WO2021113390A1 - Compositions pour le traitement de maladies - Google Patents

Compositions pour le traitement de maladies Download PDF

Info

Publication number
WO2021113390A1
WO2021113390A1 PCT/US2020/062930 US2020062930W WO2021113390A1 WO 2021113390 A1 WO2021113390 A1 WO 2021113390A1 US 2020062930 W US2020062930 W US 2020062930W WO 2021113390 A1 WO2021113390 A1 WO 2021113390A1
Authority
WO
WIPO (PCT)
Prior art keywords
fold
polynucleotide
engineered polynucleotide
engineered
rna
Prior art date
Application number
PCT/US2020/062930
Other languages
English (en)
Inventor
David HUSS
Susan BRYNE
Rafael Ponce
Original Assignee
Shape Therapeutics Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shape Therapeutics Inc. filed Critical Shape Therapeutics Inc.
Publication of WO2021113390A1 publication Critical patent/WO2021113390A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04004—Adenosine deaminase (3.5.4.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3519—Fusion with another nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/531—Stem-loop; Hairpin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/33—Alteration of splicing

Definitions

  • compositions and methods for treating or preventing Duchenne Muscular Dystrophy (DMD) in a subject in need thereof can comprise administering to a subject an engineered polynucleotide or a vector encoding the engineered polynucleotide.
  • an engineered polynucleotide can be at least partially complementary to a target pre-mRNA associated with DMD.
  • an engineered polynucleotide can be configured to recruit an RNA editing entity that edits a base of a nucleotide of the target pre-mRNA.
  • an engineered polynucleotide can at least transiently at least partially hybridize to a target pre-mRNA; and/or an engineered polynucleotide can facilitates an edit of a nucleotide of base in a target pre-mRNA when transfected into a cell, thereby facilitating exon skipping of an exon of a target pre-mRNA.
  • exon skipping can be determined by an in vitro assay that can comprise: inserting PCR primers and probes into a cell comprising the target pre-mRNA, and detecting whether the exon is present or skipped within a mature mRNA derived from the target pre-mRNA.
  • an RNA editing entity can be an ADAR polypeptide.
  • an ADAR polypeptide can be an ADARl polypeptide.
  • an ADAR polypeptide can be an ADAR2 polypeptide.
  • an engineered polynucleotide can comprise a stem-loop configured to recruit an RNA editing entity.
  • a stem-loop can comprise a GluR2 polynucleotide sequence.
  • a GluR2 polynucleotide sequence can be present on a 5’ end of an engineered polynucleotide. In some aspects, a GluR2 polynucleotide sequence can be present on a 3’ end of an engineered polynucleotide. In some aspects, a GluR2 polynucleotide sequence can be present on a 5’ end and a 3’ end of an engineered polynucleotide. In some aspects, an administering can be a parenteral administering. In some aspects, a parenteral administering can comprise an intramuscular injection or an intravenous injection.
  • an engineered polynucleotide can comprises a polynucleotide sequence with at least 90% sequence identity to any one of SEQ ID NO: 1-14.
  • a subject can be human.
  • a method can be a method of treating DMD.
  • a method can be a method of preventing DMD.
  • an engineered polynucleotide can be from about 20 nucleotides to about 300 nucleotides in length.
  • an engineered polynucleotide when at least partially hybridized to a target pre-mRNA can comprise a mismatch.
  • a mismatch can be an adenosine-cytosine mismatch.
  • an administering can be repeated at least once within a time period of about 1 year.
  • a base of a nucleotide that is edited by an RNA editing entity can be in an exon of a target pre-mRNA.
  • a base of a nucleotide that is edited by an RNA editing entity can be in an intron of a target pre-mRNA.
  • a base of a nucleotide that is edited by an RNA editing entity can be in a splice acceptor site of a target pre-mRNA.
  • a method can comprise administering to a subject an engineered polynucleotide or a vector encoding the engineered polynucleotide.
  • an engineered polynucleotide can comprise a recruiting domain that comprises a GluR2 polynucleotide sequence on a 5’ end and a 3’ end of an engineered polynucleotide.
  • a recruiting domain can be configured to recruit an RNA editing entity.
  • an engineered polynucleotide can at least transiently at least partially hybridize to a target RNA associated with Stargardt Disease or CMT1 A.
  • an engineered polynucleotide can facilitate an edit of a base of a nucleotide of a target RNA via an RNA editing entity, wherein an edit can be sufficient to treat or prevent Stargardt disease or CMT1 A in a subject.
  • an RNA editing entity can be an ADAR polypeptide.
  • an ADAR polypeptide can be an ADARl polypeptide.
  • an ADAR polypeptide can be an ADAR2 polypeptide.
  • an administering can be a parenteral administering.
  • a parenteral administering can comprise an intramuscular injection or an intravenous injection.
  • an engineered polynucleotide can comprises a polynucleotide sequence with at least 90% sequence identity to SEQ ID NO: 15 or SEQ ID NO: 16.
  • a subject can be human.
  • a method can be a method of treating Stargardt disease.
  • a method can be a method of preventing Stargardt disease.
  • an administering can be subretinal, intraorbital, or intravitral.
  • a method can be a method of treating CMT1 A.
  • a method can be a method of preventing CMT1 A.
  • an administering can be intrathecal.
  • an engineered polynucleotide can be from about 20 nucleotides to about 300 nucleotides in length. In some aspects, an engineered polynucleotide when at least partially hybridized to a target RNA can comprise a mismatch. In some aspects, a mismatch can be an adenosine-cytosine mismatch. In some aspects, an administering can be repeated at least once within a time period of about 1 year. [0004] Also provided herein are engineered polynucleotides that can comprise a targeting portion that can be at least partially complementary to a target pre-mRNA associated with Duchenne Muscular Dystrophy (DMD).
  • DMD Duchenne Muscular Dystrophy
  • an engineered polynucleotide can be configured to recruit an RNA editing entity.
  • an engineered polynucleotide when contacted with an RNA editing entity and a target pre-mRNA can be configured to facilitate exon skipping of an exon of a target pre-mRNA.
  • exon skipping can be determined by an in vitro assay that can comprise: inserting PCR primers and probes into a cell comprising a target pre-mRNA, and detecting whether an exon is present or skipped within a mature mRNA derived from a target pre-mRNA.
  • an RNA editing entity can be an ADAR polypeptide.
  • an ADAR polypeptide can be an ADARl polypeptide.
  • an ADAR polypeptide can be an ADAR2 polypeptide.
  • a an engineered polynucleotide can further comprise a stem-loop configured to recruit the RNA editing entity.
  • a stem-loop can comprise a GluR2 polynucleotide sequence.
  • a GluR2 polynucleotide sequence can be present on a 5’ end of an engineered polynucleotide.
  • a GluR2 polynucleotide sequence can be present on a 3’ end of an engineered polynucleotide.
  • a GluR2 polynucleotide sequence can be present on a 5’ end and a 3’ end of an engineered polynucleotide.
  • an engineered polynucleotide can comprise a polynucleotide sequence with at least 90% sequence identity to any one of SEQ ID NO: 1-14.
  • an engineered polynucleotide can be from about 20 nucleotides to about 300 nucleotides in length.
  • an engineered polynucleotide when at least partially hybridized to a target pre-mRNA can comprise a mismatch.
  • a mismatch can be an adenosine-cytosine mismatch.
  • a targeting portion of an engineered polynucleotide can be at least partially complementary to an exon of a target pre-mRNA. In some aspects, a targeting portion of an engineered polynucleotide can be at least partially complementary to an intron of a target pre- mRNA. In some aspects, a targeting portion of an engineered polynucleotide can be at least partially complementary to a splice acceptor site of a target pre-mRNA.
  • engineered polynucleotides that can comprise a targeting domain that can be configured to at least transiently at least partially hybridize to a target RNA associated with Stargardt Disease.
  • an engineered polynucleotide can comprise a recruiting domain that can comprise a GluR2 polynucleotide sequence on a 5’ end and a 3’ end of an engineered polynucleotide.
  • a recruiting domain can be configured to recruit an RNA editing entity.
  • an engineered polynucleotide when contacted with an RNA editing entity and a target RNA can be configured to facilitate an editing of a base of a nucleotide of a target RNA.
  • an engineered polynucleotide can comprise a polynucleotide sequence with at least 90% sequence identity to SEQ ID NO: 15.
  • a target RNA can comprise an RNA encoded by an ABCA4 gene.
  • an editing can be sufficient to increase a level of a polypeptide encoded by a target RNA, relative to a level of polypeptide produced by an otherwise comparable RNA lacking an edit.
  • an RNA editing entity can be an ADAR polypeptide.
  • an ADAR polypeptide can be an ADARl polypeptide.
  • an ADAR polypeptide can be an ADAR2 polypeptide.
  • engineered polynucleotides that can comprise a targeting domain that can be configured to at least transiently at least partially hybridize to a target RNA associated with CMT1 A.
  • an engineered polynucleotide can comprise a recruiting domain that can comprise a GluR2 polynucleotide sequence on a 5’ end and a 3’ end of an engineered polynucleotide.
  • a recruiting domain can be configured to recruit an RNA editing entity.
  • an engineered polynucleotide when contacted with an RNA editing entity and a target RNA can be configured to facilitate an editing of a base of a nucleotide of a target RNA.
  • an engineered polynucleotide can comprise a polynucleotide sequence with at least 90% sequence identity to SEQ ID NO: 16.
  • a target RNA can comprise an RNA encoded by an PMP22 gene.
  • an editing can be sufficient to reduce a level of a polypeptide encoded by a target RNA, relative to a level of polypeptide produced by an otherwise comparable RNA lacking an edit.
  • an RNA editing entity can be an ADAR polypeptide.
  • an ADAR polypeptide can be an ADARl polypeptide.
  • an ADAR polypeptide can be an ADAR2 polypeptide.
  • a vector encoding an engineered polynucleotide described herein.
  • a vector can be an adeno-associated viral (AAV) vector.
  • AAV adeno-associated viral
  • compositions in unit dose form can comprise an engineered polynucleotide as described herein or a vector as described herein, and a pharmaceutically acceptable excipient, diluent, or carrier.
  • kits that can comprise an engineered polynucleotide described herein in a container, a vector described herein in a container, or a pharmaceutical composition described herein in a container.
  • methods of making a kit which can comprise contacting an engineered polynucleotide described herein, a vector described herein, or a pharmaceutical composition described herein, with a container.
  • FIGS. 1A and IB are images illustrating the design of primers and probes for establishment of a readout assay that can indicate the presence or precise skipping of DMD exon 71 or exon 74 (FIG. 1A) followed by ddPCR (droplet digital PCR) analyses of DMD exon 71 and exon 74 skipping in mRNA from human skeletal muscle, HEK-293T cells, and undifferentiated and differentiated RD rhabdomyosarcoma cells (FIG. IB). Undifferentiated RD cells overexpressing cDNA fragments of the indicated DMD exon skipping isoforms were used as controls to demonstrate the specificity of the assay.
  • ddPCR droplet digital PCR
  • FIGS. 2A and 2B are images illustrating the increased frequency of DMD exon 71 skipping (FIG. 2A) and the increased frequency of DMD exon 74 skipping (FIG. 2B) in the presence of antisense guide RNAs of varying lengths, position, and number of GluR2 hairpins.
  • the frequency of exon 71 skipping (FIG. 2A) and exon 74 skipping (FIG. 2B) was further increased in the presence of overexpressed ADAR2 compared to the control protein GFP (endogenous ADAR levels).
  • FIGS. 3A and 3B are images illustrating the increased frequency of DMD exon 71 skipping (FIG. 3A) and the increased frequency of DMD exon 74 skipping (FIG. 3B) in the presence of antisense guide RNAs of 100 bp length, centered around the target base (@50), with a varying number of GluR2 hairpins.
  • the frequency of exon 71 skipping (FIG. 3A) and exon 74 skipping (FIG. 3B) was further increased in the presence of overexpressed ADARl pi 50, ADARl p110 and ADAR2 compared to the control protein GFP (endogenous ADAR levels).
  • FIG. 4 A and 4B are images illustrating DMD exon 71 skipping (FIG. 4 A) and DMD exon 74 skipping (FIG. 4B) antisense guide RNAs of varying lengths, position, and number of GluR2 hairpins in undifferentiated RD cells with endogenous ADAR (GFP) or ADAR2 overexpression.
  • FIG. 4C illustrates undifferentiated and differentiated human RD rhabdomyosarcoma cells.
  • FIG. 4D represents ddPCR assays showing that the differentiated RD cells express a full length DMD Dp427m isoform upon differentiation.
  • FIGS. 5A and 5B are images illustrating the schematic for exon 51 skipping in DMD mRNA (FIG. 5A) and the design of the engineered polynucleotide (adRNA) for mediating exon 51 skipping in the DMD mRNA (FIG. 5B).
  • adRNA engineered polynucleotide
  • FIG. 6A is an image illustrating the engineered polynucleotide (adRNA) for mediating the correction of a mutation in the ABCA4 mRNA at the c.5882G>A site.
  • adRNA engineered polynucleotide
  • FIG. 7A is an image illustrating the engineered polynucleotide (adRNA) for mediating the ablation of the start site in the PMP22 mRNA.
  • a method as described herein can comprise administering an engineered polynucleotide as described herein or a vector encoding an engineered polynucleotide as described herein.
  • an engineered polynucleotide as described herein can recruit an RNA editing entity and facilitate an editing of a base of a nucleotide on a target RNA via the RNA editing entity.
  • a target RNA can be chosen based on the disease to be treated, and as such a target RNA can be an RNA that encodes a polypeptide implicated in the disease.
  • Administration of the engineered polynucleotide or vector, which produces the editing of the base of the target RNA, can be used as a treatment to treat the disease in the subject, and can be used as a prophylactic therapeutic to prevent the disease in the subject.
  • an engineered polynucleotide can be utilized for RNA editing, for example to prevent or treat a disease or condition (e.g. DMD, Stargardt Disease, and CMT1 A).
  • a disease or condition e.g. DMD, Stargardt Disease, and CMT1 A.
  • an engineered polynucleotide can be used in association with a subject RNA editing entity to edit a target RNA or modulate expression of a polypeptide encoded by the target RNA. In some cases, an engineered polynucleotide can be used in association with a subject RNA editing entity to bind to an intron or exon of a target pre-mRNA.
  • an engineered polynucleotide can be used in association with a subject RNA editing entity to bind to a target pre-mRNA and to facilitate an edit of a base of a nucleotide on a splice acceptor site; a branch point adenosine; an exon; an intron; an exonic or an intronic splice enhancers or inhibitor sequences; or any combination thereof, thereby inducing the skipping of the exon in the target mRNA.
  • RNA editing entity such as ADAR polypeptides or biologically active fragments thereof can be recruited by an engineered polynucleotide as described herein to perform an edit of a nucleotide of a base in a target RNA.
  • an edit can be a deamination of a base (e.g. a deamination of an adenosine).
  • An editing of a nucleotide of a base in the target RNA by the RNA editing entity can facilitate correction of a mutation in a target RNA and/or facilitate modulation of an expression of a polypeptide encoded by the target RNA.
  • editing of a base of a nucleotide comprised in an exon or an intron of a target pre-mRNA by the RNA editing entity can facilitate exon skipping of the exon.
  • An engineered polynucleotide provided herein can be configured, upon hybridization to a target RNA, to form, at least in part, a double stranded substrate with at least a portion of the target RNA.
  • a double stranded substrate can comprise at least one mismatch between the hybridized engineered polynucleotide and the target RNA.
  • a mismatch can include an adenosine-cytosine mismatch.
  • an adenosine in an adenosine-cytosine mismatch can be the site in which editing by an RNA editing entity occurs.
  • an engineered polynucleotide can be designed such that a cytosine in present site specifically opposite an adenosine to be edited.
  • Editing of a nucleotide of a base in a target RNA by an RNA editing entity can facilitate a correction of a mutation in the target RNA.
  • a target RNA at least partially encodes a dystrophin polypeptide.
  • an RNA editing entity can facilitate the correction of a mutation in the DMD mRNA that encodes at least in part the dystrophin polypeptide.
  • a target RNA at least partially encodes an ABCA4 polypeptide.
  • an RNA editing entity can facilitate the correction of a mutation in the ABCA4 mRNA that encodes at least in part the ABCA4 polypeptide.
  • a target RNA at least partially encodes a PMP22 polypeptide.
  • an RNA editing entity can facilitate the correction of a mutation in the PMP22 mRNA that encodes at least in part the PMP22 polypeptide.
  • nucleotide base editing can be configured to edit the first amino acid (methionine) of the PMP22 polypeptide encoded by the target RNA, thereby reducing the amount of the polypeptide expressed by the target RNA.
  • range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
  • the term “about” a number refers to that number plus or minus 10% of that number.
  • the term “about” a range refers to that range minus 10% of its lowest value and plus 10% of its greatest value.
  • “Canonical amino acids” refer to those 20 amino acids that occur in nature, including for example, the amino acids shown in Table 1.
  • complementary or “complementarity” can refer to the ability of a nucleic acid to form one or more bonds with a corresponding nucleic acid sequence by, for example, hydrogen bonding (e.g., traditional Watson-Crick), covalent bonding, or other similar methods.
  • a double hydrogen bond forms between nucleobases T and A, whereas a triple hydrogen bond forms between nucleobases C and G.
  • the sequence A-G-T can be complementary to the sequence T-C-A.
  • a percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson- Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively).
  • Perfectly complementary can mean that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
  • “Substantially complementary” as used herein can refer to a degree of complementarity that can be at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. 97%, 98%, 99%, or 100% over a region of 10, 15, 20, 25, 30, 35, 40, 45, 50, or more nucleotides, or can refer to two nucleic acids that hybridize under stringent conditions (i.e., stringent hybridization conditions). Nucleic acids can include nonspecific sequences. As used herein, the term “nonspecific sequence” or “not specific” can refer to a nucleic acid sequence that contains a series of residues that can be not designed to be complementary to or can be only partially complementary to any other nucleic acid sequence.
  • determining means determining if an element is present or not (for example, detection). These terms can include quantitative, qualitative or quantitative and qualitative determinations. Assessing can be relative or absolute. “Detecting the presence of’ can include determining the amount of something present in addition to determining whether it is present or absent depending on the context.
  • encode can refer to an ability of a polynucleotide to provide information or instructions sequence sufficient to produce a corresponding gene expression product.
  • mRNA can encode for a polypeptide during translation
  • DNA can encode for an mRNA molecule during transcription.
  • an “stem loop” can refer to a structure formed in an RNA duplex where nucleotides on one RNA strand are not complementary to their positional counterpart on the opposite strand and where one side of the stem loop has greater than 5 nucleotides. In some cases, the entire length of the stem loop can range 10 to 800 nucleotides.
  • an stem loop refers can be the structure formed upon formation of the dsRNA substrate, where nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts on the opposite strand and where one side of the stem loop, either on the target RNA side or the engineered guide RNA side of the dsRNA substrate, has greater than 5 nucleotides.
  • a stem loop may be a symmetrical stem loop or an asymmetrical stem loop.
  • a “symmetrical stem loop” can refer to a stem loop where the same number of nucleotides is present on each side of the stem loop.
  • An asymmetrical stem loop can refer to a stem loop where a different number of nucleotides is present on each side of the stem loop.
  • hairpin can refer to an RNA duplex wherein a single RNA strand has folded in upon itself to form the RNA duplex.
  • the single RNA strand folds upon itself due to having nucleotide sequences upstream and downstream of the folding region base pair to each other.
  • a hairpin can be comprised in a stem loop structure.
  • the length of the entire duplex structure can be from 10 to 150 nucleotides.
  • a hairpin may refer to a recruitment hairpin, a hairpin, or a non recruitment hairpin, or any combination thereof.
  • a “recruitment hairpin” can refer to a hairpin which recruits an RNA editing entity (e.g., an ADAR).
  • a “recruitment hairpin” can be a GluR2 domain.
  • mismatch refers to any two nucleotides that do not base pair.
  • mismatch can refer to a nucleotide in a guide RNA that is unpaired to an opposing nucleotide in a target RNA within a dsRNA substrate disclosed herein.
  • a mismatch can comprise any two nucleotides that do not base pair.
  • a mismatch is an A/C mismatch.
  • an A/C mismatch comprises a C in an engineered guide RNA of the present disclosure opposite an A in a target RNA.
  • an A/C mismatch comprises an A in an engineered guide RNA of the present disclosure opposite an C in a target RNA.
  • a G/G mismatch comprises a G in an engineered guide RNA of the present disclosure opposite a G in a target RNA.
  • a mismatch positioned 5’ of the edit site may facilitate base-flipping of the target A to be edited. A mismatch may also help confer sequence specificity.
  • “Homology” or “identity” or “similarity” can refer to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which can be aligned for purposes of comparison. When a position in the compared sequence can be occupied by the same base or amino acid, then the molecules can be homologous at that position. A degree of homology between sequences can be a function of the number of matching or homologous positions shared by the sequences. An “unrelated” or “non-homologous” sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences of the disclosure. Sequence homology can refer to a % identity of a sequence to a reference sequence.
  • any particular sequence can be at least 50%, 60%, 70%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to any sequence described herein (which can correspond with a particular nucleic acid sequence described herein), such particular polypeptide sequence can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711).
  • the parameters can be set such that the percentage of identity can be calculated over the full length of the reference sequence and that gaps in sequence homology of up to 5% of the total reference sequence can be allowed.
  • the identity between a reference sequence (query sequence, i.e., a sequence of the disclosure) and a subject sequence, also referred to as a global sequence alignment can be determined using the FASTDB computer program-based son the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
  • the subject sequence can be shorter than the query sequence due to N- or C-terminal deletions, not because of internal deletions, a manual correction can be made to the results to take into consideration the fact that the FASTDB program does not account for N- and C-terminal truncations of the subject sequence when calculating global percent identity.
  • the percent identity can be corrected by calculating the number of residues of the query sequence that can be lateral to the N- and C-terminal of the subject sequence, which can be not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence.
  • a determination of whether a residue can be matched/aligned can be determined by results of the FASTDB sequence alignment. This percentage can be then subtracted from the percent identity, calculated by the FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score can be used for the purposes of this embodiment. In some cases, only residues to the N- and C-termini of the subject sequence, which can be not matched/aligned with the query sequence, can be considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest bl and C-terminal residues of the subject sequence can be considered for this manual correction.
  • a 90-residue subject sequence can be aligned with a 100-residue query sequence to determine percent identity.
  • the deletion occurs at the N-terminus of the subject sequence, and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus.
  • the 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C-termini not matched/total number of residues in the query sequence) so 10% can be subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched, the final percent identity can be 90%.
  • a 90-residue subject sequence can be compared with a 100-residue query sequence.
  • deletions can be internal deletions, so there can be no residues at the N- or C-termini of the subject sequence which can be not matched/aligned with the query.
  • percent identity calculated by FASTDB can be not manually corrected.
  • residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which can be not matched/aligned with the query sequence can be manually corrected for.
  • RNA molecules comprising a sequence that encodes a polypeptide or protein.
  • RNA is transcribed from DNA.
  • precursor mRNA containing non-protein coding regions in the sequence are transcribed from DNA and then processed to remove all or a portion of the non-coding regions (introns) to produce mature mRNA.
  • pre-mRNA refers to the RNA molecule transcribed from DNA before undergoing processing to remove the non-protein coding regions.
  • RNA sequence is interchangeable with a similar RNA sequence.
  • RNA sequence is interchangeable with a similar DNA sequence.
  • Us and Ts may be interchanged in a sequence provided herein.
  • the term “mutation” as used herein, can refer to an alteration to a nucleic acid sequence or a polypeptide sequence that is relative to a reference sequence. A mutation can occur in a DNA molecule, an RNA molecule (e.g., tRNA, mRNA), or in a polypeptide or protein, or any combination thereof.
  • the reference sequence can be obtained from a database such as the NCBI Reference Sequence Database (RefSeq) database.
  • Specific changes that can constitute a mutation can include a substitution, a deletion, an insertion, an inversion, or a conversion in one or more nucleotides or one or more amino acids.
  • Non-limiting examples of mutations in a nucleic acid sequence that, without the mutation, encodes for a polypeptide sequence include: “missense” mutations that can result in the substitution of one codon for another, a “nonsense” mutations that can change a codon from one encoding a particular amino acid to a stop codon (which can result in truncated translation of proteins), or a “silent” mutations that can be those which have no effect on the resulting protein.
  • the mutation can be a “point mutation,” which can refer to a mutation affecting only one nucleotide in a DNA or RNA sequence.
  • the mutation can be a “splice site mutations,” which can be present in a pre-mRNA (prior to processing to remove introns) resulting in mistranslation and often truncation of proteins from incorrect delineation of the splice site.
  • the mutation can be a fusion gene.
  • a fusion pair or a fusion gene can result from a mutation, such as a translocation, an interstitial deletion, a chromosomal inversion, or any combination thereof.
  • a mutation can constitute variability in the number of repeated sequences, such as triplications, quadruplications, or others.
  • a mutation can be an increase or a decrease in a copy number associated with a given sequence (i.e., copy number variation, or CNV).
  • a mutation can include two or more sequence changes in different alleles or two or more sequence changes in one allele.
  • a mutation can include two different nucleotides at one position in one allele, such as a mosaic.
  • a mutation can include two different nucleotides at one position in one allele, such as a chimeric.
  • a mutation can be present in a malignant tissue.
  • a mutation can comprise a single nucleotide variation (SNV).
  • a mutation can comprise a sequence variant, a sequence variation, a sequence alteration, or an allelic variant.
  • a presence or an absence of a mutation can indicate an increased risk to develop a disease or condition.
  • a presence or an absence of a mutation can indicate a presence of a disease or condition.
  • a mutation can be present in a benign tissue. Absence of a mutation may indicate that a tissue or sample can be benign. As an alternative, absence of a mutation may not indicate that a tissue or sample can be benign. Methods as described herein can comprise identifying a presence of a mutation in a sample.
  • polynucleotide and “oligonucleotide” can be used interchangeably and can refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or analogs thereof. Polynucleotides can have any three-dimensional structure and may perform any function, known or unknown.
  • polynucleotides a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, RNAi, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers.
  • a polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs.
  • modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide.
  • the sequence of nucleotides can be interrupted by non nucleotide components.
  • a polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component.
  • the term can also refer to both double- and single- stranded molecules. Unless otherwise specified or required, any embodiment of this disclosure that can be a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form. [0042]
  • a polynucleotide can be composed of a specific sequence of nucleotides.
  • a nucleotide comprises a nucleoside and a phosphate group.
  • a nucleotide comprises a sugar (e.g., ribose or 2’deoxyribose) and a nucleobase, such as a nitrogenous base.
  • nucleobases include adenine (A), cytosine (C), guanine (G), thymine (T), uracil (U), and inosine (I).
  • I is formed when hypoxanthine is attached to ribofuranose via a P- N9-glycosidic bond, resulting in the chemical structure:
  • the terms “engineered polynucleotide” and “engineered guide” can be used interchangeably to refer to polynucleotide-based therapeutics described in the present disclosure.
  • the term “protein”, “peptide” and “polypeptide” can be used interchangeably and in their broadest sense can refer to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics. The subunits may be linked by peptide bonds. In another embodiment, the subunit may be linked by other bonds, e.g., ester, ether, etc. A protein or peptide may contain at least two amino acids and no limitation is placed on the maximum number of amino acids which may comprise a protein’s or peptide's sequence.
  • amino acid can refer to either natural amino acids, unnatural amino acids, or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics.
  • stop codon can refer to a three-nucleotide contiguous sequence within messenger RNA that signals a termination of translation.
  • Non-limiting examples include in RNA, UAG (amber), UAA (ochre), UGA (umber, also known as opal) and in DNA TAG, TAA or TGA.
  • the term can also include nonsense mutations within DNA or RNA that introduce a premature stop codon, causing any resulting protein to be abnormally shortened.
  • a “subject” can be a biological entity containing expressed genetic materials.
  • the biological entity can be a plant, animal, or microorganism, including, for example, bacteria, viruses, fungi, and protozoa.
  • the subject can be tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro.
  • the subject can be a mammal.
  • the mammal can be a human.
  • the subject may be diagnosed or suspected of being at high risk for a disease. In some cases, the subject is not necessarily diagnosed or suspected of being at high risk for the disease [0047]
  • the term “ in vivo ” is used to describe an event that takes place in a subject’s body.
  • ex vivo is used to describe an event that takes place outside of a subject’s body.
  • An ex vivo assay is not performed on a subject. Rather, it is performed upon a sample separate from a subject.
  • An example of an ex vivo assay performed on a sample is an “in vitro ” assay.
  • in vitro is used to describe an event that takes places contained in a container for holding laboratory reagent such that it is separated from the biological source from which the material is obtained.
  • in vitro assays can encompass cell-based assays in which living or dead cells are employed.
  • In vitro assays can also encompass a cell-free assay in which no intact cells are employed.
  • treatment or “treating” are used in reference to a pharmaceutical or other intervention regimen for obtaining beneficial or desired results in the recipient.
  • beneficial or desired results include but are not limited to a therapeutic benefit and/or a prophylactic benefit.
  • a therapeutic benefit may refer to eradication or amelioration of symptoms or of an underlying disorder being treated.
  • a therapeutic benefit can be achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the subject, notwithstanding that the subject may still be afflicted with the underlying disorder.
  • a prophylactic effect includes delaying, preventing, or eliminating the appearance of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or any combination thereof.
  • a subject at risk of developing a particular disease, or to a subject reporting one or more of the physiological symptoms of a disease may undergo treatment, even though a diagnosis of this disease may not have been made.
  • an engineered polynucleotide disclosed herein can comprise a targeting region that is at least partially complementary to a target RNA or a target pre-mRNA as described herein.
  • an engineered polynucleotide can comprise at least one RNA-editing enzyme recruiting domain.
  • an engineered polynucleotide can comprise at least one nucleotide mismatch.
  • an engineered guide can be configured to facilitate editing of a nucleotide base of a mismatched nucleotide.
  • An engineered polynucleotide as described herein can be designed for treatment of Duchenne Muscular Dystrophy.
  • an engineered polynucleotide designed for treatment of DMD can comprise at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a polynucleotide sequence of any one of SEQ ID NO: 1-14 recited in Table 3 .
  • Such an engineered polynucleotide can comprise a targeting region that is at least partially complementary to a target DMD RNA (e.g.
  • an engineered polynucleotide for treating DMD can further comprise at least one RNA-editing enzyme recruiting domain.
  • an engineered polynucleotide can be configured to facilitated exon skipping of an exon of a target pre-mRNA via editing of a base of a nucleotide of an RNA editing entity (e.g. of a nucleotide comprised in a splice acceptor site; a branch point adenosine; an exon; an intron; an exonic or an intronic splice enhancers or inhibitor sequences; or any combination thereof).
  • Such editing can promote alternative splicing of a DMD pre- mRNA.
  • the alternative splicing can produce a mature mRNA that corrects the frameshift.
  • the alternative splicing can produce a mature mRNA that does not comprise the exon with the premature stop codon. Accordingly, the editing and subsequent exon skipping can produce an increase in functional dystrophin polypeptide, thereby treating or preventing DMD.
  • Functional dystrophin polypeptide can be a truncated polypeptide relative to dystrophin produced in healthy subject whose DMD mRNA did not comprise the frameshift or premature stop codon.
  • the editing of the DMD pre-mRNA can induce or promote the skipping of one or more exons selected from exon 51, 53, 45, 44, 52, 50, 43, 55, 8, 2, 6, 7, 71 and/or 74 in the Dystrophin mRNA.
  • the increase in the frequency of skipping of one or more exons from the Dystrophin mRNA can lead to an increase in the expression of a functional Dystrophin protein in the subject or a cell in the subject.
  • exon skipping via editing of the DMD pre- mRNA by administration of the engineered polynucleotide to a subject can treat or prevent DMD in the subject.
  • An engineered polynucleotide as described herein can be designed for treatment of CMT1 A.
  • Such an engineered polynucleotide can comprise (a) at least one RNA-editing enzyme recruiting domain and (b) a targeting region that is at least partially complementary to a target PMP22 mRNA.
  • an engineered polynucleotide designed for treatment of CMT1 A can comprise at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a polynucleotide sequence of SEQ ID NO: 16 recited in Table 3.
  • a targeting region can comprise at least one nucleotide mismatch with respect to the target RNA.
  • an engineered polynucleotide can be configured to facilitate editing of a base of a nucleotide of the target RNA (e.g. at the mismatched nucleotide) via association with an RNA editing entity.
  • Base editing can be used to modulate the expression level of PMP22 polypeptide expressed from the target RNA.
  • the nucleotide base editing by the RNA editing entity can be configured to edit the first amino acid (methionine) of the PMP22 polypeptide encoded by the target RNA, thereby reducing the amount of the polypeptide expressed by the target RNA.
  • reducing the amount of PMP22 via the nucleotide base editing via administration of the engineered polynucleotide to a subject can treat or prevent CMT1 A in the subject.
  • An engineered polynucleotide as described herein can be designed for treatment of Stargardt disease.
  • Such an engineered polynucleotide can comprise (a) at least one RNA-editing enzyme recruiting domain and (b) a targeting region that is at least partially complementary to a target ABCA4 mRNA.
  • an engineered polynucleotide designed for treatment of Stargardt disease can comprise at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a polynucleotide sequence of SEQ ID NO: 15 recited in Table 3.
  • a targeting region can comprise at least one nucleotide mismatch with respect to the target RNA.
  • an engineered polynucleotide can be configured to facilitate editing of a base of a nucleotide of the target RNA (e.g. at the mismatched nucleotide) via association with an RNA editing entity.
  • Nucleotide editing can be used to correct mutations in ABCA4 RNA that are implicated in the progression of Stargardt disease.
  • nucleotide editing can be used to correct point mutations at positions 1622, 2588, 3322, 4139, 5461, 5714, 5882, 6079, 6089, or 6320 of the ABCA4 gene.
  • Base editing can be used to modulate the expression level of ABCA4 polypeptide expressed from the target RNA.
  • nucleotide editing can be used to increase the amount of the functional polypeptide expressed by the target RNA.
  • increasing the amount of functional ABCA4 via the nucleotide base editing via administration of the engineered polynucleotide to a subject can treat or prevent Stargardt disease in the subject.
  • Engineered polynucleotides disclosed herein can be engineered in any way suitable for RNA editing.
  • an engineered polynucleotide can comprise at least a targeting sequence that allows it to hybridize to a region of a target RNA molecule.
  • a targeting sequence may also be referred to as a “targeting domain” or a “targeting region”.
  • a targeting sequence of an engineered polynucleotide allows the engineered polynucleotide to target an RNA sequence through base pairing, such as Watson Crick base pairing.
  • the targeting sequence can be located at either the N- terminus or C-terminus of the engineered guide. In some cases, the targeting sequence is located at both termini.
  • the targeting sequence can be of any length. In some cases, the targeting sequence can be at least about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,
  • the targeting sequence can be no greater than about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
  • an engineered guide comprises a targeting sequence that is about 75-100, 80-110, 90-120, or 95-115 nucleotides in length.
  • an engineered polynucleotide can comprise a targeting sequence that is about 100 nucleotides in length.
  • a targeting sequence can comprise at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to a target RNA. In some cases, a targeting sequence comprises less than 100% complementarity to a target RNA sequence. For example, a targeting sequence and a region of a target RNA that can be bound by the targeting sequence may have a single base mismatch. In other cases, the targeting sequence of a subject engineered polynucleotide comprises at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 20, 30, 40 or up to about 50 base mismatches. In other cases, the targeting sequence of a subject engineered polynucleotide comprises nor more than about 1, 2, 3, 4, 5, 6,
  • a targeting sequence comprises at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or up to about 15 nucleotides that differ in complementarity from a wildtype RNA of a subject target RNA. In some examples, a targeting sequence comprises no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides that differ in complementarity from a wildtype RNA of a subject target RNA.
  • an engineered polynucleotide can comprise an RNA editing entity recruiting sequence.
  • An RNA editing entity can be recruited by an RNA editing entity recruiting sequence on an engineered guide.
  • an engineered polynucleotide can be configured to facilitate editing of a base of a nucleotide of a polynucleotide of a region of a subject target RNA, modulation expression of a polypeptide encoded by the subject target RNA, or both.
  • an engineered guide can be configured to facilitate an editing of a base of a nucleotide or polynucleotide of a region of an RNA by a subject RNA editing entity.
  • an engineered polynucleotide of the disclosure may recruit an RNA editing entity.
  • an RNA editing entity recruiting domain can comprise a sequence that forms a structural motif that is recognized by the RNA editing entity.
  • an RNA editing entity recruiting domain can comprise a Glutamate ionotropic receptor AMPA type subunit 2 (GluR2) sequence.
  • the recruiting sequence can be utilized to position the RNA editing entity to effectively react with a subject target RNA after the targeting sequence, for example an antisense sequence, hybridizes to a target RNA.
  • a recruiting sequence can allow for transient binding of the RNA editing entity to the engineered guide.
  • the recruiting sequence allows for permanent binding of the RNA editing entity to the engineered guide.
  • a recruiting sequence can be of any length. In some cases, a recruiting sequence is from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
  • a recruiting sequence is no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67
  • a recruiting sequence is about 45 nucleotides in length. In some cases, at least a portion of a recruiting sequence comprises at least 1 to about 75 nucleotides. In some cases, at least a portion of a recruiting sequence comprises about 45 nucleotides to about 60 nucleotides.
  • an RNA editing entity recruiting sequence comprises a GluR2 sequence or functional fragment thereof.
  • a GluR2 sequence can be recognized by an RNA editing entity, such as an ADAR or biologically active fragment thereof.
  • a GluR2 sequence can be a non-naturally occurring sequence.
  • a GluR2 sequence can be modified, for example for enhanced recruitment.
  • a GluR2 sequence can comprise a portion of a naturally occurring GluR2 sequence and a synthetic sequence.
  • a recruiting domain comprises a GluR2 sequence, or a sequence having at least about 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity and/or length to: GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO:
  • a recruiting domain can comprise at least about 80% sequence homology to at least about 10, 15, 20, 25, or 30 nucleotides of SEQ ID NO: 17. In some examples, a recruiting domain can comprise at least about 90%, 95%, 96%, 97%, 98%, or 99% sequence homology and/or length to SEQ ID NO: 17.
  • recruiting sequences may be found in an engineered guide of the present disclosure. In some examples, at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to about 10 recruiting sequences are included in an engineered guide.
  • recruiting sequences may be located at any position of subject guides. In some cases, a recruiting sequence is on an N-terminus, middle, or C-terminus of a polynucleotide, or a combination of any of these (e.g. a recruiting present on an N-terminus and a recruiting domain present on a C-terminus).
  • a recruiting sequence can be upstream or downstream of a targeting sequence. In some cases, a recruiting sequence flanks a targeting sequence of a subject guide.
  • a recruiting sequence can comprise all ribonucleotides or deoxyribonucleotides, although a recruiting sequence comprising both ribo- and deoxyribonucleotides is not excluded.
  • the engineered polynucleotide disclosed herein can comprise a polynucleotide having at least about 99% identity, at least about 95% identity, at least about 90% identity, at least about 85% identity, at least about 80% identity, or at least about 70% identity to any of the sequences listed below in Table 3.
  • the engineered guide comprises a polynucleotide having at least about 99% length, at least about 95% length, at least about 90% length, at least about 85% length, at least about 80% length, or at least about 70% length to any of the sequences listed below in Table 3.
  • the engineered guides disclosed herein comprises a polynucleotide of any of the sequences listed below in Table 3.
  • an engineered polynucleotide can be configured to recruit an RNA editing entity (e.g. when associated with a target RNA or target pre-mRNA as described herein).
  • an RNA editing entity comprises an ADAR.
  • an ADAR comprises any one of: ADARl, ADARlpllO, ADARlpl50, ADAR2, ADAR3, APOBEC protein, or any combination thereof.
  • the ADAR RNA editing entity is ADARl.
  • the ADAR RNA editing entity is ADAR2.
  • the ADAR RNA editing entity is ADAR3.
  • an RNA editing entity can be a non- ADAR.
  • the RNA editing entity is an APOBEC protein.
  • the RNA editing entity is APOBEC 1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3E, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4, or any combination thereof.
  • the ADAR or APOBEC is mammalian. In some examples, the ADAR or APOBEC protein is human.
  • the ADAR or APOBEC protein is recombinant (e.g., an exogenously delivered recombinant ADAR or APOBEC protein), modified (e.g., an exogenously delivered modified ADAR or APOBEC protein), endogenous, or any combination thereof.
  • the RNA editing entity can be a fusion protein.
  • the RNA editing entity can be a functional portion of an RNA editing entity, such as any of the RNA editing proteins provided herein.
  • an RNA editing entity can comprise at least about 70% sequence homology and/or length to APOBEC1, APOBEC2, ADARl, ADARlpl 10, ADARlpl50, ADAR2, ADAR3, or any combination thereof.
  • the RNA editing entity is endogenous.
  • the RNA editing entity is exogenously administered in conjunction with the engineered polynucleotide or separate from the engineered polynucleotide.
  • An engineered polynucleotide is capable of associating with a subject RNA editing entity (e.g., ADAR) to facilitate editing of a target RNA.
  • a double stranded substrate formed upon hybridization of an engineered polynucleotide of the present disclosure to a target RNA can comprise a mismatch.
  • a mismatch refers to a nucleotide in an engineered polynucleotide that is unpaired to an opposing nucleotide in a target RNA within the dsRNA.
  • the engineered guide has at least partial complementarity to at least a portion of the target RNA.
  • the engineered guide hybridizes with at least a portion of the target RNA to form a double stranded substrate that has at least partially complementarity to the target RNA.
  • the double stranded substrate comprises one nucleotide mismatch.
  • the double stranded substrate comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotide mismatches.
  • the double stranded substrate comprises at most 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide mismatches.
  • a mismatch can comprise any two nucleotides that do not base pair.
  • a mismatch is an A/C mismatch.
  • An A/C mismatch may comprise a C in an engineered guide of the present disclosure opposite an A in a target RNA.
  • An A/C mismatch may comprise a A in an engineered guide of the present disclosure opposite an C in a target RNA.
  • a G/G mismatch may comprise a G in an engineered guide of the present disclosure opposite a G in a target RNA.
  • a target RNA molecule can be a pre-mRNA or mRNA molecule encoded by an ABCA4 gene, DMD gene, PMP22 gene, a fragment of any of these, or any combination thereof.
  • the DNA encoding the RNA molecule can comprise a mutation relative to an otherwise identical reference DNA molecule.
  • the RNA molecule comprises a mutation relative to an otherwise identical reference RNA molecule.
  • a polypeptide encoded by the target RNA molecule comprises a mutation relative to an otherwise identical reference protein.
  • the target RNA sequence is an mRNA molecule.
  • the mRNA molecule comprises a premature stop codon.
  • the mRNA comprises 1, 2, 3, 4 or 5 premature stop codons.
  • the stop codon is an amber stop codon (UAG), an ochre stop codon (UAA), or an opal stop codon (UGA), or a combination thereof.
  • the premature stop codon is created by a point mutation. In some examples, the premature stop codon causes translation termination of an expression product expressed by the mRNA molecule. In some examples, the premature stop codon is produced by a point mutation on an mRNA molecule in combination with two additional nucleotides. In some examples, the two additional nucleotides are (i) a U and (ii) an A or a G, on a 5’ and a 3’ end of the point mutation. In some examples, the target RNA sequence is a pre-mRNA molecule. In some examples, the pre-mRNA molecule comprises a splice site mutation.
  • the splice site mutation facilitates unintended splicing of a pre-mRNA molecule.
  • the splice site mutation results in mistranslation and/or truncation of a protein encoded by the pre-mRNA molecule.
  • a mutation comprises an insertion or a deletion. An insertion or a deletion can produce a frame shift that can result in a premature stop codon.
  • compositions and methods provided herein can be utilized to modulate expression of a target RNA.
  • Modulation can refer to altering the expression of a gene or portion thereof at one of various stages, with a view to alleviate a disease or condition associated with the level of expression of the gene or a mutation in the gene. Modulation can be mediated at the level of transcription or post-transcriptionally.
  • Modulating transcription can correct aberrant expression of splice variants generated by a mutation in a gene.
  • compositions and methods provided herein can be utilized to regulate gene translation of a target RNA. Modulation can refer to decreasing or knocking down the expression of a gene or portion thereof by decreasing the abundance of a transcript. The decreasing the abundance of a transcript can be mediated by decreasing the processing, splicing, turnover or stability of the transcript; or by decreasing the accessibility of the transcript by translational machinery such as ribosome.
  • the pre-mRNA that at least partially encodes a Dystrophin protein can be modulated to affect the splicing of the transcript by exon skipping.
  • an engineered guide described herein can facilitate a knockdown.
  • a knockdown can reduce the expression of a target RNA.
  • a knockdown can be accompanied by editing of an mRNA.
  • a knockdown can be mediated by an RNA editing enzyme (e.g. ADAR).
  • a double stranded RNA (dsRNA) substrate is formed upon hybridization of an engineered guide of the present disclosure to a target RNA.
  • the target RNA forming the double stranded substrate comprises a portion of an mRNA molecule encoded by the PMP22 gene, the overexpression of which is associated with CMT disease.
  • the targeting region of the engineered guide forming the double stranded substrate is, at least in part, complementary to a portion of an mRNA molecule encoded by the PMP22 gene.
  • the double stranded substrate comprises a single mismatch.
  • the mismatch comprised any two nucleotides that do not base pair between the target RNA and the engineered guide.
  • the mismatch is between a nucleotide in the engineered guide and a nucleotide in the target PMP22 RNA that encodes, in part, the first amino acid (methionine). In some cases, the mismatch is between a nucleotide in the engineered guide and a nucleotide in the target PMP22 RNA that does not form the first amino acid of the PMP22 protein encoded therein. In some cases, correcting the mismatched nucleotides by chemical modification by the RNA editing entity leads to a knockdown in the expression of the protein PMP22, thereby alleviating the effects of overexpression of PMP22 in the cell comprising the engineered guide.
  • the chemical modification in the target RNA comprises a modification of an adenine to an inosine.
  • the engineered polynucleotide can comprise at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a polynucleotide sequence of SEQ ID NO: 16 recited in Table 3.
  • a double stranded RNA (dsRNA) substrate is formed upon hybridization of an engineered guide of the present disclosure to a target RNA.
  • the target RNA forming the double stranded substrate comprises a portion of an mRNA molecule encoded by the ABCA4 gene.
  • the ABCA4 gene comprises a mutation that is associated with Stargardt disease.
  • the targeting region of the engineered guide forming the double stranded substrate is, at least in part, complementary to a portion of an mRNA molecule encoded by the ABCA4 gene.
  • the double stranded substrate comprises a single mismatch. In some examples, the mismatch comprised any two nucleotides that do not base pair.
  • the double stranded substrate comprises a single mismatch.
  • the mismatch comprised any two nucleotides that do not base pair between the target RNA and the engineered guide.
  • the mismatch is between a nucleotide in the engineered guide and a nucleotide in the target ABCA4 RNA that encodes, in part, a mutated amino acid in the protein ABCA4, that is associated with Stargardt disease.
  • correcting the mismatched nucleotides by chemical modification by the RNA editing entity leads to increased expression of a functional ABCA4 protein in the cell comprising the engineered guide, thereby alleviating the effects of expressing an ABCA4 RNA comprising a mutation.
  • the engineered polynucleotide can comprise at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a polynucleotide sequence of SEQ ID NO: 15 recited in Table 3.
  • the mutation is a mutation that is listed in Table 2.
  • the mutation causes or contributes to macular degeneration in a subject to which the engineered guide is administered.
  • the macular degeneration is Stargardt macular degeneration.
  • the RNA editing entity is an ADAR1 or ADAR2, and the ADAR chemically modifies an adenosine after recruitment, thereby correcting the mutation in the region of the ABCA4 target RNA that comprises the mutation associated with the Stargardt disease.
  • the chemical modification in the target RNA comprises a modification of an adenine to an inosine.
  • the engineered guide hybridizes to a region of a target RNA.
  • the RNA can be a pre-mRNA, where the engineered guide hybridizes to a region of the pre-mRNA (e.g. a splice acceptor site; a branch point adenosine; an exon; an intron; an exonic or an intronic splice enhancers or inhibitor sequences; or any combination thereof).
  • the pre-mRNA at least partially encodes a Dystrophin protein.
  • the engineered guide hybridizes to at least a portion of pre-mRNA that encodes exon 51 of the Dystrophin RNA.
  • the engineered guide hybridizes to at least a portion of pre-mRNA that encodes exon 45 of the Dystrophin RNA. In some cases, the engineered guide hybridizes to at least a portion of pre-mRNA that encodes exon 53 of the Dystrophin RNA. In some cases, the engineered guide hybridizes to at least a portion of pre-mRNA that encodes exon 44 of the Dystrophin RNA. In some cases, the engineered guide hybridizes to at least a portion of pre- mRNA that encodes exon 52 of the Dystrophin RNA. In some cases, the engineered guide hybridizes to at least a portion of pre-mRNA that encodes exon 50 of the Dystrophin RNA.
  • the engineered guide hybridizes to at least a portion of pre-mRNA that encodes exon 71 of the Dystrophin RNA. In some cases, the engineered guide hybridizes to at least a portion of pre-mRNA that encodes exon 74 of the Dystrophin RNA.
  • the engineered guide hybridizes with at least a portion of the region of a pre-mRNA that comprises at least one splice acceptor site, such as the AG dinucleotide immediately preceding the exon to be skipped.
  • the pre-mRNA encodes for a Dystrophin pre-mRNA.
  • the splice acceptor site is present immediately preceding exons 51, 45, 53, 44, 52, 50, 71, or 74in the DMD gene that encodes at least a portion of the Dystrophin protein.
  • administration of a composition or engineered guide disclosed herein can induce the chemical modification of a base of a nucleotide in a target RNA.
  • the nucleotide that is chemically modified is comprised in a splice acceptor site in the target RNA.
  • the target RNA is a pre-mRNA.
  • the pre-mRNA at least partially codes for a DMD pre-mRNA.
  • the DMD pre-mRNA at least partially encodes an isoform of the Dystrophin protein.
  • the splice acceptor site is adjacent to an exonic region of the DMD pre-mRNA.
  • the splice acceptor site that is chemically modified is adjacent to exon 51 of the DMD pre-mRNA. In some cases, the splice acceptor site that is chemically modified is adjacent to exon 45 of the DMD pre-mRNA. In some cases, the splice acceptor site that is chemically modified is adjacent to exon 53 of the DMD pre- mRNA. In some cases, the splice acceptor that is chemically modified is adjacent to exon 44 of the DMD pre-mRNA. In some cases, the splice acceptor site that is chemically modified is adjacent to exon 52 of the DMD pre-mRNA. In some cases, the splice acceptor site that is chemically modified is adjacent to exon 50 of the DMD pre-mRNA.
  • the splice acceptor site that is chemically modified is adjacent to exon 71 of the DMD pre-mRNA. In some cases, the splice acceptor site that is chemically modified is adjacent to exon 74 of the DMD pre- mRNA.
  • the double stranded substrate comprises a single mismatch.
  • the mismatch comprised any two nucleotides that do not base pair between the target pre-mRNA and the engineered guide.
  • the mismatch is between a nucleotide in the engineered guide and a nucleotide in the target pre-mRNA that encodes, in part, the Dystrophin protein.
  • the mismatch is between a nucleotide in the engineered guide and a nucleotide in the target DMD pre-mRNA that encodes a splice acceptor site in the DMD pre-mRNA.
  • chemical modification of the mismatched nucleotide in the exon of the DMD pre-mRNA induces skipping of the exon that is hybridized with the engineered guide, thereby leading to the translation of the DMD mRNA into a functional Dystrophin protein product in a cell that comprises the engineered guide.
  • the splice acceptor site that is chemically modified is present immediately preceding exons 51, 45, 53, 44, 52, 50, 71, or 74 in the DMD gene.
  • the chemical modification of the splice acceptor site in the target RNA can induce a modification of an adenine to an inosine.
  • a double stranded RNA (dsRNA) substrate is formed upon hybridization of an engineered guide of the present disclosure to a target RNA.
  • the target RNA forming the double stranded substrate comprises a portion of a pre- mRNA molecule encoded by the DMD gene.
  • the targeting region of the engineered guide forming the double stranded substrate is, at least in part, complementary to a portion of a pre-mRNA molecule encoded by the DMD gene.
  • the double stranded substrate comprises a single mismatch.
  • the mismatch comprises any two nucleotides that do not base pair.
  • the engineered substrate comprises a hairpin.
  • the hairpin functions as an ADAR recruiting domain.
  • the double stranded substrate is formed by a target RNA comprising a pre-mRNA encoded by the DMD gene and an engineered guide complementary to a portion of the pre- mRNA encoded by the DMD gene, wherein the engineered substrate comprises a single mismatch and a hairpin.
  • the exon is one of exons 51, 45, 53, 44, 46, 52, 50, 43, 6, 7, 8, 55, 2, 11, 17, 19, 21, 57, 59, 62, 63, 65, 66, 69, 74 and/or 75 in the DMD pre-mRNA that at least in part encodes the Dystrophin protein.
  • the engineered polynucleotide can comprise at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a polynucleotide sequence of any one of SEQ ID NO:l- 14.
  • the engineered guide comprises a polynucleotide having at least 99% identity, at least 95% identity, at least 90% identity, at least 85% identity, at least 80% identity, or at least 70% identity to any one of SEQ ID NO: 1-14. In some examples, the engineered guide comprises a polynucleotide having at least 99% length, at least 95% length, at least 90% length, at least 85% length, at least 80% length, or at least 70% length to any one of SEQ ID NO: 1-14.
  • administration of a composition or engineered guide disclosed herein to a subject in need thereof (a) decreases or increases expression of a gene relative to an expression of the gene prior to administration; (b) edits at least one point mutation; (c) increases the frequency of an exon skip; or (d) any combination thereof.
  • an engineered guide e.g., an engineered guide, a vector encoding or comprising an engineered guide
  • the methods of treating or preventing a disease or a condition in a subject in need thereof comprise administering to the subject having the disease or the condition an engineered guide, thereby treating or preventing the disease or the condition in the subject, wherein the engineered guide: (a) at least in part associates with at least a portion of a target RNA molecule; (b) in association with the target RNA molecule, forms a double stranded substrate, and wherein the engineered guide comprises a domain that recruits an RNA editing entity; and (c) facilitates a chemical modification of a base of a nucleotide in the target RNA molecule by the RNA editing entity.
  • administration of an engineered polynucleotide or vector encoding the same can alleviate one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual or alleviate one or more characteristic(s) of a myogenic or muscle cell of said individual.
  • Administration of an engineered polynucleotide or vector encoding the same can enhance, induce or promote skipping of an exon from a dystrophin pre- mRNA in a cell expressing said pre-mRNA in an individual suffering from Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.
  • Such administration can increase the production of a functional dystrophin protein and/or decrease the production of an aberrant dystrophin protein in a cell.
  • the administration of a composition or the engineered polynucleotide disclosed herein can allow the engineered polynucleotide to bind to an exon in the DMD pre- mRNA that at least partially codes for the Dystrophin protein.
  • the administration of a composition or the engineered polynucleotide disclosed herein can induce the skipping of the exon (that is hybridized to the engineered guide RNA) in the subject.
  • the engineered polynucleotide can induce the skipping of the exon 51 DMD mRNA in the subject.
  • the engineered polynucleotide can induce the skipping of the exon 45 in the DMD mRNA in the subject. In some cases, the engineered polynucleotide can induce the skipping of the exon 53 in the DMD mRNA in the subject. In some cases, the engineered polynucleotide can induce the skipping of the exon 44 in the DMD mRNA in the subject. In some cases, the engineered polynucleotide can induce the skipping of the exon 52 in the DMD mRNA in the subject. In some cases, the engineered polynucleotide can induce the skipping of the exon 50 in the DMD mRNA in the subject.
  • the engineered polynucleotide can induce the skipping of the exon 71 in the DMD mRNA in the subject. In some cases, the engineered polynucleotide can induce the skipping of the exon 74 in the DMD mRNA in the subject.
  • the chemical modification of the splice acceptor site in the target RNA upon binding of the engineered guide RNA can increase the frequency of skipping of the DMD mRNA exon that is at least partially hybridized to the engineered guide RNA.
  • the frequency of skipping of the DMD mRNA exon is increased by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 85%, 90%, 100%, 120%, 130%, 140%, 150%, 160%, 180%, 200%, 220%, 250%, 270%, 290%, 300%, 330%, 350%, 400%, 450%, 500%, 550%, 600%, 700%, 800%, 900%, or 1000%.
  • the frequency of skipping of the DMD mRNA exon is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 51 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 45 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 53 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 44 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 46 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 52 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 50 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 43 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 6 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 7 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 8 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 55 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 2 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 11 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 17 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 19 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 21 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 57 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 59 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 62 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 63 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 65 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 66 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, or 50 fold.
  • the frequency of skipping of the DMD mRNA exon 69 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold,
  • the frequency of skipping of the DMD mRNA exon 74 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold,
  • the frequency of skipping of the DMD mRNA exon 75 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold,
  • 66, 69, 74 or 75 is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold,
  • the increase in frequency of exon skipping of the DMD mRNA exons selected from the group comprising 51, 45, 53, 44, 46, 52,50, 43, 6, 7, 8, 55, 2, 11, 17, 19, 21, 57, 59, 62, 63, 65, 66, 69, 74 and 75, can increase in the production of a functional dystrophin in said patient or in a cell of said patient.
  • the production of a functional dystrophin in the patient is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, 50 fold, 100 fold, or 200 fold.
  • Increasing the production of a functional dystrophin in said patient or in a cell of said patient may be assessed at the mRNA level (by RT-PCR analysis) and can mean that a detectable amount of a functional or in frame dystrophin mRNA is detectable by RT PCR.
  • 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the detectable dystrophin mRNA is a functional or in frame dystrophin mRNA.
  • Increasing the production of a functional dystrophin in said patient or in a cell of said patient may be assessed at the protein level (by immunofluorescence and western blot analyses) and can mean that a detectable amount of a functional dystrophin protein is detectable by immunofluorescence or western blot analysis.
  • 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the detectable dystrophin protein is a functional dystrophin protein.
  • An increase or a decrease can be assessed in a muscular tissue or in a muscular cell of an individual or a patient by comparison to the amount present in said individual or patient before treatment with the engineered polynucleotide or vector encoding the same.
  • the comparison can be made with a muscular tissue or cell of said individual or patient, which has not yet been treated with said oligonucleotide or composition in case the treatment is local.
  • one or more symptom(s) from a DMD or a BMD patient is/are alleviated and/or one or more characteristic(s) of a muscle cell or tissue from a DMD or a BMD patient is/are alleviated using the engineered polynucleotide or vector encoding the same.
  • Such symptoms may be assessed on the patient self.
  • Such characteristics may be assessed at the cellular or tissue level of a given patient.
  • An alleviation of one or more characteristics may be assessed by any of the following assays on a myogenic cell or muscle cell from a patient: reduced calcium uptake by muscle cells, decreased collagen synthesis, altered morphology, altered lipid biosynthesis, decreased oxidative stress, and/or improved muscle fiber function, integrity, and/or survival. These parameters can be assessed using immunofluorescence and/or histochemical analyses of cross sections of muscle biopsies.
  • Alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual by administering an engineered polynucleotide or vector encoding the same can be assessed by any of the following assays: prolongation of time to loss of walking, improvement of muscle strength, improvement of the ability to lift weight, improvement of the time taken to rise from the floor, improvement in the nine-meter walking time, improvement in the time taken for four-stairs climbing, improvement of the leg function grade, improvement of the pulmonary function, improvement of cardiac function, improvement of the quality of life.
  • Assays is known to the skilled person. As an example, the publication of Manzur et al.
  • chemical modification of the base of the nucleotide in the DMD pre-mRNA molecules can be confirmed by sequencing.
  • confirming that chemical modification has occurred comprises isolating one or more DMD pre-mRNA molecules to which an engineered guide has been administered and then converting the target RNA to cDNA by reverse transcriptase prior to sequencing.
  • the sequencing employed is Sanger sequencing, next generation sequencing, or a combination thereof.
  • the engineered guide is encoded by a polynucleotide or a vector disclosed herein or is comprised in a composition, pharmaceutical composition, isolated cell, or plurality of cells disclosed herein.
  • administering can be used to alleviate one or more symptom(s) of Charcot-Marie Tooth disease or alleviate one or more characteristic(s) of the disease.
  • an engineered polynucleotide or a vector encoding the same can allow the engineered polynucleotide to bind to a region in the mRNA that at least partially codes for the PMP22 polypeptide.
  • Disclosed herein are methods of delivering any engineered guide disclosed herein (e.g., an engineered guide, a vector encoding or comprising an engineered guide) to a cell.
  • methods of delivering an engineered guide to a cell comprise delivering directly or indirectly to the cell an engineered polynucleotide that at least partially hybridizes to and forms, at least in part, a double stranded substrate with at least a portion of the PMP22 mRNA molecule, wherein the engineered polynucleotide recruits an RNA editing entity and facilitates a chemical modification of a base of a nucleotide in the start codon of the PMP22 target RNA molecule by the RNA editing entity, thereby ablating the start codon and reducing the expression of the PMP22 protein the subject.
  • the increase in frequency of ablation of the start-site codon in the PMP22 protein can decrease the production of a functional PMP22 in said patient or in a cell of said patient.
  • the production of a functional PMP22 protein in the patient is decreased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, 50 fold, 100 fold, or 200 fold.
  • Increasing the production of a functional PMP22 in said patient or in a cell of said patient may be assessed at the mRNA level (by RT-PCR analysis) and can mean that a detectable amount of a functional or in frame PMP22 mRNA is detectable by RT PCR. In another embodiment, only 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the detectable PMP22 mRNA is a functional or in frame PMP22 mRNA.
  • Decreasing the production of a functional PMP22 in said patient or in a cell of said patient may be assessed at the protein level (by immunofluorescence and western blot analyses) and mean that a detectable amount of a functional PMP22 protein is detectable by immunofluorescence or western blot analysis.
  • only 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of PMP22 protein continues to be expressed in the subject after administration of the engineered polynucleotide.
  • one or more symptom(s) from a CMT patient is/are alleviated and/or one or more characteristic(s) of a muscle cell or tissue from a CMT patient can be alleviated using an engineered polynucleotide or a vector encoding the same.
  • Such symptoms may be assessed on the patient self.
  • Such characteristics may be assessed at the cellular, tissue level of a given patient.
  • An alleviation of one or more characteristics may be assessed by any of the following assays on a myogenic cell or muscle cell from a patient: reduced calcium uptake by muscle cells, decreased collagen synthesis, altered morphology, altered lipid biosynthesis, decreased oxidative stress, and/or improved muscle fiber function, integrity, and/or survival. These parameters are usually assessed using immunofluorescence and/or histochemical analyses of cross sections of muscle biopsies.
  • Alleviating one or more symptom(s) of CMT in an individual using an engineered polynucleotide or a vector encoding the same can be assessed by any of the following assays: prolongation of time to loss of walking, improvement of muscle strength, improvement of the ability to lift weight, improvement of the time taken to rise from the floor, improvement in the nine-meter walking time, improvement in the time taken for four-stairs climbing, improvement of the leg function grade, improvement of the pulmonary function, improvement of cardiac function, improvement of the quality of life.
  • the alleviation of one or more symptom(s) of Charcot-Marie-Tooth disease (CMT) can be assessed by measuring an improvement of gross motor function, sensation, and balance.
  • the chemical modification of the base of the nucleotide in the PMP22 molecules can be confirmed by sequencing.
  • confirming that chemical modification has occurred comprises isolating one or more PMP22 RNA molecules to which an engineered guide has been administered and then converting the target RNA to cDNA by reverse transcriptase prior to sequencing.
  • the sequencing employed is Sanger sequencing, next generation sequencing, or a combination thereof.
  • the engineered guide can be encoded by a polynucleotide or a vector disclosed herein or is comprised in a composition, pharmaceutical composition, isolated cell, or plurality of cells disclosed herein.
  • administering can be used to alleviate one or more symptom(s) of Stargardt disease in an individual or alleviate one or more characteristic(s) of the disease in said individual.
  • the administration of a composition or the engineered polynucleotide disclosed herein can allow the engineered polynucleotide to bind to a region in the ABCA4 mRNA that comprises a mutation associated with Stargardt disease (not limited to the mutations in Table 2).
  • administration of an engineered polynucleotide or a vector encoding the same to a cell can comprise delivering directly or indirectly to the cell an engineered polynucleotide that at least partially hybridizes to and forms, at least in part, a double stranded substrate with at least a portion of the ABCA4 mRNA molecule that comprises the mutation associated with Stargardt disease, wherein the engineered polynucleotide recruits an RNA editing entity and facilitates a chemical modification of mutation by the RNA editing entity, thereby correcting the mutation and producing a functional ABCA4 protein in the subject.
  • administration of an engineered polynucleotide or a vector encoding the same into a subject can produce a chemical modification of a base of a polynucleotide implicated as a disease-causing mutation in an ABCA4 protein.
  • Such editing can increase the production of a functional ABCA4 in the subject or in a cell of the subject.
  • the production of a functional ABCA4 protein (that does not comprise the mutation) in the subject is increased by at least 1.2 fold, 1.5 fold, 1.7 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.4 fold, 2.6 fold, 2.8 fold, 3.0 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, 50 fold, 100 fold, or 200 fold.
  • Increasing the production of a functional ABCA4 in subject or in a cell of the subject can be assessed at the mRNA level (by RT-PCR analysis) and can mean that a detectable amount of a functional or in frame ABCA4 mRNA is detectable by RT PCR.
  • at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the detectable ABCA4 mRNA is a functional or in frame ABCA4 mRNA that does not comprise the mutation.
  • Increasing the production of a functional ABCA4 in said subject or in a cell of said subject can be assessed at the protein level (by immunofluorescence and western blot analyses) and can mean that a detectable amount of a functional ABCA4 protein is detectable by immunofluorescence or western blot analysis.
  • at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the detectable ABCA4 protein is a functional ABCA4 protein that does not comprise the mutation.
  • administration of an engineered polynucleotide or a vector encoding the same can alleviate one or more symptom(s) from a Stargardt patient and/or one or more characteristic(s) of the fundus tissue from a Stargardt patient.
  • symptoms can be assessed on the patient self.
  • characteristics may be assessed at the cellular, tissue level of a given patient.
  • An alleviation of one or more characteristics can be assessed by any of the following assays on image analysis of the presence and progression of atrophic lesion detected on autofluorescence images of the retinal images from the patient.
  • electroretinograms can be evaluated as a measure of the therapeutic effect of the administration of the engineered polynucleotide to the subject.
  • scotopic or photopic responses may be graded on a scale, to detect abnormalities in comparison to a reference population.
  • chemical modification of the ABCA4 mutation can be confirmed by sequencing.
  • confirming that chemical modification has occurred can comprise isolating one or more ABCA4 RNA molecules to which an engineered guide has been administered and then converting the target RNA to cDNA by reverse transcriptase prior to sequencing.
  • the sequencing employed can be Sanger sequencing, next generation sequencing, or a combination thereof.
  • the engineered polynucleotide can be encoded by a polynucleotide or a vector disclosed herein or can be comprised in a composition, pharmaceutical composition, isolated cell, or plurality of cells disclosed herein.
  • Methods described herein can comprise administering to a subject one or more engineered guides, polynucleotides, compositions, pharmaceutical compositions, vectors, cells and isolated cells as described herein. Methods of determining the most effective means and dosage of administration can vary with the composition used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated.
  • administration of the engineered guide, polynucleotide, composition, pharmaceutical composition, vector, or cell disclosed herein is performed for a treatment duration of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
  • administration of the engineered guide, polynucleotide, composition, pharmaceutical composition, vector, or cell disclosed herein is performed for a treatment duration of no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97,
  • a treatment duration can be from about 1 to about 30 days, from about 2 to about 30 days, from about 3 to about 30 days, from about 4 to about 30 days, from about 5 to about 30 days, from about 6 to about 30 days, from about 7 to about 30 days, from about 8 to about 30 days, from about 9 to about 30 days, from about 10 to about 30 days, from about 11 to about 30 days, from about 12 to about 30 days, from about 13 to about 30 days, from about 14 to about 30 days, from about 15 to about 30 days, from about 16 to about 30 days, from about 17 to about 30 days, from about 18 to about 30 days, from about 19 to about 30 days, from about 20 to about 30 days, from about 21 to about 30 days, from about 22 to about 30 days, from about 23 to about 30 days, from about 24 to about 30 days, from about 25 to about 30 days, from about 26 to about 30 days, from about 27 to about 30 days, from about 28 to about 30 days, or from about 29 to about 30 days.
  • administration of the engineered guide, polynucleotide, composition, pharmaceutical composition, vector, or cell disclosed herein is performed for a treatment duration of at least about 1 week, at least about 1 month, at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, at least about 10 years, at least about 15 years, at least about 20 years, or more.
  • administration is performed repeatedly over a lifetime of a subject, such as once a month or once a year for the lifetime of a subject.
  • administration is performed repeatedly over a substantial portion of a subject’s life, such as once a month or once a year for at least about 1 year, 5 years, 10 years, 15 years, 20 years, 25 years, 30 years, or more.
  • administration of the engineered guide, polynucleotide, composition, pharmaceutical composition, vector, or cell disclosed herein is performed at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 times a day. In some examples, administration or application of composition disclosed herein is performed at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 times a week. In some examples, administration of an engineered guide disclosed herein is performed at least 1,
  • an engineered guide, polynucleotide, composition, pharmaceutical composition, vector, or cell disclosed herein is administered/applied as a single dose or as divided doses.
  • engineered guides disclosed herein are administered at a first time point and a second time point.
  • an engineered guide disclosed herein is administered such that a first administration is administered before the other with a difference in administration time of 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 4 days, 7 days, 2 weeks, 4 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year or more.
  • Methods disclosed herein can comprise parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular or infusion), oral administration, inhalation administration, intraduodenal administration, rectal administration, intraocular administration, intravitreal administration, retinal administration, intraventricular administration, intracerebral administration, intracerebroventricular administration, intraparenchymal administration, subcutaneous administration, or any combination thereof.
  • parenteral administration including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular or infusion
  • oral administration inhalation administration, intraduodenal administration, rectal administration, intraocular administration, intravitreal administration, retinal administration, intraventricular administration, intracerebral administration, intracerebroventricular administration, intraparenchymal administration, subcutaneous administration, or any combination thereof.
  • a pharmaceutical composition disclosed herein is administered at dosage levels sufficient to deliver from about 0.0001 mg/kg to about 100 mg/kg, from about 0.001 mg/kg to about 0.05 mg/kg, from about 0.005 mg/kg to about 0.05 mg/kg, from about 0.001 mg/kg to about 0.005 mg/kg, from about 0.05 mg/kg to about 0.5 mg/kg, from about 0.01 mg/kg to about 50 mg/kg, from about 0.1 mg/kg to about 40 mg/kg, from about 0.5 mg/kg to about 30 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, or from about 1 mg/kg to about 25 mg/kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic, diagnostic, or prophylactic, effect.
  • methods described herein can further comprise administering a co therapy.
  • a co-therapy can comprise a cancer treatment (e.g. radiotherapy, chemotherapy, CAR-T therapy, immunotherapy, hormone therapy, cryoablation).
  • a co-therapy can comprise surgery.
  • a co-therapy can comprise a laser therapy.
  • the pharmaceutical composition can comprise a first active ingredient (e.g., an engineered guide disclosed herein, a composition disclosed herein, an isolated cell disclosed herein, or an isolated plurality of cells disclosed herein).
  • the pharmaceutical can comprise a second, third or fourth active ingredient.
  • the pharmaceutical composition can comprise an additional therapeutic agent.
  • the second, third, or fourth active ingredient can be the additional therapeutic agent.
  • the additional therapeutic agent can treat macular degeneration. In some examples, the additional therapeutic agent can treat or alleviate neurological dysfunction.
  • an engineered polynucleotide can be delivered to a subject via a vector.
  • a vector can be an RNA delivery vehicle.
  • a delivery vehicle can comprise a delivery vector.
  • a delivery vector can comprise DNA, such as double stranded or single stranded DNA.
  • a vector can comprise RNA.
  • a delivery vehicle can comprise one or more delivery vectors.
  • the one or more delivery vectors can comprise an engineered guide disclosed herein.
  • the one or more delivery vectors can comprise a polynucleotide encoding an engineered guide disclosed herein. In some examples, one delivery vector can comprise a polynucleotide encoding an engineered guide disclosed herein. In some examples, one delivery vector can comprise a polynucleotide encoding a portion of an engineered guide disclosed herein and a second delivery vector encodes a portion of an engineered guide disclosed herein.
  • the delivery vector can be a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector) a viral vector, or any combination thereof.
  • the delivery vector is a viral vector.
  • the viral vector can be a retroviral vector, an adenoviral vector, an adeno-associated viral vector, an alphavirus vector, a lentivirus vector (e.g., human or porcine), a Herpes virus vector, an Epstein-Barr virus vector, an SV40 virus vectors, a pox virus vector, or a combination thereof.
  • the viral vector is a recombinant vector, a hybrid vector, a chimeric vector, a self-complementary vector, a single-stranded vector or any combination thereof.
  • a viral vector can be an adeno-associated virus (AAV) vector.
  • a viral vector can be of a specific serotype.
  • a viral vector can be an AAV1 serotype, an AAV2 serotype, AAV3 serotype, an AAV4 serotype, AAV5 serotype, an AAV6 serotype, AAV7 serotype, an AAV8 serotype, an AAV9 serotype, an AAV10 serotype, an AAV11 serotype, or an AAV12 serotype a derivative of any of these, or any combination thereof.
  • the AAV vector can be a recombinant vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, a single-stranded AAV or any combination thereof.
  • scAAV self-complementary AAV
  • the AAV vector can be a recombinant AAV (rAAV) vector.
  • a method of producing recombinant AAV can involve, in some cases, introducing into a producer cell line: (1) DNA necessary for AAV replication and synthesis of an AAV capsid, (b) one or more helper constructs comprising the viral functions missing from the AAV vector (c) a helper virus, and (d) the plasmid construct containing the genome of the AAV vector, e.g., ITRs, promoter and transgene (e.g., an engineered guide disclosed herein) sequences, etc..
  • ITRs e.g., ITRs, promoter and transgene (e.g., an engineered guide disclosed herein) sequences, etc.
  • a viral vector described herein can be engineered through synthetic or other suitable means by references to published sequences, such as are available in the literature.
  • genomic and protein sequences of various serotypes of AAV as well as the sequences of the native terminal repeats (TRs), Rep proteins, and capsid subunits are known in the art and may be found in the literature or in public databases such as GenBank or Protein Data Bank (PDB).
  • TRs native terminal repeats
  • Rep proteins Rep proteins
  • capsid subunits are known in the art and may be found in the literature or in public databases such as GenBank or Protein Data Bank (PDB).
  • a delivery vector described herein can be produced by packaging an engineered guide disclosed herein in an AAV vector.
  • methods of producing the delivery vectors described herein can comprise, (a) introducing into a cell: (i) a polynucleotide encoding any engineered guide disclosed herein; and (ii) a viral genome comprising a Replication (Rep) gene and Capsid (Cap) gene that encodes a wild-type AAV capsid protein or modified version thereof; (b) expressing in the cell the wild-type AAV capsid protein or modified version thereof; (c) assembling an AAV particle; and (d) packaging the polynucleotide encoding the engineered polynucleotide in the AAV particle, thereby generating an AAV delivery vector.
  • Rep Replication
  • Cap Cap
  • any engineered guide disclosed herein, promoters, stuffer sequences, and any combination thereof are packaged in the AAV vector.
  • the AAV vector can package 1, 2, 3, 4, or 5 copies of the engineered guide.
  • the recombinant vectors comprise one or more inverted terminal repeats and the inverted terminal repeats comprise a 5’ inverted terminal repeat, a 3’ inverted terminal repeat, and a mutated inverted terminal repeat.
  • the mutated terminal repeat lacks a terminal resolution site.
  • a hybrid AAV vector is produced by transcapsidation, e.g., packaging an inverted terminal repeat (ITR) from a first serotype into a capsid of a second serotype, wherein the first and second serotypes are not the same.
  • the Rep gene and ITR from a first AAV serotype e.g., AAV2
  • a second AAV serotype e.g., AAV9
  • a hybrid AAV serotype comprising the AAV2 ITRs and AAV9 capsid protein may be indicated AAV2/9.
  • the hybrid AAV delivery vector comprises an AAV2/1, AAV2/2, AAV 2/4, AAV2/5, AAV2/8, or AAV2/9 vector.
  • the AAV vector can be a chimeric AAV vector.
  • the chimeric AAV vector can comprise an exogenous amino acid or an amino acid substitution, or capsid proteins from two or more serotypes.
  • a chimeric AAV vector is genetically engineered to increase transduction efficiency, selectivity, or a combination thereof.
  • the AAV vector can comprise a self-complementary AAV genome.
  • Self-complementary AAV genomes are generally known in the art and contain both DNA strands which can anneal together to form double-stranded DNA.
  • the delivery vector is a retroviral vector.
  • the retroviral vector is a Moloney Murine Leukemia Virus vector, a spleen necrosis virus vector, or a vector derived from the Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, or mammary tumor virus, or a combination thereof.
  • the retroviral vector is transfected such that the majority of sequences coding for the structural genes of the virus (e.g gag, pol, and env) are deleted and replaced by the gene(s) of interest.
  • a delivery vehicle can be a non-viral vector.
  • the delivery vehicle can be a plasmid.
  • the plasmid can comprise DNA.
  • the plasmid can comprise RNA.
  • the plasmid comprises circular double-stranded DNA.
  • the plasmid is linear.
  • the plasmid comprises one or more genes of interest and one or more regulatory elements.
  • the plasmid comprises a bacterial backbone containing an origin of replication and an antibiotic resistance gene or other selectable marker for plasmid amplification in bacteria.
  • the plasmid is a minicircle plasmid.
  • the plasmid contains one or more genes that provide a selective marker to induce a target cell to retain the plasmid.
  • the plasmid is formulated for delivery through injection by a needle carrying syringe.
  • the plasmid is formulated for delivery via electroporation.
  • the plasmids are engineered through synthetic or other suitable means known in the art.
  • the genetic elements may be assembled by restriction digest of the desired genetic sequence from a donor plasmid or organism to produce ends of the DNA which may then be readily ligated to another genetic sequence.
  • an isolated cell or cells can comprise any of the engineered guides or delivery vectors disclosed herein.
  • the isolated cell or cells comprise one or more human cells. In some examples, the isolated cell or cells comprise one or more T-Cells. In some examples, the isolated cell or cells comprise one or more HEK293 cells. In some examples, the isolated cell or cells can comprise one or more differentiated muscle cells. In some examples, the isolated cell or cells can comprise one or more blood cells.
  • compositions that can comprise an engineered polynucleotide disclosed herein, a vector described herein, a composition disclosed herein, an isolated cell disclosed herein, or an isolated plurality of cells disclosed herein; and a pharmaceutically acceptable excipient, carrier or diluent.
  • the pharmaceutical composition comprises an engineered polynucleotide disclosed herein and a pharmaceutically acceptable excipient, carrier or diluent.
  • the pharmaceutical composition comprises an engineered polynucleotide encoding an engineered guide RNA disclosed herein and a pharmaceutically acceptable excipient, carrier or diluent.
  • the pharmaceutical composition comprises a delivery vector disclosed herein and a pharmaceutically acceptable excipient, carrier or diluent.
  • the pharmaceutical composition comprises an isolated cell (e.g. comprising a delivery vector disclosed herein) or plurality of cells disclosed herein and a pharmaceutically acceptable excipient, carrier or diluent.
  • the pharmaceutical composition comprises a first active ingredient (e.g., an engineered guide disclosed herein, a composition disclosed herein, an isolated cell disclosed herein, or an isolated plurality of cells disclosed herein).
  • the pharmaceutical can comprise a second, third or fourth active ingredient.
  • the pharmaceutical composition comprises an additional therapeutic agent.
  • the second, third, or fourth active ingredient is the additional therapeutic agent.
  • the additional therapeutic agent treats macular degeneration.
  • the additional therapeutic can be a drug or a pharmaceutical that can help muscle strength and delay the progression of certain types of muscular dystrophy.
  • the additional therapeutic is a corticosteroid such as prednisone and deflazacort (Emflaza).
  • the additional therapeutic is eteplirsen (Exondys 51).
  • the additional therapeutic is golodirsen (Vyondys 53).
  • the additional therapeutic may be an angiotensin-converting enzyme (ACE) inhibitors or beta blockers.
  • ACE angiotensin-converting enzyme
  • the additional therapeutic may be a cyclosporine-A.
  • the additional therapeutic may be an oligonucleotide.
  • the additional therapeutic may be an aminoglycoside. In some cases, the additional therapeutic may be gentamicin. In some cases, the additional therapeutic may be ataluren. In some cases, the additional therapeutic may be myostatin. In some cases, the additional therapeutic may be utrophin. In some cases, the additional therapeutic may be a Vitamin D supplement.
  • the pharmaceutical composition can comprise an additional compound wherein said adjunct compound comprises a steroid, an ACE inhibitor (e.g. perindopril), angiotensin II type 1 receptor blocker Losartan, a tumor necrosis factor-alpha (TNFa) inhibitor, a source of mIGF-1, a compound for enhancing mIGF-1 expression, a compound for enhancing mIGF-1 activity, an antioxidant, an ion channel inhibitor, a protease inhibitor, L-arginine, a compound exhibiting a readthrough activity and/or inhibiting spliceosome assembly and/or splicing.
  • ACE inhibitor e.g. perindopril
  • angiotensin II type 1 receptor blocker Losartan e.g. TNFa
  • TNFa tumor necrosis factor-alpha
  • the additional therapeutic agent is a 5-HT 6 antagonist, a 5-HT2A inverse agonist, an AB42 lowering agent, an acetylcholinesterase inhibitor, an alpha secretase enhancer, an alpha-1 adrenoreceptor antagonist, an ammonia reducer, an angiotensin II receptor blocker, an alpha-2 adrenergic agonist, an anti-amyloid antibody, an anti-aggregation agent, an anti-amyloid immunotherapy, an anti-inflammatory agent, a glial cell modulator, an antioxidant, anti-tau antibody, an anti-tau immunotherapy, an anti-VEGF agent, an antiviral drug, a BACE inhibitor, a beta-adrenergic blocking agents, a beta-2 andrenergic receptor agonist, an arginase inhibitor, a beta blocker, a beta-HSDl inhibitor, a calcium channel blocker, a cannabinoid, a CB1 or CB2 endoc
  • the additional therapeutic agent is an ammonia reducer, a beta blocker, a synthetic hormone, an antibiotic, or an antiviral drug, a vascular endothelial growth factor (VEGF) inhibitor, a stem cell treatment, a vitamin or modified form thereof, or any combination thereof.
  • VEGF vascular endothelial growth factor
  • the additional therapeutic agent is AADvacl .
  • AAVrh.lOhAPOE2 ABBV-8E12, ABvac40, AD-35, aducanumab, aflibercept, AGBIOI,
  • AR1001 AstroStem, atorvastatin, AVP-786, AXS-05, BAC, benfotiamine, BHV4157,
  • BI425809, BIIB092, BIIP06 bioactive dietary polyphenol preparation, BPN14770, brexpiprazole, brolucizumab, byrostatin, CAD 106, candesartan, CERE- 110, cilostazol, CKD- 355, CNP520, COR388, crenezumab, cromolyn, CT1812, curcumin, dabigatran, DAOI, dapagliflozin, deferiprone, DHA, DHP1401, DNL747, dronabinol, efavirenz, elderberry juice, elenbecestat, escitalopram, formoterol, gantenerumab, ginkgo biloba, grapeseed extract, GRF6019, guanfacine, GV1001, hUCB-MSCs, ibuprofen, icosapent ethyl, ID 1201, insulin aspart, insulin glulisine,
  • the unit dose forms are physically discrete units suitable for administration to human or non-human subjects (e.g., animals).
  • the unit dose forms are packaged individually.
  • each unit dose contains a predetermined quantity of an active ingredient(s) that can be sufficient to produce the desired therapeutic effect in association with pharmaceutical carriers, diluents, excipients, or any combination thereof.
  • the unit dose forms comprise ampules, syringes, or individually packaged tablets and capsules, or any combination thereof.
  • a unit dose form is comprised in a disposable syringe.
  • unit-dosage forms are administered in fractions or multiples thereof.
  • a multiple-dose form comprises a plurality of identical unit dose forms packaged in a single container, which can be administered in segregated a unit dose form.
  • multiple dose forms comprise vials, bottles of tablets or capsules, or bottles of pints or gallons.
  • a multiple- dose forms comprise the same pharmaceutically active agents.
  • a multiple- dose forms comprise different pharmaceutically active agents.
  • the pharmaceutical composition comprises a pharmaceutically acceptable excipient.
  • the excipient comprises a buffering agent, a cryopreservative, a preservative, a stabilizer, a binder, a compaction agent, a lubricant, a chelator, a dispersion enhancer, a disintegration agent, a flavoring agent, a sweetener, or a coloring agent, or any combination thereof.
  • an excipient comprises a buffering agent.
  • the buffering agent comprises sodium citrate, magnesium carbonate, magnesium bicarbonate, calcium carbonate, calcium bicarbonate, or any combination thereof.
  • the buffering agent comprises sodium bicarbonate, potassium bicarbonate, magnesium hydroxide, magnesium lactate, magnesium gluconate, aluminum hydroxide, sodium citrate, sodium tartrate, sodium acetate, sodium carbonate, sodium polyphosphate, potassium polyphosphate, sodium pyrophosphate, potassium pyrophosphate, disodium hydrogen phosphate, dipotassium hydrogen phosphate, tri sodium phosphate, tripotassium phosphate, potassium metaphosphate, magnesium oxide, magnesium hydroxide, magnesium carbonate, magnesium silicate, calcium acetate, calcium glycerophosphate, calcium chloride, or calcium hydroxide and other calcium salts, or any combination thereof.
  • an excipient comprises a cryopreservative.
  • the cryopreservative comprises DMSO, glycerol, polyvinylpyrrolidone (PVP), or any combination thereof.
  • a cryopreservative comprises a sucrose, a trehalose, a starch, a salt of any of these, a derivative of any of these, or any combination thereof.
  • an excipient comprises a pH agent (to minimize oxidation or degradation of a component of the composition), a stabilizing agent (to prevent modification or degradation of a component of the composition), a buffering agent (to enhance temperature stability), a solubilizing agent (to increase protein solubility), or any combination thereof.
  • an excipient comprises a surfactant, a sugar, an amino acid, an antioxidant, a salt, a non-ionic surfactant, a solubilizer, a triglyceride, an alcohol, or any combination thereof.
  • an excipient comprises sodium carbonate, acetate, citrate, phosphate, poly-ethylene glycol (PEG), human serum albumin (HSA), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, sucrose, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, trehalose, arginine, sodium acetate, acetate, HC1, disodium edetate, lecithin, glycerin, xanthan rubber, soy isoflavones, polysorbate 80, ethyl alcohol, water, teprenone, or any combination thereof.
  • PEG poly-ethylene glycol
  • HSA human serum albumin
  • the excipient is an excipient described in the Handbook of Pharmaceutical Excipients, American Pharmaceutical Association (1986). [0141] In some examples, the excipient comprises a preservative. In some examples, the preservative comprises an antioxidant, such as alpha-tocopherol and ascorbate, an antimicrobial, such as parabens, chlorobutanol, and phenol, or any combination thereof.
  • an antioxidant such as alpha-tocopherol and ascorbate
  • an antimicrobial such as parabens, chlorobutanol, and phenol, or any combination thereof.
  • the antioxidant comprises EDTA, citric acid, ascorbic acid, butylated hydroxytoluene (BHT), butylated hydroxy anisole (BHA), sodium sulfite, p-amino benzoic acid, glutathione, propyl gallate, cysteine, methionine, ethanol or N- acetyl cysteine, or any combination thereof.
  • the preservative comprises validamycin A, TL-3, sodium ortho vanadate, sodium fluoride, N-a-tosyl-Phe- chloromethylketone, N-a-tosyl-Lys-chloromethylketone, aprotinin, phenylmethylsulfonyl fluoride, diisopropylfluorophosphate, kinase inhibitor, phosphatase inhibitor, caspase inhibitor, granzyme inhibitor, cell adhesion inhibitor, cell division inhibitor, cell cycle inhibitor, lipid signaling inhibitor, protease inhibitor, reducing agent, alkylating agent, antimicrobial agent, oxidase inhibitor, or other inhibitors, or any combination thereof.
  • the excipient comprises a binder.
  • the binder comprises starches, pregelatinized starches, gelatin, polyvinylpyrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamides, polyvinyloxoazolidone, polyvinylalcohols, C12-C18 fatty acid alcohol, polyethylene glycol, polyols, saccharides, oligosaccharides, or any combination thereof.
  • the binder is a starch, for example a potato starch, com starch, or wheat starch; a sugar such as sucrose, glucose, dextrose, lactose, or maltodextrin; a natural and/or synthetic gum; a gelatin; a cellulose derivative such as microcrystalline cellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose, carboxymethyl cellulose, methyl cellulose, or ethyl cellulose; polyvinylpyrrolidone (povidone); polyethylene glycol (PEG); a wax; calcium carbonate; calcium phosphate; an alcohol such as sorbitol, xylitol, mannitol, or water, or any combination thereof.
  • a starch for example a potato starch, com starch, or wheat starch
  • a sugar such as sucrose, glucose, dextrose, lactose, or maltodextrin
  • the excipient comprises a lubricant.
  • the lubricant comprises magnesium stearate, calcium stearate, zinc stearate, hydrogenated vegetable oils, sterotex, polyoxyethylene monostearate, talc, polyethyleneglycol, sodium benzoate, sodium lauryl sulfate, magnesium lauryl sulfate, or light mineral oil, or any combination thereof.
  • the lubricant comprises metallic stearates (such as magnesium stearate, calcium stearate, aluminum stearate), fatty acid esters (such as sodium stearyl fumarate), fatty acids (such as stearic acid), fatty alcohols, glyceryl behenate, mineral oil, paraffins, hydrogenated vegetable oils, leucine, polyethylene glycols (PEG), metallic lauryl sulphates (such as sodium lauryl sulphate, magnesium lauryl sulphate), sodium chloride, sodium benzoate, sodium acetate or talc or a combination thereof.
  • metallic stearates such as magnesium stearate, calcium stearate, aluminum stearate
  • fatty acid esters such as sodium stearyl fumarate
  • fatty acids such as stearic acid
  • fatty alcohols such as sodium stearic acid
  • fatty alcohols such as sodium stearyl fumarate
  • fatty acids such as stearic acid
  • the excipient comprises a dispersion enhancer.
  • the dispersion enhancer comprises starch, alginic acid, polyvinylpyrrolidones, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isomorphous silicate, or microcrystalline cellulose, or any combination thereof as high HLB emulsifier surfactants.
  • the excipient comprises a disintegrant.
  • a disintegrant comprises a non-effervescent disintegrant.
  • a non-effervescent disintegrants comprises starches such as corn starch, potato starch, pregelatinized and modified starches thereof, sweeteners, clays, such as bentonite, micro-crystalline cellulose, alginates, sodium starch glycolate, or gums such as agar, guar, locust bean, karaya, pectin, and tragacanth, or any combination thereof.
  • a disintegrant comprises an effervescent disintegrant.
  • a suitable effervescent disintegrant comprises bicarbonate in combination with citric acid, and sodium bicarbonate in combination with tartaric acid.
  • the excipient comprises a sweetener, a flavoring agent or both.
  • a sweetener comprises glucose (com syrup), dextrose, invert sugar, fructose, and mixtures thereof (when not used as a carrier); saccharin and its various salts such as a sodium salt; dipeptide sweeteners such as aspartame; dihydrochalcone compounds, glycyrrhizin; Stevia Rebaudiana (Stevioside); chloro derivatives of sucrose such as sucralose; and sugar alcohols such as sorbitol, mannitol, xylitol, and the like, or any combination thereof.
  • flavoring agents incorporated into a composition comprise synthetic flavor oils and flavoring aromatics; natural oils; extracts from plants, leaves, flowers, and fruits; or any combination thereof.
  • a flavoring agent comprises a cinnamon oils; oil of wintergreen; peppermint oils; clover oil; hay oil; anise oil; eucalyptus; vanilla; citrus oil such as lemon oil, orange oil, grape and grapefruit oil; and fruit essences including apple, peach, pear, strawberry, raspberry, cherry, plum, pineapple, and apricot, or any combination thereof.
  • the excipient comprises a pH agent (e.g., to minimize oxidation or degradation of a component of the composition), a stabilizing agent (e.g., to prevent modification or degradation of a component of the composition), a buffering agent (e.g., to enhance temperature stability), a solubilizing agent (e.g., to increase protein solubility), or any combination thereof.
  • the excipient comprises a surfactant, a sugar, an amino acid, an antioxidant, a salt, a non-ionic surfactant, a solubilizer, a triglyceride, an alcohol, or any combination thereof.
  • the excipient comprises sodium carbonate, acetate, citrate, phosphate, poly-ethylene glycol (PEG), human serum albumin (HSA), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, sucrose, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, trehalose, arginine, sodium acetate, acetate, HC1, disodium edetate, lecithin, glycerine, xanthan rubber, soy isoflavones, polysorbate 80, ethyl alcohol, water, teprenone, or any combination thereof.
  • PEG poly-ethylene glycol
  • HSA human serum albumin
  • the excipient comprises a cryo-preservative.
  • the excipient comprises DMSO, glycerol, polyvinylpyrrolidone (PVP), or any combination thereof.
  • the excipient comprises a sucrose, a trehalose, a starch, a salt of any of these, a derivative of any of these, or any combination thereof.
  • the pharmaceutical composition comprises a diluent.
  • the diluent comprises water, glycerol, methanol, ethanol, or other similar biocompatible diluents, or any combination thereof.
  • a diluent comprises an aqueous acid such as acetic acid, citric acid, maleic acid, hydrochloric acid, phosphoric acid, nitric acid, sulfuric acid, or any combination thereof.
  • a diluent comprises an alkaline metal carbonates such as calcium carbonate; alkaline metal phosphates such as calcium phosphate; alkaline metal sulphates such as calcium sulphate; cellulose derivatives such as cellulose, microcrystalline cellulose, cellulose acetate; magnesium oxide, dextrin, fructose, dextrose, glyceryl palmitostearate, lactitol, choline, lactose, maltose, mannitol, simethicone, sorbitol, starch, pregelatinized starch, talc, xylitol and/or anhydrates, hydrates and/or pharmaceutically acceptable derivatives thereof or combinations thereof.
  • alkaline metal carbonates such as calcium carbonate
  • alkaline metal phosphates such as calcium phosphate
  • alkaline metal sulphates such as calcium sulphate
  • cellulose derivatives such as cellulose, microcrystalline cellulose, cellulose acetate
  • magnesium oxide de
  • the pharmaceutical composition comprises a carrier.
  • the carrier comprises a liquid or solid filler, solvent, or encapsulating material.
  • the carrier comprises additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri-, tetra-oligosaccharides, and oligosaccharides; derivatized sugars such as alditols, aldolic acids, esterified sugars and the like; and polysaccharides or sugar polymers), alone or in combination.
  • the pharmaceutical composition is administered to a subject by any means which will contact the engineered polynucleotide and/or ADAR (or a vector encoding the engineered polynucleotide and/or ADAR) with a target cell.
  • the specific route will depend upon certain variables such as the target cell and can be determined by the skilled practitioner.
  • the pharmaceutical composition is administered by intravenous administration, intraperitoneal administration, intramuscular administration, intracoronary administration, intraarterial administration (e.g., into a carotid artery), subcutaneous administration, transdermal delivery, intratracheal administration, subcutaneous administration, intraarticular administration, intraventricular administration, inhalation (e.g., aerosol), intracerebral, nasal, oral, pulmonary administration, impregnation of a catheter, or direct injection into a tissue, or any combination thereof.
  • the target cells are in or near a tumor and administration is by direct injection into the tumor or tissue surrounding the tumor.
  • the tumor is a breast tumor and administration can comprise impregnation of a catheter and direct injection into the tumor.
  • aerosol (inhalation) delivery is performed using methods known in the art, such as methods described in, for example, Stribling et ah, Proc. Natl. Acad. Sci. USA 189: 11277-11281, 1992, which is incorporated by reference herein.
  • oral delivery is performed by complexing an engineered guide (or a vector encoding an engineered guide) to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal.
  • Examples of such carriers include plastic capsules or tablets, such as those known in the art.
  • direct injection techniques are used for administering the engineered polynucleotide and/or ADAR (or a vector encoding the engineered polynucleotide and/or ADAR) to a cell or tissue that is accessible by surgery, and on or near the surface of the body.
  • administration of a composition locally within the area of a target cell comprises injecting the composition centimeters or millimeters from the target cell or tissue.
  • the appropriate dosage and treatment regimen for the methods of treatment described herein vary with respect to the particular disease being treated, the engineered polynucleotide and/or ADAR (or a vector encoding the engineered polynucleotide and/or ADAR) being delivered, and the specific condition of the subject.
  • the administration is over a period of time until the desired effect (e.g., reduction in symptoms is achieved).
  • administration is 1, 2, 3, 4, 5, 6, or 7 times per week.
  • administration or application of a composition disclosed herein is performed for a treatment duration of at least about 1 week, at least about 1 month, at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, at least about 10 years, at least about 15 years, at least about 20 years, or more.
  • administration is over a period of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks.
  • administration is over a period of 2, 3, 4, 5, 6 or more months.
  • administration is performed repeatedly over a lifetime of a subject, such as once a month or once a year for the lifetime of a subject.
  • administration is performed repeatedly over a substantial portion of a subject’s life, such as once a month or once a year for at least about 1 year, 5 years, 10 years, 15 years, 20 years, 25 years, 30 years, or more. In some examples, treatment is resumed following a period of remission.
  • compositions described herein may be comprised in a kit.
  • a vector, a polynucleotide, a peptide, reagents to generate polynucleotides provided herein, and any combination thereof may be comprised in a kit.
  • kit components are provided in suitable container means.
  • Kits may comprise a suitably aliquoted composition.
  • the components of the kits may be packaged either in aqueous media or in lyophilized form.
  • the container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe, or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial.
  • the kits also will typically include a means for containing the components in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained.
  • the components of the kit may be provided as dried powder(s).
  • the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.
  • a kit can comprise an engineered polynucleotide, a precursor engineered polynucleotide, a vector comprising the engineered polynucleotide or the precursor engineered polynucleotide, or a nucleic acid of the engineered polynucleotide or the precursor engineered polynucleotide, or a pharmaceutical composition and a container.
  • a container can be plastic, glass, metal, or any combination thereof.
  • a packaged product comprising a composition described herein can be properly labeled.
  • the pharmaceutical composition described herein can be manufactured according to good manufacturing practice (cGMP) and labeling regulations.
  • a pharmaceutical composition disclosed herein can be aseptic.
  • Example 1 Design and specificity of the Taqman assays representative for the exon 71 and exon 74 deletion transcripts in ddPCR analysis.
  • PCR primers and probes were designed to detect dystrophin mRNA with or without exon 71 or exon 74 andpositioned as indicated in FIG. 1 A.
  • Probes that detect dystrophin cDNA constructs with exon 71 are labeled with the HEX dye to form Exon 71 HEX probe.
  • Probes that detect dystrophin cDNA constructs with exon 70 precisely ligated to exon 72 are labeled with the FAM dye to form Exon 70-72 FAM probe.
  • Probes that detect dystrophin cDNA constructs with exon 74 precisely ligated to exon 75 are labeled with the HEX dye to form Exon 74-75 HEX probe.
  • Probes that detect dystrophin cDNA constructs with exon 73 precisely ligated to exon 75 are labeled with the FAM dye to form Exon 73-75 FAM probe (FIG. 1A).
  • the specificity of the DMD exon 71 and DMD exon 74 ddPCR skipping assays were confirmed using control cDNA from RD rhabdomyosarcoma cells artificially overexpressing DMD exons 69-70-71-72-73-74- 75-76-77 (69-77), DMD exons 69-70-72-73-74-75-76-77 (69-70,72-77), or DMD exons 69-70- 71-72-73-75-76-77 (69-73,75-77) (FIG.
  • HEK-293T and HEK-293 cells which naturally express the C-terminal Dp71 DMD isoform, were plated at 20,000 cells per well of a 24-well plate before transfection with each of the engineered polynucleotides listed in SEQ ID NOs. 9-14 to induce exon 71 skipping or exon 74 skipping in the DMD mRNA.
  • a guide RNA targeting RAB7A was used that does not bind to the DMD pre-mRNA. The negative control serves as measure of the exon skipping that occurs naturally in the HEK-293T and HEK-293 cells.
  • RNA was isolated 38-44 hours post-transfection.
  • cDNA was synthesized using Protoscript II Reverse Transcriptase (New England Biolabsaccording to the manufacturer’s instructions. Droplet digital PCR was performed to measure skipping of DMD exon 71 and exon 74 as described above in Example 1.
  • FIG. 2A shows that guide RNA encoded by SEQ ID NOs. 9-11 achieve an enhanced level of DMD exon 71 skipping compared to the negative control guide RNAs which instead target RAB7A. Furthermore, in the presence of ADAR2 overexpression, guide RNAs encoded by SEQ ID NOs. 9-11 achieve a further enhanced level of exon 71 skipping compared to those in the presence of the GFP control.
  • FIG. 2B shows that , guide RNAs encoded by SEQ ID NOs. 12-14 achieve an enhanced level of DMD exon 74 skipping compared to the negative control guide RNAs which instead target RAB7A. Furthermore, in the presence of ADAR2 overexpression, guide RNAs encoded by SEQ ID NOs. 12-14 achieve a further enhanced level of exon 74 skipping compared to those in the presence of the GFP control.
  • FIG. 3A indicates that, while guide RNAs encoded by SEQ ID NO. 9 achieve an enhanced level of exon 71 skipping compared to negative control guide RNAs which target RAB7A, overexpression of either ADARl pi 50, ADARl pi 10, or ADAR2 further increases the exon skipping of these guide RNAs compared to the GFP control.
  • FIG. 3B indicates that, while guide RNAs encoded by SEQ ID NO. 12 achieve an enhanced level of exon 74 skipping compared to negative control guide RNAs which target RAB7A, overexpression of either ADARl pi 50, ADARl pi 10, or ADAR2 further increases the exon skipping of these guide RNAs compared to the GFP control.
  • FIGS. 4A and 4B shows that exon skipping induced by the engineered guide RNA in undifferentiated RD cells occurs both natural endogenous ADAR levels (GFP) and in the presence of overexpressed ADAR2.
  • a human muscle cell line (RD rhabdomyosarcoma) was established for further assay development expressing full length Dp427m DMD isoform upon differentiation (FIG. 4C and 4D).
  • FIGS. 5, 6, and 7 show double-stranded substrates formed by engineered guides disclosed herein and DMD pre-mRNA, ABCA4, and PMP22 respectively, disclosed herein.
  • the engineered guides are 100 bases in length comprising, at base 50, plus or minus 2 nucleotides, from the 5’ end, a cytosine intended for pairing with the adenine to be edited by an ADAR, referred to as “100@50” guides herein.
  • Example 3 Gene therapy for correcting the pathogenic mutation(s) in the Stargardt Disease patient by anti-ABCA4 guide RNAs
  • Stargardt Disease is caused by loss-of-function genetic mutations in the ABCA4 gene.
  • the most common mutations present in Stargardt Disease patients are detailed below in Table 2, with ADAR-compatible mutations listed in bold and underlined text.
  • the most common missense mutation in Stargardt disease is a G>A mutation (a c.5882 G>A mutation), which is ADAR compatible. Experiments described herein are conducted to assess the ability of engineered polynucleotides, as disclosed herein, to correct c.5882G>A mutations expressed in ABCA4 miniaturized genes (mini-genes).
  • Stargardt Disease Associated Mutations [0169] Stargardt disease patients diagnosed with the c.5882G>A mutation can be treated using an engineered polynucleotide of SEQ ID NO: 15 in Table 3.
  • the guide RNAs can be prepared by various methods.
  • the guide RNA can be prepared by Polymerase Chain Reaction (PCR) and in vitro transcription (IVT), and injected into the patient by intraocular injection.
  • PCR Polymerase Chain Reaction
  • IVTT in vitro transcription
  • the guide RNA (SEQ ID NO. 15) can also be cloned into a viral vector, such as an adenoviral vector, an adeno-associated viral vector (AAV), a lentiviral vector, or a retroviral vector.
  • the viral vector with the coding sequence of the guide RNA can be directly injected into the patient by intraocular injection.
  • the guide RNA (SEQ ID NO. 15) — as listed in Table 3 can be prepared by PCR or gBlocksTM Gene Fragments. The coding sequence can then be attached to nanoparticle or dendrimer for intraocular injection into the patient.
  • RNA editing is monitored as follows: ⁇ 1c10 L 5 optic cells are collected for RNA isolation after a week. At collection, cells are spun at l,500x g for 1 min. The media are removed. 180ul of RLT buffer + BMe is added to each well. Qiagen RNeasy protocol and kit are used to isolate the RNAs from the cell. New England Biolabs (NEB) ProtoScript II First-Strand cDNA synthesis kit is used to synthesize cDNA from the isolated RNA. cDNA of ABCA4 is sequenced by the Sanger sequencing. Sanger traces are analyzed to assess the editing efficiency of each IVT guide. The RNA editing efficiency, the A>G conversion in ABCA4, is calculated by the difference of trace signal of the ABCA4 mRNA with a G (edited) and an A (unedited) at the 5882nd nucleotide.
  • Example 4 Gene therapy for correcting the overexpression of PMP22 in the CMT1A Disease patient by anti-PMP22 guide RNAs
  • the guide RNA of SEQ ID NO. 16 listed in Table 3 is used to target the start ATG of PMP22. It can convert the start codon ATG triplet into a GTG triplet. Since the start ATG is removed, the expression of PMP22 should decrease.
  • the guide RNA sequence is cloned into a single viral vector — such as an adenoviral vector, an adeno-associated viral vector (AAV), a lentiviral vector, or a retroviral vector — for expression.
  • the vector is injected into the patient by intramuscular injection.
  • the expression level of PMP22 is monitored as follows: ⁇ 1c10 L 5 muscle cells are collected for RNA isolation after a week. At collection, cells are spun at l,500x g for 1 min. The media are removed. 180ul of RLT buffer + BMe is added to each well. Qiagen RNeasy protocol and kit are used to isolate the RNAs from the cell. New England Biolabs (NEB) ProtoScript II First-Strand cDNA synthesis kit is used to synthesize cDNA from the isolated RNA. QPCR is used to measure the expression level of PMP22, as compared to the control.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des procédés et des compositions pour la prévention ou le soulagement de maladies telles que la dystrophie musculaire de Duchenne (DMD), La maladie de Charcot-Marie-Tooth, ou la maladie de Stargardt, impliquant l'utilisation d'un polynucléotide modifié qui peut se lier à un ARN cible pertinent (DMD, PMP22 ou ABCA4, respectivement) pour induire la correction d'une mutation dans un ARN cible, la régulation de l'expression d'un ARN cible, l'induction d'un saut d'exon amélioré dans un pré-ARNm cible, ou une combinaison de celles-ci, aidant ainsi à prévenir ou à traiter la maladie.
PCT/US2020/062930 2019-12-02 2020-12-02 Compositions pour le traitement de maladies WO2021113390A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962942668P 2019-12-02 2019-12-02
US62/942,668 2019-12-02

Publications (1)

Publication Number Publication Date
WO2021113390A1 true WO2021113390A1 (fr) 2021-06-10

Family

ID=74106121

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/062930 WO2021113390A1 (fr) 2019-12-02 2020-12-02 Compositions pour le traitement de maladies

Country Status (1)

Country Link
WO (1) WO2021113390A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023152371A1 (fr) 2022-02-14 2023-08-17 Proqr Therapeutics Ii B.V. Oligonucléotides guides pour l'édition d'acides nucléiques dans le traitement de l'hypercholestérolémie
WO2023201300A3 (fr) * 2022-04-14 2023-11-23 Shift Pharmaceuticals Holding Inc. Traitements polynucléotidiques pour une maladie de charcot-marie-tooth
WO2024013361A1 (fr) 2022-07-15 2024-01-18 Proqr Therapeutics Ii B.V. Oligonucléotides pour édition d'arn médiée par adar et leur utilisation
WO2024013360A1 (fr) 2022-07-15 2024-01-18 Proqr Therapeutics Ii B.V. Oligonucléotides chimiquement modifiés pour édition d'arn médiée par adar
WO2024084048A1 (fr) 2022-10-21 2024-04-25 Proqr Therapeutics Ii B.V. Complexes oligonucléotidiques hétéroduplex d'édition d'arn

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018134301A1 (fr) * 2017-01-19 2018-07-26 Proqr Therapeutics Ii B.V. Complexes oligonucléotidiques destinés à être utilisés dans l'édition d'arn
WO2018161032A1 (fr) * 2017-03-03 2018-09-07 The Regents Of The University Of California Ciblage arn de mutations par l'intermédiaire d'arnt suppresseurs et de désaminases
CA3106738A1 (fr) * 2017-07-25 2019-01-31 Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences Procede de modulation de l'epissage de l'arn par induction d'une mutation de base au niveau d'un site d'epissage ou d'une substitution de base dans une region de polypyrimidine
WO2019071048A1 (fr) * 2017-10-04 2019-04-11 The Broad Institute, Inc. Systèmes, procédés et compositions d'édition ciblée d'acides nucléiques
WO2019158475A1 (fr) * 2018-02-14 2019-08-22 Proqr Therapeutics Ii B.V. Oligonucléotides antisens pour édition d'arn
WO2020051555A1 (fr) * 2018-09-06 2020-03-12 The Regents Of The University Of California Édition de base d'arn et d'adn par recrutement adar mis au point
WO2020210776A1 (fr) * 2019-04-12 2020-10-15 Duke University Composition d'édition de bases basée sur crispr/cas pour restaurer la fonction de la dystrophine

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018134301A1 (fr) * 2017-01-19 2018-07-26 Proqr Therapeutics Ii B.V. Complexes oligonucléotidiques destinés à être utilisés dans l'édition d'arn
WO2018161032A1 (fr) * 2017-03-03 2018-09-07 The Regents Of The University Of California Ciblage arn de mutations par l'intermédiaire d'arnt suppresseurs et de désaminases
CA3106738A1 (fr) * 2017-07-25 2019-01-31 Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences Procede de modulation de l'epissage de l'arn par induction d'une mutation de base au niveau d'un site d'epissage ou d'une substitution de base dans une region de polypyrimidine
WO2019071048A1 (fr) * 2017-10-04 2019-04-11 The Broad Institute, Inc. Systèmes, procédés et compositions d'édition ciblée d'acides nucléiques
WO2019158475A1 (fr) * 2018-02-14 2019-08-22 Proqr Therapeutics Ii B.V. Oligonucléotides antisens pour édition d'arn
WO2020051555A1 (fr) * 2018-09-06 2020-03-12 The Regents Of The University Of California Édition de base d'arn et d'adn par recrutement adar mis au point
WO2020210776A1 (fr) * 2019-04-12 2020-10-15 Duke University Composition d'édition de bases basée sur crispr/cas pour restaurer la fonction de la dystrophine

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BRUTLAG ET AL., COMP. APP. BIOSCI., vol. 6, 1990, pages 237 - 245
GAPINSKE MICHAEL ET AL: "CRISPR-SKIP: programmable gene splicing with single base editors", GENOME BIOLOGY, vol. 19, no. 1, 15 August 2018 (2018-08-15), XP055783339, Retrieved from the Internet <URL:http://link.springer.com/article/10.1186/s13059-018-1482-5/fulltext.html> DOI: 10.1186/s13059-018-1482-5 *
GENGHAO CHEN ET AL: "RNA-Guided Adenosine Deaminases: Advances and Challenges for Therapeutic RNA Editing", BIOCHEMISTRY, vol. 58, no. 15, 3 April 2019 (2019-04-03), pages 1947 - 1957, XP055729561, ISSN: 0006-2960, DOI: 10.1021/acs.biochem.9b00046 *
KATREKAR DHRUVA ET AL: "In vivo RNA editing of point mutations via RNA-guided adenosine deaminases", NATURE METHODS, NATURE PUB. GROUP, NEW YORK, vol. 16, no. 3, 8 February 2019 (2019-02-08), pages 239 - 242, XP036713087, ISSN: 1548-7091, [retrieved on 20190208], DOI: 10.1038/S41592-019-0323-0 *
KATREKAR DHRUVA ET AL: "Supplementary information In vivo RNA editing of point mutations via RNA-guided adenosine deaminases", NATURE METHODS, 8 February 2019 (2019-02-08), XP055783641, Retrieved from the Internet <URL:http://www.nature.com/articles/s41592-019-0323-0.pdf> [retrieved on 20210309], DOI: 10.1038/s41592-019-0323-0 *
STRIBLING ET AL., PROC. NATL. ACAD. SCI. USA, vol. 189, 1992, pages 11277 - 11281
VERHAART INGRID E ET AL: "Therapeutic developments for Duchenne muscular dystrophy", NATURE REVIEWS. NEUROLOGY, NATURE, US, vol. 15, no. 7, 30 May 2019 (2019-05-30), pages 373 - 386, XP036823394, ISSN: 1759-4758, [retrieved on 20190530], DOI: 10.1038/S41582-019-0203-3 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023152371A1 (fr) 2022-02-14 2023-08-17 Proqr Therapeutics Ii B.V. Oligonucléotides guides pour l'édition d'acides nucléiques dans le traitement de l'hypercholestérolémie
WO2023201300A3 (fr) * 2022-04-14 2023-11-23 Shift Pharmaceuticals Holding Inc. Traitements polynucléotidiques pour une maladie de charcot-marie-tooth
WO2024013361A1 (fr) 2022-07-15 2024-01-18 Proqr Therapeutics Ii B.V. Oligonucléotides pour édition d'arn médiée par adar et leur utilisation
WO2024013360A1 (fr) 2022-07-15 2024-01-18 Proqr Therapeutics Ii B.V. Oligonucléotides chimiquement modifiés pour édition d'arn médiée par adar
WO2024084048A1 (fr) 2022-10-21 2024-04-25 Proqr Therapeutics Ii B.V. Complexes oligonucléotidiques hétéroduplex d'édition d'arn

Similar Documents

Publication Publication Date Title
WO2021113390A1 (fr) Compositions pour le traitement de maladies
JP2021536244A (ja) 遺伝子操作されたａｄａｒのリクルートを介したｒｎａ及びｄｎａ塩基の編集
JP7416451B2 (ja) ＣＲＩＳＰＲ－Ｃａｓによる標的化された核内ＲＮＡ切断及びポリアデニル化
JP2021502058A (ja) Ｒｎａを編集するための組成物および方法
EP2892617B1 (fr) Polynucléotides antisens destinés à induire un saut d&#39;exon et méthodes de traitement de dystrophies
US20230399635A1 (en) RNA-Editing Compositions and Methods of Use
CN110381982B (zh) 与myomixer促进的肌细胞融合相关的组合物和方法
CN111718947A (zh) 用于治疗ⅲa或ⅲb型粘多糖贮积症的腺相关病毒载体及用途
US20230346979A1 (en) Gene therapies for neurodegenerative disorders
CA3136004A1 (fr) Therapies geniques pour troubles lysosomaux
US20230167452A1 (en) Compositions and methods for correcting limb girdle muscular dystrophy type 2c using exon skipping
AU2020396868A1 (en) Targeted transfer RNAS for treatment of diseases
CN114828897A (zh) 细胞活力的调节
AU2022301997A1 (en) Engineered guide rnas and polynucleotides
WO2023278436A1 (fr) Arn guides et polynucléotides modifiés
WO2023091949A2 (fr) Compositions et méthodes de traitement de troubles neurologiques liés à un déficit en bêta glucosylcéramidase
US20230047313A1 (en) Treating heart disease in muscular dystrophy patients
WO2010037143A1 (fr) Vecteurs et méthodes de traitement des convulsions cérébrales
WO2024044282A1 (fr) Constructions modifiées pour une transcription accrue de charges utiles d&#39;arn
WO2024081411A1 (fr) Constructions modifiées pour une stabilité ou une localisation améliorées de charges utiles d&#39;arn
CN117980480A (zh) 工程化引导rna和多核苷酸

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20834010

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20834010

Country of ref document: EP

Kind code of ref document: A1