WO2021113770A1 - Methods related to toxicity and response associated with cell therapy for treating b cell malignancies - Google Patents

Methods related to toxicity and response associated with cell therapy for treating b cell malignancies Download PDF

Info

Publication number
WO2021113770A1
WO2021113770A1 PCT/US2020/063486 US2020063486W WO2021113770A1 WO 2021113770 A1 WO2021113770 A1 WO 2021113770A1 US 2020063486 W US2020063486 W US 2020063486W WO 2021113770 A1 WO2021113770 A1 WO 2021113770A1
Authority
WO
WIPO (PCT)
Prior art keywords
subject
cell therapy
threshold level
tumor burden
administration
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/063486
Other languages
English (en)
French (fr)
Inventor
Jason A. Dubovsky
Julie RYTLEWSKI
Ethan THOMPSON
Jerill THORPE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Juno Therapeutics Inc
Original Assignee
Juno Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Juno Therapeutics Inc filed Critical Juno Therapeutics Inc
Priority to BR112022010310A priority Critical patent/BR112022010310A2/pt
Priority to JP2022534164A priority patent/JP7605840B2/ja
Priority to EP20829465.2A priority patent/EP4070097A1/en
Priority to MX2022006715A priority patent/MX2022006715A/es
Priority to US17/782,584 priority patent/US20230053787A1/en
Priority to AU2020395318A priority patent/AU2020395318A1/en
Priority to KR1020227023060A priority patent/KR20220132527A/ko
Priority to CN202080095371.6A priority patent/CN115398231A/zh
Priority to IL293393A priority patent/IL293393A/en
Publication of WO2021113770A1 publication Critical patent/WO2021113770A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5014Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing toxicity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/13B-cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31Chimeric antigen receptors [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/414Nervous system antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/421Immunoglobulin superfamily
    • A61K40/4211CD19 or B4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70575NGF/TNF-superfamily, e.g. CD70, CD95L, CD153, CD154
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57505Immunoassay; Biospecific binding assay; Materials therefor for cancer of the blood, e.g. leukaemia
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6863Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/80Vaccine for a specifically defined cancer
    • A61K2039/804Blood cells [leukemia, lymphoma]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2121/00Preparations for use in therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/56Staging of a disease; Further complications associated with the disease

Definitions

  • the present disclosure relates in some aspects to methods for determining the risk of toxicity (e.g., neurotoxicity) and/or the likelihood of response to a cell therapy.
  • the methods generally involve assessing parameters or biomarkers (e.g., blood analytes) that are associated with toxicity and/or response.
  • the methods relate to adoptive cell therapy involving the administration of doses of cells for treating subjects with certain B cell malignancies, such as chronic lymphocytic leukemia (CLL), such as relapsed or refractory CLL, or small lymphocytic lymphoma (SLL).
  • CLL chronic lymphocytic leukemia
  • SLL small lymphocytic lymphoma
  • the cells for the adoptive cell therapy generally express recombinant receptors such as chimeric antigen receptors (CARs).
  • the methods can be used to identify or select subjects for treatment, for example, with a cell therapy.
  • CLL and SLL are indolent cancers in which immature lymphocytes are found in the blood and bone marrow and/or in the lymph nodes.
  • CLL and SLL are considered incurable, and patients eventually relapse or become refractory to available therapies.
  • Certain methods are available for adoptive cell therapy using engineered cells expressing recombinant receptors, such as chimeric antigen receptor (CARs).
  • CARs chimeric antigen receptor
  • Improved methods are needed, for example, to reduce the risk of toxicity and/or to enhance the response to treatment, are needed. Provided are methods, uses and articles of manufacture that meet such needs.
  • the methods involve comparing the value of a parameter or the level, concentration or amount of the biomarker or analyte, to a threshold value for that particular parameter, biomarker or analyte.
  • the comparison can be used to determine the risk of toxicity and/or the likelihood of response to a cell therapy.
  • the comparison can be used to determine the risk of toxicity.
  • the comparison can be used to determine the likelihood of response to a cell therapy.
  • the cell therapy includes a dose of engineered cells including T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD19).
  • CAR chimeric antigen receptor
  • the parameter, biomarker or analyte is assessed from a subject or in a sample obtained from a subject, that has a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL).
  • the subject has a chronic lymphoblastic leukemia (CLL).
  • the subject has a small lymphocytic lymphoma (SLL).
  • the subject is a candidate for treatment with a cell therapy, and/or has received treatment with a cell therapy. In some of any embodiments, the subject is a candidate for treatment with a cell therapy. In some embodiments, the subject has received treatment with a cell therapy. In some of any embodiments, the provided methods can be used to identify or select subjects with a risk of developing a toxicity and/or that are likely to respond to a cell therapy; and/or select subjects for a particular treatment, such as with additional therapeutic agents. In some of any embodiments, the provided methods can be used to identify or select subjects with a risk of developing a toxicity. In some of any embodiments, the provided methods can be used to identify or select subjects that are likely to respond to a cell therapy. Ins ome of any embodiments, the provided methods can be used to select subjects for a particular treatment, such as with additional therapeutic agents.
  • determining the risk of developing a toxicity after administration of a cell therapy involves: assessing one or more parameters of disease burden selected from among lymph node tumor burden, blood tumor burden and the ratio of blood tumor burden to lymph node tumor burden, in a subject having a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL) that is a candidate for treatment with a cell therapy, said cell therapy including a dose of engineered cells including T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD 19), wherein the parameter is assessed from the subject prior to administering the cell therapy; and comparing, individually, the value of the one or more parameters to a threshold level for the respective parameter, wherein identifying the subject as at risk for developing a neurotoxicity following administration of the cell therapy if: the lymph node tumor burden is at or above the threshold level for lymph node tumor burden; the blood tumor burden is below the threshold level for blood tumor
  • CLL chronic lymphoblastic leukemia
  • the method further includes administering to the subject the cell therapy, optionally at a reduced dose, optionally wherein the method further includes administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity; and/or the administering of the cell therapy to the subject is carried out or is specified to be carried out in an in-patient setting and/or with admission to a hospital for one or more days; or administering to the subject an alternative treatment other than the cell therapy for treating the CLL or SLL.
  • the method further includes administering to the subject the cell therapy at a reduced dose. In some embodiments, if the subject is identified as at risk for developing a neurotoxicity, the method further includes administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity. In some embodiments, if the subject is identified as at risk for developing a neurotoxicity, the administering of the cell therapy to the subject is carried out or is specified to be carried out in an in-patient setting and/or with admission to a hospital for one or more days.
  • the method includes administering to the subject an alternative treatment other than the cell therapy for treating the CLL or SLL.
  • the method further includes administering to the subject the cell therapy, optionally wherein the subject is not administered an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity, optionally at or after the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic; and/or the administering of the cell therapy and any follow-up is carried out on an outpatient basis and/or without admitting the subject to a hospital and/or without an overnight stay at a hospital and/or without requiring admission to or an overnight stay at a hospital, optionally unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.
  • the method further includes administering to the subject the cell therapy. In some of any embodiments, if the subject is identified as not at risk for developing a neurotoxicity, the subject is not administered an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity.
  • the subject is not administered an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.
  • the administering of the cell therapy and any follow-up is carried out on an outpatient basis and/or without admitting the subject to a hospital and/or without an overnight stay at a hospital and/or without requiring admission to or an overnight stay at a hospital.
  • the administering of the cell therapy and any follow-up is carried out on an outpatient basis and/or without admitting the subject to a hospital and/or without an overnight stay at a hospital and/or without requiring admission to or an overnight stay at a hospital, unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.
  • a subject for treatment with a cell therapy involves: assessing one or more parameters of disease burden selected from among lymph node tumor burden, blood tumor burden and the ratio of blood tumor burden to lymph node tumor burden, in a subject having a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL) that is a candidate for treatment with a cell therapy, said cell therapy including a dose of engineered cells including T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD19), wherein the parameter is assessed from the subject prior to administering the cell therapy; and comparing, individually, the value of the one or more parameters to a threshold level for the respective parameter, wherein if the lymph node tumor burden is at or above the threshold level for lymph node tumor burden; the blood tumor burden is below the threshold level for blood tumor burden; and/or the ratio of blood tumor burden to lymph node tumor burden is below the threshold level for the ratio
  • Also provided herein are methods of selecting a subject for treatment with a cell therapy wherein the methods involve: assessing one or more parameters of disease burden selected from among lymph node tumor burden, blood tumor burden and the ratio of blood tumor burden to lymph node tumor burden, in a subject having a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL) that is a candidate for treatment with a cell therapy, said cell therapy including a dose of engineered cells including T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD 19), wherein the parameter is assessed from the subject prior to administering the cell therapy; and comparing, individually, the value of the one or more parameters to a threshold level for the respective parameter, wherein if the lymph node tumor burden is at or above the threshold level for lymph node tumor burden; the blood tumor burden is below the threshold level for blood tumor burden; and/or the ratio of blood tumor burden to lymph node tumor burden is below the threshold level for the ratio
  • the subject is not administered an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity.
  • the subject is not administered an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity, such as at or after the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.
  • the administration of the cell therapy and any follow-up is carried out on an outpatient basis.
  • the administration of the cell therapy and any follow-up is carried out without admitting the subject to a hospital. In some embodiments, the administration of the cell therapy and any follow-up is carried out without an overnight stay at a hospital. In some embodiments, the administration of the cell therapy and any follow-up is carried out without requiring admission to or an overnight stay at a hospital. In some embodiment, the administration of the cell therapy and any follow-up is carried out on an outpatient basis and/or without admitting the subject to a hospital and/or without an overnight stay at a hospital and/or without requiring admission to or an overnight stay at a hospital unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.
  • the method further includes administering the cell therapy, the agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity and/or the alternative treatment to the subject. In some of any embodiments, the method further includes administering the cell therapy to the subject. In some of any embodiments, the method further includes administering the agent to the subject. In some of any embodiments, the method further includes administering the other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity to the subject. In some of any embodiments, the method further includes administering the alternative treatment to the subject.
  • assessing the blood tumor burden includes determining the lymphocyte concentration in the blood of the subject.
  • the concentration is the lymphocyte count per microliter (pL) of blood.
  • the threshold level for blood tumor burden is a value between at or about 800 lymphocytes/pL and at or about 3000 lymphocytes/pL.
  • the threshold level for blood tumor burden is a value of at or about 800 lymphocytes/pL, 900 lymphocytes/pL, 1000 lymphocytes/pL, 1250 lymphocytes/pL, 1500 lymphocytes/pL, 1750 lymphocytes/pL, 2000 lymphocytes/pL, 2250 lymphocytes/pL, 2500 lymphocytes/pL, 2750 lymphocytes/pL or 3000 lymphocytes/pL, or a value between any of the foregoing.
  • the threshold level for blood tumor burden is a value of at or about 800 lymphocytes/pL.
  • the threshold level for blood tumor burden is a value of at or about 900 lymphocytes/pL.
  • the threshold level for blood tumor burden is a value of at or about 1000 lymphocytes/pL. In some of any embodiments, the threshold level for blood tumor burden is a value of at or about 1250 lymphocytes/pL. In some of any embodiments, the threshold level for blood tumor burden is a value of at or about 1500 lymphocytes/pL. In some of any embodiments, the threshold level for blood tumor burden is a value of at or about 1750 lymphocytes/pL. In some of any embodiments, the threshold level for blood tumor burden is a value of at or about 2000 lymphocytes/pL. In some of any embodiments, the threshold level for blood tumor burden is a value of at or about 2250 lymphocytes/pL.
  • the threshold level for blood tumor burden is a value of at or about 2500 lymphocytes/pL,. In some of any embodiments, the threshold level for blood tumor burden is a value of at or about 2750 lymphocytes/pL. In some of any embodiments, the threshold level for blood tumor burden is a value of at or about 3000 lymphocytcs/pL.
  • assessing the lymph node burden includes determining the largest lymph node diameter.
  • the largest lymph node diameter is measured in centimeters (cm).
  • the threshold level for the largest lymph node diameter as the lymph node burden is a value between at or about 4 cm and at or about 7 cm.
  • the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 4 cm, 4.25 cm, 4.5 cm, 4.75 cm, 5 cm, 5.25 cm, 5.5 cm, 5.75 cm, 6 cm, 6.25 cm, 6.5 cm, 6.75 cm or 7 cm, or a value between any of the foregoing.
  • the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 4 cm. In some of any embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 4.25 cm. In some of any embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 4.5 cm. In some of any embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 4.75 cm. In some of any embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 5 cm.
  • the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 5.25 cm. In some of any embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 5.5 cm. In some of any embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 5.75 cm. In some of any embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 6.0 cm. In some of any embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 6.25 cm.
  • the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 6.5 cm. In some of any embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 6.75 cm. In some of any embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 7.0 cm.
  • assessing the ratio of blood tumor burden to lymph node tumor burden includes determining the ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm).
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value between at or about 300 and at or about 1000.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000, or a value between any of the foregoing. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 300.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 350. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 400.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 450. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 500.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 550. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 600.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 650. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 700.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 750. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 800.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 850. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 900.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 950. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 1000.
  • assessing the lymph node burden includes determining the sum of the products of diameters (SPD). In some of any embodiments, the SPD is measured in centimeters squared (cm 2 ). In some of any embodiments, the threshold level for the SPD as the lymph node burden is a value between at or about 10 cm 2 and at or about 40 cm 2 .
  • the threshold level for the SPD as the lymph node burden is a value of at or about 10 cm 2 , 12.5 cm 2 , 15 cm 2 , 17.5 cm 2 , 20 cm 2 , 22.5 cm 2 , 25 cm 2 , 27.5 cm 2 , 30 cm 2 , 32.5 cm 2 , 35 cm 2 , 37.5 cm 2 or 40 cm 2 , or a value between any of the foregoing.
  • the threshold level for the SPD as the lymph node burden is a value of at or about 10 cm 2 .
  • the threshold level for the SPD as the lymph node burden is a value of at or about 12.5 cm 2 .
  • the threshold level for the SPD as the lymph node burden is a value of at or about 15 cm 2 . In some of any embodiments, the threshold level for the SPD as the lymph node burden is a value of at or about 17.5 cm 2 . In some of any embodiments, the threshold level for the SPD as the lymph node burden is a value of at or about 20 cm 2 . In some of any embodiments, the threshold level for the SPD as the lymph node burden is a value of at or about 22.5 cm 2 . In some of any embodiments, the threshold level for the SPD as the lymph node burden is a value of at or about 25 cm 2 .
  • the threshold level for the SPD as the lymph node burden is a value of at or about 27.5 cm 2 . In some of any embodiments, the threshold level for the SPD as the lymph node burden is a value of at or about 30 cm 2 . In some of any embodiments, the threshold level for the SPD as the lymph node burden is a value of at or about 32.5 cm 2 . In some of any embodiments, the threshold level for the SPD as the lymph node burden is a value of at or about 35 cm 2 . In some of any embodiments, the threshold level for the SPD as the lymph node burden is a value of at or about 37.5 cm 2 . In some of any embodiments, the threshold level for the SPD as the lymph node burden is a value of at or about 40 cm 2 .
  • assessing the ratio of blood tumor burden to lymph node tumor burden includes determining the ratio of the lymphocyte count per microliter (pL) of blood to the sum of the products of diameters (SPD) in centimeters squared (cm 2 ).
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value between at or about 25 and at or about 500.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450 or 500, or a value between any of the foregoing. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 25. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 50.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 75. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 100. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 150.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 200. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 250. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 300.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 350. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 400. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 450. In some of any embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 500.
  • a biological sample for the level, amount or concentration of tumor necrosis factor (TNF) and/or interleukin- 16 (IL-16), wherein the biological sample is from a subject having a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL) that is a candidate for treatment with a cell therapy, said cell therapy including a dose of engineered cells including T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD 19), wherein the biological sample is obtained from the subject prior to administering the cell therapy or prior to peak CAR+ T cell expansion and/or within at or about 11 days after the initiation of administration of the cell therapy; and comparing, individually, the level, amount or concentration of TNF and/or IL-16 to a threshold level for each, wherein the threshold level for TNF is a value between
  • the method further includes administering to the subject the cell therapy, optionally at a reduced dose, optionally wherein the method further includes administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity; and/or the administering of the cell therapy to the subject is carried out or is specified to be carried out in an in-patient setting and/or with admission to a hospital for one or more days; or administering to the subject an alternative treatment other than the cell therapy for treating the CLL or SLL.
  • the method further includes administering to the subject the cell therapy. In some of any embodiments, if the subject is identified as at risk for developing a neurotoxicity, the method further includes administering to the subject the cell therapy at a reduced dose. In some of any embodiments, if the subject is identified as at risk for developing a neurotoxicity, the method further includes administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity.
  • the administering of the cell therapy to the subject is carried out or is specified to be carried out in an in-patient setting and/or with admission to a hospital for one or more days.
  • the method further includes administering to the subject an alternative treatment other than the cell therapy for treating the CLL or SLL.
  • the method further includes administering to the subject the cell therapy, optionally wherein the subject is not administered an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity, optionally at or after the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic; and/or the administering of the cell therapy and any follow-up is carried out on an outpatient basis and/or without admitting the subject to a hospital and/or without an overnight stay at a hospital and/or without requiring admission to or an overnight stay at a hospital, optionally unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.
  • the method further includes administering to the subject the cell therapy.
  • the subject if the subject is identified as not at risk for developing a neurotoxicity, the subject is not administered an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity.
  • the subject is not administered an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.
  • the administering of the cell therapy and any follow-up is carried out on an outpatient basis and/or without admitting the subject to a hospital and/or without an overnight stay at a hospital and/or without requiring admission to or an overnight stay at a hospital.
  • the administering of the cell therapy and any follow-up is carried out on an outpatient basis and/or without admitting the subject to a hospital and/or without an overnight stay at a hospital and/or without requiring admission to or an overnight stay at a hospital, unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.
  • the method further includes administering the cell therapy, the agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity and/or the alternative treatment to the subject. In some of any embodiments, the method further includes administering the cell therapy to the subject. In some of any embodiments, the method further includes administering the agent to the subject. In some of any embodiments, the method further includes administering the other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity. In some of any embodiments, the method further includes administering the alternative treatment to the subject.
  • determining the risk of developing a toxicity after administration of a cell therapy involves: assaying a biological sample from a subject for the level, amount or concentration of TNF and/or IL-16, said subject having received administration of a cell therapy including a dose of engineered cells including T cells expressing a CAR for treating a CLL or SLL, wherein the biological sample is obtained from the subject prior to peak CAR+ T cell expansion and/or within at or about 11 days after the initiation of administration of the cell therapy; and comparing, individually, the level, amount or concentration of TNF and/or IL-16 to a threshold level for each, wherein the threshold level for TNF is a value between at or about 7 pg/mL and at or about 25 pg/mL; and/or the threshold level for IL-16 is a value between at or about 400 pg/mL and at or about 900 pg/mL; and if the level, amount or concentration of TNF and/or
  • the method further includes administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity, optionally prior to peak CAR+ T cell expansion and/or within at or about 11 days of administering the cell therapy to the subject; and/or the follow-up is carried out in an in-patient setting and/or with admission to a hospital for one or more days.
  • the follow-up is carried out on an outpatient basis and/or without admitting the subject to a hospital and/or without an overnight stay at a hospital and/or without requiring admission to or an overnight stay at a hospital, optionally unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.
  • the method further includes administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity.
  • the method further includes administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity prior to peak CAR+ T cell expansion. In some of any embodiments, if the subject is identified as at risk for developing a neurotoxicity, the method further includes administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity within at or about 11 days of administering the cell therapy to the subject.
  • the follow-up is carried out in an in-patient setting and/or with admission to a hospital for one or more days. In some of any embodiments, if the subject is identified as not at risk for developing a neurotoxicity, the follow-up is carried out on an outpatient basis and/or without admitting the subject to a hospital and/or without an overnight stay at a hospital and/or without requiring admission to or an overnight stay at a hospital.
  • the follow-up is carried out on an outpatient basis and/or without admitting the subject to a hospital and/or without an overnight stay at a hospital and/or without requiring admission to or an overnight stay at a hospital, unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.
  • the methods involve: administering to a subject identified as at risk of developing a neurotoxicity, an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity, said subject having previously received administration of a cell therapy for treating a CLL or SLL, wherein, at or immediately prior to administering the agent, the subject is selected or identified as being at risk of developing a neurotoxicity if the level or amount or concentration of TNF and/or IL-16 in a biological sample, obtained from the subject prior to peak CAR+ T cell expansion and/or within at or about 11 days of the initiation of administration of the cell therapy, is above a threshold level for each, wherein the threshold level for TNF is a value between at or about 7 pg/mL and at or about 25 pg/mL; and/or the threshold level for IL-16 is a value between at or about 400 pg/mL and at or about 900 pg/
  • the threshold level for TNF is a value between at or about 7 pg/mL and at or about 25 pg/mL. In some embodiments, the threshold level for IL-16 is a value between at or about 400 pg/mL and at or about 900 pg/mL.
  • a subject for treatment with an agent comprising: assaying a biological sample from a subject for the level, amount or concentration of TNF and/or IL-16, said subject having received administration of a cell therapy including a dose of engineered cells including T cells expressing a CAR that binds CD 19 for treating a CLL or SLL, wherein the biological sample is obtained from the subject prior to peak CAR+ T cell expansion and/or within at or about 11 days after the initiation of administration of the cell therapy; and comparing, individually, the level, amount or concentration of TNF and/or IL-16 to a threshold level for each, wherein the threshold level for TNF is a value between at or about 7 pg/mL and at or about 25 pg/mL; and/or the threshold level for IL-16 is a value between at or about 400 pg/mL and at or about 900 pg/mL; and if the level, amount or concentration of TNF and/or IL
  • the method further includes administering to the subject, an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity.
  • administering the agent or other treatment is carried out at a time when the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.
  • administering to the subject the cell therapy is carried out on an outpatient basis and, if the level, amount or concentration of TNF and/or IL-16 is above a threshold level the methods involve: admitting the patient to a hospital for one or more days.
  • the threshold level for TNF is a value of at or about 7 pg/mL, 8 pg/mL, 9 pg/mL, 10 pg/mL, 15 pg/mL, 20 pg/mL, or 25 pg/mL, or a value between any of the foregoing. In some of any embodiments, the threshold level for TNF is a value between at or about 8 pg/mL and at or about 10 pg/mL. In some of any embodiments, the threshold level for TNF is a value of at or about 7 pg/mL. In some of any embodiments, the threshold level for TNF is a value of at or about 8 pg/mL.
  • the threshold level for TNF is a value of at or about 9 pg/mL. In some of any embodiments, the threshold level for TNF is a value of at or about 10 pg/mL. In some of any embodiments, the threshold level for TNF is a value of at or about 15 pg/mL. In some of any embodiments, the threshold level for TNF is a value of at or about 20 pg/mL. In some of any embodiments, the threshold level for TNF is a value of at or about 25 pg/mL.
  • the threshold level for IL-16 is a value of at or about 400 pg/mL, 500 pg/mL, 600 pg/mL, 700 pg/mL, 800 pg/mL, 900 pg/mL or 1000 pg/mL, or a value between any of the foregoing. In some of any embodiments, threshold level for IL-16 is a value between at or about 500 pg/mL and at or about 700 pg/mL.In some of any embodiments, the threshold level for IL-16 is a value of at or about 400 pg/mL.
  • the threshold level for IL-16 is a value of at or about 500 pg/mL. In some of any embodiments, the threshold level for IL-16 is a value of at or about 600 pg/mL. In some of any embodiments, the threshold level for IL-16 is a value of at or about 700 pg/mL. In some of any embodiments, the threshold level for IL-16 is a value of at or about 800 pg/mL. In some of any embodiments, the threshold level for IL-16 is a value of at or about 900 pg/mL. In some of any embodiments, the threshold level for IL-16 is a value of at or about 1000 pg/mL.
  • the level, amount or concentration of both TNF and IL- 16 are assessed; and the threshold level for TNF is a value of at or about 7 pg/mL, 8 pg/mL, 9 pg/mL, 10 pg/mL, 15 pg/mL, 20 pg/mL, or 25 pg/mL, or a value between any of the foregoing
  • the threshold level for IL-16 is a value of at or about 400 pg/mL, 500 pg/mL, 600 pg/mL, 700 pg/mL, 800 pg/mL, 900 pg/mL or 1000 pg/mL, or a value between any of the foregoing.
  • the level, amount or concentration of both TNF and IL- 16 are assessed; and the threshold level for TNF is a value between at or about 8 pg/mL and at or about 10 pg/mL; and the threshold level for IL-16 is a value between at or about 500 pg/mL and at or about 700 pg/mL.
  • the biological sample is or is obtained from a blood, plasma or serum sample.
  • assessing includes contacting a biological sample with one or more reagent capable of detecting or that is specific for TNF and/or IL-16, optionally wherein the one or more reagent includes an antibody that specifically recognizes TNF and/or IL-16; and detecting the presence or absence of a complex including the one or more reagent and TNF and/or IL-16.
  • assessing includes contacting a biological sample with one or more reagent capable of detecting or that is specific for TNF and detecting the presence or absence of a complex including the one or more reagent and TNF.
  • the one or more reagent includes an antibody that specifically recognizes TNF. In some of any embodiments, assessing includes contacting a biological sample with one or more reagent capable of detecting or that is specific for IL-16 and detecting the presence or absence of a complex including the one or more reagent and IL-16. In some embodiments, the one or more reagent includes an antibody that specifically recognizes IL16. In some of any embodiments, assessing includes an immunoassay.
  • the assessing comprises enzyme-linked immunosorbent assay (ELISA), immunoblotting, immunoprecipitation, radioimmunoassay (RIA), immuno staining, a flow cytometry assay, surface plasmon resonance (SPR), a chemiluminescence assay, a lateral flow immunoassay, an inhibition assay or an avidity assay.
  • the assessing comprises an enzyme-linked immunosorbent assay (ELISA).
  • the assessing comprises a sandwich enzyme-linked immunosorbent assay (ELISA).
  • the ELISA is a bead-based ELISA.
  • the agent or other treatment is or includes an anti-IL-6 antibody, anti-IL-6R antibody or a steroid. In some of any embodiments, the agent or other treatment is or includes an anti-IL-6 antibody. In some of any embodiments, the agent or other treatment is or includes an anti-IL-6R antibody. In some of any embodiments, the agent or other treatment is or includes a steroid. In some of any embodiments, the agent is or includes tocilizumab, siltuximab or dexamethasone. In some of any embodiments, the agent is or includes tocilizumab. In some of any embodiments, the agent is or includes siltuximab.
  • the agent is or includes dexamethasone.
  • the neurotoxicity is severe neurotoxicity. In some of any embodiments, the neurotoxicity is grade 3 or higher neurotoxicity. In some of any embodiments, the neurotoxicity is grade 3 neurotoxicity. In some of any embodiments, the neurotoxicity is grade 4 neurotoxicity. In some of any embodiments, the neurotoxicity is grade 5 neurotoxicity.
  • vascular endothelial growth factor C vascular endothelial growth factor C
  • VEGLR1 vascular endothelial growth factor receptor 1
  • the biological sample is from a subject having a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL) that is a candidate for treatment with a cell therapy, said cell therapy including a dose of engineered cells including T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD 19), wherein the biological sample is obtained from the subject prior to administering the cell therapy; and comparing, individually, the level, amount or concentration of the VEGLC and/or VEGLR1 in the sample to a threshold level; wherein if the level, amount or concentration of VEGLC and/or VEGLR1 is below the respective threshold level, identifying the
  • vascular endothelial growth factor C vascular endothelial growth factor C
  • VEGLR1 vascular endothelial growth factor receptor 1
  • the biological sample is from a subject having a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL) that is a candidate for treatment with a cell therapy, said cell therapy including a dose of engineered cells including T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD 19), wherein the biological sample is obtained from the subject prior to administering the cell therapy; and selecting a subject who is likely to respond to treatment based on the results of determining a likelihood that a subject will achieve a response to the cell therapy by comparing, individually, the level, amount or concentration of the VEGFC and/or VEGFR1 in the sample to
  • vascular endothelial growth factor C VEGFC
  • VEGFR1 vascular endothelial growth factor receptor 1
  • the threshold level is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation is at or about or above the median or mean level, amount or concentration of VEGFC and/or VEGFR1 in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group achieved a response, after administration of a dose of engineered cells expressing the CAR for treating the CLL or the SLL; the threshold level is at or greater than 1.25-fold higher, at or greater than 1.3-fold higher, at or greater than 1.4-fold higher or at or greater than 1.5-fold higher than the median or mean level, amount or concentration of VEGFC and/or VEGFR1 in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group achieved a response, after administration of a dose of engineered cells expressing the CAR for treating the CLL or the SLL; the threshold level is at or greater than 1.
  • the threshold level for VEGFC is a value between at or about 60 pg/mL and at or about 70 pg/mL. In some of any embodiments, the threshold level for VEGFR1 is a value between at or about 80 pg/mL and at or about 120 pg/mL. In some of any embodiments, the level, amount or concentration of both VEGFC and VEGFR1 are assessed; and the threshold level for VEGFC is a value between at or about 60 pg/mL and at or about 70 pg/mL; and the threshold level for VEGFR1 is a value between at or about 80 pg/mL and at or about 120 pg/mL.
  • the threshold level for VEGFC is a value at or about 60 pg/mL. In some of any embodiments, the threshold level for VEGFC is a value at or about 65 pg/mL. In some of any embodiments, the threshold level for VEGFC is a value at or about 70 pg/mL. In some of any embodiments, the threshold level for VEGFR1 is a value at or about 80 pg/mL. In some of any embodiments, the threshold level for VEGFR1 is a value at or about 90 pg/mL.
  • the threshold level for VEGFR1 is a value at or about 100 pg/mL. In some of any embodiments, the threshold level for VEGFR1 is a value at or aboutl 1 pg/mL. In some of any embodiments, the threshold level for VEGFR1 is a value at or about 120 pg/mL.
  • the biological sample is or is obtained from a blood, plasma or serum sample.
  • assessing includes contacting a biological sample with one or more reagent capable of detecting or that is specific for VEGFC and/or VEGFR1, optionally wherein the one or more reagent includes an antibody that specifically recognizes VEGFC and/or VEGFR1; and detecting the presence or absence of a complex including the one or more reagent and VEGFC and/or VEGFR1.
  • assessing includes contacting a biological sample with one or more reagent capable of detecting or that is specific for VEGFC and detecting the presence or absence of a complex including the one or more reagent and VEGFC.
  • the one or more reagent includes an antibody that specifically recognizes VEGFC.
  • assessing includes contacting a biological sample with one or more reagent capable of detecting or that is specific for VEGFR1 and detecting the presence or absence of a complex including the one or more reagent and VEGFR1.
  • the one or more reagent includes an antibody that specifically recognizes VEGFR1.
  • the assessing includes an immunoassay.
  • the response includes objective response.
  • the objective response includes complete response (CR; also known in some cases as complete remission), complete remission with incomplete blood count recovery (CRi), complete remission (CR), CR with incomplete marrow recovery (CRi), nodular partial remission (nPR), partial response (PR).
  • CR complete response
  • CRi complete blood count recovery
  • CRi complete remission
  • CRi complete remission
  • CRi complete remission
  • CRi CR with incomplete marrow recovery
  • nPR nodular partial remission
  • PR partial response
  • the response is assessed at or about 1, 2, or 3 months or more after the initiation of administration of the cell therapy.
  • the response is assessed at or about 1 month after the initiation of administration of the cell therapy. In some of any embodiments, the response is assessed at or about 2 months after the initiation of administration of the cell therapy. In some of any embodiments, the response is response that is assessed at or about 3 months after the initiation of administration of the cell therapy.
  • the method further includes, prior to the administration of the cell therapy, administering a lymphodepleting therapy to the subject.
  • the subject has been preconditioned with a lymphodepleting therapy.
  • the lymphodepleting therapy includes the administration of fludarabine and/or cyclophosphamide.
  • the biological sample is obtained from the subject prior to administration of the lymphodepleting therapy to the subject.
  • the value of the one or more parameters of disease burden is the value of the one or more parameters of disease burden prior to administration of a lymphodepleting therapy to the subject. In some embodiments, the one or more parameters of disease burden is assessed prior to administration of a lymphodepleting therapy to the subject.
  • the lymphodepleting therapy includes the administration of fludarabine. In some of any embodiments, the lymphodepleting therapy includes the administration of cyclophosphamide. In some of any embodiments, the lymphodepleting therapy includes the administration of fludarabine and cyclophosphamide. In some of any embodiments, the lymphodepleting therapy includes administration of cyclophosphamide at about 200-400 mg/m 2 , optionally at or about 300 mg/m 2 , inclusive, and/or fludarabine at about 20-40 mg/m 2 , optionally 30 mg/m 2 , daily for 2-4 days, optionally for 3 days.
  • the lymphodepleting therapy includes administration of cyclophosphamide at or about 300 mg/m 2 and fludarabine at about 30 mg/m 2 daily for 3 days, optionally wherein the dose of cells is administered at least at or about 2-7 days after the lymphodepleting therapy or at least at or about 2-7 days after the initiation of the lymphodepleting therapy.
  • the method further includes administering a Bruton’s Tyrosine Kinase inhibitor (BTKi) to the subject.
  • BTKi Tyrosine Kinase inhibitor
  • the BTKi is ibmtinib.
  • the BTKi administration is initiated prior to the initiation of administration of the cell therapy.
  • the BTKi administration is continued until after the initiation of administration of the cell therapy.
  • the BTKi administration is continued for at least at or about 90 days after the initiation of administration of the cell therapy.
  • the ibmtinib is administered at a dose of at or about 140 mg to at or about 840 mg per day.
  • the ibmtinib is administered at a dose of at or about 280 mg to at or about 560 mg per day. In some of any embodiments, the ibmtinib is administered at a dose of at or about 420 mg per day. In some of any embodiments, the disease or condition is a relapsed or refractory (r/r) CLL. In some of any embodiments, the disease or condition is a relapsed or refractory (r/r) SLL.
  • the dose of engineered cells includes a defined ratio of CD4 + cells expressing the CAR to CD8 + cells expressing the CAR, optionally wherein the ratio is between approximately 1:3 and approximately 3:1. In some of any embodiments, the dose of engineered cells includes a defined ratio of CD4 + cells expressing the CAR to CD8 + cells expressing the CAR. In some embodiments, the ratio is between approximately 1:3 and approximately 3:1. In some of any embodiments, the dose of engineered cells includes a defined ratio of CD4 + cells expressing the CAR to CD8 + cells expressing the CAR that is or is approximately 1:1. In some of any embodiments, the dose of engineered cells includes at or about 2.5 x 10 7 total CAR-expressing cells to at or about 1.0 x 10 8 total CAR-expressing cells.
  • the dose of engineered cells includes at or about 2.5 x 10 7 total CAR-expressing cells.
  • the dose of engineered cells includes at or about 5 x 10 7 total cells or total CAR-expressing cells. In some of any embodiments, the dose of engineered cells includes at or about 1 x 10 8 total cells or total CAR-expressing cells. In some of any embodiments, administration of the cell therapy includes administering a plurality of separate compositions, wherein the plurality of separate compositions includes a first composition including one of the CD4 + T cells and the CD8 + T cells and a second composition including the other of the CD4 + T cells and the CD8 + T cells. In some of any embodiments, the first composition includes the CD8 + T cells and the second composition includes the CD4 + T cells.
  • the initiation of the administration of the first composition is carried out prior to the initiation of the administration of the second composition, optionally carried out no more than 48 hours apart. In some of any embodiments, the initiation of the administration of the first composition is carried out no more than 48 horus prior to the initiation of the administration of the second composition.
  • the CAR included by the CD4 + T cells and/or the CAR included by the CD8 + T cells includes a CAR that is the same and/or wherein the CD4 + T cells and/or the CD8 + T cells are genetically engineered to express a CAR that is the same.
  • the CAR expressed by the CD4 + T cells and the CAR expressed by the CD8 + T cells is the same.
  • the CD4 + T cells and the CD8 + T cells are genetically engineered to express a CAR that is the same.
  • the subject prior to the administration of the cell therapy, the subject has been treated with one or more prior therapies for the CLL or SLL, other than another dose of cells expressing CAR or a lymphodepleting therapy, optionally at least two prior therapies.
  • prior to the administration of the cell therapy the subject has been treated with one or more prior therapies for the CLL or SLL, other than another dose of cells expressing CAR or a lymphodepleting therapy.
  • the subject prior to the administration of the cell therapy, has been treated with at least two prior therapies for the CLL or SLL, other than another dose of cells expressing CAR or a lymphodepleting therapy. In some of any embodiments, prior to the administration of the cell therapy, the subject has relapsed following remission after treatment with, or become refractory to, failed and/or was intolerant to treatment with two or more prior therapies.
  • the one or more prior therapies are selected from a kinase inhibitor, optionally an inhibitor of Bruton’s tyrosine kinase (BTK), optionally ibrutinib; venetoclax; a combination therapy including fludarabine and rituximab; radiation therapy; and hematopoietic stem cell transplantation (HSCT).
  • the one or more prior therapies includes ibrutinib.
  • the one or more prior therapies includes venetoclax.
  • the one or more prior therapies include an inhibitor of Bruton’s tyrosine kinase (BTK) and/or venetoclax.
  • the one or more prior therapies include ibrutinib and venetoclax.
  • the subject has relapsed following remission after treatment with, become refractory to failed treatment with and/or is intolerant to an inhibitor of Bruton’s tyrosine kinase (BTK) and/or venetoclax.
  • BTK tyrosine kinase
  • the subject has relapsed following remission after treatment with, become refractory to, failed treatment with and/or is intolerant to ibrutinib.
  • the subject has relapsed following remission after treatment with, become refractory to, failed treatment with and/or is intolerant to venetoclax.
  • the subject has relapsed following remission after treatment with, become refractory to, failed treatment with and/or is intolerant to ibrutinib and venetoclax.
  • the engineered cells are primary T cells obtained from a subject. In some of any embodiments, the engineered cells are autologous to the subject.
  • the CAR includes an extracellular antigen-binding domain specific for CD 19, a transmembrane domain, a cytoplasmic signaling domain derived from a costimulatory molecule, which optionally is a 4- IBB, and a cytoplasmic signaling domain derived from a primary signaling ITAM-containing molecule, which optionally is a CD3zeta and the CAR includes, in order, an extracellular antigen-binding domain specific for CD 19, a transmembrane domain, a cytoplasmic signaling domain derived from a costimulatory molecule, and a cytoplasmic signaling domain derived from a primary signaling ITAM- containing molecule.
  • the antigen-binding domain is an scFv.
  • the scFv includes a CDRL1 sequence of RASQDISKYLN (SEQ ID NO: 35), a CDRL2 sequence of SRLHSGV (SEQ ID NO: 36), and/or a CDRL3 sequence of GNTLPYTFG (SEQ ID NO: 37) and/or a CDRH1 sequence of DYGVS (SEQ ID NO: 38), a CDRH2 sequence of VIWGSETTYYNSALKS (SEQ ID NO: 39), and/or a CDRH3 sequence of YAMDYWG (SEQ ID NO: 40);
  • the scFv includes a variable heavy chain region of FMC63 and a variable light chain region of FMC63 and/or a CDRL1 sequence of FMC63, a CDRL2 sequence of FMC63, a CDRL3 sequence of FMC63, a CDRH1 sequence of FMC63, a CDRH2 sequence of FMC63, and a CDRH3 sequence of FMC63 or
  • the costimulatory signaling region is a signaling domain of CD28 or 4- IBB. In some of any embodiments, the costimulatory signaling region is a signaling domain of 4- IBB. In some of any embodiments, the costimulatory domain includes SEQ ID NO: 12 or a variant thereof having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%,
  • the primary signaling domain is a CD3zeta signaling domain.
  • the primary signaling domain includes SEQ ID NO: 13 or 14 or 15 having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto.
  • the CAR further includes a spacer between the transmembrane domain and the scFv.
  • the spacer is a polypeptide spacer that includes or consists of all or a portion of an immunoglobulin hinge or a modified version thereof, optionally an IgG4 hinge, or a modified version thereof.
  • the spacer is about 15 amino acids or less, and does not include a CD28 extracellular region or a CD8 extracellular region. In some of any embodiments, the spacer is at or about 12 amino acids in length.
  • the spacer has or consists of the sequence of SEQ ID NO: 1, a sequence encoded by SEQ ID NO: 2, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, or a variant of any of the foregoing having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto; and/or includes or consists of the formula X1PPX2P, where Xi is glycine, cysteine or arginine and X2 is cysteine or threonine.
  • the scFv includes an amino acid sequence of RASQDISKYLN (SEQ ID NO: 35), an amino acid sequence of SRLHSGV (SEQ ID NO: 36), and/or an amino acid sequence of GNTLPYTFG (SEQ ID NO: 37) and/or an amino acid sequence of DYGVS (SEQ ID NO: 38), an amino acid sequence of VIWGSETTYYNSALKS (SEQ ID NO: 39), and/or an amino acid sequence of YAMDYWG (SEQ ID NO: 40) or wherein the scFv includes a variable heavy chain region of FMC63 and a variable light chain region of FMC63 and/or a CDRL1 sequence of FMC63, a CDRL2 sequence of FMC63, a CDRL3 sequence of FMC63, a CDRH1 sequence of FMC63, a CDRH2 sequence of FMC63, and a CDRH3 sequence of FMC63 or binds to the same epitope as or compete
  • the antigen binding domain includes an scFv that includes a variable heavy chain region of FMC63 and a variable light chain region of FMC63;
  • the spacer is a polypeptide spacer that includes the sequence of SEQ ID NO: 1;
  • the costimulatory domain includes SEQ ID NO: 12;
  • the primary signaling domain includes SEQ ID NO: 13, 14 or 15.
  • the subject is a human subject.
  • an article of manufacture including a composition for a cell therapy, or one of a plurality of compositions for a cell therapy, including T cells expressing a CAR that binds CD 19, and instructions for administering the cell therapy, wherein the instructions specify administering the T cell composition according to any of the provided methods.
  • PD progressive disease
  • SD stable disease
  • PR partial response
  • nPR nodular partial response
  • CR complete response
  • CRi complete response with incomplete marrow recovery.
  • IB shows results of undetectable minimal residual disease (uMRD) in blood by flow cytometry or in bone marrow by next generation sequencing (NGS) at any time point following administration to subjects with R/R CLL of anti-CD19 CAR-expressing T cells at DL1 (5 x 10 7 CAR-expressing T cells) or DL2 (1 x 10 8 CAR-expressing T cells).
  • uMRD undetectable minimal residual disease
  • NGS next generation sequencing
  • FIG. 3 shows a graph of the median cells/pl over time by dose levels in subjects with R/R CLL administered anti-CD19 CAR+ T cells at DL1 (5 x 10 7 CAR-expressing T cells) or DL2 (1 x 10 8 CAR-expressing T cells).
  • Upper error bar represents the third quartile
  • lower error bar represents the first quartile.
  • the dose of anti-CD 19 CAR+ T cells was given on day 1.
  • a Upper error bar represents the third quartile
  • lower error bar represents the first quartile.
  • uMRD undetectable minimal residual disease
  • NGS next generation sequencing
  • a Evaluable for response defined as having a pretreatment assessment and >1 post-baseline assessment; evaluable for MRD was defined as patients with detectable MRD at baseline. One subject was not evaluable for response.
  • b Failed venetoclax defined as discontinuation due to PD or ⁇ PR after >3 months of therapy.
  • c Two subjects were not evaluable for MRD.
  • d One subject was not evaluable for MRD.
  • Cl confidence interval
  • CRi complete response with incomplete blood count recovery
  • NGS next-generation sequencing
  • nPR nodular partial response
  • PD progressive disease
  • PR partial response
  • SD stable disease
  • uMRD undetectable minimal residual disease.
  • FIG. 5 shows a swimmer plot of the duration of response over time in individual subjects with R/R CLL who have failed prior treatment with both a BTKi and venetoclax, and the other treated subjects. *MRD non-evaluable. There were 7 on-study deaths: 5 subjects died from disease progression; 1 subject had grade 5 respiratory failure (DL1) unrelated to CAR+T cells therapy treatment; 1 subject had septic shock, acute kidney injury, and pneumonia (DL2), unrelated to CAR+T cells therapy treatment. No deaths occurred within the first 30 days. ND, not done; RT, Richter Transformation. [0060] FIG.
  • FIG. 6 shows a graph of the median cells/pL over time by dose levels in evaluable treated subjects and subjects who have failed prior treatment with both a BTKi and venetoclax.
  • Upper error bar represents the third quartile.
  • Lower error bar represents the first quartile.
  • FIG. 7C shows the relationship between blood and lymph node tumor burden, in subjects that developed no neurological events (open circles), subjects with grade 1 or 2 neurological events (open squares), and subjects with severe (grade 3 or higher) neurological events (Y, filled diamonds).
  • the boxed region indicates that 5 of 5 subjects with severe (grade 3 or higher) neurological events exhibited low blood tumor burden.
  • FIG. 9B shows the relationship between levels of IL-16 and TNF in blood, two days after administration of CAR+ T cells, and lymph node tumor burden (as measured by sum of the products of diameters (SPD)), in groups of subjects that exhibited no neurological events (Gr 0 NE; open circles), grade 1 or 2 neurological events (Gr 1-2 NE; open squares), or grade 3 or 4 neurological events (Gr 3-4 NE; filled diamonds).
  • SPD sum of the products of diameters
  • 9C shows the relationship between levels of IL-16 and TNF in blood, two days after administration of CAR+ T cells, and lymph node tumor burden (as measured by largest observed lymph node diameter (cm)), in groups of subjects that exhibited no neurological events (Gr 0 NE; open circles), grade 1 or 2 neurological events (Gr 1-2 NE; open squares), or grade 3 or 4 neurological events (Gr 3-4 NE; filled diamonds).
  • FIGS. 10A-10B show the level of vascular endothelial growth factor C (VEGFC; FIG. 10A) and vascular endothelial growth factor receptor 1 (VEGFR1; FIG. 10B), measured in pg/mL, in samples from subjects obtained immediately prior to CAR+ T cell administration, in responders at 3 months (M3 R; subjects that achieved CR, CRi, PR or nPR at 3 months after administration) and non-responders at 3 months (M3 NR; subjects that exhibited SD or PD at or before 3 month after administration) after administration of the CAR+ T cells.
  • M3 R subjects that achieved CR, CRi, PR or nPR at 3 months after administration
  • M3 NR subjects that exhibited SD or PD at or before 3 month after administration
  • FIG. 11A shows the mean CD3+ CAR+ T cell concentrations (measured as cells/pL) evaluated for day 1 through month 3 post-infusion, in responders at 3 months (M3 R; subjects that achieved CR, CRi, PR or nPR at 3 months after administration) and non-responders at 3 months (M3 NR; subjects that exhibited SD or PD at or before 3 month after administration).
  • FIG. 11B shows the mean CD3 CAR+ T cell concentrations evaluated for subjects that received CAR+ T cells alone (CAR T cell only), and subjects receiving CAR+ T cells and ibmtinib in combination (CAR T cell and ibmtinib), evaluated for day 1 through month 3 post-infusion.
  • FIG. 12 shows the number of concordant and discordant MRD statuses, and the overall concordance between bone marrow (BM) minimal residual disease (MRD) status measured by NGS-based assay (at 10 4 sensitivity), and peripheral blood (PB) MRD status measured by flow cytometry (at 10 4 sensitivity), at day 30 or 3 months after administration of anti-CD 19 CAR+ T cells.
  • BM bone marrow
  • MRD minimal residual disease
  • PB peripheral blood
  • flow cytometry at 10 4 sensitivity
  • the methods involve assessing one or more parameters that relate to the disease or disorder of the subject, such as parameters that relate to tumor burden in a subject.
  • the methods involve assessing the level, concentration, and/or amount of a biomarker or an analyte (e.g., blood analytes, including cytokines and growth factors, and receptors).
  • the parameter, biomarker or analyte is associated with, correlated with or indicative of a toxicity, such as neurotoxicity, that can be associated with cell therapy.
  • the parameter, biomarker or analyte is associated with, correlated with or indicative of a subject’s response (e.g., objective response, partial response and/or complete response) to a cell therapy.
  • the methods are employed in conjunction with, in the context of, or as a part of, a cell therapy, such as a cell therapy that involves administering engineered cells, such as engineered T cells that express a recombinant receptor, such as a chimeric antigen receptor (CAR); and in some cases, administration of an additional agent.
  • a toxicity such as neurotoxicity
  • CAR chimeric antigen receptor
  • the provided methods and uses in some aspects relate to uses of engineered cells (e.g., T cells) and/or compositions thereof, for the treatment of subjects having a disease or condition, which generally is or includes a cancer or a tumor, such as a leukemia or a lymphoma, most particularly chronic lymphocytic leukemia (CLL), or small lymphocytic lymphoma (SLL).
  • a disease or condition which generally is or includes a cancer or a tumor, such as a leukemia or a lymphoma, most particularly chronic lymphocytic leukemia (CLL), or small lymphocytic lymphoma (SLL).
  • CLL chronic lymphocytic leukemia
  • SLL small lymphocytic lymphoma
  • the methods and uses provide for or achieve improved response and/or more durable responses or efficacy and/or a reduced risk of toxicity or other side effects, e.g., in particular groups of subjects treated, as compared to certain alternative methods.
  • the methods are advantageous by virtue of being able to determine the risk of toxicity (e.g., neurotoxicity) and/or the likelihood of a subject to respond to the cell therapy, following administration of the CAR+ T cells.
  • the methods can also include a cell therapy that involves the administration of specified number or relative number of the engineered cells, the administration of defined ratios of particular types of the cells, treatment of particular patient populations, such as those having a particular risk profile, staging and/or prior treatment history and/or combinations thereof.
  • methods that include assessing particular parameters, e.g., tumor burden measurements and/or expression of specific biomarkers or analytes, that can be correlated with development of toxicity, and methods for treatment, e.g., intervention therapy, to prevent and/or ameliorate toxicities.
  • particular parameters e.g., tumor burden measurements and/or expression of specific biomarkers or analytes, that can be correlated with development of toxicity
  • methods for treatment e.g., intervention therapy
  • an outcome such as a therapeutic outcome, including a response, such as an objective response (OR), a complete response (CR) or a partial response (PR); or a safety outcome, such as a development of a toxicity, for example, neurotoxicity, after administration of a cell therapy.
  • compositions for use in cell therapy are also provided.
  • articles of manufacture and kits e.g., for use in the methods provided herein. In some embodiments, the articles of manufacture and kits optionally contain instructions for using, according to the methods provided herein.
  • CLL is considered an incurable disease, and subjects eventually relapse or become refractory to available therapies or treatments.
  • the subjects have a high risk disease.
  • the subjects have a high risk CLL or SLL.
  • existing treatment strategies for high risk and very high risk subjects may include fludarabine, cyclophosphamide, and rituximab (FCR), Bruton’s tyrosine kinase (BTK) inhibitors (e.g. ibrutinib), and/or allogeneic stem cell transplantation.
  • fludarabine fludarabine, cyclophosphamide, and rituximab (FCR)
  • Bruton’s tyrosine kinase (BTK) inhibitors e.g. ibrutinib
  • allogeneic stem cell transplantation e.g. ibrutinib
  • adoptive cell therapies including those involving the administration of cells expressing chimeric receptors specific for a disease or disorder of interest, such as chimeric antigen receptors (CARs) and/or other recombinant antigen receptors, as well as other adoptive immune cell and adoptive T cell therapies
  • CARs chimeric antigen receptors
  • adoptive immune cell and adoptive T cell therapies can be used for the treatment of cancer, such as B cell malignancies, and other diseases and disorders.
  • available approaches to adoptive cell therapy may not always be entirely satisfactory.
  • optimal efficacy can depend on the ability of the administered cells to recognize and bind to a target, e.g., target antigen, to traffic, localize to and successfully enter appropriate sites within the subject, tumors, and environments thereof, to become activated, expand, to exert various effector functions, including cytotoxic killing and secretion of various factors such as cytokines, to persist, including long-term, to differentiate, transition or engage in reprogramming into certain phenotypic states (such as effector, long-lived memory, less-differentiated, and effector states), to provide effective and robust recall responses following clearance and re-exposure to target ligand or antigen, and avoid or reduce exhaustion, anergy, terminal differentiation, and/or differentiation into a suppressive state.
  • a target e.g., target antigen
  • the provided embodiments are based on observations that the efficacy of adoptive cell therapy may be limited by the development of toxicity, such as neurotoxicity, in the subject to whom such cells are administered, and that particular parameters and/or biomarkers can be correlated to, associated with and/or predictive of the development of toxicity.
  • toxicity such as neurotoxicity
  • such findings can be used to determine the risk of toxicity after administration of a cell therapy for a particular subject, for example, at early time points after administration or even before administration of the cell therapy.
  • the toxicity such as neurotoxicity
  • a CAR can result in toxicity or risk thereof, such as neurotoxicity, including, in some cases, severe neurotoxicity.
  • a higher dose of such cells can increase the efficacy of the treatment, for example, by increasing exposure to the cells such as by promoting expansion and/or persistence, they may also result in an even greater risk of developing a toxicity or a more severe toxicity.
  • subjects with a higher disease burden, such as a higher lymph node tumor burden also may be at a greater risk for developing a toxicity or a more severe toxicity.
  • Certain available methods for treating or ameliorating toxicity may not always be entirely satisfactory.
  • Many such approaches focus, for example, on targeting downstream effects of toxicity, such as by cytokine blockade, and/or delivering agents such as high-dose steroids which can also eliminate or impair the function of administered cells.
  • agents such as high-dose steroids which can also eliminate or impair the function of administered cells.
  • such approaches often involve administration of such interventions only upon detection of physical signs or symptoms of toxicity, which, in some cases, may develop upon development of severe toxicity in the subject.
  • Many of these other approaches also do not prevent other forms of toxicity such as neurotoxicity, which can be associated with adoptive cell therapy.
  • such therapies are administered only after a subject presents with a physical sign or symptom of a toxicity.
  • approaches in which an agent for ameliorating toxicity is administered concurrently with the administration of the cells, or within a window of time after administration of cells, but before the development of a physical sign or symptom or severe sign or symptom, at least without the appropriate level of risk assessment, may not be satisfactory.
  • not all subjects administered with a cell therapy will or do develop a toxic outcome, or develop such a toxic outcome that requires intervention.
  • such alternatives in some contexts would involve needlessly treating certain subjects in which such treatment may be unwarranted.
  • agents and therapies are themselves associated with toxic side effects.
  • Such side effects may be even greater at the higher dose or frequency in which is it necessary to administer or treat with the agent or therapy in order to treat or ameliorate the severity of the toxicity that can result from cell therapy.
  • an agent or therapy for treating a toxicity may limit the efficacy of the cell therapy, such as the efficacy of the chimeric receptor (e.g. CAR) expressed on cells provided as part of the cell therapy (Sentman (2013) Immunotherapy, 5:10).
  • the chimeric receptor e.g. CAR
  • the provided methods offer advantages over available approaches and alternative solutions for addressing, predicting, and treating or preventing, the risk of toxic outcomes.
  • the provided methods in some embodiments result in the identification of only those subjects predicted to be at risk or above a particular threshold risk level for developing toxicity, such as one related to a cell therapy.
  • the provided methods in some embodiments permit intervention in toxic outcomes in only a subset of subjects that are more likely to develop toxicity. In many cases, this avoids treating the toxicity in all subjects being administered the cell therapy, which as described above may be unwarranted if many of the subjects would never have developed the toxicity and/or can result in unwanted effects.
  • the provided embodiments also provide advantages associated with the feature that the risk of developing toxicity, such as neurotoxicity (e.g. severe neurotoxicity) and/or the likelihood of response, can be predicted early, such as before administration, shortly after administration or initiation of a treatment such as a cell therapy, or after administration or initiation of a first dose of cell therapy.
  • neurotoxicity e.g. severe neurotoxicity
  • those subjects that are predicted to be at risk of and/or are more likely to be at risk for developing toxicity e.g. neurotoxicity, such as severe neurotoxicity
  • the ability to intervene early in the treatment of a toxic outcome or the potential of a toxic outcome can mean that a reduced dosage of an agent for treating or ameliorating the toxicity can be given and/or a decreased frequency of administration of such agent or therapy can be given.
  • the provided methods are based on observations that certain parameters, biomarkers or analytes, such as certain cytokine biomarkers, differ in subjects who later developed a toxicity, in samples obtained before treatment or early after administration of an adoptive cell therapy. In other aspects, the provided methods are also based on observations that certain parameters, biomarkers or analytes differ in subjects who later achieved a response, such as a durable response, after administration of an adoptive cell therapy.
  • biomarkers as described herein can be used in predictive methods to identify subjects that are likely or more likely to develop a toxicity to the cell therapy and/or unlikely to respond, such that subjects and effective doses can be selected prior to treatment and/or modifications (e.g., additional therapeutic agent and/or changes in monitoring) of the treatment can be made early during treatment.
  • modifications e.g., additional therapeutic agent and/or changes in monitoring
  • biomarkers as described herein can be used in predictive methods to identify subjects that are likely or more likely to develop a toxicity to the cell therapy, such that subjects and effective doses can be selected prior to treatment and/or modifications (e.g., additional therapeutic agent and/or changes in monitoring) of the treatment can be made early during treatment.
  • biomarkers as described herein can be used in predictive methods to identify subjects that are likely or more likely to respond to treatment, such that subjects and effective doses can be selected prior to treatment and/or modifications (e.g., additional therapeutic agent and/or changes in monitoring) of the treatment can be made early during treatment.
  • Such methods can inform rational strategies for early intervention and thereby facilitate the safe and effective clinical application of adoptive cell therapy, such as CAR-T cell therapy.
  • the provided methods and uses can be employed in the context of a method of treatment with a cell therapy, that includes administration of the engineered cells to a subject selected or identified as having a certain prognosis or risk of CLL.
  • Chronic lymphocytic leukemia (CLL) is a generally a variable disease. Some subjects with CLL may survive without treatment while others may require immediate intervention.
  • subjects with CLL may be classified into groups that may inform disease prognosis and/or recommended treatment strategy. In some cases, these groups may be “low risk,” “intermediate risk,” “high risk,” and/or “very high risk” and patients may be classified as such depending on a number of factors including, but not limited to, genetic abnormalities and/or morphological or physical characteristics.
  • subjects treated in accord with the method are classified or identified based on the risk of CLL.
  • the subject is one that has high risk CLL.
  • the provided methods and uses can also provide for or achieve improved responses or efficacy as compared to certain alternative methods, such as in particular groups of subjects treated, such as in patients with a leukemia, such as CLL or SLL.
  • determining the likelihood of a subject in arriving at a particular outcome or state can be a factor in identifying and selecting a subject for treatment, such as by selecting a subject who is likely to respond to treatment based on the results of determining a likelihood that a subject will achieve a response to the cell therapy, and/or modifying the treatment regimen, selecting a subject for treatment with an additional therapeutic agent, or identifying the appropriate dose for administration.
  • the methods are advantageous by virtue of determining such outcome or state, before treatment or shortly after initiation of treatment, such that the response to the treatment is improved without an increase in the risk of toxicity.
  • the methods also include administering to a subject an additional therapeutic agent, such as an agent for amelioration of toxicity and/or other additional therapeutic agents, such as a kinase inhibitor.
  • an additional therapeutic agent such as an agent for amelioration of toxicity and/or other additional therapeutic agents, such as a kinase inhibitor.
  • a risk for developing toxicity associated with cell therapy in a subject that involves assessing or detecting biomarkers (e.g., analytes) or parameters that are associated with the toxicity, e.g., neurotoxicity, such as severe neurotoxicity.
  • methods of assessing the likelihood of response to a cell therapy in a subject that involves assessing or detecting biomarkers (e.g., analytes) or parameters that are associated with a response outcome, such as objective response (OR), including complete response (CR), CR with incomplete marrow recovery (CRi), nodular partial remission (nPR), partial response (PR).
  • OR objective response
  • CR complete response
  • CRi CR with incomplete marrow recovery
  • nPR nodular partial remission
  • PR partial response
  • the methods involve assessing one or more parameters of disease burden, such as lymph node tumor burden, blood tumor burden and the ratio of blood tumor burden to lymph node tumor burden. In some of any embodiments, the methods involve assessing lymph node tumor burden. In some of any embodiments, the methods involve assessing blood tumor burden. In some of any embodiments, the methods involve assessing the ratio of blood tumor burden to lymph node tumor burden. In some of any embodiments, the methods involve assessing the level, concentration or amount of one or more biomarkers or analytes, such as interleukin 16 (IL-16), tumor necrosis factor (TNF), vascular endothelial growth factor C (VEGFC) or vascular endothelial growth factor receptor 1 (VEGFR1).
  • IL-16 interleukin 16
  • TNF tumor necrosis factor
  • VEGFC vascular endothelial growth factor C
  • VFGFR1 vascular endothelial growth factor receptor 1
  • the methods involve assessing the level, concentration or amount of interleukin 16 (IL-16). In some of any embodiments, the methods involve assessing the level, concentration or amount of tumor necrosis factor (TNF). In some of any embodiments, the methods involve assessing the level, concentration or amount of vascular endothelial growth factor C (VEGFC). In some of any embodiments, the methods involve assessing the level, concentration or amount of vascular endothelial growth factor receptor 1 (VEGFR1).
  • IL-16 interleukin 16
  • TNF tumor necrosis factor
  • VEGFC vascular endothelial growth factor C
  • VEGFR1 vascular endothelial growth factor receptor 1
  • the methods involve comparing the value of a parameter or the level, concentration or amount of the biomarker or analyte, to a threshold value for that particular parameter, biomarker or analyte. In some embodiments, the comparison can be used to determine the risk of toxicity and/or the likelihood of response to a cell therapy.
  • the cell therapy includes a dose of engineered cells including T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD19).
  • CAR chimeric antigen receptor
  • the parameter, biomarker or analyte is assessed from a subject or in a sample obtained from a subject, that has a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL).
  • the subject is a candidate for treatment with a cell therapy, and/or has received treatment with a cell therapy.
  • the provided methods can be used to identify or select subjects with a risk of developing a toxicity and/or that are likely to respond to a cell therapy; and/or select subjects for a particular treatment, such as with additional therapeutic agents, for example, an agent or a treatment to ameliorate any toxicities.
  • the methods also involve further monitoring the subject for possible symptoms of toxicity based on the risk of toxicity determined in accordance with the provided embodiments, e.g., by assessment of a parameter or a biomarker and/or comparison of the parameter or biomarker to a reference value or threshold level of the particular parameter or biomarker.
  • the methods also involve further monitoring the subject for possible response, based on the likelihood of response as determined in accordance with the provided embodiments, e.g. by assessment of a parameter or a biomarker and/or comparison of the parameter or biomarker to a reference value or threshold level of the particular parameter or biomarker.
  • the methods involve assessing or detecting the presence or absence of one or a panel of biomarkers (e.g. analytes) and/or parameters (e.g. concentration, amount, level or activity) associated with one or a panel of biomarkers (e.g. analytes).
  • a panel of biomarkers e.g. analytes
  • parameters e.g. concentration, amount, level or activity
  • the methods can include comparing the one or more parameters to a particular reference value, such as a threshold level, e.g., those associated with a risk for developing toxicity (e.g., neurotoxicity) or those associated with a particular response, such as OR, CR, ORR, CRi, PR, nPR, SD or PD, and/or durable response, such as a response that is durable for 3 months, 6 months, 9 months 12 months or more, after the initial response.
  • the methods also involve selecting subjects for treatment with a cell therapy based on the assessment of the presence or absence of the biomarker and/or comparison of the biomarkers to a reference value or threshold level of the biomarker.
  • the parameter that is assessed is or includes attributes, factors, characteristic of the patient and/or the disease or condition, and/or expression of biomarkers.
  • the parameter is or includes one or more factors indicative of the state of the patient and/or the disease or condition of the patient.
  • the parameter is indicative of tumor burden.
  • the parameter is indicative of tumor burden in a particular organ or tissue, such as lymph node tumor burden or blood tumor burden.
  • the parameter is or includes attributes, factors, characteristic of the patient and/or the disease or condition.
  • the parameter is a parameter related to tumor burden, e.g., a measurement of tumor burden.
  • a biological sample e.g., blood sample or tissue sample from the subject
  • a biomarker e.g. analyte
  • a parameter e.g. concentration, amount, level or activity
  • certain physiological or biological parameters associated with a biomarker including expression of biomarkers and/or clinical and laboratory parameters, can be assessed, from a biological sample, e.g., blood, from subjects before or after administration of the cell therapy.
  • expression biomarkers or analytes and/or clinical and laboratory parameters can be assessed from a biological sample, e.g., blood, from subjects before administration of the cell therapy (pre treatment). In some embodiments, expression biomarkers or analytes and/or clinical and laboratory parameters, can be assessed from a biological sample, e.g., blood, from subjects after administration of the cell therapy (post-treatment). In some embodiments, the concentration, amount, level or activity of biomarkers (e.g., analytes) and/or clinical and laboratory parameters can be assessed at one or more time points before or after administration of the cell therapy. In some embodiments, the peak concentration, amount, level or activity of biomarkers (e.g., analytes) and/or clinical and laboratory parameters during a specified period of time can also be determined.
  • a biomarker or an analyte is an objectively measurable characteristic or a molecule expressed by or in a biological sample, including cells, which can be indicative of or associated with a particular state or phenomenon, such as a biological process, a therapeutic outcome, a cell phenotype or a diseased state.
  • a biomarker or an analyte or parameters associated with a biomarker or an analyte can be measured or detected.
  • the presence or absence of expression of a biomarker or analyte can be detected.
  • the parameters such as concentration, amount, level or activity of the biomarker or analyte can be measured or detected.
  • the presence, absence, expression, concentration, amount, level and/or activity of the biomarker can be associated with, correlated to, indicative of and/or predictive of particular states, such as particular therapeutic outcomes or state of the subject.
  • the presence, absence, expression, concentration, amount, level and/or activity of the biomarker or analyte, such as any described herein can be used to assess the likelihood of a particular outcome or state, such as a particular therapeutic outcome, including response outcome or toxicity outcome.
  • exemplary biomarkers include cytokines, cell surface molecules, chemokines, receptors, soluble receptors, soluble serum proteins and/or degradation products.
  • biomarkers or analytes can also include particular attributes, factors, characteristic of the patient and/or the disease or condition or factors indicative of the state of the patient and/or the disease or condition of the patient (including disease burden), and/or clinical or laboratory parameters.
  • the biomarker is a cytokine. In some aspects, the biomarker is a chemokine. In some aspects, the biomarker is a growth factor. In some aspects, the biomarker is a receptor. In some aspects, the biomarker is a soluble receptor.
  • the biomarkers can be used singly or in combination with other biomarkers, such as in a panel of biomarkers.
  • expression of particular biomarkers can be correlated to particular outcomes or toxicities, e.g., development of neurotoxicity.
  • expression of particular biomarkers can be correlated to particular outcomes or response, such as objective response (OR), complete response (CR), CR with incomplete marrow recovery (CRi), nodular partial remission (nPR) or partial response (PR).
  • the methods include detecting the presence or absence of one or more biomarkers, such as a parameter (e.g. concentration, amount, level or activity) associated with one or more biomarkers, in which the one or more biomarkers are selected from among interleukin 16 (IL-16), tumor necrosis factor (TNF), vascular endothelial growth factor C (VEGFC) or vascular endothelial growth factor receptor 1 (VEGFR1).
  • IL-16 interleukin 16
  • TNF tumor necrosis factor
  • VEGFC vascular endothelial growth factor C
  • VFGFR1 vascular endothelial growth factor receptor 1
  • the parameter and/or the presence or absence and/or a parameter of one or more biomarkers is assessed from a biological sample.
  • the biological sample is a bodily fluid or a tissue.
  • the biological sample e.g., bodily fluid, is or contains whole blood, serum or plasma.
  • the parameter and/or the presence or absence and/or a parameter of one or more biomarkers is assessed prior to administration of the cell therapy (e.g., pre-infusion), e.g., obtained up to 2 days, up to 7 days, up to 14 days, up to 21 days, up to 28 days, up to 35 days or up to 40 days prior to initiation of the administration of the engineered cells.
  • the cell therapy e.g., pre-infusion
  • the biological sample is obtained from the subject prior to administration of the cell therapy (e.g., pre-infusion), e.g., obtained up to 2 days, up to 7 days, up to 14 days, up to 21 days, up to 28 days, up to 35 days or up to 40 days prior to initiation of the administration of the engineered cells.
  • the cell therapy e.g., pre-infusion
  • the biological sample is a blood, serum or plasma sample. In some embodiments, the biological sample is a blood sample. In some embodiments, the biological sample is an apheresis or leukapheresis sample. In some embodiments, the parameter and/or presence or absence and/or a parameter of one or more biomarkers (e.g. analytes) is assessed or the biological sample is obtained after administration of the cell therapy. In some embodiments, the reagents can be used prior to the administration of the cell therapy or after the administration of cell therapy, for diagnostic purposes, to identify subjects and/or to assess treatment outcomes and/or toxicities.
  • biomarkers e.g. analytes
  • the parameter and/or the presence or absence and/or a parameter of one or more biomarkers is assessed and/or the sample is obtained from the subject at a time that is within at or about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days orl5 days after initiation of administration of the genetically engineered cells.
  • the parameter and/or the presence or absence and/or a parameter of one or more biomarkers e.g.
  • analytes is assessed and/or the sample is obtained from the subject at a time that is between or between about 1 and 15 days, 1 and 12 days, 1 and 8 days, 1 and 5 days, 1 and 3 days or 1 and 2 days, each inclusive, after initiation of administration of the genetically engineered cells.
  • measuring the value of the one or more biomarkers comprises performing an in vitro assay.
  • the in vitro assay is an immunoassay, an aptamer- based assay, a histological or cytological assay, or an mRNA expression level assay.
  • the values of the one or more biomarkers are measured by an enzyme-linked immunosorbent assay (ELISA), immunoblotting, immunoprecipitation, radioimmunoassay (RIA), immuno staining, a flow cytometry assay, surface plasmon resonance (SPR), a chemiluminescence assay, a lateral flow immunoassay, an inhibition assay or an avidity assay.
  • the value of at least one of the one or more biomarkers is determined using a binding reagent that specifically binds to at least one biomarker.
  • the binding reagent is an antibody or antigen-binding fragment thereof, an aptamer or a nucleic acid probe.
  • measuring the value of the one or more biomarkers comprises contacting a reagent capable of directly or indirectly detecting the analyte with the biological sample and determining the presence or absence, level, amount or concentration of the analyte in the biological sample.
  • the one or more biomarker e.g. analyte
  • IL-16 interleukin- 16
  • TNF tumor necrosis factor
  • VEGFC vascular endothelial growth factor C
  • VEGFR1 vascular endothelial growth factor receptor 1
  • the one or more biomarker is or includes TNF.
  • the one or more biomarker (e.g. analyte) is or includes IL-16. In some embodiments, the one or more biomarker (e.g. analyte) is or includes VEGFC. In some embodiments, the one or more biomarker (e.g. analyte) is or includes VEGFR1.
  • the parameter e.g., biomarker and/or analyte
  • the parameter is detected using one or more reagent(s) capable of detecting or that is specific for the parameter.
  • measuring the value of the one or more parameters comprises contacting a reagent capable of directly or indirectly detecting the analyte with the biological sample and determining the presence or absence, level, amount or concentration of the analyte in the biological sample.
  • the one or more parameters e.g., biomarkers
  • the reagent is a binding molecule that specifically binds to the biomarker.
  • the reagent is an antibody or an antigen-binding fragment thereof.
  • the reagent is or includes a substrate or binding partner of the biomarker.
  • the parameters and/or biomarkers is assessed using an immunoassay.
  • an enzyme-linked immunosorbent assay EFISA
  • enzyme immunoassay EIA
  • radioimmunoassay RIA
  • SPR surface plasmon resonance
  • Western Blot Fateral flow assay
  • iPCR immunohistochemistry
  • protein array or immuno-PCR iPCR
  • the EFISA is a sandwich EFISA.
  • the EFISA is a bead-based EFISA.
  • using the articles of manufacture include detecting patient attributes, factors and/or biomarkers indicative of tumor burden.
  • the assaying or assessing of an patient attributes, factors and/or biomarkers is using flow cytometry.
  • the reagent is a soluble protein that binds the patient attributes, factors and/or biomarkers.
  • the assay for assessing the parameter and/or one or more biomarker is an immunoassay.
  • the assay for assessing the parameter and/or one or more biomarker is a multiplexed immunoassay, for example, for determining the parameter, such as level, concentration or amount, of multiple, such as more than one, biomarkers or analytes.
  • the methods involve comparing, individually, the level, amount or concentration of the analyte in the sample to a threshold level, thereby determining a risk of developing a toxicity after administration of the cell therapy, or thereby determining a likelihood that a subject will achieve a response to the cell therapy.
  • the exemplary threshold levels can be determined based on the mean or median values and values within a range or standard deviation of the mean or median values of the level, amount or concentration of the biomarker, e.g., analyte, in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on to exhibit a particular outcome, such as a particular therapeutic outcome, including either exhibiting a response or not exhibiting a response; or either developing a toxicity or not developing a toxicity.
  • particular aspects of determining threshold values include those described below in Sections I.A.l and I.A.2.
  • the analyte or biomarker is associated with, correlated to, indicative of and/or predictive of a particular outcome, such as development of a toxicity, in a subject that has been administered a cell therapy, such as with a composition containing genetically engineered cells.
  • a cell therapy such as with a composition containing genetically engineered cells.
  • the presence, expression, level, amount or concentration of one or more biomarker, e.g., analyte, in a biological sample obtained from a subject prior to the administration of cell therapy can be associated with, correlated to, indicative of and/or predictive of a particular outcome, such as development of a toxicity, such as any toxicity outcomes described herein, e.g., in Section II.D.
  • the toxicity is a toxicity potentially associated with cell therapy, such as any described herein, for example, in Section II.D.
  • the toxicity is neurotoxicity (NT; also called in some cases as neurological events, neurologic events or NE).
  • the toxicity is any grade neurotoxicity, such as grade 1 or higher neurotoxicity (NT).
  • the toxicity is a severe NT.
  • the toxicity is grade 2 or higher NT.
  • the toxicity is grade 3 or higher NT.
  • the toxicity is grade 4 or 5 NT.
  • the parameter is a parameter related to tumor burden, e.g., a measurement of tumor burden, such as lymph node tumor burden or blood tumor burden.
  • the parameter is a parameter related to tumor burden, e.g., a ratio of two measurements of tumor burden, such as blood tumor burden and lymph node tumor burden.
  • the biomarkers e.g. analytes
  • the biomarkers include IL-16 and TNF.
  • the methods involve assessing the risk of development of a toxicity, after administration of a cell therapy. In some embodiments, the methods involve assessing the level, amount or concentration of one or more biomarker, e.g., analyte, in a biological sample, wherein the biological sample is from a subject that is a candidate for treatment with the cell therapy, said cell therapy optionally comprising a dose or composition of genetically engineered cells expressing a recombinant receptor (e.g., CAR); and the biological sample is obtained from the subject prior to administering the cell therapy and/or said biological sample does not comprise the recombinant receptor and/or said engineered cells.
  • a biomarker e.g., analyte
  • the methods involve comparing, individually, the level, amount or concentration of the analyte in the sample to a threshold level, thereby determining a risk of developing a toxicity after administration of the cell therapy.
  • the comparisons can be used to determine the likelihood of response of the subject or the risk of development of a toxicity, after administration of a cell therapy.
  • the methods involve assessing the likelihood of response of the subject or the risk of development of a toxicity, after administration of a cell therapy. In some embodiments, the methods involve assessing the level, amount or concentration of one or more biomarker, e.g., analyte, in a biological sample, wherein the biological sample is from a subject has received a cell therapy optionally comprising a dose or composition of genetically engineered cells expressing a recombinant receptor (e.g., CAR), such as an early time point, e.g., prior to prior to peak CAR+ T cell expansion and/or within at or about 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 days, or a range defined by any of the foregoing, after the initiation of administration of the cell therapy.
  • a recombinant receptor e.g., CAR
  • the methods involve comparing, individually, the level, amount or concentration of the analyte in the sample to a threshold level, thereby determining a risk of developing a toxicity after administration of the cell therapy.
  • the comparisons can be used to determine the likelihood of response of the subject or the risk of development of a toxicity, after administration of a cell therapy.
  • the methods also involve selecting subjects for treatment with an a cell therapy, such as a particular dose of cell therapy, including administration of a particular dose of cell therapy such as those described herein, based on the assessment of the presence or absence of the biomarker and/or comparison of the biomarkers to a reference value or threshold level of the biomarker.
  • the methods also involve selecting subjects for treatment with an additional agent, such as an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity, based on the assessment of the presence or absence of the biomarker and/or comparison of the biomarkers to a reference value or threshold level of the biomarker.
  • the methods include comparing, individually, the level, amount or concentration of the analyte in the sample to a threshold level, thereby determining a risk of developing a toxicity after administration of the cell therapy.
  • the methods include identifying a subject who has a risk of developing a toxicity after administration of a cell therapy based by comparing, individually, the level, amount or concentration of the analyte in the sample to a threshold level. In some embodiments, the methods also include following or based on the results of the assessment, administering to the subject the cell therapy, and, optionally, an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity. In some embodiments, the methods also involve monitoring the subject for symptoms of toxicity if the subject is administered a cell therapy and is identified as having a risk of developing a toxicity.
  • the threshold level is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation is at or about or above the median or mean value of the parameter assessed from or the median or mean level, amount or concentration in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group did not exhibit any grade of neurotoxicity, after administration of a dose of engineered cells expressing the CAR for treating the CLL or the SLL.
  • the threshold level is at or greater than 1.25-fold higher, at or greater than 1.3-fold higher, at or greater than 1.4-fold higher or at or greater than 1.5-fold higher than the median or mean value of the parameter assessed from or the median or mean level, amount or concentration in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group did not exhibit any grade of neurotoxicity, after administration of a dose of engineered cells expressing the CAR for treating the CLL or the SLL.
  • the threshold level is at or greater than 1.25- fold higher, at or greater than 1.3-fold higher, at or greater than 1.4-fold higher or at or greater than 1.5-fold higher than the parameter assessed from or the level, amount or concentration in a biological sample obtained from a group of normal or healthy subjects that are not candidates for treatment with the cell therapy.
  • a measurement of the parameter or marker that is above the threshold value are associated with an approximately 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-fold or more increased risk of developing NT.
  • a measurement of the parameter or marker that is below the threshold value are associated with an approximately 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-fold or more decreased risk of developing NT.
  • the methods also involve further monitoring the subject for possible symptoms of toxicity based on the risk of toxicity determined in accordance with the provided embodiments, e.g., by assessment of a parameter or a biomarker and/or comparison of the parameter or biomarker to a reference value or threshold level of the particular parameter or biomarker.
  • an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity is administered to the subject prior to, within one, two, or three days of, concurrently with and/or at first fever following, the initiation of administration of the cell therapy to the subject.
  • agents or interventions for use in connection with the provided methods to treat, prevent, delay, reduce or attenuate the risk of developing toxicity are described in Section III.
  • the cell therapy is administered to the subject at a reduced dose or at a dose that is not associated with risk of developing toxicity or severe toxicity, or is not associated with a risk of developing a toxicity or severe toxicity in a majority of subjects, and/or a majority of subjects having a disease or condition that the subject has or is suspected of having, following administration of the cell therapy.
  • the cell therapy is administered to the subject in an in-patient setting and/or with admission to the hospital for one or more days, optionally wherein the cell therapy is otherwise to be administered to subjects on an outpatient basis or without admission to the hospital for one or more days.
  • the cell therapy is administered to the subject, optionally at a non-reduced dose.
  • the cells therapy is optionally administered on an outpatient basis or without admission to the hospital for one or more days.
  • the administration of the cell therapy does not include administering, prior to or concurrently with administering the cell therapy and/or prior to the development of a sign of symptom of a toxicity other than fever, an agent or treatment capable of treating, preventing, delaying, or attenuating the development of the toxicity; and/or the administration of the cell therapy is to be or may be administered to the subject on an outpatient setting and/or without admission of the subject to the hospital overnight or for one or more consecutive days and/or is without admission of the subject to the hospital for one or more days.
  • a subject is determined to be at risk of developing toxicity (e.g . neurotoxicity, such as severe neurotoxicity or grade 3 or higher neurotoxicity) by a comparison of the parameter (e.g. concentration, amount, level or activity) of the biomarker (e.g. analyte) or, individually, each of the biomarkers (e.g. analytes) to a reference value, such as threshold level, of the corresponding parameter for the biomarker or each biomarker.
  • the comparison indicates whether the subject is or is not at risk for developing toxicity, e.g., neurotoxicity such as severe neurotoxicity or grade 3 or higher neurotoxicity and/or indicates a degree of risk for developing said toxicity.
  • the reference value is one that is a threshold level or cut-off at which there is a good predictive value (e.g. accuracy, sensitivity and/or specificity) that such toxicity will occur or is likely to occur either alone or in combination with one or more biomarkers in the panel.
  • a good predictive value e.g. accuracy, sensitivity and/or specificity
  • such reference value e.g. threshold level
  • a parameter of a biomarker e.g. TNF or IL-16
  • the reference value e.g. threshold level
  • a parameter of a biomarker that is higher or greater than the reference value, e.g. threshold level, of the corresponding parameter is associated with a positive prediction of a risk of toxicity (alone or in conjunction with assessment of the other biomarkers in the panel).
  • a parameter of a biomarker that is equal to or lower than the reference value, e.g. threshold level, of the corresponding parameter is associated with a negative prediction of a risk of toxicity (alone or in conjunction with assessment of the other biomarkers in the panel).
  • the threshold level is determined based on the level, amount, concentration or other measure of the biomarker (e.g. analyte) in the sample positive for the biomarker. In some aspects, the threshold level is within 25%, within 20%, within 15%, within 10% or within 5% of the average level, amount or concentration or measure, and/or is within a standard deviation of the average level, amount or concentration or measure, of the analyte or parameter in a biological sample obtained from a group of subjects prior to receiving a recombinant receptor-expressing therapeutic cell composition, wherein each of the subjects of the group went on to develop a toxicity, e.g. neurotoxicity such as severe neurotoxicity or grade 3 or higher neurotoxicity after receiving a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • a toxicity e.g. neurotoxicity such as severe neurotoxicity or grade 3 or higher neurotoxicity after receiving a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • the biomarker correlates to and/or is predictive of the risk of developing severe neurotoxicity, such as severe neurotoxicity or grade 3 or higher neurotoxicity.
  • the threshold level is within 25%, within 20%, within 15%, within 10% or within 5% of the average level, amount or concentration or measure, and/or is within a standard deviation of the average level, amount or concentration or measure, of the analyte or parameter in a biological sample obtained from a group of subjects prior to receiving a recombinant receptor-expressing therapeutic cell composition, wherein each of the subjects of the group went on to develop severe neurotoxicity or grade 3 or higher neurotoxicity, after receiving a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • the parameter including volumetric tumor measurements or is associated with response to the cell therapy, and/or a risk for developing toxicity, e.g., neurotoxicity (NT).
  • NT neurotoxicity
  • a method of treatment that involves: (1) if the subject has a lymph node tumor burden and/or a level, amount or concentration of TNF and/or IL-16 that is at or above a threshold level; and/or if a blood tumor burden and/or a ratio of blood tumor burden to lymph node tumor burden is below a threshold level, the subject is identified as at risk of developing a neurotoxicity following administration of a cell therapy and the method comprises: (i) administering to the subject the cell therapy at a reduced dose; (ii) further administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity; and/or (iii) the administering the cell therapy to the subject is carried out or is specified to be carried out in an in-patient setting and/or with admission to a hospital for one or more days; or (2) if the subject has a lymph node tumor burden and/or a level, amount or concentration of TNF and/or
  • the parameter or factor is a parameter indicative of disease burden, such as tumor burden.
  • the parameter indicative of tumor burden is a volumetric measure of a tumor.
  • the parameter indicative of tumor burden is tumor burden in the blood.
  • the exemplary parameter includes the ratio of blood tumor burden to lymph node tumor burden.
  • the volumetric measure is a measure of the lesion(s), such as the tumor size, tumor diameter, tumor volume, tumor mass, tumor load or bulk, tumor-related edema, tumor-related necrosis, and/or number or extent of metastases.
  • the is a bidimensional measure.
  • the area of lesion(s) are calculated as the product of the longest diameter and the longest perpendicular diameter of all measurable tumors.
  • the is a unidimensional measure.
  • the size of measurable lesions is assessed as the longest diameter.
  • the sum of the products of diameters (SPD), longest tumor diameters (LD), sum of longest tumor diameters (SLD), necrosis, tumor volume, necrosis volume, necrosis-tumor ratio (NTR), peritumoral edema (PTE), and edema-tumor ratio (ETR) is measured.
  • the parameter indicative of tumor burden such as the lymph node tumor burden
  • the factor indicative of tumor burden is tumor burden in the blood, such as lymphocyte count per volume of blood, such as lymphocyte count per microliter (pL) of blood.
  • the parameter is a sum of the products of diameters (SPD) measured by determining the sum of the products of the largest perpendicular diameters of all measurable tumors.
  • SPD diameters
  • the tumor or lesion are measured in one dimension with the longest diameter (LD) and/or by determining the sum of longest tumor diameters (SLD) of all measurable lesions.
  • the parameter indicative of tumor burden is a volumetric quantification of tumor necrosis, such as necrosis volume and/or necrosis-tumor ratio (NTR), see Monsky et al., Anticancer Res. (2012) 32(11): 4951-4961.
  • the parameter indicative of tumor burden is a volumetric quantification of tumor- related edema, such as peritumoral edema (PTE) and/or edema-tumor ratio (ETR).
  • measuring can be performed using imaging techniques such as computed tomography (CT), positron emission tomography (PET), and/or magnetic resonance imaging (MRI) of the subject.
  • CT computed tomography
  • PET positron emission tomography
  • MRI magnetic resonance imaging
  • the parameter indicative of tumor burden is determined at a screening session, such as a routine assessment or blood draw to confirm and/or identify the condition or disease in the subject.
  • the parameter indicative of tumor burden is determined prior to administration of a lymphodepleting therapy to a subject.
  • the parameter is assessed from the subject prior to administration of a lymphodepleting therapy to the subject.
  • the tumor cells can be present in various organs or compartments in the host, such as the blood, bone marrow, lymph nodes or spleen.
  • the organ or compartment in which the tumor cells are present can affect the survival and proliferation of the tumor cells, and blood is the least supportive microenvironment for tumor cells.
  • CLL or SLL tumor cells can begin to die when starved in the microenvironment.
  • secondary lymphoid organs such as the lymph node
  • interaction between the tumor cells and T cells can support CLL or SLL tumor cell growth, and activation of B cells is important for retaining the CLL or SLL tumor cells in secondary lymphoid organs.
  • tumor burden in the lymph node can be a different measure and does not necessarily correlate with tumor burden in the blood.
  • the assessing comprises identifying the subject as at risk for developing a neurotoxicity following administration of the cell therapy if: (a) the lymph node tumor burden is at or above the threshold level for lymph node tumor burden; (b) the blood tumor burden is below the threshold level for blood tumor burden; and/or (c) the ratio of blood tumor burden to lymph node tumor burden is below the threshold level for the ratio; or (2) identifying the subject as not at risk for developing a neurotoxicity following administration of the cell therapy if: (a) the lymph node tumor burden is below the threshold level for tumor burden; (b) the blood tumor burden is at or above the threshold level for blood tumor burden; and/or (c) the ratio of blood tumor burden to lymph node tumor burden is above the threshold level for the ratio.
  • a subject if the ratio of blood tumor burden to lymph node tumor burden is above a threshold level, a subject is identified as not at risk of developing a neurotoxicity following administration of a cell therapy. Conversely, in some embodiments, if the ratio of blood tumor burden to lymph node tumor burden is below a threshold level, a subject is identified as at risk of developing a neurotoxicity follwong administration of a cell therapy.
  • Also provided herein are methods of determining the risk of developing a toxicity after administration of a cell therapy the method involving: assessing one or more parameters of disease burden selected from among lymph node tumor burden, blood tumor burden and the ratio of blood tumor burden to lymph node tumor burden, in a subject having a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL) that is a candidate for treatment with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD 19), wherein the parameter is assessed from the subject prior to administering the cell therapy; and comparing, individually, the value of the one or more parameters to a threshold level for the respective parameter, wherein: (1) identifying the subject as at risk for developing a neurotoxicity following administration of the cell therapy if: (a) the lymph node tumor burden is at or above the threshold level for lymph node tumor burden; (b) the blood
  • the method further comprises :(i) administering to the subject the cell therapy, optionally at a reduced dose, optionally wherein: (a) the method further comprises administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity; and/or (b) the administering of the cell therapy to the subject is carried out or is specified to be carried out in an in-patient setting and/or with admission to a hospital for one or more days; or (ii) administering to the subject an alternative treatment other than the cell therapy for treating the CLL or SLL.
  • the method further comprises: (i) administering to the subject the cell therapy, optionally wherein: (a) the subject is not administered an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity, optionally at or after the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic; and/or (b) the administering of the cell therapy and any follow-up is carried out on an outpatient basis and/or without admitting the subject to a hospital and/or without an overnight stay at a hospital and/or without requiring admission to or an overnight stay at a hospital, optionally unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C
  • Also provided herein are methods of selecting a subject for treatment with a cell therapy comprising: assessing one or more parameters of disease burden selected from among lymph node tumor burden, blood tumor burden and the ratio of blood tumor burden to lymph node tumor burden, in a subject having a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL) that is a candidate for treatment with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD19), wherein the parameter is assessed from the subject prior to administering the cell therapy; and comparing, individually, the value of the one or more parameters to a threshold level for the respective parameter, wherein: (1) if (a) the lymph node tumor burden is at or above the threshold level for lymph node tumor burden; (b) the blood tumor burden is below the threshold level for blood tumor burden; and/or (c) the ratio of blood tumor burden to
  • the methods also include administering the cell therapy, the agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity and/or the alternative treatment to the subject.
  • the exemplary parameter includes the blood tumor burden.
  • the assessing comprises determining the lymphocyte concentration in the blood of the subject.
  • the concentration is the lymphocyte count per microliter (pL) of blood.
  • the threshold level for blood tumor burden is a value between at or about 800 lymphocytes/pL and at or about 3000 lymphocytes/pL, inclusive.
  • the threshold level for blood tumor burden is a value of at or about 800 lymphocytes/pL, 900 lymphocytes/pL, 1000 lymphocytes/pL, 1250 lymphocytes/pL, 1500 lymphocytes/pL, 1750 lymphocytes/pL, 2000 lymphocytes/pL, 2250 lymphocytes/pL, 2500 lymphocytes/pL, 2750 lymphocytcs/pL or 3000 lymphocytes/pL, or a value between any of the foregoing. In some embodiments, the threshold level for blood tumor burden is a value between at or about 1250 lymphocytes/pL and at or about 1750 lymphocytes/pL.
  • the threshold level for blood tumor burden is a value of at or about 800 lymphocytes/pL. In some embodiments, the threshold level for blood tumor burden is a value of 900 lymphocytes/pL. In some embodiments, the threshold level for blood tumor burden is a value of at or about 1000 lymphocytes/pL. In some embodiments, the threshold level for blood tumor burden is a value of at or about 1250 lymphocytes/pL. In some embodiments, the threshold level for blood tumor burden is a value of at or about 1500 lymphocytes/pL. In some embodiments, the threshold level for blood tumor burden is a value of at or about 1750 lymphocytes/pL.
  • the threshold level for blood tumor burden is a value of at or about 2000 lymphocytes/pL. In some embodiments, the threshold level for blood tumor burden is a value of at or about 2250 lymphocytes/pL. In some embodiments, the threshold level for blood tumor burden is a value of at or about 2500 lymphocytes/pL. In some embodiments, the threshold level for blood tumor burden is a value of at or about 2750 lymphocytes/pL. In some embodiments, the threshold level for blood tumor burden is a value of at or about 3000 lymphocytes/pL.
  • the exemplary parameter includes lymph node tumor burden.
  • the assessing the lymph node burden comprises determining the largest lymph node diameter in the subject.
  • the assessing the lymph node burden comprises determining the largest lymph node diameter in centimeters (cm).
  • the threshold level for the largest lymph node diameter as the lymph node burden is a value between at or about 4 cm and at or about 7 cm.
  • the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 4 cm, 4.25 cm, 4.5 cm, 4.75 cm, 5 cm, 5.25 cm, 5.5 cm, 5.75 cm, 6 cm, 6.25 cm, 6.5 cm, 6.75 cm or 7 cm, or a value between any of the foregoing. In some embodiments, the threshold level for lymph node burden is a value between at or about 4.5 cm and at or about 5.5 cm. In some embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 4 cm. In some embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 4.25 cm.
  • the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 4.5 cm. In some embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 4.75 cm. In some embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 5 cm. In some embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 5.25 cm. In some embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 5.5 cm.
  • the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 5.75 cm. In some embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 6 cm. In some embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 6.25 cm. In some embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 6.5 cm. In some embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 6.75 cm. In some embodiments, the threshold level for the largest lymph node diameter as the lymph node burden is a value of at or about 7 cm.
  • the exemplary parameter includes the ratio of blood tumor burden to lymph node tumor burden.
  • the assessing comprises determining the ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm).
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value between at or about 300 and at or about 1000.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000, or a value between any of the foregoing. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 300.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 350. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 400. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 450.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 500. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 550. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 600.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 650. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 700. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 750.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 800. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 850. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 900.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 950. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to the largest lymph node diameter in centimeters (cm) as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 1000.
  • the exemplary parameter includes thelymph node tumor burden.
  • assessing the lymph node burden comprises determining the sum of the products of diameters (SPD).
  • the SPD is measured in centimeters squared (cm 2 ).
  • the threshold level for the SPD as the lymph node burden is a value between at or about 10 cm 2 and at or about 40 cm 2 .
  • the threshold level for the SPD as the lymph node burden is a value of at or about 10 cm 2 , 12.5 cm 2 , 15 cm 2 , 17.5 cm 2 , 20 cm 2 , 22.5 cm 2 , 25 cm 2 , 27.5 cm 2 , 30 cm 2 , 32.5 cm 2 , 35 cm 2 , 37.5 cm 2 or 40 cm 2 , or a value between any of the foregoing.
  • the threshold level for SPD as the lymph node burden is a value of at or about the threshold level for the SPD as the lymph node burden is a value of at or about 10 cm 2 .
  • the threshold level for SPD as the lymph node burden is a value of at or about 12.5 cm 2 .
  • the threshold level for SPD as the lymph node burden is a value of at or about 15 cm 2 . In some embodiments, the threshold level for SPD as the lymph node burden is a value of at or about 17.5 cm 2 . In some embodiments, the threshold level for SPD as the lymph node burden is a value of at or about 20 cm 2 . In some embodiments, the threshold level for SPD as the lymph node burden is a value of at or about 22.5 cm 2 . In some embodiments, the threshold level for SPD as the lymph node burden is a value of at or about 25 cm 2 . In some embodiments, the threshold level for SPD as the lymph node burden is a value of at or about 27.5 cm 2 .
  • the threshold level for SPD as the lymph node burden is a value of at or about 30 cm 2 . In some embodiments, the threshold level for SPD as the lymph node burden is a value of at or about 32.5 cm 2 . In some embodiments, the threshold level for SPD as the lymph node burden is a value of at or about 35 cm 2 . In some embodiments, the threshold level for SPD as the lymph node burden is a value of at or about 37.5 cm 2 . In some embodiments, the threshold level for SPD as the lymph node burden is a value of at or about 40 cm 2 .
  • the exemplary parameter includes the ratio of blood tumor burden to lymph node tumor burden.
  • the assessing comprises determining the ratio of the lymphocyte count per microliter (pL) of blood to the sum of the products of diameters (SPD) in centimeters squared (cm 2 ).
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value between at or about 25 and at or about 500.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450 or 500, or a value between any of the foregoing. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 25. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 50.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 75. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 100. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 150.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 200. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 250. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 300.
  • the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 350. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 400. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 450. In some embodiments, the threshold level for ratio of the lymphocyte count per microliter (pL) of blood to SPD as the ratio of blood tumor burden to lymph node tumor burden is a value of at or about 500.
  • one or more biomarkers or analytes, including parameters thereof, that can be assessed include interleukin- 16 (IL-16) or tumor necrosis factor (TNF).
  • IL-16 interleukin- 16
  • TNF tumor necrosis factor
  • elevated levels or increased levels of one or more of such biomarkers (e.g., biomarkers), such as compared to a reference value or threshold level can be associated with the development of neurotoxicity.
  • elevated levels or increased levels of one or more of such biomarkers (e.g., analytes), such as compared to a reference value or threshold level can be associated with the development of neurotoxicity.
  • exemplary biomarkers, e.g., blood analytes, that are indicative of or associated with toxicity, e.g., neurotoxicity is one or more of TNF and IL-16.
  • one or more of the following steps can be performed can be administered to the subject: (a) (1) an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity and (2) the cell therapy, wherein administration of the agent is to be administered (i) prior to, (ii) within one, two, or three days of, (iii) concurrently with and/or (iv) at first fever following, the initiation of administration of the cell therapy to the subject; and/or (b) administering to the subject a cell therapy at a reduced dose or at a dose that is not associated with risk of developing toxicity or severe toxicity, or is not associated with a risk of developing a toxicity or severe toxicity in a majority of subjects, and/or a majority of subjects having a disease or condition that the subject has or is suspected of having, following administration of the cell therapy; and/or (c) administering to the subject: (a) (1) an agent or other treatment capable of treating, preventing, delaying, reducing or at
  • the subject has a risk of developing a toxicity if the level, amount or concentration one or more of the analyte is above a threshold level and the subject has a low risk of developing a toxicity if the level, amount or concentration one or more of the analyte is below a threshold level.
  • the toxicity is neurotoxicity.
  • elevated levels of IL-16 or tumor necrosis factor (TNF) in a biological sample from a subject obtained prior to administration of a cell therapy (pre-treatment), can be associated with a higher risk of developing a neurotoxicity.
  • the threshold level is within 25%, within 20%, within 15%, within 30% or within 5% and/or is within a standard deviation above the median or mean level, amount or concentration of IL-16 or TNF, in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on not develop any toxicity after receiving a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • the threshold level is within 25%, within 20%, within 15%, within 30% or within 5% and/or is within a standard deviation below the median or mean level, amount or concentration of IL-16 or TNF, in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on to develop a toxicity after receiving a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • Also provided herein are methods of determining the risk of developing a toxicity after administration of a cell therapy the method involving: assaying a biological sample for the level, amount or concentration of tumor necrosis factor (TNF) and/or interleukin- 16 (IL-16), wherein the biological sample is from a subject having a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL) that is a candidate for treatment with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD 19), wherein the biological sample is obtained from the subject prior to administering the cell therapy or prior to peak CAR+ T cell expansion and/or within at or about 11 days after the initiation of administration of the cell therapy; and comparing, individually, the level, amount or concentration of TNF and/or IL-16 to a threshold level for each, wherein: the threshold level for TNF is
  • Also provided herein are methods of determining the risk of developing a toxicity after administration of a cell therapy the method involving: assaying a biological sample for the level, amount or concentration of tumor necrosis factor (TNF) and/or interleukin- 16 (IL-16), wherein the biological sample is from a subject having a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL) that is a candidate for treatment with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD 19), wherein the biological sample is obtained from the subject prior to administering the cell therapy; and comparing, individually, the level, amount or concentration of TNF and/or IL-16 to a threshold level for each, wherein: the threshold level for TNF is a value between at or about 7 pg/mL and at or about 25 pg/mL; and/or the
  • the method further comprises:(i) administering to the subject the cell therapy, optionally at a reduced dose, optionally wherein:(a) the method further comprises administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity; and/or (b) the administering of the cell therapy to the subject is carried out or is specified to be carried out in an in-patient setting and/or with admission to a hospital for one or more days; or (ii) administering to the subject an alternative treatment other than the cell therapy for treating the CLL or SLL.
  • the method further comprises: (i) administering to the subject the cell therapy, optionally wherein: (a) the subject is not administered an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity, optionally at or after the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic; and/or (b) the administering of the cell therapy and any follow-up is carried out on an outpatient basis and/or without admitting the subject to a hospital and/or without an overnight stay at a hospital and/or without requiring admission to or an overnight stay at a hospital, optionally unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic
  • Also provided herein are methods of selecting a subject for treatment with a cell therapy comprising: assaying a biological sample for the level, amount or concentration of tumor necrosis factor (TNF) and/or interleukin- 16 (IL-16), wherein the biological sample is from a subject having a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL) that is a candidate for treatment with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD19), wherein the biological sample is obtained from the subject prior to administering the cell therapy; and comparing, individually, the level, amount or concentration of TNF and/or IL-16 to a threshold level for each, wherein: the threshold level for TNF is a value between at or about 7 pg/mL and at or about 25 pg/mL; and/or the threshold level for IL
  • the methods also include administering the cell therapy, the agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity and/or the alternative treatment to the subject.
  • Also provided herein are methods of determining the risk of developing a toxicity after administration of a cell therapy the method involving: assaying a biological sample from a subject for the level, amount or concentration of TNF and/or IL-16, said subject having received administration of a cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR for treating a CLL or SLL, wherein the biological sample is obtained from the subject prior to peak CAR+ T cell expansion and/or within at or about 11 days after the initiation of administration of the cell therapy; and comparing, individually, the level, amount or concentration of TNF and/or IL-16 to a threshold level for each, wherein: the threshold level for TNF is a value between at or about 7 pg/mL and at or about 25 pg/mL; and/or the threshold level for IL-16 is a value between at or about 400 pg/mL and at or about 1000 pg/mL; and(l) if the level, amount or concentration of
  • the method further comprises administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity, optionally prior to peak CAR+ T cell expansion and/or within at or about 11 days of administering the cell therapy to the subject; and/or the follow-up is carried out in an in-patient setting and/or with admission to a hospital for one or more days.
  • the follow-up is carried out on an outpatient basis and/or without admitting the subject to a hospital and/or without an overnight stay at a hospital and/or without requiring admission to or an overnight stay at a hospital, optionally unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.
  • Also provided herein are methods of selecting a subject for treatment with an agent comprising: assaying a biological sample from a subject for the level, amount or concentration of TNF and/or IL-16, said subject having received administration of a cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR that binds CD19 for treating a CLL or SLL, wherein the biological sample is obtained from the subject prior to peak CAR+ T cell expansion and/or within at or about 11 days after the initiation of administration of the cell therapy; and comparing, individually, the level, amount or concentration of TNF and/or IL-16 to a threshold level for each, wherein: the threshold level for TNF is a value between at or about 7 pg/mL and at or about 25 pg/mL; and/or the threshold level for IL-16 is a value between at or about 400 pg/mL and at or about 1000 pg/mL; and if the level, amount or concentration of TNF and/
  • the methods also include administering to the subject, an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity.
  • the administering the agent or other treatment is carried out at a time when the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.
  • administering to the subject the cell therapy was carried out on an outpatient basis and, if the level, amount or concentration of TNF and/or IL-16 is above a threshold level the method comprises admitting the patient to a hospital for one or more days.
  • the biological sample is obtained from the subject prior to administering the cell therapy. In some embodiments, the biological sample is obtained from the subject prior to administration of a lymphodepleting therapy to the subject. In some embodiments, the biological sample is obtained from the subject prior to peak CAR+ T cell expansion and/or within at or about 11 days after the initiation of administration of the cell therapy. In some embodiments, the biological sample is obtained from the subject prior to peak CAR+ T cell expansion and/or within at or about 11 days of the initiation of administration of the cell therapy,
  • the threshold level is within 25%, within 20%, within 15%, within 32% or within 5% and/or is within a standard deviation above the median or mean level, amount or concentration of IL-16 or TNF, in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on not to develop any toxicity after receiving a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • the threshold level is within 25%, within 20%, within 15%, within 32% or within 5% and/or is within a standard deviation below the median or mean level, amount or concentration of IL-16 or TNF, in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on to develop a toxicity after receiving a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • the threshold level for TNF is a value between at or about 7 pg/mL and at or about 25 pg/mL. In some embodiments, the threshold level for TNF is a value of at or about 7 pg/mL, 8 pg/mL, 9 pg/mL, 10 pg/mL, 15 pg/mL, 20 pg/mL, or 25 pg/mL, or a value between any of the foregoing. In some embodiments, the threshold level for TNF is a value of at or about 7 pg/mL. In some embodiments, the threshold level for TNF is a value of at or about 8 pg/mL.
  • the threshold level for TNF is a value of at or about 9 pg/mL. In some embodiments, the threshold level for TNF is a value of at or about 10 pg/mL. In some embodiments, the threshold level for TNF is a value of at or about 15 pg/mL. In some embodiments, the threshold level for TNF is a value of at or about 20 pg/mL. In some embodiments, the threshold level for TNF is a value of at or about 25 pg/mL. In some embodiments, the threshold level for TNF is a value between at or about 8 pg/mL and at or about 10 pg/mL.
  • the threshold level for IL-16 is a value between at or about 400 pg/mL and at or about 1000 pg/mL. In some embodiments, the threshold level for IL-16 is a value of at or about 400 pg/mL, 500 pg/mL, 600 pg/mL, 700 pg/mL, 800 pg/mL, 900 pg/mL or 1000 pg/mL, or a value between any of the foregoing. In some embodiments, the threshold level for IL-16 is a value of at or about 400 pg/mL. In some embodiments, the threshold level for IL- 16 is a value of at or about 500 pg/mL.
  • the threshold level for IL-16 is a value of at or about 600 pg/mL. In some embodiments, the threshold level for IL-16 is a value of at or about 700 pg/mL. In some embodiments, the threshold level for IL-16 is a value of at or about 800 pg/mL. In some embodiments, the threshold level for IL-16 is a value of at or about 900 pg/mL. In some embodiments, the threshold level for IL-16 is a value of at or about 1000 pg/mL. In some embodiments, the threshold level for IL-16 is a value between at or about 500 pg/mL and at or about 700 pg/mL.
  • the level, amount or concentration of both TNF and IL- 16 are assessed; and the threshold level for TNF is a value of at or about 7 pg/mL, 8 pg/mL, 9 pg/mL, 10 pg/mL, 15 pg/mL, 20 pg/mL, or 25 pg/mL, or a value between any of the foregoing; and the threshold level for IL-16 is a value of at or about 400 pg/mL, 500 pg/mL, 600 pg/mL, 700 pg/mL, 800 pg/mL or 900 pg/mL, or a value between any of the foregoing.
  • the level, amount or concentration of both TNF and IL- 16 are assessed; and the threshold level for TNF is a value between at or about 8 pg/mL and at or about 10 pg/mL; and the threshold level for IL-16 is a value between at or about 500 pg/mL and at or about 700 pg/mL.
  • the threshold can be any combination of the thresholds for each of TNF and IL-16 provided herein.
  • the analyte or biomarker is associated with, correlated to, indicative of and/or predictive of a particular outcome, such as a particular response outcome, such as an objective response (OR) a complete response (CR) or a partial response (PR), or durable response, such as an OR or CR or a PR that is durable at 3, 6, 9 months or more.
  • a particular response outcome such as an objective response (OR) a complete response (CR) or a partial response (PR), or durable response, such as an OR or CR or a PR that is durable at 3, 6, 9 months or more.
  • lower or reduced levels or increased levels of one or more of such biomarkers e.g., analytes
  • criteria assessed for effective treatment includes overall response rate (ORR; also known in some cases as objective response rate), complete response (CR; also known in some cases as complete remission), complete response with incomplete marrow recovery (CRi), partial response (PR) or nodular partial remission (nPR).
  • ORR overall response rate
  • CR complete response
  • CRi complete response with incomplete marrow recovery
  • PR partial response
  • nPR nodular partial remission
  • the associate response outcome includes durable response, such as a response that is durable for 3 months, 6 months, 9 months 12 months or more, after the initial response.
  • the analyte or biomarker is associated with, correlated to, indicative of and/or predictive of a particular outcome, such as a particular response or durable response outcome, in a subject that has been administered a cell therapy, such as with a composition containing genetically engineered cells.
  • the presence, expression, level, amount or concentration of one or more biomarker, e.g., analyte, in a biological sample obtained from a subject prior to the administration of cell therapy can be associated with, correlated to, indicative of and/or predictive of a particular outcome, such as a particular response or durable response outcome.
  • presence, expression, level, amount or concentration of particular biomarkers can be correlated to a particular response or durable response outcome.
  • the response outcome can be any response outcomes described herein, e.g., in Section II.C.
  • the analyte or biomarker is associated with, correlated to, indicative of and/or predictive of a particular outcome, such as a particular response or durable response outcome, in a subject that has been administered a cell therapy, such as with a composition containing genetically engineered cells.
  • the presence, expression, level, amount or concentration of one or more biomarker, e.g., analyte, in a biological sample obtained from a subject prior to the administration of cell therapy can be associated with, correlated to, indicative of and/or predictive of a particular outcome, such as a particular response or durable response outcome.
  • presence, expression, level, amount or concentration of particular biomarkers can be correlated to a particular response or durable response outcome.
  • the response outcome can be any response outcomes described herein, e.g., in Section II.C.
  • the methods include comparing, individually, the level, amount or concentration of the analyte in the sample to a threshold level, thereby determining a likelihood that a subject will achieve a response to the cell therapy.
  • the methods include selecting a subject who is likely to respond to treatment based on the results of determining a likelihood that a subject will achieve a response to the cell therapy by comparing, individually, the level, amount or concentration of the analyte in the sample to a threshold level.
  • the methods also include administering the cell therapy to the subject selected for treatment. In some embodiments, if the subject is determined as not likely to achieve a response or a durable response, further comprising administering an additional therapeutic agent to the subject.
  • the biomarkers include those associated with a response outcome, and/or a durable response.
  • the biomarkers e.g. analytes
  • including parameters thereof include VEGFC or VEGFR1.
  • exemplary analytes or biomarkers that can be assessed or analyzed with respect to assessment of likelihood of response after administration of a cell therapy include one or more analyte selected from VEGFC or VEGFR1.
  • the subject is likely to achieve a response if the level, amount or concentration one or more of the analyte is below a threshold level and the subject is not likely to achieve a response if the level, amount or concentration one or more of the analyte is above a threshold level.
  • the response is or comprises objective response.
  • the objective response is or comprises complete response (CR) or partial response (PR).
  • reduced levels of VEGFC or VEGFR1 in a biological sample from a subject obtained prior to administration of a cell therapy (pre-treatment) can be associated with achieving objective response, including complete response (CR) or partial response (PR).
  • the response comprises objective response (OR).
  • objective response comprises complete response (CR; also known in some cases as complete remission), complete remission with incomplete marrow recovery (CRi), complete remission (CR), CR with incomplete marrow recovery (CRi), nodular partial remission PR (nPR) or partial response (PR; also known in some cases as partial remission).
  • Also provided herein are methods of assessing likelihood of a response to a cell therapy the method involving: assessing the level, amount or concentration of vascular endothelial growth factor C (VEGFC) and/or vascular endothelial growth factor receptor 1 (VEGFR1) in a biological sample, wherein the biological sample is from a subject having a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL) that is a candidate for treatment with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD 19), wherein the biological sample is obtained from the subject prior to administering the cell therapy; and comparing, individually, the level, amount or concentration of the VEGFC and/or VEGFR1 in the sample to a threshold level; wherein: (1) if the level, amount or concentration of VEGFC and/or VEGFR1 is below the respective threshold level
  • Also provided herein are methods of selecting a subject for treatment with a cell therapy comprising: assessing the level, amount or concentration of vascular endothelial growth factor C (VEGFC) and/or vascular endothelial growth factor receptor 1 (VEGFR1) in a biological sample, wherein the biological sample is from a subject having a chronic lymphoblastic leukemia (CLL) or a small lymphocytic lymphoma (SLL) that is a candidate for treatment with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a chimeric antigen receptor (CAR) that binds cluster of differentiation 19 (CD 19), wherein the biological sample is obtained from the subject prior to administering the cell therapy; and selecting a subject who is likely to respond to treatment based on the results of determining a likelihood that a subject will achieve a response to the cell therapy by comparing, individually, the level, amount or concentration of the VEGFC and/or VEGFR1 in the
  • Also provided herein are methods for treatment wherein the method comprises: (a) selecting a subject who is likely to respond to treatment based on the results of determining a likelihood that a subject will achieve a response to the cell therapy by comparing, individually, the level, amount or concentration of vascular endothelial growth factor C (VEGFC) and/or vascular endothelial growth factor receptor 1 (VEGFR1) in a biological sample, to a threshold level for each, wherein: (1) if the level, amount or concentration of VEGFC and/or VEGFR1 is below the respective threshold level, identifying the subject as having a high likelihood of achieving a response to the cell therapy; or (2) if the level, amount or concentration of VEGFC and/or VEGFR1 is at or above the respective threshold level, identifying the subject as having a low likelihood of achieving a response to the cell therapy; wherein the biological sample is from a subject having a CLL or a SLL that is a candidate for treatment with a cell therapy, said cell
  • the threshold level is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation is at or about or above the median or mean value of the parameter assessed from or the median or mean level, amount or concentration in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group achieved a response, after administration of a dose of engineered cells expressing the CAR for treating the CLL or the SLL.
  • the threshold level is at or greater than 1.25-fold higher, at or greater than 1.3-fold higher, at or greater than 1.4-fold higher or at or greater than 1.5-fold higher than the median or mean value of the parameter assessed from or the median or mean level, amount or concentration in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group achieved a response, after administration of a dose of engineered cells expressing the CAR for treating the CLL or the SLL.
  • the threshold level is at or greater than 1.25-fold higher, at or greater than 1.3-fold higher, at or greater than 1.4-fold higher or at or greater than 1.5-fold higher than the parameter assessed from or the level, amount or concentration in a biological sample obtained from a group of normal or healthy subjects that are not candidates for treatment with the cell therapy.
  • the threshold level is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation below the median or mean level, amount or concentration of VEGFC or VEGFR1 in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on to achieve a response after administration of a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • the threshold level is within 25%, within 20%, within 15%, within 10% or within 5% and/or is within a standard deviation above the median or mean level, amount or concentration of VEGFC or VEGFR1 in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group went on to exhibit stable disease (SD) and/or progressive disease (PD) after administration of a recombinant-receptor-expressing therapeutic cell composition for treating the same disease or condition.
  • SD stable disease
  • PD progressive disease
  • exemplary analytes or biomarkers that can be assessed or analyzed with respect to assessment of likelihood of durable response after administration of a cell therapy include one or more analyte selected from VEGFC or VEGFR1.
  • the subject is likely to achieve a durable response if the level, amount or concentration one or more of the analyte is below a threshold level and the subject is not likely to achieve a durable response if the level, amount or concentration one or more of the analyte is above a threshold level.
  • the durable response is or comprises a complete response (CR) or partial response (PR) that is durable for at or greater than 3 months, 4 months, 5 months, or 6 months. In some embodiments, the durable response is or comprises a CR or PR that is durable for at least 3 months.
  • reduced levels of VEGFC or VEGFR1 in a biological sample from a subject obtained prior to administration of a cell therapy (pre-treatment), can be associated with achieving durable response, such as a CR or PR that is durable for at least 3 months.
  • an exemplary biomarker or analyte is VEGFC.
  • the threshold level for VEGFC is a value between at or about 60 pg/mL and at or about 70 pg/mL.
  • the threshold level of VEGFC is a value of at or about 60 pg/mL, 61 pg/mL, 62 pg/mL, 63 pg/mL, 64 pg/mL, 65 pg/mL, 66 pg/mL, 67 pg/mL, 68 pg/mL, 69 pg/mL or 70 pg/mL, or a value between any of the foregoing.
  • the threshold level for VEGFC is at or about 60 pg/mL. In some embodiments, the threshold level for VEGFC is at or about 61 pg/mL. In some embodiments, the threshold level for VEGFC is at or about 62 pg/mL. In some embodiments, the threshold level for VEGFC is at or about 63 pg/mL. In some embodiments, the threshold level for VEGFC is at or about 64 pg/mL. In some embodiments, the threshold level for VEGFC is at or about 65pg/mL. In some embodiments, the threshold level for VEGFC is at or about 66 pg/mL.
  • the threshold level for VEGFC is at or about 67 pg/mL. In some embodiments, the threshold level for VEGFC is at or about 68 pg/mL. In some embodiments, the threshold level for VEGFC is at or about 69 pg/mL. In some embodiments, the threshold level for VEGFC is at or about 70 pg/mL.
  • an exemplary biomarker or analyte is VEGFR1.
  • threshold level for VEGFR1 is a value between at or about 80 pg/mL and at or about 120 pg/mL. In some embodiments, the threshold level for VEGFR1 is a value of at or about 80 pg/mL, 85 pg/mL, 90 pg/mL, 95 pg/mL, 100 pg/mL, 105 pg/mL, 110 pg/mL, 115 pg/mL or 120 pg/mL, or a value between any of the foregoing.
  • the threshold level for VEGFR1 is a value of at or about 80 pg/mL. In some embodiments, the threshold level for VEGFR1 is a value of at or about 85 pg/mL. In some embodiments, the threshold level for VEGFR1 is a value of at or about 90 pg/mL. In some embodiments, the threshold level for VEGFR1 is a value of at or about 95 pg/mL. In some embodiments, the threshold level for VEGFR1 is a value of at or about 100 pg/mL. In some embodiments, the threshold level for VEGFR1 is a value of at or about 105 pg/mL.
  • the threshold level for VEGFR1 is a value of at or about 110 pg/mL. In some embodiments, the threshold level for VEGFR1 is a value of at or about 115 pg/mL. In some embodiments, the threshold level for VEGFR1 is a value of at or about 120 pg/mL. [0181] In some embodiments, the level, amount or concentration of both VEGFC and VEGFR1 are assessed; and the threshold level for VEGFC is a value between at or about 60 pg/mL and at or about 70 pg/mL; and the threshold level for VEGFR1 is a value between at or about 80 pg/mL and at or about 120 pg/mL. In some of any such embodiments, the threshold can be any combination of the thresholds for each of VEGFC and VEGFR1 provided herein.
  • the methods and uses provided herein relate to a method of therapy that involves administering to the subject cells expressing genetically engineered (recombinant) cell surface receptors in adoptive cell therapy, which generally are chimeric receptors such as chimeric antigen receptors (CARs), recognizing an antigen expressed by, associated with and/or specific to the leukemia or lymphoma and/or cell type from which it is derived.
  • CARs chimeric antigen receptors
  • a cell therapy such as a cell therapy that involves administering engineered cells, such as engineered T cells that express a chimeric antigen receptor (CAR), for example, as described in Section II; and in some cases, administration of an additional agent, such as those described in Section III.
  • engineered cells such as engineered T cells that express a chimeric antigen receptor (CAR)
  • CAR chimeric antigen receptor
  • the cells are generally administered in a composition formulated for administration; the methods generally involve administering one or more doses of the cells to the subject, which dose(s) may include a particular number or relative number of cells or of the engineered cells, and/or a defined ratio or compositions of two or more sub-types within the composition, such as CD4 vs.CD8 T cells.
  • the cells, populations, and compositions are administered to a subject having a particular disease or condition to be treated, e.g., via adoptive cell therapy, such as adoptive T cell therapy.
  • adoptive cell therapy such as adoptive T cell therapy.
  • the methods involve treating a subject having a lymphoma or a leukemia, such as a chronic lymphocytic leukemia (CLL) or small lymphocytic lymphoma (SLL) with a dose of antigen receptor-expressing cells (e.g. CAR-expressing cells).
  • CLL chronic lymphocytic leukemia
  • SLL small lymphocytic lymphoma
  • the provided embodiments are based on observations, such as those described in the Examples provided herein, that the provided methods can be used to achieve a high response rate with high durability, compared to certain available methods for cell therapy, without an increased risk of toxicity.
  • the provided methods permit prolonged persistence of adoptively transferred cells for cell therapy, and/or low rate of developing toxicity in the subject.
  • the methods can be used to select subjects for treatment with cell therapy that are likely or more likely to respond to the therapy and/or to determine appropriate doses or dosing regimen for higher response rate and/or more durable response, while minimizing the risk of toxicity.
  • Such methods can inform rational strategies to facilitate the safe and effective clinical application of adoptive cell therapy, such as CAR-T cell therapy.
  • the provided methods achieve a high response rate in a heavily pretreated population of subjects with high-risk CLL (or SLL), all of whom have received one or more prior therapies including ibrutinib.
  • the treated subjects include subjects that have relapsed following initial remission on ibrutinib or who are refractory or intolerant to treatment with ibrutinib.
  • the treated subjects include subjects that have relapsed following remission or are refractory or intolerant to one or more further prior therapy in addition to ibrutinib, such as 1, 2, 3, 4, 5 or more prior therapies.
  • the subjects have relapsed or are refractory to both a prior treatment of ibrutinib and venetoclax. In some embodiments, subjects that are refractory to such treatment have progressed following one or more prior therapy. In some embodiments, subjects treated, including those treated with one or more prior therapies (e.g. ibrutinib and/or venetoclax), include those with a high-risk cytogenetics, including TP53 mutation, complex karyotype (i.e. at least three chromosomal alterations) and dell7(p).
  • prior therapies e.g. ibrutinib and/or venetoclax
  • subjects for treatment in accordance with the embodiments provided herein include subjects that have failed both a BTK inhibitor (e.g., ibrutinib) and venetoclax.
  • a BTK inhibitor e.g., ibrutinib
  • venetoclax results from an ongoing clinical trial demonstrate a high overall response rate (ORR) of greater than 65% of subjects treated across dose-levels, including complete remission (also known as complete response; CR) with incomplete blood count recovery (CRi) in greater than 35% of subjects treated.
  • ORR overall response rate
  • CR complete remission
  • CRi incomplete blood count recovery
  • the results are associated with achievement of undetectable MRD (uMRD); achievement of uMRD has been reported to correlate with improved outcomes (Kovacs et al. (2016) J. Clin. Oncol., 34:3758-3765; Thompson and Wierda (2016) Blood, 127:279-286).
  • the provided methods result in a high percentage of sustained responses that continue without progression for greater than 1 month, greater than 3 months, greater than six months or more.
  • CLL CLL is generally considered to be incurable and patients often eventually relapse or become refractory to available therapies (Dighiero and Hamblin (2008) The Lancet, 371:1017-1029).
  • CR and uMRD are inadequate and/or subjects progress or have poor outcomes following treatment with certain other agents, such as single-agent ibrutinib, venetoclax-Rituximab, Bendamustine-Rituximab or both ibrutinib and venetoclax.
  • certain other CAR T-cell therapies may not achieve such durable response rates.
  • the methods and uses include administering to the subject cells expressing genetically engineered (recombinant) cell surface receptors in adoptive cell therapy, which generally are chimeric receptors such as chimeric antigen receptors (CARs), recognizing an antigen expressed by, associated with and/or specific to the leukemia or lymphoma and/or cell type from which it is derived.
  • CARs chimeric antigen receptors
  • the targeted antigen is CLL.
  • the cells are generally administered in a composition formulated for administration; the methods generally involve administering one or more doses of the cells to the subject, which dose(s) may include a particular number or relative number of cells or of the engineered cells, and/or a defined ratio or compositions of two or more sub-types within the composition, such as CD4+ to CD8+ T cells.
  • methods are carried out with a therapeutic T cell product involving the separate administration of CD4+ and CD8+ CAR T cell compositions administered at a particular or precise number as a flat dose and/or as a defined ratio of CD4+ and CD8+ CAR T cells.
  • methods include producing or engineering the CAR T cell composition by a process that includes the separate isolation, selection or enrichment of CD4+ and CD8+ T cells from a biological sample.
  • methods for producing a CAR-T cell composition that includes enrichment of CD4+ and CD8+ T cells avoids the risk of including tumor cells in the CAR-T cell product or during the manufacturing of the CAR-T cell product.
  • CLL is a cancer in which the tumor cells are found in the periphery, which, in some contexts may interfere with and/or impact the efficacy of a CAR-T product that may include such cells or be derived from an initial composition containing such cells.
  • the subject for treatment in accordance with the methods has a relapsed or refractory (r/r) CLL.
  • the subject for treatment in accordance with the methods has a relapsed or refractory (r/r) SLL.
  • the provided methods involve assessing a risk for developing toxicity associated with cell therapy in a subject that involves assessing or detecting biomarkers (e.g ., analytes) or parameters that are associated with the toxicity, e.g., neurotoxicity, such as severe neurotoxicity, and/or CRS, such as severe CRS, in a specific group or subset of subjects, e.g., subjects identified as having high-risk disease, e.g., high-risk CLL.
  • the methods treat subjects having a form of aggressive and/or poor prognosis CLL, such as CLL that has relapsed or is refractory (R/R) to standard therapy and has a poor prognosis.
  • the subject has failed one or more prior therapies. In some embodiments, the subject is ineligible for other prior therapy. In some embodiments, the subject has failed a prior therapy with a Bruton’s Tyrosine Kinase inhibitor (BTKi), such as ibrutinib. In some embodiments, the subject has failed ibrutinib and venetoclax.
  • BTKi Tyrosine Kinase inhibitor
  • the methods, uses and articles of manufacture involve, or are used for assessing a risk for developing toxicity associated with cell therapy in a subject by assessing or detecting biomarkers (e.g., analytes) or parameters that are associated with the toxicity, e.g., neurotoxicity, such as severe neurotoxicity, and/or CRS, such as severe CRS, in of subjects involving, selecting or identifying a particular group or subset of subjects, e.g., based on specific types of disease, diagnostic criteria, prior treatments and/or response to prior treatments.
  • biomarkers e.g., analytes
  • parameters that are associated with the toxicity e.g., neurotoxicity, such as severe neurotoxicity, and/or CRS, such as severe CRS
  • the methods involve treating a subject having relapsed following remission after treatment with, or become refractory to, one or more prior therapies; or a subject that has relapsed or is refractory (R/R) to one or more prior therapies, e.g., one or more lines of standard therapy.
  • the methods involve treating subjects having chronic lymphocytic leukemia.
  • the methods involve treating subjects having small lymphocytic lymphoma.
  • the methods involve treating a subject that has an Eastern Cooperative Oncology Group Performance Status (ECOG) of 0-1.
  • ECOG Eastern Cooperative Oncology Group Performance Status
  • the methods treat a poor-prognosis population of CLL patients or subject thereof that generally responds poorly to therapies or particular reference therapies, such as one having high-risk cytogenetics (i.e., Del(17p), TP53 mutation, mutated IGHV, and complex karyotype).
  • therapies or particular reference therapies such as one having high-risk cytogenetics (i.e., Del(17p), TP53 mutation, mutated IGHV, and complex karyotype).
  • the antigen receptor e.g. CAR
  • the antigen receptor specifically binds to a target antigen associated with the disease or condition, such as associated with CLL.
  • the antigen receptor binds to a target antigen associated with SLL.
  • the antigen associated with the disease or disorder is CD19.
  • the methods include administration of the cells or a composition containing the cells to a subject, tissue, or cell, such as one having, at risk for, or suspected of having the disease, condition or disorder.
  • the subject is an adult. In some embodiments, the subject is over at or about 50, 60, or 70 years of age.
  • the subject has been previously treated with a therapy or a therapeutic agent targeting the disease or condition, e.g., CLL or SLL, prior to administration of the cells expressing the recombinant receptor.
  • a therapy or a therapeutic agent targeting the disease or condition e.g., CLL or SLL
  • the subject has been previously treated with a hematopoietic stem cell transplantation (HSCT), e.g., allogeneic HSCT or autologous HSCT.
  • HSCT hematopoietic stem cell transplantation
  • the subject has had poor prognosis after treatment with standard therapy and/or has failed one or more lines of previous therapy, for example at least at or about 1, 2, 3, 4 or more lines of previous therapy.
  • the subject has been treated or has previously received at least or about at least or about 1, 2, 3, or 4 other therapies for treating the CLL other than a lymphodepleting therapy and/or the dose of cells expressing the antigen receptor.
  • the subject has been previously treated with chemotherapy or radiation therapy.
  • the subject is refractory or non- responsive to the other therapy or therapeutic agent.
  • the subject has persistent or relapsed disease, e.g., following treatment with another therapy or therapeutic intervention, including chemotherapy or radiation.
  • the subjects have a relapsed or refractory (R/R) chronic lymphocytic leukemia (CLL) and had failed or are ineligible of a Bruton’s Tyrosine Kinase inhibitor (BTKi) therapy.
  • R/R chronic lymphocytic leukemia
  • BTKi Tyrosine Kinase inhibitor
  • the subject has been previously treated with a therapy or a therapeutic agent targeting the disease or condition, e.g. CLL, prior to administration of the cells expressing the recombinant antigen receptor.
  • the therapeutic agent is a kinase inhibitor, such as an inhibitor of Bruton’s tyrosine kinase (Btk), for example, ibmtinib.
  • the therapeutic agent is an inhibitor of B-cell lymphoma-2 (Bcl-2), for example, venetoclax.
  • the therapeutic agent is an antibody (e.g. monoclonal antibody) that specifically binds to an antigen expressed by the cells of the CLL or NHL, e.g. an antigen from any one or more of CD20, CD19, CD22, ROR1, CD45, CD21, CD5, CD33, Igkappa, Iglambda, CD79a, CD79b or CD30.
  • the therapeutic agent is an anti-CD20 antibody, e.g., rituximab.
  • the therapeutic agent is a depleting chemotherapy that is a combination therapy that includes rituximab, e.g., a combination therapy of fludarabine and rituximab or a combination therapy of anthracycline and rituximab.
  • the subject has been previously treated with hematopoietic stem cell transplantation (HSCT), e.g., allogenic HSCT or autogenic HSCT.
  • HSCT hematopoietic stem cell transplantation
  • the subject has been treated or has previously received at least or about at least or about 1, 2, 3, or 4 other therapies for treating the CLL other than the lymphodepleting therapy and/or the dose of cells expressing the antigen receptor.
  • the subject has been previously treated with chemotherapy or radiation therapy.
  • the subject is refractory or non-responsive to the other therapy or therapeutic agent.
  • the subject has persistent or relapsed disease, e.g., following treatment with another therapy or therapeutic intervention, including chemotherapy or radiation.
  • the subject is one that is eligible for a transplant, such as is eligible for a hematopoietic stem cell transplantation (HSCT), e.g., allogeneic HSCT.
  • HSCT hematopoietic stem cell transplantation
  • the subject has not previously received a transplant, despite being eligible, prior to administration of the engineered cells (e.g. CAR-T cells) or a composition containing the cells to the subject as provided herein.
  • the subject is one that is not eligible for a transplant, such as is not eligible for a hematopoietic stem cell transplantation (HSCT), e.g., allogeneic HSCT.
  • HSCT hematopoietic stem cell transplantation
  • such a subject is administered the engineered cells (e.g. CAR-T cells) or a composition containing the cells according to the provided embodiments herein.
  • the methods include administration of cells to a subject selected or identified as having high-risk CLL.
  • the subject exhibits one or more cytogenetic abnormalities, such as associated with high-risk CLL.
  • the population to be treated includes subjects having an Eastern Cooperative Oncology Group Performance Status (ECOG) that is anywhere from 0-1.
  • ECOG Eastern Cooperative Oncology Group Performance Status
  • the subjects to be treated have failed two or more prior therapies. In some aspects of any of the embodiments, the subject to be treated has failed three of more prior therapies.
  • the prior therapies include any of a therapy with an inhibitor of Bruton’s tyrosine kinase (BTK), such as ibmtinib; venetoclax; a combination therapy comprising fludarabine and rituximab; radiation therapy; and hematopoietic stem cell transplantation (HSCT).
  • BTK tyrosine kinase
  • the subject or patient has previously received but has relapsed following remission, is refractory to, has failed and/or is intolerant to treatment with ibmtinib and/or venetoclax. In some embodiments, the subject or patient has previously received but has relapsed following remission, is refractory to, has failed and/or is intolerant to treatment with ibmtinib and venetoclax.
  • the selected or identified subjects are administered a CAR T-cell therapy, e.g. anti-CD19 CAR-T cell therapy, in accord with the provided methods.
  • the subject has never achieved a complete response (CR), never received autologous stem cell transplant (ASCT), is refractory to 1 or more second line therapy, has primary refractory disease, and/or has an ECOG performance score that is between 0 and 1.
  • CR complete response
  • ASCT autologous stem cell transplant
  • subjects to be treated in accordance with the provided embodiments include subjects with a diagnosis of CLL or SLL.
  • subjects with CLL include those with CLL diagnosis with indication of treatment based on the International Workshop on Chronic Lymphocytic Leukemia (iwCLL) guidelines and clinical measurable disease (bone marrow involvement by > 30% lymphocytes, peripheral blood lymphocytosis > 5X10 9 /L, and/or measurable lymph nodes and/or hepatic or splenomegaly.
  • iwCLL Chronic Lymphocytic Leukemia
  • subjects with SLL include those with SLL diagnosis is based on lymphadenopathy and/or splenomegaly and ⁇ 5xl0 9 CD19+ CD5+ clonal B lymphocytes/L [ ⁇ 5000/pL] in the peripheral blood at diagnosis with measurable disease defined as at least one lesion > 1.5 cm in the greatest transverse diameter, and that is biopsy-proven SLL.
  • the subjects are either ineligible for treatment with Bruton’s tyrosine kinase inhibitor (BTKi, e.g., ibmtinib) due to a requirement for full-dose anticoagulation or history or arrhythmia, or had failed treatment after having been previously administered BTKi as determined by stable disease (SD) or progressive disease (PD) as best response, PD after previous response, or discontinuation due to intolerance (e.g. unmanageable toxicity).
  • BTKi tyrosine kinase inhibitor
  • SD stable disease
  • PD progressive disease
  • the subjects are treated in accordance with the provided embodiments if they had high risk disease (as determined by complex cytogenetic abnormalities (e.g., complex karyotype), del(17p), TP53 mutation, unmutated IGVH) and had failed greater than or equal to (e.g., at least) 2 prior therapies; or if they had standard-risk disease and had failed greater than or equal to (e.g., at least) 3 prior therapies.
  • subjects to be treated in accordance with the provided embodiments exclude subjects with active untreated CNS disease, ECOG >1, or Richter’s transformation.
  • compositions, methods and uses for assessing a risk for developing toxicity associated with cell therapy in a subject by detecting biomarkers (e.g ., analytes) or parameters that are associated with the toxicity, and administration of a defined composition of the cell therapy, at particular doses, that are associated with a high response rate and/or high durability of response, and low levels and/or incidence of toxicity.
  • the composition or dose administered is a flat and/or fixed dose, such as a precise flat dose, of cells and/or of one or more cells having a particular phenotype, such as a particular number of such cells or a number that is within a particular range and/or degree of variability or variance as compared to a target number.
  • the composition or dose administered contains a defined ratio of CD4 + and CD8 + cells (e.g., 1:1 ratio of CD4 + :CD8 + CAR + T cells) and/or contains a ratio that is within a certain degree of variability from such ratio, such as no more than + 10%, such as no more than + 8%, such as a degree of variability or variance of no more than + 10%, such as no more than + 8%.
  • the CD4 + and CD8 + cells are individually formulated and administered.
  • the administered cells exhibit consistent activity and/or function, e.g., cytokine production, apoptosis and/or expansion.
  • the provided compositions exhibit highly consistent and defined activity, and low variability between cells, e.g., in terms of cell number, cell function and/or cell activity, in the composition or between preparations.
  • the consistency in activity and/or function e.g., low variability between preparations of compositions, allows improved efficacy and/or safety.
  • administration of the defined compositions resulted in low product variability and low toxicity, e.g., CRS or neurotoxicity, compared to administration of cell compositions with high heterogeneity.
  • the defined, consistent composition also exhibits consistent cell expansion. Such consistency can facilitate the identification of dose, therapeutic window, evaluation of dose response and identification of factors of the subject that may correlate with safety or toxicity outcomes.
  • the subjects in some cohorts can achieve an overall response rate (ORR, in some cases also known as objective response rate) of more than 80%, a complete response (CR) rate of more than 50% at 3 months.
  • ORR overall response rate
  • CR complete response
  • subjects receiving a defined dose show improved safety outcomes.
  • the rate of severe CRS or severe NT is low.
  • particular factors of the subject e.g., certain biomarkers or analytes (e.g. TNF, IL-16) and/or parameters (e.g., parameters that relate to tumor burden, such as lymph node tumor burden and/or blood tumor burden), can be used to predict the risk of toxicity.
  • certain biomarkers or analytes e.g. TNF, IL-16
  • parameters e.g., parameters that relate to tumor burden, such as lymph node tumor burden and/or blood tumor burden
  • particular factors of the subject e.g., certain biomarkers or analytes (e.g. VEGFC1 or VEGFR1) can be used to predict the likelihood of response.
  • the provided embodiments can be used to achieve high response rate with low risk of toxicity.
  • no more than 25%, no more than 20%, no more than 15%, no more than 10% or no more than 5% of subjects treated using the provided compositions, articles of manufacture, kits, methods and uses are administered an agent (e.g. tocilizumab and/or dexamethasone) to ameliorate, treat or prevent a toxicity, either prior to or subsequent to administration of the cell therapy.
  • an agent e.g. tocilizumab and/or dexamethasone
  • the subject is not administered any prophylaxis treatment prior to receiving the engineered cells (e.g. CAR-T cells).
  • the provided embodiments provide an advantage, e.g., permits administration of the cell therapy on an outpatient basis.
  • the administration of the cell therapy e.g. dose of T cells in accord with the provided embodiments, can be performed on an outpatient basis or does not require admission to the subject to the hospital, such as admission to the hospital requiring an overnight stay.
  • such outpatient administration can allow increased access and decreased costs, while maintaining a high, durable response rate with low toxicity.
  • outpatient treatment can be advantageous for patients who already are otherwise immunocompromised by prior treatments, e.g. post-lymphodepletion, and are at a greater risk for exposures at a hospital stay or in an in-patient setting.
  • outpatient treatments also increases options for treatment for subjects who may not have access to in-patient, hospital settings, or transplant centers, thereby expanding access to the treatment.
  • the methods and uses provide for or achieve a higher response rate and/or more durable responses or efficacy and/or a reduced risk of toxicity or other side effects that can be associated with cell therapy, such as neurotoxicity (NT) or cytokine release syndrome (CRS).
  • NT neurotoxicity
  • CRS cytokine release syndrome
  • the provided observations indicated a low rate of severe NT (sNT) or severe CRS (sCRS), and a high rate of patients without any toxicities, e.g., NT or CRS.
  • At least at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% or more of the subjects treated according to the provided methods, and/or with the provided articles of manufacture or compositions achieve a complete response (CR).
  • at least 75%, at least 80%, or at least 90% of the subjects treated according to the provided methods, and/or with the provided articles of manufacture or compositions achieve an objective response (OR).
  • At least 35%, at least 45%, at least 50%, at least 55%, at least 60% or more of the subjects treated according to the provided methods, and/or with the provided articles of manufacture or compositions achieve a CR or OR by one month, by two months or by three months.
  • at least at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% or more of subjects that had failed prior treatment with a Bruton’s Tyrosine Kinase inhibitor (BTKi) and venetoclax treated according to the provided methods, and/or with the provided articles of manufacture or compositions achieve a complete response (CR).
  • At least 75%, at least 80%, or at least 90% of the subjects that had failed prior treatment with a BTKi and venetoclax treated according to the provided methods, and/or with the provided articles of manufacture or compositions achieve an objective response (OR).
  • at least 35%, at least 45%, at least 50%, at least 55%, at least 60% or more of the subjects that had failed prior treatment with a BTKi and venetoclax treated according to the provided methods, and/or with the provided articles of manufacture or compositions achieve a CR or OR by one month, by two months or by three months.
  • greater than 50%, greater than 60%, or greater than 70% had undetectable minimal residual disease (MRD) for at least one month, at least two months, at least three months or at least 6 month after administering the dose of cells.
  • greater than 50%, greater than 60%, or greater than 70% had undetectable minimal residual disease (MRD) for at least one month, at least two months, at least three months or at least 6 month after administering the dose of cells.
  • At least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or more of the subjects treated according to the provided methods, and/or with the provided articles of manufacture or compositions remain in response, such as remain in CR or OR and/or have undetectable MRD.
  • response such as CR or OR, is durable for at least three months.
  • At least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or more of the subjects that had failed prior treatment with a BTKi and venetoclax treated according to the provided methods, and/or with the provided articles of manufacture or compositions remain in response, such as remain in CR or OR and/or have undetectable MRD.
  • response such as CR or OR, is durable for at least three months.
  • the resulting response observed in such subjects by the treatment in accord with the provided methods, and/or with the provided articles of manufacture or compositions is associated with or results in a low risk of any toxicity or a low risk of severe toxicity in a majority of the subjects treated.
  • greater than or greater than about 30%, 35%, 40%, 50%, 55%, 60% or more of the subjects treated according to the provided methods and/or with the provided articles of manufacture or compositions do not exhibit any grade of CRS or any grade of neurotoxicity (NT).
  • NT neurotoxicity
  • greater than or greater than about 50%, 60%, 70%, 80% or more of the subjects treated according to the provided methods and/or with the provided articles of manufacture or compositions do not exhibit severe CRS or grade 3 or higher CRS.
  • the resulting response observed in such subjects that had failed prior treatment with a BTKi and venetoclax by the treatment in accord with the provided methods, and/or with the provided articles of manufacture or compositions is associated with or results in a low risk of any toxicity or a low risk of severe toxicity in a majority of the subjects treated.
  • greater than or greater than about 30%, 35%, 40%, 50%, 55%, 60% or more of the subjects that had failed prior treatment with a BTKi and venetoclax treated according to the provided methods and/or with the provided articles of manufacture or compositions do not exhibit any grade of CRS or any grade of neurotoxicity (NT).
  • greater than or greater than about 50%, 60%, 70%, 80% or more of the subjects that had failed prior treatment with a BTKi and venetoclax treated according to the provided methods and/or with the provided articles of manufacture or compositions do not exhibit severe CRS or grade 3 or higher CRS. In some embodiments, greater than or greater than about 50%, 60%, 70%, 80% or more of the subjects that had failed prior treatment with a BTKi and venetoclax treated according to the provided methods, and/or with the provided articles of manufacture or compositions, do not exhibit severe neurotoxicity or grade 3 or higher neurotoxicity, such as grade 4 or 5 neurotoxicity.
  • At least at or about 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of subjects treated according to the method and/or with the provided articles of manufacture or compositions do not exhibit early onset CRS or neurotoxicity and/or do not exhibit onset of CRS earlier than 1 day, 2 days, 3 days or 4 days following initiation of the administration. In some embodiments, at least at or about 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of subjects treated according to the methods, and/or with the provided articles of manufacture or compositions, do not exhibit onset of neurotoxicity earlier than 3 days, 4 days, 5 days, six days or 7 days following initiation of the administration.
  • the median onset of neurotoxicity among subjects treated according to the methods, and/or with the provided articles of manufacture or compositions is at or after the median peak of, or median time to resolution of, CRS in subjects treated according to the method. In some cases, the median onset of neurotoxicity among subjects treated according to the method is greater than at or about 8, 9, 10, or 11 days.
  • At least at or about 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of subjects that had failed prior treatment with a BTKi and venetoclax, treated according to the methods, and/or with the provided articles of manufacture or compositions do not exhibit onset of neurotoxicity earlier than 3 days, 4 days, 5 days, six days or 7 days following initiation of the administration.
  • the median onset of neurotoxicity among subjects that had failed prior treatment with a BTKi and venetoclax, treated according to the methods, and/or with the provided articles of manufacture or compositions is at or after the median peak of, or median time to resolution of, CRS in subjects treated according to the method.
  • the median onset of neurotoxicity among subjects that had failed prior treatment with a BTKi and venetoclax, treated according to the method is greater than at or about 8, 9, 10, or 11 days.
  • results are observed following administration of from or from about 2.5 x 10 7 to at or about 1.5 x 10 8 , such as from about 5 x 10 7 to at or about 1 x 10 8 total recombinant receptor-expressing T cells (e.g. CAR+ T cells), such as a dose of T cells including CD4 + and CD8 + T cells administered at a defined ratio as described herein, e.g.
  • CAR + T cells at or about a 1 : 1 ratio, and/or at a precise or flat or fixed number of CAR + T cells, or precise or flat or fixed number of a particular type of CAR + T cells such as CD4 + CAR + T cells and/or CD8 + CAR + T cells, and/or a number of any of such cells that is within a specified degree of variance, such as no more than, + or - (plus or minus, in some cases indicated as ⁇ ), 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15% as compared to such precise or flat or fixed number.
  • a specified degree of variance such as no more than, + or - (plus or minus, in some cases indicated as ⁇ ), 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15% as compared to such precise or flat or fixed number.
  • such flat or fixed number of cells is at or about 2.5 x 10 7 total CAR + T cells or of CD8 + and/or CD4 + CAR + T cells, 5xl0 7 total CAR + T cells or of CD8 + and/or CD4 + CAR + T cells, or 1 x 10 8 total CAR + T cells or of CD8 + and/or CD4 + CAR + T cells.
  • the number of cells in the dose includes or consists of or consists essentially of 2.5 x 10 7 CAR + T cells (optionally 1.25 x 10 7 CD4 + CAR + T cells and 1.25 x 10 7 CD8 + CAR + T cells); in some embodiments, it includes or consists of or consists essentially of 5 x 10 7 CAR + T cells (optionally 2.5 x 10 7 CD4 + CAR + T cells and 2.5 x 10 7 CD8 + CAR + T cells); in some embodiments, it includes 1 x 10 8 CAR+ T cells (optionally 0.5 x 10 8 CD4 + CAR + T cells and 0.5 x 10 8 CD8 + CAR + T cells).
  • the number of cells administered is within a certain degree of variance of such numbers in the aforementioned embodiments, such as within plus or minus ( ⁇ ) 5, 6, 7, 8, 9, or 10%, such as within plus or minus 8%, as compared to such number(s) of cells.
  • the dose is within a range in which a correlation is observed (optionally a linear relationship) between the number of such cells (e.g., of total CAR + T cells or of CD8 + and/or CD4 + CAR + T cells) and one or more outcomes indicative of therapeutic response, or duration thereof (e.g., likelihood of achieving a remission, a complete remission, and/or a particular duration of remission) and/or duration of any of the foregoing.
  • the higher dose of cells administered can result in greater response without or without substantially impacting or affecting the incidence or risk of toxicity (e.g. CRS or neurotoxicity), or degree of incidence or risk of toxicity, in the subject e.g. severe CRS or severe neurotoxicity.
  • CRS incidence or risk of toxicity
  • neurotoxicity e.g. CRS or neurotoxicity
  • degree of incidence or risk of toxicity in the subject e.g. severe CRS or severe neurotoxicity.
  • the subject to be treated in accordance with the provided embodiments has adequate organ function.
  • the subjects exhibit one or more of the following: serum creatinine ⁇ 1.5 x age-adjusted upper limit of normal (ULN) or calculated creatinine clearance (Cockcroft and Gault) > 30 mL/min; alanine aminotransferase (ALT) ⁇ 5 x ULN and total bilirubin ⁇ 2.0 mg/dL (or ⁇ 3.0 mg/dL for subjects with Gilbert’s syndrome or leukemic infiltration of the liver); adequate pulmonary function, defined as ⁇ Common Terminology Criteria for Adverse Events (CTCAE) Grade 1 dyspnea and saturated oxygen (Sa0 2 ) 3 92% on room air; and/or adequate cardiac function, defined as left ventricular ejection fraction (LVEF) > 40% as assessed by echocardiogram (ECHO) or multiple uptake gated acquisition (MUGA) scan performed within 30 days prior to assessment of the subjects for administration
  • ECHO echocardiogram
  • MUGA
  • the provided methods can achieve a high or a particular rate of response (such as a rate of response among a population as assessed after a certain period post administration, such as one month or three months), e.g., ORR (such as a 1 -month or 3-month ORR) of at or about 75% or more, 80% or more, 85% or more, and CR rate (such as a 1 -month or 3-month CR rate) of at or about 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 71% or more, 72% or more, 73% or more, 74% or more or approximately 75% or more.
  • ORR such as a 1 -month or 3-month ORR
  • CR rate such as a 1 -month or 3-month CR rate
  • such rates of response and durability are received following only a single administration or dose of such therapy.
  • Treatment of such subjects by the provided methods, and/or with the provided articles of manufacture or compositions also result in the subjects achieving the high rate of response, yet not exhibiting higher incidence of developing toxicities, such as neurotoxicity or CRS, even at a higher cell dosage.
  • the provided methods, articles of manufacture and/or compositions can offer advantages over other available methods or solutions or approaches for treatment such as for adoptive cell therapy.
  • the provided embodiments are those that offer an advantage for subjects with high-risk CLL, by achieving a durable response at a high rate, with reduced incidence of toxicities or side effects.
  • one or more inflammatory cytokines, chemokines or growth factors or receptors are monitored before, during, or after CAR treatment.
  • TNF or IL-16 is assessed or monitored in a subject, such as in accord with the methods herein.
  • VEGFC or VEGFR1 is assessed or monitored in a subject, such as in accord with the methods herein.
  • the provided methods also involve administering a T cell therapy, such as a composition including cells for adoptive cell therapy, e.g., such as a CAR-expressing T cells, e.g. anti-CD19 CAR+ T cells.
  • a T cell therapy such as a composition including cells for adoptive cell therapy, e.g., such as a CAR-expressing T cells, e.g. anti-CD19 CAR+ T cells.
  • the methods also include, prior to the T cell therapy, a lymphodepleting therapy, e.g. such as cyclophosphamide, fludarabine, or combinations thereof.
  • a risk for developing toxicity associated with cell therapy in a subject that involves assessing or detecting biomarkers (e.g., analytes) or parameters that are associated with the toxicity, and administering engineered cells or compositions containing engineered cells, such as engineered T cells.
  • engineered cells e.g., T cells
  • methods and uses of engineered cells (e.g., T cells) and/or compositions thereof including methods and uses for the treatment of subjects having a disease or condition such as a leukemia or a lymphoma, e.g., a chronic lymphocytic leukemia (CLL) or a small lymphocytic lymphoma (SLL), that involves administration of the engineered cells and/or compositions thereof.
  • CLL chronic lymphocytic leukemia
  • SLL small lymphocytic lymphoma
  • the provided methods and uses can achieve improved response and/or more durable responses or efficacy and/or a reduced risk of toxicity or other side effects, e.g., in particular groups of subjects treated, as compared to certain alternative methods.
  • methods of administering engineered cells or compositions containing engineered cells, such as engineered T cells, to a subject, such as a subject that has a disease or disorder are also provided.
  • engineered cells or compositions containing engineered cells such as engineered T cells
  • methods of administering engineered cells or compositions containing engineered cells, such as engineered T cells for use in treatment of a disease or disorder, or for administration to a subject having a disease or disorder.
  • the uses of the engineered cells or compositions containing engineered cells, such as engineered T cells are in accord with any of the methods described herein.
  • the engineered cells expressing a recombinant receptor, such as a chimeric antigen receptor (CAR), or compositions comprising the same, described herein are useful in a variety of therapeutic, diagnostic and prophylactic indications.
  • the engineered cells or compositions comprising the engineered cells are useful in treating a variety of diseases and disorders in a subject.
  • Such methods and uses include therapeutic methods and uses, for example, involving administration of the engineered cells, or compositions containing the same, to a subject having a disease, condition, or disorder, such as a tumor or cancer.
  • the engineered cells or compositions comprising the same are administered in an effective amount to effect treatment of the disease or disorder.
  • Uses include uses of the engineered cells or compositions in such methods and treatments, and in the preparation of a medicament in order to carry out such therapeutic methods.
  • the engineered cells or compositions comprising the engineered cells are for use in treating a variety of diseases and disorders in a subject, for example, in accordance with the therapeutic methods.
  • the methods are carried out by administering the engineered cells, or compositions comprising the same, to the subject having or suspected of having the disease or condition.
  • the methods thereby treat the disease or condition or disorder in the subject.
  • General methods for administration of cells for adoptive cell therapy are known and may be used in connection with the provided methods and compositions.
  • the disease or condition that is treated can be any in which expression of an antigen is associated with and/or involved in the etiology of a disease condition or disorder, e.g. causes, exacerbates or otherwise is involved in such disease, condition, or disorder.
  • exemplary diseases and conditions can include diseases or conditions associated with malignancy or transformation of cells (e.g. cancer), autoimmune or inflammatory disease, or an infectious disease, e.g. caused by a bacterial, viral or other pathogen.
  • Exemplary antigens which include antigens associated with various diseases and conditions that can be treated, are described above.
  • the chimeric antigen receptor or transgenic TCR specifically binds to an antigen associated with the disease or condition.
  • the diseases, conditions, and disorders are tumors, including solid tumors, hematologic malignancies, and melanomas, and including localized and metastatic tumors, infectious diseases, such as infection with a virus or other pathogen, e.g., HIV, HCV, HBV, CMV, HPV, and parasitic disease, and autoimmune and inflammatory diseases.
  • the disease, disorder or condition is a tumor, cancer, malignancy, neoplasm, or other proliferative disease or disorder.
  • diseases for treatment according to the provided methods herein include but are not limited to leukemia, lymphoma, e.g., chronic lymphocytic leukemia (CLL) and small lymphocytic lymphoma (SLL).
  • CLL chronic lymphocytic leukemia
  • SLL small lymphocytic lymphoma
  • the Eastern Cooperative Oncology Group (ECOG) performance status indicator can be used to assess or select subjects for treatment, e.g., subjects who have had poor performance from prior therapies (see, e.g., Oken et al. (1982) Am J Clin Oncol. 5:649-655).
  • the ECOG Scale of Performance Status describes a patient’s level of functioning in terms of their ability to care for themselves, daily activity, and physical ability (e.g., walking, working, etc.).
  • an ECOG performance status of 0 indicates that a subject can perform normal activity.
  • subjects with an ECOG performance status of 1 exhibit some restriction in physical activity but the subject is fully ambulatory.
  • patients with an ECOG performance status of 2 is more than 50% ambulatory.
  • the subject with an ECOG performance status of 2 may also be capable of self-care; see e.g., Sprensen et ah, (1993) Br J Cancer 67(4) 773-775.
  • the criteria reflective of the ECOG performance status are described in Table 1 below:
  • Antigens targeted by the receptors include antigens associated with a B cell malignancy, such as any of a number of known B cell marker.
  • the antigen is or includes CD20, CD19, CD22, ROR1, CD45, CD21, CD5, CD33, Igkappa, Iglambda, CD79a, CD79b or CD30.
  • the antigen is CD19.
  • the cell therapy e.g., adoptive T cell therapy
  • the cells are carried out by autologous transfer, in which the cells are isolated and/or otherwise prepared from the subject who is to receive the cell therapy, or from a sample derived from such a subject.
  • the cells are derived from a subject, e.g., patient, in need of a treatment and the cells, following isolation and processing are administered to the same subject.
  • the cell therapy e.g., adoptive T cell therapy
  • the cell therapy is carried out by allogeneic transfer, in which the cells are isolated and/or otherwise prepared from a subject other than a subject who is to receive or who ultimately receives the cell therapy, e.g., a first subject.
  • the cells then are administered to a different subject, e.g., a second subject, of the same species.
  • a different subject e.g., a second subject
  • the first and second subjects are genetically identical.
  • the first and second subjects are genetically similar.
  • the second subject expresses the same HLA class or supertype as the first subject.
  • the cells can be administered by any suitable means, for example, by bolus infusion, by injection, e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery.
  • injection e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery.
  • injection e.g., intravenous or subcutaneous injection
  • Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration.
  • a given dose is administered by a single bolus administration of the cells. In some embodiments, it is administered by multiple bolus administrations of the cells, for example, over a period of no more than 3 days, or by continuous infusion administration of the cells.
  • administration of the cell dose or any additional therapies, e.g., the lymphodepleting therapy, intervention therapy and/or combination therapy is carried out via outpatient delivery.
  • the appropriate dosage may depend on the type of disease to be treated, the type of cells or recombinant receptors, the severity and course of the disease, whether the cells are administered for preventive or therapeutic purposes, previous therapy, the subject’s clinical history and response to the cells, and the discretion of the attending physician.
  • the compositions and cells are in some embodiments suitably administered to the subject at one time or over a series of treatments.
  • the methods comprise administration of a chemotherapeutic agent, e.g., a conditioning chemotherapeutic agent.
  • a chemotherapeutic agent e.g., a conditioning chemotherapeutic agent.
  • Preconditioning subjects with immunodepleting e.g., lymphodepleting
  • ACT adoptive cell therapy
  • the methods include administering a preconditioning agent, such as a lymphodepleting or chemotherapeutic agent, such as cyclophosphamide, fludarabine, or combinations thereof, to a subject prior to the initiation of the cell therapy.
  • a preconditioning agent such as a lymphodepleting or chemotherapeutic agent, such as cyclophosphamide, fludarabine, or combinations thereof.
  • the subject may be administered a preconditioning agent at least 2 days prior, such as at least 3, 4, 5, 6, or 7 days prior, to the initiation of the cell therapy.
  • the subject is administered a preconditioning agent no more than 7 days prior, such as no more than 6, 5, 4, 3, or 2 days prior, to the initiation of the cell therapy.
  • the subject is preconditioned with cyclophosphamide at a dose between or between about 20 mg/kg and 100 mg/kg, such as between or between about 40 mg/kg and 80 mg/kg. In some aspects, the subject is preconditioned with or with about 60 mg/kg of cyclophosphamide.
  • the cyclophosphamide can be administered in a single dose or can be administered in a plurality of doses, such as given daily, every other day or every three days. In some embodiments, the cyclophosphamide is administered once daily for one or two days.
  • the subject is administered cyclophosphamide at a dose between or between about 100 mg/m 2 and 500 mg/m 2 , such as between or between about 200 mg/m 2 and 400 mg/m 2 , or 250 mg/m 2 and 350 mg/m 2 , inclusive. In some instances, the subject is administered about 300 mg/m 2 of cyclophosphamide. In some embodiments, the cyclophosphamide can be administered in a single dose or can be administered in a plurality of doses, such as given daily, every other day or every three days.
  • cyclophosphamide is administered daily, such as for 1-5 days, for example, for 3 to 5 days. In some instances, the subject is administered about 300 mg/m 2 of cyclophosphamide, daily for 3 days, prior to initiation of the cell therapy.
  • the subject is administered fludarabine at a dose between or between about 1 mg/m 2 and 100 mg/m 2 , such as between or between about 10 mg/m 2 and 75 mg/m 2 , 15 mg/m 2 and 50 mg/m 2 , 20 mg/m 2 and 40 mg/m 2 , or 24 mg/m 2 and 35 mg/m 2 , inclusive.
  • the subject is administered about 30 mg/m 2 of fludarabine.
  • the fludarabine can be administered in a single dose or can be administered in a plurality of doses, such as given daily, every other day or every three days.
  • fludarabine is administered daily, such as for 1-5 days, for example, for 3 to 5 days.
  • the subject is administered about 30 mg/m 2 of fludarabine, daily for 3 days, prior to initiation of the cell therapy.
  • the lymphodepleting agent comprises a combination of agents, such as a combination of cyclophosphamide and fludarabine.
  • the combination of agents may include cyclophosphamide at any dose or administration schedule, such as those described above, and fludarabine at any dose or administration schedule, such as those described above.
  • the subject is administered 60 mg/kg ( ⁇ 2 g/m 2 ) of cyclophosphamide and 3 to 5 doses of 25 mg/m 2 fludarabine prior to the first or subsequent dose.
  • the biological activity of the engineered cell populations in some embodiments is measured, e.g., by any of a number of known methods. Parameters to assess include specific binding of an engineered or natural T cell or other immune cell to antigen, in vivo, e.g., by imaging, or ex vivo, e.g., by ELISA or flow cytometry. In certain embodiments, the ability of the engineered cells to destroy target cells can be measured using any suitable known methods, such as cytotoxicity assays described in, for example, Kochenderfer et ah, J. Immunotherapy, 32(7): 689-702 (2009), and Herman et al. J. Immunological Methods, 285(1): 25-40 (2004). In certain embodiments, the biological activity of the cells is measured by assaying expression and/or secretion of one or more cytokines, such as CD 107a, IFNy, IL-2, and TNF.
  • cytokines such as CD 107a, IFNy, IL-2, and
  • the engineered cells are further modified in any number of ways, such that their therapeutic or prophylactic efficacy is increased.
  • the engineered CAR or TCR expressed by the population can be conjugated either directly or indirectly through a linker to a targeting moiety.
  • the practice of conjugating compounds, e.g., the CAR or TCR, to targeting moieties is known. See, for instance, Wadwa et ah, J. Drug Targeting 3: 1 1 1 (1995), and U.S. Patent 5,087,616.
  • the cells are administered as part of a combination treatment, such as simultaneously with or sequentially with, in any order, another therapeutic intervention, such as an antibody or engineered cell or receptor or agent, such as a cytotoxic or therapeutic agent.
  • the cells in some embodiments are co-administered with one or more additional therapeutic agents or in connection with another therapeutic intervention, either simultaneously or sequentially in any order.
  • the cells are co-administered with another therapy sufficiently close in time such that the cell populations enhance the effect of one or more additional therapeutic agents, or vice versa.
  • the cells are administered prior to the one or more additional therapeutic agents.
  • the cells are administered after the one or more additional therapeutic agents.
  • the one or more additional agent includes a cytokine, such as IL-2, for example, to enhance persistence.
  • a dose of cells is administered to subjects in accord with the provided methods, and/or with the provided articles of manufacture or compositions.
  • the size or timing of the doses is determined as a function of the particular disease or condition in the subject. In some cases, the size or timing of the doses for a particular disease in view of the provided description may be empirically determined.
  • the cells, or individual populations of sub-types of cells are administered to the subject at a range of about one million to about 100 billion cells and/or that amount of cells per kilogram of body weight, such as, e.g., 1 million to about 50 billion cells (e.g., about 5 million cells, about 25 million cells, about 500 million cells, about 1 billion cells, about 5 billion cells, about 20 billion cells, about 30 billion cells, about 40 billion cells, or a range defined by any two of the foregoing values), such as about 10 million to about 100 billion cells (e.g., about 20 million cells, about 30 million cells, about 40 million cells, about 60 million cells, about 70 million cells, about 80 million cells, about 90 million cells, about 10 billion cells, about 25 billion cells, about 50 billion cells, about 75 billion cells, about 90 billion cells, or a range defined by any two of the foregoing values), and in some cases about 100 million cells to about 50 billion cells (e.g., about 120 million cells, about 250 million cells, about 350 million cells
  • Dosages may vary depending on attributes particular to the disease or disorder and/or patient and/or other treatments.
  • such values refer to numbers of recombinant receptor-expressing cells; in other embodiments, they refer to number of T cells or PBMCs or total cells administered. In some embodiments, the number of cells is the number of such cells that are viable cells.
  • the dose of cells is a flat dose of cells or fixed dose of cells such that the dose of cells is not tied to or based on the body surface area or weight of a subject.
  • the dose of genetically engineered cells comprises from at or about 1 x 10 5 to at or about 5 x 10 8 total CAR-expressing T cells, from at or about 1 x 10 5 to at or about 2.5 x 10 8 total CAR-expressing T cells, from at or about 1 x 10 5 to at or about 1 x 10 8 total CAR-expressing T cells, from at or about 1 x 10 5 to at or about 5 x 10 7 total CAR- expressing T cells, from at or about 1 x 10 5 to at or about 2.5 x 10 7 total CAR-expressing T cells, from at or about 1 x 10 5 to at or about 1 x 10 7 total CAR-expressing T cells, from at or about 1 x 10 5 to at or about 5 x 10 6 total CAR-expressing T cells, from at or about 1 x 10 5 to at or about 2.5 x 10 6 total CAR-expressing T cells, from at or about 1 x 10 5 to at or about 1 x 10 6 total CAR-expressing T cells, from at or about 1 x 10 5 to
  • the dose of genetically engineered cells comprises from at or about 2.5 x 10 7 to at or about 1.5 x 10 8 total CAR-expressing T cells, such as 5 x 10 7 to 1 x 10 8 total CAR-expressing T cells. In some embodiments, the dose of genetically engineered cells comprises at least or at least about 2.5 x 10 7 CAR-expressing cells, at least or at least about 5 x 10 7 CAR-expressing cells, or at least or at least about 1 x 10 8 CAR-expressing cells. In some embodiments, the dose of T cells comprises: at or about 2.5 x 10 7 CAR-expressing T cells. In some embodiments, the dose of T cells comprises at or about 1 x 10 8 CAR-expressing T cells. In some embodiments, the dose of T cells comprises at or about 5 x 10 7 CAR-expressing T cells.
  • the number of cells is the number of such cells that are viable cells.
  • the number is with reference to the total number of CD3 + , CD8 + , or CD4 + and CD8 + , in some cases also recombinant receptor-expressing (e.g. CAR + ) cells. In some embodiments, the number is with reference to the total number of CD3 + recombinant receptor-expressing (e.g. CAR + ) cells. In some embodiments, the number is with reference to the total number of CD4 + and CD8 + recombinant receptor-expressing (e.g. CAR + ) cells. In some embodiments, the number of cells is the number of such cells that are viable cells.
  • the cell therapy comprises administration of a dose comprising a number of cell from or from about 1 x 10 5 to or to about 5 x 10 8 CD3 + , CD8 + , or CD4 + and CD8 + total T cells or CD3 + , CD8 + , or CD4 + and CD8 + recombinant receptor (e.g. CAR+)-expressing cells, from or from about 5 x 10 5 to or to about 1 x 10 7 CD3 + , CD8 + , or CD4 + and CD8 + total T cells or CD3 + , CD8 + , or CD4 + and CD8 + recombinant receptor (e.g.
  • a dose comprising a number of cell from or from about 1 x 10 5 to or to about 5 x 10 8 CD3 + , CD8 + , or CD4 + and CD8 + total T cells or CD3 + , CD8 + , or CD4 + and CD8 + recombinant receptor (e.g.
  • CAR+ recombinant receptor
  • CAR+ recombinant receptor- expressing cells, each inclusive.
  • the cell therapy comprises administration of a dose comprising a number of cell from or from about 1 x 10 5 to or to about 5 x 10 8 total CD3 + /CAR + , CD8 + /CAR + or CD4 + /CD8 + /CAR + cells, from or from about 5 x 10 5 to or to about 1 x 10 7 total CD3 + /CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + cells, or from or from about 1 x 10 6 to or to about 1 x 10 7 total CD3 + /CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + cells, each inclusive.
  • the number of cells is the number of such cells that are viable cells.
  • the dose of genetically engineered cells comprises from or from about 2.5 x 10 7 to 1.5 x 10 8 total CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells, such as 5 x 10 7 to 1 x 10 8 total CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells.
  • the dose of genetically engineered cells comprises at least or at least about 2.5 x 10 7 CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells, at least or at least about 5 x
  • CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells or at least or at least about 1 x 10 8 CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells.
  • the dose of genetically engineered cells comprises at or about 2.5 x 10 7 CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells, at or about 5 x 10 7 CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells, or at or about 1 x 10 8 CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells.
  • the number of cells is the number of such cells that are viable cells.
  • the dose of T cells comprises: at or about 5 x 10 7 recombinant receptor (e.g. CAR)-expressing T cells or at or about 2.5 x 10 7 recombinant receptor (e.g. CAR)- expressing CD8 + T cells. In some embodiments, the dose of T cells comprises: at or about 1 x
  • the dose of T cells comprises: at or about 1.5 x 10 8 recombinant receptor (e.g. CAR)-expressing T cells or at or about 0.75 x 10 8 recombinant receptor (e.g. CAR)-expressing CD8 + T cells.
  • the number of cells is the number of such cells that are viable cells.
  • the T cells of the dose include CD4 + T cells, CD8 + T cells or CD4 + and CD8 + T cells.
  • the CD8 + T cells of the dose includes between about 2.5 x 10 7 and 1 x 10 8 total recombinant receptor (e.g., CAR)- expressing CD8 + cells, or a fraction thereof such as present at a ratio of 1:3 to 3:1 CD4+ cells to CD8+ T cell, optionally at or about 1:1.
  • CAR total recombinant receptor
  • the patient is administered multiple doses, and each of the doses or the total dose can be within any of the foregoing values.
  • the dose of cells comprises the administration of from or from about 1 x 10 5 to or to about 5 x 10 8 total recombinant receptor (e.g. CAR)-expressing T cells or total T cells, from or from about 1 x
  • total recombinant receptor e.g. CAR
  • the dose of cells is a flat dose of cells or fixed dose of cells such that the dose of cells is not tied to or based on the body surface area or weight of a subject.
  • the dose of genetically engineered cells comprises from or from about 1 x 10 5 to 5 x 10 8 total CAR-expressing T cells, 1 x 10 5 to 2.5 x 10 8 total CAR-expressing T cells, 1 x 10 5 to 1 x 10 8 total CAR-expressing T cells, 1 x 10 5 to 5 x 10 7 total CAR- expressing T cells, 1 x 10 5 to 2.5 x 10 7 total CAR-expressing T cells, 1 x 10 5 to 1 x 10 7 total CAR-expressing T cells, 1 x 10 5 to 5 x 10 6 total CAR-expressing T cells, 1 x 10 5 to 2.5 x 10 6 total CAR-expressing T cells, 1 x 10 5 to 1 x 10 6 total CAR-expressing T cells, 1 x 10 6 to 5 x 10 8 total CAR-expressing T cells, 1 x 10 6 to 2.5 x 10 8 total CAR-expressing T cells, 1 x 10 6 to 1 x 10 8 total CAR-expressing T cells, 1 x 10 6 to 2.5 x 10 8 total
  • 1 x 10 7 to 1 x 10 8 total CAR-expressing T cells 1 x 10 7 to 1 x 10 8 total CAR-expressing T cells, 1 x 10 7 to 5 x 10 7 total CAR-expressing T cells, 1 x 10 7 to 2.5 x 10 7 total CAR-expressing T cells, 2.5 x 10 7 to 5 x 10 8 total CAR-expressing T cells, 2.5 x 10 7 to 2.5 x 10 8 total CAR-expressing T cells, 2.5 x 10 7 to 1 x 10 8 total CAR-expressing T cells, 2.5 x 10 7 to 5 x 10 7 total CAR-expressing T cells, 5 x 10 7 to 5 x 10 8 total CAR-expressing T cells, 5 x 10 7 to 2.5 x 10 8 total CAR-expressing T cells, 5 x 10 7 to 1 x 10 8 total CAR-expressing T cells, 5 x 10 7 to 1 x 10 8 total CAR-expressing T cells, 5 x 10 7 to 1 x 10 8 total CAR-expressing T cells, 5 x 10 7 to 1
  • the number of cells is the number of such cells that are viable cells.
  • the dose of genetically engineered cells comprises from at or about 2.5 x 10 7 to at or about 1.5 x 10 8 total CAR-expressing T cells, such as 5 x 10 7 to 1 x 10 8 total CAR-expressing T cells. In some embodiments, the dose of genetically engineered cells comprises at least or at least about 2.5 x 10 7 CAR-expressing cells, at least or at least about 5 x 10 7 CAR-expressing cells, or at least or at least about 1 x 10 8 CAR-expressing cells. In some embodiments, the dose of T cells comprises: at or about 2.5 x 10 7 CAR-expressing T cells. In some embodiments, the dose of T cells comprises at or about 1 x 10 8 CAR-expressing T cells. In some embodiments, the dose of T cells comprises at or about 5 x 10 7 CAR-expressing T cells.
  • the number of cells is the number of such cells that are viable cells.
  • the number is with reference to the total number of CD3 + , CD8 + , or CD4 + and CD8 + , in some cases also recombinant receptor-expressing (e.g. CAR + ) cells. In some embodiments, the number of cells is the number of such cells that are viable cells.
  • the cell therapy comprises administration of a dose comprising a number of cell from or from about 1 x 10 5 to or to about 5 x 10 8 CD3 + , CD8 + , or CD4 + and CD8 + total T cells or CD3 + , CD8 + , or CD4 + and CD8 + recombinant receptor (e.g. CAR+)-expressing cells, from or from about 5 x 10 5 to or to about 1 x 10 7 CD3 + , CD8 + , or CD4 + and CD8 + total T cells or CD3 + , CD8 + , or CD4 + and CD8 + recombinant receptor (e.g.
  • a dose comprising a number of cell from or from about 1 x 10 5 to or to about 5 x 10 8 CD3 + , CD8 + , or CD4 + and CD8 + total T cells or CD3 + , CD8 + , or CD4 + and CD8 + recombinant receptor (e.g.
  • CAR+ recombinant receptor
  • CAR+ recombinant receptor- expressing cells, each inclusive.
  • the cell therapy comprises administration of a dose comprising a number of cell from or from about 1 x 10 5 to or to about 5 x 10 8 total CD3 + /CAR + , CD8 + /CAR + or CD4 + /CD8 + /CAR + cells, from or from about 5 x 10 5 to or to about 1 x 10 7 total CD3 + /CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + cells, or from or from about 1 x 10 6 to or to about 1 x 10 7 total CD3 + /CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + cells, each inclusive.
  • the number of cells is the number of such cells that are viable cells.
  • the dose of genetically engineered cells comprises from or from about 2.5 x 10 7 to 1.5 x 10 8 total CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells, such as 5 x 10 7 to 1 x 10 8 total CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells.
  • the dose of genetically engineered cells comprises at least or at least about 2.5 x 10 7 CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells, at least or at least about 5 x
  • CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells or at least or at least about 1 x 10 8 CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells.
  • the dose of genetically engineered cells comprises at or about 2.5 x 10 7 CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells, at or about 5 x 10 7 CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells, or at or about 1 x 10 8 CD3+/CAR + , CD8 + /CAR + , or CD4 + /CD8 + /CAR + T cells.
  • the number of cells is the number of such cells that are viable cells.
  • the dose of T cells comprises: at or about 5 x 10 7 recombinant receptor (e.g. CAR)-expressing T cells or at or about 2.5 x 10 7 recombinant receptor (e.g. CAR)- expressing CD8 + T cells. In some embodiments, the dose of T cells comprises: at or about 1 x
  • the dose of T cells comprises: at or about 1.5 x 10 8 recombinant receptor (e.g. CAR)-expressing T cells or at or about 0.75 x 10 8 recombinant receptor (e.g. CAR)-expressing CD8 + T cells.
  • the number of cells is the number of such cells that are viable cells.
  • the patient is administered multiple doses, and each of the doses or the total dose can be within any of the foregoing values.
  • the dose of cells comprises the administration of from or from about 1 x 10 5 to or to about 5 x 10 8 total recombinant receptor (e.g. CAR)-expressing T cells or total T cells, from or from about 1 x
  • the T cells of the dose include CD4 + T cells, CD8 + T cells or CD4 + and CD8 + T cells.
  • the dose of cells e.g., recombinant receptor-expressing T cells
  • administration of a given “dose” encompasses administration of the given amount or number of cells as a single composition and/or single uninterrupted administration, e.g., as a single injection or continuous infusion, and also encompasses administration of the given amount or number of cells as a split dose or as a plurality of compositions, provided in multiple individual compositions or infusions, over a specified period of time, such as over no more than 3 days.
  • the dose is a single or continuous administration of the specified number of cells, given or initiated at a single point in time.
  • the dose is administered in multiple injections or infusions over a period of no more than three days, such as once a day for three days or for two days or by multiple infusions over a single day period.
  • the cells of the dose are administered in a single pharmaceutical composition.
  • the cells of the dose are administered in a plurality of compositions, collectively containing the cells of the dose.
  • cells of the dose may be administered by administration of a plurality of compositions or solutions, such as a first and a second, optionally more, each containing some cells of the dose.
  • the plurality of compositions, each containing a different population and/or sub-types of cells are administered separately or independently, optionally within a certain period of time.
  • the populations or sub- types of cells can include CD8 + and CD4 + T cells, respectively, and/or CD8 + - and CD4 + - enriched populations, respectively, e.g., CD4 + and/or CD8 + T cells each individually including cells genetically engineered to express the recombinant receptor.
  • the administration of the dose comprises administration of a first composition comprising a dose of CD8 + T cells or a dose of CD4 + T cells and administration of a second composition comprising the other of the dose of CD4 + T cells and the CD8 + T cells.
  • the administration of the composition or dose involves administration of the cell compositions separately.
  • the separate administrations are carried out simultaneously, or sequentially, in any order.
  • the separate administrations are carried out sequentially by administering, in any order, a first composition comprising a dose of CD8 + T cells or a dose of CD4 + T cells and a second composition comprising the other of the dose of CD4 + T cells and the CD8 + T cells.
  • the dose comprises a first composition and a second composition, and the first composition and second composition are administered within 48 hours of each other, such as no more than 36 hours of each other or not more than 24 hours of each other.
  • the first composition and second composition are administered at or about 0 to at or about 12 hours apart, from at or about 0 to at or about 6 hours apart or from at or about 0 to at or about 2 hours apart.
  • the initiation of administration of the first composition and the initiation of administration of the second composition are carried out no more than at or about 2 hours, no more than at or about 1 hour, or no more than at or about 30 minutes apart, no more than at or about 15 minutes, no more than at or about 10 minutes or no more than at or about 5 minutes apart.
  • the initiation and/or completion of administration of the first composition and the completion and/or initiation of administration of the second composition are carried out no more than at or about 2 hours, no more than at or about 1 hour, or no more than at or about 30 minutes apart, no more than at or about 15 minutes, no more than at or about 10 minutes or no more than at or about 5 minutes apart.
  • the first composition e.g., first composition of the dose
  • the first composition comprises CD4 + T cells.
  • the first composition e.g., first composition of the dose
  • the first composition is administered prior to the second composition.
  • the CD8+ T cells are administered prior to the CD4+ T cells.
  • the dose or composition of cells includes a defined or target ratio of CD4 + cells expressing a recombinant receptor (e.g. CAR) to CD8 + cells expressing a recombinant receptor (e.g. CAR) and/or of CD4 + cells to CD8 + cells, which ratio optionally is approximately 1:1 or is between approximately 1:3 and approximately 3:1, such as approximately 1:1.
  • the dose or composition of cells includes a defined or target ratio of CD4 + cells expressing a recombinant receptor (e.g. CAR) to CD8 + cells expressing a recombinant receptor (e.g. CAR) and/or of CD4 + cells to CD8 + cells, which ratio is approximately 1:1.
  • the administration of a composition or dose with the target or desired ratio of different cell populations involves the administration of a cell composition containing one of the populations and then administration of a separate cell composition comprising the other of the populations, where the administration is at or approximately at the target or desired ratio.
  • administration of a dose or composition of cells at a defined ratio leads to improved expansion, persistence and/or antitumor activity of the T cell therapy.
  • the dose or composition of cells includes a defined or target ratio of CD4 + cells expressing a recombinant receptor to CD8 + cells expressing a recombinant receptor and/or of CD4 + cells to CD8 + cells, which ratio optionally is approximately 1:1.
  • the administration of a composition or dose with the target or desired ratio of different cell populations involves the administration of a cell composition containing one of the populations and then administration of a separate cell composition comprising the other of the populations, where the administration is at or approximately at the target or desired ratio.
  • administration of a dose or composition of cells at a defined ratio leads to improved expansion, persistence and/or antitumor activity of the T cell therapy.
  • the numbers and/or concentrations of cells refer to the number of recombinant receptor (e.g., CAR)-expressing cells or the number of recombinant receptor (e.g., CAR)-expressing T cell or CD3+ T or a CD4+ and/or CD8+ T cell subset thereof. In some embodiments, the number and/or concentration of cells refers to such number of cells that are viable cells.
  • the dose of genetically engineered cells is or is about 5 x 10 7 CD3+ CAR+ viable cells, that includes a separate dose of at or about 2.5 x 10 7 CD4+ CAR+ viable cells and at or about 2.5 x 10 7 CD8+CAR+ viable cells. In some embodiments, the dose of genetically engineered cells is or is about 1 x 10 8 CD3+CAR+ viable cells, that includes a separate dose of at or about 5 x 10 7 CD4+CAR+ viable cells and at or about 5 xlO 7 CD8+CAR+ viable cells.
  • the dose of genetically engineered cells is or is about 1.5 x 10 8 CD3+CAR+ viable cells, that includes a separate dose of at or about 0.75 x 10 8 CD4+CAR+ viable cells and at or about 0.75 xlO 8 CD8+CAR+ viable cells.
  • the administration effectively treats the subject despite the subject having failed, become refractory to and/or become resistant to another therapy. In some embodiments, the administration effectively treats the subject despite the subject having become refractory to another therapy. In some embodiments, the administration effectively treats the subject despite the subject having become resistant to another therapy. In some embodiments, at least 30% of subjects treated according to the method achieve complete remission (CR); and/or at least about 75% of the subjects treated according to the method achieve an objective response (OR). In some embodiments, at least or about at least 35%, 40%, 45%, 50%, 55%, 60% or more of subjects treated according to the method achieve CR and/or at least or about at least 50%,
  • At least 30% of subjects that have failed both a prior BTK inhibitor (e.g., ibrutinib) therapy and venetoclax, treated according to the method achieve complete remission (CR); and/or at least about 75% of the subjects that have failed both a prior BTK inhibitor (e.g., ibrutinib) therapy and venetoclax, treated according to the method achieve an objective response (OR).
  • a prior BTK inhibitor e.g., ibrutinib
  • venetoclax e.g., CR
  • OR objective response
  • At least or about at least 35%, 40%, 45%, 50%, 55%, 60% or more of subjects that have failed both a prior BTK inhibitor (e.g., ibrutinib) therapy and venetoclax, treated according to the method achieve CR and/or at least or about at least 50%, 60%, 70%, or 80% achieve an objective response (OR).
  • criteria assessed for effective treatment includes overall response rate (ORR; also known in some cases as objective response rate), complete response (CR; also known in some cases as complete remission), complete remission with incomplete blood count recovery (CRi), stable disease (SD), and/or partial disease (PD).
  • the duration of the response before progression is for greater than 1 month, greater than 2 months, greater than 3 months, greater than 6 months or more. In some embodiments, at least 35%, 40%, 45%, 50%, 55%, 60% or more of subjects treated according to the methods provided herein achieve complete remission (CR; also known in some cases as complete remission) at or about 3 months or at or about 6 months after administration of the cell therapy.
  • CR complete remission
  • the administration in accord with the provided methods, and/or with the provided articles of manufacture or compositions generally reduces or prevents the expansion or burden of the disease or condition in the subject.
  • the methods generally reduce tumor size, bulk, metastasis, percentage of blasts in the bone marrow or molecularly detectable cancer and/or improve prognosis or survival or other symptom associated with tumor burden.
  • Disease burden can encompass a total number of cells of the disease in the subject or in an organ, tissue, or bodily fluid of the subject, such as the organ or tissue of the tumor or another location, e.g., which would indicate metastasis.
  • tumor cells may be detected and/or quantified in the blood or bone marrow in the context of certain hematological malignancies.
  • Disease burden can include, in some embodiments, the mass of a tumor, the number or extent of metastases and/or the percentage of blast cells present in the bone marrow.
  • a subject has leukemia.
  • the extent of disease burden can be determined by assessment of residual leukemia in blood or bone marrow.
  • response rates in subjects are based on the International Workshop on Chronic Lymphocytic Leukemia (IWCLL) response criteria (Hallek, et ah, Blood 2008, Jun 15; 111(12): 5446-5456).
  • response rates in subjects, such as subjects with CLL are based on the International Workshop on Chronic Lymphocytic Leukemia (IWCLL) response criteria (Hallek et ah, Blood 2018 131 (25): 2745- 2760).
  • CR complete remission
  • PR partial remission
  • PD progressive disease
  • the subjects exhibits a CR or OR if, within 1 month of the administration of the dose of cells, lymph nodes in the subject are less than at or about 20 mm in size, less than at or about 10 mm in size or less than at or about 10 mm in size.
  • an index clone of the CLL is not detected in the bone marrow of the subject (or in the bone marrow of greater than 50%, 60%, 70%, 80%, 90% or more of the subjects treated according to the methods.
  • an index clone of the CLL is assessed by IgH deep sequencing.
  • the index clone is not detected at a time that is at or about or at least at or about 1, 2, 3, 4, 5, 6, 12, 18 or 24 months following the administration of the cells.
  • a subject exhibits morphologic disease if there are greater than or equal to 5% blasts in the bone marrow, for example, as detected by light microscopy, such as greater than or equal to 10% blasts in the bone marrow, greater than or equal to 20% blasts in the bone marrow, greater than or equal to 30% blasts in the bone marrow, greater than or equal to 40% blasts in the bone marrow or greater than or equal to 50% blasts in the bone marrow.
  • a subject exhibits morphologic disease if there are greater than or equal to 5% blasts in the bone marrow.
  • a subject exhibits complete or clinical remission if there are less than 5% blasts in the bone marrow.
  • a subject has leukemia.
  • the extent of disease burden can be determined by assessment of residual leukemia in blood or bone marrow.
  • a subject exhibits morphologic disease if there are greater than or equal to 5% blasts in the bone marrow, for example, as detected by light microscopy, such as greater than or equal to 10% blasts in the bone marrow, greater than or equal to 20% blasts in the bone marrow, greater than or equal to 30% blasts in the bone marrow, greater than or equal to 40% blasts in the bone marrow or greater than or equal to 50% blasts in the bone marrow.
  • a subject exhibits morphologic disease if there are greater than or equal to 5% blasts in the bone marrow.
  • a subject exhibits complete or clinical remission if there are less than 5% blasts in the bone marrow.
  • a subject may exhibit complete remission, but a small proportion of morphologically undetectable (by light microscopy techniques) residual leukemic cells are present.
  • a subject is said to exhibit minimum residual disease (MRD) if the subject exhibits less than 5% blasts in the bone marrow and exhibits molecularly detectable cancer.
  • MRD minimum residual disease
  • molecularly detectable cancer can be assessed using any of a variety of molecular techniques that permit sensitive detection of a small number of cells.
  • such techniques include PCR assays, which can determine unique Ig/T-cell receptor gene rearrangements or fusion transcripts produced by chromosome translocations.
  • flow cytometry can be used to identify cancer cell based on leukemia- specific immunophenotypes.
  • molecular detection of cancer can detect as few as 1 leukemia cell in 100,000 normal cells.
  • a subject exhibits MRD that is molecularly detectable if at least or greater than 1 leukemia cell in 100,000 cells is detected, such as by PCR or flow cytometry.
  • the disease burden of a subject is molecularly undetectable or MRD , such that, in some cases, no leukemia cells are able to be detected in the subject using PCR or flow cytometry techniques.
  • an index clone of the leukemia is not detected in the bone marrow of the subject (or in the bone marrow of greater than 50%, 60%, 70%, 80%, 90% or more of the subjects treated according to the methods.
  • an index clone of the leukemia, e.g. CLL is assessed by IGH deep sequencing.
  • the index clone is not detected at a time that is at or about or at least at or about 1, 2, 3, 4, 5, 6, 12, 18 or 24 months following the administration of the cells.
  • MRD is detected by flow cytometry.
  • Flow cytometry can be used to monitor bone marrow and peripheral blood samples for cancer cells.
  • flow cytometry is used to detect or monitor the presence of cancer cells in bone marrow.
  • multiparameter immunological detection by flow cytometry is used to detect cancer cells (see for example, Coustan-Smith et al., (1998) Lancet 351:550-554).
  • multiparameter immunological detection by mass cytometry is used to detect cancer cells.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45 or 50 parameters can be used to detect cancer cells.
  • MRD is described as subjects who have no evidence of CLL in peripheral blood or marrow, i.e., CR or PR based on residual lymphadenopathy or splenomegaly. In some aspects, MRD is measured via flow cytometry of peripheral blood and IgHV deep sequencing of bone marrow.
  • bone marrow is harvested by bone marrow aspirates or bone marrow biopsies, and lymphocytes are isolated for analysis.
  • Monoclonal and/or polyclonal antibodies conjugated to a fluorochrome e.g., fluorescein isothiocyanate (FITC), phycoerythrin, peridinin chlorophyll protein, or biotin
  • FITC fluorescein isothiocyanate
  • phycoerythrin e.g., phycoerythrin
  • peridinin chlorophyll protein e.g., FITC
  • FITC fluorescein isothiocyanate
  • phycoerythrin phycoerythrin
  • peridinin chlorophyll protein or biotin
  • TdT terminal deoxynucleotidyl transferase
  • Lymphoid cells can be identified and gated based on a light-scatter dot plot and then secondarily gated to identify cell populations expressing the immunophenotypic features of interest. Exemplary epitopes are set forth in Table 2 below. Other immunologic classification of leukemias and lymphomas are provided by Foon and Todd (Blood (1986) 68(1): 1-31). In some aspects, flow cytometric assessment of MRD can be achieved by quantifying live lymphocytes bearing one or more CLL immunophenotypes (e.g., low forward/side scatter; CD3 neg ; CD5 + ; CD14 neg ; CD19 + ; CD23 + ; CD45 + ; CD56 neg ).
  • CLL immunophenotypes e.g., low forward/side scatter; CD3 neg ; CD5 + ; CD14 neg ; CD19 + ; CD23 + ; CD45 + ; CD56 neg ).
  • deep sequencing of the immunoglobulin heavy chain (IGH) locus of harvested B cells can be used to detect minimal residual disease (MRD).
  • MRD minimal residual disease
  • Clonal presence of a particular IgG rearrangement can provide a marker to detect the presence of B cell malignancies, such as CLL and/or residual presence of malignant cells thereof.
  • cells such as a population containing or suspected of containing B cells are harvested and isolated from blood.
  • cells are harvested and isolated from bone marrow, e.g., from bone marrow aspirates or bone marrow biopsies and/or from other biological samples.
  • polymerase chain reaction (PCR) amplification of the complementarity determining region 3 (CDR3) is achieved using primers to highly conserved sequences within the V and J regions of the gene locus, which may be used to identify clonal populations of cells for purposes of assessing minimal residual disease.
  • Other methods for detecting clonal populations such as single cell sequencing approaches, including those providing information regarding number of cells of a particular lineage and/or expressing a particular variable chain such as variable heavy chain or binding site thereof, such as a clonal population, may be used.
  • the IGH DNA is amplified using a degenerate primers or primers recognizing regions of variable chains shared among different cell clones, such as those recognizing consensus V and degenerate consensus J region of the IGH sequence.
  • An exemplary sequence of the V region is ACACGGCCTCGTGTATTACTGT (SEQ ID NO: 57).
  • An exemplary degenerate consensus sequence of the J region is ACCTGAGGAGACGGTGACC (SEQ ID NO: 58).
  • the PCR product or sequencing result in some aspects is specific to the rearranged allele and serves as a clonal marker for MRD detection.
  • PCR products can be sequenced to yield patient- specific oligonucleotides constructed as probes for allele- specific PCR for sensitive detection of MRD following treatment of B-cell malignancies with CAR-T cell therapy, e.g. CD19 CAR- T cell therapy.
  • CAR-T cell therapy e.g. CD19 CAR- T cell therapy.
  • V region family- specific primers for the framework region 1 can be used instead.
  • persistence of PCR-detectable tumor cells such as cells of the B cell malignancy such as the CLL, such as detectable IGH sequences corresponding to the malignant or clonal IGH sequences, after treatment is associated with increased risk of relapse.
  • patients who are negative for malignant IGH sequences following treatment in some aspects, even in the context of other criteria indicating progressive disease or only a partial response, such as persistence of enlarged lymph nodes or other criteria that may in some contexts be associated with disease or lack of complete response) may be deemed to have increased likelihood to enter into CR or durable CR or prolonged survival, compared to patients with persistent malignant IGH sequences.
  • such prognostic and staging determinations are particularly relevant for treatments in which clearance of malignant cells is observed within a short period of time following administration of the therapy, e.g., in comparison to resolution of other clinical symptoms such as lymph node size or other staging criteria.
  • absence of detectable IGH or minimal residual disease in a sample such as the bone marrow may be a preferred readout for response or likelihood of response or durability thereof, as compared to other available staging or prognostic approaches.
  • results from MRD e.g., IGH deep sequencing information, may inform further intervention or lack thereof.
  • a subject deemed negative for malignant IGH may in some aspects be not further treated or not be further administered a dose of the therapy provided, or that the subject be administered a lower or reduced dose.
  • a subject exhibiting MRD via IGH deep sequencing be further treated, e.g., with the therapy initially administered at a similar or higher dose or with a further treatment.
  • the disease or condition persists following administration of the first dose and/or administration of the first dose is not sufficient to eradicate the disease or condition in the subject.
  • the method reduces the burden of the disease or condition, e.g., number of tumor cells, size of tumor, duration of patient survival or event-free survival, to a greater degree and/or for a greater period of time as compared to the reduction that would be observed with a comparable method using an alternative dosing regimen, such as one in which the subject receives one or more alternative therapeutic agents and/or one in which the subject does not receive a dose of cells and/or a lymphodepleting agent in accord with the provided methods, and/or with the provided articles of manufacture or compositions.
  • the burden of a disease or condition in the subject is detected, assessed, or measured.
  • Disease burden may be detected in some aspects by detecting the total number of disease or disease-associated cells, e.g., tumor cells, in the subject, or in an organ, tissue, or bodily fluid of the subject, such as blood or serum.
  • survival of the subject survival within a certain time period, extent of survival, presence or duration of event-free or symptom-free survival, or relapse-free survival, is assessed.
  • any symptom of the disease or condition is assessed.
  • the measure of disease or condition burden is specified.
  • the probability of relapse is reduced as compared to other methods, for example, methods in which the subject receives one or more alternative therapeutic agents and/or one in which the subject does not receive a dose of cells and/or a lymphodepleting agent in accord with the provided methods, and/or with the provided articles of manufacture or compositions.
  • the pharmacokinetics of administered cells are determined to assess the availability, e.g., bioavailability of the administered cells.
  • Methods for determining the pharmacokinetics of adoptively transferred cells may include drawing peripheral blood from subjects that have been administered engineered cells, and determining the number or ratio of the engineered cells in the peripheral blood.
  • Approaches for selecting and/or isolating cells may include use of chimeric antigen receptor (CAR)-specific antibodies (e.g., Brentjens et ah, Sci. Transl. Med. 2013 Mar; 5(177): 177ra38) Protein L (Zheng et ah, J. Transl. Med.
  • CAR chimeric antigen receptor
  • epitope tags such as Strep-Tag sequences, introduced directly into specific sites in the CAR, whereby binding reagents for Strep-Tag are used to directly assess the CAR (Liu et al. (2016) Nature Biotechnology, 34:430; international patent application Pub. No. WO2015095895) and monoclonal antibodies that specifically bind to a CAR polypeptide (see international patent application Pub. No. WO2014190273).
  • Extrinsic marker genes may in some cases be utilized in connection with engineered cell therapies to permit detection or selection of cells and, in some cases, also to promote cell suicide.
  • EGFRt truncated epidermal growth factor receptor
  • a transgene of interest a CAR or TCR
  • EGFRt may contain an epitope recognized by the antibody cetuximab (Erbitux®) or other therapeutic anti-EGFR antibody or binding molecule, which can be used to identify or select cells that have been engineered with the EGFRt construct and another recombinant receptor, such as a chimeric antigen receptor (CAR), and/or to eliminate or separate cells expressing the receptor.
  • cetuximab Erbitux®
  • CAR chimeric antigen receptor
  • the number of CAR + T cells in a biological sample obtained from the patient, e.g., blood can be determined at a period of time after administration of the cell therapy, e.g., to determine the pharmacokinetics of the cells.
  • number of CAR + T cells, optionally CAR + CD8 + T cells and/or CAR + CD4 + T cells, detectable in the blood of the subject, or in a majority of subjects so treated by the method is greater than 1 cells per pL, greater than 5 cells per pL or greater than per 10 cells per pL.
  • the provided methods are designed to or include features that result in a lower rate and/or lower degree of toxicity, toxic outcome or symptom, toxicity- promoting profile, factor, or property, such as a symptom or outcome associated with or indicative of cytokine release syndrome (CRS) or neurotoxicity, for example, compared to administration of an alternative cell therapy, such as an alternative CAR + T cell composition and/or an alternative dosing of cells, e.g. a dosing of cells that is not administered at a defined ratio.
  • an alternative cell therapy such as an alternative CAR + T cell composition and/or an alternative dosing of cells, e.g. a dosing of cells that is not administered at a defined ratio.
  • the provided methods do not result in a high rate or likelihood of toxicity or toxic outcomes, or reduces the rate or likelihood of toxicity or toxic outcomes, such as neurotoxicity (NT), cytokine release syndrome (CRS), such as compared to certain other cell therapies.
  • the methods do not result in, or do not increase the risk of, severe NT (sNT), severe CRS (sCRS), macrophage activation syndrome, tumor lysis syndrome, fever of at least at or about 38 degrees Celsius for three or more days and a plasma level of CRP of at least at or about 20 mg/dL.
  • greater than or greater than about 30%, 35%, 40%, 50%, 55%, 60% or more of the subjects treated according to the provided methods do not exhibit any grade of CRS or any grade of neurotoxicity.
  • no more than 50% of subjects treated e.g. at least 60%, at least 70%, at least 80%, at least 90% or more of the subjects treated
  • CRS cytokine release syndrome
  • at least 50% of subjects treated according to the method do not exhibit a severe toxic outcome (e.g.
  • severe CRS or severe neurotoxicity such as do not exhibit grade 3 or higher neurotoxicity and/or does not exhibit severe CRS, or does not do so within a certain period of time following the treatment, such as within a week, two weeks, or one month of the administration of the cells..
  • greater than or greater than about 30%, 35%, 40%, 50%, 55%, 60% or more of the subjects that had failed both a prior BTK inhibitor (e.g., ibrutinib) therapy and venetoclax, treated according to the provided methods do not exhibit any grade of CRS or any grade of neurotoxicity.
  • no more than 50% of subjects treated e.g.
  • At least 60%, at least 70%, at least 80%, at least 90% or more of the subjects treated that had failed both a prior BTK inhibitor exhibit a cytokine release syndrome (CRS) higher than grade 2 and/or a neurotoxicity higher than grade 2.
  • a prior BTK inhibitor e.g., ibrutinib
  • venetoclax e.g., a cytokine release syndrome
  • parameters assessed to determine certain toxicities include adverse events (AEs), treatment-emergent adverse events, dose-limiting toxicities (DLTs), CRS, neurologic events and NT.
  • adoptive T cell therapy such as treatment with T cells expressing chimeric antigen receptors
  • T cells expressing chimeric antigen receptors can induce toxic effects or outcomes such as cytokine release syndrome and neurotoxicity.
  • effects or outcomes parallel high levels of circulating cytokines, which may underlie the observed toxicity.
  • the toxic outcome is or is associated with or indicative of cytokine release syndrome (CRS) or severe CRS (sCRS).
  • CRS cytokine release syndrome
  • sCRS severe CRS
  • CRS can occur in some cases following adoptive T cell therapy and administration to subjects of other biological products. See Davila et al., Sci Transl Med 6, 224ra25 (2014); Brentjens et al., Sci. Transl. Med. 5,
  • CRS is caused by an exaggerated systemic immune response mediated by, for example, T cells, B cells, NK cells, monocytes, and/or macrophages. Such cells may release a large amount of inflammatory mediators such as cytokines and chemokines. Cytokines may trigger an acute inflammatory response and/or induce endothelial organ damage, which may result in microvascular leakage, heart failure, or death. Severe, life-threatening CRS can lead to pulmonary infiltration and lung injury, renal failure, or disseminated intravascular coagulation. Other severe, life-threatening toxicities can include cardiac toxicity, respiratory distress, neurologic toxicity and/or hepatic failure.
  • CRS may be treated using anti-inflammatory therapy such as an anti-IL-6 therapy, e.g., anti-IL-6 antibody, e.g., tocilizumab, or antibiotics or other agents as described.
  • anti-IL-6 therapy e.g., anti-IL-6 antibody, e.g., tocilizumab, or antibiotics or other agents as described.
  • anti-IL-6 therapy e.g., anti-IL-6 antibody, e.g., tocilizumab
  • antibiotics or other agents as described.
  • signs and symptoms of CRS are known and include those described herein.
  • a particular dosage regimen or administration effects or does not effect a given CRS -associated outcome, sign, or symptom, particular outcomes, signs, and symptoms and/or quantities or degrees thereof may be specified.
  • CRS In the context of administering CAR-expressing cells, CRS typically occurs 6-20 days after infusion of cells that express a CAR. See Xu et al., Cancer Letters 343 (2014) 172- 78. In some cases, CRS occurs less than 6 days or more than 20 days after CAR T cell infusion. The incidence and timing of CRS may be related to baseline cytokine levels or tumor burden at the time of infusion. Commonly, CRS involves elevated serum levels of interferon (IEN)-g, tumor necrosis factor (TNL)-a, and/or interleukin (IL)-2. Other cytokines that may be rapidly induced in CRS are IL-Ib, IL-6, IL-8, and IL-10.
  • IEN interferon
  • TNL tumor necrosis factor
  • IL interleukin
  • Exemplary outcomes associated with CRS include fever, rigors, chills, hypotension, dyspnea, acute respiratory distress syndrome (ARDS), encephalopathy, ALT/AST elevation, renal failure, cardiac disorders, hypoxia, neurologic disturbances, and death.
  • Neurological complications include delirium, seizure-like activity, confusion, word-finding difficulty, aphasia, and/or becoming obtunded.
  • Other CRS-related outcomes include fatigue, nausea, headache, seizure, tachycardia, myalgias, rash, acute vascular leak syndrome, liver function impairment, and renal failure.
  • CRS is associated with an increase in one or more factors such as serum-ferritin, d-dimer, aminotransferases, lactate dehydrogenase and triglycerides, or with hypofibrinogenemia or hepatosplenomegaly.
  • Other exemplary signs or symptoms associated with CRS include hemodynamic instability, febrile neutropenia, increase in serum C- reactive protein (CRP), changes in coagulation parameters (for example, international normalized ratio (INR), prothrombin time (PTI) and/or fibrinogen), changes in cardiac and other organ function, and/or absolute neutrophil count (ANC).
  • outcomes associated with CRS include one or more of: persistent fever, e.g., fever of a specified temperature, e.g., greater than at or about 38 degrees Celsius, for two or more, e.g., three or more, e.g., four or more days or for at least three consecutive days; fever greater than at or about 38 degrees Celsius; elevation of cytokines, such as a max fold change, e.g., of at least at or about 75, compared to pre-treatment levels of at least two cytokines (e.g., at least two of the group consisting of interferon gamma (IFNy), GM-CSF, IL-6, IL-10, FR-3L, fracktalkine, and IL-5, and/or tumor necrosis factor (TNFa)), or a max fold change, e.g., of at least at or about 250 of at least one of such cytokines; and/or at least one clinical sign of toxicity, such as hypotension
  • cytokines such as
  • Exemplary CRS -related outcomes include increased or high serum levels of one or more factors, including cytokines and chemokines and other factors associated with CRS. Exemplary outcomes further include increases in synthesis or secretion of one or more of such factors. Such synthesis or secretion can be by the T cell or a cell that interacts with the T cell, such as an innate immune cell or B cell.
  • the CRS -associated serum factors or CRS-related outcomes include inflammatory cytokines and/or chemokines, including interferon gamma (IFN-g), TNF- a, IL-Ib, IL-2, IL-6, IL-7, IL-8, IL-10, IL-12, sIL-2Ra, granulocyte macrophage colony stimulating factor (GM-CSF), macrophage inflammatory protein (MIP)-l, tumor necrosis factor alpha (TNFa), IL-6, and IL-10, IL-Ib, IL-8, IL-2, MIP-1, Flt-3L, fracktalkine, and/or IL-5.
  • IFN-g interferon gamma
  • TNF- a TNF- a
  • IL-Ib interferon gamma
  • IL-2 interferon gamma
  • IL-6 IL-6
  • IL-7 IL-8
  • IL-10 IL-12
  • the factor or outcome includes C reactive protein (CRP).
  • CRP C reactive protein
  • CRP also is a marker for cell expansion.
  • subjects that are measured to have high levels of CRP do not have CRS.
  • a measure of CRS includes a measure of CRP and another factor indicative of CRS.
  • Factors include fevers, hypoxia, hypotension, neurologic changes, elevated serum levels of inflammatory cytokines, such as a set of seven cytokines (IFNy, IL-5, IL-6, IL-10, FR-3L, fractalkine, and GM-CSF) whose treatment- induced elevation can correlate well with both pretreatment tumor burden and sCRS symptoms.
  • cytokines such as a set of seven cytokines (IFNy, IL-5, IL-6, IL-10, FR-3L, fractalkine, and GM-CSF
  • Other guidelines on the diagnosis and management of CRS are known (see e.g., Lee et al, Blood. 2014;124(2):188-95).
  • the criteria reflective of CRS grade are those detailed in Table 3 below.
  • outcomes associated with severe CRS or grade 3 CRS or greater include one or more of: persistent fever, e.g., fever of a specified temperature, e.g., greater than at or about 38 degrees Celsius, for two or more, e.g., three or more, e.g., four or more days or for at least three consecutive days; fever greater than at or about 38 degrees Celsius; elevation of cytokines, such as a max fold change, e.g., of at least at or about 75, compared to pre-treatment levels of at least two cytokines (e.g., at least two of the group consisting of interferon gamma (IFNy), GM-CSF, IL-6, IL-10, Flt-3L, fracktalkine, and IL-5, and/or tumor necrosis factor alpha (TNFa)), or a max fold change, e.g., of at least at or about 250 of at least one of such cytok
  • IFNy interferon gamma
  • the CRS such as severe CRS, encompasses a combination of (1) persistent fever (fever of at least 38 degrees Celsius for at least three days) and (2) a serum level of CRP of at least at or about 20 mg/dL.
  • the CRS encompasses hypotension requiring the use of two or more vasopressors or respiratory failure requiring mechanical ventilation.
  • the dosage of vasopressors is increased in a second or subsequent administration.
  • severe CRS or grade 3 CRS encompasses an increase in alanine aminotransferase, an increase in aspartate aminotransferase, chills, febrile neutropenia, headache, left ventricular dysfunction, encephalopathy, hydrocephalus, and/or tremor.
  • the method of measuring or detecting the various outcomes may be specified.
  • the toxic outcome is or is associated with neurotoxicity.
  • symptoms associated with a clinical risk of neurotoxicity include confusion, delirium, aphasia, expressive aphasia, obtundation, myoclonus, lethargy, altered mental status, convulsions, seizure-like activity, seizures (optionally as confirmed by electroencephalogram [EEG]), elevated levels of beta amyloid (Ab), elevated levels of glutamate, and elevated levels of oxygen radicals.
  • neurotoxicity is graded based on severity (e.g., using a Grade 1-5 scale (see, e.g., Guido Cavaletti & Paola Marmiroli Nature Reviews Neurology 6, 657-666 (December 2010); National Cancer Institute — Common Toxicity Criteria version 4.03 (NCI-CTCAE v4.03).
  • Grade 1-5 scale see, e.g., Guido Cavaletti & Paola Marmiroli Nature Reviews Neurology 6, 657-666 (December 2010); National Cancer Institute — Common Toxicity Criteria version 4.03 (NCI-CTCAE v4.03).
  • neurologic symptoms may be the earliest symptoms of sCRS. In some embodiments, neurologic symptoms are seen to begin 5 to 7 days after cell therapy infusion. In some embodiments, duration of neurologic changes may range from 3 to 19 days.
  • time or degree of resolution of neurologic changes is not hastened by treatment with anti-IL-6 and/or steroid(s).
  • a subject is deemed to develop “severe neurotoxicity” in response to or secondary to administration of a cell therapy or dose of cells thereof, if, following administration, the subject displays symptoms that limit self-care (e.g. bathing, dressing and undressing, feeding, using the toilet, taking medications) from among: 1) symptoms of peripheral motor neuropathy, including inflammation or degeneration of the peripheral motor nerves; 2) symptoms of peripheral sensory neuropathy, including inflammation or degeneration of the peripheral sensory nerves, dysesthesia, such as distortion of sensory perception, resulting in an abnormal and unpleasant sensation, neuralgia, such as intense painful sensation along a nerve or a group of nerves, and/or paresthesia, such as functional disturbances of sensory neurons resulting in abnormal cutaneous sensations of tingling, numbness, pressure, cold and warmth in the absence of stimulus.
  • severe neurotoxicity includes neurotoxicity with a grade of 3 or greater, such as set forth in Table 4.
  • the methods reduce symptoms associated with CRS or neurotoxicity compared to other methods.
  • the provided methods reduce symptoms, outcomes or factors associated with CRS, including symptoms, outcomes or factors associated with severe CRS or grade 3 or higher CRS, compared to other methods.
  • subjects treated according to the present methods may lack detectable and/or have reduced symptoms, outcomes or factors of CRS, e.g. severe CRS or grade 3 or higher CRS, such as any described, e.g. set forth in Table 3.
  • subjects treated according to the present methods may have reduced symptoms of neurotoxicity, such as limb weakness or numbness, loss of memory, vision, and/or intellect, uncontrollable obsessive and/or compulsive behaviors, delusions, headache, cognitive and behavioral problems including loss of motor control, cognitive deterioration, and autonomic nervous system dysfunction, and sexual dysfunction, compared to subjects treated by other methods.
  • subjects treated according to the present methods may have reduced symptoms associated with peripheral motor neuropathy, peripheral sensory neuropathy, dysethesia, neuralgia or paresthesia.
  • the methods reduce outcomes associated with neurotoxicity including damage to the nervous system and/or brain, such as the death of neurons.
  • the methods reduce the level of factors associated with neurotoxicity such as beta amyloid (Ab), glutamate, and oxygen radicals.
  • Abs beta amyloid
  • glutamate glutamate
  • oxygen radicals oxygen radicals
  • the toxicity outcome is a dose-limiting toxicity (DLT).
  • the toxic outcome is a dose-limiting toxicity.
  • the toxic outcome is the absence of a dose-limiting toxicity.
  • a dose-limiting toxicity (DLT) is defined as any grade 3 or higher toxicity as assessed by any known or published guidelines for assessing the particular toxicity, such as any described above and including the National Cancer Institute (NCI) Common Terminology Criteria for Adverse Events (CTCAE) version 4.0.
  • a DLT can be described as any treatment-emergent grade 4 or 5 AEs, except those listed in the exceptions below; any treatment-emergent grade 3 AEs that do not resolve to grade ⁇ 2 within 7 days, except those listed in the exceptions below; any treatment- emergent grade 3 seizures that do not resolve to grade ⁇ 2 within 3 days; and any treatment- emergent autoimmune toxicity grade >3, with the exception of B-cell aplasia (which is an expected risk associated with administration of engineered cell); exceptions listed below are not considered DLTs: any treatment-emergent AE that is clearly unrelated to the administration of the engineered cells (e.g., motor vehicle accident); grade 4 infusional toxicities that are reversible to grade ⁇ 2 in 8 hours; grade 3 or 4 fever or febrile neutropenia for ⁇ 2 weeks; grade 4 transaminitis that is considered a symptom of CRS; grade 3 transaminitis for ⁇ 2 weeks; grade 3 bone pain due to T-
  • the low rate, risk or likelihood of developing a toxicity e.g. CRS or neurotoxicity or severe CRS or neurotoxicity, e.g. grade 3 or higher CRS or neurotoxicity, observed with administering a dose of T cells in accord with the provided methods, and/or with the provided articles of manufacture or compositions, permits administration of the cell therapy on an outpatient basis.
  • the administration of the cell therapy e.g. dose of T cells (e.g. CAR+ T cells) in accord with the provided methods, and/or with the provided articles of manufacture or compositions, is performed on an outpatient basis or does not require admission to the subject to the hospital, such as admission to the hospital requiring an overnight stay.
  • subjects administered the cell therapy e.g. dose of T cells (e.g. CAR+ T cells) in accord with the provided methods, and/or with the provided articles of manufacture or compositions, including subjects treated on an outpatient basis, are not administered an intervention for treating any toxicity prior to or with administration of the cell dose, unless or until the subject exhibits a sign or symptom of a toxicity, such as of a neurotoxicity or CRS.
  • a sign or symptom of a toxicity such as of a neurotoxicity or CRS.
  • Exemplary agents for treating, delaying, attenuating or ameliorating a toxicity are described in Section III.
  • a subject administered the cell therapy e.g. a dose of T cells (e.g. CAR+ T cells), including subjects treated on an outpatient basis, exhibits a fever the subject is given or is instructed to receive or administer a treatment to reduce the fever.
  • the fever in the subject is characterized as a body temperature of the subject that is (or is measured at) at or above a certain threshold temperature or level.
  • the threshold temperature is that associated with at least a low-grade fever, with at least a moderate fever, and/or with at least a high-grade fever.
  • the threshold temperature is a particular temperature or range.
  • the threshold temperature may be at or about or at least at or about 38, 39, 40, 41, or 42 degrees Celsius, and/or may be a range of at or about 38 degrees Celsius to at or about 39 degrees Celsius, a range of at or about 39 degrees Celsius to at or about 40 degrees Celsius, a range of at or about 40 degrees Celsius to at or about 41 degrees, or a range of at or about 41 degrees Celsius to at or about 42 degrees Celsius.
  • the treatment designed to reduce fever includes treatment with an antipyretic.
  • An antipyretic may include any agent, e.g., compound, composition, or ingredient, that reduces fever, such as one of any number of agents known to have antipyretic effects, such as NS A IDs (such as ibuprofen, naproxen, ketoprofen, and nimesulide), salicylates, such as aspirin, choline salicylate, magnesium salicylate, and sodium salicylate, paracetamol, acetaminophen, Metamizole, Nabumetone, Phenaxone, antipyrine, febrifuges.
  • the antipyretic is acetaminophen.
  • acetaminophen can be administered at a dose of 12.5 mg/kg orally or intravenously up to every four hours.
  • it is or comprises ibuprofen or aspirin.
  • the subject is administered an alternative treatment for treating the toxicity, such as any described in Section III below.
  • an alternative treatment for treating the toxicity such as any described in Section III below.
  • the subject is instructed to return to the hospital if the subject has and/or is determined to or to have a sustained fever.
  • the subject has, and/or is determined to or considered to have, a sustained fever if he or she exhibits a fever at or above the relevant threshold temperature, and where the fever or body temperature of the subject is not reduced, or is not reduced by or by more than a specified amount (e.g., by more than 1 °C, and generally does not fluctuate by about, or by more than about, 0.5 °C, 0.4 °C, 0.3 °C, or 0.2 °C), following a specified treatment, such as a treatment designed to reduce fever such as treatment with an antipyretic, e.g. NSAID or salicylates, e.g. ibuprofen, acetaminophen or aspirin.
  • a specified amount e.g., by more than 1 °C, and generally does not fluctuate by about, or by more than about, 0.5 °C, 0.4 °C, 0.3 °C, or 0.2 °C
  • a specified treatment such as a treatment designed to reduce
  • a subject is considered to have a sustained fever if he or she exhibits or is determined to exhibit a fever of at least at or about 38 or 39 degrees Celsius, which is not reduced by or is not reduced by more than at or about 0.5 °C, 0.4 °C, 0.3 °C, or 0.2 °C, or by at or about 1%, 2%, 3%, 4%, or 5%, over a period of 6 hours, over a period of 8 hours, or over a period of 12 hours, or over a period of 24 hours, even following treatment with the antipyretic such as acetaminophen.
  • the dosage of the antipyretic is a dosage ordinarily effective in such as subject to reduce fever or fever of a particular type such as fever associated with a bacterial or viral infection, e.g., a localized or systemic infection.
  • the subject has, and/or is determined to or considered to have, a sustained fever if he or she exhibits a fever at or above the relevant threshold temperature, and where the fever or body temperature of the subject does not fluctuate by about, or by more than about, 1 °C, and generally does not fluctuate by about, or by more than about, 0.5 °C, 0.4 °C, 0.3 °C, or 0.2 °C.
  • Such absence of fluctuation above or at a certain amount generally is measured over a given period of time (such as over a 24-hour, 12-hour, 8-hour, 6-hour, 3-hour, or 1-hour period of time, which may be measured from the first sign of fever or the first temperature above the indicated threshold).
  • a subject is considered to or is determined to exhibit sustained fever if he or she exhibits a fever of at least at or about or at least at or about 38 or 39 degrees Celsius, which does not fluctuate in temperature by more than at or about 0.5°C, 0.4 °C, 0.3 °C, or 0.2 °C, over a period of 6 hours, over a period of 8 hours, or over a period of 12 hours, or over a period of 24 hours.
  • the fever is a sustained fever; in some aspects, the subject is treated at a time at which a subject has been determined to have a sustained fever, such as within one, two, three, four, five six, or fewer hours of such determination or of the first such determination following the initial therapy having the potential to induce the toxicity, such as the cell therapy, such as dose of T cells, e.g. CAR+ T cells.
  • one or more interventions or agents for treating the toxicity is administered at a time at which or immediately after which the subject is determined to or confirmed to (such as is first determined or confirmed to) exhibit sustained fever, for example, as measured according to any of the aforementioned embodiments.
  • the one or more toxicity- targeting therapies is administered within a certain period of time of such confirmation or determination, such as within 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, or 8 hours thereof.
  • the provided methods and articles of manufacture can be used in connection with, or involve or include, one or more agents or treatments for treating, preventing, delaying, or attenuating the development of a toxicity.
  • the agent or other treatment capable of treating, preventing, delaying, or attenuating the development of a toxicity is administered prior to and/or concurrently with administration of a therapeutic cell composition comprising the genetically engineered cells.
  • the agent e.g., a toxicity-targeting agent, or treatment capable of treating, preventing, delaying, or attenuating the development of a toxicity is a steroid
  • a cytokine receptor such as IL-6 receptor, CD 122 receptor (IL-2Rbeta receptor), or CCR2
  • the agent is an agonist of a cytokine receptor and/or cytokine, such as TGF-b.
  • the agent e.g., agonist, antagonist or inhibitor, is an antibody or antigen-binding fragment, a small molecule, a protein or peptide, or a nucleic acid.
  • a fluid bolus can be employed as an intervention, such as to treat hypotension associated with CRS.
  • the target hematocrit levels are >24%.
  • the intervention includes the use of absorbent resin technology with blood or plasma filtration.
  • the intervention includes dialysis, plasmapheresis, or similar technologies.
  • vasopressors or acetaminophen can be employed.
  • the agent can be administered sequentially, intermittently, or at the same time as or in the same composition as the therapy, such as cells for adoptive cell therapy.
  • the agent can be administered before, during, simultaneously with, or after administration of the immunotherapy and/or cell therapy.
  • the agent is administered at a time as described herein and in accord with the provided methods, and/or with the provided articles of manufacture or compositions.
  • the toxicity-targeting agent is administered at a time that is within, such as less than or no more than, 3, 4, 5, 6, 7, 8, 9 or 10 days after initiation of the immunotherapy and/or cell therapy.
  • the toxicity-targeting agent is administered within or within about 1 day, 2 days or 3 days after initiation of administration of the immunotherapy and/or cell therapy.
  • the agent e.g., toxicity-targeting agent
  • the agent is administered to a subject after initiation of administration of the immunotherapy and/or cell therapy at a time at which the subject does not exhibit grade 2 or higher CRS or grade 2 or higher neurotoxicity.
  • the toxicity-targeting agent is administered after initiation of administration of the immunotherapy and/or cell therapy at a time at which the subject does not exhibit severe CRS or severe neurotoxicity.
  • the subject is one that does not exhibit grade 2 or higher CRS, such as severe CRS, and/or does not exhibit grade 2 or higher neurotoxicity, such as severe neurotoxicity.
  • Non-limiting examples of interventions for treating or ameliorating a toxicity such as severe CRS (sCRS) or severe neurotoxicity, are described in Table 5.
  • the intervention includes tocilizumab or other toxicity-targeting agent as described, which can be at a time in which there is a sustained or persistent fever of greater than or about 38 °C or greater than or greater than about 39 °C in the subject.
  • the fever is sustained in the subject for more than 10 hours, more than 12 hours, more than 16 hours, or more than 24 hours before intervention.
  • the agent or therapy or intervention e.g., toxicity-targeting agent
  • a composition or formulation such as a pharmaceutical composition or formulation, as described herein.
  • the agent alone or as part of a pharmaceutical composition can be administered intravenously or orally, or by any other acceptable known route of administration or as described herein.
  • the dosage of agent or the frequency of administration of the agent in a dosage regimen is reduced compared to the dosage of the agent or its frequency in a method in which a subject is treated with the agent after grade 2 or higher CRS or neurotoxicity, such as after severe, e.g., grade 3 or higher, CRS or after severe, e.g., grade 3 or higher neurotoxicity, has developed or been diagnosed (e.g. after physical signs or symptoms of grade 3 or higher CRS or neurotoxicity has manifested).
  • the dosage of agent or the frequency of administration of the agent in a dosage regimen is reduced compared to the dosage of the agent or its frequency in a method in which a subject is treated for CRS or neurotoxicity greater than 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, three weeks, or more after administration of the immunotherapy and/or cell therapy.
  • the dosage is reduced by greater than or greater than about 1.2-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold or more.
  • the dosage is reduced by greater than or about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more.
  • the frequency of dosing is reduced, such as the number of daily doses is reduced or the number of days of dosing is reduced.
  • the agent e.g., toxicity-targeting agent, that treats and/or that prevents, delays, or attenuates the development of or risk for developing a toxicity to an immunotherapy and/or a cell therapy
  • a steroid e.g., corticosteroid.
  • the agent that treats and/or that prevents, delays, or attenuates the development of or risk for developing a toxicity to an immunotherapy is a steroid.
  • the steroid is a corticosteroid.
  • Corticosteroids typically include glucocorticoids and mineralocorticoids.
  • glucocorticoids include synthetic and non-synthetic glucocorticoids.
  • glucocorticoids include, but are not limited to: alclomethasones, algestones, beclomethasones (e.g. beclomethasone dipropionate), betamethasones (e.g. betamethasone 17- valerate, betamethasone sodium acetate, betamethasone sodium phosphate, betamethasone valerate), budesonides, clobetasols (e.g.
  • clobetasol propionate clobetasones
  • clocortolones e.g. clocortolone pivalate
  • cloprednols corticosterones
  • cortisones and hydrocortisones e.g. hydrocortisone acetate
  • cortivazols deflazacorts, desonides, desoximethasones
  • dexamethasones e.g. dexamethasone 21-phosphate, dexamethasone acetate, dexamethasone sodium phosphate
  • diflorasones e.g.
  • diflorasone diacetate diflucortolones, difluprednates, enoxolones, fluazacorts, flucloronides, fludrocortisones (e.g., fludrocortisone acetate), flumethasones (e.g. flumethasone pivalate), fhmisolides, fluocinolones (e.g. fluocinolone acetonide), fluocinonides, fluocortins, fluocortolones, fluorometholones (e.g.
  • fluorometholone acetate fluperolones (e.g., fluperolone acetate), fluprednidenes, fluprednisolones, flurandrenolides, fluticasones (e.g. fluticasone propionate), formocortals, halcinonides, halobetasols, halometasones, halopredones, hydrocortamates, hydrocortisones (e.g.
  • prednisolone 25-diethylaminoacetate prednisolone sodium phosphate, prednisolone 21-hemisuccinate, prednisolone acetate; prednisolone farnesylate, prednisolone hemisuccinate, prednisolone-21 (beta-D-glucuronide), prednisolone metasulphobenzoate, prednisolone steaglate, prednisolone tebutate, prednisolone tetrahydrophthalate), prednisones, prednivals, prednylidenes, rimexolones, tixocortols, triamcinolones (e.g.
  • the glucocorticoid is selected from among cortisones, dexamethasones, hydrocortisones, methylprednisolones, prednisolones and prednisones.
  • the glucocorticoid is dexamethasone.
  • the agent is a corticosteroid and is administered in an amount that is therapeutically effective to treat, ameliorate or reduce one or more symptoms of a toxicity to an immunotherapy and/or a cell therapy, such as CRS or neurotoxicity.
  • indicators of improvement or successful treatment include determination of the failure to manifest a relevant score on toxicity grading scale (e.g. CRS or neurotoxicity grading scale), such as a score of less than 3, or a change in grading or severity on the grading scale as discussed herein, such as a change from a score of 4 to a score of 3, or a change from a score of 4 to a score of 2, 1 or 0.
  • toxicity grading scale e.g. CRS or neurotoxicity grading scale
  • the corticosteroid is provided in a therapeutically effective dose.
  • Therapeutically effective concentration can be determined empirically by testing in known in vitro or in vivo (e.g. animal model) systems. For example, the amount of a selected corticosteroid to be administered to ameliorate symptoms or adverse effects of a toxicity to an immunotherapy and/or a cell therapy, such as CRS or neurotoxicity, can be determined by standard clinical techniques. In addition, animal models can be employed to help identify optimal dosage ranges. The precise dosage, which can be determined empirically, can depend on the particular therapeutic preparation, the regime and dosing schedule, the route of administration and the seriousness of the disease.
  • the corticosteroid can be administered in any amount that is effective to ameliorate one or more symptoms associated with the toxicity, such as with the CRS or neurotoxicity.
  • the corticosteroid e.g., glucocorticoid
  • the corticosteroid such as a glucocor
  • the corticosteroid can be administered, for example, at a dosage of at or about 0.001 mg/kg (of the subject), 0.002 mg/kg, 0.003 mg/kg, 0.004 mg/kg, 0.005 mg/kg, 0.006 mg/kg, 0.007 mg/kg, 0.008 mg/kg, 0.009 mg/kg, 0.01 mg/kg, 0.015 mg/kg, 0.02 mg/kg, 0.025 mg/kg, 0.03 mg/kg, 0.035 mg/kg, 0.04 mg/kg, 0.045 mg/kg, 0.05 mg/kg,
  • the corticosteroid, or glucocorticoid for example dexamethasone, can be administered orally (tablets, liquid or liquid concentrate), PO, intravenously (IV), intramuscularly or by any other known route or route described herein (e.g., with respect to pharmaceutical formulations).
  • the corticosteroid is administered as a bolus, and in other aspects it may be administered over a period of time.
  • the glucocorticoid can be administered over a period of more than one day, such as over two days, over 3 days, or over 4 or more days.
  • the corticosteroid can be administered one per day, twice per day, or three times or more per day.
  • the corticosteroid e.g., dexamethasone
  • the corticosteroid may in some examples be administered at 10 mg (or equivalent) IV twice a day for three days.
  • the dosage of corticosteroid e.g., glucocorticoid
  • the dose of corticosteroid is tapered.
  • the corticosteroid may be administered at an initial dose (or equivalent dose, such as with reference to dexamethasone) of 4 mg, and upon each successive administration the dose may be lowered, such that the dose is 3 mg for the next administration, 2 mg for the next administration, and 1 mg for the next administration
  • the dose of corticosteroid administered is dependent upon the specific corticosteroid, as a difference in potency exists between different corticosteroids. It is typically understood that drugs vary in potency, and that doses can therefore vary, in order to obtain equivalent effects. Table 6 shows equivalence in terms of potency for various glucocorticoids and routes of administration. Equivalent potency in clinical dosing is well known. Information relating to equivalent steroid dosing (in a non-chronotherapeutic manner) may be found in the British National Formulary (BNF) 37, March 1999.
  • the steroid is administered in an equivalent dosage amount of from or from about 1.0 mg to 20 mg dexamethasone per day, such as 1.0 mg to 15 mg dexamethasone per day, 1.0 mg to 10 mg dexamethasone per day, 2.0 mg to 8 mg dexamethasone per day, or 2.0 mg to 6.0 mg dexamethasone per day, each inclusive.
  • the steroid is administered in an equivalent dose of at or about 4 mg or at or about 8 mg dexamethasone per day.
  • the steroid is administered if fever persists after treatment with tocilizumab.
  • dexamethasone is administered orally or intravenously at a dosage of 5-10 mg up to every 6-12 hours with continued fevers.
  • tocilizumab is administered concurrently with or subsequent to oxygen supplementation .
  • the inhibitor in the combination therapy is an inhibitor of a microglial cell activity.
  • the administration of the inhibitor modulates the activity of microglia.
  • the inhibitor is an antagonist that inhibits the activity of a signaling pathway in microglia.
  • the microglia inhibitor affects microglial homeostasis, survival, and/or proliferation.
  • the inhibitor targets the CSF1R signaling pathway.
  • the inhibitor is an inhibitor of CSF1R.
  • the inhibitor is a small molecule. In some cases, the inhibitor is an antibody.
  • administration of the inhibitor results in one or more effects selected from an alteration in microglial homeostasis and viability, a decrease or blockade of microglial cell proliferation, a reduction or elimination of microglial cells, a reduction in microglial activation, a reduction in nitric oxide production from microglia, a reduction in nitric oxide synthase activity in microglia, or protection of motor neurons affected by microglial activation.
  • the agent alters the level of a serum or blood biomarker of CSF1R inhibition, or a decrease in the level of urinary collagen type 1 cross-linked N-telopeptide (NTX) compared to at a time just prior to initiation of the administration of the inhibitor.
  • the administration of the agent transiently inhibits the activity of microglia activity and/or wherein the inhibition of microglia activity is not permanent. In some embodiments, the administration of the agent transiently inhibits the activity of CSF1R and/or wherein the inhibition of CSF1R activity is not permanent.
  • the agent that reduces microglial cell activity is a small molecule, peptide, protein, antibody or antigen-binding fragment thereof, an antibody mimetic, an aptamer, or a nucleic acid molecule.
  • the method involves administration of an inhibitor of microglia activity.
  • the agent is an antagonist that inhibits the activity of a signaling pathway in microglia.
  • the agent that reduces microglial cell activity affects microglial homeostasis, survival, and/or proliferation.
  • the agent that reduces microglial cell activation is selected from an anti-inflammatory agent, an inhibitor of NADPH oxidase (NOX2), a calcium channel blocker, a sodium channel blocker, inhibits GM-CSF, inhibits CSF1R, specifically binds CSF-1, specifically binds IL-34, inhibits the activation of nuclear factor kappa B (NF-KB), activates a CB2 receptor and/or is a CB2 agonist, a phosphodiesterase inhibitor, inhibits microRNA-155 (miR-155), upregulates microRNA-124 (miR-124), inhibits nitric oxide production in microglia, inhibits nitric oxide synthase, or activates the transcription factor NRF2 (also called nuclear factor (erythroid-derived 2)-like 2, or NFE2L2).
  • NOX2 NADPH oxidase
  • NRF2 nuclear factor (erythroid-derived 2)-like 2, or NFE2L2
  • the agent that reduces microglial cell activity targets CSF1 (also called macrophage colony-stimulating factor MCSF).
  • CSF1 also called macrophage colony-stimulating factor MCSF
  • the agent that reduces microglial cell activity affects MCSF-stimulated phosphorylation of the M-CSF receptor (Pryer et al. Proc Am Assoc Cancer Res, AACR Abstract nr DDT02-2 (2009)).
  • the agent that reduces microglial cell activity is MCS110 (international patent application publication number W02014001802; Clinical Trial Study Record Nos.:Al NCT00757757; NCT02807844; NCT02435680; NCT01643850).
  • the agent that reduces microglial cell activity is a small molecule that targets the CSF1 pathway.
  • the agent is a small molecule that binds CSF1R.
  • the agent is a small molecule which inhibits CSF1R kinase activity by competing with ATP binding to CSF1R kinase.
  • the agent is a small molecule which inhibits the activation of the CFS1R receptor. In some cases, the binding of the CSF-1 ligand to the CSF1R is inhibited.
  • the agent that reduces microglial cell activity is any of the inhibitors described in US Patent Application Publication Number US20160032248.
  • the agent is a small molecule inhibitor selected from PLX- 3397, PLX7486, JNJ-40346527, JNJ28312141, ARRY-382, PLX73086 (AC-708), DCC-3014, AZD6495, GW2580, K ⁇ 20227, BLZ945, PLX647, and PLX5622.
  • the agent is any of the inhibitors described in Conway et al., Proc Natl Acad Sci USA,
  • NCT01054014 NCT01316822; NCT02880371; NCT02673736; international patent application publication numbers W02008063888A2, W02006009755A2, US patent application publication numbers US20110044998, US 2014/0065141, and US 2015/0119267.
  • the agent that reduces microglial cell activity is 4-((2- (((lR,2R)-2-hydroxycyclohexyl)amino)benzo[d]thiazol-6-yl)oxy)-N-methylpicolinamide (BLZ945) or a pharmaceutically acceptable salt thereof or derivatives thereof.
  • the agent is the following compound: wherein R1 is an alkyl pyrazole or an alkyl carboxamide, and R2 is a hydroxycycloalkyl or a pharmaceutically acceptable salt thereof.
  • the agent that reduces microglial cell activity is 5-((5-chloro- lH-pyrrolo[2,3-b]pyridin-3-yl)methyl)-N-((6-(trifluoromethyl)pyridin-3-yl)methyl)pyridin-2- amine, N-[5-[(5-Chloro-lH-pyrrolo[2,3-b]pyridin-3-yl)methyl]-2-pyridinyl]-6-(trifluoromethyl)- 3-pyridinemethanamine) (PLX 3397) or a pharmaceutically acceptable salt thereof or derivatives thereof.
  • the agent is 5-(lH-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-N-[[4- (trifluoromethyl)phenyl] methyl] -2-pyridinamine dihydrochloride (PLX647) or a pharmaceutically acceptable salt thereof or derivatives thereof.
  • the agent that reduces microglial cell activity is the following compound: or a pharmaceutically acceptable salt thereof.
  • the agent that reduces microglial cell activity is the following compound: or a pharmaceutically acceptable salt thereof.
  • the agent is any of the inhibitors described in US patent number US7893075.
  • the agent that reduces microglial cell activity is 4-cyano-N-[2- ( 1 -cyclohexen- l-yl)-4-[l - [(dimethylamino)acetyl] -4-piperidinyl]phenyl] - 1 H-imidazole-2- carboxamide monohydrochloride (JNJ28312141) or a pharmaceutically acceptable salt thereof or derivatives thereof.
  • the agent is the following compound:
  • the agent is any of the inhibitors described in US patent number US7645755.
  • the agent that reduces microglial cell activity is 1H- Imidazole-2-carboxamide, 5-cyano-N-(2-(4, 4-dimethyl- 1-cyclohexen- l-yl)-6-(tetrahydro- 2,2,6,6-tetramethyl-2H-pyran-4-yl)-3-pyridinyl)-, 4-Cyano-lH-imidazole-2-carboxylic acid N- (2-(4,4-dimethylcyclohex-l-enyl)-6-(2,2,6,6-tetramethyltetrahydropyran-4-yl)pyridin-3- yl)amide, 4-Cyano-N-(2-(4,4-dimethylcyclohex- 1-en- l-yl)-6-(2,2,6,6-tetramethyl-tetrahydro- 2H-pyran-4-yl)pyridin-3-yl)-lH-imidazole-2-car
  • the agent that reduces microglial cell activity is 5-(3- Methoxy-4-((4-methoxybenzyl)oxy)benzyl)pyrimidine-2, 4-diamine (GW2580) or a pharmaceutically acceptable salt thereof or derivatives thereof.
  • the agent is the following compound: or a pharmaceutically acceptable salt thereof (international patent application publication number W02009099553).
  • the agent that reduces microglial cell activity is 4-(2,4- difluoroanilino)-7-ethoxy-6-(4-methylpiperazin-l-yl)quinoline-3-carboxamide (AZD6495) or a pharmaceutically acceptable salt thereof or derivatives thereof.
  • the agent is the following compound: or a pharmaceutically acceptable salt thereof.
  • the agent that reduces microglial cell activity is N- ⁇ 4-[(6,7- dimethoxy-4-quinolyl)oxy] -2-methoxyphenyl ⁇ -N0-[l-(l ,3 -thiazole-2-yl)ethyl] urea (K ⁇ 20227) or a pharmaceutically acceptable salt thereof or derivatives thereof.
  • the agent is the following compound: or a pharmaceutically acceptable salt thereof.
  • the agent that reduces microglial cell activation is an antibody that targets the CSF1 pathway.
  • the agent is an antibody that binds CSF1R.
  • the anti-CSFIR antibody blocks CSF1R dimerization.
  • the anti-CSFIR antibody blocks the CSF1R dimerization interface that is formed by domains D4 and D5 (Ries et al. Cancer Cell 25(6):846-59 (2014)).
  • the agent is selected from emactuzumab (RG7155; RO5509554), Cabiralizumab (FPA-008), LY-3022855 (IMC-CS4), AMG-820, TG-3003, MCS110, H27K15, 12-2D6, 2-4A5 (Rovida and Sbarba, / Clin Cell Immunol.6:6 (2015); Clinical Trial Study Record Nos.: NCT02760797;
  • the agent that reduces microglial cell activation is a tetracycline antibiotic.
  • the agent affects IL-lb, IL-6, TNFa, or iNOS concentration in microglia cells (Yrjanheikki et al. PNAS 95(26): 15769-15774 (1998); Clinical Trial Study Record No: NCT01120899).
  • the agent is an opioid antagonist (Younger et al. Pain Med. 10(4):663-672 (2009.)
  • the agent reduces glutamatergic neurotransmission (US Patent Number 5,527,814).
  • the agent modulates NFkB signaling (Valera et al J.
  • the agent targets cannabinoid receptors (Ramirez et al. J. Neurosci 25(8): 1904- 13(2005)).
  • the agent is selected from minocycline, naloxone, riluzole, lenalidomide, and a cannabinoid (optionally WIN55 or 212-2).
  • Nitric oxide production from microglia is believed, in some cases, to result in or increase neurotoxicity.
  • the agent modulates or inhibits nitric oxide production from microglia.
  • the agent inhibits nitric oxide synthase (NOS).
  • NOS nitric oxide synthase
  • the NOS inhibitor is Ronopterin (VAS-203), also known as 4- amino-tetrahydrobiopterin (4-ABH4).
  • the NOS inhibitor is cindunistat, A-84643, ONO-1714, L-NOARG, NCX-456, VAS-2381, GW-273629, NXN-462, CKD-712, KD-7040, or guanidinoethyldisulfide.
  • the agent is any of the inhibitors described in Hoing et al., Cell Stem Cell. 2012 Nov 2;ll(5):620-32.
  • the agent blocks T cell trafficking, such as to the central nervous system.
  • blocking T cell trafficking can reduce or prevent immune cells from crossing blood vessel walls into the central nervous system, including crossing the blood-brain barrier.
  • activated antigen- specific T cells produce pro- inflammatory cytokines, including IFN-g and TNF, upon reactivation in the CNS, leading to activation of resident cells such as microglia and astrocytes. See Kivisakk et al., Neurology. 2009 Jun 2; 72(22): 1922-1930.
  • the agent inhibits adhesion molecules on immune cells, including T cells.
  • the agent inhibits an integrin.
  • the integrin is alpha-4 integrin.
  • the agent is natalizumab (Tysabri®).
  • the agent modulates a cell surface receptor.
  • the agent modulates the sphingo sine- 1 -phosphate (SIP) receptor, such as S1PR1 or S1PR5.
  • the agent causes the internalization of a cellular receptor, such as a sphingosine-1 -phosphate (SIP) receptor, such as S1PR1 or S1PR5.
  • a cellular receptor such as a sphingosine-1 -phosphate (SIP) receptor, such as S1PR1 or S1PR5.
  • SIP sphingosine-1 -phosphate
  • the agent is fingolimod (Gilenya®) or ozanimod (RPC- 1063).
  • the transcription factor NRF2 is believed to regulate the anti-oxidant response, for example, by turning on genes that contain a cis-acting element in their promoter region.
  • An example of such an element includes an antioxidant response element (ARE).
  • the agent activates NRF2.
  • activating NRF2 in microglial cells reduces the microglial cells’ responsiveness to IFN and LPS.
  • activating NRF2 inhibits, slows, or reduces demyelination, axonal loss, neuronal death, and/or oligodendrocyte death.
  • the agent upregulates the cellular cytoprotective pathway regulated by NRF2.
  • the agent that activates NRF2 is dimethyl fumarate (Tecfidera®). In some embodiments, the agent is any of the inhibitors described in US patent number 8,399,514. In some embodiments, the agent is any of the inhibitors described in Hoing et ah, Cell Stem Cell. 2012 Nov 2;ll(5):620-32.
  • the agent that reduces microglial cell activation is (4S,4aS,5aR,12aS)-4,7-bis(dimethylamino)-3,10,12,12a-tetrahydroxy-l,ll-dioxo- l,4,4a,5,5a,6,ll,12a-octahydrotetracene-2-carboxamide (Minocycline) or a pharmaceutically acceptable salt thereof or derivatives thereof.
  • the agent is any of the compounds described in US patent application publication number US20100190755.
  • the agent is the following compound: or a pharmaceutically acceptable salt thereof.
  • the agent that reduces microglial cell activation is 3-(7-amino- 3-oxo- lH-isoindol-2-yl)piperidine-2,6-dione (lenalidomide) or a pharmaceutically acceptable salt thereof or derivatives thereof.
  • the agent is the following compound: or a pharmaceutically acceptable salt thereof.
  • the agent that reduces microglial cell activation is 4R,4aS,7aR,12bS)-4a,9-dihydroxy-3-prop-2-enyl-2,4,5,6,7a,13-hexahydro-lH-4,12- methanobenzofuro [3, 2-e] isoquinoline-7 -one (naloxone) or a pharmaceutically acceptable salt thereof or derivatives thereof.
  • the agent is any of the compounds described in US patent number US 8247425.
  • the agent is the following compound: or a pharmaceutically acceptable salt thereof.
  • the agent that reduces microglial cell activation is 2-amino-6- (trifluoromethoxy)benzothiazole, 6-(trifluoromethoxy)benzo[d]thiazol-2-amine, or 6- (trifluoromethoxy)-l,3-benzothiazol-2-amine (riluzole) or a pharmaceutically acceptable salt thereof or derivatives thereof as described in US patent number US5527814.
  • the agent is the following compound: or a pharmaceutically acceptable salt thereof.
  • the agent that reduces microglial cell activation is a modulator of a signaling pathway in microglia. In some cases, the agent reduces microglia singling. In some embodiments, the agent is a GM-CSF (CSF2) inhibitor. In other embodiments, the agent that reduces microglial cell activation is an ion channel blocker. In some specific embodiments, the agent is a calcium channel blocker. For example, in some specific examples, the agent is a dihydropyridine calcium channel blocker. In some embodiments, the agent is a microRNA inhibitor. For example, the agent targets miR-155.
  • CSF2 GM-CSF
  • the agent that reduces microglial cell activation is an ion channel blocker.
  • the agent is a calcium channel blocker.
  • the agent is a dihydropyridine calcium channel blocker.
  • the agent is a microRNA inhibitor.
  • the agent targets miR-155.
  • the agent that reduces microglial cell activation is selected from MOR103, Nimodipine, IVIg, and FNA-anti-miR-155 (Butoxsky et al. Ann Neurol, 77(l):75-99 (2015) and Sanz et al., Br J Pharmacol. 167(8): 1702-1711 (2012); Winter et al., Ann Clin and Transl Neurol. 2328-9503 (2016); Clinical Trial Study Record Nos.: NCT01517282, NCT00750867).
  • the agent that reduces microglial cell activation is 3-(2- methoxyethyl) 5-propan-2-yl 2,6-dimethyl-4-(3-nitrophenyl)-l,4-dihydropyridine-3,5- dicarboxylate (nimodipine) or a pharmaceutically acceptable salt thereof or derivatives thereof.
  • the agent is any of the inhibitors described in US patent number US3799934.
  • the agent is the following compound: or a pharmaceutically acceptable salt thereof.
  • the agent that reduces microglial cell activation is administered in a form that only affects to central nervous system and/or does not affect tumor-associated macrophages.
  • the agent promotes microglia quiescence but does not eliminate or reduce the number of microglia.
  • the method involves inhibiting microglia activity specifically in the brain such as described in Ponomarev et al., Nature Medicine , (1):64- 70 (2011)
  • the agent e.g. toxicity-targeting agent, that treats or ameliorates symptoms of a toxicity of immunotherapy and/or a cell therapy, such as CRS or neurotoxicity, is one that targets a cytokine.
  • the agent is an antagonist or inhibitor of a cytokine, such as transforming growth factor beta (TGF-beta), interleukin 6 (IL-6), interleukin 10 (IL-10), IL-2, MIRIb (CCL4), TNF alpha, IL-1, interferon gamma (IFN-gamma), or monocyte chemoattractant protein-1 (MCP-1).
  • TGF-beta transforming growth factor beta
  • IL-6 interleukin 6
  • IL-10 interleukin 10
  • IL-2 interleukin-2
  • MIRIb CCL4
  • TNF alpha TNF alpha
  • IL-1 interferon gamma
  • IFN-gamma interferon gamma
  • MCP-1 monocyte chem
  • the agent that treats or ameliorates symptoms of a toxicity of an immunotherapy and/or a cell therapy, such as CRS or neurotoxicity is one that targets (e.g. inhibits or is an antagonist of) a cytokine receptor, such as IL-6 receptor (IL-6R), IL-2 receptor (IL-2R/CD25), MCP-1 (CCL2) receptor (CCR2 or CCR4), a TGF-beta receptor (TGF-beta I, II, or III), IFN-gamma receptor (IFNGR), MIRIb receptor (e.g., CCR5), TNF alpha receptor (e.g., TNFR1), IL-1 receptor (ILl-Ro/IL- ⁇ ), or IL-10 receptor (IL-1 OR).
  • a cytokine receptor such as IL-6 receptor (IL-6R), IL-2 receptor (IL-2R/CD25), MCP-1 (CCL2) receptor (CCR2 or CCR4)
  • TGF-beta receptor TGF-beta I, II,
  • the amount of a selected agent that treats or ameliorates symptoms of a toxicity of an immunotherapy and/or a cell therapy, such as CRS or neurotoxicity to be administered to ameliorate symptoms or adverse effects of a toxicity to an immunotherapy and/or a cell therapy, such as CRS or neurotoxicity can be determined by standard clinical techniques.
  • exemplary adverse events include, but are not limited to, an increase in alanine aminotransferase, an increase in aspartate aminotransferase, chills, febrile neutropenia, headache, hypotension, left ventricular dysfunction, encephalopathy, hydrocephalus, seizure, and/or tremor.
  • the agent is administered in a dosage amount of from or from about 30 mg to 5000 mg, such as 50 mg to 1000 mg, 50 mg to 500 mg, 50 mg to 200 mg, 50 mg to 100 mg, 100 mg to 1000 mg, 100 mg to 500 mg, 100 mg to 200 mg, 200 mg to 1000 mg, 200 mg to 500 mg or 500 mg to 1000 mg.
  • the agent is administered from or from about 0.5 mg/kg to 100 mg/kg, such as from or from about 1 mg/kg to 50 mg/kg, 1 mg/kg to 25 mg/kg, 1 mg/kg to 10 mg/kg, 1 mg/kg to 5 mg/kg, 5 mg/kg to 100 mg/kg, 5 mg/kg to 50 mg/kg, 5 mg/kg to 25 mg/kg, 5 mg/kg to 10 mg/kg, 10 mg/kg to 100 mg/kg, 10 mg/kg to 50 mg/kg, 10 mg/kg to 25 mg/kg, 25 mg/kg to 100 mg/kg, 25 mg/kg to 50 mg/kg to 50 mg/kg to 100 mg/kg.
  • the agent is administered in a dosage amount of from or from about 1 mg/kg to 10 mg/kg, 2 mg/kg to 8 mg/kg, 2 mg/kg to 6 mg/kg, 2 mg/kg to 4 mg/kg or 6 mg/kg to 8 mg/kg, each inclusive. In some aspects, the agent is administered in a dosage amount of at least or at least about or about 1 mg/kg, 2 mg/kg, 4 mg/kg, 6 mg/kg, 8 mg/kg, 10 mg/kg or more. In some embodiments, the agent is administered at a dose of 4 mg/kg or 8 mg/kg.
  • the agent is administered by injection, e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery.
  • they are administered by parenteral, intrapulmonary, and intranasal, and, if desired for local treatment, intralesional administration.
  • Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration.
  • the amount of the agent is administered about or approximately twice daily, daily, every other day, three times a week, weekly, every other week or once a month.
  • the agent is administered as part of a composition or formulation, such as a pharmaceutical composition or formulation as described below.
  • a composition or formulation such as a pharmaceutical composition or formulation as described below.
  • the composition comprising the agent is administered as described below.
  • the agent is administered alone and may be administered by any known acceptable route of administration or by one described herein, such as with respect to compositions and pharmaceutical formulations.
  • the agent that treats or ameliorates symptoms of a toxicity of the immunotherapy and/or cell therapy, such as CRS or neurotoxicity is an antibody or antigen binding fragment.
  • the agent is tocilizumab, siltuximab, sarilumab, olokizumab (CDP6038), elsilimomab, ALD518/B MS-945429, sirukumab (CNTO 136), CPSI- 2634, ARGX-109, FE301, or FM101.
  • the agent is an antagonist or inhibitor of IL-6 or the IL-6 receptor (IL-6R).
  • the agent is an antibody that neutralizes IL-6 activity, such as an antibody or antigen-binding fragment that binds to IL-6 or IL-6R.
  • the agent is or comprises tocilizumab (atlizumab) or sarilumab, anti-IL-6R antibodies.
  • the agent is an anti-IL-6R antibody described in U.S. Patent No: 8,562,991.
  • the agent that targets IL-6 is an anti-IL-6 antibody, such as siltuximab, elsilimomab, ALD518/BMS-945429, simkumab (CNTO 136), CPSI-2634, ARGX- 109, FE301, FM101, or olokizumab (CDP6038).
  • the agent may neutralize IL-6 activity by inhibiting the ligand-receptor interactions. The feasibility of this general type of approach has been demonstrated with a natural occurring receptor antagonist for interleukin- 1. See Harmurn, C. H. et ah, Nature (1990) 343:336-340.
  • the IL-6/IL-6R antagonist or inhibitor is an IL-6 mutein, such as one described in U.S. Patent No. 5591827.
  • the agent that is an antagonist or inhibitor of IL-6/IL-6R is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is tocilizumab.
  • tocilizumab is administered as an early intervention in accord with the provided methods, and/or with the provided articles of manufacture or compositions, at a dosage of from or from about 1 mg/kg to 12 mg/kg, such as at or about 4 mg/kg, 8 mg/kg, or 10 mg/kg.
  • tocilizumab is administered by intravenous infusion.
  • tocilizumab is administered for a persistent fever of greater than 39°C lasting 10 hours that is unresponsive to acetaminophen.
  • a second administration of tocilizumab is provided if symptoms recur after 48 hours of the initial dose.
  • the agent is an agonist or stimulator of TGF-b or a TGF-b receptor (e.g., TGF-b receptor I, II, or III).
  • the agent is an antibody that increases TGF-b activity, such as an antibody or antigen-binding fragment that binds to TGF-b or one of its receptors.
  • the agent that is an agonist or stimulator of TGF- b and/or its receptor is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is an antagonist or inhibitor of MCP-1 (CCL2) or a MCP-1 receptor (e.g., MCP-1 receptor CCR2 or CCR4).
  • the agent is an antibody that neutralizes MCP-1 activity, such as an antibody or antigen-binding fragment that binds to MCP-1 or one of its receptors (CCR2 or CCR4).
  • the MCP-1 antagonist or inhibitor is any described in Gong et al. J Exp Med. 1997 Jul 7; 186(1): 131-137 or Shahrara et al. J Immunol 2008; 180:3447-3456.
  • the agent that is an antagonist or inhibitor of MCP-1 and/or its receptor (CCR2 or CCR4) is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is an antagonist or inhibitor of IFN-g or an IFN-g receptor (IFNGR).
  • the agent is an antibody that neutralizes IFN-g activity, such as an antibody or antigen-binding fragment that binds to IFN-g or its receptor (IFNGR).
  • the IFN-gamma neutralizing antibody is any described in Dobber et al. Cell Immunol. 1995 Feb;160(2):185-92 or Ozmen et al. J Immunol. 1993 Apr l;150(7):2698-705.
  • the agent that is an antagonist or inhibitor of IFN-y/IFNGR is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is an antagonist or inhibitor of IL-10 or the IL-10 receptor (IL-10R).
  • the agent is an antibody that neutralizes IL-10 activity, such as an antibody or antigen-binding fragment that binds to IL-10 or IL-10R.
  • the IL-10 neutralizing antibody is any described in Dobber et al. Cell Immunol. 1995 Feb;160(2):185-92 or Hunter et al. J Immunol. 2005 Jun 1 ; 174(11):7368-75.
  • the agent that is an antagonist or inhibitor of IL-10/IL-10R is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is an antagonist or inhibitor of IL-1 or the IL-1 receptor (IL-1R).
  • the agent is an IL-1 receptor antagonist, which is a modified form of IL-1R, such as anakinra (see, e.g., Fleischmann et al., (2006) Annals of the rheumatic diseases. 65(8): 1006-12).
  • the agent is an antibody that neutralizes IL-1 activity, such as an antibody or antigen-binding fragment that binds to IL-1 or IL-1R, such as canakinumah (see also EP 2277543).
  • the agent that is an antagonist or inhibitor of IL-1/IL-1R is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is an antagonist or inhibitor of a tumor necrosis factor (TNF) or a tumor necrosis factor receptor (TNFR).
  • TNF tumor necrosis factor
  • TNFR tumor necrosis factor receptor
  • the agent is an antibody that blocks TNF activity, such as an antibody or antigen-binding fragment that binds to a TNF, such as TNFa, or its receptor (TNFR, e.g., TNFRp55 or TNFRp75).
  • the agent is selected from among infliximab, adalimumab, certolizumab pegol, golimumab and etanercept.
  • the agent that is an antagonist or inhibitor of TNF/TNFR is a small molecule, a protein or peptide, or a nucleic acid.
  • the agent is a small molecule that affects TNF, such as lenalidomide (see, e.g., Muller et al. (1999) Bioorganic & Medicinal Chemistry Letters. 9 (11): 1625).
  • the agent is an antagonist or inhibitor of signaling through the Janus kinase (JAK) and two Signal Transducer and Activator of Transcription (STAT) signaling cascade. JAK/STAT proteins are common components of cytokine and cytokine receptor signaling.
  • the agent that is an antagonist or inhibitor of JAK/STAT such as mxolitinib (see, e.g., Mesa et al. (2012) Nature Reviews Drug Discovery. 11(2): 103- 104), tofacitinib (also known as Xeljanz, Jakvinus tasocitinib and CP-690550), Baricitinib (also known as LY-3009104, INCB-28050), Filgotinib (G- 146034, GLPG-0634), Gandotinib (LY- 2784544), Lestaurtinib (CEP-701), Momelotinib (GS-0387, CYT-387), Pacritinib (SB 1518), and Upadacitinib (ABT-494).
  • the agent is a small molecule, a protein or peptide, or a nucleic acid.
  • a device such as absorbent resin technology with blood or plasma filtration, can be used to reduce cytokine levels.
  • the device used to reduce cytokine levels is a physical cytokine absorber, such as an extracorporeal cytokine absorber.
  • a physical cytokine absorber can be used to eliminate cytokines from the bloodstream in an ex vivo , extracorporeal manner.
  • the agent is a porous polymer.
  • the agent is CytoSorb (see, e.g., Basu et al. Indian J Crit Care Med. (2014) 18(12): 822-824).
  • the additional therapeutic agent is any of the other therapeutic agents described herein, including agents that are capable of an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity.
  • the additional therapeutic agent is an agent that is capable of enhancing or increasing the expansion and/or persistence of the cells, which, in some cases can lead to an improved response to the cell therapy.
  • such methods can include administration of the additional therapeutic agent prior to, simultaneously with, during, during the course of (including once and/or periodically during the course of), and/or subsequently to, the administration (e.g., initiation of administration) of the cell therapy (e.g. CAR-expressing T cells).
  • the administrations can involve sequential or intermittent administrations of the additional therapeutic agent and the cell therapy.
  • the agent is a kinase inhibitor.
  • the inhibitor in the TEC family of kinase inhibits one or more kinase of the TEC family, including Bruton’s tyrosine kinase (BTK), IL2 inducible T-cell kinase (ITK), tec protein tyrosine kinase (TEC), BMX non-receptor tyrosine kinase (Etk), and TXK tyrosine kinase (TXK).
  • the inhibitor is a Bruton’s tyrosine kinase inhibitor (BTKi).
  • the inhibitor is or comprises ibrutinib or acalabmtinib (see, e.g., Barrett et ah, ASH 58 th Annual Meeting San Diego, CA December 3-6, 2016, Abstract 654; Ruella et ah, ASH 58 th Annual Meeting San Diego, CA December 3-6, 2016, Abstract 2159).
  • the agent is an inhibitor as described in U.S. Patent No.
  • the administration of the BTKi is initiated at or at least about 5 to at or about 7 days, such as at or about 5, 6 or 7 days, prior to obtaining the sample from the subject and is carried out in a dosing regimen comprising administration of the BTKi, e.g., ibrutinib, at least until the sample is obtained from the subject and continued and/or further administration of the BTKi, e.g., ibrutinib, that extends for at or about or greater than three months after initiation of administration of the cell therapy.
  • a dosing regimen comprising administration of the BTKi, e.g., ibrutinib, at least until the sample is obtained from the subject and continued and/or further administration of the BTKi, e.g., ibrutinib, that extends for at or about or greater than three months after initiation of administration of the cell therapy.
  • the BTKi e.g., ibrutinib
  • the BTKi is administered in an amount from or from about 140 mg to or to about 560 mg once per day each day it is administered during the dosing regimen.
  • the subject subsequent to initiating administration of the BTKi, e.g., ibrutinib, and prior to the administration of the cell therapy, the subject has been preconditioned with a lymphodepleting therapy.
  • the methods further include, administering a lymphodepleting therapy to the subject subsequent to the administration of the BTKi, e.g., ibrutinib, and prior to the administration of the cell therapy.
  • the administration of the lymphodepleting therapy is completed within 7 days prior to initiation of the administration of the cell therapy. In some embodiments, the administration of the lymphodepleting therapy is completed in at or about 2 to at or about 7 days, such as at or about 7 days, prior to initiation of the administration of the cell therapy. In some embodiments, the dosing regimen comprises discontinuing or pausing administration of the BTKi, e.g., ibrutinib, during the lymphodepleting therapy. In some embodiments, the dosing regimen comprises resuming or further administering the BTKi, e.g., ibrutinib, after completion of the lymphodepleting therapy.
  • the BTKi e.g., ibrutinib
  • the methods or uses involve administering to a subject having a cancer a BTKi, e.g., ibrutinib, or a pharmaceutically acceptable salt thereof; and administering a lymphodepleting therapy to the subject; and administering the cell therapy to the subject within 2 to 7 days, after completing the lymphodepleting therapy.
  • a BTKi e.g., ibrutinib
  • the administration of the BTKi is initiated at or at least about 5 to 7 days, such as 7 days, prior to obtaining the sample from the subject and is carried out in a dosing regimen comprising administration of the BTKi, e.g., ibrutinib, up to the initiation of the lymphodepleting therapy, discontinuing or pausing administration of the BTKi, e.g., ibrutinib, during the lymphodepleting therapy and resuming or further administering the BTKi, e.g., ibrutinib, for a period that extends for at or greater than three months after initiation of administration of the cell therapy, wherein the BTKi, e.g., ibrutinib, is administered in an amount from or from about 140 mg to or to about 560 mg once per day each day it is administered during the dosing regimen.
  • a dosing regimen comprising administration of the BTKi, e.g., ibrutinib, up to
  • the administration of the BTKi, e.g., ibrutinib, per day it is administered is from or from about 280 mg to or to about 560 mg. In some embodiments, administration of the BTKi, e.g., ibrutinib, is initiated at or at least about 7 days prior to obtaining the sample from the subject.
  • the administration of the BTKi is initiated from or from about 30 to about 40 days prior to initiating the administration of the cell therapy; the sample is obtained from the subject from or from about 23 days to about 38 days prior to initiating the administration of the cell therapy; and/or the lymphodepleting therapy is completed at or about 5 to 7 days, such as 7 days, prior to initiating administration of the cell therapy.
  • the administration of the BTKi is initiated at or about 35 days prior to initiating the administration of the cell therapy; the sample is obtained from the subject from or from about 28 days to about 32 days prior to initiating the administration of the cell therapy; and/or the lymphodepleting therapy is completed about 5 to about 7 days, such as 7 days, prior to initiating administration of the cell therapy.
  • the administration of the BTKi continues at regular intervals until the initiation of the cell therapy and/or for a time after the initiation of the cell therapy.
  • the BTKi e.g., ibrutinib
  • the BTKi is administered prior to and after initiation of administration of the cell therapy.
  • the BTKi e.g., ibrutinib, e.g., ibrutinib is administered, or is continued and/or further administered, after administration of the cell therapy.
  • the BTKi e.g., ibrutinib
  • the BTKi is administered simultaneously, or within or within about 1 hours, 2 hours, 6 hours, 12 hours, 24 hours, 48 hours, 96 hours, 4 days, 5 days, 6 days or 7 days, 14 days, 15 days, 21 days, 24 days, 28 days, 30 days, 36 days, 42 days, 60 days, 72 days, 90 days, 120 days, 180 days, 210 days,
  • the provided methods involve continued and/or further administration, such as at regular intervals, of the BTKi, e.g., ibrutinib, after initiation of administration of the cell therapy, e.g., for a duration of any of the foregoing periods after initiation of the cell therapy.
  • the BTKi e.g., ibrutinib
  • the BTKi e.g., ibrutinib
  • the BTKi e.g., ibrutinib
  • the period, e.g., for continued and/or further administration of the BTKi, e.g., ibrutinib extends for at or about or greater than four months after the initiation of the administration of the cell therapy. In some embodiments, the period, e.g., for continued administration of the BTKi, e.g., ibrutinib, extends for at or about or greater than five months after the initiation of the administration of the cell therapy. In some embodiments, the period, e.g., for continued administration of the BTKi, e.g., ibrutinib, extends for at or about or greater than six months after the initiation of the administration of the cell therapy.
  • administration of the BTKi extends for a period of at least three months. In some embodiments, administration of the BTKi, e.g., ibrutinib, extends for a period of at or about 90 days, at or about 100 days, at or about 105 days, at or about 110 days, at or about 115 days, at or about 120 days, at or about 125 days, at or about 130 days, at or about 135 days, at or about 140 days, at or about 145 days, at or about 150 days, at or about 155 days, at or about 160 days, at or about 165 days, at or about 170 days, at or about 175 days, at or about 180 days, at or about 185 days, at or about 190 days, at or about 195 days, at or about 200 days or more after initiation of administration of the cell therapy.
  • the BTKi e.g., ibrutinib
  • the BTKi e.g., ibrutinib
  • the BTKi is administered at a total daily dosage amount of at least or at least about 50 mg/day, 100 mg/day, 140 mg/day, 150 mg/day,
  • the inhibitor is administered in an amount of or about 420 mg/day. In some embodiments, the inhibitor is administered in an amount that is less than or less than about 560 mg/day and at least about or at least 140 mg/day.
  • the inhibitor is administered in an amount that is less than or less than about 420 mg/day and at least about or at least 280 mg/day. In some embodiments, the inhibitor is administered in an amount of at or about, or at least at or about, 140 mg/day, 280 mg/day, 420 mg/day or 560 mg/day. In some embodiments, the inhibitor is administered in an amount of at or about, or at least at or about, 420 mg/day or 560 mg/day. In some embodiments, the inhibitor is administered in an amount of no more than 140 mg/day, 280 mg/day, 420 mg/day or 560 mg/day. In some embodiments, the inhibitor is administered in an amount of no more than 420 mg/day or 560 mg/day.
  • the amount comprises from or from about 140 mg to at or about 840 mg per each day the BTKi, e.g., ibrutinib, is administered. In some embodiments, the amount comprises from or from about 140 mg to or to about 560 mg per each day the BTKi, e.g., ibrutinib is administered. In some aspects, the BTKi, e.g., ibrutinib, is administered at a dose of at or about 420 mg daily, or a lower dose if prior dose reduction was necessary to manage toxicity.
  • the inhibitor is administered once daily. In some embodiments, the inhibitor is administered twice daily.
  • ibrutinib may be administered orally.
  • dosages such as daily dosages, are administered in one or more divided doses, such as 2, 3, or 4 doses, or in a single formulation.
  • the inhibitor can be administered alone, in the presence of a pharmaceutically acceptable carrier, or in the presence of other therapeutic agents.
  • the BTKi e.g., ibrutinib
  • a cell therapy e.g., CAR T cell therapy.
  • the administration of BTKi, e.g., ibrutinib is continued until after the initiation of administration of the cell therapy, e.g., CAR T cell therapy.
  • the BTKi e.g., ibrutinib
  • a cell therapy e.g., CAR T cell therapy
  • the BTKi e.g., ibrutinib
  • the initiation of the cell therapy e.g., CAR T cell therapy.
  • the cells for use in or administered in connection with the provided methods contain or are engineered to contain an engineered receptor, e.g., an engineered antigen receptor, such as a chimeric antigen receptor (CAR), or a T cell receptor (TCR).
  • an engineered receptor e.g., an engineered antigen receptor, such as a chimeric antigen receptor (CAR), or a T cell receptor (TCR).
  • populations of such cells compositions containing such cells and/or enriched for such cells, such as in which cells of a certain type such as T cells or CD8 + or CD4 + cells are enriched or selected.
  • compositions are pharmaceutical compositions and formulations for administration, such as for adoptive cell therapy.
  • therapeutic methods for administering the cells and compositions to subjects e.g., patients, in accord with the provided methods, and/or with the provided articles of manufacture or compositions.
  • the cells include one or more nucleic acids introduced via genetic engineering, and thereby express recombinant or genetically engineered products of such nucleic acids.
  • gene transfer is accomplished by first stimulating the cells, such as by combining it with a stimulus that induces a response such as proliferation, survival, and/or activation, e.g., as measured by expression of a cytokine or activation marker, followed by transduction of the activated cells, and expansion in culture to numbers sufficient for clinical applications.
  • the cells generally express recombinant receptors, such as antigen receptors including functional non-TCR antigen receptors, e.g., chimeric antigen receptors (CARs), and other antigen-binding receptors such as transgenic T cell receptors (TCRs). Also among the receptors are other chimeric receptors.
  • antigen receptors including functional non-TCR antigen receptors, e.g., chimeric antigen receptors (CARs), and other antigen-binding receptors such as transgenic T cell receptors (TCRs).
  • CARs chimeric antigen receptors
  • TCRs transgenic T cell receptors
  • chimeric receptors such as a chimeric antigen receptors, contain one or more domains that combine a ligand-binding domain (e.g. antibody or antibody fragment) that provides specificity for a desired antigen (e.g., tumor antigen) with intracellular signaling domains.
  • the intracellular signaling domain is a stimulating or an activating intracellular domain portion, such as a T cell stimulating or activating domain, providing a primary activation signal or a primary signal.
  • the intracellular signaling domain contains or additionally contains a costimulatory signaling domain to facilitate effector functions.
  • chimeric receptors when genetically engineered into immune cells can modulate T cell activity, and, in some cases, can modulate T cell differentiation or homeostasis, thereby resulting in genetically engineered cells with improved longevity, survival and/or persistence in vivo , such as for use in adoptive cell therapy methods.
  • Exemplary antigen receptors including CARs, and methods for engineering and introducing such receptors into cells, include those described, for example, in international patent application publication numbers W0200014257, WO2013126726, WO2012/129514, WO2014031687, WO2013/166321, W02013/071154, W02013/123061 U.S. patent application publication numbers US2002131960, US2013287748, US20130149337, U.S.
  • the antigen receptors include a CAR as described in U.S. Patent No.: 7,446,190, and those described in International Patent Application Publication No.: WO/2014055668 Al.
  • the CARs include CARs as disclosed in any of the aforementioned publications, such as WO2014031687, US 8,339,645, US 7,446,179, US 2013/0149337, U.S. Patent No.: 7,446,190, US Patent No.: 8,389,282, Kochenderfer et al., 2013, Nature Reviews Clinical Oncology, 10, 267-276 (2013); Wang et al. (2012) J. Immunother. 35(9): 689-701; and Brentjens et al., Sci Transl Med. 2013 5(177). See also WO2014031687, US 8,339,645, US 7,446,179, US 2013/0149337, U.S. Patent No.: 7,446,190, and US Patent No.: 8,389,282.
  • the chimeric receptors such as CARs, generally include an extracellular antigen binding domain, such as a portion of an antibody molecule, generally a variable heavy (VH) chain region and/or variable light (VL) chain region of the antibody, e.g., an scFv antibody fragment.
  • VH variable heavy
  • VL variable light
  • the antigen targeted by the receptor is a polypeptide. In some embodiments, it is a carbohydrate or other molecule. In some embodiments, the antigen is selectively expressed or overexpressed on cells of the disease or condition, e.g., the tumor or pathogenic cells, as compared to normal or non-targeted cells or tissues. In other embodiments, the antigen is expressed on normal cells and/or is expressed on the engineered cells.
  • the antigen targeted by the receptor is selected from among anb6 integrin (avb6 integrin), B cell maturation antigen (BCMA), B7-H3, B7-H6, carbonic anhydrase 9 (CA9, also known as CAIX or G250), a cancer-testis antigen, cancer/testis antigen IB (CTAG, also known as NY-ESO-1 and LAGE-2), carcinoembryonic antigen (CEA), a cyclin, cyclin A2, C-C Motif Chemokine Ligand 1 (CCL-1), CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7/8, CD123, CD133, CD138, CD171, chondroitin sulfate proteoglycan 4 (CSPG4), epidermal growth factor protein (EGFR), type III epidermal growth factor receptor mutation (EGFR vIII), epithelial glycoprotein 2 (avb6 integrin),
  • Antigens targeted by the receptors include antigens associated with a B cell malignancy, such as any of a number of known B cell marker.
  • the antigen targeted by the receptor is CD20, CD19, CD22, ROR1, CD45, CD21, CD5, CD33, Igkappa, Iglambda, CD79a, CD79b or CD30.
  • the antigen is or includes a pathogen- specific or pathogen-expressed antigen.
  • the antigen is a viral antigen (such as a viral antigen from HIV, HCV, HBV, etc.), bacterial antigens, and/or parasitic antigens.
  • the antigen is CD19.
  • the scFv contains a VH and a VL derived from an antibody or an antibody fragment specific to CD 19.
  • the antibody or antibody fragment that binds CD 19 is a mouse derived antibody such as FMC63 and SJ25C1.
  • the antibody or antibody fragment is a human antibody, e.g., as described in U.S. Patent Publication No. US 2016/0152723.
  • the scFv and/or VH domains is derived from FMC63.
  • FMC63 generally refers to a mouse monoclonal IgGl antibody raised against Nalm-1 and -16 cells expressing CD19 of human origin (Ling, N. R., el al. (1987). Leucocyte typing III. 302).
  • the FMC63 antibody comprises a CDR-H1 and a CDR-H2 set forth in SEQ ID NOS: 38 and 39, respectively, and a CDR-H3 set forth in SEQ ID NO: 40 or 54; and a CDR- L1 set forth in SEQ ID NO: 35 and a CDR-L2 set forth in SEQ ID NO: 36 or 55 and a CDR-L3 set forth in SEQ ID NO: 37 or 56.
  • the FMC63 antibody comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 41 and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 42.
  • the scFv comprises a variable light chain containing a CDR- L1 sequence of SEQ ID NO:35, a CDR-L2 sequence of SEQ ID NO:36, and a CDR-L3 sequence of SEQ ID NO:37 and/or a variable heavy chain containing a CDR-H1 sequence of SEQ ID NO:38, a CDR-H2 sequence of SEQ ID NO:39, and a CDR-H3 sequence of SEQ ID NO:40.
  • the scFv comprises a variable heavy chain region set forth in SEQ ID NO:41 and a variable light chain region set forth in SEQ ID NO:42.
  • variable heavy and variable light chains are connected by a linker.
  • the linker is set forth in SEQ ID NO:24.
  • the scFv comprises, in order, a VH, a linker, and a VL. In some embodiments, the scFv comprises, in order, a VL, a linker, and a VH.
  • the scFv is encoded by a sequence of nucleotides set forth in SEQ ID NO:25 or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:25.
  • the scFv comprises the sequence of amino acids set forth in SEQ ID NO:43 or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
  • the scFv is derived from SJ25C1.
  • SJ25C1 is a mouse monoclonal IgGl antibody raised against Nalm-1 and -16 cells expressing CD 19 of human origin (Ling, N. R., el al. (1987). Leucocyte typing III. 302).
  • the SJ25C1 antibody comprises a CDR-H1, a CDR-H2 and a CDR-H3 sequence set forth in SEQ ID NOS: 47-49, respectively, and a CDR-L1, a CDR-L2 and a CDR-L3 sequence set forth in SEQ ID NOS: 44-46, respectively.
  • the SJ25C1 antibody comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 50 and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 51.
  • the scFv comprises a variable light chain containing a CDR- L1 sequence of SEQ ID NO:44, a CDR-L2 sequence of SEQ ID NO: 45, and a CDR-L3 sequence of SEQ ID NO:46 and/or a variable heavy chain containing a CDR-H1 sequence of SEQ ID NO:47, a CDR-H2 sequence of SEQ ID NO:48, and a CDR-H3 sequence of SEQ ID NO:49.
  • the scFv comprises a variable heavy chain region set forth in SEQ ID NO:50 and a variable light chain region set forth in SEQ ID NO:51.
  • variable heavy and variable light chain are connected by a linker.
  • the linker is set forth in SEQ ID NO:52.
  • the scFv comprises, in order, a VH , a linker, and a VL. In some embodiments, the scFv comprises, in order, a VL, a linker, and a VH.
  • the scFv comprises the sequence of amino acids set forth in SEQ ID NO:53 or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:53.
  • the chimeric antigen receptor includes an extracellular portion containing an antibody or antibody fragment. In some aspects, the chimeric antigen receptor includes an extracellular portion containing the antibody or fragment and an intracellular signaling domain. In some embodiments, the antibody or fragment includes an scFv.
  • antibody herein is used in the broadest sense and includes polyclonal and monoclonal antibodies, including intact antibodies and functional (antigen-binding) antibody fragments, including fragment antigen binding (Fab) fragments, F(ab’) 2 fragments, Fab’ fragments, Fv fragments, recombinant IgG (rlgG) fragments, heavy chain variable (VH) regions capable of specifically binding the antigen, single chain antibody fragments, including single chain variable fragments (scFv), and single domain antibodies (e.g., sdAb, sdFv, nanobody) fragments.
  • Fab fragment antigen binding
  • rlgG fragment antigen binding
  • VH heavy chain variable
  • immunoglobulins such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific, e.g., bispecific or trispecific, antibodies, diabodies, triabodies, and tetrabodies, tandem di-scFv, tandem tri- scFv.
  • antibody should be understood to encompass functional antibody fragments thereof also referred to herein as “antigen-binding fragments.”
  • the term also encompasses intact or full-length antibodies, including antibodies of any class or sub-class, including IgG and sub-classes thereof, IgM, IgE, IgA, and IgD.
  • CDR complementarity determining region
  • HVR hypervariable region
  • CDR-H1, CDR-H2, CDR-H3 three CDRs in each heavy chain variable region
  • CDR-F1, CDR-F2, CDR-F3 three CDRs in each light chain variable region
  • “Framework regions” and “FR” are known, in some cases, to refer to the non-CDR portions of the variable regions of the heavy and light chains.
  • FR-H1, FR-H2, FR-H3, and FR-H4 there are four FRs in each full-length heavy chain variable region (FR-H1, FR-H2, FR-H3, and FR-H4), and four FRs in each full-length light chain variable region (FR-F1, FR-F2, FR-F3, and FR-F4).
  • the boundaries of a given CDR or FR may vary depending on the scheme used for identification.
  • the Rabat scheme is based on structural alignments
  • the Chothia scheme is based on structural information. Numbering for both the Rabat and Chothia schemes is based upon the most common antibody region sequence lengths, with insertions accommodated by insertion letters, for example, “30a,” and deletions appearing in some antibodies. The two schemes place certain insertions and deletions (“indels”) at different positions, resulting in differential numbering.
  • the Contact scheme is based on analysis of complex crystal structures and is similar in many respects to the Chothia numbering scheme.
  • the AbM scheme is a compromise between Rabat and Chothia definitions based on that used by Oxford Molecular’s AbM antibody modeling software.
  • Table 8 lists exemplary position boundaries of CDR-L1, CDR-L2, CDR-L3 and CDR-H1, CDR-H2, CDR-H3 as identified by Rabat, Chothia, AbM, and Contact schemes, respectively.
  • residue numbering is listed using both the Rabat and Chothia numbering schemes.
  • FRs are located between CDRs, for example, with FR-L1 located before CDR-L1, FR-L2 located between CDR-L1 and CDR-L2, FR-L3 located between CDR-L2 and CDR-L3 and so forth.
  • CDR complementary determining region
  • individual specified CDRs e.g ., CDR-H1, CDR-H2, CDR-H3
  • CDR-H1, CDR-H2, CDR-H3 individual specified CDRs
  • a particular CDR e.g., a CDR-H3
  • a CDR-H3 contains the amino acid sequence of a corresponding CDR in a given VH or VL region amino acid sequence
  • a CDR has a sequence of the corresponding CDR (e.g., CDR-H3) within the variable region, as defined by any of the aforementioned schemes, or other known schemes.
  • specific CDR sequences are specified. Exemplary CDR sequences of provided antibodies are described using various numbering schemes, although it is understood that a provided antibody can include CDRs as described according to any of the other aforementioned numbering schemes or other numbering schemes known to a skilled artisan.
  • FR or individual specified FR(s) e.g., FR- Hl, FR-H2, FR-H3, FR-H4
  • FR- Hl, FR-H2, FR-H3, FR-H4 FR- Hl, FR-H2, FR-H3, FR-H4
  • FR-Hl, FR-H2, FR-H3, FR-H4 FR- Hl, FR-H2, FR-H3, FR-H4
  • the scheme for identification of a particular CDR, FR, or FRs or CDRs is specified, such as the CDR as defined by the Kabat, Chothia, AbM or Contact method, or other known schemes.
  • the particular amino acid sequence of a CDR or FR is given.
  • variable region refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen.
  • the variable regions of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three CDRs.
  • FRs conserved framework regions
  • a single VH or VL domain may be sufficient to confer antigen-binding specificity.
  • antibodies that bind a particular antigen may be isolated using a VH or VL domain from an antibody that binds the antigen to screen a library of complementary VL or VH domains, respectively. See, e.g., Portolano et al, J. Immunol. 150:880-887 (1993); Clarkson etal, Nature 352:624-628 (1991).
  • antibody fragments refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds.
  • antibody fragments include but are not limited to Fv, Fab, Fab’, Fab’-SH, F(ab’)2; diabodies; linear antibodies; heavy chain variable (VH) regions, single-chain antibody molecules such as scFvs and single-domain antibodies comprising only the VH region; and multispecific antibodies formed from antibody fragments.
  • the antigen-binding domain in the provided CARs is or comprises an antibody fragment comprising a variable heavy chain (VH) and a variable light chain (VL) region.
  • the antibodies are single-chain antibody fragments comprising a heavy chain variable (VH) region and/or a light chain variable (VL) region, such as scFvs.
  • variable region refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen.
  • the variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three CDRs.
  • FRs conserved framework regions
  • a single VH or VL domain may be sufficient to confer antigen-binding specificity.
  • antibodies that bind a particular antigen may be isolated using a VH or VL domain from an antibody that binds the antigen to screen a library of complementary VL or VH domains, respectively. See, e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991).
  • Single-domain antibodies are antibody fragments comprising all or a portion of the heavy chain variable domain or all or a portion of the light chain variable domain of an antibody.
  • a single-domain antibody is a human single-domain antibody.
  • the CAR comprises an antibody heavy chain domain that specifically binds the antigen, such as a cancer marker or cell surface antigen of a cell or disease to be targeted, such as a tumor cell or a cancer cell, such as any of the target antigens described herein or known.
  • Antibody fragments can be made by various techniques, including but not limited to proteolytic digestion of an intact antibody as well as production by recombinant host cells.
  • the antibodies are recombinantly-produced fragments, such as fragments comprising arrangements that do not occur naturally, such as those with two or more antibody regions or chains joined by synthetic linkers, e.g., peptide linkers, and/or that are may not be produced by enzyme digestion of a naturally-occurring intact antibody.
  • the antibody fragments are scFvs.
  • a “humanized” antibody is an antibody in which all or substantially all CDR amino acid residues are derived from non-human CDRs and all or substantially all FR amino acid residues are derived from human FRs.
  • a humanized antibody optionally may include at least a portion of an antibody constant region derived from a human antibody.
  • a “humanized form” of a non-human antibody refers to a variant of the non-human antibody that has undergone humanization, typically to reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody.
  • some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the CDR residues are derived), e.g., to restore or improve antibody specificity or affinity.
  • a non-human antibody e.g., the antibody from which the CDR residues are derived
  • the antibody portion of the recombinant receptor e.g., CAR
  • an immunoglobulin constant region such as a hinge region, e.g., an IgG4 hinge region, and/or a C H 1/C L and/or Fc region.
  • the constant region or portion is of a human IgG, such as IgG4 or IgGl.
  • the portion of the constant region serves as a spacer region between the antigen-recognition component, e.g., scFv, and transmembrane domain.
  • the spacer can be of a length that provides for increased responsiveness of the cell following antigen binding, as compared to in the absence of the spacer.
  • Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153, international patent application publication number WO2014031687, U.S. Patent No. 8,822,647 or published app. No. US2014/0271635.
  • the constant region or portion is of a human IgG, such as IgG4 or IgGl.
  • the spacer has the sequence ESKYGPPCPPCP (set forth in SEQ ID NO: 1), and is encoded by the sequence set forth in SEQ ID NO: 2.
  • the spacer has the sequence set forth in SEQ ID NO: 3.
  • the spacer has the sequence set forth in SEQ ID NO: 4.
  • the constant region or portion is of IgD.
  • the spacer has the sequence set forth in SEQ ID NO: 5.
  • the spacer has a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any of SEQ ID NOS: 1, 3, 4 or 5.
  • the spacer has the sequence set forth in SEQ ID NOS: 26-34.
  • the spacer has a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any of SEQ ID NOS: 26-34.
  • the antigen receptor comprises an intracellular domain linked directly or indirectly to the extracellular domain.
  • the chimeric antigen receptor includes a transmembrane domain linking the extracellular domain and the intracellular signaling domain.
  • the intracellular signaling domain comprises an IT AM.
  • the antigen recognition domain e.g. extracellular domain
  • the chimeric receptor generally is linked to one or more intracellular signaling components, such as signaling components that mimic activation through an antigen receptor complex, such as a TCR complex, in the case of a CAR, and/or signal via another cell surface receptor.
  • the chimeric receptor comprises a transmembrane domain linked or fused between the extracellular domain (e.g. scFv) and intracellular signaling domain.
  • the antigen binding component e.g., antibody
  • the antigen binding component is linked to one or more transmembrane and intracellular signaling domains.
  • a transmembrane domain that naturally is associated with one of the domains in the receptor e.g., CAR
  • the transmembrane domain is selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.
  • the transmembrane domain in some embodiments is derived either from a natural or from a synthetic source. Where the source is natural, the domain in some aspects is derived from any membrane-bound or transmembrane protein.
  • Transmembrane regions include those derived from (i.e. comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154.
  • the transmembrane domain in some embodiments is synthetic.
  • the synthetic transmembrane domain comprises predominantly hydrophobic residues such as leucine and valine. In some aspects, a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
  • the linkage is by linkers, spacers, and/or transmembrane domain(s). In some aspects, the transmembrane domain contains a transmembrane portion of CD28.
  • the extracellular domain and transmembrane domain can be linked directly or indirectly.
  • the extracellular domain and transmembrane are linked by a spacer, such as any described herein.
  • the receptor contains extracellular portion of the molecule from which the transmembrane domain is derived, such as a CD28 extracellular portion.
  • intracellular signaling domains are those that mimic or approximate a signal through a natural antigen receptor, a signal through such a receptor in combination with a costimulatory receptor, and/or a signal through a costimulatory receptor alone.
  • a short oligo- or polypeptide linker for example, a linker of between 2 and 10 amino acids in length, such as one containing glycines and serines, e.g., glycine-serine doublet, is present and forms a linkage between the transmembrane domain and the cytoplasmic signaling domain of the CAR.
  • T cell activation is in some aspects described as being mediated by two classes of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation through the TCR (primary cytoplasmic signaling sequences), and those that act in an antigen- independent manner to provide a secondary or co- stimulatory signal (secondary cytoplasmic signaling sequences).
  • primary cytoplasmic signaling sequences those that initiate antigen-dependent primary activation through the TCR
  • secondary cytoplasmic signaling sequences those that act in an antigen- independent manner to provide a secondary or co- stimulatory signal.
  • the CAR includes one or both of such signaling components.
  • the receptor e.g., the CAR
  • the CAR generally includes at least one intracellular signaling component or components.
  • the CAR includes a primary cytoplasmic signaling sequence that regulates primary activation of the TCR complex.
  • Primary cytoplasmic signaling sequences that act in a stimulatory manner may contain signaling motifs which are known as immunoreceptor tyrosine -based activation motifs or IT AMs.
  • IT AM containing primary cytoplasmic signaling sequences include those derived from CD3 zeta chain, FcR gamma, CD3 gamma, CD3 delta and CD3 epsilon.
  • cytoplasmic signaling molecule(s) in the CAR contain(s) a cytoplasmic signaling domain, portion thereof, or sequence derived from CD3 zeta.
  • the receptor includes an intracellular component of a TCR complex, such as a TCR CD3 chain that mediates T-cell activation and cytotoxicity, e.g., CD3 zeta chain.
  • the antigen-binding portion is linked to one or more cell signaling modules.
  • cell signaling modules include CD3 transmembrane domain, CD3 intracellular signaling domains, and/or other CD transmembrane domains.
  • the receptor e.g., CAR
  • the receptor further includes a portion of one or more additional molecules such as Fc receptor g, CD8, CD4, CD25, or CD16.
  • the CAR or other chimeric receptor includes a chimeric molecule between CD3-zeta ( € ⁇ 3-z) or Fc receptor g and CD8, CD4, CD25 or CD16.
  • the cytoplasmic domain or intracellular signaling domain of the receptor activates at least one of the normal effector functions or responses of the immune cell, e.g., T cell engineered to express the CAR.
  • the CAR induces a function of a T cell such as cytolytic activity or T-helper activity, such as secretion of cytokines or other factors.
  • a truncated portion of an intracellular signaling domain of an antigen receptor component or costimulatory molecule is used in place of an intact immunostimulatory chain, for example, if it transduces the effector function signal.
  • the intracellular signaling domain or domains include the cytoplasmic sequences of the T cell receptor (TCR), and in some aspects also those of co-receptors that in the natural context act in concert with such receptors to initiate signal transduction following antigen receptor engagement.
  • TCR T cell receptor
  • full activation In the context of a natural TCR, full activation generally requires not only signaling through the TCR, but also a costimulatory signal.
  • a component for generating secondary or co-stimulatory signal is also included in the CAR.
  • the CAR does not include a component for generating a costimulatory signal.
  • an additional CAR is expressed in the same cell and provides the component for generating the secondary or costimulatory signal.
  • the chimeric antigen receptor contains an intracellular domain of a T cell costimulatory molecule.
  • the CAR includes a signaling domain and/or transmembrane portion of a costimulatory receptor, such as CD28, 4-1BB, 0X40,
  • the same CAR includes both the activating and costimulatory components.
  • the chimeric antigen receptor contains an intracellular domain derived from a T cell costimulatory molecule or a functional variant thereof, such as between the transmembrane domain and intracellular signaling domain.
  • the T cell costimulatory molecule is CD28 or 4 IBB.
  • the activating domain is included within one CAR, whereas the costimulatory component is provided by another CAR recognizing another antigen.
  • the CARs include activating or stimulatory CARs, costimulatory CARs, both expressed on the same cell (see WO2014/055668).
  • the cells include one or more stimulatory or activating CAR and/or a costimulatory CAR.
  • the cells further include inhibitory CARs (iCARs, see Fedorov et al., Sci. Transl.
  • the intracellular signaling domain comprises a CD28 transmembrane and signaling domain linked to a CD3 (e.g., CD3-zeta) intracellular domain.
  • the intracellular signaling domain comprises a chimeric CD28 and CD 137 (4- IBB, TNFRSF9) co- stimulatory domains, linked to a CD3 zeta intracellular domain.
  • the CAR encompasses one or more, e.g., two or more, costimulatory domains and an activation domain, e.g., primary activation domain, in the cytoplasmic portion.
  • exemplary CARs include intracellular components of CD3-zeta, CD28, and 4- IBB.
  • the vector encoding the antigen receptor, and/or the cells expressing the CAR or other antigen receptor further includes a nucleic acid sequence encoding one or more marker(s).
  • the one or more marker(s) is a transduction marker, surrogate marker and/or a selection marker.
  • the marker is a surrogate marker, such as a cell surface marker, which may be used to confirm transduction or engineering of the cell to express the receptor
  • the marker is a transduction marker or a surrogate marker.
  • a transduction marker or a surrogate marker can be used to detect cells that have been introduced with the polynucleotide, e.g., a polynucleotide encoding a recombinant receptor.
  • the transduction marker can indicate or confirm modification of a cell.
  • the surrogate marker is a protein that is made to be co-expressed on the cell surface with the recombinant receptor, e.g. CAR.
  • such a surrogate marker is a surface protein that has been modified to have little or no activity.
  • the surrogate marker is encoded on the same polynucleotide that encodes the recombinant receptor.
  • the nucleic acid sequence encoding the recombinant receptor is operably linked to a nucleic acid sequence encoding a marker, optionally separated by an internal ribosome entry site (IRES), or a nucleic acid encoding a self cleaving peptide or a peptide that causes ribosome skipping, such as a 2A sequence, such as a T2A, a P2A, an E2A or an F2A.
  • IRS internal ribosome entry site
  • Extrinsic marker genes may in some cases be utilized in connection with engineered cell to permit detection or selection of cells and, in some cases, also to promote cell suicide.
  • Exemplary surrogate markers can include truncated forms of cell surface polypeptides, such as truncated forms that are non-functional and to not transduce or are not capable of transducing a signal or a signal ordinarily transduced by the full-length form of the cell surface polypeptide, and/or do not or are not capable of internalizing.
  • Exemplary truncated cell surface polypeptides including truncated forms of growth factors or other receptors such as a truncated human epidermal growth factor receptor 2 (tHER2), a truncated epidermal growth factor receptor (tEGFR, exemplary tEGFR sequence set forth in SEQ ID NO: 11 or 76) or a prostate-specific membrane antigen (PSMA) or modified form thereof.
  • tEGFR may contain an epitope recognized by the antibody cetuximab (Erbitux®) or other therapeutic anti-EGFR antibody or binding molecule, which can be used to identify or select cells that have been engineered with the tEGFR construct and an encoded exogenous protein, and/or to eliminate or separate cells expressing the encoded exogenous protein.
  • the marker e.g. surrogate marker
  • the marker includes all or part (e.g., truncated form) of CD34, a NGFR, a CD19 or a truncated CD19, e.g., a truncated non-human CD19, or epidermal growth factor receptor (e.g., tEGFR).
  • the marker is or comprises a fluorescent protein, such as green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), such as super-fold GFP (sfGFP), red fluorescent protein (RFP), such as tdTomato, mCherry, mStrawberry, AsRed2, DsRed or DsRed2, cyan fluorescent protein (CFP), blue green fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), and yellow fluorescent protein (YFP), and variants thereof, including species variants, monomeric variants, and codon-optimized and/or enhanced variants of the fluorescent proteins.
  • the marker is or comprises an enzyme, such as a luciferase, the lacZ gene from E.
  • coli alkaline phosphatase, secreted embryonic alkaline phosphatase (SEAP), chloramphenicol acetyl transferase (CAT).
  • exemplary light-emitting reporter genes include luciferase (luc), b-galactosidase, chloramphenicol acetyltransferase (CAT), b-glucuronidase (GUS) or variants thereof.
  • the marker is a selection marker.
  • the selection marker is or comprises a polypeptide that confers resistance to exogenous agents or drugs.
  • the selection marker is an antibiotic resistance gene.
  • the selection marker is an antibiotic resistance gene confers antibiotic resistance to a mammalian cell.
  • the selection marker is or comprises a Puromycin resistance gene, a Hygromycin resistance gene, a Blasticidin resistance gene, a Neomycin resistance gene, a Geneticin resistance gene or a Zeocin resistance gene or a modified form thereof.
  • the molecule is a non-self molecule, e.g., non-self protein, i.e., one that is not recognized as “self’ by the immune system of the host into which the cells will be adoptively transferred.
  • the marker serves no therapeutic function and/or produces no effect other than to be used as a marker for genetic engineering, e.g., for selecting cells successfully engineered.
  • the marker may be a therapeutic molecule or molecule otherwise exerting some desired effect, such as a ligand for a cell to be encountered in vivo, such as a costimulatory or immune checkpoint molecule to enhance and/or dampen responses of the cells upon adoptive transfer and encounter with ligand.
  • the nucleic acid encoding the marker is operably linked to a polynucleotide encoding for a linker sequence, such as a cleavable linker sequence, e.g., a T2A.
  • a linker sequence such as a cleavable linker sequence, e.g., a T2A.
  • a marker, and optionally a linker sequence can be any as disclosed in PCT Pub. No. WO2014031687.
  • the marker can be a truncated EGFR (tEGFR) that is, optionally, linked to a linker sequence, such as a T2A cleavable linker sequence.
  • tEGFR truncated EGFR
  • An exemplary polypeptide for a truncated EGFR comprises the sequence of amino acids set forth in SEQ ID NO: 7 or 16 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
  • An exemplary T2A linker sequence comprises the sequence of amino acids set forth in SEQ ID NO: 6 or 17 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 6 or 17.
  • the marker is a molecule, e.g., cell surface protein, not naturally found on T cells or not naturally found on the surface of T cells, or a portion thereof.
  • CARs are referred to as first, second, and/or third generation CARs.
  • a first generation CAR is one that solely provides a CD3 -chain induced signal upon antigen binding; in some aspects, a second-generation CARs is one that provides such a signal and costimulatory signal, such as one including an intracellular signaling domain from a costimulatory receptor such as CD28 or CD137; in some aspects, a third generation CAR is one that includes multiple costimulatory domains of different costimulatory receptors.
  • the CAR contains an antibody, e.g., an antibody fragment, a transmembrane domain that is or contains a transmembrane portion of CD28 or a functional variant thereof, and an intracellular signaling domain containing a signaling portion of CD28 or functional variant thereof and a signaling portion of CD3 zeta or functional variant thereof.
  • the CAR contains an antibody, e.g., antibody fragment, a transmembrane domain that is or contains a transmembrane portion of CD28 or a functional variant thereof, and an intracellular signaling domain containing a signaling portion of a 4- IBB or functional variant thereof and a signaling portion of CD3 zeta or functional variant thereof.
  • the receptor further includes a spacer containing a portion of an Ig molecule, such as a human Ig molecule, such as an Ig hinge, e.g. an IgG4 hinge, such as a hinge- only spacer.
  • an Ig molecule such as a human Ig molecule
  • an Ig hinge e.g. an IgG4 hinge, such as a hinge- only spacer.
  • the transmembrane domain of the recombinant receptor e.g., the CAR
  • transmembrane domain that comprises the sequence of amino acids set forth in SEQ ID NO: 8 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 8; in some embodiments, the transmembrane-domain containing portion of the recombinant receptor comprises the sequence of amino acids set forth in SEQ ID NO: 9 or a sequence of amino acids having at least at or about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto.
  • the intracellular signaling component(s) of the recombinant receptor contains an intracellular costimulatory signaling domain of human CD28 or a functional variant or portion thereof, such as a domain with an LL to GG substitution at positions 186-187 of a native CD28 protein.
  • the intracellular signaling domain can comprise the sequence of amino acids set forth in SEQ ID NO: lO or ll or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 10 or 11.
  • the intracellular domain comprises an intracellular costimulatory signaling domain of 4-1BB (e.g. (Accession No. Q07011.1) or functional variant or portion thereof, such as the sequence of amino acids set forth in SEQ ID NO: 12 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 12.
  • 4-1BB e.g. (Accession No. Q07011.1
  • functional variant or portion thereof such as the sequence of amino acids set forth in SEQ ID NO: 12 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 12.
  • the intracellular signaling domain of the recombinant receptor comprises a human CD3 zeta stimulatory signaling domain or functional variant thereof, such as an 112 AA cytoplasmic domain of isoform 3 of human € ⁇ 3z (Accession No.: P20963.2) or a CD3 zeta signaling domain as described in U.S. Patent No.: 7,446,190 or U.S. Patent No. 8,911,993.
  • a human CD3 zeta stimulatory signaling domain or functional variant thereof such as an 112 AA cytoplasmic domain of isoform 3 of human € ⁇ 3z (Accession No.: P20963.2) or a CD3 zeta signaling domain as described in U.S. Patent No.: 7,446,190 or U.S. Patent No. 8,911,993.
  • the intracellular signaling domain comprises the sequence of amino acids as set forth in SEQ ID NO: 13, 14 or 15 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
  • the spacer contains only a hinge region of an IgG, such as only a hinge of IgG4 or IgGl, such as the hinge only spacer set forth in SEQ ID NO: 1.
  • the spacer is or contains an Ig hinge, e.g., an IgG4-derived hinge, optionally linked to a CH2 and/or CH3 domains.
  • the spacer is an Ig hinge, e.g., an IgG4 hinge, linked to CH2 and CH3 domains, such as set forth in SEQ ID NO: 4.
  • the spacer is an Ig hinge, e.g., an IgG4 hinge, linked to a CH3 domain only, such as set forth in SEQ ID NO: 3.
  • the spacer is or comprises a glycine- serine rich sequence or other flexible linker such as known flexible linkers.
  • the CAR includes an antibody such as an antibody fragment, including scFvs, a spacer, such as a spacer containing a portion of an immunoglobulin molecule, such as a hinge region and/or one or more constant regions of a heavy chain molecule, such as an Ig-hinge containing spacer, a transmembrane domain containing all or a portion of a CD28-derived transmembrane domain, a CD28-derived intracellular signaling domain, and a CD3 zeta signaling domain.
  • an antibody such as an antibody fragment, including scFvs
  • a spacer such as a spacer containing a portion of an immunoglobulin molecule, such as a hinge region and/or one or more constant regions of a heavy chain molecule, such as an Ig-hinge containing spacer, a transmembrane domain containing all or a portion of a CD28-derived transmembrane domain, a CD28-derived intracellular signaling domain
  • the CAR includes an antibody or fragment, such as scFv, a spacer such as any of the Ig-hinge containing spacers, a CD28-derived transmembrane domain, a 4-lBB-derived intracellular signaling domain, and a CD3 zeta-derived signaling domain.
  • the CAR is a CD19-directed CAR containing an scFv antigen -binding domain from FMC63; a immunoglobulin hinge spacer, a transmembrane domain, and an intracellular signaling domain containing a costimulatory signaling region that is a signaling domain of 4- IBB and a signaling domain of a CD3-zeta (O ⁇ 3z) chain.
  • the scFv contains the sequence set forth in SEQ ID NO::43.
  • the scFv ha a VL having CDRs having an amino acid sequences RASQDISKYLN (SEQ ID NO: 35), an amino acid sequence of SRLHSGV (SEQ ID NO: 36), and an amino acid sequence of GNTLPYTFG (SEQ ID NO: 37); and a VH with CDRs having an amino acid sequence of DYGVS (SEQ ID NO: 38), an amino acid sequence of VIWGS ETT Y YN S ALKS (SEQ ID NO: 39) and YAMDYWG (SEQ ID NO: 40)).
  • the transmembrane domain has the sequence set forth in SEQ ID NO:8.
  • the transmembrane domain has a sequence that has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:8.
  • the 4-1BB costimulatory signaling domain has the sequence set forth in SEQ ID NO: 12.
  • the 4- IBB costimulatory signaling domain has a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 12.
  • the CD3-zeta domain has the sequence set forth in SEQ ID NO: 13.
  • the CD3zeta signaling domain has a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto.
  • the CD19-directed CAR binds to CD 19 and mediates cytokine production and/or cytotoxic activity against CD 19+ target cells when expressed in a T cell and stimulated via the CAR, such as by binding to CD 19.
  • nucleic acid molecules encoding such CAR constructs further includes a sequence encoding a T2A ribosomal skip element and/or a tEGFR sequence, e.g., downstream of the sequence encoding the CAR.
  • the sequence encodes a T2A ribosomal skip element set forth in SEQ ID NO: 6 or 17, or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
  • T cells expressing an antigen receptor can also be generated to express a truncated EGFR (EGFRt) as a non-immunogenic selection epitope (e.g. by introduction of a construct encoding the CAR and EGFRt separated by a T2A ribosome switch to express two proteins from the same construct), which then can be used as a marker to detect such cells (see e.g. U.S. Patent No. 8,802,374).
  • the sequence encodes an tEGFR sequence set forth in SEQ ID NO: 7 or 16, or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 7 or 16.
  • a single promoter may direct expression of an RNA that contains, in a single open reading frame (ORF), two or three genes (e.g. encoding the molecule involved in modulating a metabolic pathway and encoding the recombinant receptor) separated from one another by sequences encoding a self-cleavage peptide (e.g., 2A sequences) or a protease recognition site (e.g., furin).
  • ORF thus encodes a single polypeptide, which, either during (in the case of 2 A) or after translation, is processed into the individual proteins.
  • the peptide such as T2A
  • T2A can cause the ribosome to skip (ribosome skipping) synthesis of a peptide bond at the C -terminus of a 2 A element, leading to separation between the end of the 2A sequence and the next peptide downstream (see, for example, de Felipe. Genetic Vaccines and Ther. 2:13 (2004) and de Felipe et al. Traffic 5:616-626 (2004)).
  • Many 2A elements are known.
  • 2A sequences that can be used in the methods and nucleic acids disclosed herein, without limitation, 2A sequences from the foot-and-mouth disease virus (F2A, e.g., SEQ ID NO: 21), equine rhinitis A virus (E2A, e.g., SEQ ID NO: 20), Thosea asigna virus (T2A, e.g., SEQ ID NO: 6 or 17), and porcine teschovirus-1 (P2A, e.g., SEQ ID NO: 18 or 19) as described in U.S. Patent Publication No. 20070116690.
  • F2A foot-and-mouth disease virus
  • E2A equine rhinitis A virus
  • T2A e.g., SEQ ID NO: 6 or 17
  • P2A porcine teschovirus-1
  • the recombinant receptors, such as CARs, expressed by the cells administered to the subject generally recognize or specifically bind to a molecule that is expressed in, associated with, and/or specific for the disease or condition or cells thereof being treated.
  • the receptor Upon specific binding to the molecule, e.g., antigen, the receptor generally delivers an immuno stimulatory signal, such as an ITAM-transduced signal, into the cell, thereby promoting an immune response targeted to the disease or condition.
  • the cells express a CAR that specifically binds to an antigen expressed by a cell or tissue of the disease or condition or associated with the disease or condition.
  • TCRs T Cell Receptors
  • engineered cells such as T cells, used in connection with the provided methods, uses, articles of manufacture or compositions are cells that express a T cell receptor (TCR) or antigen-binding portion thereof that recognizes an peptide epitope or T cell epitope of a target polypeptide, such as an antigen of a tumor, viral or autoimmune protein.
  • TCR T cell receptor
  • a “T cell receptor” or “TCR” is a molecule that contains a variable a and b chains (also known as TCRa and TCRp, respectively) or a variable g and d chains (also known as TCRa and TCRp, respectively), or antigen-binding portions thereof, and which is capable of specifically binding to a peptide bound to an MHC molecule.
  • the TCR is in the ab form.
  • TCRs that exist in ab and gd forms are generally structurally similar, but T cells expressing them may have distinct anatomical locations or functions.
  • a TCR can be found on the surface of a cell or in soluble form.
  • a TCR is found on the surface of T cells (or T lymphocytes) where it is generally responsible for recognizing antigens bound to major histocompatibility complex (MHC) molecules.
  • MHC major histocompatibility complex
  • the term “TCR” should be understood to encompass full TCRs as well as antigen-binding portions or antigen-binding fragments thereof.
  • the TCR is an intact or full-length TCR, including TCRs in the ab form or gd form.
  • the TCR is an antigen-binding portion that is less than a full- length TCR but that binds to a specific peptide bound in an MHC molecule, such as binds to an MHC-peptide complex.
  • an antigen-binding portion or fragment of a TCR can contain only a portion of the structural domains of a full-length or intact TCR, but yet is able to bind the peptide epitope, such as MHC-peptide complex, to which the full TCR binds.
  • an antigen-binding portion contains the variable domains of a TCR, such as variable a chain and variable b chain of a TCR, sufficient to form a binding site for binding to a specific MHC-peptide complex.
  • the variable chains of a TCR contain complementarity determining regions involved in recognition of the peptide, MHC and/or MHC-peptide complex.
  • variable domains of the TCR contain hypervariable loops, or complementarity determining regions (CDRs), which generally are the primary contributors to antigen recognition and binding capabilities and specificity.
  • CDRs complementarity determining regions
  • a CDR of a TCR or combination thereof forms all or substantially all of the antigen-binding site of a given TCR molecule.
  • the various CDRs within a variable region of a TCR chain generally are separated by framework regions (FRs), which generally display less variability among TCR molecules as compared to the CDRs (see, e.g., Jores et al., Proc. Nat’l Acad. Sci. U.S.A.
  • CDR3 is the main CDR responsible for antigen binding or specificity, or is the most important among the three CDRs on a given TCR variable region for antigen recognition, and/or for interaction with the processed peptide portion of the peptide-MHC complex.
  • the CDR1 of the alpha chain can interact with the N- terminal part of certain antigenic peptides.
  • CDR1 of the beta chain can interact with the C-terminal part of the peptide.
  • CDR2 contributes most strongly to or is the primary CDR responsible for the interaction with or recognition of the MHC portion of the MHC-peptide complex.
  • the variable region of the b-chain can contain a further hypervariable region (CDR4 or HVR4), which generally is involved in superantigen binding and not antigen recognition (Kotb (1995) Clinical Microbiology Reviews, 8:411-426).
  • a TCR also can contain a constant domain, a transmembrane domain and/or a short cytoplasmic tail (see, e.g., Janeway et al., Immunobiology: The Immune System in Health and Disease, 3rd Ed., Current Biology Publications, p. 4:33, 1997).
  • each chain of the TCR can possess one N-terminal immunoglobulin variable domain, one immunoglobulin constant domain, a transmembrane region, and a short cytoplasmic tail at the C-terminal end.
  • a TCR is associated with invariant proteins of the CD3 complex involved in mediating signal transduction.
  • a TCR chain contains one or more constant domain.
  • the extracellular portion of a given TCR chain e.g., a-chain or b-chain
  • a constant domain e.g., a-chain constant domain or Ca, typically positions 117 to 259 of the chain based on Rabat numbering or b chain constant domain or C , typically positions 117 to 295 of the chain based on Rabat
  • the extracellular portion of the TCR formed by the two chains contains two membrane-proximal constant domains, and two membrane-distal variable domains, which variable domains each contain CDRs.
  • the constant domain of the TCR may contain short connecting sequences in which a cysteine residue forms a disulfide bond, thereby linking the two chains of the TCR.
  • a TCR may have an additional cysteine residue in each of the a and b chains, such that the TCR contains two disulfide bonds in the constant domains.
  • the TCR chains contain a transmembrane domain.
  • the transmembrane domain is positively charged.
  • the TCR chain contains a cytoplasmic tail.
  • the structure allows the TCR to associate with other molecules like CD3 and subunits thereof.
  • a TCR containing constant domains with a transmembrane region may anchor the protein in the cell membrane and associate with invariant subunits of the CD3 signaling apparatus or complex.
  • the intracellular tails of CD3 signaling subunits e.g. CD3y, CD35, CD3e and CD3z chains
  • the TCR may be a heterodimer of two chains a and b (or optionally g and d) or it may be a single chain TCR construct. In some embodiments, the TCR is a heterodimer containing two separate chains (a and b chains or g and d chains) that are linked, such as by a disulfide bond or disulfide bonds.
  • the TCR can be generated from a known TCR sequence(s), such as sequences of na,b chains, for which a substantially full-length coding sequence is readily available. Methods for obtaining full-length TCR sequences, including V chain sequences, from cell sources are well known.
  • nucleic acids encoding the TCR can be obtained from a variety of sources, such as by polymerase chain reaction (PCR) amplification of TCR-encoding nucleic acids within or isolated from a given cell or cells, or synthesis of publicly available TCR DNA sequences.
  • PCR polymerase chain reaction
  • the TCR is obtained from a biological source, such as from cells such as from a T cell (e.g. cytotoxic T cell), T-cell hybridomas or other publicly available source.
  • the T-cells can be obtained from in vivo isolated cells.
  • the TCR is a thymically selected TCR.
  • the TCR is a neoepitope-restricted TCR.
  • the T- cells can be a cultured T-cell hybridoma or clone.
  • the TCR or antigen-binding portion thereof or antigen-binding fragment thereof can be synthetically generated from knowledge of the sequence of the TCR.
  • the TCR is generated from a TCR identified or selected from screening a library of candidate TCRs against a target polypeptide antigen, or target T cell epitope thereof.
  • TCR libraries can be generated by amplification of the repertoire of Va and nb from T cells isolated from a subject, including cells present in PBMCs, spleen or other lymphoid organ. In some cases, T cells can be amplified from tumor-infiltrating lymphocytes (TILs). In some embodiments, TCR libraries can be generated from CD4 + or CD8 + cells. In some embodiments, the TCRs can be amplified from a T cell source of a normal of healthy subject, i.e. normal TCR libraries.
  • the TCRs can be amplified from a T cell source of a diseased subject, i.e. diseased TCR libraries.
  • degenerate primers are used to amplify the gene repertoire of Va and nb, such as by RT-PCR in samples, such as T cells, obtained from humans.
  • scTv libraries can be assembled from naive Va and nb libraries in which the amplified products are cloned or assembled to be separated by a linker.
  • the libraries can be HLA allele- specific.
  • TCR libraries can be generated by mutagenesis or diversification of a parent or scaffold TCR molecule.
  • the TCRs are subjected to directed evolution, such as by mutagenesis, e.g., of the a or b chain. In some aspects, particular residues within CDRs of the TCR are altered. In some embodiments, selected TCRs can be modified by affinity maturation. In some embodiments, antigen- specific T cells may be selected, such as by screening to assess CTL activity against the peptide. In some aspects, TCRs, e.g. present on the antigen-specific T cells, may be selected, such as by binding activity, e.g., particular affinity or avidity for the antigen.
  • the TCR or antigen-binding portion thereof is one that has been modified or engineered.
  • directed evolution methods are used to generate TCRs with altered properties, such as with higher affinity for a specific MHC-peptide complex.
  • directed evolution is achieved by display methods including, but not limited to, yeast display (Holler et al. (2003) Nat Immunol, 4, 55-62; Holler et al. (2000) Proc Natl Acad Sci U S A, 97, 5387-92), phage display (Li et al. (2005) Nat Biotechnol, 23, 349-54), or T cell display (Chervin et al. (2008) J Immunol Methods, 339, 175-84).
  • display approaches involve engineering, or modifying, a known, parent or reference TCR.
  • a wild-type TCR can be used as a template for producing mutagenized TCRs in which in one or more residues of the CDRs are mutated, and mutants with an desired altered property, such as higher affinity for a desired target antigen, are selected.
  • peptides of a target polypeptide for use in producing or generating a TCR of interest are known or can be readily identified.
  • peptides suitable for use in generating TCRs or antigen-binding portions can be determined based on the presence of an HLA-restricted motif in a target polypeptide of interest, such as a target polypeptide described below.
  • peptides are identified using available computer prediction models.
  • such models include, but are not limited to, ProPredl (Singh and Raghava (2001) Bioinformatics 17(12): 1236- 1237, and SYFPEITHI (see Schuler et al. (2007) Immunoinformatics Methods in Molecular Biology, 409(1): 75-93 2007).
  • the MHC-restricted epitope is HLA-A0201, which is expressed in approximately 39-46% of all Caucasians and therefore, represents a suitable choice of MHC antigen for use preparing a TCR or other MHC-peptide binding molecule.
  • HLA-A0201 -binding motifs and the cleavage sites for proteasomes and immune- proteasomes using computer prediction models are known.
  • such models include, but are not limited to, ProPredl (described in more detail in Singh and Raghava, ProPred: prediction of HLA-DR binding sites. BIO INFORMATICS 17(12): 1236- 12372001), and SYFPEITHI (see Schuler et al.
  • the TCR or antigen binding portion thereof may be a recombinantly produced natural protein or mutated form thereof in which one or more property, such as binding characteristic, has been altered.
  • a TCR may be derived from one of various animal species, such as human, mouse, rat, or other mammal.
  • a TCR may be cell-bound or in soluble form.
  • the TCR is in cell-bound form expressed on the surface of a cell.
  • the TCR is a full-length TCR. In some embodiments, the TCR is an antigen-binding portion. In some embodiments, the TCR is a dimeric TCR (dTCR).
  • the TCR is a single-chain TCR (sc-TCR).
  • a dTCR or scTCR have the structures as described in WO 03/020763, WO 04/033685,
  • the TCR contains a sequence corresponding to the transmembrane sequence. In some embodiments, the TCR does contain a sequence corresponding to cytoplasmic sequences. In some embodiments, the TCR is capable of forming a TCR complex with CD3. In some embodiments, any of the TCRs, including a dTCR or scTCR, can be linked to signaling domains that yield an active TCR on the surface of a T cell.
  • the TCR is expressed on the surface of cells.
  • a dTCR contains a first polypeptide wherein a sequence corresponding to a TCR a chain variable region sequence is fused to the N terminus of a sequence corresponding to a TCR a chain constant region extracellular sequence, and a second polypeptide wherein a sequence corresponding to a TCR b chain variable region sequence is fused to the N terminus a sequence corresponding to a TCR b chain constant region extracellular sequence, the first and second polypeptides being linked by a disulfide bond.
  • the bond can correspond to the native inter-chain disulfide bond present in native dimeric ab TCRs. In some embodiments, the interchain disulfide bonds are not present in a native TCR.
  • one or more cysteines can be incorporated into the constant region extracellular sequences of dTCR polypeptide pair.
  • both a native and a non-native disulfide bond may be desirable.
  • the TCR contains a transmembrane sequence to anchor to the membrane.
  • a dTCR contains a TCR a chain containing a variable a domain, a constant a domain and a first dimerization motif attached to the C-terminus of the constant a domain, and a TCR b chain comprising a variable b domain, a constant b domain and a first dimerization motif attached to the C-terminus of the constant b domain, wherein the first and second dimerization motifs easily interact to form a covalent bond between an amino acid in the first dimerization motif and an amino acid in the second dimerization motif linking the TCR a chain and TCR b chain together.
  • the TCR is a scTCR.
  • a scTCR can be generated using methods known, See e.g., Soo Hoo, W. F. et al. PNAS (USA) 89, 4759 (1992); Wiilfing,
  • a scTCR contains an introduced non-native disulfide interchain bond to facilitate the association of the TCR chains (see e.g. International published PCT No. WO 03/020763).
  • a scTCR is a non-disulfide linked truncated TCR in which heterologous leucine zippers fused to the C-termini thereof facilitate chain association (see e.g. International published PCT No. W099/60120).
  • a scTCR contain a TCRa variable domain covalently linked to a TCRP variable domain via a peptide linker (see e.g., International published PCT No. W099/18129).
  • a scTCR contains a first segment constituted by an amino acid sequence corresponding to a TCR a chain variable region, a second segment constituted by an amino acid sequence corresponding to a TCR b chain variable region sequence fused to the N terminus of an amino acid sequence corresponding to a TCR b chain constant domain extracellular sequence, and a linker sequence linking the C terminus of the first segment to the N terminus of the second segment.
  • a scTCR contains a first segment constituted by an a chain variable region sequence fused to the N terminus of an a chain extracellular constant domain sequence, and a second segment constituted by a b chain variable region sequence fused to the N terminus of a sequence b chain extracellular constant and transmembrane sequence, and, optionally, a linker sequence linking the C terminus of the first segment to the N terminus of the second segment.
  • a scTCR contains a first segment constituted by a TCR b chain variable region sequence fused to the N terminus of a b chain extracellular constant domain sequence, and a second segment constituted by an a chain variable region sequence fused to the N terminus of a sequence a chain extracellular constant and transmembrane sequence, and, optionally, a linker sequence linking the C terminus of the first segment to the N terminus of the second segment.
  • the linker of a scTCRs that links the first and second TCR segments can be any linker capable of forming a single polypeptide strand, while retaining TCR binding specificity.
  • the linker sequence may, for example, have the formula -P-AA-P- wherein P is proline and AA represents an amino acid sequence wherein the amino acids are glycine and serine.
  • the first and second segments are paired so that the variable region sequences thereof are orientated for such binding.
  • the linker has a sufficient length to span the distance between the C terminus of the first segment and the N terminus of the second segment, or vice versa, but is not too long to block or reduces bonding of the scTCR to the target ligand.
  • the linker can contain from or from about 10 to 45 amino acids, such as 10 to 30 amino acids or 26 to 41 amino acids residues, for example 29, 30, 31 or 32 amino acids.
  • the linker has the formula -PGGG-(SGGGG)s-P- wherein P is proline, G is glycine and S is serine (SEQ ID NO:28).
  • the linker has the sequence GSADDAKKDAAKKDGKS (SEQ ID NO:29).
  • the scTCR contains a covalent disulfide bond linking a residue of the immunoglobulin region of the constant domain of the a chain to a residue of the immunoglobulin region of the constant domain of the b chain.
  • the interchain disulfide bond in a native TCR is not present.
  • one or more cysteines can be incorporated into the constant region extracellular sequences of the first and second segments of the scTCR polypeptide. In some cases, both a native and a non native disulfide bond may be desirable.
  • the native disulfide bonds are not present.
  • the one or more of the native cysteines forming a native interchain disulfide bonds are substituted to another residue, such as to a serine or alanine.
  • an introduced disulfide bond can be formed by mutating non-cysteine residues on the first and second segments to cysteine. Exemplary non-native disulfide bonds of a TCR are described in published International PCT No. W02006/000830.
  • the TCR or antigen-binding fragment thereof exhibits an affinity with an equilibrium binding constant for a target antigen of between or between about 10-5 and 10-12 M and all individual values and ranges therein.
  • the target antigen is an MHC-peptide complex or ligand.
  • nucleic acid or nucleic acids encoding a TCR can be amplified by PCR, cloning or other suitable means and cloned into a suitable expression vector or vectors.
  • the expression vector can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host. Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses.
  • the vector can a vector of the pUC series (Fermentas Life Sciences), the pBluescript series (Stratagene, LaJolla, Calif.), the pET series (Novagen,
  • bacteriophage vectors such as l ⁇ q, lOT 1 1 , lZhrII (Stratagene), EMBL4, and lNMI 149, also can be used.
  • plant expression vectors can be used and include pBIOl, pBI101.2, pBI101.3, pBI121 and pBIN19 (Clontech).
  • animal expression vectors include pEUK-Cl, pMAM and pMAMneo (Clontech).
  • a viral vector is used, such as a retroviral vector.
  • the recombinant expression vectors can be prepared using standard recombinant DNA techniques.
  • vectors can contain regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA- based.
  • the vector can contain a nonnative promoter operably linked to the nucleotide sequence encoding the TCR or antigen-binding portion (or other MHC-peptide binding molecule).
  • the promoter can be a non-viral promoter or a viral promoter, such as a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, and a promoter found in the long-terminal repeat of the murine stem cell virus.
  • CMV cytomegalovirus
  • SV40 SV40 promoter
  • RSV RSV promoter
  • promoter found in the long-terminal repeat of the murine stem cell virus a promoter found in the long-terminal repeat of the murine stem cell virus.
  • Other known promoters also are contemplated.
  • the a and b chains are PCR amplified from total cDNA isolated from a T cell clone expressing the TCR of interest and cloned into an expression vector.
  • the a and b chains are cloned into the same vector.
  • the a and b chains are cloned into different vectors.
  • the generated a and b chains are incorporated into a retroviral, e.g. lentiviral, vector.
  • CAARs Chimeric Auto- Antibody Receptors
  • CAAR chimeric autoantibody receptor
  • the CAAR is specific for an autoantibody.
  • a cell expressing the CAAR such as a T cell engineered to express a CAAR, can be used to specifically bind to and kill autoantibody expressing cells, but not normal antibody expressing cells.
  • CAAR- expressing cells can be used to treat an autoimmune disease associated with expression of self antigens, such as autoimmune diseases.
  • CAAR-expressing cells can target B cells that ultimately produce the autoantibodies and display the autoantibodies on their cell surfaces, mark these B cells as disease-specific targets for therapeutic intervention.
  • CAAR-expressing cells can be used to efficiently targeting and killing the pathogenic B cells in autoimmune diseases by targeting the disease-causing B cells using an antigen-specific chimeric autoantibody receptor.
  • the recombinant receptor is a CAAR, such as any described in U.S. Patent Application Pub. No. US 2017/0051035.
  • the CAAR comprises an autoantibody binding domain, a transmembrane domain, and an intracellular signaling region.
  • the intracellular signaling region comprises an intracellular signaling domain.
  • the intracellular signaling domain is or comprises a primary signaling domain, a signaling domain that is capable of inducing a primary activation signal in a T cell, a signaling domain of a T cell receptor (TCR) component, and/or a signaling domain comprising an immunoreceptor tyrosine -based activation motif (ITAM).
  • TCR T cell receptor
  • ITAM immunoreceptor tyrosine -based activation motif
  • the intracellular signaling region comprises a secondary or costimulatory signaling region (secondary intracellular signaling regions).
  • the autoantibody binding domain comprises an autoantigen or a fragment thereof.
  • the choice of autoantigen can depend upon the type of autoantibody being targeted.
  • the autoantigen may be chosen because it recognizes an autoantibody on a target cell, such as a B cell, associated with a particular disease state, e.g. an autoimmune disease, such as an autoantibody-mediated autoimmune disease.
  • the autoimmune disease includes pemphigus vulgaris (PV).
  • Exemplary autoantigens include desmoglein 1 (Dsgl) and Dsg3.
  • the cells used in connection with the provided methods, uses, articles of manufacture and compositions include cells employing multi-targeting strategies, such as expression of two or more genetically engineered receptors on the cell, each recognizing the same of a different antigen and typically each including a different intracellular signaling component.
  • multi-targeting strategies are described, for example, in International Patent Application, Publication No.: WO 2014055668 A1 (describing combinations of activating and costimulatory CARs, e.g., targeting two different antigens present individually on off-target, e.g., normal cells, but present together only on cells of the disease or condition to be treated) and Fedorov et al., Sci. Transl.
  • the cells include a receptor expressing a first genetically engineered antigen receptor (e.g., CAR or TCR) which is capable of inducing an activating or stimulatory signal to the cell, generally upon specific binding to the antigen recognized by the first receptor, e.g., the first antigen.
  • the cell further includes a second genetically engineered antigen receptor (e.g., CAR or TCR), e.g., a chimeric costimulatory receptor, which is capable of inducing a costimulatory signal to the immune cell, generally upon specific binding to a second antigen recognized by the second receptor.
  • the first antigen and second antigen are the same. In some embodiments, the first antigen and second antigen are different.
  • the first and/or second genetically engineered antigen receptor is capable of inducing an activating signal to the cell.
  • the receptor includes an intracellular signaling component containing IT AM or IT AM-like motifs.
  • the activation induced by the first receptor involves a signal transduction or change in protein expression in the cell resulting in initiation of an immune response, such as IT AM phosphorylation and/or initiation of GG AM-mediated signal transduction cascade, formation of an immunological synapse and/or clustering of molecules near the bound receptor (e.g. CD4 or CD8, etc.), activation of one or more transcription factors, such as NF-KB and/or AP-1, and/or induction of gene expression of factors such as cytokines, proliferation, and/or survival.
  • an immune response such as IT AM phosphorylation and/or initiation of GG AM-mediated signal transduction cascade
  • formation of an immunological synapse and/or clustering of molecules near the bound receptor e.g. CD4 or CD8, etc.
  • the first and/or second receptor includes intracellular signaling domains or regions of costimulatory receptors such as CD28, CD137 (4-1BB), 0X40, and/or ICOS.
  • the first and second receptor include an intracellular signaling domain of a costimulatory receptor that are different.
  • the first receptor contains a CD28 costimulatory signaling region and the second receptor contain a 4- 1BB co-stimulatory signaling region or vice versa.
  • the first and/or second receptor includes both an intracellular signaling domain containing IT AM or IT AM-like motifs and an intracellular signaling domain of a costimulatory receptor.
  • the first receptor contains an intracellular signaling domain containing IT AM or IT AM-like motifs and the second receptor contains an intracellular signaling domain of a costimulatory receptor.
  • the costimulatory signal in combination with the activating signal induced in the same cell is one that results in an immune response, such as a robust and sustained immune response, such as increased gene expression, secretion of cytokines and other factors, and T cell mediated effector functions such as cell killing.
  • neither ligation of the first receptor alone nor ligation of the second receptor alone induces a robust immune response.
  • the cell becomes tolerized or unresponsive to antigen, or inhibited, and/or is not induced to proliferate or secrete factors or carry out effector functions.
  • a desired response is achieved, such as full immune activation or stimulation, e.g., as indicated by secretion of one or more cytokine, proliferation, persistence, and/or carrying out an immune effector function such as cytotoxic killing of a target cell.
  • the two receptors induce, respectively, an activating and an inhibitory signal to the cell, such that binding by one of the receptor to its antigen activates the cell or induces a response, but binding by the second inhibitory receptor to its antigen induces a signal that suppresses or dampens that response.
  • activating CARs and inhibitory CARs or iCARs are combinations of activating CARs and inhibitory CARs or iCARs.
  • Such a strategy may be used, for example, in which the activating CAR binds an antigen expressed in a disease or condition but which is also expressed on normal cells, and the inhibitory receptor binds to a separate antigen which is expressed on the normal cells but not cells of the disease or condition.
  • the multi-targeting strategy is employed in a case where an antigen associated with a particular disease or condition is expressed on a non-diseased cell and/or is expressed on the engineered cell itself, either transiently (e.g., upon stimulation in association with genetic engineering) or permanently.
  • an antigen associated with a particular disease or condition is expressed on a non-diseased cell and/or is expressed on the engineered cell itself, either transiently (e.g., upon stimulation in association with genetic engineering) or permanently.
  • the plurality of antigens are expressed on the cell, tissue, or disease or condition being targeted, such as on the cancer cell.
  • the cell, tissue, disease or condition is multiple myeloma or a multiple myeloma cell.
  • one or more of the plurality of antigens generally also is expressed on a cell which it is not desired to target with the cell therapy, such as a normal or non-diseased cell or tissue, and/or the engineered cells themselves. In such embodiments, by requiring ligation of multiple receptors to achieve a response of the cell, specificity and/or efficacy is achieved.
  • the provided methods involve administering to a subject having a disease or condition cells expressing a recombinant antigen receptor.
  • a recombinant antigen receptor e.g., CARs or TCRs
  • exemplary methods include those for transfer of nucleic acids encoding the receptors, including via viral, e.g., retroviral or lentiviral, transduction, transposons, and electroporation.
  • the genetic engineering generally involves introduction of a nucleic acid encoding the recombinant or engineered component into a composition containing the cells, such as by retroviral transduction, transfection, or transformation.
  • the engineered cells are produced by a process that generates an output composition of enriched T cells from one or more input compositions and/or from a single biological sample.
  • the output composition contains cells that express a recombinant receptor, e.g., a CAR, such as an anti-CD19 CAR.
  • the cells of the output compositions are suitable for administration to a subject as a therapy, e.g., an autologous cell therapy.
  • the output composition is a composition of enriched CD4+ or CD8+ T cells.
  • the process for generating or producing engineered cells is by a process that includes some or all of the steps of: collecting or obtaining a biological sample; isolating, selecting, or enriching input cells from the biological sample; cryopreserving and storing the input cells; thawing and/or incubating the input cells under stimulating conditions; engineering the stimulated cells to express or contain a recombinant polynucleotide, e.g., a polynucleotide encoding a recombinant receptor such as a CAR; cultivating the engineered cells, e.g.
  • the process is performed with two or more input compositions of enriched T cells, such as a separate CD4+ composition and a separate CD8+ composition, that are separately processed and engineered from the same starting or initial biological sample and re-infused back into the subject at a defined ratio, e.g. 1:1 ratio of CD4+ to CD8+ T cells.
  • the enriched T cells are or include engineered T cells, e.g., T cells transduced to express a recombinant receptor.
  • an output composition of engineered cells expressing a recombinant receptor is produced from an initial and/or input composition of cells.
  • the input composition is a composition of enriched T cells, enriched CD4+ T cells, and/or enriched CD8+ T cells (herein after also referred to as compositions of enriched T cells, compositions of enriched CD4+ T cells, and compositions of enriched CD8+ T cells, respectively).
  • the dose of engineered T cells employed in the embodiments provided herein, for administration to a subject is enriched for CD4+ or CD8+ T cells.
  • the enrichment is compared to the amount or percentage of CD4+ or CD8+ cells that are present in the input composition and/or a single biological sample, such as a sample obtained from the subject.
  • a composition enriched in CD4+ T cells contains at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.9% CD4+ T cells.
  • the composition of enriched CD4+ T cells contains 100% CD4+ T cells, or contains about 100% CD4+ T cells.
  • the composition of enriched T cells includes or contains less than 20%, less than 10%, less than 5%, less than 1%, less than 0.1%, or less than 0.01% CD8+ T cells, and/or contains no CD8+ T cells, and/or is free or substantially free of CD8+ T cells.
  • the populations of cells consist essentially of CD4+ T cells.
  • a composition enriched in CD8+ T cells contains at least 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.9% CD8+ T cells, or contains or contains about 100% CD8+ T cells.
  • the composition of enriched CD8+ T cells includes or contains less than 20%, less than 10%, less than 5%, less than 1%, less than 0.1%, or less than 0.01% CD4+ T cells, and/or contains no CD4+ T cells, and/or is free or substantially free of CD4+ T cells.
  • the populations of cells consist essentially of CD8+ T cells.
  • the process for producing engineered cells further can include one or more of: activating and/or stimulating a cells, e.g., cells of an input composition; genetically engineering the activated and/or stimulated cells, e.g., to introduce a polynucleotide encoding a recombinant protein by transduction or transfection; and/or cultivating the engineered cells, e.g., under conditions that promote proliferation and/or expansion.
  • the provided methods may be used in connection with harvesting, collecting, and/or formulating output compositions produced after the cells have been incubated, activated, stimulated, engineered, transduced, transfected, and/or cultivated.
  • engineered cells such as those that express an anti-CD19 CAR as described, used in accord with the provided methods are produced or generated by a process for selecting, isolating, activating, stimulating, expanding, cultivating, and/or formulating cells. In some embodiments, such methods include any as described.
  • engineered cells such as those that express an anti-CD19 CAR as described, used in accord with the provided methods and uses are produced or generated by a process for selecting, isolating, activating, stimulating, expanding, cultivating, and/or formulating cells. In some embodiments, such methods include any as described.
  • engineered cells such as those that express an anti-CD19 CAR as described, used in accord with the provided methods and uses are produced or generated by exemplary processes as described in, for example, WO 2019/089855 and WO 2015/164675.
  • exemplary processes for generating, producing or manufacturing the engineered cells such as those that express an anti-CD19 CAR as described, or a composition comprising such cells, such as a composition comprising engineered CD4+ T cells and engineered CD 8+ T cells each expressing the same anti-CD 19 chimeric antigen receptor (CAR)
  • CD4+ and CD8+ cells are separately selected from human peripheral blood mononuclear cells (PBMCs), for example, that are obtained by leukapheresis, generating separate enriched CD4+ and enriched CD8+ cell compositions.
  • PBMCs peripheral blood mononuclear cells
  • such cells can be cryopreserved.
  • the CD4+ and CD8+ compositions can be subsequently thawed and separately subject to steps for stimulation, transduction, and expansion.
  • thawed CD4+ and CD8+ cells are separately stimulated, for example, in the presence of paramagnetic polystyrene-coated beads coupled to anti-CD3 and anti-CD28 antibodies (such as at a 1:1 bead to cell ratio).
  • the stimulation is carried out in media containing human recombinant IL-2, human recombinant IL-15, and N-Acetyl Cysteine (NAC).
  • the cell culture media for CD4+ cells also can include human recombinant IL-7.
  • CD4+ and CD8+ cells are separately transduced with a lentiviral vector encoding the same CAR, such as the same anti-CD 19 CAR.
  • the CAR can contain an anti-CD 19 scFv derived from a murine antibody, an immunoglobulin spacer, a transmembrane domain derived from CD28, a costimulatory region derived from 4-1BB, and a CD3-zeta intracellular signaling domain.
  • the vector can encode a truncated receptor that serves as a surrogate marker for CAR expression that is connected to the CAR construct by a T2A sequence.
  • the cells are transduced in the presence of 10 pg/ml protamine sulfate.
  • the beads are removed from the cell compositions by exposure to a magnetic field.
  • the CD4+ and CD8+ cell compositions are separately cultivated for expansion with continual mixing and oxygen transfer by a bioreactor (for example, a Xuri W25 Bioreactor).
  • poloxamer is added to the media.
  • both the CD4+ and the CD8+ cell compositions are cultivated in the presence of IL-2 and IL-15.
  • the CD4+ cell media also included IL-7.
  • the CD4+ and CD8+ cells are each cultivated, prior to harvest, to 4-fold expansion.
  • cells from each composition can be separately harvested, formulated, and cryopreserved.
  • the exemplary processes for generating, producing or manufacturing the engineered cells such as those that express an anti-CD 19 CAR as described, or a composition comprising such cells, such as a composition comprising engineered CD4+ T cells and engineered CD8+ T cells each expressing the same anti-CD19 chimeric antigen receptor (CAR), include those described in Table 11 below.
  • Table 11 Exemplary process for generating CD4+ and CD8+ CAR-T cells
  • a different exemplary process for generating, producing or manufacturing the engineered cells or a composition comprising such cells include a process that differs from the exemplary process above in that: NAC is not added to the media during stimulation; CD4+ cell media does not contain IL-2; cells are stimulated at a bead to cell ratio of 3:1; cells are transduced with a higher concentration of protamine sulfate; bead removal occurs at about day 7; and expansion is performed at a static setting, i.e., without continual mixing or perfusion (e.g., semi-continuous and/or stepwise perfusion), and without poloxamer.
  • NAC is not added to the media during stimulation
  • CD4+ cell media does not contain IL-2
  • cells are stimulated at a bead to cell ratio of 3:1
  • cells are transduced with a higher concentration of protamine sulfate
  • bead removal occurs at about day 7
  • expansion is performed at a static setting, i.e., without continual mixing or
  • At least one separate composition of enriched CD4+ T cells and at least one separate composition of enriched CD8+ T cells are isolated, selected, enriched, or obtained from a single biological sample, e.g., a sample of PBMCs or other white blood cells from the same donor such as a patient or healthy individual.
  • a separate composition of enriched CD4+ T cells and a separate composition of enriched CD8+ T cells originated, e.g., were initially isolated, selected, and/or enriched, from the same biological sample, such as a single biological sample obtained, collected, and/or taken from a single subject.
  • a biological sample is first subjected to selection of CD4+ T cells, where both the negative and positive fractions are retained, and the negative fraction is further subjected to selection of CD8+ T cells.
  • a biological sample is first subjected to selection of CD8+ T cells, where both the negative and positive fractions are retained, and the negative fraction is further subjected to selection of CD4+ T cells.
  • methods of selection are carried out as described in International PCT publication No. WO2015/164675. In some embodiments, methods of selection are carried out as described in International PCT publication No. WO 2019/089855.
  • a biological sample is first positively selected for CD8+ T cells to generate at least one composition of enriched CD8+ T cells, and the negative fraction is then positively selected for CD4+ T cells to generate at least one composition of enriched CD4+ T cells, such that the at least one composition of enriched CD8+ T cells and the at least one composition of enriched CD4+ T cells are separate compositions from the same biological sample, e.g., from the same donor patient or healthy individual.
  • two or more separate compositions of enriched T cells are separately frozen, e.g., cryoprotectedor cryopreserved in a cryopreservation media.
  • two or more separate compositions of enriched T cells are activated and/or stimulated by contacting with a stimulatory reagent (e.g., by incubation with anti-CD3/anti-CD28 conjugated magnetic beads for T cell activation).
  • a stimulatory reagent e.g., by incubation with anti-CD3/anti-CD28 conjugated magnetic beads for T cell activation.
  • each of the activated/stimulated cell composition is engineered, transduced, and/or transfected, e.g., using a viral vector encoding a recombinant protein (e.g.
  • the method comprises removing the stimulatory reagent, e.g., magnetic beads, from the cell composition.
  • a cell composition containing engineered CD4+ T cells and a cell composition containing engineered CD8+ T cells are separately cultivated, e.g., for separate expansion of the CD4+ T cell and CD8+ T cell populations therein.
  • a cell composition from the cultivation is harvested and/or collected and/or formulated, e.g., by washing the cell composition in a formulation buffer.
  • a formulated cell composition comprising CD4+ T cells and a formulated cell composition comprising CD8+ T cells is frozen, e.g., cryoprotected or cryopreserved in a cryopreservation media.
  • engineered CD4+ T cells and CD8+ T cells in each formulation originate from the same donor or biological sample and express the same recombination protein (e.g., CAR, such as anti-CD19 CAR).
  • a separate engineered CD4+ formulation and a separate engineered CD8+ formulation are administered at a defined ratio, e.g. 1:1, to a subject in need thereof such as the same donor.
  • cells such as T cells, used in connection with the provided methods, uses, articles of manufacture or compositions are cells have been genetically engineered to express a recombinant receptor, e.g., a CAR or a TCR described herein.
  • the engineered cells are used in the context of cell therapy, e.g., adoptive cell therapy.
  • the engineered cells are immune cells.
  • the engineered cells are T cells, such as CD4+ or CD8+ T cells.
  • the nucleic acids such as nucleic acids encoding a recombinant receptor
  • the nucleic acids are not naturally occurring, such as a nucleic acid not found in nature, including one comprising chimeric combinations of nucleic acids encoding various domains from multiple different cell types.
  • the cells generally are eukaryotic cells, such as mammalian cells, and typically are human cells.
  • the cells are derived from the blood, bone marrow, lymph, or lymphoid organs, are cells of the immune system, such as cells of the innate or adaptive immunity, e.g., myeloid or lymphoid cells, including lymphocytes, typically T cells and/or NK cells.
  • Other exemplary cells include stem cells, such as multipotent and pluripotent stem cells, including induced pluripotent stem cells (iPSCs).
  • the cells typically are primary cells, such as those isolated directly from a subject and/or isolated from a subject and frozen.
  • the cells include one or more subsets of T cells or other cell types, such as whole T cell populations, CD4 + cells, CD8 + cells, and subpopulations thereof, such as those defined by function, activation state, maturity, potential for differentiation, expansion, recirculation, localization, and/or persistence capacities, antigen-specificity, type of antigen receptor, presence in a particular organ or compartment, marker or cytokine secretion profile, and/or degree of differentiation.
  • the cells may be allogeneic and/or autologous.
  • the methods include off-the-shelf methods.
  • the cells are pluripotent and/or multipotent, such as stem cells, such as induced pluripotent stem cells (iPSCs).
  • the methods include isolating cells from the subject, preparing, processing, culturing, and/or engineering them, and re introducing them into the same subject, before or after cryopreservation.
  • T cells and/or of CD4 + and/or of CD8 + T cells are naive T (TN) cells, effector T cells (TEFF), memory T cells and sub-types thereof, such as stem cell memory T (TSCM), central memory T (TCM), effector memory T (TEM), or terminally differentiated effector memory T cells, tumor-infiltrating lymphocytes (TIL), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosa-associated invariant T (MAIT) cells, naturally occurring and adaptive regulatory T (Treg) cells, helper T cells, such as TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, follicular helper T cells, alpha/beta T cells, and delta/gamma T cells.
  • TN naive T
  • TSCM stem cell memory T
  • TCM central memory T
  • TEM effector memory T
  • TIL tumor-infiltrating lymphocyte
  • the cells are natural killer (NK) cells.
  • the cells are monocytes or granulocytes, e.g., myeloid cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, and/or basophils.
  • the cells include one or more nucleic acids introduced via genetic engineering, and thereby express recombinant or genetically engineered products of such nucleic acids.
  • the nucleic acids are heterologous, i.e., normally not present in a cell or sample obtained from the cell, such as one obtained from another organism or cell, which for example, is not ordinarily found in the cell being engineered and/or an organism from which such cell is derived.
  • the nucleic acids are not naturally occurring, such as a nucleic acid not found in nature, including one comprising chimeric combinations of nucleic acids encoding various domains from multiple different cell types.
  • preparation of the engineered cells includes one or more culture and/or preparation steps.
  • the cells for introduction of the nucleic acid encoding the transgenic receptor such as the CAR may be isolated from a sample, such as a biological sample, e.g., one obtained from or derived from a subject.
  • the subject from which the cell is isolated is one having the disease or condition or in need of a cell therapy or to which cell therapy will be administered.
  • the subject in some embodiments is a human in need of a particular therapeutic intervention, such as the adoptive cell therapy for which cells are being isolated, processed, and/or engineered.
  • the cells in some embodiments are primary cells, e.g., primary human cells.
  • the samples include tissue, fluid, and other samples taken directly from the subject, as well as samples resulting from one or more processing steps, such as separation, centrifugation, genetic engineering (e.g. transduction with viral vector), washing, and/or incubation.
  • the biological sample can be a sample obtained directly from a biological source or a sample that is processed.
  • Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples, including processed samples derived therefrom.
  • the sample from which the cells are derived or isolated is blood or a blood-derived sample, or is or is derived from an apheresis or leukapheresis product.
  • exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, gut associated lymphoid tissue, mucosa associated lymphoid tissue, spleen, other lymphoid tissues, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsil, or other organ, and/or cells derived therefrom.
  • Samples include, in the context of cell therapy, e.g., adoptive cell therapy, samples from autologous and allogeneic sources.
  • the cells are derived from cell lines, e.g., T cell lines.
  • the cells in some embodiments are obtained from a xenogeneic source, for example, from mouse, rat, non-human primate, and pig.
  • isolation of the cells includes one or more preparation and/or non-affinity based cell separation steps.
  • cells are washed, centrifuged, and/or incubated in the presence of one or more reagents, for example, to remove unwanted components, enrich for desired components, lyse or remove cells sensitive to particular reagents.
  • cells are separated based on one or more property, such as density, adherent properties, size, sensitivity and/or resistance to particular components.
  • cells from the circulating blood of a subject are obtained, e.g., by apheresis or leukapheresis.
  • the samples contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and/or platelets, and in some aspects contains cells other than red blood cells and platelets.
  • the blood cells collected from the subject are washed, e.g., to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps.
  • the cells are washed with phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • the wash solution lacks calcium and/or magnesium and/or many or all divalent cations.
  • a washing step is accomplished a semi-automated “flow-through” centrifuge (for example, the Cobe 2991 cell processor, Baxter) according to the manufacturer’s instructions.
  • a washing step is accomplished by tangential flow filtration (TFF) according to the manufacturer’s instructions.
  • the cells are resuspended in a variety of biocompatible buffers after washing, such as, for example, Ca ++ /Mg ++ free PBS.
  • components of a blood cell sample are removed and the cells directly resuspended in culture media.
  • the methods include density-based cell separation methods, such as the preparation of white blood cells from peripheral blood by lysing the red blood cells and centrifugation through a Percoll or Ficoll gradient.
  • the selection step includes incubation of cells with a selection reagent.
  • the incubation with a selection reagent or reagents e.g., as part of selection methods which may be performed using one or more selection reagents for selection of one or more different cell types based on the expression or presence in or on the cell of one or more specific molecules, such as surface markers, e.g., surface proteins, intracellular markers, or nucleic acid.
  • surface markers e.g., surface proteins, intracellular markers, or nucleic acid.
  • any known method using a selection reagent or reagents for separation based on such markers may be used.
  • the selection reagent or reagents result in a separation that is affinity- or immunoaffinity-based separation.
  • the selection in some aspects includes incubation with a reagent or reagents for separation of cells and cell populations based on the cells’ expression or expression level of one or more markers, typically cell surface markers, for example, by incubation with an antibody or binding partner that specifically binds to such markers, followed generally by washing steps and separation of cells having bound the antibody or binding partner, from those cells having not bound to the antibody or binding partner.
  • a reagent or reagents for separation of cells and cell populations based on the cells’ expression or expression level of one or more markers typically cell surface markers
  • an antibody or binding partner that specifically binds to such markers
  • a volume of cells is mixed with an amount of a desired affinity-based selection reagent.
  • the immunoaffinity-based selection can be carried out using any system or method that results in a favorable energetic interaction between the cells being separated and the molecule specifically binding to the marker on the cell, e.g., the antibody or other binding partner on the solid surface, e.g., particle.
  • methods are carried out using particles such as beads, e.g. magnetic beads, that are coated with a selection agent (e.g. antibody) specific to the marker of the cells.
  • the particles e.g.
  • beads can be incubated or mixed with cells in a container, such as a tube or bag, while shaking or mixing, with a constant cell density-to-particle (e.g., bead) ratio to aid in promoting energetically favored interactions.
  • the methods include selection of cells in which all or a portion of the selection is carried out in the internal cavity of a centrifugal chamber, for example, under centrifugal rotation.
  • incubation of cells with selection reagents, such as immunoaffinity-based selection reagents is performed in a centrifugal chamber.
  • the isolation or separation is carried out using a system, device, or apparatus described in International Patent Application, Publication Number W02009/072003, or US 20110003380 Al.
  • the system is a system as described in International Publication Number W02016/073602.
  • the user by conducting such selection steps or portions thereof (e.g., incubation with antibody-coated particles, e.g., magnetic beads) in the cavity of a centrifugal chamber, the user is able to control certain parameters, such as volume of various solutions, addition of solution during processing and timing thereof, which can provide advantages compared to other available methods.
  • certain parameters such as volume of various solutions, addition of solution during processing and timing thereof, which can provide advantages compared to other available methods.
  • the ability to decrease the liquid volume in the cavity during the incubation can increase the concentration of the particles (e.g. bead reagent) used in the selection, and thus the chemical potential of the solution, without affecting the total number of cells in the cavity. This in turn can enhance the pairwise interactions between the cells being processed and the particles used for selection.
  • carrying out the incubation step in the chamber permits the user to effect agitation of the solution at desired time(s) during the incubation, which also can improve the interaction.
  • At least a portion of the selection step is performed in a centrifugal chamber, which includes incubation of cells with a selection reagent.
  • a volume of cells is mixed with an amount of a desired affinity-based selection reagent that is far less than is normally employed when performing similar selections in a tube or container for selection of the same number of cells and/or volume of cells according to manufacturer’s instructions.
  • an amount of selection reagent or reagents that is/are no more than 5%, no more than 10%, no more than 15%, no more than 20%, no more than 25%, no more than 50%, no more than 60%, no more than 70% or no more than 80% of the amount of the same selection reagent(s) employed for selection of cells in a tube or container-based incubation for the same number of cells and/or the same volume of cells according to manufacturer’s instructions is employed.
  • the cells are incubated in the cavity of the chamber in a composition that also contains the selection buffer with a selection reagent, such as a molecule that specifically binds to a surface marker on a cell that it desired to enrich and/or deplete, but not on other cells in the composition, such as an antibody, which optionally is coupled to a scaffold such as a polymer or surface, e.g., bead, e.g., magnetic bead, such as magnetic beads coupled to monoclonal antibodies specific for CD4 and CD8.
  • a selection reagent such as a molecule that specifically binds to a surface marker on a cell that it desired to enrich and/or deplete, but not on other cells in the composition, such as an antibody, which optionally is coupled to a scaffold such as a polymer or surface, e.g., bead, e.g., magnetic bead, such as magnetic beads coupled to monoclonal antibodies specific for CD4 and CD8.
  • the selection reagent is added to cells in the cavity of the chamber in an amount that is substantially less than (e.g. is no more than 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% or 80% of the amount) as compared to the amount of the selection reagent that is typically used or would be necessary to achieve about the same or similar efficiency of selection of the same number of cells or the same volume of cells when selection is performed in a tube with shaking or rotation.
  • the incubation is performed with the addition of a selection buffer to the cells and selection reagent to achieve a target volume with incubation of the reagent of, for example, 10 mL to 200 mL, such as at least or about at least 10 mL, 20 mL, 30 mL, 40 mL, 50 mL, 60 mL, 70 mL, 80 mL, 90 mL, 100 mL, 150 mL or 200 mL.
  • the selection buffer and selection reagent are pre mixed before addition to the cells.
  • the selection buffer and selection reagent are separately added to the cells.
  • the selection incubation is carried out with periodic gentle mixing condition, which can aid in promoting energetically favored interactions and thereby permit the use of less overall selection reagent while achieving a high selection efficiency.
  • the total duration of the incubation with the selection reagent is from or from about 5 minutes to 6 hours, such as 30 minutes to 3 hours, for example, at least or about at least 30 minutes, 60 minutes, 120 minutes or 180 minutes.
  • the incubation generally is carried out under mixing conditions, such as in the presence of spinning, generally at relatively low force or speed, such as speed lower than that used to pellet the cells, such as from or from about 600 rpm to 1700 rpm (e.g. at or about or at least 600 rpm, 1000 rpm, or 1500 rpm or 1700 rpm), such as at an RCF at the sample or wall of the chamber or other container of from or from about 80g to lOOg (e.g. at or about or at least 80 g, 85 g, 90 g, 95 g, or 100 g).
  • the spin is carried out using repeated intervals of a spin at such low speed followed by a rest period, such as a spin and/or rest for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 seconds, such as a spin at approximately 1 or 2 seconds followed by a rest for approximately 5, 6, 7, or 8 seconds.
  • a rest period such as a spin and/or rest for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 seconds, such as a spin at approximately 1 or 2 seconds followed by a rest for approximately 5, 6, 7, or 8 seconds.
  • such process is carried out within the entirely closed system to which the chamber is integral.
  • this process (and in some aspects also one or more additional step, such as a previous wash step washing a sample containing the cells, such as an apheresis sample) is carried out in an automated fashion, such that the cells, reagent, and other components are drawn into and pushed out of the chamber at appropriate times and centrifugation effected, so as to complete the wash and binding step in a single closed system using an automated program.
  • the incubated cells are subjected to a separation to select for cells based on the presence or absence of the particular reagent or reagents.
  • the separation is performed in the same closed system in which the incubation of cells with the selection reagent was performed.
  • incubated cells, including cells in which the selection reagent has bound are transferred into a system for immunoaffinity-based separation of the cells.
  • the system for immunoaffinity-based separation is or contains a magnetic separation column.
  • the isolation methods include the separation of different cell types based on the expression or presence in the cell of one or more specific molecules, such as surface markers, e.g., surface proteins, intracellular markers, or nucleic acid. In some embodiments, any known method for separation based on such markers may be used. In some embodiments, the separation is affinity- or immunoaffinity-based separation.
  • the isolation in some aspects includes separation of cells and cell populations based on the cells’ expression or expression level of one or more markers, typically cell surface markers, for example, by incubation with an antibody or binding partner that specifically binds to such markers, followed generally by washing steps and separation of cells having bound the antibody or binding partner, from those cells having not bound to the antibody or binding partner.
  • Such separation steps can be based on positive selection, in which the cells having bound the reagents are retained for further use, and/or negative selection, in which the cells having not bound to the antibody or binding partner are retained. In some examples, both fractions are retained for further use. In some aspects, negative selection can be particularly useful where no antibody is available that specifically identifies a cell type in a heterogeneous population, such that separation is best carried out based on markers expressed by cells other than the desired population.
  • the separation need not result in 100% enrichment or removal of a particular cell population or cells expressing a particular marker.
  • positive selection of or enrichment for cells of a particular type refers to increasing the number or percentage of such cells, but need not result in a complete absence of cells not expressing the marker.
  • negative selection, removal, or depletion of cells of a particular type refers to decreasing the number or percentage of such cells, but need not result in a complete removal of all such cells.
  • multiple rounds of separation steps are carried out, where the positively or negatively selected fraction from one step is subjected to another separation step, such as a subsequent positive or negative selection.
  • a single separation step can deplete cells expressing multiple markers simultaneously, such as by incubating cells with a plurality of antibodies or binding partners, each specific for a marker targeted for negative selection.
  • multiple cell types can simultaneously be positively selected by incubating cells with a plurality of antibodies or binding partners expressed on the various cell types.
  • T cells such as cells positive or expressing high levels of one or more surface markers, e.g., CD28 + , CD62L + , CCR7 + , CD27 + , CD127 + , CD4 + , CD8 + , CD45RA + , and/or CD45RO + T cells, are isolated by positive or negative selection techniques.
  • surface markers e.g., CD28 + , CD62L + , CCR7 + , CD27 + , CD127 + , CD4 + , CD8 + , CD45RA + , and/or CD45RO + T cells.
  • CD3 + , CD28 + T cells can be positively selected using anti-CD3/anti- CD28 conjugated magnetic beads (e.g., DYNABEADS® M-450 CD3/CD28 T Cell Expander).
  • anti-CD3/anti- CD28 conjugated magnetic beads e.g., DYNABEADS® M-450 CD3/CD28 T Cell Expander.
  • isolation is carried out by enrichment for a particular cell population by positive selection, or depletion of a particular cell population, by negative selection.
  • positive or negative selection is accomplished by incubating cells with one or more antibodies or other binding agent that specifically bind to one or more surface markers expressed or expressed (marker + ) at a relatively higher level (marker 111811 ) on the positively or negatively selected cells, respectively.
  • a biological sample e.g., a sample of PBMCs or other white blood cells
  • CD4+ T cells are subjected to selection of CD4+ T cells, where both the negative and positive fractions are retained.
  • CD8+ T cells are selected from the negative fraction.
  • a biological sample is subjected to selection of CD8+ T cells, where both the negative and positive fractions are retained.
  • CD4+ T cells are selected from the negative fraction.
  • T cells are separated from a PBMC sample by negative selection of markers expressed on non-T cells, such as B cells, monocytes, or other white blood cells, such as CD 14.
  • a CD4 + or CD8 + selection step is used to separate CD4 + helper and CD8 + cytotoxic T cells.
  • Such CD4 + and CD8 + populations can be further sorted into sub-populations by positive or negative selection for markers expressed or expressed to a relatively higher degree on one or more naive, memory, and/or effector T cell subpopulations.
  • CD8 + cells are further enriched for or depleted of naive, central memory, effector memory, and/or central memory stem cells, such as by positive or negative selection based on surface antigens associated with the respective subpopulation.
  • enrichment for central memory T (TCM) cells is carried out to increase efficacy, such as to improve long-term survival, expansion, and/or engraftment following administration, which in some aspects is particularly robust in such sub-populations. See Terakura et al. (2012) Blood.1:72-82; Wang et al. (2012) J Immunother. 35(9):689-701.
  • combining Tc M -enriched CD8 + T cells and CD4 + T cells further enhances efficacy.
  • memory T cells are present in both CD62L + and CD62L subsets of CD8 + peripheral blood lymphocytes.
  • PBMCs can be enriched for or depleted of CD62L CD8 + and/or CD62L + CD8 + fractions, such as using anti-CD8 and anti-CD62L antibodies.
  • the enrichment for central memory T (TCM) cells is based on positive or high surface expression of CD45RO, CD62L, CCR7, CD28, CD3, and/or CD127; in some aspects, it is based on negative selection for cells expressing or highly expressing CD45RA and/or granzyme B.
  • isolation of a CD8 + population enriched for TCM cells is carried out by depletion of cells expressing CD4, CD 14, CD45RA, and positive selection or enrichment for cells expressing CD62L.
  • enrichment for central memory T (TCM) cells is carried out starting with a negative fraction of cells selected based on CD4 expression, which is subjected to a negative selection based on expression of CD 14 and CD45RA, and a positive selection based on CD62L.
  • Such selections in some aspects are carried out simultaneously and in other aspects are carried out sequentially, in either order.
  • the same CD4 expression-based selection step used in preparing the CD8 + cell population or subpopulation also is used to generate the CD4 + cell population or sub population, such that both the positive and negative fractions from the CD4-based separation are retained and used in subsequent steps of the methods, optionally following one or more further positive or negative selection steps.
  • a sample of PBMCs or other white blood cell sample is subjected to selection of CD4 + cells, where both the negative and positive fractions are retained.
  • the negative fraction then is subjected to negative selection based on expression of CD 14 and CD45RA or CD 19, and positive selection based on a marker characteristic of central memory T cells, such as CD62L or CCR7, where the positive and negative selections are carried out in either order.
  • CD4 + T helper cells are sorted into naive, central memory, and effector cells by identifying cell populations that have cell surface antigens.
  • CD4 + lymphocytes can be obtained by standard methods.
  • naive CD4 + T lymphocytes are CD45RO , CD45RA + , CD62L + , CD4 + T cells.
  • central memory CD4 + cells are CD62L + and CD45RO + .
  • effector CD4 + cells are CD62L and CD45RO .
  • a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CDllb, CD16, HLA-DR, and CD8.
  • the antibody or binding partner is bound to a solid support or matrix, such as a magnetic bead or paramagnetic bead, to allow for separation of cells for positive and/or negative selection.
  • the cells and cell populations are separated or isolated using immunomagnetic (or affinitymagnetic) separation techniques (reviewed in Methods in Molecular Medicine, vol. 58: Metastasis Research Protocols, Vol. 2: Cell Behavior In Vitro and In Vivo, p 17-25 Edited by: S. A. Brooks and U. Schumacher ⁇ Humana Press Inc., Totowa, NJ).
  • the sample or composition of cells to be separated is incubated with small, magnetizable or magnetically responsive material, such as magnetically responsive particles or microparticles, such as paramagnetic beads (e.g., such as Dynalbeads or MACS beads).
  • the magnetically responsive material, e.g., particle generally is directly or indirectly attached to a binding partner, e.g., an antibody, that specifically binds to a molecule, e.g., surface marker, present on the cell, cells, or population of cells that it is desired to separate, e.g., that it is desired to negatively or positively select.
  • a binding partner e.g., an antibody
  • the magnetic particle or bead comprises a magnetically responsive material bound to a specific binding member, such as an antibody or other binding partner.
  • a specific binding member such as an antibody or other binding partner.
  • Suitable magnetic particles include those described in Molday, U.S. Pat. No. 4,452,773, and in European Patent Specification EP 452342 B, which are hereby incorporated by reference.
  • Colloidal sized particles such as those described in Owen U.S. Pat. No. 4,795,698, and Liberti et ah, U.S. Pat. No. 5,200,084 are other examples.
  • the incubation generally is carried out under conditions whereby the antibodies or binding partners, or molecules, such as secondary antibodies or other reagents, which specifically bind to such antibodies or binding partners, which are attached to the magnetic particle or bead, specifically bind to cell surface molecules if present on cells within the sample.
  • the antibodies or binding partners, or molecules such as secondary antibodies or other reagents, which specifically bind to such antibodies or binding partners, which are attached to the magnetic particle or bead, specifically bind to cell surface molecules if present on cells within the sample.
  • the sample is placed in a magnetic field, and those cells having magnetically responsive or magnetizable particles attached thereto will be attracted to the magnet and separated from the unlabeled cells.
  • those cells having magnetically responsive or magnetizable particles attached thereto will be attracted to the magnet and separated from the unlabeled cells.
  • positive selection cells that are attracted to the magnet are retained; for negative selection, cells that are not attracted (unlabeled cells) are retained.
  • a combination of positive and negative selection is performed during the same selection step, where the positive and negative fractions are retained and further processed or subject to further separation steps.
  • the magnetically responsive particles are coated in primary antibodies or other binding partners, secondary antibodies, lectins, enzymes, or streptavidin.
  • the magnetic particles are attached to cells via a coating of primary antibodies specific for one or more markers.
  • the cells, rather than the beads are labeled with a primary antibody or binding partner, and then cell-type specific secondary antibody- or other binding partner (e.g., streptavidin)-coated magnetic particles, are added.
  • streptavidin-coated magnetic particles are used in conjunction with biotinylated primary or secondary antibodies.
  • the magnetically responsive particles are left attached to the cells that are to be subsequently incubated, cultured and/or engineered; in some aspects, the particles are left attached to the cells for administration to a patient.
  • the magnetizable or magnetically responsive particles are removed from the cells. Methods for removing magnetizable particles from cells are known and include, e.g., the use of competing non-labeled antibodies, and magnetizable particles or antibodies conjugated to cleavable linkers. In some embodiments, the magnetizable particles are biodegradable.
  • the affinity-based selection is via magnetic-activated cell sorting (MACS) (Miltenyi Biotec, Auburn, CA). Magnetic Activated Cell Sorting (MACS) systems are capable of high-purity selection of cells having magnetized particles attached thereto.
  • MACS operates in a mode wherein the non-target and target species are sequentially eluted after the application of the external magnetic field. That is, the cells attached to magnetized particles are held in place while the unattached species are eluted. Then, after this first elution step is completed, the species that were trapped in the magnetic field and were prevented from being eluted are freed in some manner such that they can be eluted and recovered.
  • the non-target cells are labelled and depleted from the heterogeneous population of cells.
  • the isolation or separation is carried out using a system, device, or apparatus that carries out one or more of the isolation, cell preparation, separation, processing, incubation, culture, and/or formulation steps of the methods.
  • the system is used to carry out each of these steps in a closed or sterile environment, for example, to minimize error, user handling and/or contamination.
  • the system is a system as described in International Patent Application, Publication Number W02009/072003, or US 20110003380 Al.
  • the system or apparatus carries out one or more, e.g., all, of the isolation, processing, engineering, and formulation steps in an integrated or self-contained system, and/or in an automated or programmable fashion.
  • the system or apparatus includes a computer and/or computer program in communication with the system or apparatus, which allows a user to program, control, assess the outcome of, and/or adjust various aspects of the processing, isolation, engineering, and formulation steps.
  • the separation and/or other steps is carried out using CliniMACS system (Miltenyi Biotec), for example, for automated separation of cells on a clinical-scale level in a closed and sterile system.
  • Components can include an integrated microcomputer, magnetic separation unit, peristaltic pump, and various pinch valves.
  • the integrated computer in some aspects controls all components of the instrument and directs the system to perform repeated procedures in a standardized sequence.
  • the magnetic separation unit in some aspects includes a movable permanent magnet and a holder for the selection column.
  • the peristaltic pump controls the flow rate throughout the tubing set and, together with the pinch valves, ensures the controlled flow of buffer through the system and continual suspension of cells.
  • the CliniMACS system in some aspects uses antibody-coupled magnetizable particles that are supplied in a sterile, non-pyrogenic solution.
  • the cells after labelling of cells with magnetic particles the cells are washed to remove excess particles.
  • a cell preparation bag is then connected to the tubing set, which in turn is connected to a bag containing buffer and a cell collection bag.
  • the tubing set consists of pre-assembled sterile tubing, including a pre-column and a separation column, and are for single use only. After initiation of the separation program, the system automatically applies the cell sample onto the separation column. Labelled cells are retained within the column, while unlabeled cells are removed by a series of washing steps.
  • the cell populations for use with the methods described herein are unlabeled and are not retained in the column. In some embodiments, the cell populations for use with the methods described herein are labeled and are retained in the column. In some embodiments, the cell populations for use with the methods described herein are eluted from the column after removal of the magnetic field, and are collected within the cell collection bag.
  • separation and/or other steps are carried out using the CliniMACS Prodigy system (Miltenyi Biotec).
  • the CliniMACS Prodigy system in some aspects is equipped with a cell processing unity that permits automated washing and fractionation of cells by centrifugation.
  • the CliniMACS Prodigy system can also include an onboard camera and image recognition software that determines the optimal cell fractionation endpoint by discerning the macroscopic layers of the source cell product. For example, peripheral blood is automatically separated into erythrocytes, white blood cells and plasma layers.
  • the CliniMACS Prodigy system can also include an integrated cell cultivation chamber which accomplishes cell culture protocols such as, e.g., cell differentiation and expansion, antigen loading, and long-term cell culture.
  • Input ports can allow for the sterile removal and replenishment of media and cells can be monitored using an integrated microscope. See, e.g., Klebanoff et al. (2012) J Immunother. 35(9): 651-660, Terakura et al. (2012) Blood.1:72-82, and Wang et al. (2012) J Immunother. 35(9):689-701.
  • a cell population described herein is collected and enriched (or depleted) via flow cytometry, in which cells stained for multiple cell surface markers are carried in a fluidic stream.
  • a cell population described herein is collected and enriched (or depleted) via preparative scale (FACS)-sorting.
  • FACS preparative scale
  • a cell population described herein is collected and enriched (or depleted) by use of microelectromechanical systems (MEMS) chips in combination with a FACS-based detection system (see, e.g., WO 2010/033140, Cho et al. (2010) Lab Chip 10, 1567-1573; and Godin et al. (2008) J Biophoton. 1(5):355— 376. In both cases, cells can be labeled with multiple markers, allowing for the isolation of well-defined T cell subsets at high purity.
  • MEMS microelectromechanical systems
  • the antibodies or binding partners are labeled with one or more detectable marker, to facilitate separation for positive and/or negative selection.
  • separation may be based on binding to fluorescently labeled antibodies.
  • separation of cells based on binding of antibodies or other binding partners specific for one or more cell surface markers are carried in a fluidic stream, such as by fluorescence- activated cell sorting (FACS), including preparative scale (FACS) and/or microelectromechanical systems (MEMS) chips, e.g., in combination with a flow-cytometric detection system.
  • FACS fluorescence- activated cell sorting
  • MEMS microelectromechanical systems
  • the preparation methods include steps for freezing, e.g., cryopreserving, the cells, either before or after isolation, incubation, and/or engineering.
  • the freeze and subsequent thaw step removes granulocytes and, to some extent, monocytes in the cell population.
  • the cells are suspended in a freezing solution, e.g., following a washing step to remove plasma and platelets. Any of a variety of known freezing solutions and parameters in some aspects may be used.
  • a freezing solution e.g., following a washing step to remove plasma and platelets.
  • Any of a variety of known freezing solutions and parameters in some aspects may be used.
  • PBS containing 20% DMSO and 8% human serum albumin (HSA), or other suitable cell freezing media. This is then diluted 1 : 1 with media so that the final concentration of DMSO and HSA are 10% and 4%, respectively.
  • HSA human serum albumin
  • the isolation and/or selection results in one or more input compositions of enriched T cells, e.g., CD3+ T cells, CD4+ T cells, and/or CD8+ T cells.
  • two or more separate input composition are isolated, selected, enriched, or obtained from a single biological sample.
  • separate input compositions are isolated, selected, enriched, and/or obtained from separate biological samples collected, taken, and/or obtained from the same subject.
  • the one or more input compositions is or includes a composition of enriched T cells that includes at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or at or at about 100% CD3+ T cells.
  • the input composition of enriched T cells consists essentially of CD3+ T cells.
  • the one or more input compositions is or includes a composition of enriched CD4+ T cells that includes at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or at or at about 100% CD4+ T cells.
  • the input composition of CD4+ T cells includes less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1%, less than 0.1%, or less than 0.01% CD8+ T cells, and/or contains no CD8+ T cells, and/or is free or substantially free of CD8+ T cells.
  • the composition of enriched T cells consists essentially of CD4+ T cells.
  • the one or more compositions is or includes a composition of CD8+ T cells that is or includes at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or at or at about 100% CD8+ T cells.
  • the composition of CD8+ T cells contains less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1%, less than 0.1%, or less than 0.01% CD4+ T cells, and/or contains no CD4+ T cells, and/or is free of or substantially free of CD4+ T cells.
  • the composition of enriched T cells consists essentially of CD8+ T cells.
  • the cells are incubated and/or cultured prior to or in connection with genetic engineering.
  • the incubation steps can include culture, cultivation, stimulation, activation, and/or propagation.
  • the incubation and/or engineering may be carried out in a culture vessel, such as a unit, chamber, well, column, tube, tubing set, valve, vial, culture dish, bag, or other container for culture or cultivating cells.
  • the compositions or cells are incubated in the presence of stimulating conditions or a stimulatory agent. Such conditions include those designed to induce proliferation, expansion, activation, and/or survival of cells in the population, to mimic antigen exposure, and/or to prime the cells for genetic engineering, such as for the introduction of a recombinant antigen receptor.
  • the conditions can include one or more of particular media, temperature, oxygen content, carbon dioxide content, time, agents, e.g., nutrients, amino acids, antibiotics, ions, and/or stimulatory factors, such as cytokines, chemokines, antigens, binding partners, fusion proteins, recombinant soluble receptors, and any other agents designed to activate the cells.
  • agents e.g., nutrients, amino acids, antibiotics, ions, and/or stimulatory factors, such as cytokines, chemokines, antigens, binding partners, fusion proteins, recombinant soluble receptors, and any other agents designed to activate the cells.
  • the stimulating conditions or agents include one or more agent, e.g., ligand, which is capable of stimulating or activating an intracellular signaling domain of a TCR complex.
  • the agent turns on or initiates TCR/CD3 intracellular signaling cascade in a T cell.
  • agents can include antibodies, such as those specific for a TCR, e.g. anti-CD3.
  • the stimulating conditions include one or more agent, e.g. ligand, which is capable of stimulating a costimulatory receptor, e.g., anti- CD28.
  • agents and/or ligands may be, bound to solid support such as a bead, and/or one or more cytokines.
  • the expansion method may further comprise the step of adding anti-CD3 and/or anti CD28 antibody to the culture medium (e.g., at a concentration of at least about 0.5 ng/mL).
  • the stimulating agents include IL-2, IL-15 and/or IL-7.
  • the IL-2 concentration is at least about 10 units/mL.
  • incubation is carried out in accordance with techniques such as those described in US Patent No. 6,040,177 to Riddell et ah, Klebanoff et al.(2012) J Immunother. 35(9): 651-660, Terakura et al. (2012) Blood.1:72-82, and/or Wang et al. (2012) J Immunother. 35(9):689-701.
  • the T cells are expanded by adding to a culture-initiating composition feeder cells, such as non-dividing peripheral blood mononuclear cells (PBMC), (e.g., such that the resulting population of cells contains at least about 5, 10, 20, or 40 or more PBMC feeder cells for each T lymphocyte in the initial population to be expanded); and incubating the culture (e.g. for a time sufficient to expand the numbers of T cells).
  • PBMC peripheral blood mononuclear cells
  • the non-dividing feeder cells can comprise gamma-irradiated PBMC feeder cells.
  • the PBMC are irradiated with gamma rays in the range of about 3000 to 3600 rads to prevent cell division.
  • the feeder cells are added to culture medium prior to the addition of the populations of T cells.
  • the stimulating conditions include temperature suitable for the growth of human T lymphocytes, for example, at least about 25 degrees Celsius, generally at least about 30 degrees Celsius, and generally at or about 37 degrees Celsius.
  • the incubation may further comprise adding non-dividing EBV-transformed lymphoblastoid cells (LCL) as feeder cells.
  • LCL can be irradiated with gamma rays in the range of about 6000 to 10,000 rads.
  • the LCL feeder cells in some aspects is provided in any suitable amount, such as a ratio of LCL feeder cells to initial T lymphocytes of at least about 10:1.
  • antigen-specific T cells such as antigen-specific CD4 + and/or CD8 + T cells
  • antigen-specific T cell lines or clones can be generated to cytomegalovirus antigens by isolating T cells from infected subjects and stimulating the cells in vitro with the same antigen.
  • At least a portion of the incubation in the presence of one or more stimulating conditions or a stimulatory agents is carried out in the internal cavity of a centrifugal chamber, for example, under centrifugal rotation, such as described in International Publication Number W02016/073602.
  • at least a portion of the incubation performed in a centrifugal chamber includes mixing with a reagent or reagents to induce stimulation and/or activation.
  • cells, such as selected cells are mixed with a stimulating condition or stimulatory agent in the centrifugal chamber.
  • a volume of cells is mixed with an amount of one or more stimulating conditions or agents that is far less than is normally employed when performing similar stimulations in a cell culture plate or other system.
  • the stimulating agent is added to cells in the cavity of the chamber in an amount that is substantially less than (e.g. is no more than 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% or 80% of the amount) as compared to the amount of the stimulating agent that is typically used or would be necessary to achieve about the same or similar efficiency of selection of the same number of cells or the same volume of cells when selection is performed without mixing in a centrifugal chamber, e.g. in a tube or bag with periodic shaking or rotation.
  • the incubation is performed with the addition of an incubation buffer to the cells and stimulating agent to achieve a target volume with incubation of the reagent of, for example, 10 mL to 200 mL, such as at least or about at least or about or 10 mL, 20 mL, 30 mL, 40 mL, 50 mL, 60 mL, 70 mL, 80 mL, 90 mL, 100 mL, 150 mL or 200 mL.
  • the incubation buffer and stimulating agent are pre-mixed before addition to the cells.
  • the incubation buffer and stimulating agent are separately added to the cells.
  • the stimulating incubation is carried out with periodic gentle mixing condition, which can aid in promoting energetically favored interactions and thereby permit the use of less overall stimulating agent while achieving stimulating and activation of cells.
  • the incubation generally is carried out under mixing conditions, such as in the presence of spinning, generally at relatively low force or speed, such as speed lower than that used to pellet the cells, such as from or from about 600 rpm to 1700 rpm (e.g. at or about or at least 600 rpm, 1000 rpm, or 1500 rpm or 1700 rpm), such as at an RCF at the sample or wall of the chamber or other container of from or from about 80g to lOOg (e.g. at or about or at least 80 g, 85 g, 90 g, 95 g, or 100 g).
  • the spin is carried out using repeated intervals of a spin at such low speed followed by a rest period, such as a spin and/or rest for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 seconds, such as a spin at approximately 1 or 2 seconds followed by a rest for approximately 5, 6, 7, or 8 seconds.
  • a rest period such as a spin and/or rest for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 seconds, such as a spin at approximately 1 or 2 seconds followed by a rest for approximately 5, 6, 7, or 8 seconds.
  • the total duration of the incubation is between or between about 1 hour and 96 hours, 1 hour and 72 hours, 1 hour and 48 hours, 4 hours and 36 hours, 8 hours and 30 hours or 12 hours and 24 hours, such as at least or about at least 6 hours, 12 hours, 18 hours, 24 hours, 36 hours or 72 hours.
  • the further incubation is for a time between or about between 1 hour and 48 hours, 4 hours and 36 hours, 8 hours and 30 hours or 12 hours and 24 hours, inclusive.
  • the stimulating conditions include incubating, culturing, and/or cultivating a composition of enriched T cells with and/or in the presence of one or more cytokines.
  • the one or more cytokines are recombinant cytokines.
  • the one or more cytokines are human recombinant cytokines.
  • the one or more cytokines bind to and/or are capable of binding to receptors that are expressed by and/or are endogenous to T cells.
  • the one or more cytokines is or includes a member of the 4-alpha-helix bundle family of cytokines.
  • members of the 4-alpha-helix bundle family of cytokines include, but are not limited to, interleukin-2 (IL-2), interleukin-4 (IL-4), interleukin-7 (IL-7), interleukin-9 (IL-9), interleukin 12 (IL-12), interleukin 15 (IL-15), granulocyte colony- stimulating factor (G-CSF), and granulocyte-macrophage colony-stimulating factor (GM-CSF).
  • IL-2 interleukin-2
  • IL-4 interleukin-4
  • IL-7 interleukin-9
  • IL-12 interleukin 12
  • IL-15 interleukin 15
  • G-CSF granulocyte colony- stimulating factor
  • GM-CSF granulocyte-macrophage colony-stimulating factor
  • the stimulation results in activation and/or proliferation of the cells, for example, prior to transduction.
  • engineered cells such as T cells, used in connection with the provided methods, uses, articles of manufacture or compositions are cells have been genetically engineered to express a recombinant receptor, e.g., a CAR or a TCR described herein.
  • the cells are engineered by introduction, delivery or transfer of nucleic acid sequences that encode the recombinant receptor and/or other molecules.
  • methods for producing engineered cells includes the introduction of a polynucleotide encoding a recombinant receptor (e.g. anti-CD 19 CAR) into a cell, e.g., such as a stimulated or activated cell.
  • a recombinant receptor e.g. anti-CD 19 CAR
  • the recombinant proteins are recombinant receptors, such as any described.
  • Introduction of the nucleic acid molecules encoding the recombinant protein, such as recombinant receptor, in the cell may be carried out using any of a number of known vectors.
  • Such vectors include viral and non-viral systems, including lentiviral and gammaretroviral systems, as well as transposon-based systems such as PiggyBac or Sleeping Beauty-based gene transfer systems.
  • Exemplary methods include those for transfer of nucleic acids encoding the receptors, including via viral, e.g., retroviral or lentiviral, transduction, transposons, and electroporation.
  • the engineering produces one or more engineered compositions of enriched T cells.
  • the one or more compositions of stimulated T cells are or include two separate stimulated compositions of enriched T cells.
  • two separate compositions of enriched T cells e.g., two separate compositions of enriched T cells that have been selected, isolated, and/or enriched from the same biological sample, are separately engineered.
  • the two separate compositions include a composition of enriched CD4+ T cells.
  • the two separate compositions include a composition of enriched CD8+ T cells.
  • two separate compositions of enriched CD4+ T cells and enriched CD8+ T cells are genetically engineered separately.
  • gene transfer is accomplished by first stimulating the cell, such as by combining it with a stimulus that induces a response such as proliferation, survival, and/or activation, e.g., as measured by expression of a cytokine or activation marker, followed by transduction of the activated cells, and expansion in culture to numbers sufficient for clinical applications.
  • the gene transfer is accomplished by first incubating the cells under stimulating conditions, such as by any of the methods described.
  • methods for genetic engineering are carried out by contacting one or more cells of a composition with a nucleic acid molecule encoding the recombinant protein, e.g. recombinant receptor.
  • the contacting can be effected with centrifugation, such as spinoculation (e.g. centrifugal inoculation).
  • centrifugation such as spinoculation (e.g. centrifugal inoculation).
  • spinoculation e.g. centrifugal inoculation
  • Exemplary centrifugal chambers include those produced and sold by Biosafe SA, including those for use with the Sepax® and Sepax® 2 system, including an A-200/F and A-200 centrifugal chambers and various kits for use with such systems.
  • Exemplary chambers, systems, and processing instrumentation and cabinets are described, for example, in US Patent No. 6,123,655, US Patent No. 6,733,433 and Published U.S. Patent Application, Publication No.: US 2008/0171951, and published international patent application, publication no.
  • kits for use with such systems include, but are not limited to, single-use kits sold by BioSafe SA under product names CS-430.1, CS-490.1, CS-600.1 or CS-900.2.
  • the contacting can be effected with centrifugation, such as spinoculation (e.g., centrifugal inoculation).
  • the composition containing cells, viral particles and reagent can be rotated, generally at relatively low force or speed, such as speed lower than that used to pellet the cells, such as from or from about 600 rpm to 1700 rpm (e.g., at or about or at least 600 rpm, 1000 rpm, or 1500 rpm or 1700 rpm).
  • the rotation is carried at a force, e.g., a relative centrifugal force, of from or from about 100 g to 3200 g (e.g., at or about or at least at or about 100 g, 200 g, 300 g, 400 g, 500 g, 1000 g, 1500 g, 2000 g, 2500 g, 3000 g or 3200 g), as measured for example at an internal or external wall of the chamber or cavity.
  • a force e.g., a relative centrifugal force, of from or from about 100 g to 3200 g (e.g., at or about or at least at or about 100 g, 200 g, 300 g, 400 g, 500 g, 1000 g, 1500 g, 2000 g, 2500 g, 3000 g or 3200 g), as measured for example at an internal or external wall of the chamber or cavity.
  • RCF relative centrifugal force
  • an object or substance such as a cell, sample, or pellet and/or a point in the chamber or other container being rotated
  • the value may be determined using well-known formulas, taking into account the gravitational force, rotation speed and the radius of rotation (distance from the axis of rotation and the object, substance, or particle at which RCF is being measured).
  • the introducing is carried out by contacting one or more cells of a composition with a nucleic acid molecule encoding the recombinant protein, e.g. recombinant receptor.
  • the contacting can be effected with centrifugation, such as spinoculation (e.g. centrifugal inoculation).
  • centrifugation such as spinoculation (e.g. centrifugal inoculation).
  • centrifugation such as spinoculation (e.g. centrifugal inoculation).
  • Such methods include any of those as described in International Publication Number W02016/073602.
  • Exemplary centrifugal chambers include those produced and sold by Biosafe SA, including those for use with the Sepax® and Sepax® 2 system, including an A-200/F and A-200 centrifugal chambers and various kits for use with such systems.
  • Exemplary chambers, systems, and processing instrumentation and cabinets are described, for example, in US Patent No. 6,123,655, US Patent No. 6,733,433 and Published U.S. Patent Application, Publication No.: US 2008/0171951, and published international patent application, publication no. WO 00/38762, the contents of each of which are incorporated herein by reference in their entirety.
  • Exemplary kits for use with such systems include, but are not limited to, single-use kits sold by BioSafe SA under product names CS-430.1, CS-490.1, CS-600.1 or CS-900.2.
  • the system is included with and/or placed into association with other instrumentation, including instrumentation to operate, automate, control and/or monitor aspects of the transduction step and one or more various other processing steps performed in the system, e.g. one or more processing steps that can be carried out with or in connection with the centrifugal chamber system as described herein or in International Publication Number W02016/073602.
  • This instrumentation in some embodiments is contained within a cabinet.
  • the instrumentation includes a cabinet, which includes a housing containing control circuitry, a centrifuge, a cover, motors, pumps, sensors, displays, and a user interface.
  • An exemplary device is described in US Patent No. 6,123,655, US Patent No. 6,733,433 and US 2008/0171951.
  • the system comprises a series of containers, e.g., bags, tubing, stopcocks, clamps, connectors, and a centrifuge chamber.
  • the containers, such as bags include one or more containers, such as bags, containing the cells to be transduced and the viral vector particles, in the same container or separate containers, such as the same bag or separate bags.
  • the system further includes one or more containers, such as bags, containing medium, such as diluent and/or wash solution, which is pulled into the chamber and/or other components to dilute, resuspend, and/or wash components and/or compositions during the methods.
  • the containers can be connected at one or more positions in the system, such as at a position corresponding to an input line, diluent line, wash line, waste line and/or output line.
  • the chamber is associated with a centrifuge, which is capable of effecting rotation of the chamber, such as around its axis of rotation. Rotation may occur before, during, and/or after the incubation in connection with transduction of the cells and/or in one or more of the other processing steps. Thus, in some embodiments, one or more of the various processing steps is carried out under rotation, e.g., at a particular force.
  • the chamber is typically capable of vertical or generally vertical rotation, such that the chamber sits vertically during centrifugation and the side wall and axis are vertical or generally vertical, with the end wall(s) horizontal or generally horizontal.
  • the composition containing cells, the vector, e.g., viral particles, and reagent can be rotated, generally at relatively low force or speed, such as speed lower than that used to pellet the cells, such as from or from about 600 rpm to 1700 rpm (e.g. at or about or at least 600 rpm, 1000 rpm, or 1500 rpm or 1700 rpm).
  • the rotation is carried at a force, e.g., a relative centrifugal force, of from or from about 100 g to 3200 g (e.g.
  • RCF relative centrifugal force
  • RCF relative centrifugal force
  • the term “relative centrifugal force” or RCF is generally understood to be the effective force imparted on an object or substance (such as a cell, sample, or pellet and/or a point in the chamber or other container being rotated), relative to the earth’s gravitational force, at a particular point in space as compared to the axis of rotation.
  • the value may be determined using well-known formulas, taking into account the gravitational force, rotation speed and the radius of rotation (distance from the axis of rotation and the object, substance, or particle at which RCF is being measured).
  • the cells are transferred to a bioreactor bag assembly for culture of the genetically engineered cells, such as for cultivation or expansion of the cells.
  • recombinant nucleic acids are transferred into cells using recombinant infectious vims particles, such as, e.g., vectors derived from simian vims 40 (SV40), adenovimses, adeno-associated vims (AAV).
  • recombinant nucleic acids are transferred into T cells using recombinant lentiviral vectors or retroviral vectors, such as gamma-retroviral vectors (see, e.g., Koste et al. (2014) Gene Therapy 2014 Apr 3. doi: 10.1038/gt.2014.25; Carlens et al.
  • the retroviral vector has a long terminal repeat sequence (LTR), e.g., a retroviral vector derived from the Moloney murine leukemia vims (MoMLV), myeloproliferative sarcoma virus (MPSV), murine embryonic stem cell virus (MESV), murine stem cell virus (MSCV) or spleen focus forming virus (SFFV).
  • LTR long terminal repeat sequence
  • MoMLV Moloney murine leukemia vims
  • MPSV myeloproliferative sarcoma virus
  • MMV murine embryonic stem cell virus
  • MSCV murine stem cell virus
  • SFFV spleen focus forming virus
  • retroviral vectors are derived from murine retroviruses.
  • the retroviruses include those derived from any avian or mammalian cell source.
  • the retroviruses typically are amphotropic, meaning that they are capable of infecting host cells of several species, including humans.
  • the gene to be expressed replaces the retroviral gag, pol and/or env sequences.
  • retroviral gag, pol and/or env sequences A number of illustrative retroviral systems have been described (e.g., U.S. Pat. Nos. 5,219,740; 6,207,453; 5,219,740; Miller and Rosman (1989) BioTechniques 7:980-990; Miller, A. D.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Engineering & Computer Science (AREA)
PCT/US2020/063486 2019-12-06 2020-12-04 Methods related to toxicity and response associated with cell therapy for treating b cell malignancies Ceased WO2021113770A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
BR112022010310A BR112022010310A2 (pt) 2019-12-06 2020-12-04 Métodos relacionados com a toxicidade e resposta associada com terapia celular para tratamento de malignidades de célula b
JP2022534164A JP7605840B2 (ja) 2019-12-06 2020-12-04 B細胞性悪性疾患を処置するための細胞療法と関連する毒性および奏効に関係する方法
EP20829465.2A EP4070097A1 (en) 2019-12-06 2020-12-04 Methods related to toxicity and response associated with cell therapy for treating b cell malignancies
MX2022006715A MX2022006715A (es) 2019-12-06 2020-12-04 Metodos relacionados con toxicidad y respuesta asociada con terapia celular para tratar neoplasias malignas de celulas b.
US17/782,584 US20230053787A1 (en) 2019-12-06 2020-12-04 Methods related to toxicity and response associated with cell therapy for treating b cell malignancies
AU2020395318A AU2020395318A1 (en) 2019-12-06 2020-12-04 Methods related to toxicity and response associated with cell therapy for treating B cell malignancies
KR1020227023060A KR20220132527A (ko) 2019-12-06 2020-12-04 B 세포 악성 종양을 치료하기 위한 세포 요법과 연관된 독성 및 반응과 관련된 방법
CN202080095371.6A CN115398231A (zh) 2019-12-06 2020-12-04 与治疗b细胞恶性肿瘤的细胞疗法相关的毒性和反应的相关方法
IL293393A IL293393A (en) 2019-12-06 2020-12-04 Cell therapy-related toxicity and response-related methods for the treatment of b-cell malignancies

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962945105P 2019-12-06 2019-12-06
US62/945,105 2019-12-06

Publications (1)

Publication Number Publication Date
WO2021113770A1 true WO2021113770A1 (en) 2021-06-10

Family

ID=74046188

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/063486 Ceased WO2021113770A1 (en) 2019-12-06 2020-12-04 Methods related to toxicity and response associated with cell therapy for treating b cell malignancies

Country Status (10)

Country Link
US (1) US20230053787A1 (https=)
EP (1) EP4070097A1 (https=)
JP (1) JP7605840B2 (https=)
KR (1) KR20220132527A (https=)
CN (1) CN115398231A (https=)
AU (1) AU2020395318A1 (https=)
BR (1) BR112022010310A2 (https=)
IL (1) IL293393A (https=)
MX (1) MX2022006715A (https=)
WO (1) WO2021113770A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023230548A1 (en) * 2022-05-25 2023-11-30 Celgene Corporation Method for predicting response to a t cell therapy

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240122664A (ko) * 2023-02-03 2024-08-13 서울대학교산학협력단 혈액암 치료를 위한 키메라 항원 수용체(Chimeric Antigen Receptor) T 세포의 비임상 평가 방법

Citations (84)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3799934A (en) 1971-04-10 1974-03-26 Bayer Ag Unsymmetrical esters of 1,4-dihydropyridine 3,5-dicarboxylic acid
US4452773A (en) 1982-04-05 1984-06-05 Canadian Patents And Development Limited Magnetic iron-dextran microspheres
US4690915A (en) 1985-08-08 1987-09-01 The United States Of America As Represented By The Department Of Health And Human Services Adoptive immunotherapy as a treatment modality in humans
US4795698A (en) 1985-10-04 1989-01-03 Immunicon Corporation Magnetic-polymer particles
US4903830A (en) 1988-02-12 1990-02-27 Alps Electric Co., Ltd. Automatic mounting chip component
US5087616A (en) 1986-08-07 1992-02-11 Battelle Memorial Institute Cytotoxic drug conjugates and their delivery to tumor cells
US5168062A (en) 1985-01-30 1992-12-01 University Of Iowa Research Foundation Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter-regulatory DNA sequence
US5200084A (en) 1990-09-26 1993-04-06 Immunicon Corporation Apparatus and methods for magnetic separation
US5219740A (en) 1987-02-13 1993-06-15 Fred Hutchinson Cancer Research Center Retroviral gene transfer into diploid fibroblasts for gene therapy
EP0452342B1 (en) 1988-12-28 1994-11-30 MILTENYI, Stefan Methods and materials for high gradient magnetic separation of biological materials
WO1996013593A2 (en) 1994-10-26 1996-05-09 Procept, Inc. Soluble single chain t cell receptors
WO1996018105A1 (en) 1994-12-06 1996-06-13 The President And Fellows Of Harvard College Single chain t-cell receptor
US5527814A (en) 1992-03-06 1996-06-18 Rhone Poulenc Rorer S.A. Use of 2-amino-6-(trifluoromethoxy)benzothiazole for obtaining a medicament for the treatment of amyotrophic lateral sclerosis
US5591827A (en) 1992-10-20 1997-01-07 Cetus Oncology Corporation Interleukin-6 receptor antagonists
WO1999018129A1 (en) 1997-10-02 1999-04-15 Sunol Molecular Corporation Soluble single-chain t-cell receptor proteins
WO1999060120A2 (en) 1998-05-19 1999-11-25 Avidex Limited Soluble t cell receptor
US5994136A (en) 1997-12-12 1999-11-30 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
US6013516A (en) 1995-10-06 2000-01-11 The Salk Institute For Biological Studies Vector and method of use for nucleic acid delivery to non-dividing cells
WO2000014257A1 (en) 1998-09-04 2000-03-16 Sloan-Kettering Institute For Cancer Research Fusion receptors specific for prostate-specific membrane antigen and uses thereof
US6040177A (en) 1994-08-31 2000-03-21 Fred Hutchinson Cancer Research Center High efficiency transduction of T lymphocytes using rapid expansion methods ("REM")
WO2000038762A1 (en) 1998-12-24 2000-07-06 Biosafe S.A. Blood separation system particularly for concentrating hematopoietic stem cells
US6123655A (en) 1996-04-24 2000-09-26 Fell; Claude Cell separation system with variable size chamber for the processing of biological fluids
US6207453B1 (en) 1996-03-06 2001-03-27 Medigene Ag Recombinant AAV vector-based transduction system and use of same
US6410319B1 (en) 1998-10-20 2002-06-25 City Of Hope CD20-specific redirected T cells and their use in cellular immunotherapy of CD20+ malignancies
US6451995B1 (en) 1996-03-20 2002-09-17 Sloan-Kettering Institute For Cancer Research Single chain FV polynucleotide or peptide constructs of anti-ganglioside GD2 antibodies, cells expressing same and related methods
US20020131960A1 (en) 2000-06-02 2002-09-19 Michel Sadelain Artificial antigen presenting cells and methods of use thereof
WO2003020763A2 (en) 2001-08-31 2003-03-13 Avidex Limited Soluble t cell receptor
US20030170238A1 (en) 2002-03-07 2003-09-11 Gruenberg Micheal L. Re-activated T-cells for adoptive immunotherapy
WO2004033685A1 (en) 2002-10-09 2004-04-22 Avidex Ltd Single chain recombinant t cell receptors
WO2006000830A2 (en) 2004-06-29 2006-01-05 Avidex Ltd Cells expressing a modified t cell receptor
WO2006009755A2 (en) 2004-06-17 2006-01-26 Plexxikon, Inc. Azaindoles modulating c-kit activity and uses therefor
US7070995B2 (en) 2001-04-11 2006-07-04 City Of Hope CE7-specific redirected immune cells
US20070116690A1 (en) 2001-12-10 2007-05-24 Lili Yang Method for the generation of antigen-specific lymphocytes
WO2008063888A2 (en) 2006-11-22 2008-05-29 Plexxikon, Inc. Compounds modulating c-fms and/or c-kit activity and uses therefor
US20080171951A1 (en) 2005-03-23 2008-07-17 Claude Fell Integrated System for Collecting, Processing and Transplanting Cell Subsets, Including Adult Stem Cells, for Regenerative Medicine
US7446190B2 (en) 2002-05-28 2008-11-04 Sloan-Kettering Institute For Cancer Research Nucleic acids encoding chimeric T cell receptors
US7446179B2 (en) 2000-11-07 2008-11-04 City Of Hope CD19-specific chimeric T cell receptor
US7514444B2 (en) 2006-09-22 2009-04-07 Pharmacyclics, Inc. Inhibitors of bruton's tyrosine kinase
WO2009072003A2 (en) 2007-12-07 2009-06-11 Miltenyi Biotec Gmbh Sample processing system and methods
WO2009076524A2 (en) 2007-12-11 2009-06-18 The University Of North Carolina At Chapel Hill Polypurine tract modified retroviral vectors
WO2009099553A2 (en) 2008-02-01 2009-08-13 The Regents Of The University Of California Use of kinase inhibitor in treatment of atherosclerosis
US7645755B2 (en) 2004-10-22 2010-01-12 Janssen Pharmaceutical N.V. Inhibitors of c-fms kinase
WO2010033140A2 (en) 2008-05-06 2010-03-25 Innovative Micro Technology Removable/disposable apparatus for mems particle sorting device
US20100190755A1 (en) 2008-09-19 2010-07-29 Paul Abato Tetracycline compounds for the treatment of rheumatoid arthritis and related methods of treatment
EP2277543A1 (en) 2002-09-06 2011-01-26 Amgen, Inc Therapeutic anti-IL-1R1 monoclonal antibody
US20110044998A1 (en) 2008-01-28 2011-02-24 Medimmune Limited Stabilized Angiopoietin-2 Antibodies And Uses Thereof
WO2011044186A1 (en) 2009-10-06 2011-04-14 The Board Of Trustees Of The University Of Illinois Human single-chain t cell receptors
US8247425B2 (en) 2008-09-30 2012-08-21 Wyeth Peripheral opioid receptor antagonists and uses thereof
WO2012129514A1 (en) 2011-03-23 2012-09-27 Fred Hutchinson Cancer Research Center Method and compositions for cellular immunotherapy
US8324353B2 (en) 2001-04-30 2012-12-04 City Of Hope Chimeric immunoreceptor useful in treating human gliomas
US8339645B2 (en) 2008-05-27 2012-12-25 Canon Kabushiki Kaisha Managing apparatus, image processing apparatus, and processing method for the same, wherein a first user stores a temporary object having attribute information specified but not partial-area data, at a later time an object is received from a second user that includes both partial-area data and attribute information, the storage unit is searched for the temporary object that matches attribute information of the received object, and the first user is notified in response to a match
EP2537416A1 (en) 2007-03-30 2012-12-26 Memorial Sloan-Kettering Cancer Center Constitutive expression of costimulatory ligands on adoptively transferred T lymphocytes
US8399514B2 (en) 2007-02-08 2013-03-19 Biogen Idec Ma Inc. Treatment for multiple sclerosis
US8398282B2 (en) 2011-05-12 2013-03-19 Delphi Technologies, Inc. Vehicle front lighting assembly and systems having a variable tint electrowetting element
WO2013071154A1 (en) 2011-11-11 2013-05-16 Fred Hutchinson Cancer Research Center Cyclin a1-targeted t-cell immunotherapy for cancer
US20130149337A1 (en) 2003-03-11 2013-06-13 City Of Hope Method of controlling administration of cancer antigen
US8479118B2 (en) 2007-12-10 2013-07-02 Microsoft Corporation Switching search providers within a browser search box
WO2013123061A1 (en) 2012-02-13 2013-08-22 Seattle Children's Hospital D/B/A Seattle Children's Research Institute Bispecific chimeric antigen receptors and therapeutic uses thereof
WO2013126726A1 (en) 2012-02-22 2013-08-29 The Trustees Of The University Of Pennsylvania Double transgenic t cells comprising a car and a tcr and their methods of use
US8562991B2 (en) 2008-09-26 2013-10-22 Chugai Seiyaku Kabushiki Kaisha Antibody molecules that bind to IL-6 receptor
US20130287748A1 (en) 2010-12-09 2013-10-31 The Trustees Of The University Of Pennsylvania Use of Chimeric Antigen Receptor-Modified T-Cells to Treat Cancer
WO2013166321A1 (en) 2012-05-03 2013-11-07 Fred Hutchinson Cancer Research Center Enhanced affinity t cell receptors and methods for making the same
WO2014001802A1 (en) 2012-06-26 2014-01-03 Chroma Therapeutics Ltd 2-aminopyrazine derivatives as csf-1 r kinase inhibitors
WO2014031687A1 (en) 2012-08-20 2014-02-27 Jensen, Michael Method and compositions for cellular immunotherapy
US20140065141A1 (en) 2011-05-05 2014-03-06 Novartis Ag Csf-1r inhibitors for treatment of brain tumors
WO2014055668A1 (en) 2012-10-02 2014-04-10 Memorial Sloan-Kettering Cancer Center Compositions and methods for immunotherapy
US8754090B2 (en) 2010-06-03 2014-06-17 Pharmacyclics, Inc. Use of inhibitors of bruton's tyrosine kinase (Btk)
US8802374B2 (en) 2009-11-03 2014-08-12 City Of Hope Truncated epiderimal growth factor receptor (EGFRt) for transduced T cell selection
US8822647B2 (en) 2008-08-26 2014-09-02 City Of Hope Method and compositions using a chimeric antigen receptor for enhanced anti-tumor effector functioning of T cells
US20140271635A1 (en) 2013-03-16 2014-09-18 The Trustees Of The University Of Pennsylvania Treatment of cancer using humanized anti-cd19 chimeric antigen receptor
WO2014190273A1 (en) 2013-05-24 2014-11-27 Board Of Regents, The University Of Texas System Chimeric antigen receptor-targeting monoclonal antibodies
US20150119267A1 (en) 2012-04-16 2015-04-30 Sloan-Kettering Institute For Cancer Research Inhibition of colony stimulating factor-1 receptor signaling for the treatment of brain cancer
WO2015095895A1 (en) 2013-12-20 2015-06-25 Fred Hutchinson Cancer Research Center Tagged chimeric effector molecules and receptors thereof
US9108442B2 (en) 2013-08-20 2015-08-18 Ricoh Company, Ltd. Image forming apparatus
WO2015164675A1 (en) 2014-04-23 2015-10-29 Juno Therapeutics, Inc. Methods for isolating, culturing, and genetically engineering immune cell populations for adoptive therapy
US20160032248A1 (en) 2013-03-15 2016-02-04 Stemcell Technologies, Inc. Compositions and methods for obtaining enriched mesenchymal stem cell cultures
US9296753B2 (en) 2012-06-04 2016-03-29 Pharmacyclics Llc Crystalline forms of a Bruton's tyrosine kinase inhibitor
WO2016073602A2 (en) 2014-11-05 2016-05-12 Juno Therapeutics, Inc. Methods for transduction and cell processing
US20160152723A1 (en) 2014-08-28 2016-06-02 Juno Therapeutics, Inc. Antibodies and chimeric antigen receptors specific for cd19
US9405601B2 (en) 2012-12-20 2016-08-02 Mitsubishi Electric Corporation In-vehicle apparatus and program
US20170051035A1 (en) 2014-05-02 2017-02-23 The Trustees Of The University Of Pennsylvania Compositions and methods of chimeric autoantibody receptor t cells
WO2017214207A2 (en) * 2016-06-06 2017-12-14 Juno Therapeutics, Inc. Methods for the treatment of b cell malignancies using adoptive cell therapy
WO2018223101A1 (en) * 2017-06-02 2018-12-06 Juno Therapeutics, Inc. Articles of manufacture and methods for treatment using adoptive cell therapy
WO2019089855A1 (en) 2017-11-01 2019-05-09 Juno Therapeutics, Inc. Process for generating therapeutic compositions of engineered cells

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2016229201B2 (en) 2015-03-06 2021-01-28 The Board Of Regents Of The University Of Texas System Anti-LILRB antibodies and their use in detecting and treating cancer

Patent Citations (104)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3799934A (en) 1971-04-10 1974-03-26 Bayer Ag Unsymmetrical esters of 1,4-dihydropyridine 3,5-dicarboxylic acid
US4452773A (en) 1982-04-05 1984-06-05 Canadian Patents And Development Limited Magnetic iron-dextran microspheres
US5168062A (en) 1985-01-30 1992-12-01 University Of Iowa Research Foundation Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter-regulatory DNA sequence
US5385839A (en) 1985-01-30 1995-01-31 University Of Iowa Research Foundation Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter regulatory DNA sequence
US4690915A (en) 1985-08-08 1987-09-01 The United States Of America As Represented By The Department Of Health And Human Services Adoptive immunotherapy as a treatment modality in humans
US4795698A (en) 1985-10-04 1989-01-03 Immunicon Corporation Magnetic-polymer particles
US5087616A (en) 1986-08-07 1992-02-11 Battelle Memorial Institute Cytotoxic drug conjugates and their delivery to tumor cells
US5219740A (en) 1987-02-13 1993-06-15 Fred Hutchinson Cancer Research Center Retroviral gene transfer into diploid fibroblasts for gene therapy
US4903830A (en) 1988-02-12 1990-02-27 Alps Electric Co., Ltd. Automatic mounting chip component
EP0452342B1 (en) 1988-12-28 1994-11-30 MILTENYI, Stefan Methods and materials for high gradient magnetic separation of biological materials
US5200084A (en) 1990-09-26 1993-04-06 Immunicon Corporation Apparatus and methods for magnetic separation
US5527814A (en) 1992-03-06 1996-06-18 Rhone Poulenc Rorer S.A. Use of 2-amino-6-(trifluoromethoxy)benzothiazole for obtaining a medicament for the treatment of amyotrophic lateral sclerosis
US5591827A (en) 1992-10-20 1997-01-07 Cetus Oncology Corporation Interleukin-6 receptor antagonists
US6040177A (en) 1994-08-31 2000-03-21 Fred Hutchinson Cancer Research Center High efficiency transduction of T lymphocytes using rapid expansion methods ("REM")
WO1996013593A2 (en) 1994-10-26 1996-05-09 Procept, Inc. Soluble single chain t cell receptors
WO1996018105A1 (en) 1994-12-06 1996-06-13 The President And Fellows Of Harvard College Single chain t-cell receptor
US6013516A (en) 1995-10-06 2000-01-11 The Salk Institute For Biological Studies Vector and method of use for nucleic acid delivery to non-dividing cells
US6207453B1 (en) 1996-03-06 2001-03-27 Medigene Ag Recombinant AAV vector-based transduction system and use of same
US6451995B1 (en) 1996-03-20 2002-09-17 Sloan-Kettering Institute For Cancer Research Single chain FV polynucleotide or peptide constructs of anti-ganglioside GD2 antibodies, cells expressing same and related methods
US6123655A (en) 1996-04-24 2000-09-26 Fell; Claude Cell separation system with variable size chamber for the processing of biological fluids
WO1999018129A1 (en) 1997-10-02 1999-04-15 Sunol Molecular Corporation Soluble single-chain t-cell receptor proteins
US5994136A (en) 1997-12-12 1999-11-30 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
WO1999060120A2 (en) 1998-05-19 1999-11-25 Avidex Limited Soluble t cell receptor
WO2000014257A1 (en) 1998-09-04 2000-03-16 Sloan-Kettering Institute For Cancer Research Fusion receptors specific for prostate-specific membrane antigen and uses thereof
US6410319B1 (en) 1998-10-20 2002-06-25 City Of Hope CD20-specific redirected T cells and their use in cellular immunotherapy of CD20+ malignancies
US6733433B1 (en) 1998-12-24 2004-05-11 Biosafe S.A. Blood separation system particularly for concentrating hematopoietic stem cells
WO2000038762A1 (en) 1998-12-24 2000-07-06 Biosafe S.A. Blood separation system particularly for concentrating hematopoietic stem cells
US20020131960A1 (en) 2000-06-02 2002-09-19 Michel Sadelain Artificial antigen presenting cells and methods of use thereof
US7446179B2 (en) 2000-11-07 2008-11-04 City Of Hope CD19-specific chimeric T cell receptor
US7446191B2 (en) 2001-04-11 2008-11-04 City Of Hope DNA construct encoding CE7-specific chimeric T cell receptor
US7070995B2 (en) 2001-04-11 2006-07-04 City Of Hope CE7-specific redirected immune cells
US7265209B2 (en) 2001-04-11 2007-09-04 City Of Hope CE7-specific chimeric T cell receptor
US7354762B2 (en) 2001-04-11 2008-04-08 City Of Hope Method for producing CE7-specific redirected immune cells
US8324353B2 (en) 2001-04-30 2012-12-04 City Of Hope Chimeric immunoreceptor useful in treating human gliomas
WO2003020763A2 (en) 2001-08-31 2003-03-13 Avidex Limited Soluble t cell receptor
US20070116690A1 (en) 2001-12-10 2007-05-24 Lili Yang Method for the generation of antigen-specific lymphocytes
US20030170238A1 (en) 2002-03-07 2003-09-11 Gruenberg Micheal L. Re-activated T-cells for adoptive immunotherapy
US7446190B2 (en) 2002-05-28 2008-11-04 Sloan-Kettering Institute For Cancer Research Nucleic acids encoding chimeric T cell receptors
EP2277543A1 (en) 2002-09-06 2011-01-26 Amgen, Inc Therapeutic anti-IL-1R1 monoclonal antibody
WO2004033685A1 (en) 2002-10-09 2004-04-22 Avidex Ltd Single chain recombinant t cell receptors
US20130149337A1 (en) 2003-03-11 2013-06-13 City Of Hope Method of controlling administration of cancer antigen
WO2006009755A2 (en) 2004-06-17 2006-01-26 Plexxikon, Inc. Azaindoles modulating c-kit activity and uses therefor
WO2006000830A2 (en) 2004-06-29 2006-01-05 Avidex Ltd Cells expressing a modified t cell receptor
US7645755B2 (en) 2004-10-22 2010-01-12 Janssen Pharmaceutical N.V. Inhibitors of c-fms kinase
US20080171951A1 (en) 2005-03-23 2008-07-17 Claude Fell Integrated System for Collecting, Processing and Transplanting Cell Subsets, Including Adult Stem Cells, for Regenerative Medicine
US8703780B2 (en) 2006-09-22 2014-04-22 Pharmacyclics, Inc. Inhibitors of Bruton's tyrosine kinase
US8697711B2 (en) 2006-09-22 2014-04-15 Pharmacyclics, Inc. Inhibitors of bruton'S tyrosine kinase
US8735403B2 (en) 2006-09-22 2014-05-27 Pharmacyclics, Inc. Inhibitors of Bruton's tyrosine kinase
US8754091B2 (en) 2006-09-22 2014-06-17 Pharmacyclics, Inc. Inhibitors of bruton's tyrosine kinase
US8497277B2 (en) 2006-09-22 2013-07-30 Pharmacyclics, Inc. Inhibitors of Bruton's tyrosine kinase
US8476284B2 (en) 2006-09-22 2013-07-02 Pharmacyclics, Inc. Inhibitors of Bruton's tyrosine kinase
US7514444B2 (en) 2006-09-22 2009-04-07 Pharmacyclics, Inc. Inhibitors of bruton's tyrosine kinase
US8008309B2 (en) 2006-09-22 2011-08-30 Pharmacyclics, Inc. Inhibitors of bruton's tyrosine kinase
US8957079B2 (en) 2006-09-22 2015-02-17 Pharmacyclics, Inc. Inhibitors of Bruton's tyrosine kinase
US9181257B2 (en) 2006-09-22 2015-11-10 Pharmacyclics Llc Inhibitors of Bruton's tyrosine kinase
WO2008063888A2 (en) 2006-11-22 2008-05-29 Plexxikon, Inc. Compounds modulating c-fms and/or c-kit activity and uses therefor
US7893075B2 (en) 2006-11-22 2011-02-22 Plexxikon, Inc. Compounds modulating c-fms and/or c-kit activity and uses therefor
US8399514B2 (en) 2007-02-08 2013-03-19 Biogen Idec Ma Inc. Treatment for multiple sclerosis
US8389282B2 (en) 2007-03-30 2013-03-05 Memorial Sloan-Kettering Cancer Center Constitutive expression of costimulatory ligands on adoptively transferred T lymphocytes
EP2537416A1 (en) 2007-03-30 2012-12-26 Memorial Sloan-Kettering Cancer Center Constitutive expression of costimulatory ligands on adoptively transferred T lymphocytes
US20110003380A1 (en) 2007-12-07 2011-01-06 Stefan Miltenyi Sample Processing System and Methods
WO2009072003A2 (en) 2007-12-07 2009-06-11 Miltenyi Biotec Gmbh Sample processing system and methods
US8479118B2 (en) 2007-12-10 2013-07-02 Microsoft Corporation Switching search providers within a browser search box
WO2009076524A2 (en) 2007-12-11 2009-06-18 The University Of North Carolina At Chapel Hill Polypurine tract modified retroviral vectors
US20110044998A1 (en) 2008-01-28 2011-02-24 Medimmune Limited Stabilized Angiopoietin-2 Antibodies And Uses Thereof
WO2009099553A2 (en) 2008-02-01 2009-08-13 The Regents Of The University Of California Use of kinase inhibitor in treatment of atherosclerosis
WO2010033140A2 (en) 2008-05-06 2010-03-25 Innovative Micro Technology Removable/disposable apparatus for mems particle sorting device
US8339645B2 (en) 2008-05-27 2012-12-25 Canon Kabushiki Kaisha Managing apparatus, image processing apparatus, and processing method for the same, wherein a first user stores a temporary object having attribute information specified but not partial-area data, at a later time an object is received from a second user that includes both partial-area data and attribute information, the storage unit is searched for the temporary object that matches attribute information of the received object, and the first user is notified in response to a match
US8822647B2 (en) 2008-08-26 2014-09-02 City Of Hope Method and compositions using a chimeric antigen receptor for enhanced anti-tumor effector functioning of T cells
US20100190755A1 (en) 2008-09-19 2010-07-29 Paul Abato Tetracycline compounds for the treatment of rheumatoid arthritis and related methods of treatment
US8562991B2 (en) 2008-09-26 2013-10-22 Chugai Seiyaku Kabushiki Kaisha Antibody molecules that bind to IL-6 receptor
US8247425B2 (en) 2008-09-30 2012-08-21 Wyeth Peripheral opioid receptor antagonists and uses thereof
WO2011044186A1 (en) 2009-10-06 2011-04-14 The Board Of Trustees Of The University Of Illinois Human single-chain t cell receptors
US8802374B2 (en) 2009-11-03 2014-08-12 City Of Hope Truncated epiderimal growth factor receptor (EGFRt) for transduced T cell selection
US8999999B2 (en) 2010-06-03 2015-04-07 Pharmacyclics, Inc. Use of inhibitors of Bruton's tyrosine kinase (Btk)
US9125889B2 (en) 2010-06-03 2015-09-08 Pharmacyclics, Inc. Use of inhibitors of Bruton's tyrosine kinase (Btk)
US8754090B2 (en) 2010-06-03 2014-06-17 Pharmacyclics, Inc. Use of inhibitors of bruton's tyrosine kinase (Btk)
US8911993B2 (en) 2010-12-09 2014-12-16 The Trustees Of The University Of Pennsylvania Compositions for treatment of cancer
US20130287748A1 (en) 2010-12-09 2013-10-31 The Trustees Of The University Of Pennsylvania Use of Chimeric Antigen Receptor-Modified T-Cells to Treat Cancer
WO2012129514A1 (en) 2011-03-23 2012-09-27 Fred Hutchinson Cancer Research Center Method and compositions for cellular immunotherapy
US20140065141A1 (en) 2011-05-05 2014-03-06 Novartis Ag Csf-1r inhibitors for treatment of brain tumors
US8398282B2 (en) 2011-05-12 2013-03-19 Delphi Technologies, Inc. Vehicle front lighting assembly and systems having a variable tint electrowetting element
WO2013071154A1 (en) 2011-11-11 2013-05-16 Fred Hutchinson Cancer Research Center Cyclin a1-targeted t-cell immunotherapy for cancer
WO2013123061A1 (en) 2012-02-13 2013-08-22 Seattle Children's Hospital D/B/A Seattle Children's Research Institute Bispecific chimeric antigen receptors and therapeutic uses thereof
WO2013126726A1 (en) 2012-02-22 2013-08-29 The Trustees Of The University Of Pennsylvania Double transgenic t cells comprising a car and a tcr and their methods of use
US20150119267A1 (en) 2012-04-16 2015-04-30 Sloan-Kettering Institute For Cancer Research Inhibition of colony stimulating factor-1 receptor signaling for the treatment of brain cancer
WO2013166321A1 (en) 2012-05-03 2013-11-07 Fred Hutchinson Cancer Research Center Enhanced affinity t cell receptors and methods for making the same
US9296753B2 (en) 2012-06-04 2016-03-29 Pharmacyclics Llc Crystalline forms of a Bruton's tyrosine kinase inhibitor
WO2014001802A1 (en) 2012-06-26 2014-01-03 Chroma Therapeutics Ltd 2-aminopyrazine derivatives as csf-1 r kinase inhibitors
WO2014031687A1 (en) 2012-08-20 2014-02-27 Jensen, Michael Method and compositions for cellular immunotherapy
WO2014055668A1 (en) 2012-10-02 2014-04-10 Memorial Sloan-Kettering Cancer Center Compositions and methods for immunotherapy
US9405601B2 (en) 2012-12-20 2016-08-02 Mitsubishi Electric Corporation In-vehicle apparatus and program
US20160032248A1 (en) 2013-03-15 2016-02-04 Stemcell Technologies, Inc. Compositions and methods for obtaining enriched mesenchymal stem cell cultures
US20140271635A1 (en) 2013-03-16 2014-09-18 The Trustees Of The University Of Pennsylvania Treatment of cancer using humanized anti-cd19 chimeric antigen receptor
WO2014190273A1 (en) 2013-05-24 2014-11-27 Board Of Regents, The University Of Texas System Chimeric antigen receptor-targeting monoclonal antibodies
US9108442B2 (en) 2013-08-20 2015-08-18 Ricoh Company, Ltd. Image forming apparatus
WO2015095895A1 (en) 2013-12-20 2015-06-25 Fred Hutchinson Cancer Research Center Tagged chimeric effector molecules and receptors thereof
WO2015164675A1 (en) 2014-04-23 2015-10-29 Juno Therapeutics, Inc. Methods for isolating, culturing, and genetically engineering immune cell populations for adoptive therapy
US20170051035A1 (en) 2014-05-02 2017-02-23 The Trustees Of The University Of Pennsylvania Compositions and methods of chimeric autoantibody receptor t cells
US20160152723A1 (en) 2014-08-28 2016-06-02 Juno Therapeutics, Inc. Antibodies and chimeric antigen receptors specific for cd19
WO2016073602A2 (en) 2014-11-05 2016-05-12 Juno Therapeutics, Inc. Methods for transduction and cell processing
WO2017214207A2 (en) * 2016-06-06 2017-12-14 Juno Therapeutics, Inc. Methods for the treatment of b cell malignancies using adoptive cell therapy
WO2018223101A1 (en) * 2017-06-02 2018-12-06 Juno Therapeutics, Inc. Articles of manufacture and methods for treatment using adoptive cell therapy
WO2019089855A1 (en) 2017-11-01 2019-05-09 Juno Therapeutics, Inc. Process for generating therapeutic compositions of engineered cells

Non-Patent Citations (134)

* Cited by examiner, † Cited by third party
Title
"Antibody-antigen interactions: Contact analysis and binding site topography", J. MOL. BIOL., vol. 262, pages 732 - 745
"Metastasis Research Protocols, Vol. 2: Cell Behavior In Vitro and In Vivo, p", vol. 58, HUMANA PRESS INC., article "Methods in Molecular Medicine", pages: 17 - 25
"National Cancer Institute-Common Toxicity Criteria (CTCAE) scale, version 4.03 (NCI-CTCAE v4.03). See Common Terminology for Adverse Events (CTCAE) Version 4", 28 May 2009, U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES
"Remington: The Science and Practice of Pharmacy", 1 May 2005, LIPPINCOTT WILLIAMS & WILKINS
"Remington's Pharmaceutical Sciences", 1980, MACK PUB. CO.
AL-LAZIKANI ET AL., JMB, vol. 273, 1997, pages 927 - 948
ALONSO-CAMINO ET AL., MOL THER NUCL ACIDS, vol. 2, 2013, pages e93
BARRETT ET AL., ASH 58TH ANNUAL MEETING SAN DIEGO, CA, 3 December 2016 (2016-12-03)
BARRETT ET AL., CHIMERIC ANTIGEN RECEPTOR THERAPY FOR CANCER ANNUAL REVIEW OF MEDICINE, vol. 65, 2014, pages 333 - 347
BASU ET AL., INDIAN J CRIT CARE MED, vol. 18, no. 12, 2014, pages 822 - 824
BORIS-LAWRIETEMIN, CUR. OPIN. GENET. DEVELOP., vol. 3, 1993, pages 102 - 109
BRASH ET AL., MOL. CELL BIOL., vol. 7, 1987, pages 2031 - 2034
BRENTJENS ET AL., SCI TRANSL MED., vol. 5, no. 177, 2013
BRENTJENS ET AL., SCI. TRANSL. MED., vol. 5, 2013, pages 177ra38
BRENTJENS ET AL., SCI. TRANSL. MED., vol. 5, no. 177, March 2013 (2013-03-01), pages 177ra38
BROWN ET AL., J VIROL, vol. 73, 1999, pages 9011
BURNS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 8033 - 8037
BUTOXSKY ET AL., ANN NEUROL., vol. 77, no. 1, 2015, pages 75 - 99
CAMERON J. TURTLE ET AL: "Durable Molecular Remissions in Chronic Lymphocytic Leukemia Treated With CD19-Specific Chimeric Antigen Receptor-Modified T Cells After Failure of Ibrutinib", JOURNAL OF CLINICAL ONCOLOGY, 17 July 2017 (2017-07-17), US, pages - 15, XP055402565, ISSN: 0732-183X, DOI: 10.1200/JCO.2017.72.8519 *
CARCELLER ET AL., PEDIATR BLOOD CANCER, vol. 63, no. 8, 2016, pages 1400 - 1406
CARLENS ET AL., EXP HEMATOL, vol. 28, no. 10, 2000, pages 1137 - 46
CAVALIERI ET AL., BLOOD, vol. 102, no. 2, 2003, pages 1637 - 1644
CHEADLE ET AL.: "Chimeric antigen receptors for T-cell based therapy", METHODS MOL BIOL, vol. 907, 2012, pages 645 - 66, XP009179541, DOI: 10.1007/978-1-61779-974-7_36
CHERVIN ET AL., J IMMUNOL METHODS, vol. 339, 2008, pages 175 - 84
CHICAYBAM ET AL., PLOS ONE, vol. 8, no. 3, 2013, pages e60298
CHO ET AL., LAB CHIP, vol. 10, 2010, pages 1567 - 1573
CHOTHIA ET AL., EMBO J., vol. 7, 1988, pages 3745
CLARKSON ET AL., NATURE, vol. 352, 1991, pages 624 - 628
CONWAY ET AL., PROC NATL ACAD SCI U S A, vol. 102, no. 44, 2005, pages 16078 - 83
COUSTAN-SMITH ET AL., LANCET, vol. 351, 1998, pages 550 - 554
DAGHER ET AL., JOURNAL OF NEUROINFLAMMATION, vol. 12, no. 139, 2015
DAVILA ET AL., SCI TRANSL MED, vol. 6, 2014, pages 224ra25
DAVILLA ET AL., SCIENCE TRANSLATIONAL MEDICINE, vol. 6, no. 224, 2014, pages 224ra25
DE FELIPE ET AL., TRAFFIC, vol. 5, 2004, pages 616 - 626
DIGHIEROHAMBLIN, THE LANCET, vol. 371, 2008, pages 1017 - 1029
DOBBER ET AL., CELL IMMUNOL, vol. 160, no. 2, February 1995 (1995-02-01), pages 185 - 92
EISENHAUER ET AL., EUR J CANCER, vol. 45, no. 2, 2009, pages 228 - 247
ENGELMAN ET AL., J VIROL, vol. 69, 1995, pages 2729
FEDOROV ET AL., SCI. TRANSL. MEDICINE, vol. 5, 2013, pages 215
FEDOROV ET AL., SCI. TRANSL. MEDICINE, vol. 5, no. 215, December 2013 (2013-12-01)
FELIPE, GENETIC VACCINES AND THER, vol. 2, no. 13, 2004
FLEISCHMANN ET AL., ANNALS OF THE RHEUMATIC DISEASES, vol. 65, no. 8, 2006, pages 1006 - 12
FOONTODD, BLOOD, vol. 68, no. 1, 1986, pages 1 - 31
GODIN ET AL., J BIOPHOTON, vol. 1, no. 5, 2008, pages 355 - 376
GONG ET AL., J EXP MED., vol. 186, no. 1, 7 July 1997 (1997-07-07), pages 131 - 137
GRUPP ET AL., N. ENGL. J. MED., vol. 368, 2013, pages 1509 - 1518
GUIDO CAVALETTIPAOLA MARMIROLI, NATURE REVIEWS NEUROLOGY, vol. 6, December 2010 (2010-12-01), pages 657 - 666
GUO ET AL., CONTEMP CLIN TRIALS, vol. 58, 2017, pages 23 - 33
HAEGEL ET AL., CANCER RES, no. 288, 2015
HALLEK ET AL., BLOOD, vol. 111, no. 12, 15 June 2008 (2008-06-15), pages 5446 - 5456
HALLEK ET AL., BLOOD, vol. 111, no. 12, 2018, pages 5446 - 5456
HARMURN, C. H. ET AL., NATURE, vol. 346, 1990, pages 776 - 777
HERMAN ET AL., J. IMMUNOLOGICAL METHODS, vol. 285, no. 1, 2004, pages 25 - 40
HOING ET AL., CELL STEM CELL, vol. 11, no. 5, 2 November 2012 (2012-11-02), pages 620 - 32
HOING ET AL., CELL STEM CELL., vol. 11, no. 5, 2 November 2012 (2012-11-02), pages 620 - 32
HOLLER ET AL., NAT IMMUNOL, vol. 4, 2003, pages 55 - 62
HOLLER ET AL., PROC NATL ACAD SCI USA, vol. 97, 2000, pages 5387 - 92
HONEGGER APLIICKTHUN A: "Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool", J MOL BIOL, vol. 309, no. 3, 8 June 2001 (2001-06-08), pages 657 - 70, XP004626893, DOI: 10.1006/jmbi.2001.4662
HUDECEK ET AL., CLIN. CANCER RES., vol. 19, 2013, pages 3153
HUNTER ET AL., J IMMUNOL., vol. 174, no. 11, 1 June 2005 (2005-06-01), pages 7368 - 75
JAIN ET AL., BLOOD, vol. 125, no. 13, 2015, pages 2062 - 2067
JANEWAY ET AL.: "Immunobiology: The Immune System in Health and Disease", 1997, CURRENT BIOLOGY PUBLICATIONS, pages: 4 - 33
JORES ET AL., PROC. NAT'L ACAD. SCI. U.S.A., vol. 87, 1990, pages 9138
KIVISAKK ET AL., NEUROLOGY, vol. 72, no. 22, 2 June 2009 (2009-06-02), pages 1922 - 1930
KLEBANOFF ET AL., J IMMUNOTHER, vol. 35, no. 9, 2012, pages 651 - 660
KOCHENDERFER ET AL., BLOOD, vol. 119, 2012, pages 2709 - 2720
KOCHENDERFER ET AL., J. IMMUNOTHERAPY, vol. 32, no. 7, 2009, pages 689 - 702
KOCHENDERFER ET AL., NATURE REVIEWS CLINICAL ONCOLOGY, vol. 10, 2013, pages 267 - 276
KOSTE ET AL., GENE THERAPY, 3 April 2014 (2014-04-03)
KOTB, CLINICAL MICROBIOLOGY REVIEWS, vol. 8, 1995, pages 411 - 426
KOVACS ET AL., J. CLIN. ONCOL., vol. 34, 2016, pages 3758 - 3765
KURUCZ, I ET AL., PNAS
LEE ET AL., BLOOD, vol. 124, no. 2, 2014, pages 188 - 95
LEFRANC ET AL., DEV. COMP. IMMUNOL., vol. 27, no. 55, 2003
LEFRANC MP ET AL.: "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains", DEV COMP IMMUNOL, vol. 27, no. 1, January 2003 (2003-01-01), pages 55 - 77, XP055585227, DOI: 10.1016/S0145-305X(02)00039-3
LI ET AL., NAT BIOTECHNOL, vol. 23, 2005, pages 349 - 54
LIU ET AL., NATURE BIOTECH, vol. 34, no. 4, April 2016 (2016-04-01), pages 430 - 434
LIU ET AL., NATURE BIOTECHNOLOGY, vol. 34, 2016, pages 430
LUPTON S. D. ET AL., MOL. AND CELL BIOL., vol. 11, no. 6, 1991
MANTHEY ET AL., MOL CANCER THER, vol. 8, no. 11, 2009, pages 3151 - 61
MANURI ET AL., HUM GENE THER, vol. 21, no. 4, 2010, pages 427 - 437
MARTIN ET AL.: "Modeling antibody hypervariable loops: a combined algorithm", PNAS, vol. 86, no. 23, 1989, pages 9268 - 9272, XP000165667, DOI: 10.1073/pnas.86.23.9268
MCWILLIAMS ET AL., J VIROL, vol. 77, 2003, pages 11150
MESA ET AL., NATURE REVIEWS DRUG DISCOVERY, vol. 11, no. 2, 2012, pages 103 - 104
MILLER, A. D., HUMAN GENE THERAPY, vol. 1, 1990, pages 5 - 14
MILLERROSMAN, BIOTECHNIQUES, vol. 7, 1989, pages 980 - 990
MONSKY ET AL., ANTICANCER RES, vol. 32, no. 11, 2012, pages 4951 - 4961
MULLER ET AL., BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, vol. 9, no. 11, 1999, pages 1625
OHNO ET AL., MOL CANCER THER, vol. 5, no. 11, 2006, pages 2634 - 43
OKEN ET AL., AM J CLIN ONCOL, vol. 5, 1982, pages 649 - 655
OZMEN ET AL., J IMMUNOL., vol. 150, no. 7, 1 April 1993 (1993-04-01), pages 2698 - 705
PARK ET AL., TRENDS BIOTECHNOL, vol. 11, 29 November 2011 (2011-11-29), pages 550 - 557
PHILPOTTTHRASHER, HUMAN GENE THERAPY, vol. 18, 2007, pages 483
PONOMAREV ET AL., NATURE MEDICINE, vol. 1, 2011, pages 64 - 70
PORTOLANO ET AL., J. IMMUNOL., vol. 150, 1993, pages 880 - 887
POWELLLEVIN, J VIROL, vol. 70, 1996, pages 5288
PRYER ET AL., PROC AM ASSOC CANCER RES
PUIGGROS ET AL., BIOMED RESEARCH INTERNATIONAL, vol. 2014, no. 2014
PYONTECK ET AL., NAT MED, vol. 19, no. 10, 2013, pages 1264 - 1272
RAMIREZ ET AL., J. NEUROSCI, vol. 25, no. 8, 2005, pages 1904 - 13
RIDDELL ET AL., HUMAN GENE THERAPY, vol. 3, 1992, pages 319 - 338
RIES ET AL., CANCER CELL, vol. 25, no. 6, 2014, pages 846 - 59
ROSENBERG, NAT REV CLIN ONCOL., vol. 8, no. 10, 2011, pages 577 - 85
ROVIDASBARBA, J CLIN CELL IMMUNOL, vol. 6, no. 6, 2015
S RENSEN ET AL., BR J CANCER, vol. 67, no. 4, 1993, pages 773 - 775
SADELAIN ET AL., CANCER DISCOV, vol. 3, no. 4, April 2013 (2013-04-01), pages 388 - 398
SANZ ET AL., BR J PHARMACOL, vol. 167, no. 8, 2012, pages 1702 - 1711
SCARPA ET AL., VIROLOGY, vol. 180, 1991, pages 849 - 852
SCHLUETER, C. J. ET AL., J. MOL. BIOL., vol. 256, 1996, pages 859 - 745
SCHULER ET AL.: "SYFPEITHI, Database for Searching and T-Cell Epitope Prediction", IMMUNOINFORMATICS METHODS IN MOLECULAR BIOLOGY, vol. 409, no. 1, 2007, pages 75 - 93
SHAHRARA ET AL., J IMMUNOL, vol. 180, 2008, pages 3447 - 3456
SHARMA ET AL., MOLEC THER NUCL ACIDS, vol. 2, 2013, pages e74
SINGHRAGHAVA, BIOINFORMATICS, vol. 17, no. 12, 2001, pages 1236 - 1237
SINGHRAGHAVA: "ProPred: prediction of HLA-DR binding sites", BIOINFORMATICS, vol. 17, no. 12, 2001, pages 1236 - 1237, XP002371461, DOI: 10.1093/bioinformatics/17.12.1236
SMITH ET AL., CANCER RES, no. 4889, 2016
SOO HOO, W. F. ET AL., PNAS (USA, vol. 89, 1992, pages 4759
THEMELI ET AL., NAT BIOTECHNOL., vol. 31, no. 10, 2013, pages 928 - 933
THOMPSONWIERDA, BLOOD, vol. 127, 2016, pages 279 - 286
TSUKAHARA ET AL., BIOCHEM BIOPHYS RES COMMUN, vol. 438, no. 1, 2013, pages 84 - 9
TURTLE ET AL., CURR. OPIN. IMMUNOL., vol. 24, no. 5, October 2012 (2012-10-01), pages 633 - 39
VALERA ET AL., J. NEUROINFLAMMATION, vol. 12, no. 93, 2015
VAN TEDELOO ET AL., GENE THERAPY, vol. 7, no. 16, 2000, pages 1431 - 1437
VERHOEYEN ET AL., METHODS MOL BIOL, vol. 506, 2009, pages 115 - 126
VON TRESCKOW ET AL., CLIN CANCER RES., vol. 21, no. 8, 2015
WADWA ET AL., J. DRUG TARGETING, vol. 3, no. 111, 1995
WANG ET AL., J. IMMUNOTHER., vol. 35, no. 9, 2012, pages 689 - 701
WIILFING, C.PLIICKTHUN, A., J. MOL. BIOL., vol. 242, 1994, pages 655
WINTER ET AL., ANN CLIN AND TRANSL NEUROL, 2016, pages 2328 - 9503
WU ET AL., CANCER, vol. 2, 18 March 2012 (2012-03-18), pages 160 - 75
XU ET AL., CANCER LETTERS, vol. 343, 2014, pages 172 - 78
YOUNGER ET AL., PAIN MED, vol. 10, no. 4, 2009, pages 663 - 672
YRJANHEIKKI ET AL., PNAS, vol. 95, no. 26, 1998, pages 15769 - 15774
ZHENG ET AL.: "Protein L", J. TRANSL. MED., vol. 10, February 2012 (2012-02-01), pages 29
ZUFFEREY ET AL., J VIROL, vol. 72, 1998, pages 8150

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023230548A1 (en) * 2022-05-25 2023-11-30 Celgene Corporation Method for predicting response to a t cell therapy

Also Published As

Publication number Publication date
AU2020395318A1 (en) 2022-06-09
US20230053787A1 (en) 2023-02-23
KR20220132527A (ko) 2022-09-30
MX2022006715A (es) 2022-09-23
JP7605840B2 (ja) 2024-12-24
CN115398231A (zh) 2022-11-25
BR112022010310A2 (pt) 2022-08-16
IL293393A (en) 2022-07-01
EP4070097A1 (en) 2022-10-12
JP2023504737A (ja) 2023-02-06

Similar Documents

Publication Publication Date Title
US12168027B2 (en) Methods associated with tumor burden for assessing response to a cell therapy
EP3886894B1 (en) Methods for dosing and treatment of b cell malignancies in adoptive cell therapy
US20210198372A1 (en) Methods for dosing and for modulation of genetically engineered cells
EP3548084B1 (en) Methods for determining car-t cells dosing
CA3120869A1 (en) Methods for treatment using adoptive cell therapy
CA3064597A1 (en) Articles of manufacture and methods related to toxicity associated with cell therapy
JP7605840B2 (ja) B細胞性悪性疾患を処置するための細胞療法と関連する毒性および奏効に関係する方法
WO2022133030A1 (en) Combination therapy of a cell therapy and a bcl2 inhibitor
KR20260005874A (ko) 전신 자가면역 질환을 치료하기 위한 세포 요법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20829465

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022534164

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022010310

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2020395318

Country of ref document: AU

Date of ref document: 20201204

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020829465

Country of ref document: EP

Effective date: 20220706

ENP Entry into the national phase

Ref document number: 112022010310

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20220526

WWW Wipo information: withdrawn in national office

Ref document number: 2020829465

Country of ref document: EP