inflammatory, allergic and/or proliferative processes: atopic dermatitis; psoriasis; pityriasis rubra pilaris; erythematous disorders induced by various noxae, e.g.
  • cutaneous T-cell lymphomas renal disorders associated with inflammatory, allergic and/or proliferative processes nephrotic syndrome; all nephritides hepatic disorders associated with inflammatory, allergic and/or proliferative processes: acute liver cell necrosis; acute hepatitis of varying origin, e.g.
  • indigenous sprue proctological disorders associated with inflammatory, allergic and/or proliferative processes anal eczema; fissures; haemorrhoids; idiopatic proctitis ocular disorders associated with inflammatory, allergic and/or proliferative processes: allergic keratitis, uveitis, ulceris; conjunctivitis; blepharitis; optic neuritis; chlorioditis; sympathetic ophthalmia ear-nose-throat disorders associated with inflammatory, allergic and/or proliferative processes: allergic rhinitis, hay fever; otitis externa, e.g.
  • West syndrome haematological disorders associated with inflammatory, allergic and/or proliferative processes acquired haemolytic anaemia; idiopathic thrombocytopenia tumour disorders associated with inflammatory, allergic and/or proliferative processes: acute lymphatic leukaemia; malignant lymphomas; lymphogranulomatoses; lymphosarcomas; extensive metastasization, especially in cases of breast, bronchial and prostate carcinomas endocrine disorders associated with inflammatory, allergic and/or proliferative processes: endocrine orbitopathy; thyreotoxic crisis; de Quervain thyroiditis; Hashimoto thyroiditis; Basedow's disease organ and tissue transplantations, graft-versus-host disease severe states of shock, e.g.
  • SIRS systemic inflammatory response syndrome
  • congenital primary adrenal insufficiency e.g. congenital adrenogenital syndrome
  • acquired primary adrenal insufficiency e.g. Addison’s disease, autoimmune adrenalitis, postinfectious tumours, metastases, etc
  • congenital secondary adrenal insufficiency e.g. congenital hypopituitarism
  • acquired secondary adrenal insufficiency e.g. postinfectious, tumours, etc emesis associated with inflammatory, allergic and/or proliferative processes, e.g. in combination with a 5-HT3 antagonist for emesis induced by cytostatic drugs pain of inflammatory origin, e.g. lumbago
  • the compounds according to the invention are also suitable for the treatment of viral disorders such as, for example, infections caused by papilloma viruses, herpes viruses, Epstein-Barr viruses, hepatitis B or C viruses and human immunodeficiency viruses.
  • viral disorders such as, for example, infections caused by papilloma viruses, herpes viruses, Epstein-Barr viruses, hepatitis B or C viruses and human immunodeficiency viruses.
  • the compounds according to the invention are also suitable for the treatment of atherosclerosis, dyslipidaemia, hypercholesterolaemia, hypertriglyceridaemia, peripheral vascular disorders, cardiovascular disorders, angina pectoris, ischaemia, stroke, myocardial infarction, angioplastic restenosis, hypertension, thrombosis, adiposity, endotoxemia.
  • the compounds according to the invention are also suitable for the treatment of neurodegenerative diseases such as, for example, multiple sclerosis, Alzheimer’s disease and Parkinson’s disease.
  • the present application furthermore provides the compounds according to the invention for use as medicaments, in particular for the prophylaxis and/or therapy of tumour disorders.
  • the present application furthermore provides the compounds according to the invention for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, cervix carcinomas, breast carcinomas, in particular hormone receptor-negative, hormone receptor positive or BRCA-associated breast carcinomas, pancreas carcinomas, kidney cell carcinomas, hepatocellular carcinomas, melanomas and other skin tumours, non-small-cell bronchial carcinomas, endometrial carcinomas and colorectal carcinomas.
  • leukaemias in particular acute myeloid leukaemias
  • prostate carcinomas in particular androgen receptor-positive prostate carcinomas
  • cervix carcinomas breast carcinomas
  • pancreas carcinomas in particular hormone receptor-negative, hormone receptor positive or BRCA-associated breast carcinomas
  • pancreas carcinomas kidney cell carcinomas, hepatocellular carcinomas, melanomas and other skin tumours, non-small-cell bronchi
  • the present application furthermore provides the compounds according to the invention for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, breast carcinomas, in particular oestrogen receptor alpha-negative breast carcinomas, melanomas or multiple myelomas.
  • the invention furthermore provides the use of the compounds according to the invention for preparing a medicament.
  • the present application furthermore provides the use of the compounds according to the invention for preparing a medicament for the prophylaxis and/or therapy of tumour disorders.
  • the present application furthermore provides the use of the compounds according to the invention for preparing a medicament for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor positive prostate carcinomas, cervix carcinomas, breast carcinomas, in particular of hormone receptor-negative, hormone receptor-positive or BRCA-associated breast carcinomas, pancreas carcinomas, kidney cell carcinomas, hepatocellular carcinomas, melanomas and other skin tumours, non-small-cell bronchial carcinomas, endometrial carcinomas and colorectal carcinomas.
  • leukaemias in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor positive prostate carcinomas, cervix carcinomas, breast carcinomas, in particular of hormone receptor-negative, hormone receptor-positive or BRCA-associated
  • the present application furthermore provides the use of the compounds according to the invention for preparing a medicament for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor positive prostate carcinomas, breast carcinomas, in particular oestrogen receptor alpha negative breast carcinomas, melanomas or multiple myelomas.
  • the present application furthermore provides the use of the compounds according to the invention for the prophylaxis and/or therapy of tumour disorders.
  • the present application furthermore provides the use of the compounds according to the invention for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, cervix carcinomas, breast carcinomas, in particular hormone receptor-negative, hormone receptor-positive or BRCA-associated breast carcinomas, pancreas carcinomas, kidney cell carcinomas, hepatocellular carcinomas, melanomas and other skin tumours, non- small-cell bronchial carcinomas, endometrial carcinomas and colorectal carcinomas.
  • leukaemias in particular acute myeloid leukaemias
  • prostate carcinomas in particular androgen receptor-positive prostate carcinomas
  • cervix carcinomas breast carcinomas
  • pancreas carcinomas in particular hormone receptor-negative, hormone receptor-positive or BRCA-associated breast carcinomas
  • pancreas carcinomas kidney cell carcinomas, hepatocellular carcinomas, melanomas and other skin tumours, non- small
  • the present application furthermore provides the use of the compounds according to the invention for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, breast carcinomas, in particular oestrogen receptor alpha-negative breast carcinomas, melanomas or multiple myelomas.
  • the present application furthermore provides pharmaceutical formulations in the form of tablets comprising one of the compounds according to the invention for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, cervix carcinomas, breast carcinomas, in particular of hormone receptor-negative, hormone receptor-positive or BRCA-associated breast carcinomas, pancreas carcinomas, kidney cell carcinomas, hepatocellular carcinomas, melanomas and other skin tumours, non-small-cell bronchial carcinomas, endometrial carcinomas and colorectal carcinomas.
  • leukaemias in particular acute myeloid leukaemias
  • prostate carcinomas in particular androgen receptor-positive prostate carcinomas
  • cervix carcinomas breast carcinomas
  • pancreas carcinomas in particular of hormone receptor-negative, hormone receptor-positive or BRCA-associated breast carcinomas
  • pancreas carcinomas kidney cell carcinomas, hepatocellular carcinomas, melan
  • the present application furthermore provides pharmaceutical formulations in the form of tablets comprising one of the compounds according to the invention for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, breast carcinomas, in particular oestrogen receptor-alpha-negative breast carcinomas, melanomas or multiple myelomas.
  • leukaemias in particular acute myeloid leukaemias
  • prostate carcinomas in particular androgen receptor-positive prostate carcinomas
  • breast carcinomas in particular oestrogen receptor-alpha-negative breast carcinomas
  • melanomas or multiple myelomas in particular acute myeloid leukaemias
  • leukaemias in particular acute myeloid leukaemias
  • prostate carcinomas in particular androgen receptor-positive prostate carcinomas
  • breast carcinomas in particular oestrogen receptor-alpha-negative breast carcinomas
  • melanomas melanomas or multiple myelomas
  • the invention furthermore provides the use of the compounds according to the invention for treating disorders associated with proliferative processes.
  • the invention furthermore provides the use of the compounds according to the invention for treating benign hyperplasias, inflammatory disorders, autoimmune disorders, sepsis, viral infections, vascular disorders and neurodegenerative disorders.
  • the compounds according to the invention can be employed by themselves or, if required, in combination with one or more other pharmacologically active substances, as long as this combination does not lead to unwanted and unacceptable side effects. Accordingly, the present invention furthermore provides medicaments comprising a compound according to the invention and one or more further active compounds, in particular for the prophylaxis and/or therapy of the disorders mentioned above.
  • the compounds of the present invention can be combined with known antihyperproliferative, cytostatic or cytotoxic substances for treatment of cancer disorders.
  • the combination of the compounds according to the invention with other substances customary for cancer therapy or else with radiotherapy is indicated in particular.
  • Suitable active compounds for combinations which may be mentioned by way of example, without this list being exclusive, are: abiraterone acetate, Abraxane, acolbifene, Actimmune, actinomycin D (dactinomycin), afatinib, Affinitak, Afinitor, aldesleukin, alendronic acid, Alfaferone, alitretinoin, allopurinol, Aloprim, Aloxi, Alpharadin, altretamine, aminoglutethimide, aminopterin, amifostine, amrubicin, amsacrine, anastrozole, Anzmet, apalutamide, apatinib, Aranesp, arglabin, arsen ic trioxide, Aromasin, arzoxifene, asoprisnil, L-asparaginase, atamestane, atrasentan, Avastin, axitinib, 5-azacytidine, azathio
  • Cam path camptothecin, capecitabin, carboplatin, carfilzomib, carmustine, Casodex, CCI- 779, CDC-501 , cediranib, Cefeson, Celebrex, celmoleukin, Cerubidine, cediranib, chlorambucil, cisplatin, cladribine, clodronic acid, clofarabine, colaspase, Corixa, crisnatol, crizotinib, cyclophosphamide, cyproterone acetate, cytarabine, dacarbazine, dactinomycin, darolutamide, dasatinib, daunorubicin, DaunoXome, Decadron, Decadron phosphate, decitabine, degarelix, Delestrogen, denileukin diftitox, Depo-Medrol, deslorelin, dexrazoxane,
  • the compounds according to the invention can also be combined in a very promising manner with biological therapeutics, such as antibodies (e.g. aflibercept, alemtuzumab, bevacizumab, brentuximumab, catumaxomab, cetuximab, denosumab, edrecolomab, gemtuzumab, ibritumomab, ipilimumab, ofatumumab, panitumumab, pertuzumab, rituximab, tositumumab, trastuzumab) and recombinant proteins.
  • biological therapeutics such as antibodies (e.g. aflibercept, alemtuzumab, bevacizumab, brentuximumab, catumaxomab, cetuximab, denosumab, edrecolomab, gemtuzumab, ibritumomab,
  • the compounds according to the invention may also achieve positive effects in combination with other therapies directed against angiogenesis, such as, for example, with bevacizumab, axitinib, regorafenib, cediranib, sorafenib, sunitinib or thalidomide.
  • Combinations with antihormones and steroidal metabolic enzyme inhibitors are particularly suitable because of their favourable profile of side effects.
  • the compounds according to the invention can moreover also be employed in combination with radiotherapy and/or surgical intervention.
  • the various aspects of the invention described in this application are illustrated by the following examples which are not meant to limit the invention in any way.
  • the compounds of general formula (I) according to the invention can be prepared according to the following Schemes 1 to 4.
  • the schemes and procedures described below illustrate synthetic routes to the compounds of general formula (I) of the invention and are not intended to be limiting. It is clear to the person skilled in the art that the order of transformations as exemplified in Scheme 1 to 4 can be modified in various ways. The order of transformations exemplified in these schemes is therefore not intended to be limiting. In addition, interconversion of any of the substituents R 1 and all other defined groups of formula I can be achieved before and/or after the exemplified transformations.
  • Compounds of general formula (la) can be obtained by reaction of compounds of general formula (P) or (Q) with compounds of formula (I la) or (lib), respectively. Reactions are employed depending on the nature of chemical functional groups at the corresponding reaction centers on both reacting partners. Chemical reactions employed, but not intended to be limiting, include, for example, amide formation, urea formation, nucleophilic substitutions reactions (alkylation, exchange of OH group).
  • amide coupling occurs by a reaction of an acid chloride with an amine in the presence of a base such as triethylamine, pyridine, N-e thyl- A/,A/-diisopropylamine, in an aprotic polar/non polar solvents such as acetonitrile, dichlomethane, 1,2 dichloroethane, chloroform, /V,/V-dimethylformamide (DMF), 1-methyl- pyrrolidin-2-one (NMP) at ambient or elevated temperatures.
  • a base such as triethylamine, pyridine, N-e thyl- A/,A/-diisopropylamine
  • an aprotic polar/non polar solvents such as acetonitrile, dichlomethane, 1,2 dichloroethane, chloroform, /V,/V-dimethylformamide (DMF), 1-methyl- pyrrolidin-2-one (N
  • a catalyst such as / ⁇ /,/ ⁇ /-dimethylaminopyridine, also, known as DMAP, is added to the reaction.
  • a catalyst such as / ⁇ /,/ ⁇ /-dimethylaminopyridine, also, known as DMAP.
  • amide coupling can be accomplished by a reaction of a carboxylic acid with an amine in the presence of a base and an appropriate coupling reagent in an aprotic polar/non polar solvent at ambient or elevated temperatures.
  • Suitable amide coupling are, for example, 0-(7-aza-1Hbenzotriazol-1-yl)-/V,/V,/ ⁇ r,/ ⁇ f-tetramethyluronium hexafluorphosphate, also called HATU, 0-(Benzotriazol-1-yl)-/V,/V,/V',/V'-tetramethyl-uronium tetrafluoroborate (TBTU),dicyclohexylcarbodiimide, a combination of 1 H-benzotriazol and 1-ethyl-3-[3- dimethylamino]carbodiimide hydrochloride or propanephosphonic acid anhydride (T3P).
  • T3P propanephosphonic acid anhydride
  • Appropriate bases include, for example, /V,/V-dimethylaminopyridine, N-etby ⁇ -N,N- diisopropylamine, triethylamine.
  • Solvents used in such amide coupling reaction are, for example, /V,/V-dimethylformamide(DMF),
  • Compounds of general formula (I), in particular (la) and (lb), can also be obtained by nucleophilic substitution of compounds of general formula (P) or (Q) with compounds of formula (lla) or (lib) with Yi or Y2 being an halogen in particular -l,-Br,-CI.
  • Selected examples disclosed employed sodium hydrogencarbonate in DMF at elevated temperatures (WO2008/64351 , page 81 compound 1), or /V-ethyl-/ ⁇ /,/ ⁇ /-diisopropylamine; in dioxane at elevated temperatures (US6727264, page 149, step 1), sodium carbonate in THF at elevated temperatures (US6262056, example 8).
  • the hydroxy group can be converted to a new functionality giving rise to Yi or Y2 being an O-LG, (LG meaning a Leaving Group) which allows further transformations.
  • LG as new functionality preferably includes, but is not limited to, a mesylate group or a tosylate group, which can be used as a suitable leaving group in subsequent nucleophilic reactions as well, see Journal of Medicinal Chemistry 2006, 49, 11, 3116-3135, WO2018/69863 (page 172), Bioorganic and Medicinal Chemistry 2015, 23, 24, 7735-7742 as selected examples.
  • Compounds of general formula (la), can also be obtained by urea formation of compounds of general formula (P) with compounds of general formula (lla), in which Yi is for example a - NH-C(0)-(lmidazolyl) group.
  • Yi is for example a - NH-C(0)-(lmidazolyl) group.
  • Such transformations have is disclosed in Bioorganic and Medicinal Chemistry2013vol. 21# 23p. 7283 - 7308, W02008/60621 as selected examples.
  • Formation of compounds of general formula (lla) with Yi being -NH-C(0)-(lmidazolyl) has been described for example in WO2011/162409 (column 348-349), W02003/104236 (page 62).
  • Compounds of general formula (lb) can also be obtained by reaction of compounds of general formula (Q) with compounds of general formula (lib) by similar reactions described above.
  • compounds of general formula (I) can be obtained by ether bond formation of compounds of formula (Q) with compounds (lib) using Mitsunobu reaction, see for selected examples, Journal of Medicinal Chemistry 2009 vol. 52# 19, 6012 - 6023, Journal of Organic Chemistry 2011, vol. 76, # 16, 6912 - 6917.
  • Compounds of general formula (I la) or (lib) can be obtained by connecting a suitably functionalized E3 ligase binder to the chain defined as Ri_.
  • PG is a Protecting Group
  • Preferred PGs are t-butyloxycarbonyl-, t-butylester, benzyloxycarbonyl-, benzyl- and para-methoxybenzyk
  • the compounds of general formula Ilia and lllb can purchased like for example in Intermediate 3.1 or obtained from commercial source and subsequently modified by standard functional groups transformation according to procedures known in the art.
  • the lUPAC names of the examples and intermediates were generated using the program ' ACD/Name batch version 12.01 ' from ACD LABS, and were adapted if needed.
  • the present invention covers the intermediate compounds which are disclosed in the Example Section of this text, infra.
  • the present invention covers any sub-combination within any embodiment or aspect of the present invention of intermediate compounds of general formula 1 to12, supra.
  • the compounds of general formula (I) of the present invention can be converted to any salt, preferably pharmaceutically acceptable salts, as described herein, by any method which is known to the person skilled in the art.
  • any salt of a compound of general formula (I) of the present invention can be converted into the free compound, by any method which is known to the person skilled in the art.
  • All reagents, for which the synthesis is not described in the experimental part, are either commercially available, or are known compounds or may be formed from known compounds by known methods by a person skilled in the art.
  • the compounds and intermediates produced according to the methods of the invention may require purification. Purification of organic compounds is well known to the person skilled in the art and there may be several ways of purifying the same compound. In some cases, no purification may be necessary. In some cases, the compounds may be purified by crystallization. In some cases, impurities may be removed by trituration using a suitable solvent. In some cases, the compounds may be purified by chromatography, particularly flash column chromatography, using for example prepacked silica gel cartridges, e.g.
  • Biotage SNAP cartridges KP-Sil ® or KP-NH ® in combination with a Biotage autopurifier system (SP4 ® or Isolera Four ® ) and eluents such as gradients of hexane/ethyl acetate or DCM/methanol.
  • SP4 ® or Isolera Four ® Biotage autopurifier system
  • eluents such as gradients of hexane/ethyl acetate or DCM/methanol.
  • regular silica gel was used in flash column chromatography.
  • the compounds may be purified by prep. HPLC using for example a Waters autopurifier equipped with a diode array detector and/or on-line electrospray ionization mass spectrometer in combination with a suitable prepacked reverse phase column and eluents such as gradients of water and acetonitrile which may contain additives such as trifluoroacetic acid, formic acid or aqueous ammonia.
  • HPLC HPLC using for example a Waters autopurifier equipped with a diode array detector and/or on-line electrospray ionization mass spectrometer in combination with a suitable prepacked reverse phase column and eluents such as gradients of water and acetonitrile which may contain additives such as trifluoroacetic acid, formic acid or aqueous ammonia.
  • purification methods as described above can provide those compounds of the present invention which possess a sufficiently basic or acidic functionality in the form of a salt, such as, in the case of a compound of the present invention which is sufficiently basic, a trifluoroacetate or formate salt for example, or, in the case of a compound of the present invention which is sufficiently acidic, an ammonium salt for example.
  • a salt of this type can either be transformed into its free base or free acid form, respectively, by various methods known to the person skilled in the art or be used as salts in subsequent biological assays. It is to be understood that the specific form (e.g. salt, free base etc.) of a compound of the present invention as isolated and as described herein is not necessarily the only form in which said compound can be applied to a biological assay in order to quantify the specific biological activity.
  • Instrument Shimadzu LCMS-2020; Column: Kinetex 2.6u XB-C18, 50 mmx3.0mm, particle size 2.6mM; eluent A: water + 0.05% TFA, eluent B: acetonitrile; gradient: 0-2.0 min. 5-80 % B, 2.0-2.8 min 80% B, 2.9 min. 5 % B; flow 1.5 mL/min; temperature: 40 °C; PDA: 254 nm.
  • Instrument Shimadzu LCMS-2020; Column: Kinetex 2.6u XB-C18, 50 mmx3.0mm, particle size 2.6mM; eluent A: water + 0.05% TFA, eluent B: acetonitrile; gradient: 0-6.0 min. 5-95 % B, 6.0-6.8 min 95% B, 6.9 min. 5 % B; flow 1.5 mL/min; temperature: 40 °C; PDA: 254 nm.
  • Instrument Shimadzu LCMS-2020; Column: Ascentis Express C18, 50 mmx2.1mm, particle size 2.7mM; eluent A: water + 0.05% TFA, eluent B: acetonitrile + 0.05% TFA; gradient: 0-2.1 min. 5-100 % B, 2.1-2.7 min 100% B, 2.7-2.75 min. 100-5 % B; flow 1.0 mL/min; temperature: 40 °C; PDA: 190-400 nm.
  • Instrument Shimadzu LCMS-2020; Column: Kinetex 2.6u XB-C18, 50 mmx3.0mm, particle size 2.6mM; eluent A: water + 0.05% TFA, eluent B: acetonitrile +0.05%TFA; gradient: 0-1.1 min. 5-100 % B, 1.1-1.7 min 100% B, 1.71-2.0 min. 100-5 % B; flow 1.5 mL/min; temperature: 45 °C; PDA: 190-400 nm.
  • Instrument Shimadzu LCMS-2020; Column: Kinetex 2.6u XB-C18 100A, 50 mmx3.0mm, particle size 2.6mM; eluent A: water + 0.1% TFA, eluent B: acetonitrile +0.1%TFA; gradient: 0-1.1 min. 10-100% B, 1.1-1.6 min 100% B, 1.6-1.7 min 100-10% B; flow 1.5 mL/min; temperature: 40°C; PDA: 190-400 nm.
  • Instrument Shimadzu LCMS-2020; Column: CAPCELL CORE C18, 50 mmx2.1mm, particle size 2.7mM; eluent A: water + 0.1 % TFA, eluent B: acetonitrile +0.1%TFA; gradient: 0-1.1 min. 10-100% B, 1.1-1.7 min 100% B, 1.7-1.75 min 100-10% B; flow 1.0 mL/min; temperature: 40°C; PDA: 190-400 nm.
  • multiplicities of proton signals in 1 H NMR spectra reflect the observed signal form and do not take into account any higher-order signal phenomena.
  • chemical shift data refers to the center of the signal in question.
  • the 1 H-NMR data of selected compounds are listed in the form of 1 H-NMR peaklists.
  • a peaklist is described by the general form: di (intensityi), 62 (intensity2), ... , d, (intensity,), ... , d h (intensity,,).
  • a 1 H-NMR peaklist is similar to a classical 1 H-NMR readout, and thus usually contains all the peaks listed in a classical NMR interpretation. Moreover, similar to classical 1 H-NMR printouts, peaklists can show solvent signals, signals derived from stereoisomers of the particular target compound, peaks of impurities, 13 C satellite peaks, and/or spinning sidebands.
  • the peaks of stereoisomers, and/or peaks of impurities are typically displayed with a lower intensity compared to the peaks of the target compound (e.g., with a purity of >90%).
  • Such stereoisomers and/or impurities may be typical for the particular manufacturing process, and therefore their peaks may help to identify a reproduction of the manufacturing process on the basis of "by-product fingerprints".
  • An expert who calculates the peaks of the target compound by known methods can isolate the peaks of the target compound as required, optionally using additional intensity filters. Such an operation would be similar to peak-picking in classical 1 H-NMR interpretation.
  • N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide (2.00 g, 4.63 mmol, synthesis described in WO2014026997, example 49.1 A) (1000 mg, 2.313mmol) in anhydrous THF (15 mL) was treated with tris(dibenzylideneacetone)dipalladium(0) (63.5 mg,
  • the title compound (CAS: 1061605-21-7) is commercially available from different vendors.
  • the reaction mixture was stirred at 90°C for 16h.
  • the mixture was cooled to RT, poured into water (50 ml_) and extracted with ethyl acetate (2 x 50 ml_).
  • the combined organic phases were washed with water (50 ml_) and brine (50 ml_), dried over anhydrous sodium sulfate, and concentrated under reduced pressure.
  • the crude product was purified by column chromatography with petroleum ether/ ethyl acetate (1:3/v:v) to yield 420 mg (24%) of the product.
  • the reaction mixture was stirred at 90°C for 16h. The mixture was cooled to RT, poured into water (50 mL) and extracted with ethyl acetate (2 x 50 ml). The combined organic phases were washed with water (50 mL) and brine (50 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product was purified by column chromatography with petroleum ether/ ethyl acetate (1 :4/v:v) to yield 350 mg (19%) of the product.
  • tert-butyl 3-(2- ⁇ 2-[2-( ⁇ 2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3- dihydro-1 H-isoindol-4-yl ⁇ amino)ethoxy]ethoxy ⁇ ethoxy)propanoate (intermediate 3.3, 304 mg, 570 pmol) was dissolved in DCM (10 ml) and TFA (880 pi, 11.4 mmol) added. The reaction mixture was stirred at ambient temperature for 2 h. The reaction was treated with another 878 mI of TFA and stirred for further 3 h. The volatiles were evaporated under reduced pressure.
  • the reaction mixture was stirred at 90°C for 16h. The mixture was cooled to RT, poured into water (50 mL) and extracted with ethyl acetate (2 x 50 ml). The combined organic phases were washed with water (50 mL) and brine (50 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product was purified by column chromatography with petroleum ether/ ethyl acetate (1:4/v:v) to yield 500 mg (28%) of the product.
  • the reaction mixture was stirred at 90°C for 16h. The mixture was cooled to room temperature, poured into water (50 ml_) and extracted with ethyl acetate (2x50 ml). The combined organic phases were washed with water (50 ml) and brine (50 ml_), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product was purified by column chromatography with petroleum ether/ ethyl acetate (1 :3/v:v) to yield 430 mg (22%) of the desired product.
  • the mixture was cooled to ambient temperature and ethyl acetate (30 mL) was added to the reaction mixture.
  • the organic phase was washed with sat. aqueous sodium hydrogencarbonate (3x 30 mL) and brine (30 mL), dried over anhydrous sodium sulfate and concentrated under reduced pressure.
  • the crude product was purified by column chromotography (2%-25% MeOH in DCM) to yield 206 mg (20%) of the desired product.
  • reaction mixture was stirred at RT for 16h.
  • crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 95.3 mg of the title compound (44 % yield) after freeze drying of the pooled fractions as yellow lyophilisate.
  • 3H-2,3-benzodiazepine-3-carboxamide (intermediate 1.1, 100 mg, 226 pmol) and 3-(2- ⁇ 2-[2- ( ⁇ 2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-4- yl ⁇ amino)ethoxy]ethoxy ⁇ ethoxy)propanoic acid (intermediate 3.6, 108 mg, 226 pmol) in DMF (1.2 ml_) was added N,N-diisopropylethylamine (160 pi, 910 pmol) followed by 1- propanephosphonic anhydride in DMF (260 pi, 50 % solution in DMF, 450 pmol; CAS- RN:[68957-94-8]).
  • reaction mixture was stirred at RT for 16h.
  • crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 103 mg of the title compound (50% yield) after freeze drying of the pooled fractions as yellow lyophilisate.
  • 3H-2,3-benzodiazepine-3-carboxamide (intermediate 1.1, 50.0 mg, 114 pmol) and ⁇ 2-[2-( ⁇ 2- [2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl ⁇ amino)-2- oxoethoxy]ethoxy ⁇ acetic acid (intermediate 3.10, 49.5 mg, 114 pmol) in DMF (1 ml_, 13 mmol) was added N,N-diisopropylethylamine (80 pi, 460 pmol) followed by 1- propanephosphonic anhydride in DMF (130 pi, 50 % solution in DMF, 230 pmol; CAS- RN:[68957-94-8]).
  • reaction mixture was stirred at RT for 16h.
  • crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 46.1 mg of the title compound (47% yield) after freeze drying of the pooled fractions as yellow lyophilisate.
  • reaction mixture was stirred at RT for 16h.
  • crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 31.1 mg of the title compound (31% yield) after freeze drying of the pooled fractions as lyophilisate.
  • reaction mixture was stirred at RT for 16h.
  • crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 47.2 mg of the title compound (43% yield) after freeze drying of the pooled fractions as yellow lyophilisate.
  • reaction mixture was stirred at RT for 16h.
  • crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 32 mg of the title compound (16% yield) after freeze drying of the pooled fractions as yellow lyophilisate.
  • the pharmacological activity of the compounds according to the invention can be assessed using in vitro and/or in vivo assays, as known to the person skilled in the art.
  • the following examples describe the biological activity of the compounds according to the invention, without the invention being limited to said examples.
  • Example compounds according to the invention were tested in selected biological assays one or more times. When tested more than once, data are reported as either average values or as median values, wherein
  • the average value also referred to as the arithmetic mean value, represents the sum of the values obtained divided by the number of times tested
  • the median value represents the middle number of the group of values when ranked in ascending or descending order. If the number of values in the data set is odd, the median is the middle value. If the number of values in the data set is even, the median is the arithmetic mean of the two middle values.
  • Examples were synthesized one or more times. When synthesized more than once, data from biological assays represent average values or median values calculated utilizing data sets obtained from testing of one or more synthetic batch.
  • Assay buffer 50 mM Hepes pH 7.5, 50 mM NaCI, 50 mM KF, 0.25 mM Chaps, 0.05 % BSA. Assay volume: 5 pi. Incubation time / temperature: overnight / 4 °C.
  • the reactions were performed in a volume of 5 pL in 384-well black microtiter plates and the measurements done with a PHERAstar reader (BMG Labtech, Ortenberg, Germany) using the HTRF module (excitation: 10 flashes at 320 nm; emission: 615 and 665 nm).
  • HEK293 cells stably expressing N-terminal fluorescently tagged BRD4 variants were generated by stable integration of expression constructs into HEK293 wild-type cells.
  • PROTAC-mediated degradation was measured by quantification of the tagGFP2-BRD4 fluorescence intensity after 24h compound treatment.
  • human embryonic kidney HEK293 cells DSMZ ACC 305
  • stably expressing tagGFP2-BRD4 were seeded in 20 pi into 384- well microtiter plates (8000 cells per well) containing 200 nl_ of compounds in Dose- Response. Control wells received DMSO. Plates were then incubated for 24h at 37 °C in a humidified incubator and fixed with 1% PFA for 30 min.
  • K562 myelogenous leukemia suspension cells (ATCC CCL- 243) were seeded in IMDM + 10% charcoal-treated fetal bovine serum, followed by 6-hour or 24-hour treatment with 500 nM of compounds (end concentration) at 37 °C, 5% CO2 and 95% humidity. After incubation, cell lysis and RNA isolation were performed with the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), cDNA Synthesis with the SuperscriptTM III First- Strand Synthesis SuperMix for qRT-PCR (Invitrogen, Carlsbad, CA, USA).
  • the TaqMan® Fast Advanced Master Mix, #4444557 (Thermo Fisher Scientific, Waltham, MA, USA) with 15 ng cDNA per well was used in triplicates in a 384-well plate, analyzed with 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA).
  • cyclophilin A transcript levels were measured as housekeeping gene for normalization purposes.
  • the following TaqMan probes were used: Hs00153408_m1 (c-Myc), Hs00958474_m1 (IKZF1) and 4326316E (cyclophilin A) (all from Thermo Fisher Scientific).
  • CA-46 Burkitt’s lymphoma cells (ATCC CRL-1648) were plated in RPMI-1640 with phenol red + 10 % FBS in a 12-well cell culture plate. After one day, cells were treated with different concentrations of compounds. 24 hours later, cells were harvested in 1x RIPA buffer (Thermo Fisher Scientific) with Benzonase (Merck Millipore, Burlington, MA, USA) and 1x Complete protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO, USA).
  • CA46 Burkitt’s lymphoma cells were plated in RPMI-1640 with phenol red + 10 % FBS at 2.7 x 10 5 cells/well in a 96-well microti ter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by CellTiter Glo (Promega, Mannheim, Germany) staining at day 0 and day 2. Luminescence was measured with the Tecan (Mannedorf, Switzerland) Spark plate reader (0.2 sec/well). IC50 values were calculated with the GraphPad Prism software.
  • CA46 Burkitt’s lymphoma cells were plated in RPMI-1640 with phenol red + 10 % FBS at 5.0 x 10 3 cells/well in a 96-well microti ter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by CellTiter Glo (Promega) staining at day 0 and day 8. Luminescence was measured with the Tecan Spark plate reader (0.2 sec/well). IC50 values were calculated with the GraphPad Prism software.
  • VCaP cells - 2 days VCaP human prostate tumor cells were plated in DMEM with phenol red + 10 % FBS at 2.7 x 10 5 cells/well in a 96-well microti ter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by CellTiter Glo (Promega) staining at day 0 and day 2. Luminescence was measured with the Tecan Spark plate reader (0.2 sec/well). IC50 values were calculated with the GraphPad Prism software.
  • VCaP human prostate tumor cells were plated in DMEM with phenol red + 10 % FBS at 4.0 x 10 4 cells/well in a 96-well microti ter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by CellTiter Glo (Promega) staining at day 0 and day 8. Luminescence was measured with the Tecan Spark plate reader (0.2 sec/well). IC50 values were calculated with the GraphPad Prism software.
  • DU-145 human prostate tumor cells were plated in DMEM /Ham’s F12 with phenol red + 10 % FBS at 2.0 x 10 3 cells/well in a 96-well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by alamarBlue (Thermo Fisher Scientific) staining at day 0 and day 5. Absorbance was measured with the Tecan Spark plate reader. IC50 values were calculated with the GraphPad Prism software.
  • DV-90 lung carcinoma cells were plated in RPMI-1640 with phenol red + 10 % FBS at 8.0 x 10 3 cells/well in a 96- well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by alamarBlue (Thermo Fisher Scientific) staining at day 0 and day 5. Absorbance was measured with the Tecan Spark plate reader. IC50 values were calculated with the GraphPad Prism software.
  • NCI-H2030 lung carcinoma cells were plated in RPMI-1640 with phenol red + 10 % FBS at 1.0 x 10 3 cells/well in a 96- well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by alamarBlue (Thermo Fisher Scientific) staining at day 0 and day 5. Absorbance was measured with the Tecan Spark plate reader. IC50 values were calculated with the GraphPad Prism software.
  • HS-852.T cells 5 days HS-852.T melanoma cells were plated in DMEM with phenol red + 10 % FBS at 8.0 x 10 3 cells/well in a 96- well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by alamarBlue (Thermo Fisher Scientific) staining at day 0 and day 5. Absorbance was measured with the Tecan Spark plate reader. IC50 values were calculated with the GraphPad Prism software.
  • DMSO normalized to vehicle
  • SK-MEL-2 melanoma cells were plated in MEM Earle ' s with phenol red + 10 % FBS at 8.0 x 10 3 cells/well in a 96- well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by alamarBlue (Thermo Fisher Scientific) staining at day 0 and day 5. Absorbance was measured with the Tecan Spark plate reader. IC50 values were calculated with the GraphPad Prism software.
  • DMSO normalized to vehicle
  • CHL-1 melanoma cells were plated in DMEM with phenol red + 10 % FBS at 1.0 x 10 3 cells/well in a 96- well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by alamarBlue (Thermo Fisher Scientific) staining at day 0 and day 5. Absorbance was measured with the Tecan Spark plate reader. IC50 values were calculated with the GraphPad Prism software.
  • DMSO normalized to vehicle
  • NanoBRET Nano-Glo substrate was prepared in Opti-MEM without phenol red (10 mM final concentration) and added at a final concentration of 13.5 mM.
  • Donor emission (450 nm) and acceptor emission (610 nm or 630 nm) were recorded after 3 min of substrate addition with a PHERAstar reader (BMG Labtech) using a NanoBRET module (Luminescence Module 450-610). The ratio of the emissions at 610 nm and 450 nm was used as the specific signal for further evaluation.
  • EC 50 values were calculated using a four-parameter fit, with a commercial software package (Genedata Screener, Basel, Switzerland).
  • Target engagement to CRBN was measured in live cells (live mode) compared to lytic cells (perm mode) using the In-cell CRBN Kit (Promega) to assess E3 target engagement as well as cell permeability.
  • Serial dilutions of test compounds were prepared in 100% DMSO using a Precision Pipetting System (BioTek).
  • BioTek Precision Pipetting System
  • the 100-fold concentrated solution of the test compound (50 nl_) in DMSO was transferred to non-binding microtiter test plates (384- well, Corning, USA) using a Hummingbird liquid handler (Digilab). Plates were sealed with adhesive foil and stored at - 20 °C until use.
  • NanoLuc-CRBN 3000 cells/well
  • Opti- MEM Opti- MEM without phenol red
  • white 384- well non-binding assay plates containing the test compounds.
  • digitonin SigmaAldrich
  • CRBN tracer 0.5 mM final concentration for live mode; 1 mM final concentration for perm mode
  • the perm mode assays were incubated for 30 min at RT while the live mode assays were incubated for 2h at 37 °C, 5% CO2.
  • NanoBRET NanoGlo substrate was prepared in Opti-MEM without phenol red (10 mM final concentration), additionally for the live mode the NanoGlo extracellular inhibitor was added at a final concentration of 20 mM (Promega).
  • Donor emission (450 nm) and acceptor emission (610 nm or 630 nm) were recorded after 3 min of substrate addition with a PHERAstar reader (BMG Labtech) using a NanoBRET module (Luminescence Module 450-610). The ratio of the emissions at 610 nm and 450 nm was used as the specific signal for further evaluation.
  • BRD4 crRNA Integrated DNA Technologies, Coralville, IA, USA
  • tracerRNA Integrated DNA Technologies
  • the single-stranded Ultramer DNA Oligonucleotide template Integrated DNA Technologies
  • a 24 mM stock of tracrRNA:crRNA duplex was prepared by boiling at 95 °C for 5 min and then cooling down on the bench.
  • Per electroporation reaction a ribonucleoprotein (RNP) complex was formed by incubating 100 pmol Cas9 and 120 pmol tracrRNA:crRNA for 20 min at ambient temperature.
  • RNP ribonucleoprotein
  • HEK293 cells (2 x 10 5 cells per reaction) were resuspended in 20 pL 4D Nucleofector solution (Lonza, Basel Switzerland). The RNP complex and 100 pmol donor template were electroporated with the 4D Nucleofector System (Lonza) using the program CM-130. Following electroporation pre-warmed growth medium was added and cells were incubated for 30 min at 37 °C, 5% CO2 before plating them on a 24-well plate. After 3-5 days post-electroporation, cells were analyzed for insertion of the HiBiT tag using the NanoGlo HiBiT Lytic Detection System (Promega) according to the manufacturer’s protocol.
  • edited CRISPR cells and parental cells were adjusted to 1 x 10 6 cells/mL. 50 pL were transferred to a white 96- well plate and Glo HiBiT Lytic Reagent (Promega), consisting of Nano-Glo HiBiT Lytic Buffer, Nano-Glo HiBiT Lytic Substrate, and LgBiT Protein was added according to the manufacturer’s protocol (Promega). Cells were incubated for 20 min at room temperature with shaking. Afterwards luminescence was measured using a PHERAstar reader (BMG Labtech).
  • crRNA_BRD4 tgggatcactagcatgtctg ssODN_BRD4 (single-stranded Ultramer DNA Oligonucleotide template) catctgctgactgatatctcacgggggctcttctctttgtagagtgcctggtgaagaatgtgatgggatcactagcatgGTGA
  • test compounds were prepared in 100% DMSO using a Precision Pipetting System (BioTek) e.g. 20 pM, 5.7 pM, 1.6 pM, 0.47 pM, 0.13 pM, 38 nM, 11 nM, 3.1 nM, 0.89 nM, 0.25 nM and 0.073 nM.
  • BioTek Precision Pipetting System
  • the 100-fold concentrated solution of the test compound (200 nL) in DMSO was transferred to white HV microti ter test plates (384-well, Corning) using a Hummingbird liquid handler (Digilab). Plates were sealed with adhesive foil and stored at -20 °C until use.
  • Edited cells were diluted to 6 c 10 5 cells/mL in growth medium. As a control unedited cells were added to one row on the plate to assess the background signal. 20 pL of cell suspension were added per well and incubated with compounds for 4h, 6h, or 24h. After the indicated amount of time Glo HiBiT Lytic Reagent (N3030; Promega), consisting of Nano-Glo HiBiT Lytic Buffer, Nano-Glo HiBiT Lytic Substrate, and LgBiT Protein, were added according to the manufacturer’s protocol (Promega), and cells were incubated for 20 min at room temperature with shaking. Afterwards luminescence was measured using a PHERAstar reader (BMG Labtech).
  • Glo HiBiT Lytic Reagent N3030; Promega
  • Glo HiBiT Lytic Reagent consisting of Nano-Glo HiBiT Lytic Buffer, Nano-Glo HiBiT Lytic Substrate, and L
  • HiBiT-BRD4 HEK293 cells were transfected with a plasmid encoding the LgBiT part of the Nanoluc (Promega) using Fugene HD (Promega). After 20h the transfected and edited cells were diluted to 3 c 10 5 cel I s/m L in growth medium. As a control unedited cells were added to one row on the plate to assess the background signal. 20 pL of cells were plated on white HV 384-well microtiter plates (Corning). On the next day medium was changed to C0 2 -independent medium (Thermo Fisher Scientific) containing 20 pM NanoGlo Endurazine substrate (Promega).
  • test compound e.g. 20 pM, 5.7 pM, 1.6 pM, 0.47 pM, 0.13 pM, 38 nM, 11 nM, 3.1 nM, 0.89 nM, 0.25 nM and 0.073 nM. Plates were sealed with a clear foil and read every 5 min for 24h at 37 °C using a PHERAstar reader (BMG Labtech).

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurosurgery (AREA)
  • Engineering & Computer Science (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Derivatives of 2,3- benzodiazepines as inhibitors of Bromodomain and extra C-terminal domain (BET) proteins, in particular the BRD4 family member, methods of preparing said compounds, intermediate compounds useful for preparing said compounds, pharmaceutical compositions and combinations comprising said compounds, and the use of said compounds for manufacturing pharmaceutical compositions for the treatment or prophylaxis of diseases for hyperproliferative disorders, in particular for tumor disorders. The 2,3- benzodiazepines derivatives according to the invention are active as inhibitors as well as degraders of BET proteins.

Description

SUBSTITUTED 2,3-BENZODIAZEPINES DERIVATIVES
The present invention covers derivatives of 2,3- benzodiazepines as inhibitors of Bromodomain and extra C-terminal domain (BET) proteins, in particular the BRD4 family member, methods of preparing said compounds, intermediate compounds useful for preparing said compounds, pharmaceutical compositions and combinations comprising said compounds, and the use of said compounds for manufacturing pharmaceutical compositions for the treatment or prophylaxis of diseases for hyperproliferative disorders, in particular for tumor disorders.
More particularly the 2,3- benzodiazepines derivatives according to the invention are active as inhibitors as well as degraders of BET proteins.
The present invention furthermore relates to the use of these BET protein inhibitors for benign hyperplasia, atherosclerotic disorders, sepsis, autoimmune disorders, vascular disorders, viral infections, fungal infections, for neurodegenerative disorders, for inflammatory disorders, for atherosclerotic disorders and for the control of male fertility.
BACKGROUND
The present invention covers derivatives of 2,3- benzodiazepines as BET protein inhibitors, particularly BRD4 inhibitors, as such and as protein degraders.
The human BET family has the four members BRD2, BRD3, BRD4 and BRDT. They each contain two related bromodomains and one extra C-terminal domain (Wu and Chiang, J.
Biol. Chem., 2007282:13141-13145). The bromodomains are protein regions that recognize acetyl ated lysine residues. Acetylated lysines are often found in the N-terminal region of histones (e.g. histone 3 or histone 4) and are characteristic features of an open chromatin structure which is permissive for active gene transcription (Kuo and Allis, Bioessays, 1998, 20:615-626). The various acetylation patterns bound by BET proteins in histones were studied in detail (Umehara et al., J. Biol. Chem., 2010, 285:7610-7618; Filippakopoulos et a!., Cell, 2012, 149:214-231). In addition, bromodomains can recognize other acetylated proteins. For example, BRD4 binds to RelA to stimulated NF-KB and transcriptional activity of inflammatory genes (Huang et al. , Mol. Cell. Biol., 2009, 29:1375-1387; Zhang et al. , J. Biol. Chem., 2012, 287:28840-28851 ; Hajmirza et al., Biomedicine, 2018, 6:pii E16). The extraterminal domain of BRD2, BRD3 and BRD4 interacts with several proteins having a role in chromatin modulation and regulation of gene expression (Rahman et al., Mol. Cell. Biol., 2011, 31:2641-2652).
Mechanistically BET proteins play important roles in cell growth and in the cell cycle (Taniguchi, Int. J. Mol. Sci. , 2016, 17:pii E1849). They are associated with mitotic chromosomes, suggesting a role in epigenetic memory (Dey et al., Mol. Biol. Cell, 2009, 20:4899-4909; Yang et al., Mol. Cell. Biol., 2008, 28:967-976). BRD4 is important for the post-mitotic reactivation of gene transcription (Zhao et al., Nat. Cell. Biol., 2011, 13:1295- 1304). It is essential for transcription elongation and for recruiting the elongation complex P- TEFb, which consists of CDK9 and cyclin T1, resulting in activation of RNA polymerase II (Yang et al., Mol. Cell, 2005, 19:535-545; Schroder et al., J. Biol. Chem., 2012, 287:1090- 1099; Li et al., Transcription, 2018, 9:88-94). As a consequence, the expression of genes involved in cell proliferation such as, for example, c-Myc and aurora B, is stimulated (You et al., Mol. Cell. Biol., 2009, 29:5094-5103; Zuber et al., Nature, 2011, 478:524-528). BRD2 and BRD3 bind to transcribed genes in hyperacetylated chromatin regions and promote transcription by RNA polymerase II (LeRoy et al., Mol. Cell, 2008, 30:51-60).
Knocking-down BRD4 expression or inhibiting its interaction with acetyl ated histones in various cell lines leads to G1 arrest and to cell death by apoptosis (Mochizuki et al., J. Biol. Chem., 2008, 283:9040-9048; Mertz et al., Proc. Natl. Acad. Sci. USA, 2011, 108:16669- 16674). It has also been shown that BRD4 binds to promoter regions of several genes that are activated in the G1 phase, for example cyclin D1 and D2 (Mochizuki et al., J. Biol.
Chem., 2008, 283:9040-9048). In addition, after BRD4 inhibition, inhibition of the expression of c-Myc, an essential factor in cell proliferation, was demonstrated (Dawson et al., Nature, 2011, 478:529-533; Delmore et al., Cell, 2011, 146:1-14; Mertz et al., Proc. Natl. Acad. Sci. USA, 2011, 108:16669-16674). Another gene strongly down-regulated following treatment with a BET inhibitor is IKZF1 (Siu et al., Leukemia, 2017, 31:1760-1769).
BRD2 and BRD4 knockout mice die early during embryogenesis (Gyuris et al., Biochim. Biophys. Acta, 2009, 1789:413-421; Houzelstein et al., Mol. Cell. Biol., 2002, 22:3794-3802). Heterozygous BRD4 mice have various growth defects, which can be attributed to reduced cellular proliferation (Houzelstein et al., Mol. Cell. Biol., 2002, 22:3794-3802).
BET proteins play an important role in various types of tumors. Fusion between the BET proteins BRD3 or BRD4 and NUT, a protein that normally is only expressed in the testis, leads to NUT midline carcinoma (French, Cancer Genet. Cytogenet, 2010, 203:16-20). The fusion protein prevents cellular differentiation and promotes proliferation (Yan et al., J. Biol. Chem., 2011, 286:27663-27675). The growth of derived in vivo models is reduced by a BRD4 inhibitor (Filippakopoulos et al., Nature, 2010, 468:1067-1073). The identification of selective and potent BET inhibitors brought evidence that BET proteins are involved in different leukemia types (Astorgues-Xerri et al., Leuk Lymphoma, 2019, 1-4, doi 10.1080/10428194.2019.1617860) and lymphoma types (Chaidos et al, Ther Adv Hematol, 2016, 6:128-141; Bernasconi et al, 2017, 178:936-948). BET inhibitors also show efficacy in solid tumors including prostate cancer (Urbanucci and Mills, Mol Cell Endocrinol, 2018, 462:31-40), breast cancer (Sahni and Keri, Pharmacol. Res., 2018, 129:156-176; Park et a!. , Sci. Rep., 2019, 9:13305), melanoma (Segura et a!., Cancer Res., 2013, 73:6264-6276; Gelato et al. , Oncogene, 2018, 37:512-521), lung cancer (Klingbeil et al. , Cell Death Dis., 2016, 7:e2365; Riveiro et al., Oncotarget, 2016, 7:84675-84687), pancreas cancer (Yamamoto et al, Oncotarget, 2016, 7:61469-61484; Jauset et al., Oncotarget, 2018, 9:18734-18746), colorectal cancer (McCleland et al., J. Clin. Invest., 2016, 126:639-652), gastric cancer (Montenegro et al., Oncotarget, 2016, 7:43997-44012) and glioblastoma (Berenguer-Daize, Int. J. Cancer, 2016, 139:2047-2055).
BET proteins are also involved in viral infections. BRD4 binds to the E2 protein of various papilloma viruses and is important for the survival of the viruses in latently infected cells (Wu et al., Genes Dev., 2006, 20:2383-2396; Vosa et al., J. Virol., 2012, 86:348-357; Morse et al., Antivir. Res., 2018, 154:158-165). The herpes virus that is responsible for Kaposi's sarcoma also interacts with various BET proteins, which is important for disease resistance (Viejo-Borbolla et al., J. Virol., 2005, 79:13618-13629; You et al., J. Virol., 2006, 80:8909- 8919). By binding to P-TEFb, BRD4 also plays an important role in HIV replication (Bisgrove et al., Proc. Natl Acad. Sci. USA, 2007, 104:13690-13695).
BET proteins are also involved in fungal infections (F. Mietton et al., Nat. Comm., 2017, 8:15482). The BET protein Bdf1 is essential for viability and virulence of Candida albicans and selective inhibitors, that do not interact with human BET bromodomains have been described (F. Mietton et al., Nat. Comm., 2017, 8:15482).
BET proteins are in addition involved in inflammatory processes. BRD2-hypomorphic mice display reduced inflammation in fat tissue (Wang et al., Biochem. J., 2009, 425:71-83). The infiltration of macrophages in white fat tissue is also reduced in BRD2-deficient mice (Wang et al., Biochem. J., 2009, 425:71-83). It has also been shown that BRD4 regulates a number of genes that are involved in inflammation. In LPS-stimulated macrophages, a BRD4- inhibitor prevents the expression of inflammatory genes, for example IL-1 or IL-6 (Nicodeme et al., Nature, 2010, 468:1119-1123).
BET proteins also regulate the expression of the ApoA1 gene which plays an important role in atherosclerosis and in inflammatory processes (Chung et al., J. Med. Chem, 2011, 54:3827-3838; Gosmini et al., J. Med. Chem., 2014, 57:8111-8131; Hajmirza et al., Biomedicines, 2018, 6:pii E16). Apolipoprotein A1 (ApoA1) is a main component of high density lipoproteins (HDL), and an elevated expression of ApoA1 leads to increased blood cholesterol levels (Degoma and Rader, Nat. Rev. Cardiol., 2011, 8:266-277). Increased HDL levels are associated with a reduced risk of atherosclerosis (Chapman et al., Eur. Heart J., 201110.1080/10428194.2019.1617860, 32:1345- 1361). A role of BET proteins in obesity (Brown et al., Proc. Natl. Acad. Sci, 2018, 115:2144-2149) and neurological disorders (Kingwell, Nat. Rev. Drug Discov., 2017, 16:677; Penas et al.,
Nat. Commun., 2019, 10:3028) has furthermore been described.
The BET family member BRDT is expressed exclusively in the testis and plays an essential role in spermatogenesis (Zdrojewicz et al., Adv. Clin. Exp. Med., 2015, 24:705-714; Barda et al., Gene Expr. Patterns, 2016, 20:130-137). Blockade of BRDT function leads to reversible infertility without impact on the endocrine system (Shang et al., Development, 2007, 139:3507-3515).
2,3- benzodiazepines derivatives are known in the state of the art as potent inhibitors of BET proteins, in particular as BRD4 inhibitors. Their synthesis and activity were described for example in the patent applications: WO2014/026997, WO2014/128067, WO2014/202578, WO2015/121226, W02015/121230, WO2015/121227, WO2015/121268, WO2016/062688.
The compounds according to the invention differ from those disclosed in the state of the art for the fact that they possess a specific substitution comprising a linker and an E3 ligase binder on the (hetero)cyclic moiety. Such specific substitution does not only modify the activity on BET, but also provides the possibility to engage the ubiquitin proteasome system by means of recruitment of E3 ligases such as von Hippel-Lindau (VHL) or Cereblon (CRBN). These chimeric compounds have the ability of initiating the degradation of the BET protein, thus providing a stronger effect on the physiological activity in comparison to just inhibiting the activity of the protein.
T argeted protein degradation refers to small molecule-induced ubiquitination and degradation of disease targets, in which the small molecule simultaneously recruits both the target protein and a ubiquitin E3 ligase into close proximity of each other which leads to ubiquitination of the target protein at specific lysine residues. A clinical proof of concept for targeted protein degradation is provided by the recent discovery that the potent anti-cancer drugs thalidomide, lenalidomide and pomalidomide (collectively known as IMiDs) exert their therapeutic effects through induced degradation of key efficacy targets, such as IKZF1, IKZF3, ZFP91, or casein kinase 1 alpha (An et al., Nat. Commun., 2017, 8:15398; Kronke et al, Nature, 2015, 523:183-188; Petzold et al., Nature, 2016, 532:127-130). IMiDs recruit CRBN, which belongs to an E3 ubiquitin ligase complex, and act by redirecting the activity of this complex to ubiquitinate the protein bound by the other moiety of the chimeric compound, ultimately leading to degradation. (Chamberlain et al, Nat. Struct. Mol. Biol., 2014, 21:803- 809 ; Fischer et al., Nature, 2014, 512:49-53; Ito et al., Science, 2010, 327 : 1345-1350; Petzold et al., Nature, 2016, 532 :127-130). ARV-110 and ARV-471 are clinical chimeric compounds targeting the androgen receptor or estrogen receptor, respectively, and coupled to a moiety that recruits the E3 ligase complex (Neklesa et al., Cancer Res, 2018, 78:abstract 5236 ; Flanagan et al., Cancer Res., 2019, 74: abstract P5-04-18).
Potent and selective BET degraders have been reported in the state of the art. BET degraders differ from BET inhibitors in their cellular potency, phenotypic effects, pharmacokinetic proper-ties and toxicity profiles. Furthermore, differential outcomes are observed in the cellular and animal models for BET degraders in comparison to BET inhibitors (Yang et al., Drug Discov. Today, 2019, 31:43-51; Scheepstra M et al., Comput. Struct. Biotechnol. J., 2019, 17:160-176).
Despite the strong preclinical antitumor activity demonstrated by BET degraders in vitro and in vivo, no BET degrader has been advanced into clinical development, suggesting that either a selective BRD4 degrader or a tissue-specific BET degrader may be needed for successful clinical development. There is therefore a medical need for improved compounds presenting a selective inhibition of BET together with subsequent degradation.
Accordingly, it would be desirable to provide novel compounds having prophylactic and therapeutic properties.
It is therefore an object of the present invention to provide compounds and pharmaceutical compositions comprising these compounds for prophylactic and therapeutic use for hyperproliferative disorders, in particular for tumor disorders, and also as BET protein inhibitors for viral infections, for neurodegenerative disorders, for inflammatory disorders, for atherosclerotic disorders, for obesity and for the control of male fertility.
DESCRIPTION OF THE INVENTION
In accordance with a first aspect, the present invention covers compounds of general formula (I):
Figure imgf000006_0001
in which: R1 represents cyclopropyl, -(CrC2)-alkyl, m ethoxy or methylamino,
A represents a group from:
Figure imgf000007_0001
wherein ** represents the connection point to RL,
Ri_ is a (C1-C20) alkyl chain, in which one or more carbon atom can be optionally replaced by -0-, or -N(RLI)- or -C(O)-, or by a 4, 5 or 6 membered carbocyclic or heterocyclic ring, excluding combinations such as, -0-0-, -N(Ru)-N(Ru)-, -C(0)-C(0)-, -N(RLI)-0-, -C(0)-0- 0(0), and in which Ru is hydrogen or -(CrC6)-alkyl
E3 LB represents a group selected from:
Figure imgf000007_0002
wherein *** indicates the point of attachment of a group with Ri_; and stereoisomers, tautomers, N-oxides, hydrates, solvates, and salts thereof, and mixtures of the same.
In accordance with a second aspect, the present invention covers compounds of general formula (la):
Figure imgf000008_0001
in which:
R1 represents cyclopropyl, -(CrC2)-alkyl, m ethoxy or methylamino,
RL is a (C1-C20) alkyl chain, in which one or more carbon atom can be optionally replaced by -0-, or -N(RLI)- or -C(O)-, or by a 4, 5 or 6 membered carbocyclic or heterocyclic ring, excluding combinations such as, -0-0-, -N(Ru)-N(Ru)-, -C(0)-C(0)-, -N(RLI)-0-, -C(0)-0- 0(0), and in which RLI is hydrogen or -(CrC6)-alkyl
E3 LB represents a group selected from:
Figure imgf000008_0002
wherein *** indicates the point of attachment of a group with RL; and stereoisomers, tautomers, N-oxides, hydrates, solvates, and salts thereof, and mixtures of the same.
In accordance with a third aspect, the present invention covers compounds of general formula (lb):
Figure imgf000009_0001
in which:
R1 represents cyclopropyl, -(CrC2)-alkyl, m ethoxy or methylamino,
RL is a (C1-C20) alkyl chain, in which one or more carbon atom can be optionally replaced by -0-, or -N(RLI)- or -C(0)-, or by a 4, 5 or 6 membered carbocyclic or heterocyclic ring, excluding combinations such as, -0-0-, -N(Ru)-N(Ru)-, -C(0)-C(0)-, -N(RLI)-0-, -C(0)-0- 0(0), and in which Ru is hydrogen or -(CrC6)-alkyl,
E3LB represents a group selected from:
Figure imgf000009_0002
wherein *** indicates the point of attachment of a group with RL; and stereoisomers, tautomers, N-oxides, hydrates, solvates, and salts thereof, and mixtures of the same.
Further aspects of the inventions refer to compounds of formula (I), (la) and (lb) in which R1 represents methylamino.
In relation to formula (I) defined above, RL is also defined as the linker between the E3 ligase binder (E3LB) and the BET Protein binding molecule which made by the core of general formula I together with the group A.
In accordance with a fourth aspect, the present invention covers compounds of general formula (lb):
Figure imgf000010_0001
in which:
R1 represents cyclopropyl, -(CrC2)-alkyl, m ethoxy or methylamino,
RL is a (C1-C20) alkyl chain, in which one or more carbon atom can be optionally replaced by -0-, or -N(RLI)- or -C(O)-, or by a 4, 5 or 6 membered carbocyclic or heterocyclic ring, excluding combinations such as, -0-0-, -N(Ru)-N(Ru)-, -C(0)-C(0)-, -N(RLI)-0-, -C(0)-0- 0(0), and in which RLI is hydrogen or -(CrC6)-alkyl,
E3LB represents a group selected from:
Figure imgf000010_0002
wherein *** indicates the point of attachment of a group with RL; and stereoisomers, tautomers, N-oxides, hydrates, solvates, and salts thereof, and mixtures of the same.
Further aspects of the inventions refer to compounds of formula (I), (la) and (lb) in which R1 represents methylamino.
In relation to formula (I) defined above, RL is also defined as the linker between the E3 ligase binder (E3LB) and the BET Protein binding molecule which made by the core of general formula I together with the group A.
Moreover, the invention covers compounds of formula (I), (la) and (lb) are those in which RL is
Figure imgf000011_0001
wherein ** and *** indicate the point of attachment of a Ri_ group with the BET Binding Molecule and E3 LB respectively.
Furthermore, compounds of formula (la) are those in which RL is
Figure imgf000011_0002
wherein ** and *** indicate the point of attachment of a Ri_ group with the BET Binding Molecule and E3 LB respectively. Moreover, compounds of formula (lb) are those in which Ri_ is
Figure imgf000012_0001
More in detail, compounds of formula (I), (la) and (lb) are those in which Ri_ is
Figure imgf000013_0001
wherein ** and *** indicate the point of attachment of a Ri_ group with the BET Binding Molecule and E3 LB respectively.
Further compounds of formula (lb) are those specifically in which Ri_ is
Figure imgf000013_0002
wherein ** and *** indicate the point of attachment of a Ri_ group with the BET Binding Molecule and E3 LB respectively.
According to particular embodiments of the present invention 4, 5 or 6 membered carbocyclic or heterocyclic rings are: pyrrolidine, pyrazolidine, imidazolidine, pyrroline pyrazoline imidazoline, pyrrole, pyrazole, imidazole, isoxazole, oxazole, thiophene, isothiazole, thiazole, furan piperidine, hexahydropyridazine, hexahydropyrimidine, pyridine, pyrimidine, pyrazine, 2H-pyran, 4H-pyran.
In accordance to further particular embodiments of the present invention -(CrC6)-alkyl means linear or branched pentyl, butyl, or propyl, more in particular -(CrC2)-alkyl which means methyl or ethyl.
The present invention covers the compounds of general formula (I) which are disclosed in the Example Section of this text, infra ; said specific compounds are: (4S)-1-(4-{4-[15-({2-[2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl}amino)-
4,7,10,13-tetraoxapentadecanan-1-oyl]piperazin-1-yl}phenyl)-7,8-dimethoxy-N,4- dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
(4S)-1-(4-{4-[15-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-4,7,10,13-tetraoxapentadecanan-1-oyl]piperazin-1-yl}phenyl)-7,8-dimethoxy- N,4-dimethyl-4,5-dihydro-3H-2, 3-benzodiazepine- 3-carboxamide, (4S)-1-(4-{4-[3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol- 4-yl}amino)ethoxy]ethoxy}ethoxy)propanoyl]piperazin-1-yl}phenyl)-7,8-dimethoxy-N,4- dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide, (4S)-1-(4-{4-[3-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1 H-isoindol-4- yl}amino)ethoxy]ethoxy}ethoxy)propanoyl]piperazin-1-yl}phenyl)-7,8-dimethoxy-N,4- dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide (4S)-1-(4-{4-[(2-{2-[2-({2-[2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-2-oxoethoxy]ethoxy}ethoxy)acetyl]piperazin-1-yl}phenyl)-7,8-dimethoxy-N,4- dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide (4S)-1-{4-[4-({2-[2-({2-[2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-2-oxoethoxy]ethoxy}acetyl)piperazin-1-yl]phenyl}-7,8-dimethoxy-N,4- dimethyl-4, 5-dihydro-3H-2,3-benzodiazepine-3-carboxamide (4S)-1-[4-(4-{5-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-4- yl}oxy)acetamido]pentanoyl}piperazin-1-yl)phenyl]-7,8-dimethoxy-N,4-dimethyl-4,5- dihydro-3H-2,3-benzodiazepine-3-carboxamide (4S)-1-(4-{4-[14-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-14-oxo-3,6,9,12-tetraoxatetradecanan-1-oyl]piperazin-1-yl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2, 3-benzodiazepine- 3-carboxamide (4R)-1-(4-{4-[15-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1 H-isoindol-4- yl}amino)-4,7,10,13-tetraoxapentadecanan-1-oyl]piperazin-1-yl}phenyl)-7,8-dimethoxy- N,4-dimethyl-4,5-dihydro-3H-2, 3-benzodiazepine- 3-carboxamide (4R)-1-(4-{4-[3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H-isoindol- 4-yl}amino)ethoxy]ethoxy}ethoxy)propanoyl]piperazin-1-yl}phenyl)-7,8-dimethoxy-N,4- dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide (4S)-1-(4-{[2-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-4- yl}amino)ethoxy]ethoxy}ethoxy)ethyl]carbamoyl}phenyl)-7,8-dimethoxy-N, 4-dimethyl- 4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide (4S)-1-[4-({4-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}oxy)acetamido]butyl}carbamoyl)phenyl]-7,8-dimethoxy-N,4-dimethyl-4,5-dihydro-3H-
2,3-benzodiazepine-3-carboxamide (4S)-1-(4-{[14-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-3,6,9,12-tetraoxatetradecan-1-yl]carbamoyl}phenyl)-7,8-dimethoxy-N,4- dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide (4S)-1-(4-{4-[3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol- 5-yl}amino)ethoxy]ethoxy}ethoxy)propanoyl]piperazin-1-yl}phenyl)-7,8-dimethoxy-N,4- dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide, and (4S)-1-(4-{4-[15-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-5- yl}amino)-4,7,10,13-tetraoxapentadecan-1-oyl]piperazin-1-yl}phenyl)-7,8-dimethoxy- N,4-dimethyl-4,5-dihydro-3H-2, 3-benzodiazepine- 3-carboxamide N-(13-{4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1-yl]phenyl}-13-oxo-3,6,9-trioxa-12-azatridecanan-1-oyl)-3-methyl-L- valyl-(4R)-4-hydroxy-N-{[4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl}-L-prolinamide
N-{[2-(2-{4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1-yl]benzamido}ethoxy)ethoxy]acetyl}-3-methyl-L-valyl-(4R)-4-hydroxy-
N-{[4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl}-L-prolinamide
N-(16-{4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1-yl]phenyl}-16-oxo-3,6,9,12-tetraoxa-15-azahexadecanan-1-oyl)-3- methyl-L-valyl-(4R)-4-hydroxy-N-{[4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl}-L- prolinamide and stereoisomers, tautomers, N-oxides, hydrates, solvates, and salts thereof, and mixtures of the same.
Compounds according to the invention are the compounds of the formula (I) and their salts, solvates and solvates of the salts, the compounds included in the formula (I) of the formulae mentioned in the following and their salts, solvates and solvates of the salts, and the compounds included in the formula (I) and mentioned in the following as embodiment examples and their salts, solvates and solvates of the salts, where the compounds included in the formula (I) and mentioned in the following are not already salts, solvates and solvates of the salts.
The present invention likewise embraces the use of the salts of the compounds according to the invention.
In the context of the present invention, preferred salts are physiologically acceptable salts of the compounds according to the invention, these are also defined as pharmaceutical acceptable salts. However, salts which for their part are not suitable for pharmaceutical applications but which can be used, for example, for isolating and purifying the compounds according to the invention are also included. Physiologically acceptable salts of the compounds according to the invention include acid addition salts of mineral acids, carboxylic acids and sulphonic acids, e.g. salts of hydrochloric acid, hydrobromic acid, sulphuric acid, phosphoric acid, methanesulphonic acid, ethanesulphonic acid, toluenesulphonic acid, benzenesulphonic acid, naphthalenedisulphonic acid, acetic acid, trifluorooacetic acid, propionic acid, lactic acid, tartaric acid, malic acid, citric acid, fumaric acid, maleic acid, and benzoic acid.
Physiologically acceptable salts of the compounds according to the invention furthermore embrace, for example, base addition salts, for example of alkali metals such as sodium or potassium, of alkaline earth metals such as calcium or magnesium, or of ammonium salts derived from ammonia or organic amines containing 1 to 16 carbon atoms, such as, for example, methylamine, ethylamine, diethylamine, triethylamine, ethyldiisopropylamine, monoethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, dimethylamino- ethanol, procaine, dibenzylamine, /V-methylmorpholine, arginine, lysine, ethylenediamine, N- methylpiperidine, /V-methylglucamine, dimethylglucamine, ethylglucamine, 1,6-hexadiamine, glucosamine, sarcosine, serinol, tris(hydroxymethyl)aminomethane, aminopropanediol, Sovak base, and/or 1 -amino-2, 3, 4-butanetriol. Furthermore, the compounds according to the invention can form base addition salts with quarternary ammonium ions which can be obtained, for example, by quarternization of appropriate amines with agents such as lower alkyl halides, for example methyl, ethyl, propyl and butyl chlorides, bromides and iodides, dialkyl sulphates such as dimethyl, diethyl, dibutyl and diamyl sulphate, long-chain halides such as decyl, lauryl, myristyl and stearyl chlorides, bromides and iodides, or arylalkyl halides such as benzyl bromide or phenethyl bromide. Examples of such quarternary ammonium ions are tetramethylammonium, tetraethylammonium, tetra(n-propyl)ammonium, tetra(n-butyl)ammonium, and also benzyltrimethylammonium.
The present invention furthermore provides all possible crystalline and polymorphic forms of the compounds according to the invention, the polymorphs being present either as individual polymorphs or as a mixture of a plurality of polymorphs in any concentration ranges.
The present invention furthermore provides medicaments comprising the compounds according to the invention and at least one or more other active compounds, in particular for the prophylaxis and/or therapy of tumour disorders.
Solvates in the context of the invention are designated as those forms of the compounds according to the invention which form a complex in the solid or liquid state by coordination with solvent molecules. Hydrates are a specific form of solvates, in which the coordination takes place with water. Hydrates are preferred solvates in the context of the present invention. The compounds according to the invention can exist in different stereoisomeric forms depending on their structure, i.e. in the form of configuration isomers or optionally also as conformation isomers. At position 4, the compounds according to the invention have a centre of asymmetry. They can therefore be present as pure enantiomers, racemates or else as diastereomers or mixtures thereof if one or more of the substituents described in formula (I) comprises a further asymmetric element, for example an achiral carbon atom. The present invention therefore also includes the enantiomers and diastereomers and their particular mixtures. The stereoisomerically uniform constituents can be isolated from such mixtures of enantiomers and/or diastereomers in a known manner; chromatography processes are preferably used for this, in particular HPLC chromatography on an achiral or chiral phase.
In general, the enantiomers according to the invention inhibit the target with different potency and have different activity in the cancer cell lines investigated.
Where the compounds according to the invention can occur in tautomeric forms, the present invention includes all the tautomeric forms.
The present invention also encompasses all suitable isotopic variants of the compounds according to the invention. An isotopic variant of a compound according to the invention is understood here to mean a compound in which at least one atom within the compound according to the invention has been exchanged for another atom of the same atomic number, but with a different atomic mass than the atomic mass which usually or predominantly occurs in nature. Examples of isotopes which can be incorporated into a compound according to the invention are those of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine, chlorine, bromine and iodine, such as 2H (deuterium), 3H (tritium), 13C, 14C, 15N, 170, 180, 32P, 33P, 33S, 34S, 35S, 36S, 18F, 36CI, 82Br, 123l, 124l, 129l and 131l. Particular isotopic variants of a compound according to the invention, especially those in which one or more radioactive isotopes have been incorporated, may be beneficial, for example, for the examination of the mechanism of action or of the active compound distribution in the body; due to comparatively easy preparability and detectability, especially compounds labelled with 3H or 14C isotopes are suitable for this purpose. In addition, the incorporation of isotopes, for example of deuterium, can lead to particular therapeutic benefits as a consequence of greater metabolic stability of the compound, for example an extension of the half-life in the body or a reduction in the active dose required; such modifications of the compounds according to the invention may therefore in some cases also constitute a preferred embodiment of the present invention. Isotopic variants of the compounds according to the invention can be prepared by generally used processes known to those skilled in the art, for example by the methods described below and the methods described in the working examples, by using corresponding isotopic modifications of the particular reagents and/or starting compounds therein.
The present invention moreover also includes prodrugs of the compounds according to the invention. The term "prodrugs" here designates compounds which themselves can be biologically active or inactive but are converted (for example metabolically or hydrolytically) into compounds according to the invention during their dwell time in the body.
The compounds according to the invention can act systemically and/or locally. For this purpose, they can be administered in a suitable manner, such as, for example, orally, parenterally, pulmonarily, nasally, sublingually, lingually, buccally, rectal ly, dermally, transdermally, conjunctivally, otically, as or as an implant or stent.
For these administration routes, the compounds according to the invention can be administered in suitable administration forms.
Suitable for oral administration are administration forms working according to the prior art, which release the compounds according to the invention rapidly and/or in modified form and comprise the compounds according to the invention in crystalline and/ or amorphized and/or dissolved form, such as, for example, tablets (non-coated or coated tablets, for example coated with enteric, slowly dissolving or insoluble coats which control the release of the compound according to the invention), tablets which decompose rapidly in the oral cavity or films/wafers, films/lyophylizates, capsules (for example hard gelatin capsules or soft gelatin capsules), sugar-coated tablets, granules, pellets, powders, emulsions, suspensions, aerosols or solutions.
Parenteral administration can take place with circumvention of an absorption step (for example intravenous, intraarterial, intracardiac, intraspinal or intralumbar) or with involvement of an absorption (for example intramuscular, subcutaneous, intracutaneous, percutaneous or intraperitoneal). For parenteral administration, suitable administration forms are, inter alia, injection and infusion preparations in the form of solutions, suspensions, emulsions, lyophilizates or sterile powders.
Suitable for the other administration routes are, for example, pharmaceutical forms for inhalation (inter alia powder inhalers, nebulizers), nasal drops, nasal solutions, nasal sprays; tablets, films/wafers or capsules to be applied lingually, sublingually or buccally, suppositories, ear or eye preparations, vaginal capsules, aqueous suspensions (lotions, shake lotions), lipophilic suspensions, ointments, creams, transdermal therapeutic systems (such as, for example, patches), milk, pastes, foams, dusting powders, implants or stents. The compounds according to the invention can be converted into the administration forms mentioned. This may take place in a manner known per se by mixing with inert non-toxic, pharmaceutically acceptable auxiliaries. These auxiliaries include, inter alia, carriers (for example microcrystalline cellulose, lactose, mannitol), solvents (for example liquid polyethylene glycols), emulsifiers and dispersants or wetting agents (for example sodium dodecylsulphate, polyoxysorbitan oleate), binders (for example polyvinylpyrrolidone), synthetic and natural polymers (for example albumin), stabilizers (e.g. antioxidants such as, for example, ascorbic acid), colorants (e.g. inorganic pigments such as, for example, iron oxides) and taste and/or odour corrigents.
The present invention furthermore provides medicaments comprising the compounds according to the invention, usually together with one or more inert non-toxic, pharmaceutically suitable auxiliaries, and their use for the purposes mentioned above.
Formulation of the compounds according to the invention to give pharmaceutical products takes place in a manner known per se by converting the active compound(s) with the excipients customary in pharmaceutical technology into the desired administration form.
Auxiliaries which can be employed in this connection are, for example, carrier substances, fillers, disinteg rants, binders, humectants, lubricants, absorbents and adsorbents, diluents, solvents, cosolvents, emulsifiers, solubilizers, masking flavours, colorants, preservatives, stabilizers, wetting agents, salts to alter the osmotic pressure or buffers. Reference should be made in this connection to Remington's Pharmaceutical Science, 15th ed. Mack Publishing Company, East Pennsylvania (1980).
The pharmaceutical formulations may be in solid form, for example as tablets, coated tablets, pills, suppositories, capsules, transdermal systems or in semisolid form, for example as ointments, creams, gels, suppositories, emulsions or in liquid form, for example as solutions, tinctures, suspensions or emulsions.
Auxiliaries in the context of the invention may be, for example, salts, saccharides (mono-, di- , tri-, oligo-, and/or polysaccharides), proteins, amino acids, peptides, fats, waxes, oils, hydrocarbons and derivatives thereof, where the auxiliaries may be of natural origin or may be obtained by synthesis or partial synthesis.
Suitable for oral or peroral administration are in particular tablets, coated tablets, capsules, pills, powders, granules, pastilles, suspensions, emulsions or solutions. Suitable for parenteral administration are in particular suspensions, emulsions and especially solutions.
The present invention relates to the use of the compounds according to the invention.
They can be used for the prophylaxis and therapy of human disorders, in particular tumour disorders.
The compounds according to the invention can be used in particular for inhibiting or reducing cell proliferation and/or cell division and/or to induce apoptosis.
The compounds according to the invention are suitable in particular for the treatment of hyper-proliferative disorders such as, for example, psoriasis, keloids and other skin hyperplasias, benign prostate hyperplasias (BPH), solid tumours and haematological tumours.
Solid tumours which can be treated in accordance with the invention are, for example, tumours of the breast, the respiratory tract, the brain, the reproductive organs, the gastrointestinal tract, the urogenital tract, the eye, the liver, the skin, the head and the neck, the thyroid gland, the parathyroid gland, the bones and the connective tissue and metastases of these tumours.
Haematological tumours which can be treated are, for example, multiple myelomas, lymphomas or leukaemias.
Breast tumours which can be treated are, for example: breast carcinomas with positive hormone receptor status breast carcinomas with negative hormone receptor status Her-2 positive breast carcinomas hormone receptor and Her-2 negative breast carcinomas BRCA-associated breast carcinomas inflammatory breast carcinomas. Tumours of the respiratory tract which can be treated are, for example, non-small-cell bronchial carcinomas such as squamous-cell carcinoma, adenocarcinoma, large-cell carcinoma and small-cell bronchial carcinomas.
Tumours of the brain which can be treated are, for example, gliomas, glioblastomas, astrocytomas, meningiomas and medulloblastomas.
Tumours of the male reproductive organs which can be treated are, for example: prostate carcinomas, malignant tumours of the epididymis, malignant testicular tumours and penis carcinomas.
Tumours of the female reproductive organs which can be treated are, for example: endometrial carcinomas cervix carcinomas ova rial carcinomas vaginal carcinomas vulvar carcinomas
Tumours of the gastrointestinal tract which can be treated are, for example: colorectal carcinomas anal carcinomas stomach carcinomas pancreas carcinomas oesophagus carcinomas gall bladder carcinomas carcinomas of the small intestine salivary gland carcinomas neuroendocrine tumours gastrointestinal stroma tumours
Tumours of the urogenital tract which can be treated are, for example: urinary bladder carcinomas kidney cell carcinomas carcinomas of the renal pelvis and lower urinary tract Tumours of the eye which can be treated are, for example: retinoblastomas intraocular melanomas
Tumours of the liver which can be treated are, for example: hepatocellular carcinomas cholangiocellular carcinomas
Tumours of the skin which can be treated are, for example: malignant melanomas basaliomas spinaliomas Kaposi sarcomas Merkel cell carcinomas
Tumours of the head and neck which can be treated are, for example: larynx carcinomas carcinomas of the pharynx and the oral cavity carcinomas of midline structures (e.g. NMC, C.A. French, Annu. Rev. Pathol. 2012, 7:247-265)
Sarcomas which can be treated are, for example: soft tissue sarcomas osteosarcomas Lymphomas which can be treated are, for example: non-Hodgkin lymphomas Hodgkin lymphomas cutaneous lymphomas lymphomas of the central nervous system - AIDS-associated lymphomas Leukaemias which can be treated are, for example: acute myeloid leukaemias chronic myeloid leukaemias acute lymphatic leukaemias chronic lymphatic leukaemias hairy cell leukaemias
Advantageously, the compounds according to the invention can be used for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, cervix carcinomas, breast carcinomas, in particular of hormone receptor negative, hormone receptor positive or BRCA-associated breast carcinomas, pancreas carcinomas, kidney cell carcinomas, hepatocellular carcinomas, melanomas and other skin tumours, non-small-cell bronchial carcinomas, endometrial carcinomas and colorectal carcinomas.
Particularly advantageously, the compounds according to the invention can be employed for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, breast carcinomas, in particular oestrogen receptor alpha-negative breast carcinomas, melanomas or multiple myelomas.
The compounds according to the invention are also suitable for the prophylaxis and/or therapy of benign hyperproliferative diseases such as endometriosis, leiomyoma and benign prostate hyperplasia.
The compounds according to the invention are also suitable for controlling male fertility.
The compounds according to the invention are also suitable for the prophylaxis and/or therapy of systemic inflammatory diseases, in particular LPS-induced endotoxic shock and/or bacteria- induced sepsis. The compounds according to the invention are also suitable for the prophylaxis and/or therapy of inflammatory or autoimmune disorders such as: pulmonary disorders associated with inflammatory, allergic and/or proliferative processes: chronic obstructive pulmonary disorders of any origin, especially bronchial asthma; bronchitis of varying origin; all types of restrictive pulmonary disorders, especially allergic alveolitis; all types of pulmonary oedema, especially toxic pulmonary oedema; sarcoidoses and granulomatoses, especially Boeck's disease rheumatic disorders/autoimmune diseases/joint disorders associated with inflammatory, allergic and/or proliferative processes: all types of rheumatic disorders, especially rheumatoid arthritis, acute rheumatic fever, polymyalgia rheumatica; reactive arthritis; inflammatory soft tissue disorders of other origin; arthritic symptoms associated with degenerative joint disorders (arthroses); traumatic arth ritides; collagenoses of any origin, e.g. systemic lupus erythematosus, scleroderma, polymyositis, dermatomyositis, Sjogren's syndrome, Still's syndrome, Felty's syndrome allergies associated with inflammatory and/or proliferative processes: all types of allergic reactions, e.g. angioedema, hay fever, insect bite, allergic reactions to drugs, blood derivatives, contrast media etc., anaphylactic shock, urticaria, contact dermatitis vessel inflammations (vasculitides): panarterilitis nodosa, arterilitis temporalis, erythema nodosum dermatological disorders associated with inflammatory, allergic and/or proliferative processes: atopic dermatitis; psoriasis; pityriasis rubra pilaris; erythematous disorders induced by various noxae, e.g. radiation, chemicals, burns etc.; bullous dermatoses; lichenoid disorders; pruritus; seborrheic eczema; rosacea; pemphigus vulgaris; erythema exsudativum multiforme; balanitis; vulvitis; hair loss such as alopecia areata; cutaneous T-cell lymphomas renal disorders associated with inflammatory, allergic and/or proliferative processes: nephrotic syndrome; all nephritides hepatic disorders associated with inflammatory, allergic and/or proliferative processes: acute liver cell necrosis; acute hepatitis of varying origin, e.g. viral, toxic, drug-induced; chronic aggressive and/or chronic intermittent hepatitis gastrointestinal disorders associated with inflammatory, allergic and/or proliferative processes: regional enteritis (Crohn's disease); ulcerative colitis; gastritis; reflux oesophagitis; gastroenteritides of other origin, e.g. indigenous sprue proctological disorders associated with inflammatory, allergic and/or proliferative processes: anal eczema; fissures; haemorrhoids; idiopatic proctitis ocular disorders associated with inflammatory, allergic and/or proliferative processes: allergic keratitis, uveitis, iritis; conjunctivitis; blepharitis; optic neuritis; chlorioditis; sympathetic ophthalmia ear-nose-throat disorders associated with inflammatory, allergic and/or proliferative processes: allergic rhinitis, hay fever; otitis externa, e.g. caused by contact eczema, infection etc.; otitis media neurological disorders associated with inflammatory, allergic and/or proliferative processes: cerebral oedema, especially tumour-induced cerebral oedema; multiple sclerosis; acute encephalomyelitis; meningitis; various types of spasms, e.g. West syndrome haematological disorders associated with inflammatory, allergic and/or proliferative processes: acquired haemolytic anaemia; idiopathic thrombocytopenia tumour disorders associated with inflammatory, allergic and/or proliferative processes: acute lymphatic leukaemia; malignant lymphomas; lymphogranulomatoses; lymphosarcomas; extensive metastasization, especially in cases of breast, bronchial and prostate carcinomas endocrine disorders associated with inflammatory, allergic and/or proliferative processes: endocrine orbitopathy; thyreotoxic crisis; de Quervain thyroiditis; Hashimoto thyroiditis; Basedow's disease organ and tissue transplantations, graft-versus-host disease severe states of shock, e.g. anaphylactic shock, systemic inflammatory response syndrome (SIRS) substitution therapy in cases of: congenital primary adrenal insufficiency, e.g. congenital adrenogenital syndrome; acquired primary adrenal insufficiency, e.g. Addison’s disease, autoimmune adrenalitis, postinfectious tumours, metastases, etc; congenital secondary adrenal insufficiency, e.g. congenital hypopituitarism; acquired secondary adrenal insufficiency, e.g. postinfectious, tumours, etc emesis associated with inflammatory, allergic and/or proliferative processes, e.g. in combination with a 5-HT3 antagonist for emesis induced by cytostatic drugs pain of inflammatory origin, e.g. lumbago
The compounds according to the invention are also suitable for the treatment of viral disorders such as, for example, infections caused by papilloma viruses, herpes viruses, Epstein-Barr viruses, hepatitis B or C viruses and human immunodeficiency viruses.
The compounds according to the invention are also suitable for the treatment of atherosclerosis, dyslipidaemia, hypercholesterolaemia, hypertriglyceridaemia, peripheral vascular disorders, cardiovascular disorders, angina pectoris, ischaemia, stroke, myocardial infarction, angioplastic restenosis, hypertension, thrombosis, adiposity, endotoxemia.
The compounds according to the invention are also suitable for the treatment of neurodegenerative diseases such as, for example, multiple sclerosis, Alzheimer’s disease and Parkinson’s disease.
These disorders are well characterized in man but also exist in other mammals.
The present application furthermore provides the compounds according to the invention for use as medicaments, in particular for the prophylaxis and/or therapy of tumour disorders.
The present application furthermore provides the compounds according to the invention for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, cervix carcinomas, breast carcinomas, in particular hormone receptor-negative, hormone receptor positive or BRCA-associated breast carcinomas, pancreas carcinomas, kidney cell carcinomas, hepatocellular carcinomas, melanomas and other skin tumours, non-small-cell bronchial carcinomas, endometrial carcinomas and colorectal carcinomas.
The present application furthermore provides the compounds according to the invention for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, breast carcinomas, in particular oestrogen receptor alpha-negative breast carcinomas, melanomas or multiple myelomas.
The invention furthermore provides the use of the compounds according to the invention for preparing a medicament.
The present application furthermore provides the use of the compounds according to the invention for preparing a medicament for the prophylaxis and/or therapy of tumour disorders. The present application furthermore provides the use of the compounds according to the invention for preparing a medicament for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor positive prostate carcinomas, cervix carcinomas, breast carcinomas, in particular of hormone receptor-negative, hormone receptor-positive or BRCA-associated breast carcinomas, pancreas carcinomas, kidney cell carcinomas, hepatocellular carcinomas, melanomas and other skin tumours, non-small-cell bronchial carcinomas, endometrial carcinomas and colorectal carcinomas.
The present application furthermore provides the use of the compounds according to the invention for preparing a medicament for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor positive prostate carcinomas, breast carcinomas, in particular oestrogen receptor alpha negative breast carcinomas, melanomas or multiple myelomas.
The present application furthermore provides the use of the compounds according to the invention for the prophylaxis and/or therapy of tumour disorders.
The present application furthermore provides the use of the compounds according to the invention for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, cervix carcinomas, breast carcinomas, in particular hormone receptor-negative, hormone receptor-positive or BRCA-associated breast carcinomas, pancreas carcinomas, kidney cell carcinomas, hepatocellular carcinomas, melanomas and other skin tumours, non- small-cell bronchial carcinomas, endometrial carcinomas and colorectal carcinomas.
The present application furthermore provides the use of the compounds according to the invention for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, breast carcinomas, in particular oestrogen receptor alpha-negative breast carcinomas, melanomas or multiple myelomas.
The present application furthermore provides pharmaceutical formulations in the form of tablets comprising one of the compounds according to the invention for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, cervix carcinomas, breast carcinomas, in particular of hormone receptor-negative, hormone receptor-positive or BRCA-associated breast carcinomas, pancreas carcinomas, kidney cell carcinomas, hepatocellular carcinomas, melanomas and other skin tumours, non-small-cell bronchial carcinomas, endometrial carcinomas and colorectal carcinomas. The present application furthermore provides pharmaceutical formulations in the form of tablets comprising one of the compounds according to the invention for the prophylaxis and/or therapy of leukaemias, in particular acute myeloid leukaemias, prostate carcinomas, in particular androgen receptor-positive prostate carcinomas, breast carcinomas, in particular oestrogen receptor-alpha-negative breast carcinomas, melanomas or multiple myelomas.
The invention furthermore provides the use of the compounds according to the invention for treating disorders associated with proliferative processes.
The invention furthermore provides the use of the compounds according to the invention for treating benign hyperplasias, inflammatory disorders, autoimmune disorders, sepsis, viral infections, vascular disorders and neurodegenerative disorders.
The compounds according to the invention can be employed by themselves or, if required, in combination with one or more other pharmacologically active substances, as long as this combination does not lead to unwanted and unacceptable side effects. Accordingly, the present invention furthermore provides medicaments comprising a compound according to the invention and one or more further active compounds, in particular for the prophylaxis and/or therapy of the disorders mentioned above.
For example, the compounds of the present invention can be combined with known antihyperproliferative, cytostatic or cytotoxic substances for treatment of cancer disorders. The combination of the compounds according to the invention with other substances customary for cancer therapy or else with radiotherapy is indicated in particular.
Suitable active compounds for combinations which may be mentioned by way of example, without this list being exclusive, are: abiraterone acetate, Abraxane, acolbifene, Actimmune, actinomycin D (dactinomycin), afatinib, Affinitak, Afinitor, aldesleukin, alendronic acid, Alfaferone, alitretinoin, allopurinol, Aloprim, Aloxi, Alpharadin, altretamine, aminoglutethimide, aminopterin, amifostine, amrubicin, amsacrine, anastrozole, Anzmet, apalutamide, apatinib, Aranesp, arglabin, arsen ic trioxide, Aromasin, arzoxifene, asoprisnil, L-asparaginase, atamestane, atrasentan, Avastin, axitinib, 5-azacytidine, azathioprine, BCG or tice-BCG, bendamustine, bestatin, betamethasone acetate, betamethasone sodium phosphate, bexarotene, bicalutamide, bleomycin sulphate, broxuridine, bortezomib, bosutinib, busulfan, cabazitaxel, calcitonin,
Cam path, camptothecin, capecitabin, carboplatin, carfilzomib, carmustine, Casodex, CCI- 779, CDC-501 , cediranib, Cefeson, Celebrex, celmoleukin, Cerubidine, cediranib, chlorambucil, cisplatin, cladribine, clodronic acid, clofarabine, colaspase, Corixa, crisnatol, crizotinib, cyclophosphamide, cyproterone acetate, cytarabine, dacarbazine, dactinomycin, darolutamide, dasatinib, daunorubicin, DaunoXome, Decadron, Decadron phosphate, decitabine, degarelix, Delestrogen, denileukin diftitox, Depo-Medrol, deslorelin, dexrazoxane, diethylstilbestrol, Diflucan, 2', 2'- difluorodeoxycytidine, DN-101, docetaxel, doxifluridine, doxorubicin (Adriamycin), dronabinol, dSLIM, dutasteride, DW-166HC, edotecarin, eflornithine, Eligard, Elitek, Ellence, Emend, enzalutamide, epirubicin, epoetin- alfa, Epogen, epothilone and its derivatives, eptaplatin, Ergamisol, erlotinib, erythro- hydroxynonyladenine, Estrace, estradiol, estramustine sodium phosphate, ethynylestradiol, Ethyol, etidronic acid, Etopophos, etoposide, everolimus, exatecan, exemestan, fadrozole, Fareston, fenretinide, filgrastim, finasteride, fligrastim, floxuridine, fluconazole, fludarabine, 5-fluordeoxyuridine monophosphate, 5-fluorouracil (5-FU), fluoxymesterone, flutamide, Folotyn, formestane, fosteabine, fotemustin, fulvestrant, Gammagard, gefitinib, gemcitabine, gemtuzumab, Gleevec, Gliadel, goserelin, gossypol, granisetron-hydrochloride, hexamethylmelamine, histamine dihydrochloride, histrelin, holmium-166-DOTPM, Hycamtin, Hydrocortone, erythro-hydroxynonyladenine, hydroxyurea, hydroxyprogesterone caproate, ibandronic acid, ibritumomab tiuxetan, idarubicin, ifosfamide, imatinib, iniparib, interferon alpha, interferon alpha 2, interferon alpha-2a, interferon alpha 2b, interferon alpha n1, interferon alpha n3, interferon beta, interferon gamma 1a, interleukin 2, Intron A, Iressa, irinotecan, ixabepilone, keyhole limpet haemocyanin, Kytril, lanreotide, lapatinib, lasofoxifene, lentinan sulphate, lestaurtinib, letrozole, leucovorin, leuprolide, leuprolide acetate, levamisole, levofolinic acid calcium salt, Levothroid, Levoxyl, Libra, liposomal MTP- PE, lomustine, lonafarnib, lonidamine, Marinol, mechlorethamine, mecobalamin, medroxyprogesterone acetate, megestrol acetate, melphalan, Menest, 6-mercaptopurine, mesna, methotrexate, Metvix, miltefosine, minocycline, minodronate, miproxifene, mitomycin C, mitotane, mitoxantrone, Modrenal, MS-209, MX-6, Myocet, nafarelin, nedaplatin, nelarabine, nemorubicin, Neovastat, neratinib, Neulasta, Neumega, Neupogen, nilotimib, nilutamide, nimustine, nolatrexed, Nolvadex, NSC-631570, obatoclax, oblimersen, OCT-43, octreotide, olaparib, ondansetron hydrochloride, Onco-TCS, Orapred, Osidem, oxaliplatin, paclitaxel, pamidronate disodium, pazopanib, Pediapred, pegaspargase, Pegasys, pemetrexed, pentostatin, N-phosphonoacetyl-L-aspartate, picibanil, pilocarpine hydrochloride, pirarubicin, plerixafor, plicamycin, PN-401, porfimer sodium, prednimustine, prednisolone, prednisone, Premarin, procarbazine, Procrit, QS-21, quazepam, R-1589, raloxifene, raltitrexed, ranpirnase, RDEA119, Rebif, regorafenib, 13-cis-retinoic acid, rhenium-186 etidronate, rituximab, Roferon-A, romidepsin, romurtide, ruxolitinib, Salagen, salinomycin, Sandostatin, sargramostim, satraplatin, semaxatinib, semustine, seocalcitol, sipuleucel-T, sizofiran, sobuzoxane, Solu-Medrol, sorafenib, streptozocin, strontium-89 chloride, sunitinib, Synthroid, T- 138067, tamoxifen, tamsulosin, Tarceva, tasonermin, testolactone, Taxoprexin, Taxotere, teceleukin, temozolomide, temsirolimus, teniposide, testosterone propionate, Testred, thalidomide, thymosin alpha 1, thioguanine, thiotepa, thyrotropin, tiazofurin, tiludronic acid, tipifarnib, tirapazamine, TLK-286, toceranib, topotecan, toremifene, tositumomab, tastuzumab, treosulfan, TransMID-107R, tretinoin, Trexall, trimethylmelamine, trimetrexate, triptorelin acetate, triptorelin pamoate, trofosfamide, UFT, uridine, valrubicin, valspodar, vandetanib, vapreotid, vatalanib, vemurafinib, verteporfin, vesnarinon, vinblastine, vincristine, vindesine, vinflunine, vinorelbine, Virulizin, vismodegib, Xeloda, Z-100, Zinecard, zi nostatin stimalamer, Zofran, zoledronic acid.
Also indicated is, in particular, a combination of the compounds according to the invention with a P-TEFb or CDK9 inhibitor.
The compounds according to the invention can also be combined in a very promising manner with biological therapeutics, such as antibodies (e.g. aflibercept, alemtuzumab, bevacizumab, brentuximumab, catumaxomab, cetuximab, denosumab, edrecolomab, gemtuzumab, ibritumomab, ipilimumab, ofatumumab, panitumumab, pertuzumab, rituximab, tositumumab, trastuzumab) and recombinant proteins.
The compounds according to the invention may also achieve positive effects in combination with other therapies directed against angiogenesis, such as, for example, with bevacizumab, axitinib, regorafenib, cediranib, sorafenib, sunitinib or thalidomide. Combinations with antihormones and steroidal metabolic enzyme inhibitors are particularly suitable because of their favourable profile of side effects.
Generally, the following aims can be pursued with the combination of compounds of the present invention with other agents having a cytostatic or cytotoxic action:
• an improved activity in slowing down the growth of a tumour, in reducing its size or even in its complete elimination compared with treatment with an individual active compound;
• the possibility of employing the chemotherapeutics used in a lower dosage than in monotherapy;
• the possibility of a more tolerable therapy with few side effects compared with individual administration;
• the possibility of treatment of a broader spectrum of tumour disorders;
• achievement of a higher rate of response to the therapy;
• a longer survival time of the patient compared with present-day standard therapy.
The compounds according to the invention can moreover also be employed in combination with radiotherapy and/or surgical intervention. The various aspects of the invention described in this application are illustrated by the following examples which are not meant to limit the invention in any way.
The example testing experiments described herein serve to illustrate the present invention and the invention is not limited to the examples given.
EXPERIMENTAL SECTION - GENERAL PART
The compounds of general formula (I) according to the invention can be prepared according to the following Schemes 1 to 4. The schemes and procedures described below illustrate synthetic routes to the compounds of general formula (I) of the invention and are not intended to be limiting. It is clear to the person skilled in the art that the order of transformations as exemplified in Scheme 1 to 4 can be modified in various ways. The order of transformations exemplified in these schemes is therefore not intended to be limiting. In addition, interconversion of any of the substituents R1 and all other defined groups of formula I can be achieved before and/or after the exemplified transformations. These modifications can be such as the introduction of protecting groups, cleavage of protecting groups, reduction or oxidation of functional groups, halogenation, metallation, substitution, nucleophilic addition to carbonyl groups, formation of amides, reductive aminations, saponification, transition metal catalyzed coupling reactions or other reactions known to the person skilled in the art. These transformations include those which introduce a functionality which allows for further interconversion of substituents. Appropriate protecting groups and their introduction and cleavage are well-known to the person skilled in the art (see for example T.W. Greene and P.G.M. Wuts in Protective Groups in Organic Synthesis, 3rd edition, Wiley 1999). Specific examples are described in the subsequent paragraphs.
Scheme 1 - Connection of the BET Protein Binding Molecule to the linker with E3LB:
Compounds of the present invention can be synthesized according to the general procedure depicted in Scheme 1 by connecting compounds of general formula (P) and (Q) in which Z can be OH, NH2 or Cl with compounds of general formula (lla) in which Yi can be O-LG, halogen, -C(0)OCi-Cs-alkyl, -COOH, -C(0)CI, - or -NHC(0)-(imidazolyl) and in which Y2 can be OH, -O-LG, halogen, -C(0)OCrC5-alkyl, -COOH, -C(0)CI, -NH2 or -NHC(0)-(imidazolyl).
Figure imgf000032_0001
Compounds of general formula (la) can be obtained by reaction of compounds of general formula (P) or (Q) with compounds of formula (I la) or (lib), respectively. Reactions are employed depending on the nature of chemical functional groups at the corresponding reaction centers on both reacting partners. Chemical reactions employed, but not intended to be limiting, include, for example, amide formation, urea formation, nucleophilic substitutions reactions (alkylation, exchange of OH group).
As far as amide formation is concerned, amide coupling occurs by a reaction of an acid chloride with an amine in the presence of a base such as triethylamine, pyridine, N-e thyl- A/,A/-diisopropylamine, in an aprotic polar/non polar solvents such as acetonitrile, dichlomethane, 1,2 dichloroethane, chloroform, /V,/V-dimethylformamide (DMF), 1-methyl- pyrrolidin-2-one (NMP) at ambient or elevated temperatures. Occasionally, small amount of a catalyst, such as /\/,/\/-dimethylaminopyridine, also, known as DMAP, is added to the reaction. For example, see WO 2006/117570 (page 25, stage 1), WO 2008/64432 (page 64, example 5), WO2007/59613 (page 14, example 2a) and references therein.
Alternatively, amide coupling can be accomplished by a reaction of a carboxylic acid with an amine in the presence of a base and an appropriate coupling reagent in an aprotic polar/non polar solvent at ambient or elevated temperatures. Suitable amide coupling are, for example, 0-(7-aza-1Hbenzotriazol-1-yl)-/V,/V,/\r,/\f-tetramethyluronium hexafluorphosphate, also called HATU, 0-(Benzotriazol-1-yl)-/V,/V,/V',/V'-tetramethyl-uronium tetrafluoroborate (TBTU),dicyclohexylcarbodiimide, a combination of 1 H-benzotriazol and 1-ethyl-3-[3- dimethylamino]carbodiimide hydrochloride or propanephosphonic acid anhydride (T3P). Appropriate bases include, for example, /V,/V-dimethylaminopyridine, N-etby\-N,N- diisopropylamine, triethylamine. Solvents used in such amide coupling reaction are, for example, /V,/V-dimethylformamide(DMF),
1-methyl-pyrrolidin-2-one (NMP), dichlomethane or tetrahydrofuran. For example, see, WO 2005/115972 (e.g. example 1), WO 2006/52722 (example 158, step 2), J. Am. Chem. Soc. 1992, 114, 9327, Org. Lett. 2011, 5048-5051 and references cited therein. The use of HATU as coupling reagent was preferred.
Compounds of general formula (I), in particular (la) and (lb), can also be obtained by nucleophilic substitution of compounds of general formula (P) or (Q) with compounds of formula (lla) or (lib) with Yi or Y2 being an halogen in particular -l,-Br,-CI. Selected examples disclosed employed sodium hydrogencarbonate in DMF at elevated temperatures (WO2008/64351 , page 81 compound 1), or /V-ethyl-/\/,/\/-diisopropylamine; in dioxane at elevated temperatures (US6727264, page 149, step 1), sodium carbonate in THF at elevated temperatures (US6262056, example 8). In case of Yi or Y2 being a -OH, the hydroxy group can be converted to a new functionality giving rise to Yi or Y2 being an O-LG, (LG meaning a Leaving Group) which allows further transformations. LG as new functionality preferably includes, but is not limited to, a mesylate group or a tosylate group, which can be used as a suitable leaving group in subsequent nucleophilic reactions as well, see Journal of Medicinal Chemistry 2006, 49, 11, 3116-3135, WO2018/69863 (page 172), Bioorganic and Medicinal Chemistry 2015, 23, 24, 7735-7742 as selected examples.
Compounds of general formula (la), can also be obtained by urea formation of compounds of general formula (P) with compounds of general formula (lla), in which Yi is for example a - NH-C(0)-(lmidazolyl) group. Such transformations have is disclosed in Bioorganic and Medicinal Chemistry2013vol. 21# 23p. 7283 - 7308, W02008/60621 as selected examples. Formation of compounds of general formula (lla) with Yi being -NH-C(0)-(lmidazolyl) has been described for example in WO2011/162409 (column 348-349), W02003/104236 (page 62).
Compounds of general formula (lb) can also be obtained by reaction of compounds of general formula (Q) with compounds of general formula (lib) by similar reactions described above. In addition, compounds of general formula (I) can be obtained by ether bond formation of compounds of formula (Q) with compounds (lib) using Mitsunobu reaction, see for selected examples, Journal of Medicinal Chemistry 2009 vol. 52# 19, 6012 - 6023, Journal of Organic Chemistry 2011, vol. 76, # 16, 6912 - 6917. Compounds of general formula (I la) or (lib) can be obtained by connecting a suitably functionalized E3 ligase binder to the chain defined as Ri_. The E3 ligase binder containing functional groups such as, but not limiting to -NH2, -OH, -COOH, or halogen, is reacted with compounds of general formula (Ilia) or (Nib) as outlined in Scheme 2
Scheme 2 - Connection of the E3 ligase binder to the linker:
Compounds of general formula (I la) or (lib) are synthesized starting with compounds of general formula (Ilia) or (lllb) in which W can be OH, O-LG, halogen, -C(0)OCi-Cs-alkyl, COOH, -C(0)CI, primary or secondary amine or -NHC(0)-(imidazolyl), with the provision that Yi and W or Y2 and W are not the same functional group, and in which V can be fluoro, chloro, bromo, OH, primary or secondary amine, using reactions, such as amide formation, nucleophilic substitution reactions, ether bond formation, as exemplified above. Furthermore, transition metal catalyzed cross coupling reaction of Hartwig / Buchwald type can be used as well, see for selected examples W02004/72051 (page 55, step 2) or W02009/20990, page 111 (intermediate B64), respectively.
Y1 W Y1 E3LB
V-E3LB + V RL
(Ilia) (Ha)
Y2 w
Y2 E3LB
V-E3LB + V
(lllb) V
(lib)
More particularly in the case of E3LB as identified below, and in which PG is a Protecting Group:
Figure imgf000034_0001
The synthesis of compounds of general formula (Ilia) or (lllb) will be disclosed in the experimental section below. Preferred PGs are t-butyloxycarbonyl-, t-butylester, benzyloxycarbonyl-, benzyl- and para-methoxybenzyk
Compounds of general formula (I), in particular (la) and (lb), can also be prepared by the reaction of compounds of general formula (IVa) or (IVb) with P, Vi, V2, Ri_, and W having the meaning given above together with an E3 ligase binder (E3LB).
Scheme 3 - Connection of the BET Protein Binding Molecule with linker to the E3LB:
Similar reactions, such as amide formation, nucleophilic substitution reactions, ether bond formation, as described above, can be used for the synthesis of compounds of general formula (la) and (lb) outlined in Scheme 3.
Schema 3:
Figure imgf000035_0001
Compounds of general formula (la) or (lb) can be obtained by the reactions of compounds of general formula (IVa) with compounds of general formula V-E3LB or by the reaction of compounds of general formula (IVb) with compounds of general formula V-E3LB, respectively, with R1, Ri_, W, V, E3LB have the meaning as defined above.
Scheme 4 - Connection of the BET Protein Binding Molecule to the linker Ri :
Similar reactions such as amide formation, nucleophilic substitution reactions, ether bond formation, as described above, can be used for the synthesis of compounds of general formula (IVa) or (IVb) as outlined in Scheme 4.
Figure imgf000036_0001
This applies analogously to cases in which synthesis intermediates or example compounds or salts thereof have been obtained, by the preparation and/or purification processes described, as solvates, such as hydrates with (if defined) unknown stoichiometric composition.
The compounds of general formula Ilia and lllb can purchased like for example in Intermediate 3.1 or obtained from commercial source and subsequently modified by standard functional groups transformation according to procedures known in the art.
The lUPAC names of the examples and intermediates were generated using the program 'ACD/Name batch version 12.01 ' from ACD LABS, and were adapted if needed.
The various aspects of the invention described in this application are illustrated by the following examples which are not meant to limit the invention in any way.
The present invention covers the intermediate compounds which are disclosed in the Example Section of this text, infra.
The present invention covers any sub-combination within any embodiment or aspect of the present invention of intermediate compounds of general formula 1 to12, supra.
The compounds of general formula (I) of the present invention can be converted to any salt, preferably pharmaceutically acceptable salts, as described herein, by any method which is known to the person skilled in the art. Similarly, any salt of a compound of general formula (I) of the present invention can be converted into the free compound, by any method which is known to the person skilled in the art. All reagents, for which the synthesis is not described in the experimental part, are either commercially available, or are known compounds or may be formed from known compounds by known methods by a person skilled in the art.
The compounds and intermediates produced according to the methods of the invention may require purification. Purification of organic compounds is well known to the person skilled in the art and there may be several ways of purifying the same compound. In some cases, no purification may be necessary. In some cases, the compounds may be purified by crystallization. In some cases, impurities may be removed by trituration using a suitable solvent. In some cases, the compounds may be purified by chromatography, particularly flash column chromatography, using for example prepacked silica gel cartridges, e.g.
Biotage SNAP cartridges KP-Sil® or KP-NH® in combination with a Biotage autopurifier system (SP4® or Isolera Four®) and eluents such as gradients of hexane/ethyl acetate or DCM/methanol. In flash column chromatography, unmodified (“regular”) silica gel may be used as well as aminophase functionalized silica gel. If reference is made to flash column chromatography or to flash chromatography in the experimental section without specification of a stationary phase, regular silica gel was used.
In some cases, the compounds may be purified by prep. HPLC using for example a Waters autopurifier equipped with a diode array detector and/or on-line electrospray ionization mass spectrometer in combination with a suitable prepacked reverse phase column and eluents such as gradients of water and acetonitrile which may contain additives such as trifluoroacetic acid, formic acid or aqueous ammonia.
In some cases, purification methods as described above can provide those compounds of the present invention which possess a sufficiently basic or acidic functionality in the form of a salt, such as, in the case of a compound of the present invention which is sufficiently basic, a trifluoroacetate or formate salt for example, or, in the case of a compound of the present invention which is sufficiently acidic, an ammonium salt for example. A salt of this type can either be transformed into its free base or free acid form, respectively, by various methods known to the person skilled in the art or be used as salts in subsequent biological assays. It is to be understood that the specific form (e.g. salt, free base etc.) of a compound of the present invention as isolated and as described herein is not necessarily the only form in which said compound can be applied to a biological assay in order to quantify the specific biological activity.
Chemical names were generated using the ACD/Name software from ACD/Labs. In some cases generally accepted names of commercially available reagents were used in place of ACD/Name generated names. The following table 1 lists the abbreviations used in this paragraph and in the Examples section as far as they are not explained within the text body. Other abbreviations have their meanings customary perse to the skilled person.
Table 1: Abbreviations
Figure imgf000038_0001
Figure imgf000039_0001
Other abbreviations have their meanings customary per se to the skilled person.
Analytical LC-MS Methods:
Method 1 :
Instrument: Agilent 1290 UPLCMS 6230 TOF; column: BEH C 18 1.7 pm, 50x2.1mm; Eluent A: water + 0.05 % formic acid (99%); Eluent B: acetonitrile + 0.05 % formic acid (99%); gradient: 0-1.72-90% B, 1.7-2.090% B; flow 1.2 mL/min; temperature: 60°C; DAD scan: 190-400 nm.
Method 2:
Instrument: Shimadzu LCMS-2020; Column: Kinetex 2.6u XB-C18, 50 mmx3.0mm, particle size 2.6pM; eluent A: water + 0.05% TFA, eluent B: acetonitrile; gradient: 0-4.8 min. 5-80 % B, 4.9 min. 5 % B; flow 1.5 mL/min; temperature: 40 °C; PDA: 254 nm. Method 3:
Instrument: Shimadzu LCMS-2020; Column: Kinetex 2.6u XB-C18, 50 mmx3.0mm, particle size 2.6mM; eluent A: water + 0.05% TFA, eluent B: acetonitrile; gradient: 0-2.0 min. 5-80 % B, 2.0-2.8 min 80% B, 2.9 min. 5 % B; flow 1.5 mL/min; temperature: 40 °C; PDA: 254 nm.
Method 4:
Instrument: Shimadzu LCMS-2020; Column: Kinetex 2.6u XB-C18, 50 mmx3.0mm, particle size 2.6mM; eluent A: water + 0.05% TFA, eluent B: acetonitrile; gradient: 0-6.0 min. 5-95 % B, 6.0-6.8 min 95% B, 6.9 min. 5 % B; flow 1.5 mL/min; temperature: 40 °C; PDA: 254 nm.
Method 5:
Instrument: Shimadzu LCMS-2020; Column: Ascentis Express C18, 50 mmx2.1mm, particle size 2.7mM; eluent A: water + 0.05% TFA, eluent B: acetonitrile + 0.05% TFA; gradient: 0-2.1 min. 5-100 % B, 2.1-2.7 min 100% B, 2.7-2.75 min. 100-5 % B; flow 1.0 mL/min; temperature: 40 °C; PDA: 190-400 nm.
Method 6:
Instrument: Shimadzu LCMS-2020; Column: Kinetex 2.6u XB-C18, 50 mmx3.0mm, particle size 2.6mM; eluent A: water + 0.05% TFA, eluent B: acetonitrile +0.05%TFA; gradient: 0-1.1 min. 5-100 % B, 1.1-1.7 min 100% B, 1.71-2.0 min. 100-5 % B; flow 1.5 mL/min; temperature: 45 °C; PDA: 190-400 nm.
Method 7:
Instrument: Shimadzu LCMS-2020; Column: Kinetex 2.6u XB-C18 100A, 50 mmx3.0mm, particle size 2.6mM; eluent A: water + 0.1% TFA, eluent B: acetonitrile +0.1%TFA; gradient: 0-1.1 min. 10-100% B, 1.1-1.6 min 100% B, 1.6-1.7 min 100-10% B; flow 1.5 mL/min; temperature: 40°C; PDA: 190-400 nm.
Method 8:
Instrument: Shimadzu LCMS-2020; Column: CAPCELL CORE C18, 50 mmx2.1mm, particle size 2.7mM; eluent A: water + 0.1 % TFA, eluent B: acetonitrile +0.1%TFA; gradient: 0-1.1 min. 10-100% B, 1.1-1.7 min 100% B, 1.7-1.75 min 100-10% B; flow 1.0 mL/min; temperature: 40°C; PDA: 190-400 nm.
Preparative LC-MS Methods:
Method I:
Instrument: Waters Autopurification MS SingleQuad; Column: Waters XBrigde C18 5m 100x30mm; eluent A: water + 0.1 vol. % formic acid (99 %), eluent B: acetonitrile; gradient: 0.00-0.50 min 32% B (25 -> 70mL/min), 0.51-5.50 min 32-42% B (70mL/min), DAD scan: 210-400 nm
NMR Spectra:
The multiplicities of proton signals in 1H NMR spectra given in the following paragraphs reflect the observed signal form and do not take into account any higher-order signal phenomena. As a rule, the chemical shift data refers to the center of the signal in question.
In the case of wide multiplets, a range is specified. Signals hidden by solvent or water were either assigned tentatively or are not listed. Strongly broadened signals - e.g. caused by rapid rotation of molecular moieties or by interchanging protons - have also been assigned tentatively (often referred to as a broad multiplet or broad singlet) or are not shown.
The 1H-NMR data of selected compounds are listed in the form of 1H-NMR peaklists.
Therein, for each signal peak the d value in ppm is given, followed by the signal intensity, reported in round brackets. The d value-signal intensity pairs from different peaks are separated by commas. Therefore, a peaklist is described by the general form: di (intensityi), 62 (intensity2), ... , d, (intensity,), ... , dh (intensity,,).
The intensity of a sharp signal correlates with the height (in cm) of the signal in a printed NMR spectrum. When compared with other signals, this data can be correlated to the real ratios of the signal intensities. In the case of broad signals, more than one peak, or the center of the signal along with their relative intensity, compared to the most intense signal displayed in the spectrum, are shown. A 1H-NMR peaklist is similar to a classical 1H-NMR readout, and thus usually contains all the peaks listed in a classical NMR interpretation. Moreover, similar to classical 1H-NMR printouts, peaklists can show solvent signals, signals derived from stereoisomers of the particular target compound, peaks of impurities, 13C satellite peaks, and/or spinning sidebands. The peaks of stereoisomers, and/or peaks of impurities are typically displayed with a lower intensity compared to the peaks of the target compound (e.g., with a purity of >90%). Such stereoisomers and/or impurities may be typical for the particular manufacturing process, and therefore their peaks may help to identify a reproduction of the manufacturing process on the basis of "by-product fingerprints". An expert who calculates the peaks of the target compound by known methods (MestReC, ACD simulation, or by use of empirically evaluated expectation values), can isolate the peaks of the target compound as required, optionally using additional intensity filters. Such an operation would be similar to peak-picking in classical 1H-NMR interpretation. A detailed description of the reporting of NMR data in the form of peaklists can be found in the publication "Citation of NMR Peaklist Data within Patent Applications" (cf. http://www.researchdisclosure.com/searching-disclosures, Research Disclosure Database Number 605005, 2014, 01 Aug 2014). In the peak picking routine, as described in the Research Disclosure Database Number 605005, the parameter "MinimumHeight" can be adjusted between 1% and 4%. However, depending on the chemical structure and/or depending on the concentration of the measured compound it may be reasonable to set the parameter "MinimumHeight" <1%.
EXPERIMENTAL SECTION
BET Binding Molecule - Intermediate 1
Intermediate 1.0
(4R)-7,8-dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4,5-dihydro-3H-2,3- benzodiazepine-3-carboxamide
Figure imgf000042_0001
The reaction was splitted in two microwave tubes. (4R)-1-(4-Bromophenyl)-7,8-dimethoxy-
N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide (2.00 g, 4.63 mmol, synthesis described in WO2014026997, example 49.1 A) (1000 mg, 2.313mmol) in anhydrous THF (15 mL) was treated with tris(dibenzylideneacetone)dipalladium(0) (63.5 mg,
O.069 mmol, CAS 51364-51-3), Dave-Phos (91mg, 0.231 mmol, CAS 213697-53-1), sodium t-butoxide (267 mg, 2.776 mmol) and piperazine (199.2 mg, 2.313 mmol). The mixture was heated to 80°C and stirred overnight. The reactions mixture was treated with another equivalent of piperazine, 0.03 eq tris(dibenzylideneacetone)dipalladium(0), 0.1 eq Dave- Phos, heated to 90°C and stirred for further 4 hours. The reaction mixture was quenched with saturated sodium hydrogen carbonate solution and extracted into ethyl acetate (3x).
The combined organic layers were isolated, dried (hydrophobic filter paper) and concentrated to dryness under reduced pressure. The crude material was purified by flash column chromatography (Biotage Isolera, 100g SNAP Ultra) eluting with a gradient solution of dichloromethane/methanol 0-35%. The product rich fractions were pooled and evaporated to yield the desired product as a yellow crystalline solid: 1.06 g (50% yield, 95% purity).
LC-MS (method 4): Rt = 0.57 min; MS (ESIpos): m/z = 438 [M+H]+
Ή-NMR (400 MHz, DMSO-d6) d [ppm]: 1.047 (5.57), 1.063 (5.54), 2.085 (0.94), 2.323 (0.63), 2.327 (0.90), 2.332 (0.64), 2.420 (0.66), 2.448 (0.90), 2.454 (1.01), 2.518 (3.37), 2.523 (2.28), 2.618 (6.79), 2.630 (6.99), 2.665 (0.76), 2.669 (1.01), 2.673 (0.85), 2.807 (0.94), 2.827 (2.66), 2.840 (4.00), 2.852 (3.24), 3.154 (2.79), 3.167 (3.28), 3.178 (2.48), 3.599 (16.00), 3.833 (15.27), 3.847 (0.52), 4.871 (0.64), 4.886 (0.72), 4.900 (0.61), 5.759 (7.07), 6.283 (1.22), 6.294 (1.25), 6.306 (0.42), 6.540 (5.61), 6.917 (3.06), 6.940 (3.22), 7.029 (4.87), 7.577 (3.76), 7.599 (3.51). optical rotation: [a]D 20 = -354.1° +/- 0.46° (c = 1.00; methanol)
Intermediate 1.1
(4S)-7,8-dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4,5-dihydro-3H-2,3- benzodiazepine-3-carboxamide
Figure imgf000043_0001
The synthesis of intermediate 1.1 is described in W02914026997, example 131.1.
Intermediate 1.2
4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1 -yl]benzoic acid
Figure imgf000044_0001
The synthesis of intermediate 1.2 is described in WO2016062688, example 1.2A
E3 liqase binder- Intermediate 2
Intermediate 2.0
(2S)-5-amino-2-(4-fluoro-1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)-5-oxopentanoic acid
Figure imgf000044_0002
A mixture of 4-fluoro-2-benzofuran-1 ,3-dione (10.0 g, 60.2 mmol; CAS-RN: [652-39-1]) and L- glutamine (8.80 g, 60.2 mmol) in dry N,N-dimethylformamide (100 ml_) was stirred at 90°C for 8 h. The solvent was removed under reduced pressure. Then the residue was redissolved in 4N hydrochloric acid (50 ml_) and stirred for additional 8h. The resulting precipitation was collected by filtration, washed with water, and dried to afford 8 g (45 % ) of the desired product.
LC-MS (method 8): Rt = 0.52 min; MS (ESIpos): m/z = 295 [M+H]+
Intermediate 2.1
2-[(3S)-2,6-dioxopiperidin-3-yl]-4-fluoro-1H-isoindole-1,3(2H)-dione
Figure imgf000044_0003
(2S)-5-amino-2-(4-fluoro-1 ,3-dioxo-1 ,3-dihydro-2H-isoindol-2-yl)-5-oxopentanoic acid (intermediate 2.0, 8.00 g, 27.2 mmol) was added in 80 ml_ of acetonitrile, then 1,1'- carbonyldiimidazole (5.29 g, 32.6 mmol; CAS- R N : [530-62- 1 ]) and 4-dimethylaminopyridine (332 mg, 2.72 mmol; CAS-RN: [1122-58-3]) were added. The reaction mixture was stirred at 90°C for 5 h. The reaction mixture was cooled to RT and the solvent was evaporated under reduced pressure subjected to column chromatography with dichloromethane/methanol (20 : 1) to yield 2.5 g (33%) of the desired product.
LC-MS (method 7): Rt = 0.71 min; MS (ESIpos): m/z = 277 [M+H]+
Intermediate 2.2
2-(2,6-dioxopiperidin-3-yl)-5-fluoro-1H-isoindole-1,3(2H)-dione
Figure imgf000045_0001
The synthesis of the title compound has been disclosed in G. M. Burslem, P. Ottis, S. Jaime- Figueroa, A. Morgan, P. M. Cromm, M. Toure, C. M. Crews, ChemMedChem 2018, 13 1508-1512.
Intermediate 2.3
2-[[2-(2,6-dioxo-3-piperidinyl)-2,3-dihydro-1 ,3-dioxo-1 H-isoindol-4-yl]oxy]-acetic acid
Figure imgf000045_0002
The title compound (CAS: 1061605-21-7) is commercially available from different vendors.
E3 liqase binder with linker or BRD4 binding molecule with linker - Intermediate 3
Intermediate 3.1 tert-butyl 1 -({2-[2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-4-yl}amino)- 3,6,9, 12-tetraoxapentadecan-15-oate
Figure imgf000046_0002
In a microwave tube 2-[2,6-dioxopiperidin-3-yl]-4-fluoro-1H-isoindole-1,3(2H)-dione (300 mg, 1.09 mmol, CAS RN [835616-60-9]), tert- butyl 1 -amino-3,6,9, 12-tetraoxapentadecan-15-oate (559 mg, 1.74 mmol; CAS-RN [581065-95-4]), DIPEA (1.89 ml_, 11 mmol) in anhydrous DMA (0.5 ml_) was irradiated to 140°C in the microwave reactor for 1h. The reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions). The product rich fractions were pooled and freeze dried to afford the desired product as a yellow lyophilisate (249 mg, 39% yield).
LC-MS (method 1): Rt = 1.09 min; MS (ESIpos): m/z = 578 [M+H]+
Ή-NMR (400 MHz, DMSO-d6) d [ppm]: 1.380 (16.00), 1.390 (0.48), 2.382 (0.64), 2.397 (1.39), 2.413 (0.68), 2.518 (0.89), 2.522 (0.63), 3.464 (3.70), 3.474 (0.99), 3.481 (1.07),
3.485 (1.63), 3.489 (1.69), 3.493 (0.94), 3.500 (0.41), 3.519 (0.48), 3.526 (0.56), 3.532
(0.74), 3.547 (1.28), 3.555 (0.61), 3.563 (1.77), 3.578 (0.65), 3.602 (0.43), 3.615 (0.69),
7.031 (0.53), 7.048 (0.56), 7.138 (0.45), 7.159 (0.49), 11.101 (0.52).
Intermediate 3.2 tert-butyl 3-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H-isoindol- 4-yl}amino)ethoxy]ethoxy}ethoxy)propanoate
Figure imgf000046_0001
2-[(3S)-2,6-dioxopiperidin-3-yl]-4-fluoro-1H-isoindole-1,3(2H)-dione (900 mg, 3.26 mmol, intermediate 2.1) was added to 30 ml_ of N,N-dimethylformamide (30 ml_), then tert-butyl 3- {2-[2-(2-aminoethoxy)ethoxy]ethoxy}propanoate (904 mg, 3.26 mmol; CAS-RN: [252881 -74- 6]) was added and finally N,N-diisopropylethylamine (1.26 g, 9.77 mmol). The reaction mixture was stirred at 90°C for 16h.The mixture was cooled to RT, poured into water (50 ml_) and extracted with ethyl acetate (2 x 50 ml_). The combined organic phases were washed with water (50 ml_) and brine (50 ml_), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product was purified by column chromatography with petroleum ether/ ethyl acetate (1:3/v:v) to yield 420 mg (24%) of the product.
LC-MS (method 8): Rt = 0.75 min; MS (ESIpos): m/z = 534 [M+H]+
Intermediate 3.3 tert-butyl 3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H- isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)propanoate
Figure imgf000047_0001
In a microwave tube: 2-[(3RS)-2,6-dioxopiperidin-3-yl]-4-fluoro-1 H-isoindole-1,3(2H)-dione (50.0 mg, 181 pmol, CAS 835616-60-9), tert-butyl 3-{2-[2- (2-am i noethoxy) ethoxy]ethoxy}- propanoate (126 mg, 80 % purity, 362 pmol; CAS-RN:[252881-74-6]), N,N- diisopropylethylamine (320 pi, 1.8 mmol; CAS-RN : [7087-68-5]) in anhydrous N,N- dimethylacetamide (0.25 mI) was irradiated to 140 °C in the microwave reactor for 1h. The reaction mixture was filtered and purified by prep. HPLC (acidic conditions). The product rich fractions were pooled and freeze dried to afford the desired product as a yellow lyophilisate (51 mg 99% purity, 52% yield).
LC-MS (method 1): Rt = 1.10 min; MS (ESIpos): m/z = 534 [M+H]+
Ή-NMR (400 MHz, DMSO-d6) d [ppm]: 1.378 (16.00), 2.326 (0.64), 2.331 (0.44), 2.375 (0.67), 2.390 (1.46), 2.406 (0.73), 2.518 (2.36), 2.522 (1.59), 2.668 (0.63), 2.673 (0.45), 3.459 (0.91), 3.466 (0.84), 3.472 (1.43), 3.481 (1.10), 3.487 (0.85), 3.493 (0.50), 3.516 (0.45), 3.523 (0.62), 3.528 (0.83), 3.544 (1.37), 3.548 (0.67), 3.555 (0.58), 3.559 (1.70), 3.575 (0.69), 3.599 (0.45), 3.613 (0.73), 7.031 (0.56), 7.048 (0.58), 7.136 (0.48), 7.157 (0.52), 11.101 (0.54).
Intermediate 3.4 tert-butyl 1-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-3,6,9,12-tetraoxapentadecan-15-oate
Figure imgf000048_0001
2-[(3S)-2,6-dioxopiperidin-3-yl]-4-fluoro-1H-isoindole-1,3(2H)-dione (900 mg, 3.26 mmol, intermediate 2.1) was added to 30 ml_ of N,N-dimethylformamide (30 mL), then tert-butyl 1- amino-3,6,9, 12-tetraoxapentadecan-15-oate (1.05 g, 3.26 mmol; CAS- R N : [581065-95-4]) was added and finally N,N-diisopropylethylamine (1.26 g, 9.77 mmol). The reaction mixture was stirred at 90°C for 16h.The mixture was cooled to RT, poured into water (50 mL) and extracted with ethyl acetate (2 x 50 ml). The combined organic phases were washed with water (50 mL) and brine (50 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product was purified by column chromatography with petroleum ether/ ethyl acetate (1 :4/v:v) to yield 350 mg (19%) of the product.
LC-MS (method 7): Rt = 0.89 min; MS (ESIpos): m/z = 578 [M+H]+
Intermediate 3.5
3-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)ethoxy]ethoxy}ethoxy)propanoic acid
Figure imgf000048_0002
Tert-butyl 3-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)ethoxy]ethoxy}ethoxy)propanoate (420 mg, 787 pmol, intermediate 3.2) was added to 15 mL of dichloromethane and trifluoroacetic acid (1 mL) was added. The reaction mixture was stirred at RT for 2 h. The mixture was concentrated under reduced pressure to yield 333 mg (85%) of the product.
LC-MS (method 5): Rt = 1.05 min; MS (ESIpos): m/z = 478 [M+H]+ 1H-NMR (400 MHz, METHANOL-d4) delta [ppm]: -0.008 (0.64), 0.008 (0.56), 1.285 (0.77), 2.087 (0.40), 2.095 (0.49), 2.107 (0.53), 2.112 (0.40), 2.119 (0.62), 2.126 (0.55), 2.506 (2.44), 2.521 (5.18), 2.537 (2.67), 2.549 (0.41), 2.694 (0.43), 2.702 (0.60), 2.722 (0.73), 2.727 (1.22), 2.738 (0.53), 2.756 (1.07), 2.761 (1.09), 2.766 (0.81), 2.772 (0.61), 2.816 (0.82), 2.830 (0.77), 2.853 (0.53), 2.859 (0.80), 2.865 (0.60), 2.874 (0.46), 2.990 (0.66), 3.489 (1.55), 3.502 (3.14), 3.515 (2.08), 3.567 (0.81), 3.571 (0.93), 3.577 (1.84), 3.581 (1.52), 3.585 (2.02), 3.592 (3.11), 3.611 (3.14), 3.616 (2.35), 3.619 (2.28), 3.624 (2.10), 3.631 (1.19), 3.635 (1.22), 3.640 (0.96), 3.648 (16.00), 3.657 (1.00), 3.690 (2.68), 3.706 (7.20), 3.721 (5.08), 3.733 (1.91), 5.030 (1.12), 5.044 (1.11), 5.061 (1.14), 5.075 (0.94), 7.043 (2.03), 7.061 (2.20), 7.086 (1.90), 7.107 (2.09), 7.530 (1.46), 7.547 (1.45), 7.551 (1.51), 7.569 (1.28).
Intermediate 3.6
3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)ethoxy]ethoxy}ethoxy)propanoic acid
Figure imgf000049_0001
In a round bottom flask, tert-butyl 3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3- dihydro-1 H-isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)propanoate (intermediate 3.3, 304 mg, 570 pmol) was dissolved in DCM (10 ml) and TFA (880 pi, 11.4 mmol) added. The reaction mixture was stirred at ambient temperature for 2 h. The reaction was treated with another 878 mI of TFA and stirred for further 3 h. The volatiles were evaporated under reduced pressure. The residue thus obtained was dissolved in AC N: water (2:8) and freeze dried. The crude product was dissolved in DCM (5ml) and TFA (500mI) added. The mixture was stirred for another 2 hours. The volatiles were evaporated under reduced pressure. The residue thus obtained was dissolved in ACN: water (2:8) and freeze dried to afford the desired product as a sticky yellow solid (325 mg, 90% purity).
LC-MS (method 1): Rt = 0.74 min; MS (ESIpos): m/z = 478 [M+H]+
Ή-NMR (400 MHz, DMSO-d6) d [ppm]: 1.997 (0.66), 2.005 (1.12), 2.011 (1.22), 2.023 (1.25), 2.029 (0.95), 2.036 (1.35), 2.042 (1.22), 2.075 (1.74), 2.337 (0.63), 2.404 (6.55), 2.420 (15.01), 2.436 (7.21), 2.518 (7.05), 2.523 (5.10), 2.530 (1.51), 2.540 (6.98), 2.565 (2.37), 2.606 (1.48), 2.834 (0.72), 2.848 (1.28), 2.870 (1.02), 2.878 (1.22), 2.883 (1.15), 2.891 (0.95), 2.914 (0.63), 2.926 (0.63), 3.450 (3.00), 3.458 (4.71), 3.463 (8.36), 3.469 (9.91), 3.475 (13.20), 3.485 (12.12), 3.490 (8.30), 3.494 (5.07), 3.497 (5.23), 3.505 (4.12), 3.510 (3.88), 3.518 (5.20), 3.520 (4.38), 3.525 (6.78), 3.530 (8.26), 3.547 (8.20), 3.553 (6.19), 3.560 (12.02), 3.568 (3.33), 3.576 (16.00), 3.592 (7.70), 3.603 (5.56), 3.616 (8.40), 3.630 (4.21), 3.728 (3.46), 5.032 (1.84), 5.045 (2.57), 5.064 (1.94), 5.078 (2.11), 6.608 (1.25), 7.031 (5.79), 7.048 (6.12), 7.138 (5.04), 7.160 (5.43), 7.564 (4.25), 7.581 (4.08), 7.585 (4.08), 7.603 (3.52), 11.100 (5.60).
Intermediate 3.7
1-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl}amino)-
3,6,9, 12-tetraoxapentadecan-15-oic acid
Figure imgf000050_0001
In a round bottom flask, tert-butyl 1-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-
1H-isoindol-4-yl}amino)-3,6,9,12-tetraoxapentadecan-15-oate (247 mg, 428 mitioI, intermediate 3.1) was dissolved in DCM (8 ml_) and TFA (660 mI, 8.6 mmol) added. The reaction mixture was stirred at ambient temperature for 2 h. LC-MS showed remaining starting material therefore the reaction mixture was treated with another 659 mI of TFA and stirring continued for further 3 h. The volatiles were evaporated under reduced pressure. The residue was dissolved in a mixture of acetonitrile / water (2:8) and freeze dried to afford the desired product as a sticky yellow solid (252 mg, 90% purity, 102% yield) which was used without further purification.
LC-MS (method 1): Rt = 0.76 min; MS (ESIpos): m/z = 522 [M+H]+
Ή-NMR (400 MHz, DMSO-d6) d [ppm]: 2.003 (0.41), 2.009 (0.45), 2.021 (0.48), 2.035 (0.49), 2.040 (0.46), 2.084 (0.81), 2.331 (0.67), 2.409 (2.32), 2.425 (5.11), 2.441 (2.66), 2.518 (4.02), 2.522 (2.74), 2.539 (0.81), 2.563 (1.07), 2.606 (0.64), 2.673 (0.68), 2.849 (0.48), 2.878 (0.49), 2.883 (0.46), 3.467 (16.00), 3.475 (5.41), 3.482 (5.84), 3.487 (7.55), 3.492 (7.59), 3.497 (5.87), 3.504 (5.06), 3.511 (5.82), 3.523 (7.70), 3.530 (8.68), 3.535 (9.61), 3.551 (8.13), 3.558 (6.54), 3.562 (7.44), 3.572 (3.85), 3.578 (7.49), 3.594 (3.74),
3.603 (2.78), 3.616 (3.47), 3.630 (1.70), 5.031 (0.68), 5.045 (0.91), 5.063 (0.70), 5.077 (0.75), 6.607 (0.54), 7.031 (2.00), 7.049 (2.12), 7.138 (1.78), 7.160 (1.92), 7.564 (1.40), 7.581 (1.43), 7.585 (1.38), 7.602 (1.13), 11.101 (2.10).
Intermediate 3.8
1-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl}amino)-
3,6,9, 12-tetraoxapentadecan-15-oic acid
Figure imgf000051_0001
tert-butyl 1-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl}amino)- 3,6,9, 12-tetraoxapentadecan-15-oate (350 mg, 606 mitioI, intermediate 3.4) was added to 15 ml_ of dichloromethane and trifluoroacetic acid (1 mL) was added. The reaction mixture was stirred at RT for 2 h. The mixture was concentrated under reduced pressure to yield 114 mg (36%) of the product.
LC-MS (method 5): Rt = 1.07 min; MS (ESIpos): m/z = 522 [M+H]+
1H-NMR (300 MHz, METHANOL-d4) delta [ppm]: 1.225 (0.47), 1.284 (0.52), 2.106 (0.60), 2.122 (0.60), 2.504 (2.09), 2.525 (4.47), 2.546 (2.51), 2.699 (0.67), 2.727 (0.85), 2.741 (0.70), 2.766 (1.10), 2.780 (0.90), 2.805 (0.95), 2.822 (0.87), 2.869 (0.57), 3.344 (0.49), 3.487 (1.42), 3.505 (2.90), 3.522 (2.04), 3.582 (7.15), 3.596 (2.19), 3.612 (6.29), 3.617 (6.04), 3.633 (3.53), 3.654 (16.00), 3.684 (2.36), 3.705 (6.49), 3.725 (4.32), 3.740 (1.49), 5.022 (0.92), 5.038 (1.10), 5.061 (0.84), 5.081 (0.85), 7.045 (1.86), 7.068 (2.11), 7.087 (1.72), 7.116 (1.94), 7.528 (1.26), 7.557 (1.31), 7.581 (0.97).
Intermediate 3.9
{2-[2-(2-{[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl]amino}-2- oxoethoxy)ethoxy]ethoxy}acetic acid
Figure imgf000051_0002
Into a 100-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-[2-[2-(carboxymethoxy)ethoxy]ethoxy]acetic acid (CAS 13887-98- 4, 1.0 g, 4.50 mmol, 1.00 equiv), THF (30 mL), N,N-dimethylformamide (3 drops), ethanedioyl dichloride (1.42 g, 11.27 mmol, 2.50 equiv). The resulting solution was stirred for 1 h at room temperature. Then 4-amino-2-(2,6-dioxopiperidin-3-yl)-2,3-dihydro-1H-isoindole- 1,3-dione (CAS 19171-19-8, 740 mg, 2.71 mmol, 0.60 equiv) added to the solution. The resulting solution was allowed to react, with stirring, for an additional 40 min at 80°C. The reaction was repeated 19 times. The resulting mixture was concentrated under vacuum. The reaction was then quenched by the addition of 500 mL of water and stirred 30 min. The resulting solution was extracted with 4x500 mL of EA/THF=1/1 and the organic layers combined, dried over anhydrous sodium sulfate and concentrated under vacuum. The crude product was purified by Flash-Prep-HPLC with the following conditions (lntelFlash-2): Column, C18 silica gel; mobile phase, ACN/water (0.1%TFA)=5/95 increasing to ACN/water (0.1 %TFA)=50/50 within 10 min; Detector, UV 220 nm. This resulted in 5.3 g (12.3%) of 2-[2- [2-([[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl]carbamoyl]methoxy)ethoxy]ethoxy]acetic acid as a light yellow solid.
LC-MS (method 2): Rt = 1.54 min; MS (ESIpos): m/z = 478 [M+H]+
1H-NMR (300 MHz, DMSO-d6) d [ppm]: 12.59 (s, 1H), 11.15 (s, 1H), 10.36 (s, 1H), 8.72 (d, J = 8.4 Hz, 1 H), 7.87 (m, 1H), 7.63 (d, J = 7.5 Hz, 1H), 5.16 (m, 1H), 4.21 (s, 2H), 4.05 (s, 2H), 3.82 (m, 4H), 3.57 (s, 4H), 2.90 (m, 1H), 2.58 (m, 2H), 2.10 (m, 1H).
Intermediate 3.10
[2-(2-{[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl]amino}-2- oxoethoxy)ethoxy]acetic acid
Figure imgf000052_0001
Into a 100-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-[2-(carboxymethoxy)ethoxy]acetic acid (1.0 g, 5.61 mmol, 1.00 equiv), THF (30 ml_), N,N-dimethylformamide (3 drops), ethanedioyl dichloride (1.77 g, 14.05 mmol, 2.50 equiv). The resulting solution was stirred for 1h at RT. Then 4-amino-2-(2,6- dioxopiperidin-3-yl)-2,3-dihydro-1 H-isoindole-1 ,3-dione (CAS 19171-19-8, 920 mg, 3.37 mmol, 0.60 equiv) added to the solution. The resulting solution was allowed to react with stirring, for an additional 40 min at 80°C. The resulting mixture was concentrated under vacuum. The reaction was then quenched by the addition of 500 ml_ of water and stirred 30 min. The resulting solution was extracted with 4x500 ml_ of ethyl acetate/THF=1:1 and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The crude product was purified by Flash-Prep-HPLC with the following conditions (lntelFlash-1): Column, C18 silica gel; mobile phase, ACN/water (0.1%TFA)=5/95 increasing to ACN/water (0.1%TFA)=50/50 within 10 min; Detector, UV 220nm.This resulted in 5.5 g (11.3%) of 2-[2-([[2-(2,6-dioxopiperidin-3-yl)-1 ,3-dioxo-2, 3-dihydro- 1 H-isoindol-4- yl]carbamoyl]methoxy)ethoxy]acetic acid as a light yellow solid.
LC-MS (method 2): Rt = 1.47 min; MS (ESIpos): m/z = 434 [M+H]+
1H-NMR (300 MHz, DMSO-d6) d [ppm]: 11.14 (s, 1H), 10.36 (s, 1H), 8.71 (d, J = 8.4 Hz,
1H), 7.86 (m, 1H), 7.63 (d, J = 7.2 Hz, 1H), 5.16 (m, 1H), 4.22 (s, 2H), 4.03 (m, 2H), 3.71 (m, 4H), 2.89 (m, 1H), 2.54 (m, 2H), 2.09 (m, 1H).
Intermediate 3.11
5-{[(benzyloxy)carbonyl]amino}pentanoic acid
Figure imgf000053_0001
Into a 500-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 5-aminopentanoic acid hydrochloride (CAS 627-95-2, 20 g, 130.20 mmol, 1.00 equiv), sodium hydroxide (2 N) (165 ml_, 2.50 equiv). This was followed by the addition of benzyl chloroform ate (24.5 g, 143.62 mmol, 1.10 equiv) dropwise with stirring at OoC. The resulting solution was stirred for 1 overnight at room temperature. The resulting solution was extracted with 3 x 100 mL of ethyl acetate and the aqueous layers combined. The pH value of the solution was adjusted to 2 with hydrogen chloride (6 N). The resulting solution was extracted with 3x200 mL of ethyl acetate and the organic layers combined. The resulting mixture was washed with 1x300 mL of sodium chloride. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The resulting solution was diluted with 400 mL of PE. The solids were collected by filtration. This resulted in 28 g (86%) of 5-[[(benzyloxy)carbonyl]amino]pentanoic acid as a white solid. Intermediate 3.12 tert-butyl 5-{[(benzyloxy)carbonyl]amino}pentanoate
Figure imgf000054_0001
Into a 500-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 5-[[(benzyloxy)carbonyl]amino]pentanoic acid (28 g, 111.43 mmol, 1.00 equiv), 2-methylpropan-2-ol (180 ml_), pyridine (100 mL). This was followed by the addition of phosphoryl trichloride (18.8 g, 122.61 mmol, 1.10 equiv) dropwise with stirring at - 10oC. The resulting solution was stirred for 1 overnight at room temperature. The resulting mixture was concentrated under vacuum. The resulting solution was diluted with 500 mL of water. The resulting solution was extracted with 3x200 mL of ethyl acetate and the organic layers combined. The resulting mixture was washed with 1x300 mL of sodium chloride. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was applied onto a silica gel column with ethyl acetate/petroleum ether (8/92). This resulted in 18 g (53%) of tert-butyl 5-[[(benzyloxy)carbonyl]amino]pentanoate as colorless oil.
Intermediate 3.13 tert-butyl 5-aminopentanoate
Figure imgf000054_0002
Into a 500-mL round- bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl 5-[[(benzyloxy)carbonyl]amino]pentanoate (18 g, 58.56 mmol, 1.00 equiv), methanol (200 mL), Palladium carbon (2 g). The resulting solution was maintained with an atmosphere of hydrogen and stirred for 1 overnight at RT. The solids were filtered out. The resulting mixture was concentrated under vacuum. This resulted in 8.5 g (84%) of tert-butyl 5-aminopentanoate as colorless oil.
Intermediate 3.14 tert-butyl 5-(2-{[2-(2,6-dioxopiperidin-3-yl)-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-4- yl]oxy}acetamido)pentanoate
Figure imgf000055_0002
Into a 500-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-[[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl]oxy]acetic acid (intermediate 2.3, 10.5 g, 31.60 mmol, 1.00 equiv), N,N-dimethylformamide (200 mL), TEA (8 g, 79.06 mmol, 2.50 equiv), HATU (18.03 g, 47.42 mmol, 1.50 equiv). This was followed by the addition of tert-butyl 5-aminopentanoate (8.2 g, 47.33 mmol, 1.50 equiv) dropwise with stirring at 5°C. The resulting solution was stirred for 1 overnight at room temperature. The resulting solution was diluted with 600 mL of water. The resulting solution was extracted with 3x200 mL of ethyl acetate and the organic layers combined. The resulting mixture was washed with 2x300 mL of sodium chloride. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The crude product was purified by Flash-Prep-HPLC. This resulted in 7.2 g (47%) of tert-butyl 5-(2-[[2-(2,6-dioxopiperidin-3- yl)-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl]oxy]acetamido)pentanoate as a white solid.
Intermediate 3.15
5-[2-({2-[2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}oxy)acetamido]pentanoic acid
Figure imgf000055_0001
Into a 500-mL round- bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl 5-(2-[[2-(2,6-dioxopiperidin-3-yl)-1 ,3-dioxo-2,3-dihydro-1 H- isoindol-4-yl]oxy]acetamido)pentanoate (intermediate 3.14, 7.2 g, 14.77 mmol, 1.00 equiv), dichloromethane (150 ml_), TFA (30 mL). The resulting solution was stirred for 2 h at RT. The resulting mixture was concentrated under vacuum. The resulting solution was diluted with 300 mL of water. The solids were collected by filtration. This resulted in 5.25 g (82%) of 5-(2-[[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl]oxy]acetamido)pentanoic acid as a white solid.
LC-MS (method 3): Rt = 0.97 min; MS (ESIpos): m/z = 432 [M+H]+ 1H-NMR (300 MHz, DMSO-d6) d [ppm]: 12.00 (s, 1H), 11.11 (s, 1 H), 7.93-7.99 (m, 1H), 7.79-7.84 (m, 1 H), 7.48-7.51 (d, 1 H), 7.38-7.40 (d, 1 H), 5.09-5.15 (m, 1H), 4.77 (s, 2H), 3.14-3.21 (m, 2H), 2.84-2.96 (m, 1H), 2.50-2.63 (m, 2H), 2.14-2.30 (m, 2H), 1.98-2.14 (m, 1H), 1.36-1.59 (m, 4H).
Intermediate 3.16
14-{[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl]amino}-14-oxo- 3,6,9, 12-tetraoxatetradecan-1 -oic acid
Figure imgf000056_0001
Into a 1000-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3,6,9, 12-tetraoxatetradecanedioic acid (14 g, 52.58 mmol, 1.00 equiv), thionyl chloride (140 ml_). The resulting solution was stirred for 1.5 h at 75°C. The mixture was concentrated under vacuum. The residue was dissolved in anhydrous THF (500 ml_). To this was added 4-amino-2-(2,6-dioxopiperidin-3-yl)-2,3-dihydro-1H-isoindole-1 ,3-dione (CAS 19171-19-8, 8.6 g, 0.60 equiv). The resulting solution was allowed to react with stirring for an additional 1 h at 50°C. The reaction mixture was cooled to room temperature. The resulting mixture was concentrated under vacuum. The reaction was then quenched by the addition of sodium bicarbonate (300 ml_). The resulting solution was extracted with 3x300 ml_ of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate and concentrated under vacuum. The crude product was purified by Flash-Prep-HPLC with the following conditions (lntelFlash-1): Column, silica gel; mobile phase, ACN/water=5% increasing to MeCN/water =50% within 10 min; Detector, UV 254 nm. This resulted in 5.13 g (19%) of 14-{[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl]amino}-14- oxo-3,6,9,12-tetraoxatetradecan-1-oic acid as a solid.
LC-MS (method 4): Rt = 1.83 min; MS (ESIpos): m/z = 522.2 [M+H]+
1H-NMR (300 MHz, DMSO-d6) d [ppm]: 12.56 (1 H, s), 11.15 (1H, s), 10.35~10.36 (1 H, d), 8.71-8.74 (1H, d), 7.84-7.90 (1 H, t), 7.62-7.65 (1H, d), 5.13-5.19 (1H, m), 4.21-4.35 (1H, d), 3.99 (2H, s), 3.75-3.78 (2H, t), 3.66-3.68 (2H, t), 3.51-3.62 (8H, t), 2.86-2.95 (1 H, m), 2.84-2.50 (2H, m), 2.06-2.10 (1 H, d) Intermediate 3.17 tert-butyl [2-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H- isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)ethyl]carbamate
Figure imgf000057_0001
2-[(3S)-2,6-dioxopiperidin-3-yl]-4-fluoro-1H-isoindole-1,3(2H)-dione (900 mg, 3.26 mmol, CAS 911109-85-8) was added to 30 ml_ of N,N-dimethylformamide (30 mL), then tert-butyl (2-{2-[2-(2-aminoethoxy)ethoxy]ethoxy}ethyl)carbamate (953 mg, 3.26 mmol; CAS- RN:[101187-40-0]) was added and finally N,N-diisopropylethylamine (1.26 g, 9.77 mmol). The reaction mixture was stirred at 90°C for 16h.The mixture was cooled to RT, poured into water (50 mL) and extracted with ethyl acetate (2 x 50 ml). The combined organic phases were washed with water (50 mL) and brine (50 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product was purified by column chromatography with petroleum ether/ ethyl acetate (1:4/v:v) to yield 500 mg (28%) of the product.
LC-MS (method 6): Rt = 0.88 min; MS (ESIpos): m/z = 549 [M+H]+
Intermediate 3.18
4-[(2-{2-[2-(2-aminoethoxy)ethoxy]ethoxy}ethyl)amino]-2-[(3S)-2,6-dioxopiperidin-3-yl]-
1H-isoindole-1,3(2H)-dione trifluoroacetate
Figure imgf000057_0002
tert-butyl [2-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)ethoxy]ethoxy}ethoxy)ethyl]carbamate (intermediate 3.17, 500 mg, 911 pmol) was solved in 15 mL of dichloromethane and trifluoroacetic acid (1 mL) was added. The reaction mixture was stirred at RT for 2 h. The mixture was concentrated under reduced pressure to yield 398 mg (78%) of the product.
LC-MS (method 5): Rt = 0.88 min; MS (ESIpos): m/z = 449 [M+H]+
1H-NMR (400 MHz, METHANOL-d4) delta [ppm]: 2.111 (0.42), 2.124 (0.47), 2.695 (0.45), 2.726 (0.97), 2.761 (0.92), 2.767 (0.74), 2.771 (0.53), 2.778 (0.42), 2.818 (0.48), 2.832 (0.60), 2.854 (0.42), 2.862 (0.42), 2.866 (0.45), 3.077 (0.95), 3.090 (1.42), 3.102 (1.02), 3.507 (1.21), 3.519 (2.21), 3.533 (1.50), 3.635 (1.08), 3.638 (1.11), 3.643 (1.44), 3.647 (2.07), 3.651 (2.95), 3.660 (3.71), 3.665 (2.55), 3.677 (16.00), 3.684 (2.53), 3.717 (1.63), 3.730 (2.31), 3.743 (1.19), 5.036 (0.71), 5.050 (0.82), 5.067 (0.76), 5.081 (0.71), 7.064 (1.47), 7.082 (1.60), 7.093 (1.40), 7.114 (1.50), 7.545 (1.03), 7.563 (1.07), 7.567 (1.10), 7.584 (0.90).
Intermediate 3.19 tert-butyl [14-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-3,6,9,12-tetraoxatetradecan-1-yl]carbamate
Figure imgf000058_0001
2-[(3S)-2,6-dioxopiperidin-3-yl]-4-fluoro-1H-isoindole-1,3(2H)-dione (900 mg, 3.26 mmol) was added to 30 ml of N,N-dimethylformamide, then tert-butyl (14-amino-3,6,9,12- tetraoxatetradecan-1-yl)carbamate (1.10 g, 3.26 mmol; CAS-RN:[811442-84-9]) N,N- diisopropylethylamine (1.26 g, 9.77 mmol) were added. The reaction mixture was stirred at 90°C for 16h.The mixture was cooled to room temperature, poured into water (50 ml_) and extracted with ethyl acetate (2x50 ml). The combined organic phases were washed with water (50 ml) and brine (50 ml_), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product was purified by column chromatography with petroleum ether/ ethyl acetate (1 :3/v:v) to yield 430 mg (22%) of the desired product.
LC-MS (method 6): Rt = 0.82 min; MS (ESIpos): m/z = 592 [M+H]+
Intermediate 3.20
4-[(14-amino-3, 6,9,12-tetraoxatetradecan-1-yl)amino]-2-[(3S)-2,6-dioxopiperidin-3-yl]- 1H-isoindole-1,3(2H)-dione trifluoroacetate
Figure imgf000059_0001
Tert-butyl [14-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl}- amino)-3,6,9,12-tetraoxatetradecan-1-yl]carbamate (intermediate 3.19, 430 mg, 726 pmol) was solved in 15 ml_ of dichloromethane and trifluoroacetic acid (1 mL) was added. The reaction mixture was stirred at RT for 2 h. The mixture was concentrated under reduced pressure to yield 240 mg (50%) of the desired product.
LC-MS (method 5): Rt = 0.91 min; MS (ESIpos): m/z = 493 [M+H]+
1H-NMR (300 MHz, METHANOL-d4) d [ppm]: 0.010 (0.58), 1.205 (0.40), 1.229 (0.74), 1.253 (0.41), 1.293 (0.20), 2.069 (0.23), 2.096 (0.38), 2.111 (0.48), 2.128 (0.55), 2.135 (0.51), 2.145 (0.33), 2.639 (0.20), 2.654 (0.24), 2.684 (0.41), 2.695 (0.61), 2.717 (0.46), 2.727 (0.90), 2.741 (0.58), 2.762 (0.94), 2.769 (1.25), 2.782 (0.74), 2.809 (0.87), 2.825 (0.81), 2.856 (0.38), 2.872 (0.51), 2.883 (0.35), 2.914 (0.19), 2.930 (0.20), 3.078 (1.20), 3.093
(1.82), 3.111 (1.40), 3.131 (0.40), 3.148 (0.30), 3.257 (0.35), 3.276 (0.73), 3.495 (1.34), 3.513 (2.71), 3.530 (1.95), 3.542 (0.50), 3.636 (16.00), 3.647 (5.65), 3.659 (5.63), 3.671 (12.34), 3.695 (2.20), 3.719 (2.05), 3.736 (2.98), 3.753 (1.39), 4.061 (0.28), 4.083 (0.28), 5.028 (0.86), 5.045 (0.97), 5.068 (0.82), 5.087 (0.81), 7.062 (1.76), 7.087 (2.64), 7.118
(1.83), 7.540 (1.17), 7.564 (1.19), 7.568 (1.21), 7.592 (0.96).
Intermediate 3.21 tert-butyl-3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H- isoindol-5-yl}amino)ethoxy]ethoxy}ethoxy)propanoate
Figure imgf000059_0002
To a solution of 2-[(3RS)-2,6-Dioxopiperidin-3-yl]-5-fluor-1 H-isoindol-1,3(2H)-dion
(intermediate 2.2, 500 mg, 1.81 mmol) in N,N-Dimethylacetamid (6 mL) and N,N- Diisopropylethylamin (3.2 mL, 18 mmol; CAS- R N : [7087-68-5]) was added tert-Butyl-3-{2-[2- (2-aminoethoxy)ethoxy]ethoxy}propanoat (753 mg, 2.72 mmol) and the reaction mixture heated to 150° C for 90 min under microwave irradiation. The mixture was cooled to RT and ethyl acetate (30 mL) was added to the reaction mixture. The organic phase was washed with sat. NaHCC>3 (3x 30 mL) and brine (30 mL), dried over anhydrous sodium sulfate and concentrated under reduced pressure. The crude product was purified by column chromotography (2%-25% MeOH in DCM) to yield 100 mg (11%) of the desired product.
LC-MS (method 6): Rt = 1.07 min; MS (ESIpos): m/z = 534 [M+H]+
1H-NMR (400 MHz, DMSO-d6) d [ppm]: 1.237 (0.33), 1.381 (16.00), 1.396 (0.70), 1.989 (0.20), 2.008 (0.18), 2.338 (0.27), 2.382 (0.73), 2.398 (1.44), 2.414 (0.68), 2.520 (3.40), 2.525 (2.20), 2.552 (0.26), 2.680 (0.27), 3.307 (0.26), 3.350 (0.52), 3.364 (0.50), 3.377 (0.20), 3.450 (0.17), 3.456 (0.24), 3.464 (0.38), 3.470 (0.82), 3.475 (1.38), 3.480 (1.40), 3.484 (0.81), 3.498 (0.27), 3.505 (0.20), 3.513 (0.23), 3.520 (0.44), 3.527 (0.79), 3.532 (1.25), 3.537 (1.31), 3.541 (0.73), 3.551 (0.88), 3.566 (1.50), 3.576 (0.55), 3.582 (0.93), 3.590 (0.74), 3.603 (0.33), 5.009 (0.18), 5.023 (0.24), 5.041 (0.20), 5.054 (0.20), 6.881 (0.26), 6.887 (0.27), 6.903 (0.27), 6.908 (0.30), 7.000 (0.49), 7.006 (0.44), 7.170 (0.30), 7.549 (0.55), 7.570 (0.50), 11.066 (0.44).
Intermediate 3.22 tert-butyl 1 -({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-5- yl}amino)-3,6,9,12-tetraoxapentadecan-15-oate
Figure imgf000060_0001
To a solution of 2-[(3RS)-2,6-Dioxopiperidin-3-yl]-5-fluor-1 H-isoindol-1,3(2H)-dion (intermediate 2.2, 500 mg, 1.81 mmol) in N,N-dimethylacetamid (6 ml_) and N,N- diisopropylethylamin (3.2 mL, 18 mmol; CAS-RN: [7087-68-5]) was added tert-Butyl-1-amino- 3,6,9, 12-tetraoxapentadecan-15-oat (873 mg, 2.72 mmol) and the reaction mixture heated to 150° C fur 90 min under microwave irradiation. The mixture was cooled to ambient temperature and ethyl acetate (30 mL) was added to the reaction mixture. The organic phase was washed with sat. aqueous sodium hydrogencarbonate (3x 30 mL) and brine (30 mL), dried over anhydrous sodium sulfate and concentrated under reduced pressure. The crude product was purified by column chromotography (2%-25% MeOH in DCM) to yield 206 mg (20%) of the desired product.
LC-MS (method 6): Rt = 1.08 min; MS (ESIpos): m/z = 578 [M+H]+
Intermediate 3.23
3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-5- yl}amino)ethoxy]ethoxy}ethoxy)propanoic acid trifluoroacetate
Figure imgf000061_0001
To a solution of tert-butyl-3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-
1H-isoindol-5-yl}amino)ethoxy]ethoxy}ethoxy)propanoate (intermediate 3.21, 100 mg, 187 prnol) in DCM (6 ml_), TFA (2.0 mL, 26 mmol; CAS-RN: [76-05-1]) was added and the reaction mixture stirred at ambient temperature for 2 h. Afterwards, the solvent was removed under reduced pressure and the crude product used without further purification.
LC-MS (method 6): Rt = 0.76 min; MS (ESIpos): m/z = 478 [M+H]+
Intermediate 3.24
1-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-5-yl}amino)- 3,6,9, 12-tetraoxapentadecan-15-oic acid trifluoroacetate
Figure imgf000061_0002
To a solution of tert-butyl-1-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1 H- isoindol-5-yl}amino)-3,6,9,12-tetraoxapentadecan-15-oate (intermediate 3.22, 210 mg, 364 prnol) in DCM (9 mL), TFA (3.0 mL, 39 mmol; CAS-RN:[76-05-1]) was added and the reaction mixture stirred at ambient temperature for 2 h. Afterwards, the solvent was removed under reduced pressure and the crude product used without further purification.
LC-MS (method 6): Rt = 0.78 min; MS (ESIpos): m/z = 522 [M+H]+
Intermediate 3.25
N-({2-[2-(2-aminoethoxy)ethoxy]ethoxy}acetyl)-3-methyl-L-valyl-(4R)-4-hydroxy-N-{[4-
(4-methyl-1,3-thiazol-5-yl)phenyl]methyl}-L-prolinamide
Figure imgf000062_0001
The synthesis of intermediate 3.25 is described in Chemical Biology (2017), 12(10), 2570- 2578, [CAS 2010159-56-3]
Intermediate 3.26
N-{[2-(2-aminoethoxy)ethoxy]acetyl}-3-methyl-L-valyl-(4R)-4-hydroxy-N-{[4-(4-methyl-
1,3-thiazol-5-yl)phenyl]methyl}-L-prolinamide
Figure imgf000062_0002
The synthesis of intermediate 3.26 is described in Journal of Medicinal Chemistry (2018), 61(2), 504-513, [CAS 2010159-60-9]
Intermediate 3.27 N-(14-amino-3, 6,9,12-tetraoxatetradecanan-1-oyl)-3-methyl-L-valyl-(4R)-4-hydroxy-N- {[4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl}-L-prolinamide
Figure imgf000063_0001
The synthesis of intermediate 3.27 is described in Journal of Medicinal Chemistry (2018), 61(2), 504-513, [CAS 2010159-57-4]
Synthesis of BET - E3 engaging derivatives:
Example 1
(4S)-1-(4-{4-[15-({2-[2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-4,7,10,13-tetraoxapentadecanan-1-oyl]piperazin-1-yl}phenyl)-7,8-dimethoxy-
N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000063_0002
To a solution of (4S)-7,8-dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4,5-dihydro- 3H-2,3-benzodiazepine-3-carboxamide (intermediate 1.1, 100 mg, 226 pmol, synthesis described in W02914026997, example 131.1) and 1-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3- dioxo-2,3-dihydro-1H-isoindol-4-yl}amino)-3,6,9,12-tetraoxapentadecan-15-oic acid (intermediate 3.5, 118 mg, 226 pmol) in DMF (1.2 ml_) was added N,N-diisopropylethylamine (158 mI, 905 pmol) followed by 1-propanephosphonic anhydride in DMF (264 mI, 50 % solution in DMF, 450 pmol; CAS-RN:[68957-94-8]). The reaction mixture was stirred at RT for 16h. The crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 95.3 mg of the title compound (44 % yield) after freeze drying of the pooled fractions as yellow lyophilisate.
LC-MS (method 1): Rt = 1.02 min; MS (ESIpos): m/z = 941.6 [M+H]+
Ή-NMR (400 MHz, DMSO-d6) d [ppm]: 1.039 (3.30), 1.055 (3.37), 2.336 (0.42), 2.428 (0.49), 2.518 (4.95), 2.523 (3.56), 2.532 (0.67), 2.556 (0.79), 2.593 (1.26), 2.610 (2.26), 2.620 (4.74), 2.632 (4.74), 2.659 (0.51), 2.822 (0.53), 2.843 (0.74), 3.226 (0.93), 3.280 (0.98), 3.432 (0.47), 3.447 (1.30), 3.461 (1.74), 3.465 (1.72), 3.478 (16.00), 3.492 (1.00), 3.504 (1.42), 3.511 (1.51), 3.516 (1.98), 3.535 (1.98), 3.541 (1.44), 3.548 (1.30), 3.556 (0.63), 3.559 (0.58), 3.590 (12.26), 3.601 (3.84), 3.614 (2.88), 3.630 (2.47), 3.647 (1.09), 3.831 (9.00), 4.882 (0.40), 4.896 (0.44), 5.027 (0.51), 5.040 (0.67), 5.059 (0.51), 5.073 (0.56), 6.307 (0.77), 6.319 (0.74), 6.530 (3.58), 6.599 (0.79), 6.943 (1.81), 6.966 (1.84), 7.026 (3.23), 7.040 (1.65), 7.122 (1.28), 7.143 (1.40), 7.552 (0.91), 7.569 (0.95), 7.573 (0.93), 7.592 (2.74), 7.614 (2.00), 11.101 (1.56).
Example 2
(4S)-1-(4-{4-[15-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-4,7,10,13-tetraoxapentadecanan-1-oyl]piperazin-1-yl}phenyl)-7,8-dimethoxy-
N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000064_0001
To a solution of (4S)-7,8-dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4, 5-dihydro- 3H-2,3-benzodiazepine-3-carboxamide (intermediate 1.1, 40.0 mg, 90.5 mitioI) and 1-({2- [(3S)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1H-isoindol-4-yl}amino)-3,6,9,12- tetraoxapentadecan-15-oic acid (intermediate 3.6, 47.2 mg, 90.5 pmol) in DMF (460 mI, 6.0 mmol) was added N,N-diisopropylethylamine (63 mI, 360 mitioI) followed by 1- propanephosphonic anhydride in DMF (110 mI, 50 % solution in DMF, 180 pmol; CAS- RN:[68957-94-8]). The reaction mixture was stirred at RT for 16h. The crude reaction mixture was purified by preparative HPLC (method I) to give 52.5 mg after evaporation of the solvents of the title compound (55 % yield).
LC-MS (method 1): Rt = 1.03 min; MS (ESIpos): m/z = 941.6 [M+H]+
Ή-NMR (400 MHz, CHLOROFORM-d) d [ppm]: 0.850 (1.52), 0.865 (1.05), 1.091 (4.51), 1.107 (4.54), 1.261 (2.39), 1.291 (0.52), 1.592 (5.87), 2.104 (0.51), 2.111 (0.50), 2.123 (0.62), 2.144 (0.49), 2.182 (3.96), 2.685 (1.38), 2.701 (2.91), 2.713 (1.29), 2.718 (1.73), 2.735 (0.67), 2.755 (1.35), 2.763 (0.57), 2.770 (0.87), 2.778 (0.77), 2.786 (0.72), 2.818 (0.67), 2.848 (0.42), 2.865 (5.81), 2.877 (5.83), 2.905 (0.57), 2.944 (0.67), 2.954 (0.72), 2.979 (0.55), 2.990 (0.52), 3.256 (0.90), 3.268 (1.45), 3.281 (1.90), 3.293 (1.38), 3.306 (1.00), 3.446 (0.62), 3.460 (1.77), 3.473 (1.98), 3.487 (0.82), 3.637 (1.14), 3.650 (15.64), 3.655 (5.77), 3.660 (5.43), 3.672 (16.00), 3.700 (12.51), 3.708 (2.20), 3.722 (2.94), 3.735 (1.43), 3.794 (0.99), 3.808 (1.30), 3.820 (2.31), 3.837 (3.23), 3.853 (1.41), 3.943 (11.32), 4.885 (0.65), 4.898 (0.61), 4.915 (0.84), 4.929 (0.54), 5.310 (0.84), 5.317 (0.41), 6.159 (0.79), 6.171 (0.78), 6.490 (0.44), 6.504 (0.85), 6.518 (0.44), 6.632 (3.84), 6.754 (3.53), 6.899 (2.44), 6.908 (2.01), 6.922 (2.63), 6.929 (2.08), 7.103 (1.86), 7.121 (2.01), 7.478 (1.20), 7.488 (3.09), 7.496 (1.52), 7.499 (1.43), 7.511 (2.81), 7.518 (1.23), 7.529 (0.42),
8.484 (0.59).
Example 3
(4S)-1-(4-{4-[3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H- isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)propanoyl]piperazin-1-yl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000065_0001
To a solution of (4S)-7,8-dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4, 5-dihydro-
3H-2,3-benzodiazepine-3-carboxamide (intermediate 1.1, 100 mg, 226 pmol) and 3-(2-{2-[2- ({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-4- yl}amino)ethoxy]ethoxy}ethoxy)propanoic acid (intermediate 3.6, 108 mg, 226 pmol) in DMF (1.2 ml_) was added N,N-diisopropylethylamine (160 pi, 910 pmol) followed by 1- propanephosphonic anhydride in DMF (260 pi, 50 % solution in DMF, 450 pmol; CAS- RN:[68957-94-8]). The reaction mixture was stirred at RT for 16h. The crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 103 mg of the title compound (50% yield) after freeze drying of the pooled fractions as yellow lyophilisate.
LC-MS (method 1): Rt = 1.02 min; MS (ESIpos): m/z = 897.6 [M+H]+
Ή-NMR (400 MHz, DMSO-d6) d [ppm]: 1.039 (4.50), 1.055 (4.47), 1.997 (0.41), 2.003 (0.44), 2.011 (0.60), 2.028 (0.50), 2.034 (0.46), 2.084 (0.68), 2.428 (0.52), 2.462 (1.00),
2.518 (1.62), 2.523 (1.35), 2.535 (0.72), 2.558 (0.95), 2.584 (1.36), 2.601 (3.27), 2.622 (6.42), 2.633 (5.88), 2.669 (0.46), 2.808 (0.53), 2.821 (0.74), 2.843 (0.96), 2.856 (0.53),
2.865 (0.45), 2.874 (0.51), 2.879 (0.47), 3.222 (1.34), 3.274 (1.35), 3.430 (0.63), 3.444 (1.68), 3.458 (1.94), 3.472 (1.48), 3.479 (1.54), 3.492 (6.05), 3.503 (2.04), 3.506 (2.07),
3.513 (2.63), 3.518 (3.54), 3.528 (3.41), 3.534 (2.24), 3.540 (1.52), 3.553 (0.66), 3.590 (16.00), 3.598 (5.91), 3.612 (3.89), 3.629 (3.25), 3.645 (1.46), 3.832 (11.90), 4.883 (0.57), 4.897 (0.60), 4.910 (0.53), 5.029 (0.72), 5.043 (0.93), 5.061 (0.73), 5.075 (0.79), 6.309 (1.06), 6.321 (1.03), 6.530 (4.75), 6.583 (0.58), 6.597 (1.15), 6.611 (0.53), 6.940 (2.50),
6.963 (2.53), 7.021 (2.57), 7.027 (4.21), 7.038 (2.29), 7.117 (1.78), 7.139 (1.96), 7.548 (1.25), 7.566 (1.34), 7.569 (1.29), 7.591 (3.25), 7.614 (2.74), 11.102 (2.32).
Example 4
(4S)-1-(4-{4-[3-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H- isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)propanoyl]piperazin-1-yl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000067_0001
To a solution of (4S)-7,8-dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4, 5-dihydro-
3H-2,3-benzodiazepine-3-carboxamide (intermediate 1.1, 40.0 mg, 90.5 pmol) and 3-(2-{2- [2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl}amino)ethoxy]- ethoxy}ethoxy)propanoic acid (intermediate 3.5, 43.2 mg, 90.5 pmol) in DMF (460 pi, 6.0 mmol) was added N,N-diisopropylethylamine (63 pi, 360 pmol) followed by 1- propanephosphonic anhydride in DMF (110 pi, 50 % solution in DMF, 180 pmol; CAS- RN:[68957-94-8]). The reaction mixture was stirred at RT for 16h. The crude reaction mixture was purified by prep. HPLC (method I) to give 45 mg after evaporation of the solvents of the title compound (50 % yield).
LC-MS (method 1): Rt = 1.02 min; MS (ESIpos): m/z = 897.6 [M+H]+
Ή-NMR (400 MHz, CHLOROFORM-d) d [ppm]: 1.090 (5.39), 1.107 (5.42), 1.261 (0.59), 1.599 (2.31), 2.102 (0.42), 2.111 (0.90), 2.122 (0.57), 2.128 (0.40), 2.141 (0.52), 2.182 (1.81), 2.688 (1.38), 2.704 (2.65), 2.721 (1.87), 2.733 (1.07), 2.746 (1.40), 2.756 (1.36), 2.770 (2.09), 2.793 (0.47), 2.803 (0.62), 2.864 (7.06), 2.876 (6.80), 2.900 (0.69), 2.943 (0.82), 2.953 (0.90), 2.979 (0.68), 2.989 (0.62), 3.255 (1.09), 3.268 (1.78), 3.280 (2.32), 3.292 (1.71), 3.305 (1.23), 3.443 (0.56), 3.451 (1.27), 3.456 (1.38), 3.464 (1.46), 3.469 (1.39), 3.478 (0.66), 3.652 (1.15), 3.666 (5.30), 3.675 (16.00), 3.686 (3.94), 3.699 (15.79), 3.715 (2.74), 3.717 (2.72), 3.729 (1.28), 3.801 (1.26), 3.817 (1.65), 3.827 (2.43), 3.844 (2.79), 3.860 (1.28), 3.943 (13.49), 4.892 (0.69), 4.905 (0.65), 4.922 (1.05), 4.936 (0.54), 5.295 (0.46), 5.301 (0.49), 5.309 (0.90), 5.317 (0.50), 5.323 (0.44), 6.158 (0.93), 6.171 (0.93), 6.494 (0.54), 6.507 (1.05), 6.521 (0.53), 6.629 (4.74), 6.753 (4.14), 6.895 (4.72), 6.917 (4.92), 7.105 (2.21), 7.122 (2.35), 7.476 (1.59), 7.485 (3.47), 7.494 (1.72), 7.497 (1.75), 7.507 (3.16), 7.515 (1.36), 7.528 (0.41), 8.755 (0.47).
Example 5 (4S)-1-(4-{4-[(2-{2-[2-({2-[2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-2-oxoethoxy]ethoxy}ethoxy)acetyl]piperazin-1-yl}phenyl)-7,8-dimethoxy-
N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000068_0001
To a solution of (4S)-7,8-dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4, 5-dihydro-
3H-2,3-benzodiazepine-3-carboxamide (intermediate 1.1, 50.0 mg, 114 pmol) and (2-{2-[2- ({2-[2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-4-yl}amino)-2- oxoethoxy]ethoxy}ethoxy)acetic acid (intermediate 3.9, 54.6 mg, 114 pmol) in DMF (1 ml_,
13 mmol) was added N,N-diisopropylethylamine (80 pi, 460 pmol) followed by 1- propanephosphonic anhydride in DMF (130 pi, 50 % solution in DMF, 230 pmol; CAS- RN:[68957-94-8]). The reaction mixture was stirred at RT for 16h. The crude reaction mixture was purified by prep reversed phase HPLC (acidic conditions) to give 65.3 mg after evaporation of the solvents of the title compound (63 % yield).
LC-MS (method 1): Rt = 0.96 min; MS (ESIpos): m/z = 897.5 [M+H]+
Ή-NMR (400 MHz, CHLOROFORM-d) d [ppm]: 0.101 (0.52), 0.180 (0.68), 1.084 (5.92), 1.100 (5.99), 2.165 (0.77), 2.173 (0.57), 2.185 (0.47), 2.722 (0.91), 2.745 (1.60), 2.750 (1.75), 2.779 (2.16), 2.867 (6.59), 2.879 (7.01), 2.903 (0.56), 2.955 (1.00), 2.964 (1.06), 2.990 (0.80), 2.999 (0.72), 3.272 (1.71), 3.288 (1.68), 3.308 (1.72), 3.694 (15.04), 3.726 (2.35), 3.737 (2.84), 3.745 (3.68), 3.767 (1.92), 3.775 (2.83), 3.779 (2.48), 3.787 (3.00), 3.798 (3.37), 3.806 (4.00), 3.815 (3.64), 3.818 (3.66), 3.825 (3.88), 3.943 (16.00), 4.078 (0.66), 4.117 (2.03), 4.156 (3.66), 4.165 (2.44), 4.194 (0.80), 4.292 (4.91), 4.944 (0.60), 4.957 (0.80), 4.975 (0.74), 4.988 (0.69), 5.294 (0.41), 5.304 (0.50), 5.311 (0.55), 5.319 (0.62), 5.332 (0.48), 6.194 (0.60), 6.210 (0.77), 6.222 (0.62), 6.619 (3.24), 6.622 (3.19), 6.751 (4.86), 6.886 (1.97), 6.908 (2.20), 7.469 (3.71), 7.491 (3.33), 7.577 (2.02), 7.595 (2.57), 7.704 (1.27), 7.724 (1.87), 7.744 (1.01), 8.851 (1.80), 8.872 (1.71), 10.480 (2.23).
Example 6 (4S)-1-{4-[4-({2-[2-({2-[2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-2-oxoethoxy]ethoxy}acetyl)piperazin-1-yl]phenyl}-7,8-dimethoxy-N,4- dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000069_0001
To a solution of (4S)-7,8-dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4, 5-dihydro-
3H-2,3-benzodiazepine-3-carboxamide (intermediate 1.1, 50.0 mg, 114 pmol) and {2-[2-({2- [2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl}amino)-2- oxoethoxy]ethoxy}acetic acid (intermediate 3.10, 49.5 mg, 114 pmol) in DMF (1 ml_, 13 mmol) was added N,N-diisopropylethylamine (80 pi, 460 pmol) followed by 1- propanephosphonic anhydride in DMF (130 pi, 50 % solution in DMF, 230 pmol; CAS- RN:[68957-94-8]). The reaction mixture was stirred at RT for 16h. The crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 46.1 mg of the title compound (47% yield) after freeze drying of the pooled fractions as yellow lyophilisate.
LC-MS (method 1): Rt = 0.95 min; MS (ESIpos): m/z = 853.4 [M+H]+
Ή-NMR (400 MHz, CHLOROFORM-d) d [ppm]: 0.100 (0.41), 0.179 (0.62), 1.079 (5.51), 1.095 (5.67), 2.151 (0.45), 2.159 (0.58), 2.164 (0.55), 2.170 (0.46), 2.184 (0.46), 2.625 (0.56), 2.718 (0.46), 2.725 (0.82), 2.745 (1.38), 2.755 (0.95), 2.760 (1.24), 2.765 (1.01), 2.772 (0.99), 2.782 (0.91), 2.794 (0.43), 2.805 (0.56), 2.869 (5.46), 2.880 (5.77), 2.917 (0.53), 2.960 (0.52), 2.968 (0.72), 2.974 (0.53), 2.995 (0.41), 3.002 (0.52), 3.210 (0.80), 3.317 (0.84), 3.691 (16.00), 3.774 (0.49), 3.841 (0.57), 3.860 (3.38), 3.870 (2.30), 3.879 (3.67), 3.887 (1.71), 3.902 (0.90), 3.912 (0.49), 3.942 (14.59), 4.169 (0.65), 4.209 (4.39), 4.219 (3.78), 4.258 (0.50), 4.323 (2.33), 4.325 (2.48), 4.332 (3.73), 4.366 (0.53), 4.912 (0.45), 4.924 (0.67), 4.943 (0.61), 5.324 (0.51), 6.215 (0.59), 6.228 (0.87), 6.240 (0.59), 6.611 (5.09), 6.749 (4.34), 6.891 (1.91), 6.913 (2.03), 7.445 (2.16), 7.448 (2.41), 7.468 (2.22), 7.470 (1.98), 7.570 (1.84), 7.587 (2.35), 7.704 (1.54), 7.725 (1.74), 7.743 (1.26), 8.837 (2.16), 8.858 (2.09), 10.478 (1.58).
Example 7
(4S)-1-[4-(4-{5-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-
4-yl}oxy)acetamido]pentanoyl}piperazin-1-yl)phenyl]-7,8-dimethoxy-N,4-dimethyl-4,5- dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000070_0001
To a solution of (4S)-7,8-dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4,5-dihydro- 3H-2,3-benzodiazepine-3-carboxamide (intermediate 1.1, 60.6 mg, 137 mitioI) and 5-[2-({2- [(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-4- yl}oxy)acetamido]pentanoic acid (intermediate 3.15, 59.2 mg, 137 pmol) (49.5 mg, 114 pmol) in DMF (1 ml_, 13 mmol) was added N,N-diisopropylethylamine (59.2 mg, 137 pmol) followed by 1-propanephosphonic anhydride in DMF (160 mI, 50 % solution in DMF, 270 mitioI; CAS-RN:[68957-94-8]). The reaction mixture was stirred at RT for 16h. The crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 31.1 mg of the title compound (31% yield) after freeze drying of the pooled fractions as lyophilisate.
LC-MS (method 1): Rt = 0.92 min; MS (ESIpos): m/z = 851.4 [M+H]+
1H-NMR (400 MHz, CHLOROFORM-d) delta [ppm]: 0.180 (0.44), 0.991 (0.50), 1.008 (0.51), 1.090 (3.71), 1.106 (3.76), 1.596 (2.64), 1.655 (0.86), 1.676 (1.22), 1.694 (1.26), 1.710 (0.57), 1.734 (0.55), 1.752 (1.19), 1.764 (0.87), 1.771 (1.12), 1.792 (0.73), 1.809 (0.23), 2.175 (0.64), 2.187 (0.49), 2.206 (0.51), 2.218 (0.26), 2.374 (0.18), 2.392 (0.33), 2.411 (0.65), 2.430 (1.08), 2.441 (0.73), 2.448 (0.65), 2.460 (1.03), 2.479 (0.62), 2.498 (0.33), 2.626 (4.49), 2.702 (0.16), 2.726 (0.71), 2.734 (0.50), 2.748 (0.88), 2.762 (1.35), 2.783 (1.70), 2.810 (0.38), 2.820 (0.64), 2.865 (6.11), 2.877 (6.22), 2.891 (1.16), 2.902 (1.08), 2.933 (0.66), 2.957 (0.73), 2.966 (0.82), 2.993 (0.60), 3.002 (0.56), 3.085 (0.24), 3.271 (0.79), 3.304 (0.66), 3.320 (1.01), 3.335 (1.26), 3.352 (1.19), 3.368 (0.79), 3.471 (0.23), 3.488 (0.57), 3.504 (0.71), 3.521 (0.62), 3.537 (0.40), 3.692 (2.78), 3.699 (15.87), 3.762 (0.44), 3.893 (0.38), 3.946 (16.00), 4.602 (1.20), 4.637 (2.84), 4.680 (2.86), 4.715 (1.19), 4.929 (0.43), 4.936 (0.46), 4.942 (0.50), 4.950 (0.44), 4.959 (0.74), 4.966 (0.68), 4.980 (0.32), 5.301 (0.33), 5.311 (0.43), 5.318 (0.44), 5.327 (0.52), 5.333 (0.44), 5.340 (0.40), 5.349 (0.32), 6.190 (0.63), 6.202 (0.62), 6.584 (0.51), 6.623 (4.53), 6.730 (0.42), 6.755 (4.06), 6.959 (0.89), 6.979 (0.94), 7.006 (0.74), 7.207 (2.14), 7.228 (2.30), 7.509 (1.52), 7.528 (1.72), 7.562 (2.43), 7.572 (0.33), 7.580 (2.86), 7.667 (0.76), 7.740 (1.95), 7.758 (1.87), 7.761 (1.99), 7.779 (1.51), 8.969 (0.23).
Example 8
(4S)-1-(4-{4-[14-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-14-oxo-3,6,9,12-tetraoxatetradecanan-1-oyl]piperazin-1-yl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000071_0001
To a solution of (4S)-7,8-dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4,5-dihydro- 3H-2,3-benzodiazepine-3-carboxamide (intermediate 1.1, 50.0 mg, 114 mitioI) and 14-({2- [(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1H-isoindol-4-yl}amino)-14-oxo- 3, 6 , 9 , 12-tetraoxatetradecan- 1 -oic acid (intermediate 3.16, 59.6 mg, 114 pmol) in DMF (1 ml_, 13 mmol) was added N,N-diisopropylethylamine (80 mI, 460 mitioI) followed by 1- propanephosphonic anhydride in DMF (130 mI, 50 % solution in DMF, 230 pmol; CAS- RN: [68957-94-8]). The reaction mixture was stirred at RT for 16h. The crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 47.2 mg of the title compound (43% yield) after freeze drying of the pooled fractions as yellow lyophilisate.
LC-MS (method 1): Rt = 0.97 min; MS (ESIpos): m/z = 941.5 [M+H]+
Ή-NMR (400 MHz, CHLOROFORM-d) d [ppm]: 0.101 (0.54), 0.180 (0.79), 1.086 (4.65), 1.101 (4.57), 2.147 (0.63), 2.155 (0.41), 2.160 (0.48), 2.180 (0.47), 2.716 (0.62), 2.738 (0.87), 2.752 (0.89), 2.773 (1.79), 2.782 (0.65), 2.793 (0.76), 2.826 (0.56), 2.865 (5.62), 2.877 (5.82), 2.921 (0.55), 2.950 (0.75), 2.959 (0.81), 2.986 (0.61), 2.995 (0.56), 3.285 (2.03), 3.296 (2.08), 3.649 (0.40), 3.663 (0.96), 3.667 (1.33), 3.675 (2.20), 3.688 (3.62), 3.697 (16.00), 3.707 (3.04), 3.715 (4.37), 3.722 (3.48), 3.730 (3.38), 3.735 (4.23), 3.747 (1.39), 3.754 (0.75), 3.760 (0.56), 3.812 (8.06), 3.943 (13.27), 4.176 (1.94), 4.185 (2.58), 4.186 (2.81), 4.190 (2.47), 4.254 (0.43), 4.262 (0.49), 4.288 (3.06), 4.295 (2.96), 4.929 (0.55), 4.942 (0.51), 4.959 (0.88), 4.972 (0.45), 5.301 (0.43), 5.308 (0.45), 5.318 (0.51), 5.323 (0.44), 5.330 (0.40), 6.178 (0.71), 6.190 (0.66), 6.625 (3.74), 6.753 (3.95), 6.902 (1.53), 6.923 (1.63), 7.482 (2.75), 7.504 (2.46), 7.576 (1.60), 7.578 (1.73), 7.594 (2.12), 7.596 (2.05), 7.709 (1.29), 7.730 (1.44), 7.748 (1.00), 8.852 (1.79), 8.873 (1.72), 10.493 (1.50).
Example 9
(4R)-1-(4-{4-[15-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-4,7,10,13-tetraoxapentadecanan-1-oyl]piperazin-1-yl}phenyl)-7,8-dimethoxy-
N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000072_0001
To a solution of (4R)-7,8-dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4,5-dihydro- 3H-2,3-benzodiazepine-3-carboxamide (intermediate 1.0, 41.9 mg, 95.9 mitioI) and 1-({2- [(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1H-isoindol-4-yl}amino)-3,6,9,12- tetraoxapentadecan-15-oic acid (intermediate 3.7, 50.0 mg, 95.9 pmol) in DMF (1 ml_, 13 mmol) was added N,N-diisopropylethylamine (67 mI, 380 mitioI) followed by 1- propanephosphonic anhydride in DMF (110 mI, 50 % solution in DMF, 190 pmol; CAS- RN: [68957-94-8]). The reaction mixture was stirred at RT for 16h. The crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 43.2 mg of the title compound (47% yield) after freeze drying of the pooled fractions as yellow lyophilisate. LC-MS (method 1): Rt = 1.02 min; MS (ESIpos): m/z = 941.6 [M+H]+
Ή-NMR (400 MHz, DMSO-d6) d [ppm]: 1.039 (3.36), 1.055 (3.36), 2.318 (0.43), 2.322 (0.94), 2.326 (1.28), 2.331 (0.90), 2.336 (0.41), 2.428 (0.58), 2.518 (4.56), 2.522 (3.25), 2.532 (0.60), 2.556 (0.73), 2.594 (1.28), 2.610 (2.31), 2.620 (4.75), 2.632 (4.73), 2.659 (0.49), 2.664 (1.01), 2.668 (1.30), 2.673 (0.94), 2.678 (0.43), 2.822 (0.53), 2.843 (0.75), 3.225 (0.94), 3.279 (1.03), 3.433 (0.49), 3.447 (1.35), 3.461 (1.86), 3.465 (1.84), 3.478 (16.00), 3.492 (1.01), 3.504 (1.43), 3.511 (1.54), 3.516 (1.99), 3.535 (2.01), 3.541 (1.48), 3.548 (1.30), 3.556 (0.66), 3.559 (0.62), 3.590 (12.34), 3.601 (3.91), 3.614 (2.91), 3.630 (2.48), 3.647 (1.09), 3.830 (8.98), 4.882 (0.43), 4.895 (0.43), 5.027 (0.51), 5.040 (0.68), 5.059 (0.51), 5.073 (0.56), 6.307 (0.77), 6.319 (0.75), 6.530 (3.59), 6.584 (0.41), 6.598 (0.81), 6.943 (1.84), 6.966 (1.86), 7.026 (3.27), 7.040 (1.65), 7.122 (1.28), 7.143 (1.41), 7.552 (0.92), 7.569 (0.96), 7.573 (0.94), 7.592 (2.76), 7.614 (2.03), 11.100 (1.52).
Example 10
(4R)-1 -(4-{4-[3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H- isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)propanoyl]piperazin-1-yl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000073_0001
To a solution of (4R)-7,8-dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4,5-dihydro- 3H-2,3-benzodiazepine-3-carboxamide (intermediate 1.0, 41.9 mg, 95.9 mitioI) and 3-(2-{2- [2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)ethoxy]ethoxy}ethoxy)propanoic acid (intermediate 3.6, 54.6 mg, 114 pmol) in DMF
(1 ml_, 13 mmol) was added N,N-diisopropylethylamine (80 mI, 460 mitioI) followed by 1- propanephosphonic anhydride in DMF (130 mI, 50 % solution in DMF, 230 pmol; CAS- RN: [68957-94-8]). The reaction mixture was stirred at RT for 16h. The crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 65 mg of the title compound (63% yield) after freeze drying of the pooled fractions as yellow lyophilisate. LC-MS (method 1): Rt = 1.02 min; MS (ESIpos): m/z = 897.6 [M+H]+
Ή-NMR (400 MHz, DMSO-d6) d [ppm]: 1.039 (3.03), 1.054 (2.98), 2.083 (0.41), 2.462 (0.80), 2.518 (1.04), 2.522 (0.93), 2.539 (16.00), 2.558 (0.65), 2.584 (0.93), 2.601 (2.20), 2.622 (4.18), 2.633 (3.93), 2.821 (0.50), 2.843 (0.65), 3.223 (0.92), 3.274 (0.93), 3.430 (0.44), 3.444 (1.13), 3.458 (1.29), 3.472 (0.98), 3.479 (1.05), 3.492 (4.10), 3.503 (1.38), 3.506 (1.38), 3.513 (1.77), 3.518 (2.38), 3.528 (2.29), 3.533 (1.51), 3.540 (1.01), 3.590 (10.81), 3.598 (4.01), 3.612 (2.61), 3.629 (2.15), 3.645 (0.98), 3.831 (8.02), 4.897 (0.42), 5.029 (0.48), 5.042 (0.62), 5.061 (0.49), 5.075 (0.52), 6.309 (0.72), 6.320 (0.69), 6.530 (3.08), 6.597 (0.77), 6.940 (1.66), 6.963 (1.69), 7.021 (1.72), 7.026 (2.79), 7.038 (1.53), 7.117 (1.19), 7.139 (1.30), 7.548 (0.82), 7.566 (0.88), 7.569 (0.86), 7.591 (2.21), 7.614 (1.82), 11.102 (1.50).
Example 11
(4S)-1-(4-{[2-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H- isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)ethyl]carbamoyl}phenyl)-7,8-dimethoxy-
N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000074_0001
To a solution of 4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1-yl]benzoic acid (100 mg, 237 mitioI, synthesis described in WO20 16062688, example 1.2 A) and 4-[(2-{2-[2-(2-aminoethoxy)ethoxy]ethoxy}ethyl)amino]- 2-[(3S)-2,6-dioxopiperidin-3-yl]-1 H-isoindole-1 ,3(2H)-dione trifluoroacetate (133 mg, 237 pmol, intermediate 3.18) in DMF (1.2 ml_, 16 mmol) was added N,N-diisopropylethylamine (160 mI, 950 mitioI) followed by 1-propanephosphonic anhydride in DMF (280 mI, 50 % solution in DMF, 470 mitioI; CAS-RN:[68957-94-8]). The reaction mixture was stirred at RT for 16h. The crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 32 mg of the title compound (16% yield) after freeze drying of the pooled fractions as yellow lyophilisate.
LC-MS (method 1): Rt = 1.0 min; MS (ESIpos): m/z = 828.5 [M+H]+ 1H-NMR (400 MHz, CHLOROFORM-d) delta [ppm]: 0.850 (0.62), 0.866 (0.46), 0.960 (4.89), 0.976 (4.91), 1.261 (0.86), 1.595 (16.00), 2.102 (0.72), 2.114 (0.46), 2.133 (0.46), 2.182 (4.61), 2.706 (0.48), 2.717 (0.49), 2.736 (0.51), 2.744 (1.08), 2.754 (0.66), 2.760 (0.81), 2.764 (0.57), 2.844 (0.70), 2.861 (1.18), 2.881 (1.19), 2.888 (6.42), 2.900 (6.63), 3.127 (0.77), 3.132 (0.80), 3.164 (0.62), 3.169 (0.61), 3.424 (0.62), 3.437 (1.73), 3.450 (1.96), 3.464 (0.79), 3.635 (9.86), 3.653 (0.54), 3.675 (3.38), 3.692 (15.30), 3.703 (7.79), 3.712 (2.22), 3.943 (12.40), 4.867 (0.41), 4.891 (0.58), 4.897 (0.63), 5.309 (2.21), 5.470 (0.42), 5.476 (0.46), 5.487 (0.66), 5.492 (0.68), 5.503 (0.44), 5.509 (0.42), 6.472 (0.45), 6.485 (0.86), 6.499 (0.43), 6.533 (4.36), 6.573 (0.78), 6.585 (0.77), 6.719 (3.56), 6.850 (0.73), 6.877 (1.79), 6.898 (1.88), 7.006 (0.42), 7.091 (1.89), 7.109 (2.08), 7.462 (1.16), 7.481 (1.21), 7.483 (1.21), 7.502 (1.01), 7.521 (3.16), 7.525 (1.07), 7.528 (0.66), 7.537 (1.10), 7.542 (3.60), 7.811 (3.50), 7.832 (2.96), 8.302 (0.82).
Example 12
(4S)-1-[4-({4-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}oxy)acetamido]butyl}carbamoyl)phenyl]-7,8-dimethoxy-N,4-dimethyl-4, 5-dihydro- 3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000075_0001
To a solution of 4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1-yl]benzoic acid (100 mg, 237 pmol, synthesis described in WO20 16062688, example 1.2A) and N-(4-aminobutyl)-2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]- 1 ,3-dioxo-2,3-dihydro-1 H-isoindol-4-yl}oxy)acetamide trifluoroacetate (122 mg, 237 pmol, CAS 1799711-25-3) in DMF (1.2 ml_, 16 mmol) was added N,N-diisopropylethylamine (160 pi, 950 pmol) followed by 1-propanephosphonic anhydride in DMF (280 pi, 50 % solution in DMF, 470 pmol; CAS-RN:[68957-94-8]). The reaction mixture was stirred at RT for 16h. The crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 33 mg of the title compound (16% yield) after freeze drying of the pooled fractions as lyophilisate. LC-MS (method 1): Rt = 0.90 min; MS (ESIpos): m/z = 782 [M+H]+
Ή-NMR (400 MHz, CHLOROFORM-d) d [ppm]: 0.967 (1.90), 0.970 (2.01), 0.983 (1.96), 0.986 (1.97), 1.282 (16.00), 1.588 (1.66), 1.766 (1.34), 2.866 (2.07), 2.878 (2.27), 2.883 (2.48), 2.895 (1.93), 3.626 (7.42), 3.938 (4.18), 3.942 (4.35), 4.655 (0.84), 4.685 (1.42), 6.505 (2.31), 6.715 (1.21), 6.720 (1.25), 7.508 (1.18), 7.511 (1.32), 7.529 (1.66), 7.532 (1.40), 7.571 (0.99), 7.780 (2.16), 7.801 (1.74).
Example 13
(4S)-1-(4-{[14-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-3,6,9,12-tetraoxatetradecan-1-yl]carbamoyl}phenyl)-7,8-dimethoxy-N,4- dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000076_0001
To a solution of 4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1-yl]benzoic acid (100 mg, 237 pmol) and 4-[(14-amino-3,6,9,12- tetraoxatetradecan-1-yl)amino]-2-[(3S)-2,6-dioxopiperidin-3-yl]-1H-isoindole-1 ,3(2H)-dione trifluoroacetate (143 mg, 237 pmol, intermediate 3.20) in DMF (1.2 ml_, 16 mmol) was added
N,N-diisopropylethylamine (160 mI, 950 pmol) followed by 1-propanephosphonic anhydride in DMF (280 mI, 50 % solution in DMF, 470 mmol; CAS-RN:[68957-94-8]). The reaction mixture was stirred at RT for 16h. The crude reaction mixture was filtered and purified by prep reversed phase HPLC (acidic conditions) to give 37 mg of the title compound (16% yield) after freeze drying of the pooled fractions as yellow lyophilisate.
LC-MS (method 1): Rt = 1.01 min; MS (ESIpos): m/z = 872 [M+H]+
Ή-NMR (400 MHz, CHLOROFORM-d) d [ppm]: 0.962 (3.53), 0.966 (3.56), 0.978 (3.58),
O.983 (3.44), 1.650 (2.05), 2.729 (1.44), 2.847 (0.98), 2.855 (0.92), 2.864 (1.00), 2.869 (0.85), 2.883 (5.05), 2.888 (5.56), 2.896 (5.30), 2.900 (4.87), 3.127 (0.97), 3.132 (1.00),
3.163 (0.78), 3.401 (1.31), 3.415 (1.89), 3.426 (1.45), 3.616 (1.60), 3.623 (9.48), 3.626 (5.05), 3.633 (11.54), 3.637 (5.28), 3.642 (2.93), 3.646 (4.53), 3.652 (2.40), 3.660 (9.20), 3.663 (5.73), 3.675 (16.00), 3.678 (7.55), 3.687 (6.13), 3.692 (7.43), 3.699 (4.23), 3.702 (4.02), 3.711 (4.35), 3.718 (2.20), 3.722 (2.39), 3.945 (9.69), 3.948 (9.31), 4.861 (0.80), 4.874 (0.69), 4.891 (1.11), 5.496 (0.77), 6.512 (1.02), 6.530 (5.06), 6.723 (4.54), 6.849 (1.04), 6.865 (1.19), 6.871 (1.19), 6.887 (1.11), 7.085 (1.56), 7.094 (1.75), 7.102 (1.66), 7.111 (1.61), 7.458 (1.28), 7.476 (1.43), 7.479 (1.41), 7.497 (1.23), 7.505 (2.30), 7.511 (2.41), 7.521 (0.89), 7.526 (2.70), 7.529 (1.78), 7.532 (2.40), 7.829 (2.22), 7.836 (2.39), 7.851 (2.05), 7.858 (1.88).
Example 14
(4S)-1-(4-{4-[3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H- isoindol-5-yl}amino)ethoxy]ethoxy}ethoxy)propanoyl]piperazin-1-yl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000077_0001
To a solution of (4S)-7,8-Dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4,5-dihydro- 3H-2,3-benzodiazepin-3-carboxamid (intermediate 1.1, 50.0 mg, 114 mitioI) and 3-(2-{2-[2- ({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-5- yl}amino)ethoxy]ethoxy}ethoxy)propanoic acid (intermediate 3.23, 65.5 mg, 137 pmol) in DMF (1 ml_) was added N,N-Diisopropylethylamin (200 mI, 1.1 mmol; CAS-RN: [7087-68-5]) followed by HATU: (65.2 mg, 171 mitioI; CAS- R N : [148893- 10- 1 ]) . The reaction mixture was stirred at room temperature for 16 h. DMSO (1 ml_) was added to the reaction mixture and the crude product was purified by prep reversed phase HPLC (acidic conditions) to yield 72.5 mg (67%) of the title compound.
LC-MS (method 1): Rt = 0.98 min; MS (ESIpos): m/z = 897.4 [M+H]+
1H-NMR (400 MHz, DMSO-d6) d [ppm]: 1.006 (0.29), 1.023 (0.20), 1.033 (0.75), 1.041 (2.97), 1.050 (1.09), 1.056 (2.92), 1.096 (0.71), 1.113 (0.61), 1.241 (0.18), 1.969 (0.29), 1.982 (0.31), 1.995 (0.34), 2.001 (0.31), 2.077 (0.16), 2.431 (0.32), 2.459 (0.57), 2.466 (0.55), 2.521 (1.36), 2.525 (1.22), 2.542 (1.97), 2.592 (1.03), 2.608 (1.72), 2.624 (4.46), 2.635 (3.87), 2.731 (0.23), 2.811 (0.34), 2.823 (0.59), 2.836 (0.36), 2.844 (0.46), 2.858 (0.50), 2.878 (0.25), 2.890 (0.33), 2.901 (0.16), 3.225 (0.82), 3.280 (0.82), 3.353 (1.23), 3.366 (0.58), 3.492 (7.30), 3.511 (0.92), 3.522 (3.36), 3.525 (3.46), 3.536 (1.00), 3.543 (0.58), 3.565 (1.11), 3.578 (2.18), 3.594 (10.50), 3.619 (1.56), 3.636 (2.03), 3.652 (0.93), 3.834 (8.00), 4.870 (0.24), 4.885 (0.37), 4.899 (0.38), 4.912 (0.34), 4.926 (0.23), 5.004 (0.47), 5.018 (0.61), 5.036 (0.47), 5.049 (0.52), 6.299 (0.20), 6.310 (0.66), 6.322 (0.65), 6.534 (3.11), 6.872 (0.64), 6.878 (0.68), 6.893 (0.67), 6.898 (0.72), 6.944 (1.61), 6.967 (1.64), 6.999 (1.23), 7.004 (1.27), 7.029 (2.63), 7.146 (0.36), 7.160 (0.79), 7.173 (0.40), 7.541 (1.37), 7.550 (0.25), 7.562 (1.26), 7.571 (0.22), 7.596 (2.03), 7.618 (1.78), 11.067 (1.67).
Example 15
(4S)-1-(4-{4-[15-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-5- yl}amino)-4,7,10,13-tetraoxapentadecan-1-oyl]piperazin-1-yl}phenyl)-7,8-dimethoxy-
N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
Figure imgf000078_0001
To a solution of (4S)-7,8-Dimethoxy-N,4-dimethyl-1-[4-(piperazin-1-yl)phenyl]-4,5-dihydro-
3H-2,3-benzodiazepin-3-carboxamide (intermediate 1.1 , 50.0 mg, 114 pmol) and 1-({2- [(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1H-isoindol-5-yl}amino)-3,6,9,12- tetraoxapentadecan-15-oic acid (intermediate 3.24, 71.5 mg, 137 pmol) in DMF (1 ml_) was added N,N-Diisopropylethylamin (200 mI, 1.1 mmol; CAS- R N : [7087-68-5]) followed by HATU: (65.2 mg, 171 pmol; CAS- R N : [ 148893- 10- 1 ]) . The reaction mixture was stirred at room temperature for 16 h. DMSO (1 ml_) was added to the reaction mixture and the crude product was purified by prep reversed phase HPLC (acidic conditions) to yield 27.1 mg (22%) of the title compound.
LC-MS (method 1): Rt = 0.98 min; MS (ESIpos): m/z = 941.5 [M+H]+ 1H-NMR (400 MHz, DMSO-d6) d [ppm]: 1.007 (0.18), 1.042 (3.30), 1.058 (3.36), 1.100 (0.39), 1.117 (0.32), 1.241 (0.26), 1.970 (0.29), 1.983 (0.31), 1.989 (0.27), 1.996 (0.33), 2.001 (0.31), 2.009 (0.22), 2.324 (0.26), 2.329 (0.39), 2.334 (0.28), 2.410 (0.22), 2.426 (0.60), 2.429 (0.45), 2.442 (0.31), 2.460 (0.61), 2.466 (0.58), 2.520 (2.06), 2.525 (1.59), 2.542 (1.38), 2.596 (1.08), 2.614 (2.01), 2.623 (3.69), 2.634 (3.75), 2.662 (0.19), 2.667 (0.33), 2.671 (0.44), 2.676 (0.33), 2.731 (0.17), 2.812 (0.39), 2.825 (0.65), 2.837 (0.38), 2.846 (0.50), 2.859 (0.54), 2.879 (0.24), 2.890 (0.25), 2.901 (0.17), 3.230 (0.96), 3.283 (0.98), 3.414 (0.98), 3.422 (0.75), 3.425 (0.73), 3.431 (0.46), 3.447 (1.25), 3.476 (11.58), 3.486 (12.82), 3.501 (0.92), 3.508 (1.16), 3.515 (1.61), 3.520 (2.40), 3.531 (2.59), 3.536 (1.93), 3.543 (1.38), 3.548 (0.90), 3.555 (0.77), 3.568 (1.47), 3.581 (2.66), 3.595 (12.36), 3.618 (2.31), 3.635 (2.52), 3.652 (1.23), 3.834 (8.98), 4.870 (0.28), 4.885 (0.42), 4.899 (0.44), 4.913 (0.39), 4.927 (0.27), 5.004 (0.47), 5.018 (0.61), 5.037 (0.48), 5.050 (0.52), 6.312 (0.54), 6.324 (0.55), 6.536 (3.50), 6.874 (0.64), 6.879 (0.69), 6.895 (0.65), 6.900 (0.73), 6.947 (1.82), 6.969 (1.98), 6.999 (1.23), 7.004 (1.20), 7.030 (3.00), 7.073 (0.27), 7.162 (0.45), 7.201 (0.21), 7.500 (0.26), 7.520 (0.24), 7.543 (1.39), 7.564 (1.29), 7.596 (2.25), 7.619 (1.99), 11.066 (1.55).
Example 16
N-(13-{4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1-yl]phenyl}-13-oxo-3,6,9-trioxa-12-azatridecanan-1-oyl)-3-methyl-L- valyl-(4R)-4-hydroxy-N-{[4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl}-L-prolinamide
Figure imgf000079_0001
To a solution of N-({2-[2-(2-aminoethoxy)ethoxy]ethoxy}acetyl)-3-methyl-L-valyl-(4R)-4- hy d roxy- N -{[4- (4- m ethy I - 1 ,3-thiazol-5-yl)phenyl]methyl}-L-prolinamide (intermediate 3.25, 50.0 mg, 80.7 pmol) and 4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4, 5-dihydro- 3H-2,3-benzodiazepin-1-yl]benzoic acid (intermediate 1.2, 41.7 mg, 105 pmol) in DMSO (2 mL) was added N,N-Diisopropylethylamin diisopropylethylamine (84 mI, 480 pmol; CAS- RN: [7087-68-5]) followed by HATU: (46 mg, 121 pmol; CAS-RN:[148893-10-1]). The reaction mixture was stirred at room temperature for 16 h. DMSO (1 mL) was added to the reaction mixture and the crude product was purified by prep reversed phase HPLC (acidic conditions) to yield 31.8 mg (36% yield) of the title compound.
LC-MS (method 1): Rt = 1.03 min; MS (ESIpos): m/z = 999.7 [M+H]+
Ή-NMR (500 MHz, DMSO-d6) d [ppm]: 0.910 (1.59), 0.933 (16.00), 0.939 (6.09), 0.953
(4.33), 1.895 (0.60), 2.433 (12.46), 2.443 (1.14), 2.514 (1.09), 2.518 (0.96), 2.522 (0.76), 2.676 (4.95), 2.685 (5.03), 2.709 (0.45), 2.727 (0.50), 2.738 (0.59), 2.756 (0.52), 2.937 (0.54), 2.945 (0.63), 2.966 (0.52), 2.974 (0.43), 3.413 (1.13), 3.425 (1.47), 3.436 (0.71), 3.510 (1.37), 3.522 (2.34), 3.531 (11.21), 3.551 (2.54), 3.558 (5.84), 3.568 (2.79), 3.573 (2.79), 3.582 (2.51), 3.590 (1.87), 3.611 (0.86), 3.647 (0.60), 3.655 (0.72), 3.669 (0.41), 3.832 (10.11), 3.948 (3.92), 4.226 (0.49), 4.237 (0.52), 4.257 (0.78), 4.269 (0.74), 4.344 (0.64), 4.358 (0.85), 4.372 (0.72), 4.390 (0.48), 4.403 (0.48), 4.419 (0.60), 4.435 (1.00), 4.452 (0.56), 4.550 (1.21), 4.569 (1.25), 5.127 (0.42), 5.153 (1.75), 5.159 (1.70), 6.475 (3.96), 6.673 (0.89), 6.682 (0.86), 7.018 (3.31), 7.389 (15.16), 7.420 (1.02), 7.428 (0.42), 7.439 (1.00), 7.685 (2.45), 7.702 (2.83), 7.862 (2.86), 7.879 (2.20), 8.595 (0.66), 8.603
(1.34), 8.616 (0.78), 8.971 (4.12).
Example 17
N-{[2-(2-{4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1-yl]benzamido}ethoxy)ethoxy]acetyl}-3-methyl-L-valyl-(4R)-4-hydroxy-
N-{[4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl}-L-prolinamide
Figure imgf000081_0001
To a solution of N-{[2-(2-aminoethoxy)ethoxy]acetyl}-3-methyl-L-valyl-(4R)-4-hydroxy-N-{[4-
(4-methyl-1 ,3-thiazol-5-yl)phenyl]methyl}-L-prolinamide (intermediate 3.26, 50.0 mg, 86.8 pmol) and 4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1-yl]benzoic acid (intermediate 1.2, 44.9 mg, 113 pmol) in DMSO (2 ml_) was added N,N-Diisopropylethylamin diisopropylethylamine (91 pi, 520 pmol; CAS- RN: [7087-68- 5]) followed by HATU: (49.5 mg, 113 pmol; CAS-RN:[148893-10-1]). The reaction mixture was stirred at room temperature for 16 h. DMSO (1 ml_) was added to the reaction mixture and the crude product was purified by prep reversed phase HPLC (acidic conditions) to yield 17.9 mg (19% yield) of the title compound.
LC-MS (method 1): Rt = 1.02 min; MS (ESIpos): m/z = 955.7 [M+H]+
Ή-NMR (400 MHz, DMSO-d6) d [ppm]: 0.917 (2.62), 0.931 (16.00), 0.937 (7.41), 0.953 (4.57), 1.895 (0.61), 2.057 (0.41), 2.323 (0.58), 2.327 (0.82), 2.332 (0.57), 2.426 (14.45), 2.445 (1.58), 2.518 (2.37), 2.523 (1.69), 2.539 (0.65), 2.672 (5.38), 2.678 (1.84), 2.684 (5.26), 2.703 (0.45), 2.725 (0.48), 2.739 (0.56), 2.761 (0.51), 2.935 (0.54), 2.944 (0.63), 2.971 (0.51), 2.980 (0.41), 3.453 (1.19), 3.468 (1.41), 3.482 (0.61), 3.528 (12.27), 3.568 (1.37), 3.583 (2.19), 3.591 (2.07), 3.600 (1.92), 3.608 (2.32), 3.615 (2.39), 3.627 (2.26), 3.646 (1.01), 3.656 (0.83), 3.832 (10.95), 3.926 (0.42), 3.965 (3.14), 4.213 (0.41), 4.227 (0.46), 4.252 (0.89), 4.266 (0.77), 4.331 (0.94), 4.345 (1.38), 4.369 (0.50), 4.385 (0.42), 4.425 (0.58), 4.444 (1.10), 4.466 (0.68), 4.559 (1.23), 4.583 (1.21), 5.128 (0.46), 5.162 (2.00), 5.171 (1.89), 6.478 (4.39), 6.675 (0.97), 6.687 (0.91), 7.019 (3.49), 7.381 (14.81), 7.403 (0.60), 7.430 (0.50), 7.444 (1.09), 7.468 (0.98), 7.679 (2.67), 7.700 (3.11), 7.853 (3.19), 7.874 (2.47), 8.572 (0.52), 8.587 (1.18), 8.605 (1.22), 8.619 (0.50), 8.956 (4.88), 8.986 (0.47). Example 18
N-(16-{4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1 -yl]phenyl}-16-oxo-3,6,9, 12-tetraoxa-15-azahexadecanan-1 -oyl)-3- methyl-L-valyl-(4R)-4-hydroxy-N-{[4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl}-L- prolinamide
Figure imgf000082_0001
To a solution of N-(14-amino-3,6,9,12-tetraoxatetradecanan-1-oyl)-3-methyl-L-valyl-(4R)-4- hy d roxy- N -{[4- (4- m ethy I - 1 ,3-thiazol-5-yl)phenyl]methyl}-L-prolinamide (intermediate 3.27, 50.0 mg, 75.3 pmol) and 4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-
3H-2,3-benzodiazepin-1-yl]benzoic acid (intermediate 1.2, 38.9 mg, 97.9 pmol) in DMSO (2 ml_) was added N,N-Diisopropylethylamin diisopropylethylamine (79 mI, 450 pmol; CAS- RN: [7087-68-5]) followed by HATU: (43 mg, 113 pmol; CAS-RN:[148893-10-1]). The reaction mixture was stirred at room temperature for 16 h. DMSO (1 ml_) was added to the reaction mixture and the crude product was purified by prep reversed phase HPLC (acidic conditions) to yield 52.8 mg (60% yield) of the title compound.
LC-MS (method 1): Rt = 1.04 min; MS (ESIpos): m/z = 1043.8 [M+H]+
Ή-NMR (500 MHz, DMSO-d6) d [ppm]: 0.912 (1.58), 0.934 (16.00), 0.941 (6.04), 0.954 (4.27), 1.894 (0.58), 2.434 (12.88), 2.445 (1.14), 2.514 (1.41), 2.518 (1.33), 2.522 (1.08),
2.676 (5.40), 2.685 (5.35), 2.707 (0.47), 2.726 (0.48), 2.736 (0.56), 2.754 (0.51), 2.938 (0.53), 2.946 (0.65), 2.966 (0.53), 2.974 (0.46), 3.404 (0.44), 3.416 (1.24), 3.428 (1.43), 3.439 (0.64), 3.486 (0.63), 3.501 (3.17), 3.506 (3.56), 3.514 (4.76), 3.525 (5.52), 3.532
(12.24), 3.548 (1.71), 3.556 (1.79), 3.560 (1.76), 3.580 (1.63), 3.585 (1.78), 3.590 (1.49), 3.610 (0.81), 3.647 (0.61), 3.654 (0.71), 3.667 (0.41), 3.832 (10.70), 3.952 (4.84), 4.223 (0.45), 4.235 (0.49), 4.255 (0.75), 4.266 (0.68), 4.344 (0.60), 4.366 (0.65), 4.379 (0.68), 4.398 (0.46), 4.411 (0.47), 4.417 (0.63), 4.434 (0.96), 4.450 (0.54), 4.549 (1.22), 4.568
(1.24), 5.118 (0.41), 5.127 (0.40), 5.151 (1.81), 5.158 (1.73), 6.475 (3.88), 6.668 (0.92),
6.677 (0.89), 7.018 (3.41), 7.372 (0.44), 7.390 (10.05), 7.403 (0.48), 7.412 (1.05), 7.431 (1.28), 7.690 (2.60), 7.707 (2.95), 7.868 (3.04), 7.885 (2.35), 8.590 (0.51), 8.602 (1.42), 8.614 (1.40), 8.624 (0.48), 8.976 (4.20).
EXPERIMENTAL SECTION - BIOLOGICAL ASSAYS
The pharmacological activity of the compounds according to the invention can be assessed using in vitro and/or in vivo assays, as known to the person skilled in the art. The following examples describe the biological activity of the compounds according to the invention, without the invention being limited to said examples.
Example compounds according to the invention were tested in selected biological assays one or more times. When tested more than once, data are reported as either average values or as median values, wherein
• the average value, also referred to as the arithmetic mean value, represents the sum of the values obtained divided by the number of times tested, and
• the median value represents the middle number of the group of values when ranked in ascending or descending order. If the number of values in the data set is odd, the median is the middle value. If the number of values in the data set is even, the median is the arithmetic mean of the two middle values.
Examples were synthesized one or more times. When synthesized more than once, data from biological assays represent average values or median values calculated utilizing data sets obtained from testing of one or more synthetic batch.
The in vitro activity of the compounds of the present invention can be demonstrated in the following assays:
1. BRD4 bromodomain interaction assay
The interaction between purified recombinant human BRD4 bromodomain 1 (BD1) and a synthetic, biotin-labelled acetylated peptide derived from histone H4 was determined using the TR-FRET technology. Assay components: 10 nM His-BRD4 (BD1), 50 nM biotin-histone H4 acetylated peptide (SGRGK(Ac)GGK(Ac)GLGK(Ac)GGAK(Ac)RHGSGSK-biotin), 2.5 nM SA-EU Chelate (PerkinElmer, Waltham, MA, USA) and 10 nM Anti-6His-XL665 (Cisbio, Codolet, France). Assay buffer: 50 mM Hepes pH 7.5, 50 mM NaCI, 50 mM KF, 0.25 mM Chaps, 0.05 % BSA. Assay volume: 5 pi. Incubation time / temperature: overnight / 4 °C.
The interaction between purified recombinant human BRD4 bromodomain 2 (BD2) and a synthetic, biotin-labelled acetylated peptide derived from histone H4 was determined using the TR-FRET technology. Assay components: 100 nM His-BRD4 (BD2), 50 nM biotin- histone H4 acetylated peptide
(SGRGK(Ac)GGK(Ac)GLGK(Ac)GGAK(Ac)RHRKVLRDNGSGSK-Biotin), 2.5 nM Lance- Eu- W1024 chelate (PerkinElmer) and 50 nM Anti-6His-XL665 (Cisbio). Assay buffer: 50 mM Hepes pH 7.5, 50 mM NaCI, 50 mM KF, 0.25 mM Chaps, 0.05 % BSA. Assay volume: 5 pi. Incubation time / temperature: overnight / 4 °C.
The reactions were performed in a volume of 5 pL in 384-well black microtiter plates and the measurements done with a PHERAstar reader (BMG Labtech, Ortenberg, Germany) using the HTRF module (excitation: 10 flashes at 320 nm; emission: 615 and 665 nm).
Table 1: HTRF assay results
Figure imgf000084_0001
2. Quantification of degradation of fluorescently labelled BRD4 in HEK293 cells
HEK293 cells stably expressing N-terminal fluorescently tagged BRD4 variants were generated by stable integration of expression constructs into HEK293 wild-type cells. PROTAC-mediated degradation was measured by quantification of the tagGFP2-BRD4 fluorescence intensity after 24h compound treatment. For this, human embryonic kidney HEK293 cells (DSMZ ACC 305) stably expressing tagGFP2-BRD4 were seeded in 20 pi into 384- well microtiter plates (8000 cells per well) containing 200 nl_ of compounds in Dose- Response. Control wells received DMSO. Plates were then incubated for 24h at 37 °C in a humidified incubator and fixed with 1% PFA for 30 min. Cells were then stained with Hoechst 33342 (Life Technologies, Carlsbad, CA, USA; H-1399, 0.1pg/mL) and imaged on an automated confocal microscopy system (e.g. Opera Phenix, Perkin Elmer). Nuclear and cytoplasmic intensity of the tagGFP2 fluorescence signal was determined by automated image analysis using custom generated scripts (MetaXpress). Data were then transferred to Genedata Screener software, normalized to DMSO and DCso values (half-maximal concentration to achieve maximal reduction of tagGFP staining intensity of the tagGFP2- BRD4 reporter fusion proteins relative to DMSO) are reported.
Table 2: Quantification of degradation of fluorescently labelled BRD4 in HEK293 cells
Figure imgf000085_0001
3. Real-time quantitative PCR
For real-time quantitative PCR, K562 myelogenous leukemia suspension cells (ATCC CCL- 243) were seeded in IMDM + 10% charcoal-treated fetal bovine serum, followed by 6-hour or 24-hour treatment with 500 nM of compounds (end concentration) at 37 °C, 5% CO2 and 95% humidity. After incubation, cell lysis and RNA isolation were performed with the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), cDNA Synthesis with the Superscript™ III First- Strand Synthesis SuperMix for qRT-PCR (Invitrogen, Carlsbad, CA, USA). For real-time quantitative PCR, the TaqMan® Fast Advanced Master Mix, #4444557 (Thermo Fisher Scientific, Waltham, MA, USA) with 15 ng cDNA per well was used in triplicates in a 384-well plate, analyzed with 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). To compare changes in gene expression level, cyclophilin A transcript levels were measured as housekeeping gene for normalization purposes. The following TaqMan probes were used: Hs00153408_m1 (c-Myc), Hs00958474_m1 (IKZF1) and 4326316E (cyclophilin A) (all from Thermo Fisher Scientific).
Table 3: Quantification of target gene expression
Figure imgf000086_0001
4. Endogenous BRD4 protein degradation assay (Western blot analysis)
CA-46 Burkitt’s lymphoma cells (ATCC CRL-1648) were plated in RPMI-1640 with phenol red + 10 % FBS in a 12-well cell culture plate. After one day, cells were treated with different concentrations of compounds. 24 hours later, cells were harvested in 1x RIPA buffer (Thermo Fisher Scientific) with Benzonase (Merck Millipore, Burlington, MA, USA) and 1x Complete protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO, USA). Lysates were run on a NuPAGE 7% tris-acetate gel (Thermo Fisher Scientific) and transferred to a 0.2 pm nitrocellulose membrane using a Trans-Blot Turbo Transfer system (Bio-Rad Laboratories, Hercules, CA, USA). Blots were stained with anti-BRD4 antibody (Cell Signaling Technology, Danvers, MA, USA; #13440) and anti-c-Myc (D84C12) antibody (Cell Signaling Technology, Danvers, MA, USA; #5605). b-actin was used as loading control (Proteintech Group, Rosemont, IL, USA; 60008-1). DC50 and Dmax values were calculated with the GraphPad Prism software (San Diego, CA, USA). Figure 1: Degradation of endogenous BRD4 in CA-46 cells
Compound 3
Figure imgf000087_0001
Table 4: Quantification of degradation of endogenous BRD4 in CA-46 cells
Figure imgf000087_0002
5. Proliferation assays
CA46 cells - 2 days
CA46 Burkitt’s lymphoma cells were plated in RPMI-1640 with phenol red + 10 % FBS at 2.7 x 105 cells/well in a 96-well microti ter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by CellTiter Glo (Promega, Mannheim, Germany) staining at day 0 and day 2. Luminescence was measured with the Tecan (Mannedorf, Switzerland) Spark plate reader (0.2 sec/well). IC50 values were calculated with the GraphPad Prism software.
CA46 cells - 8 days
CA46 Burkitt’s lymphoma cells were plated in RPMI-1640 with phenol red + 10 % FBS at 5.0 x 103 cells/well in a 96-well microti ter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by CellTiter Glo (Promega) staining at day 0 and day 8. Luminescence was measured with the Tecan Spark plate reader (0.2 sec/well). IC50 values were calculated with the GraphPad Prism software.
VCaP cells - 2 days VCaP human prostate tumor cells were plated in DMEM with phenol red + 10 % FBS at 2.7 x 105 cells/well in a 96-well microti ter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by CellTiter Glo (Promega) staining at day 0 and day 2. Luminescence was measured with the Tecan Spark plate reader (0.2 sec/well). IC50 values were calculated with the GraphPad Prism software.
VCaP cells - 8 days
VCaP human prostate tumor cells were plated in DMEM with phenol red + 10 % FBS at 4.0 x 104 cells/well in a 96-well microti ter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by CellTiter Glo (Promega) staining at day 0 and day 8. Luminescence was measured with the Tecan Spark plate reader (0.2 sec/well). IC50 values were calculated with the GraphPad Prism software.
DU-145 cells - 5 days
DU-145 human prostate tumor cells were plated in DMEM /Ham’s F12 with phenol red + 10 % FBS at 2.0 x 103 cells/well in a 96-well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by alamarBlue (Thermo Fisher Scientific) staining at day 0 and day 5. Absorbance was measured with the Tecan Spark plate reader. IC50 values were calculated with the GraphPad Prism software.
DV-90 cells - 5 days
DV-90 lung carcinoma cells were plated in RPMI-1640 with phenol red + 10 % FBS at 8.0 x 103 cells/well in a 96- well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by alamarBlue (Thermo Fisher Scientific) staining at day 0 and day 5. Absorbance was measured with the Tecan Spark plate reader. IC50 values were calculated with the GraphPad Prism software.
NCI-H2030 cells - 5 days
NCI-H2030 lung carcinoma cells were plated in RPMI-1640 with phenol red + 10 % FBS at 1.0 x 103 cells/well in a 96- well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by alamarBlue (Thermo Fisher Scientific) staining at day 0 and day 5. Absorbance was measured with the Tecan Spark plate reader. IC50 values were calculated with the GraphPad Prism software.
HS-852.T cells - 5 days HS-852.T melanoma cells were plated in DMEM with phenol red + 10 % FBS at 8.0 x 103 cells/well in a 96- well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by alamarBlue (Thermo Fisher Scientific) staining at day 0 and day 5. Absorbance was measured with the Tecan Spark plate reader. IC50 values were calculated with the GraphPad Prism software.
SK-MEL-2 cells - 3 days
SK-MEL-2 melanoma cells were plated in MEM Earle's with phenol red + 10 % FBS at 1.0 x 103 cells/well in a 96- well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by CellTiter Glo (Promega) staining at day 0 and day 3. Luminescence was measured with the Tecan Spark plate reader (0.2 sec/well). IC50 values (inhibitory concentration at 50% of maximal effect) were determined by means of a 4-parameter fit on measurement data which were normalized to vehicle (DMSO) treated cells (=100%) and measurement readings taken immediately before compound exposure (=0%).
SK-MEL-2 cells - 5 days
SK-MEL-2 melanoma cells were plated in MEM Earle's with phenol red + 10 % FBS at 8.0 x 103 cells/well in a 96- well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by alamarBlue (Thermo Fisher Scientific) staining at day 0 and day 5. Absorbance was measured with the Tecan Spark plate reader. IC50 values were calculated with the GraphPad Prism software.
CHL-1 cells - 3 days
CHL-1 melanoma cells were plated in DMEM with phenol red + 10 % FBS at 5.0 x 102 cells/well in a 96- well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by CellTiter Glo (Promega) staining at day 0 and day 3. Luminescence was measured with the Tecan Spark plate reader (0.2 sec/well). IC50 values (inhibitory concentration at 50% of maximal effect) were determined by means of a 4-parameter fit on measurement data which were normalized to vehicle (DMSO) treated cells (=100%) and measurement readings taken immediately before compound exposure (=0%).
CHL-1 cells - 5 days
CHL-1 melanoma cells were plated in DMEM with phenol red + 10 % FBS at 1.0 x 103 cells/well in a 96- well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by alamarBlue (Thermo Fisher Scientific) staining at day 0 and day 5. Absorbance was measured with the Tecan Spark plate reader. IC50 values were calculated with the GraphPad Prism software.
LOX-IMVI cells - 3 days
LOX-IMVI melanoma cells were plated in RPMI-1640 with phenol red + 10 % FBS at 5.0 x 102 cells/well in a 96- well microtiter plate. After one day, cells were treated with different concentrations of compounds (day 0). Cell number was determined by CellTiter Glo (Promega) staining at day 0 and day 3. Luminescence was measured with the Tecan Spark plate reader (0.2 sec/well). IC50 values (inhibitory concentration at 50% of maximal effect) were determined by means of a 4-parameter fit on measurement data which were normalized to vehicle (DMSO) treated cells (=100%) and measurement readings taken immediately before compound exposure (=0%).
Table 5: Cell lines used for proliferation experiments
Figure imgf000090_0001
Table 6: Inhibition of cell proliferation
Figure imgf000091_0001
Figure imgf000091_0002
Figure imgf000091_0003
6. Cellular ternary complex formation assay CRBN - BRD4
Cellular ternary complex formation of BRD4 and CRBN was assessed in HEK293 cells ectopically expressing NanoLuc-BRD4 and HaloTag-CRBN using an adapted version of the NanoBRET kit for BRD4 and CRBN ternary complex formation (Promega). Serial dilutions of test compounds were prepared in 100% DMSO using a Precision Pipetting System (BioTek, Winooski, VT, USA). For preparation of test compound dilutions in assay plates, the 100- fold concentrated solution of the test compound (50 nl_) in DMSO was transferred to white microtiter test plates (384- well, Corning, NY, USA) using a Hummingbird liquid handler (Digilab, MA, USA). Plates were sealed with adhesive foil and stored at -20 °C until use. Cells, which were transfected on the day before with NanoLuc-BRD4 and HaloTag-CRBN, were diluted in Opti-MEM without phenol red and 4% FBS, adjusted to 1 x 106 cells/ ml_ and pretreated with the proteasome inhibitor MG-132 at a final concentration of 10 mM for 30 min. Pretreated cells were plated in white 384-well assay plates containing the test compounds (4000 cells/ well) with the addition of Ligand 618 (Promega) at a final concentration of 100 nM. Plates were incubated for 1h at 37 °C, 5% CO2. Immediately prior to BRET measurements, NanoBRET Nano-Glo substrate was prepared in Opti-MEM without phenol red (10 mM final concentration) and added at a final concentration of 13.5 mM. Donor emission (450 nm) and acceptor emission (610 nm or 630 nm) were recorded after 3 min of substrate addition with a PHERAstar reader (BMG Labtech) using a NanoBRET module (Luminescence Module 450-610). The ratio of the emissions at 610 nm and 450 nm was used as the specific signal for further evaluation. The data were normalized using the controls: No Tracer = 100% displacement, control wells with tracer = 0% displacement. Compounds were tested in duplicates at up to 11 concentrations (e.g. 20 mM, 5.7 mM, 1.6 mM, 0.47 mM, 0.13 mM, 38 hM, 11 hM, 3.1 hM, 0.89 hM, 0.25 hM and 0.073 hM). EC50 values were calculated using a four-parameter fit, with a commercial software package (Genedata Screener, Basel, Switzerland).
Table 7: CRBN BRD4 cell ternary complex formation assay
Figure imgf000093_0001
7. CRBN engagement/ cell permeability assay
Target engagement to CRBN was measured in live cells (live mode) compared to lytic cells (perm mode) using the In-cell CRBN Kit (Promega) to assess E3 target engagement as well as cell permeability. Serial dilutions of test compounds were prepared in 100% DMSO using a Precision Pipetting System (BioTek). For preparation of test compound dilutions in assay plates, the 100-fold concentrated solution of the test compound (50 nl_) in DMSO was transferred to non-binding microtiter test plates (384- well, Corning, USA) using a Hummingbird liquid handler (Digilab). Plates were sealed with adhesive foil and stored at - 20 °C until use. Cells overexpressing NanoLuc-CRBN (3000 cells/well) were diluted in Opti- MEM without phenol red and plated in white 384- well non-binding assay plates containing the test compounds. For the perm mode, cells were lyzed with digitonin (SigmaAldrich) at a final concentration of 0.05 mg/mL. CRBN tracer (0.5 mM final concentration for live mode; 1 mM final concentration for perm mode) were added. The perm mode assays were incubated for 30 min at RT while the live mode assays were incubated for 2h at 37 °C, 5% CO2. Immediately prior to BRET measurements, NanoBRET NanoGlo substrate was prepared in Opti-MEM without phenol red (10 mM final concentration), additionally for the live mode the NanoGlo extracellular inhibitor was added at a final concentration of 20 mM (Promega). Donor emission (450 nm) and acceptor emission (610 nm or 630 nm) were recorded after 3 min of substrate addition with a PHERAstar reader (BMG Labtech) using a NanoBRET module (Luminescence Module 450-610). The ratio of the emissions at 610 nm and 450 nm was used as the specific signal for further evaluation. The data were normalized using the controls: No Tracer = 100% displacement, control wells with tracer = 0% displacement. Compounds were tested in duplicates at up to 11 concentrations (e.g. 20 mM, 5.7 pM, 1.6 pM, 0.47 pM, 0.13 pM, 38 nM, 11 nM, 3.1 nM, 0.89 nM, 0.25 nM and 0.073 nM). ECso values were calculated using a four-parameter fit, with a commercial software package (Genedata Screener).
Table 8: CRBN engagement/cell permeability assay
Figure imgf000094_0001
8. Split NanoLUC degradation assay
8.1 Generation of endogenously tagged HiBiT-BRD4 cells
To generate N-terminally HiBiT-tagged BRD4 in HEK293 cells, BRD4 crRNA (Integrated DNA Technologies, Coralville, IA, USA), tracerRNA (Integrated DNA Technologies) and the single-stranded Ultramer DNA Oligonucleotide template (Integrated DNA Technologies) were diluted to 100 mM in 10 mM Tris, 0.1 mM EDTA. A 24 mM stock of tracrRNA:crRNA duplex was prepared by boiling at 95 °C for 5 min and then cooling down on the bench. Per electroporation reaction a ribonucleoprotein (RNP) complex was formed by incubating 100 pmol Cas9 and 120 pmol tracrRNA:crRNA for 20 min at ambient temperature. HEK293 cells (2 x 105 cells per reaction) were resuspended in 20 pL 4D Nucleofector solution (Lonza, Basel Switzerland). The RNP complex and 100 pmol donor template were electroporated with the 4D Nucleofector System (Lonza) using the program CM-130. Following electroporation pre-warmed growth medium was added and cells were incubated for 30 min at 37 °C, 5% CO2 before plating them on a 24-well plate. After 3-5 days post-electroporation, cells were analyzed for insertion of the HiBiT tag using the NanoGlo HiBiT Lytic Detection System (Promega) according to the manufacturer’s protocol. Briefly, edited CRISPR cells and parental cells were adjusted to 1 x 106 cells/mL. 50 pL were transferred to a white 96- well plate and Glo HiBiT Lytic Reagent (Promega), consisting of Nano-Glo HiBiT Lytic Buffer, Nano-Glo HiBiT Lytic Substrate, and LgBiT Protein was added according to the manufacturer’s protocol (Promega). Cells were incubated for 20 min at room temperature with shaking. Afterwards luminescence was measured using a PHERAstar reader (BMG Labtech).
Sequences: crRNA_BRD4 tgggatcactagcatgtctg ssODN_BRD4 (single-stranded Ultramer DNA Oligonucleotide template) catctgctgactgatatctcacgggggctcttctcttcctttgtagagtgcctggtgaagaatgtgatgggatcactagcatgGTGA
GCGGCTGGCGGCTGTTCAAGAAGATTAGCtctgcggagagcggccctgggacgagattgagaaatctgcc agtaatgggggatggactagaaacttcccaaatgtctac
8.2 HiBiT-BRD4 lytic degradation assay
To assess BRD4 degradation, serial dilutions of test compounds were prepared in 100% DMSO using a Precision Pipetting System (BioTek) e.g. 20 pM, 5.7 pM, 1.6 pM, 0.47 pM, 0.13 pM, 38 nM, 11 nM, 3.1 nM, 0.89 nM, 0.25 nM and 0.073 nM. For preparation of test compound dilutions in assay plates, the 100-fold concentrated solution of the test compound (200 nL) in DMSO was transferred to white HV microti ter test plates (384-well, Corning) using a Hummingbird liquid handler (Digilab). Plates were sealed with adhesive foil and stored at -20 °C until use. Edited cells were diluted to 6 c 105 cells/mL in growth medium. As a control unedited cells were added to one row on the plate to assess the background signal. 20 pL of cell suspension were added per well and incubated with compounds for 4h, 6h, or 24h. After the indicated amount of time Glo HiBiT Lytic Reagent (N3030; Promega), consisting of Nano-Glo HiBiT Lytic Buffer, Nano-Glo HiBiT Lytic Substrate, and LgBiT Protein, were added according to the manufacturer’s protocol (Promega), and cells were incubated for 20 min at room temperature with shaking. Afterwards luminescence was measured using a PHERAstar reader (BMG Labtech).
Table 9: HiBiT-BRD4 lytic degradation assay
Figure imgf000096_0001
8.3 HiBiT-BRD4 kinetic degradation assay
To assess the degradation of BRD4 in a live kinetic measurement HiBiT-BRD4 HEK293 cells were transfected with a plasmid encoding the LgBiT part of the Nanoluc (Promega) using Fugene HD (Promega). After 20h the transfected and edited cells were diluted to 3 c 105 cel I s/m L in growth medium. As a control unedited cells were added to one row on the plate to assess the background signal. 20 pL of cells were plated on white HV 384-well microtiter plates (Corning). On the next day medium was changed to C02-independent medium (Thermo Fisher Scientific) containing 20 pM NanoGlo Endurazine substrate (Promega). After 2.5 h a serial dilution of test compound was added (e.g. 20 pM, 5.7 pM, 1.6 pM, 0.47 pM, 0.13 pM, 38 nM, 11 nM, 3.1 nM, 0.89 nM, 0.25 nM and 0.073 nM). Plates were sealed with a clear foil and read every 5 min for 24h at 37 °C using a PHERAstar reader (BMG Labtech).
Table 10: HiBiT-BRD4 kinetic degradation assay
Figure imgf000097_0001

Claims

1. A compound of general formula (I):
Figure imgf000098_0001
in which:
R1 represents cyclopropyl, -(CrC2)-alkyl, m ethoxy or methylamino, A represents a group from:
Figure imgf000098_0002
wherein ** represents the connection point to Ri_,
Ri_ is a (C1-C20) alkyl chain, in which one or more carbon atom can be optionally replaced by -0-, or -N(RLI)- or -C(O)-, or by a 4, 5 or 6 membered carbocyclic or heterocyclic ring, excluding combinations such as, -0-0-, - N(RU)-N(RLI)-, -C(0)-C(0)-, -N(RLI)-0-, -C(0)-0-C(0), and in which Ru is hydrogen or-(Ci-C6)-alkyl
E3 LB represents a group selected from:
Figure imgf000099_0001
wherein *** indicates the point of attachment of a group with Ri_; and stereoisomers, tautomers, N-oxides, hydrates, solvates, and salts thereof, and mixtures of the same.
2. A compound of general formula (la) according to formula (I) of claim 1 :
Figure imgf000099_0002
in which:
R1 represents cyclopropyl, -(CrC2)-alkyl, m ethoxy or methylamino,
Ri_ is a (C1-C20) alkyl chain, in which one or more carbon atom can be optionally replaced by -0-, or -N(RLI)- or -C(O)-, or by a 4, 5 or 6 membered carbocyclic or heterocyclic ring, excluding combinations such as, -0-0-, - N(RU)-N(RLI)-, -C(0)-C(0)-, -N(RLI)-0-, -C(0)-0-C(0), and in which Ru is hydrogen or-(Ci-C6)-alkyl
E3 LB represents a group selected from:
Figure imgf000100_0001
wherein *** indicates the point of attachment of a group with RL; and stereoisomers, tautomers, N-oxides, hydrates, solvates, and salts thereof, and mixtures of the same.
3. A compound of general formula (lb) according to formula (I) of claim 1:
Figure imgf000100_0002
in which:
R1 represents cyclopropyl, -(CrC2)-alkyl, m ethoxy or methylamino,
Ri_ is a (C1-C20) alkyl chain, in which one or more carbon atom can be optionally replaced by -0-, or -N(RLI)- or -C(O)-, or by a 4, 5 or 6 membered carbocyclic or heterocyclic ring, excluding combinations such as, -0-0-, - N(RU)-N(RLI)-, -C(0)-C(0)-, -N(RLI)-0-, -C(0)-0-C(0), and in which Ru is hydrogen or-(Ci-C6)-alkyl,
E3 LB represents a group selected from:
Figure imgf000100_0003
wherein *** indicates the point of attachment of a group with Ri_; and stereoisomers, tautomers, N-oxides, hydrates, solvates, and salts thereof, and mixtures of the same.
4. A compound according to anyone of the previous claims characterized in that Ri_ is
Figure imgf000101_0001
wherein ** and *** indicate the point of attachment of a Ri_ group with the BET Binding Molecule and E3 LB respectively.
5. A compound according to anyone of the previous claims characterized in that Ri_ is
Figure imgf000101_0002
wherein ** and *** indicate the point of attachment of a Ri_ group with the BET Binding Molecule and E3 LB respectively.
6. A compound according to claim 1 of formula:
(4S)-1-(4-{4-[15-({2-[2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-4,7,10,13-tetraoxapentadecanan-1-oyl]piperazin-1-yl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
(4S)-1-(4-{4-[15-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-
4-yl}amino)-4,7,10,13-tetraoxapentadecanan-1-oyl]piperazin-1-yl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide,
(4S)-1-(4-{4-[3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H- isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)propanoyl]piperazin-1-yl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide,
(4S)-1-(4-{4-[3-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H- isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)propanoyl]piperazin-1-yl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
(4S)-1-(4-{4-[(2-{2-[2-({2-[2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1H-isoindol-
4-yl}amino)-2-oxoethoxy]ethoxy}ethoxy)acetyl]piperazin-1-yl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
(4S)-1-{4-[4-({2-[2-({2-[2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-2-oxoethoxy]ethoxy}acetyl)piperazin-1-yl]phenyl}-7,8-dimethoxy-N,4- dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
(4S)-1-[4-(4-{5-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H- isoindol-4-yl}oxy)acetamido]pentanoyl}piperazin-1-yl)phenyl]-7,8-dimethoxy-
N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide
(4S)-1-(4-{4-[14-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H- isoindol-4-yl}amino)-14-oxo-3,6,9,12-tetraoxatetradecanan-1-oyl]piperazin-1- yl}phenyl)-7,8-dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3- carboxamide
(4R)-1-(4-{4-[15-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H- isoindol-4-yl}amino)-4,7,10,13-tetraoxapentadecanan-1-oyl]piperazin-1- yl}phenyl)-7,8-dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3- carboxamide
(4R)-1-(4-{4-[3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H- isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)propanoyl]piperazin-1-yl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide (4S)-1-(4-{[2-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1H- isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)ethyl]carbamoyl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide (4S)-1-[4-({4-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1 H-isoindol- 4-yl}oxy)acetamido]butyl}carbamoyl)phenyl]-7,8-dimethoxy-N,4-dimethyl-4,5- dihydro-3H-2,3-benzodiazepine-3-carboxamide (4S)-1-(4-{[14-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-4- yl}amino)-3, 6,9,12-tetraoxatetradecan-1-yl]carbamoyl}phenyl)-7, 8-dimethoxy- N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide (4S)-1-(4-{4-[3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H- isoindol-5-yl}amino)ethoxy]ethoxy}ethoxy)propanoyl]piperazin-1-yl}phenyl)-7,8- dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2,3-benzodiazepine-3-carboxamide, and
(4S)-1-(4-{4-[15-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H- isoindol-5-yl}amino)-4,7,10,13-tetraoxapentadecan-1-oyl]piperazin-1-yl}phenyl)- 7, 8-dimethoxy-N,4-dimethyl-4,5-dihydro-3H-2, 3- benzodiazepine- 3-carboxamide N-(13-{4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1-yl]phenyl}-13-oxo-3,6,9-trioxa-12-azatridecanan-1-oyl)-3- methyl-L-valyl-(4R)-4-hydroxy-N-{[4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl}-L- prolinamide
N-{[2-(2-{4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1-yl]benzamido}ethoxy)ethoxy]acetyl}-3-methyl-L-valyl-(4R)-4- hydroxy-N-{[4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl}-L-prolinamide N-(16-{4-[(4S)-7,8-dimethoxy-4-methyl-3-(methylcarbamoyl)-4,5-dihydro-3H-2,3- benzodiazepin-1-yl]phenyl}-16-oxo-3, 6,9,12-tetraoxa-15-azahexadecanan-1- oyl)-3-methyl-L-valyl-(4R)-4-hydroxy-N-{[4-(4-methyl-1 ,3-thiazol-5- yl)phenyl]methyl}-L-prolinamide and stereoisomers, tautomers, N-oxides, hydrates, solvates, and salts thereof, and mixtures of the same.
7. A compound according to any one of the previous claims, for use in the treatment or prophylaxis of a disease.
8. Use of a compound according to any one of claims 1 to 6, for the treatment or prophylaxis of a disease.
9. Use of a compound according to any one of claims 1 to 6, for the preparation of a medicament for the treatment or prophylaxis of a disease.
10. Use according to any one of claims 8, or 9, wherein the disease is benign hyperplasia, atherosclerotic disorders, sepsis, autoimmune disorders, vascular disorders, viral infections, fungal infections, for neurodegenerative disorders, for inflammatory disorders, for atherosclerotic disorders and for the control of male fertility.
11. A pharmaceutical composition comprising at least one compound according to any one of the claims 1 to 6 and one or more pharmaceutically acceptable excipients.
12. A compound of formula: tert- butyl 1-({2-[2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-3,6,9,12-tetraoxapentadecan-15-oate; tert- butyl 3-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H- isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)propanoate; tert- butyl 3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1H- isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)propanoate; tert- butyl 1-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)-3,6,9,12-tetraoxapentadecan-15-oate;
3-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}amino)ethoxy]ethoxy}ethoxy)propanoic acid; 1-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1H-isoindol-4-yl}amino)- 3,6,9, 12-tetraoxapentadecan-15-oic acid; 1-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-4-yl}amino)- 3,6,9, 12-tetraoxapentadecan-15-oic acid;
{2-[2-(2-{[2-(2,6-dioxopiperidin-3-yl)-1 ,3-dioxo-2,3-dihydro-1H-isoindol-4-yl]amino}- 2-oxoeth oxy) eth oxy] eth oxy}aceti c acid;
[2-(2-{[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl]amino}-2- oxoeth oxy) eth oxy] aceti c acid tert- butyl 5-(2-{[2-(2,6-dioxopiperidin-3-yl)-1 ,3-dioxo-2, 3-dihydro- 1 H-isoindol-4- yl]oxy}acetamido)pentanoate
5-[2-({2-[2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4- yl}oxy)acetamido]pentanoic acid
14-{[2-(2,6-dioxopiperidin-3-yl)-1 ,3-dioxo-2,3-dihydro-1 H-isoindol-4-yl]amino}-14- oxo-3, 6,9,12-tetraoxatetrad ecan-1-oic acid tert- butyl [2-(2-{2-[2-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2, 3-dihydro- 1 H- isoindol-4-yl}amino)ethoxy]ethoxy}ethoxy)ethyl]carbamate
4-[(2-{2-[2-(2-aminoethoxy)ethoxy]ethoxy}ethyl)amino]-2-[(3S)-2,6-dioxopiperidin-3- yl]-1 H-isoindole-1 ,3(2H)-dione trifluoroacetate tert- butyl [14-({2-[(3S)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2, 3-dihydro- 1 H-isoindol-4- yl}amino)-3,6,9,12-tetraoxatetradecan-1-yl]carbamate 4-[(14-amino-3,6,9,12-tetraoxatetradecan-1-yl)amino]-2-[(3S)-2,6-dioxopiperidin-3- yl]-1 H-isoindole-1 ,3(2H)-dione trifluoroacetate tert-butyl-3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H- isoindol-5-yl}amino)ethoxy]ethoxy}ethoxy)propanoate tert- butyl 1-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1 ,3-dioxo-2, 3-dihydro- 1 H-isoindol-5- yl}amino)-3,6,9,12-tetraoxapentadecan-15-oate 3-(2-{2-[2-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-5- yl}amino)ethoxy]ethoxy}ethoxy)propanoic acid trifluoroacetate 1-({2-[(3RS)-2,6-dioxopiperidin-3-yl]-1,3-dioxo-2,3-dihydro-1H-isoindol-5-yl}amino)- 3,6,9, 12-tetraoxapentadecan-15-oic acid trifluoroacetate
PCT/EP2021/052142 2020-01-31 2021-01-29 Substituted 2,3-benzodiazepines derivatives WO2021152113A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP20154860.9 2020-01-31
EP20154860 2020-01-31

Publications (1)

Publication Number Publication Date
WO2021152113A1 true WO2021152113A1 (en) 2021-08-05

Family

ID=69423156

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2021/052142 WO2021152113A1 (en) 2020-01-31 2021-01-29 Substituted 2,3-benzodiazepines derivatives

Country Status (1)

Country Link
WO (1) WO2021152113A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114085213A (en) * 2022-01-20 2022-02-25 苏州国匡医药科技有限公司 Preparation method of ARV-471
WO2023122481A3 (en) * 2021-12-20 2023-08-03 Sigma-Aldrich Co. Llc Chemical linkers
WO2023249469A1 (en) * 2022-06-24 2023-12-28 주식회사 아이비스바이오 Novel thalidomide derivative and production method therefor

Citations (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6262056B1 (en) 1997-07-08 2001-07-17 Vita-Invest, Sa Benzothiophene derivatives and corresponding use and composition
WO2003104236A1 (en) 2002-06-01 2003-12-18 Bristol-Myers Squibb Company Calcitonin gene related peptide receptor antagonists
US6727264B1 (en) 2001-07-05 2004-04-27 Synaptic Pharmaceutical Corporation Substituted anilinic piperidines as MCH selective antagonists
WO2004072051A1 (en) 2003-02-11 2004-08-26 Vernalis (Cambridge) Limited Isoxazole compounds as inhibitors of heat shock proteins
WO2005115972A1 (en) 2004-05-25 2005-12-08 Astrazeneca Ab Therapeutic compounds
WO2006052722A1 (en) 2004-11-09 2006-05-18 Smithkline Beecham Corporation Glycogen phosphorylase inhibitor compounds and pharmaceutical compositions thereof
WO2006117570A1 (en) 2005-05-05 2006-11-09 Chroma Therapeutics Ltd Quinoline derivatives as kinase enzyme inhibitors
WO2007059613A1 (en) 2005-11-22 2007-05-31 University Of Saskatchewan Antineoplastic compounds
WO2008060621A2 (en) 2006-11-17 2008-05-22 Abbott Laboratories Aminopyrrolidines as chemokine receptor antagonists
WO2008064351A2 (en) 2006-11-22 2008-05-29 Progenics Pharmaceuticals, Inc. (r)-n-stereoisomers of 7,8-saturated-4,5-epoxy-morphinanium analogs
WO2008064432A1 (en) 2006-12-01 2008-06-05 The University Of Sydney Polycyclic molecular compounds
WO2009020990A1 (en) 2007-08-08 2009-02-12 Smithkline Beecham Corporation 2- [ (2-{phenylamino}-1h-pyrrolo [2, 3-d] pyrimidin-4-yl) amino] benzamide derivatives as igf-1r inhibitors for the treatment of cancer
WO2011162409A1 (en) 2010-06-22 2011-12-29 Shionogi & Co., Ltd. Compounds having trpv1 antagonistic activity and uses thereof
WO2014026997A1 (en) 2012-08-16 2014-02-20 Bayer Pharma Aktiengesellschaft 2,3-benzodiazepines
WO2014128067A1 (en) 2013-02-19 2014-08-28 Bayer Pharma Aktiengesellschaft Bicyclo 2,3-benzodiazepines and spirocyclically substituted 2,3-benzodiazepines
WO2014202578A1 (en) 2013-06-17 2014-12-24 Bayer Pharma Aktiengesellschaft Substituted phenyl-2,3-benzodiazepines
WO2015121226A1 (en) 2014-02-13 2015-08-20 Bayer Pharma Aktiengesellschaft 6-substituted 2,3-benzodiazepines
WO2015121230A1 (en) 2014-02-14 2015-08-20 Bayer Pharma Aktiengesellschaft 9-substituted 2,3-benzodiazepines
WO2015121268A1 (en) 2014-02-14 2015-08-20 Bayer Pharma Aktiengesellschaft 1-phenyl-3h-2,3-benzodiazepines and their use as bromodomain inhibitors
WO2015121227A1 (en) 2014-02-14 2015-08-20 Bayer Pharma Aktiengesellschaft 6,9-disubstituted 1-phenyl-3h-2,3-benzodiazepines and their use as bromodomain inhibitors
WO2016062688A1 (en) 2014-10-23 2016-04-28 Bayer Pharma Aktiengesellschaft 1-phenyl-4,5-dihydro-3h-2,3-benzodiazepine derivatives
WO2017185036A1 (en) * 2016-04-22 2017-10-26 Dana Farber Cancer Institute, Inc. Bifunctional molecules for degradation of egfr and methods of use
WO2018069863A1 (en) 2016-10-13 2018-04-19 Glaxosmithkline Intellectual Property Development Limited 1,3 di-substituted cyclobutane or azetidine derivatives as hematopoietic prostaglandin d synthase inhibitors
WO2019078522A1 (en) * 2017-10-20 2019-04-25 한국화학연구원 Cereblon protein degradation inducing compound, preparation method therefor and pharmaceutical composition for preventing or treating cancer, containing same as active ingredient
CN109879877A (en) * 2019-03-04 2019-06-14 吉林大学 A compound capable of degrading PLK1 and BRD4 proteins and its application
WO2020200291A1 (en) * 2019-04-02 2020-10-08 Cullgen (Shanghai) , Inc. Compounds and methods of treating cancers

Patent Citations (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6262056B1 (en) 1997-07-08 2001-07-17 Vita-Invest, Sa Benzothiophene derivatives and corresponding use and composition
US6727264B1 (en) 2001-07-05 2004-04-27 Synaptic Pharmaceutical Corporation Substituted anilinic piperidines as MCH selective antagonists
WO2003104236A1 (en) 2002-06-01 2003-12-18 Bristol-Myers Squibb Company Calcitonin gene related peptide receptor antagonists
WO2004072051A1 (en) 2003-02-11 2004-08-26 Vernalis (Cambridge) Limited Isoxazole compounds as inhibitors of heat shock proteins
WO2005115972A1 (en) 2004-05-25 2005-12-08 Astrazeneca Ab Therapeutic compounds
WO2006052722A1 (en) 2004-11-09 2006-05-18 Smithkline Beecham Corporation Glycogen phosphorylase inhibitor compounds and pharmaceutical compositions thereof
WO2006117570A1 (en) 2005-05-05 2006-11-09 Chroma Therapeutics Ltd Quinoline derivatives as kinase enzyme inhibitors
WO2007059613A1 (en) 2005-11-22 2007-05-31 University Of Saskatchewan Antineoplastic compounds
WO2008060621A2 (en) 2006-11-17 2008-05-22 Abbott Laboratories Aminopyrrolidines as chemokine receptor antagonists
WO2008064351A2 (en) 2006-11-22 2008-05-29 Progenics Pharmaceuticals, Inc. (r)-n-stereoisomers of 7,8-saturated-4,5-epoxy-morphinanium analogs
WO2008064432A1 (en) 2006-12-01 2008-06-05 The University Of Sydney Polycyclic molecular compounds
WO2009020990A1 (en) 2007-08-08 2009-02-12 Smithkline Beecham Corporation 2- [ (2-{phenylamino}-1h-pyrrolo [2, 3-d] pyrimidin-4-yl) amino] benzamide derivatives as igf-1r inhibitors for the treatment of cancer
WO2011162409A1 (en) 2010-06-22 2011-12-29 Shionogi & Co., Ltd. Compounds having trpv1 antagonistic activity and uses thereof
WO2014026997A1 (en) 2012-08-16 2014-02-20 Bayer Pharma Aktiengesellschaft 2,3-benzodiazepines
WO2014128067A1 (en) 2013-02-19 2014-08-28 Bayer Pharma Aktiengesellschaft Bicyclo 2,3-benzodiazepines and spirocyclically substituted 2,3-benzodiazepines
WO2014202578A1 (en) 2013-06-17 2014-12-24 Bayer Pharma Aktiengesellschaft Substituted phenyl-2,3-benzodiazepines
WO2015121226A1 (en) 2014-02-13 2015-08-20 Bayer Pharma Aktiengesellschaft 6-substituted 2,3-benzodiazepines
WO2015121230A1 (en) 2014-02-14 2015-08-20 Bayer Pharma Aktiengesellschaft 9-substituted 2,3-benzodiazepines
WO2015121268A1 (en) 2014-02-14 2015-08-20 Bayer Pharma Aktiengesellschaft 1-phenyl-3h-2,3-benzodiazepines and their use as bromodomain inhibitors
WO2015121227A1 (en) 2014-02-14 2015-08-20 Bayer Pharma Aktiengesellschaft 6,9-disubstituted 1-phenyl-3h-2,3-benzodiazepines and their use as bromodomain inhibitors
WO2016062688A1 (en) 2014-10-23 2016-04-28 Bayer Pharma Aktiengesellschaft 1-phenyl-4,5-dihydro-3h-2,3-benzodiazepine derivatives
WO2017185036A1 (en) * 2016-04-22 2017-10-26 Dana Farber Cancer Institute, Inc. Bifunctional molecules for degradation of egfr and methods of use
WO2018069863A1 (en) 2016-10-13 2018-04-19 Glaxosmithkline Intellectual Property Development Limited 1,3 di-substituted cyclobutane or azetidine derivatives as hematopoietic prostaglandin d synthase inhibitors
WO2019078522A1 (en) * 2017-10-20 2019-04-25 한국화학연구원 Cereblon protein degradation inducing compound, preparation method therefor and pharmaceutical composition for preventing or treating cancer, containing same as active ingredient
CN109879877A (en) * 2019-03-04 2019-06-14 吉林大学 A compound capable of degrading PLK1 and BRD4 proteins and its application
WO2020200291A1 (en) * 2019-04-02 2020-10-08 Cullgen (Shanghai) , Inc. Compounds and methods of treating cancers

Non-Patent Citations (83)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Science", 1980, MACK PUBLISHING COMPANY
AN ET AL., NAT. COMMUN., vol. 8, 2017, pages 15398
ASTORGUES-XERRI ET AL., LEUK LYMPHOMA, 2019, pages 1 - 4
BARDA ET AL., GENE EXPR. PATTERNS, vol. 20, 2016, pages 130 - 137
BERENGUER-DAIZE, INT. J. CANCER, vol. 139, 2016, pages 2047 - 2055
BIOORGANIC AND MEDICINAL CHEMISTRY, vol. 21, 23, 2013, pages 7283 - 7308
BIOORGANIC AND MEDICINAL CHEMISTRY, vol. 23, no. 24, 2015, pages 7735 - 7742
BISGROVE ET AL., PROC. NATL ACAD. SCI. USA, vol. 104, 2007, pages 13690 - 13695
BROWN ET AL., PROC. NATL. ACAD. SCI, vol. 115, 2018, pages 2144 - 2149
C.A. FRENCH, ANNU. REV. PATHOL., vol. 7, 2012, pages 247 - 265
CAS , no. 1799711-25-3
CHAIDOS ET AL., THER ADV HEMATOL, vol. 6, 2016, pages 128 - 141
CHAMBERLAIN ET AL., NAT. STRUCT. MOL. BIOL., vol. 21, 2014, pages 803 - 809
CHAPMAN ET AL., EUR. HEART J., 201110.1080/10428194.2019.1617860, vol. 32, pages 1345 - 1361
CHEMICAL BIOLOGY, vol. 12, no. 10, 2017, pages 2570 - 2578
CHUNG ET AL., J. MED. CHEM, vol. 54, 2011, pages 3827 - 3838
DAWSON ET AL., NATURE, vol. 478, 2011, pages 529 - 533
DEGOMARADER, NAT. REV. CARDIOL., vol. 8, 2011, pages 266 - 277
DELMORE ET AL., CELL, vol. 146, 2011, pages 1 - 14
DEY ET AL., MOL. BIOL. CELL, vol. 20, 2009, pages 4899 - 4909
F. MIETTON ET AL., NAT. COMM., vol. 8, 2017, pages 15482
FILIPPAKOPOULOS ET AL., CELL, vol. 149, 2012, pages 214 - 231
FILIPPAKOPOULOS ET AL., NATURE, vol. 468, 2010, pages 1119 - 1123
FISCHER ET AL., NATURE, vol. 512, 2014, pages 49 - 53
FLANAGAN ET AL., CANCER RES, vol. 74, 2019
FRENCH, CANCER GENET. CYTOGENET., vol. 203, 2010, pages 16 - 20
G. M. BURSLEMP. OTTISS. JAIME-FIGUEROAA. MORGANP. M. CROMMM. TOUREC. M. CREWS, CHEMMEDCHEM, vol. 13, 2018, pages 1508 - 1512
GELATO ET AL., ONCOGENE, vol. 37, 2018, pages 512 - 521
GOSMINI ET AL., J. MED. CHEM., vol. 57, 2014, pages 8111 - 8131
GYURIS ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1789, 2009, pages 413 - 421
HAJMIRZA ET AL., BIOMEDICINE, vol. 6, 2018, pages E16
HAJMIRZA ET AL., BIOMEDICINES, vol. 6, 2018, pages E16
HOUZELSTEIN ET AL., MOL. CELL. BIOL., vol. 22, 2002, pages 3794 - 3802
HUANG ET AL., MOL. CELL. BIOL., vol. 29, 2009, pages 5094 - 5103
ITO ET AL., SCIENCE, vol. 327, 2010, pages 1345 - 1350
J. AM. CHEM. SOC., vol. 114, 1992, pages 9327
JAUSET ET AL., ONCOTARGET, vol. 9, 2018, pages 18734 - 18746
JING LU ET AL: "Hijacking the E3 Ubiquitin Ligase Cereblon to Efficiently Target BRD4", CHEMISTRY & BIOLOGY, vol. 22, no. 6, 18 June 2015 (2015-06-18), GB, pages 755 - 763, XP055227483, ISSN: 1074-5521, DOI: 10.1016/j.chembiol.2015.05.009 *
JOURNAL OF MEDICINAL CHEMISTRY, vol. 49, no. 11, 2006, pages 3116 - 3135
JOURNAL OF MEDICINAL CHEMISTRY, vol. 52-19, 2009, pages 6012 - 6023
JOURNAL OF MEDICINAL CHEMISTRY, vol. 61, no. 2, 2018, pages 504 - 513
JOURNAL OF ORGANIC CHEMISTRY, vol. 76, 16, 2011, pages 6912 - 6917
KINGWELL, NAT. REV. DRUG DISCOV., vol. 16, 2017, pages 677
KLINGBEIL ET AL., CELL DEATH DIS., vol. 7, 2016, pages e2365
KRONKE ET AL., NATURE, vol. 523, 2015, pages 183 - 188
KUOALLIS, BIOESSAYS, vol. 20, 1998, pages 615 - 626
LEROY ET AL., MOL. CELL, vol. 30, 2008, pages 51 - 60
LI ET AL., TRANSCRIPTION, vol. 9, 2018, pages 88 - 94
MCCLELAND ET AL., J. CLIN. INVEST., vol. 126, 2016, pages 639 - 652
MERTZ ET AL., PROC. NATL. ACAD. SCI. USA, vol. 108, 2011, pages 16669 - 16674
MICHAEL ZENGERLE ET AL: "Selective Small Molecule Induced Degradation of the BET Bromodomain Protein BRD4", ACS CHEMICAL BIOLOGY, vol. 10, no. 8, 21 August 2015 (2015-08-21), pages 1770 - 1777, XP055333869, ISSN: 1554-8929, DOI: 10.1021/acschembio.5b00216 *
MOCHIZUKI ET AL., J. BIOL. CHEM., vol. 283, 2008, pages 9040 - 9048
MONTENEGRO ET AL., ONCOTARGET, vol. 7, 2016, pages 43997 - 44012
MORSE ET AL., ANTIVIR. RES., vol. 154, 2018, pages 158 - 165
NEKLESA ET AL., CANCER RES, vol. 78, 2018
ORG. LETT., 2011, pages 5048 - 5051
PARK ET AL., SCI. REP., vol. 9, 2019, pages 13305
PENAS ET AL., NAT. COMMUN., vol. 10, 2019, pages 3028
PENG LIJIE ET AL: "Supporting Information Identification of New Small-Molecule Inducers of Estrogen-Related Receptor ? (ERR?) Degradation", ACS MEDICINAL CHEMISTRY LETTERS, 4 December 2019 (2019-12-04), pages S1 - S207, XP055786844, Retrieved from the Internet <URL:https://pubs.acs.org/doi/10.1021/acsmedchemlett.9b00025> [retrieved on 20210317] *
PETZOLD ET AL., NATURE, vol. 532, 2016, pages 127 - 130
RAHMAN ET AL., MOL. CELL. BIOL., vol. 31, 2011, pages 2641 - 2652
SAHNIKERI, PHARMACOL. RES., vol. 129, 2018, pages 156 - 176
SCHEEPSTRA M ET AL., COMPUT. STRUCT. BIOTECHNOL. J., vol. 17, 2019, pages 160 - 176
SCHRODER ET AL., J. BIOL. CHEM., vol. 287, 2012, pages 28840 - 28851
SEGURA ET AL., CANCER RES., vol. 73, 2013, pages 6264 - 6276
SHANG ET AL., DEVELOPMENT, vol. 139, 2007, pages 3507 - 3515
SIU ET AL., LEUKEMIA, vol. 31, 2017, pages 1760 - 1769
T.W. GREENEP.G.M. WUTS: "Protective Groups in Organic Synthesis", 1999, WILEY
TANIGUCHI, INT. J. MOL. SCI., vol. 17, 2016, pages E1849
UMEHARA ET AL., J. BIOL. CHEM., vol. 285, 2010, pages 7610 - 7618
URBANUCCIMILLS, MOL CELL ENDOCRINOL, vol. 462, 2018, pages 31 - 40
VIEJO-BORBOLLA ET AL., J. VIROL., vol. 79, 2005, pages 13618 - 13629
VOSA ET AL., J. VIROL., vol. 86, 2012, pages 348 - 357
WANG ET AL., BIOCHEM. J., vol. 425, 2009, pages 71 - 83
WU ET AL., GENES DEV., vol. 20, 2006, pages 2383 - 2396
WU, CHIANG, BIOL. CHEM., vol. 282, 2007, pages 13141 - 13145
YAN ET AL., J. BIOL. CHEM., vol. 286, 2011, pages 27663 - 27675
YANG ET AL., DRUG DISCOV. TODAY, vol. 31, 2019, pages 43 - 51
YANG ET AL., MOL. CELL, vol. 19, 2005, pages 535 - 545
YANG ET AL., MOL. CELL. BIOL., vol. 28, 2008, pages 967 - 976
YOU ET AL., J. VIROL., vol. 80, 2006, pages 8909 - 8919
ZDROJEWICZ ET AL., ADV. CLIN. EXP. MED., vol. 24, 2015, pages 705 - 714
ZHAO ET AL., NAT. CELL. BIOL., vol. 13, 2011, pages 1295 - 1304

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023122481A3 (en) * 2021-12-20 2023-08-03 Sigma-Aldrich Co. Llc Chemical linkers
CN114085213A (en) * 2022-01-20 2022-02-25 苏州国匡医药科技有限公司 Preparation method of ARV-471
WO2023249469A1 (en) * 2022-06-24 2023-12-28 주식회사 아이비스바이오 Novel thalidomide derivative and production method therefor

Similar Documents

Publication Publication Date Title
EP3027614B1 (en) Substituted dihydropyrido[3,4-b]pyrazinones as dual inhibitors of bet-proteins and polo-like kinases
KR20210098960A (en) HELIOS small molecule degrading agent and method of use
US9890147B2 (en) 2,3-benzodiazepines
US20150344444A1 (en) Bet-protein-inhibiting dihydroxyquinoxalinones
JP2014525421A (en) 6H-thieno [3,2-f] [1,2,4] triazolo [4,3-a] [1,4] diazepine
CA2915419A1 (en) Substituted phenyl-2,3-benzodiazepines
EP3649119B1 (en) Novel compounds and pharmaceutical compositions thereof for the treatment of fibrosis
US20160009725A1 (en) Pyrrolo- and pyrazolo-triazolodiazepines as bet-protein inhibitors for treating hyperproliferative diseases
US20150376196A1 (en) 4-substituted pyrrolo- and pyrazolo-diazepines
US20160193206A1 (en) Bet-protein-inhibiting dihydropyridopyrazinones
WO2021152113A1 (en) Substituted 2,3-benzodiazepines derivatives
US20160129011A1 (en) Bicyclo 2,3-benzodiazepines and spirocyclically substituted 2,3-benzodiazepines
EP4110340A1 (en) Potent and selective degraders of alk
US20160176867A1 (en) Modified bet-protein-inhibiting dihydroquinoxalinones and dihydropyridopyrazinones
JP2020510672A (en) FGFR kinase inhibitor and pharmaceutical use
KR20220070229A (en) Aza-quinoline compounds and uses thereof
CA3201333A1 (en) N-[2-({4-[3-(anilino)-4-oxo-4,5,6,7-tetrahydro-1h-pyrrolo[3,2-c]pyridin-2-yl]pyridin-3-yl)oxy)ethyl]prop-2-enamide derivatives and similar compounds as egfr inhibitors for the treatment of cancer
WO2015193219A1 (en) Bet-protein inhibiting 3,4-dihydropyrido[2,3-b]pyrazinones with meta-substituted aromatic amino- or ether groups
WO2015121230A1 (en) 9-substituted 2,3-benzodiazepines
WO2015121268A1 (en) 1-phenyl-3h-2,3-benzodiazepines and their use as bromodomain inhibitors
WO2015193228A1 (en) Bet-protein inhibiting 1,4-dihydropyrido[3,4-b]pyrazinones with para-substituted aromatic amino- or ether groups
WO2015121227A1 (en) 6,9-disubstituted 1-phenyl-3h-2,3-benzodiazepines and their use as bromodomain inhibitors
WO2025021075A1 (en) Nsd protein degradation agent and use thereof
HK1197408A (en) 6h-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepines
HK1168791A1 (en) Substituted imidazoquinoxalines

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21701552

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21701552

Country of ref document: EP

Kind code of ref document: A1