WO2021112641A1 - 중쇄 디올을 생산하는 재조합 균주 및 이를 이용한 중쇄 디올의 생산방법 - Google Patents

중쇄 디올을 생산하는 재조합 균주 및 이를 이용한 중쇄 디올의 생산방법 Download PDF

Info

Publication number
WO2021112641A1
WO2021112641A1 PCT/KR2020/017700 KR2020017700W WO2021112641A1 WO 2021112641 A1 WO2021112641 A1 WO 2021112641A1 KR 2020017700 W KR2020017700 W KR 2020017700W WO 2021112641 A1 WO2021112641 A1 WO 2021112641A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
encoded
nucleotide sequence
metabolic pathway
activity
Prior art date
Application number
PCT/KR2020/017700
Other languages
English (en)
French (fr)
Inventor
안정오
박규연
전우영
장민정
이홍원
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of WO2021112641A1 publication Critical patent/WO2021112641A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0077—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with a reduced iron-sulfur protein as one donor (1.14.15)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01001—Alcohol dehydrogenase (1.1.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/03—Oxidoreductases acting on the CH-OH group of donors (1.1) with a oxygen as acceptor (1.1.3)
    • C12Y101/0302—Long-chain-alcohol oxidase (1.1.3.20)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/15—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with reduced iron-sulfur protein as one donor, and incorporation of one atom of oxygen (1.14.15)
    • C12Y114/15003—Alkane 1-monooxygenase (1.14.15.3)

Definitions

  • the present invention relates to a recombinant strain for producing a heavy chain diol and a method for producing a heavy chain diol by culturing the same.
  • Bioplatform compounds are produced through biological or chemical conversion based on biomass-derived raw materials, and are used in the synthesis of polymer monomers and new materials.
  • ⁇ , ⁇ -diol is a material used as a monomer of polyester, and polyester is widely used for various purposes including fiber, film, and combined use due to its excellent properties.
  • polyethylene terephthalate obtained by polycondensation of ethylene glycol and terephthalic acid is excellent in mechanical strength and chemical properties and is used in many applications, and is mass-produced worldwide as a synthetic fiber most suitable for medical use.
  • polytrimethylene terephthalate using 1,3-propanediol and terephthalic acid as raw materials a cheap 1,3-propanediol synthesis method has recently been developed, and the market is on the rise. It is expected to develop as a medical application with a soft touch that takes advantage of the low polymer properties.
  • biomass-derived polyesters are attracting attention.
  • ⁇ , ⁇ -diol The production of ⁇ , ⁇ -diol can be accomplished by a biological method through chemical synthesis or microbial fermentation, and when such biological method is used, new strain development using metabolic engineering technology and optimization of the fermentation process are required.
  • a microorganism having both a ⁇ -oxidative metabolic pathway and an ⁇ -oxidative metabolic pathway may be used, for example, Klebsiella oxytoca , Krebsila pneumoniae.
  • Strains such as Klebsiella pneumoniae , Aerobacter aerogenes , and recombinant Saccharomyces cerevisiae are known to be capable of producing 2,3-butanediol in high yield and high productivity. (KR10-2012-0107021A, KR10-2012-0128776A, KR10-2015-0068581A).
  • microorganisms are classified as pathogenic microorganisms, limiting safety and industrialization aspects. Also, current industrial scale production is limited to short-chain diol biosynthesis, and studies on medium-chain or long-chain ⁇ , ⁇ -diols are limited. It is insufficient.
  • Escherichia coli Escherichia coli
  • the technology of producing 1,12-diol by the cytochrome p450 enzymes from alkane compounds but in the known (Scheps et al, Organic & Biomolecular Chemistry, 9:. 17, 6727-6733 (2011 )), the E. coli system requires an expensive heme or haem precursor and an endogenous electron transport system for CYP expression, and there is a limit to the large-scale production of heavy chain diols in that the absorption of hydrophobic substrates is limited.
  • an object of the present invention is to provide a recombinant microorganism into which a specific enzyme involved in an oxidative metabolic pathway is introduced.
  • an object of the present invention is to provide a method for producing a medium-chain diol in a more improved yield from an alcohol or alkane derived from fatty acids by culturing the recombinant microorganism.
  • one aspect of the present invention is a gene among the enzymes involved in the ⁇ -oxidative metabolic pathway in a microorganism having both an ⁇ -oxidative metabolic pathway and a ⁇ -oxidative metabolic pathway, a part of fatty alcohol oxidase or all of the activity is reduced or lost, optionally the activity of fatty alcohol dehydrogenase and/or fatty aldehyde dehydrogenase is reduced or lost, and the activity of acyl-CoA oxidase in the ⁇ -oxidative metabolic pathway is reduced or On the other hand, it provides a recombinant microorganism in which the activity of endogenous monooxygenase involved in the ⁇ -oxidation metabolic pathway is reduced or lost.
  • the recombinant microorganism may exhibit activity by introducing at least one exogenous monooxygenase in addition to the decrease or loss of the activity of the endogenous monooxygenase.
  • the exogenous monooxygenase may be a cytochrome P450 enzyme derived from bacteria, but is not limited thereto.
  • the endogenous monooxygenase, fatty alcohol dehydrogenase, fatty alcohol oxidase gene and acyl-CoA oxidase are each independently some of the isoform enzymes present in the microorganism or All of the activity may be reduced or lost, but is not limited thereto.
  • the microorganism may be yeast, but is not limited thereto.
  • the yeast may be included in any one genus selected from the group consisting of Yarrowia genus, Saccharomyes genus, Pichia genus and Candida genus, but is not limited thereto.
  • Another aspect of the present invention provides a method for producing a medium chain diol comprising the step of culturing the recombinant microorganism in an environment in which at least one of a medium chain alkane and a medium chain fatty alcohol is supplied.
  • the recombinant microorganism of the present invention comprises a fatty alcohol oxidase and optionally a fatty alcohol dehydrogenase and/or a fatty alcohol oxidase involved in an ⁇ -oxidative metabolic pathway in a microorganism having both an ⁇ -oxidative metabolic pathway and a ⁇ -oxidative metabolic pathway of hydrocarbons.
  • FIG. 1 schematically shows the ⁇ -oxidative metabolic pathway and the ⁇ -oxidative metabolic pathway occurring in a microorganism having both the ⁇ -oxidative metabolic pathway and the ⁇ -oxidative metabolic pathway of hydrogen, its products, and types of related enzymes.
  • Figure 2 shows the homologous recombination process using URA3 as a selection marker, where HR is a homologous region and RS is a repeat sequence.
  • Figure 3 shows a map of the vector pYIGEM used to construct the strain improvement of the present invention.
  • FIG. 4 shows the types of knocked-out genes in recombinant microorganisms prepared in Examples of the present invention, and a red square indicates that the corresponding gene has been removed.
  • 5 is a series of steps (a) of knocking out a gene in the process of producing recombinant microorganisms in the embodiments of the present invention, and n-alkane or As a result of confirming the yield of producing medium-chain diol from fatty alcohol, (b) is the result when n-alkane is used as a substrate, and (c) is the result when n-alkanol is used as a substrate (1,12) -DDDA: 1,12-dodecanoic acid; 12-HDA: 12-hydroxydodecanoic acid; 1,12-DIOL: 1,12-dodecanediol).
  • FIG. 7 shows the substrate preference (a) of the endogenous monooxygenase of Yarrowia lipolytica and the degree of conversion of n-alkanes to heavy chain ⁇ , ⁇ -diols in recombinant microbial strains in which ALK3 and/or ALK6 genes are deleted.
  • (b) shows a series of processes for producing recombinant microorganisms by knocking out the ALK3 and/or ALK6 gene from the YID05 strain
  • (c) is n in the culture in which the recombinant microorganism is cultured - Shows the results of confirming the degree of conversion of dodecane and 1-dodecanol to 1,12-dodecanediol (1,12-DDDA: 1,12-dodecanedioic acid; 12-HDA: 12-hydroxy degree) decanoic acid; 1,12-DIOL: 1,12-dodecanediol).
  • FIG. 8 is a strategy for confirming the peroxidation activity of each endogenous monooxygenase of Yarrowia lipolytica and the results thereof,
  • (a) is a recombinant microorganism in which all endogenous monooxygenase is knocked out (YID09 strain) schematically shows a strategy to confirm the peroxidation activity of individual ALK genes by expression of each ALK gene, and
  • (b) shows that n-alkanes are oxidized in cultures of recombinant microorganisms expressing each ALK gene individually.
  • Figure 10a shows the results of confirming the types and amounts of products produced in the culture after introducing various types of bacteria-derived exogenous monooxygenase into the YID09 strain in which all endogenous monooxygenase is knocked out ( 1,12-DDDA: 1,12-dodecanoic acid; 12-HDA: 12-hydroxydodecanoic acid; 1-DDA: dodecanoic acid; 1-DOL: 1-dodecanol; 1,12-DIOL: 1, 12-dodecanediol).
  • Figure 10b shows the production of 1,12-dodecanediol produced in the culture after introducing various types of bacteria-derived exogenous monooxygenase into YID09 strain in which all endogenous monooxygenase is knocked out. .
  • ⁇ -oxidation refers to a metabolic process in which the methyl group terminal of a fatty acid is oxidized to form a dicarboxylic acid
  • ⁇ -oxidation refers to the oxidation of a carbon atom at the ⁇ -position in the carboxy group of the fatty acid to acetyl- It refers to a metabolic process in which CoA is gradually decomposed into fatty acids with reduced carbon atoms by 2 each time.
  • the concepts of ⁇ -oxidation and ⁇ -oxidation and enzymes involved in these metabolic processes are well known to those skilled in the art of biochemistry.
  • ⁇ -hydroxy fatty acids are first produced by the action of cytochrome P450 (endogenous monooxygenase) and NADPH-cytochrome P450 reductase, The ⁇ -hydroxy fatty acids are converted to ⁇ -aldehyde fatty acids by the action of fatty alcohol dehydrogenase and fatty alcohol oxidase, and the ⁇ -aldehyde fatty acids are converted to ⁇ , ⁇ -di converted to carboxylic acids.
  • cytochrome P450 endogenous monooxygenase
  • NADPH-cytochrome P450 reductase NADPH-cytochrome P450 reductase
  • fatty acyl-CoA (C n ) is first generated by the action of fatty acetyl-CoA synthetase, and the fatty acyl- CoA (C n) is an acyl -CoA dehydrogenase and acyl trans - ⁇ 2 by the action of an oxidase -CoA - is converted into yen five days -CoA (C n), the trans - ⁇ 2 - five days yen -CoA ( C n) is five days yen -CoA Hydra other kinase (hydratase) is converted to L- ⁇ - hydroxy acyl CoA (C n) by the action of the L- ⁇ - hydroxy acyl CoA (C n) is 3 hydroxy acyl -CoA dehydrogenase is converted into CoA (C n) by the action of an oxidase -CoA - is converted into yen five days -CoA (C
  • the acyl-CoA (C n-2 ) thus generated is again subjected to the same process as above, and as this process is repeated, the carbon number of the fatty acid is gradually reduced and finally converted into a short-chain fatty acid having a small number of carbon atoms.
  • ⁇ , ⁇ -dicarboxylic acid generated through the ⁇ -oxidative metabolic pathway is converted to fatty acyl-CoA (C n ) and then goes through the ⁇ -oxidative metabolic pathway, through which acetyl-CoA and the number of carbon atoms converted to two reduced fatty acyl-CoA(C n-2 ) (see FIG. 1 ).
  • the term “involved” means that an enzyme is used in at least one step of the metabolic process of ⁇ -oxidation or ⁇ -oxidation to convert a product generated in the immediately preceding step into a reactant of the next step. If the activity of the enzyme is reduced or lost, the efficiency of the step in which the enzyme is used in the metabolic process of the ⁇ -oxidation or ⁇ -oxidation decreases, or that little or no conversion occurs in the step it means
  • the term "reduced or lost activity” refers to a state in which an enzyme does not exhibit sufficient activity, or no activity at all, as well as a state in which the enzyme is not sufficiently expressed or is not expressed at all. it means Methods for reducing or losing the activity of enzymes as described above are well known to those skilled in the art of biochemistry.
  • the gene encoding the enzyme is knocked down to reduce the expression level, or mutations such as substitution or deletion of some amino acids in the active domain of the enzyme There may be a method of lowering the activity of the enzyme itself by inducing.
  • the gene encoding the enzyme is completely knocked out to block the expression of the enzyme itself, or the active domain of the enzyme is knocked out to knock out the enzyme. There may be a method of not having any activity even if expressed. Techniques such as knock-down, knock-out, and mutagenesis as described above may also be used by methods well known to those skilled in the art of biochemistry.
  • fatty means having a carbon chain having a large number of carbon atoms, for example, 5 to 30 carbon atoms
  • fatty alcohol is a straight or branched chain having 5 to 30 carbon atoms. It means a chain alcohol
  • fatty aldehyde means a straight-chain or branched aldehyde having a carbon chain of 5 to 30 carbon atoms.
  • the activity of some or all of the fatty alcohol oxidase involved in the ⁇ -oxidative metabolic pathway is decreased or lost, the activity of some or all of the acyl-CoA oxidase involved in the ⁇ -oxidation metabolic pathway is decreased or lost, while the activity of some or all of the endogenous monooxygenase involved in the ⁇ -oxidative metabolic pathway.
  • any microorganism having both the ⁇ -oxidation metabolic pathway and the ⁇ -oxidation metabolic pathway of hydrocarbon can be used without limitation, and specifically converts hydrocarbons through the pathway of ⁇ -oxidation metabolism as shown in FIG. 1 . If it is a microorganism that can convert to ⁇ , ⁇ -dicarboxylic acid and can decompose fatty acids into acetyl-CoA and acyl-CoA through the pathway of ⁇ -oxidation metabolism, not only those known in the past, but also those to be revealed in the future can be used without limitation it could be Such microorganisms are widely known to those skilled in the art to which the present invention pertains or can be easily determined by those skilled in the art, and a representative example is yeast.
  • the yeast is Saccharomyces ( Saccharomyces ), Kluyveromyces ( Kluyveromyces ), Candida ( Candida ), Pichia ( Pichia ), Schizosaccharomyces , Hansenula ( Hansenula ), Chloeckera ( Kloeckera ), Shi Waniomyces ( Schwanniomyces ), Yarrowia ( Yarrowia ), Cryptococcus ( Cryptococcus ), Debaromyces ( Debaromyces ), Saccharomycecopsis , Saccharomycodes ( Saccharomycodes ), Wickerhamia ( Wickerhamia ) ), Wickerhamiella ( Wickerhamiella ), Debayomyces , Hanseniaspora , Ogataea , Kuraishia , Komagataella , Metschnikowia , Williopsis , It may be included in Nakazawa Ah (Nakazawaea), in such torul
  • the feasibility of the present invention was confirmed by using a representative Yarrowia lipolytica as a microorganism having both the ⁇ -oxidative metabolic pathway and the ⁇ -oxidative metabolic pathway of hydrocarbons as described above. .
  • the fatty alcohol oxidase is an enzyme having an activity of converting fatty alcohol into fatty aldehyde by participating in the ⁇ -oxidation metabolic pathway, and may be classified as EC 1.1.3.20, depending on the type of specific microorganism FAO, FAOT, LCAO etc. can be called.
  • the specific amino acid sequence of the fatty alcohol oxidase may be somewhat different depending on the type of microorganism, the fatty alcohol oxidase is involved in the ⁇ -oxidation metabolic pathway and has an activity to convert fatty alcohol to fatty aldehyde, and is determined by the nucleotide sequence of SEQ ID NO: 22.
  • the specific nucleotide sequence of the fatty alcohol oxidase may be slightly different depending on the type of microorganism, but at least 60%, at least 70%, at least 80%, preferably at least 90%, more preferably from the nucleotide sequence of SEQ ID NO: 22 Preferably, it can be encoded by a gene comprising a nucleotide sequence exhibiting at least 95%, even more preferably at least 99%, and most preferably 100% homology.
  • the fatty alcohol oxidase may have reduced or lost activity. As described above, by reducing or losing the activity of fatty alcohol oxidase in microorganisms having both the ⁇ -oxidative metabolic pathway and the ⁇ -oxidative metabolic pathway of hydrocarbons, the fatty alcohol into fatty aldehydes through the ⁇ -oxidative metabolic pathway in the microorganism may be reduced or blocked.
  • the activity of some or all of the homologous enzymes is reduced. or it may be lost.
  • homologous fatty alcohol oxidases referred to as FAO1, FAO1B, FAO2, and FAO2B exist, and in this case, at least one fatty alcohol oxidase selected from the group consisting of FAO1, FAO1B, FAO2 and FAO2B. activity may be decreased or lost, or both activity may be decreased or lost.
  • the degree to which further oxidation of fatty alcohol is blocked in the ⁇ -oxidation metabolic pathway can be determined. For example, for some rather than all of the homologous enzymes of the fatty alcohol oxidase, and loss of activity rather than reduction, the efficiency of blocking further oxidation of fatty alcohols in the ⁇ -oxidative metabolic pathway can be further improved.
  • the recombinant microorganism of the present invention in addition to the decrease or loss of the activity of fatty alcohol oxidase, in addition to the decrease or loss of the activity of fatty alcohol oxidase, it is additionally involved in the ⁇ -oxidative metabolic pathway to further improve the efficiency of additional oxidation of fatty alcohol through the ⁇ -oxidation metabolic pathway
  • the activity of part or all of fatty alcohol dehydrogenase, or part or all of fatty aldehyde dehydrogenase involved in the ⁇ -oxidation metabolic pathway may be reduced or lost.
  • the fatty alcohol dehydrogenase is an enzyme having an activity to convert fatty alcohol to fatty aldehyde by participating in the ⁇ -oxidative metabolic pathway, and may be classified as EC 1.1.1.192, depending on the type of specific microorganism ADH, FADH and the like.
  • the specific amino acid sequence of the fatty alcohol dehydrogenase may be somewhat different depending on the type of microorganism, it is involved in the ⁇ -oxidation metabolic pathway and has an activity to convert fatty alcohol into fatty aldehyde, SEQ ID NOs: 13 to 21 At least 60%, at least 70%, at least 80%, preferably at least 90%, more preferably at least 95%, even more preferably at least 99%, most preferably with each polypeptide encoded by the nucleotide sequence of is 100% amino acid sequence homology, all of which may correspond to the fatty alcohol dehydrogenase of the present invention.
  • the fatty alcohol dehydrogenase although the specific nucleotide sequence may be slightly different depending on the type of microorganism, at least 60%, at least 70%, at least 80%, preferably at least 60%, at least 70%, at least 80% of each of the nucleotide sequences of SEQ ID NOs: 13 to 21 It can be encoded by genes comprising a nucleotide sequence exhibiting at least 90%, more preferably at least 95%, even more preferably at least 99%, most preferably 100% homology.
  • the fatty alcohol dehydrogenase may have reduced or lost activity.
  • Conversion to fatty aldehydes may be reduced or blocked.
  • the homologous enzymes are part or all of the enzymes. Activity may be reduced or lost.
  • nine homologous fatty alcohol dehydrogenases referred to as ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 and FADH.
  • the ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 and FADH are encoded by the nucleotide sequences of SEQ ID NOs: 13 to 21, respectively.
  • the ADH1, ADH2, ADH3, ADH4, ADH5 The activity of at least one fatty alcohol dehydrogenase selected from the group consisting of , ADH6, ADH7, ADH8 and FADH may be reduced or lost, or the activity of all nine may be reduced or lost.
  • the degree to which the ⁇ -oxidative metabolic pathway is blocked may be determined. For example, for some rather than all of the homologous enzymes of the fatty alcohol dehydrogenase, and loss of activity rather than reduction, the efficiency of blocking further oxidation of fatty alcohols in the ⁇ -oxidative metabolic pathway would be further improved.
  • the fatty aldehyde dehydrogenase is an enzyme having an activity of converting fatty aldehydes into fatty acids by participating in the ⁇ -oxidative metabolic pathway, and may be classified as EC 1.2.1.48, and ALDH, FALDH depending on the specific type of microorganism etc. can be called.
  • the fatty aldehyde dehydrogenase is involved in the ⁇ -oxidation metabolic pathway and has an activity of converting fatty aldehydes into fatty acids, At least 60%, at least 70%, at least 80%, preferably at least 90%, more preferably at least 95%, even more preferably at least 99%, most preferably with each polypeptide encoded by the nucleotide sequence If it shows 100% amino acid sequence homology, all of them may correspond to the fatty aldehyde dehydrogenase of the present invention.
  • the fatty aldehyde dehydrogenase although the specific nucleotide sequence may be slightly different depending on the type of microorganism, at least 60%, at least 70%, at least 80%, preferably from each of the nucleotide sequences of SEQ ID NOs: 23 to 26 It can be encoded by genes comprising a nucleotide sequence exhibiting at least 90%, more preferably at least 95%, even more preferably at least 99%, most preferably 100% homology.
  • the fatty aldehyde dehydrogenase may have reduced or lost activity.
  • the reduction of fatty aldehydes through the ⁇ -oxidative metabolic pathway in the microorganism Conversion to fatty acids may be reduced or blocked.
  • the homologous enzymes are partially or all of the enzymes. Activity may be reduced or lost.
  • FALDH1, FALDH2, FALDH3 and FALDH4 there are four homologous fatty aldehyde dehydrogenases referred to as FALDH1, FALDH2, FALDH3 and FALDH4, and the FALDH1, FALDH2, FALDH3 and FALDH4 are each encoded by the nucleotide sequences of SEQ ID NOs: 23 to 26.
  • the activity of at least one fatty aldehyde dehydrogenase selected from the group consisting of FALDH1, FALDH2, FALDH3 and FALDH4 is reduced or lost. or all four activities may be reduced or lost.
  • the degree to which the ⁇ -oxidative metabolic pathway is blocked may be determined. For example, for some rather than all of the homologous enzymes of the fatty aldehyde dehydrogenase, and loss of activity rather than reduction, the efficiency of blocking further oxidation of fatty aldehydes in the ⁇ -oxidative metabolic pathway would be further improved.
  • the acyl-CoA oxidase is an enzyme having an activity to convert fatty acyl-CoA to trans- ⁇ 2 -enoyl-CoA by participating in the ⁇ -oxidative metabolic pathway, and may be classified as EC 1.3.3.6, specific Depending on the type of microorganism, it may be called ACO, ACOX, COX, POX, etc.
  • the specific amino acid sequence of the acyl-CoA oxidase may be slightly different depending on the type of microorganism, it is involved in the ⁇ -oxidation metabolic pathway and has an activity of converting fatty acyl-CoA into trans- ⁇ 2 -enoyl-CoA
  • at least 60%, at least 70%, at least 80%, preferably at least 90%, more preferably at least 95%, even more preferably each polypeptide encoded by the nucleotide sequence of SEQ ID NOs: 27 to 32 All of them may correspond to the acyl-CoA oxidase of the present invention as long as they exhibit at least 99%, most preferably 100% amino acid sequence homology.
  • the specific nucleotide sequence of the acyl-CoA oxidase may be slightly different depending on the type of microorganism, but at least 60%, at least 70%, at least 80%, preferably at least 90% from each of the nucleotide sequences of SEQ ID NOs: 27 to 32 %, more preferably at least 95%, even more preferably at least 99%, most preferably 100% homology.
  • the acyl-CoA oxidase may have reduced or lost activity.
  • fatty acyl-CoA through the ⁇ -oxidative metabolic pathway in the microorganism Conversion to trans- ⁇ 2 -enoyl-CoA may be reduced or blocked.
  • acyl-CoA oxidase is an enzyme involved in the initial step of the ⁇ -oxidation metabolic pathway, by reducing or losing the activity of the acyl-CoA oxidase as described above, fatty acyl-CoA enters the ⁇ -oxidation metabolic pathway. By blocking it, it can ultimately block the ⁇ -oxidation metabolic pathway itself.
  • homologous enzymes of the acyl-CoA oxidase when present in a microorganism having both the ⁇ -oxidation metabolic pathway and the ⁇ -oxidation metabolic pathway of hydrocarbons, the homologous enzymes have some or all of their activity may be reduced or lost.
  • ACO1 POX1
  • ACO2 POX2
  • ACO3 POX3
  • ACO4 POX4
  • ACO5 POX5
  • ACO6 POX6
  • ACO1 (POX1), ACO2 (POX2), ACO3 (POX3), ACO4 (POX4), ACO5 (POX5) and ACO6 (POX6) are each SEQ ID NO: 27 It is encoded by the nucleotide sequence of to 32, in this case at least one selected from the group consisting of ACO1 (POX1), ACO2 (POX2), ACO3 (POX3), ACO4 (POX4), ACO5 (POX5) and ACO6 (POX6).
  • the activity of acyl-CoA oxidase may be decreased or lost, and the activity of all six may be decreased or lost.
  • the degree to which the ⁇ -oxidative metabolic pathway is blocked may be determined according to the extent and extent to which the activity of homologous enzymes of the acyl-CoA oxidase is reduced or lost. For example, the blocking efficiency of the ⁇ -oxidation metabolic pathway can be further improved when the activity is lost rather than reduced, and for some rather than all of the homologous enzymes of the acyl-CoA oxidase.
  • the endogenous monooxygenase is inherently present in microorganisms having both the ⁇ -oxidative metabolic pathway and the ⁇ -oxidative metabolic pathway of the hydrocarbon, and participates in the ⁇ -oxidative metabolic pathway to end the alkane or fatty acid.
  • As an enzyme for introducing a hydroxyl group it has an activity of converting an alkane into a fatty alcohol or converting a fatty acid into an ⁇ -hydroxy fatty acid.
  • the endogenous monooxygenase may be classified as EC 1.14, and may be referred to as ALK, CYP, Cyt-P450, etc. according to specific types of microorganisms.
  • the specific amino acid sequence of the endogenous monooxygenase may be somewhat different depending on the type of microorganism, it is involved in the ⁇ -oxidation metabolic pathway to convert an alkane to a fatty alcohol or convert a fatty acid to an ⁇ -hydroxy fatty acid.
  • As having activity at least 60%, at least 70%, at least 80%, preferably at least 90%, more preferably at least 95%, even more with each polypeptide encoded by the nucleotide sequence of SEQ ID NOs: 1 to 12
  • Preferably, as long as it exhibits at least 99%, most preferably 100% amino acid sequence homology, all may correspond to the endogenous monooxygenase of the present invention.
  • the endogenous monooxygenase although the specific nucleotide sequence may be slightly different depending on the type of microorganism, at least 60%, at least 70%, at least 80%, preferably at least from each of the nucleotide sequences of SEQ ID NOs: 1 to 12 90%, more preferably at least 95%, even more preferably at least 99%, most preferably 100% homology may be encoded by genes comprising a nucleotide sequence.
  • the endogenous monooxygenase also converts alkanes to fatty alcohols and fatty acids to ⁇ -hydroxy fatty acids, but its oxidative activity is excessive and not only oxidizes alkanes to fatty alcohols, but also converts alkanes to fatty aldehydes and fatty acids to ⁇ - It is not only oxidized to hydroxy fatty acids, but also peroxidized to ⁇ -aldehyde fatty acids. Therefore, in order to inhibit the peroxidation activity of the endogenous monooxygenase in the recombinant microorganism of the present invention, the endogenous monooxygenase may have reduced or lost activity.
  • the homologous enzymes of the endogenous monooxygenase are present in the microorganism having both the ⁇ -oxidation metabolic pathway and the ⁇ -oxidation metabolic pathway of hydrocarbons, the homologous enzymes are partially or fully active This may be reduced or lost.
  • ALK1, ALK2, ALK3, ALK4, ALK5, ALK6, ALK7, ALK8, ALK9, ALK10, ALK11 and ALK12 Endogenous monooxygenases exist, and the ALK1, ALK2, ALK3, ALK4, ALK5, ALK6, ALK7, ALK8, ALK9, ALK10, ALK11 and ALK12 are encoded by the nucleotide sequences of SEQ ID NOs: 1 to 12, respectively.
  • the at least one endogenous monooxygenase may be one comprising at least one of ALK3 and ALK6, wherein the activity of all of the ALK1, ALK2, ALK3, ALK4, ALK5, ALK6, ALK7, ALK8, ALK9, ALK10, ALK11 and ALK12 is may be reduced or lost.
  • the degree of peroxidation of an alkane or fatty acid may be determined according to the extent and extent to which the activity of homologous enzymes of the endogenous monooxygenase is reduced or lost. For example, if the activity is lost rather than reduced, and for some rather than all of the homologous enzymes of the endogenous monooxygenase, the degree of peroxidation of alkanes or fatty acids can be further improved.
  • the activity of some of the endogenous monooxygenases is lost in Yarrowia lipolytica, and it contains heavy chain n-alkanes or heavy chain primary alcohols.
  • the production of the peroxidation product dicarboxylic acid
  • the productivity of the heavy chain diol was improved, compared to the case where the activity of the endogenous monooxygenase was intact (see FIG. 7).
  • At least one exogenous monooxygenase is It may be introduced to show activity.
  • the exogenous monooxygenase is not inherently present in microorganisms having both the ⁇ -oxidative metabolic pathway and the ⁇ -oxidative metabolic pathway of the hydrocarbon, but is derived from another species, and is basically the endogenous monooxygenase It has an activity of introducing a hydroxyl group at the terminal of an alkane or fatty acid, that is, converting an alkane into a fatty alcohol or converting a fatty acid into an ⁇ -hydroxy fatty acid, and may be classified as EC 1.14.
  • the exogenous monooxygenase may have a lower activity than the endogenous monooxygenase for peroxidizing alkane or fatty acid to fatty aldehyde or ⁇ -aldehyde fatty acid.
  • the exogenous monooxygenase can be used without limitation, as long as it oxidizes an alkane or fatty acid only to a fatty alcohol or ⁇ -hydroxy fatty acid and does not peroxidize even to a fatty aldehyde or ⁇ -aldehyde fatty acid.
  • the exogenous monooxygenase may be derived from bacteria, or may be a cytochrome P450 enzyme derived from bacteria.
  • the exogenous monooxygenase is CYP153A13 encoded by the nucleotide sequence of SEQ ID NO: 33, CYP153A33 encoded by the nucleotide sequence of SEQ ID NO: 34, nfa22930 (CYP154) encoded by the nucleotide sequence of SEQ ID NO: 35, SEQ ID NO: It may be at least one selected from the group consisting of nfa33510 (CYP151A) encoded by the nucleotide sequence of 36 and nfa22290 (CYP140A) encoded by the nucleotide sequence of SEQ ID NO: 37, but is not limited thereto.
  • fatty alcohol oxidase in a microorganism having both the ⁇ -oxidative metabolic pathway and the ⁇ -oxidative metabolic pathway of the hydrocarbon, fatty alcohol oxidase, fatty alcohol dehydrogenase, fatty aldehyde dehydrogenase, acyl- For both CoA oxidase and endogenous monooxygenase, it loses the activity of all its homologous enzymes and can introduce exogenous monooxygenase from bacteria.
  • the fatty alcohol oxidase, fatty alcohol dehydrogenase, fatty aldehyde dehydrogenase, acyl-CoA oxidase and endogenous monooxygenase using conventional genetic recombination techniques known in the art. It is possible to prepare a recombinant microorganism in which some or all of the activity is reduced or lost, and at least one exogenous monooxygenase is introduced.
  • methods such as transformation, transduction, transfection, microinjection, and electroporation may be exemplified, but this It is not limited.
  • genes among enzymes involved in ⁇ -oxidative metabolic pathways, the activity of some or all of fatty alcohol oxidase is reduced or lost, selectively reduced or lost activity of fatty alcohol dehydrogenase and/or fatty aldehyde dehydrogenase, reduced or lost activity of acyl-CoA oxidase in the ⁇ -oxidative metabolic pathway, while the ⁇ -oxidative metabolic pathway
  • endogenous monooxygenases with reduced or lost activity when alkanes are supplied as substrates Either end is oxidized to form a primary alcohol (fatty alcohol), but the activity of part or all of a fatty alcohol oxidase, and optionally a part or all of a
  • the primary alcohol (fatty alcohol) formed as described above becomes a substrate again and the other end is oxidized by the action of cytochrome P450 and NADPH-cytochrome P450 reductase, which has reduced or lost activity, so that the secondary alcohol ⁇ , ⁇ - Diol is formed.
  • cytochrome P450 and NADPH-cytochrome P450 reductase which has reduced or lost activity
  • the secondary alcohol ⁇ , ⁇ - Diol is formed.
  • the endogenous monooxygenase having high peroxidation activity since the activity of some or all of the endogenous monooxygenase having high peroxidation activity is reduced or lost, the degree of peroxidation of the primary alcohol (fatty alcohol) to fatty aldehyde is reduced, as a result, the endogenous monooxygenase Compared to before the decrease or loss of the activity of sygenase, the peroxidation product of the primary alcohol is decreased, and the amount of ⁇ , ⁇ -diol formed by oxidation at the other end increases.
  • the method for producing a medium chain diol of the present invention includes culturing the recombinant microorganism in an environment in which at least one of an alkane and a fatty alcohol is supplied.
  • the alkane may be a medium chain alkane, for example, an alkane having 5 to 30 carbon atoms, preferably 6 to 20 carbon atoms, and more preferably 8 to 16 carbon atoms.
  • the alkane may be straight-chain or branched, preferably straight-chain.
  • the fatty alcohol may be a medium-chain primary alcohol, for example, a primary alcohol having 5 to 30 carbon atoms, preferably 6 to 20 carbon atoms, and more preferably 8 to 16 carbon atoms.
  • the fatty alcohol may also be straight-chain or branched, preferably straight-chain.
  • either one of the alkane or the fatty alcohol may be supplied, or the two may be supplied in a mixed state.
  • the environment in which at least one of the alkane and the fatty alcohol is supplied may be to artificially supply the alkane or fatty alcohol from the outside or to add the alkane or fatty alcohol to the medium used for culture and supply it together, and the supply is continuous or intermittent can be
  • the medium chain diol is an ⁇ , ⁇ -diol in which hydroxyl groups are introduced at both ends of a straight or branched hydrocarbon having 5 to 30 carbon atoms, preferably 6 to 20 carbon atoms, and more preferably 8 to 16 carbon atoms.
  • the method for producing the heavy chain diol utilizes the metabolic process of the recombinant microorganism of the present invention in which the ⁇ -oxidation metabolic pathway is blocked and the peroxidation activity for fatty alcohol is controlled in the ⁇ -oxidation metabolic pathway, so the principle as described above to produce ⁇ , ⁇ -diols from alkanes or fatty alcohols. Accordingly, the type of ⁇ , ⁇ -diol produced also varies depending on the type of alkane or fatty alcohol supplied, and when a heavy chain alkane or fatty alcohol is supplied, heavy chain ⁇ , ⁇ -diol is generated.
  • 1,8-octanediol is produced as ⁇ , ⁇ -diol
  • dodecane or 1-dodecanol having 12 carbon atoms is supplied
  • ⁇ , ⁇ -diol 1,12-dodecanediol is produced
  • hexadecane or 1-hexadecanol having 16 carbon atoms is supplied
  • 1,16-hexadecanediol is produced as ⁇ , ⁇ -diol.
  • 1,12-dodecane which is representative of several heavy chain alkanes or primary alcohols, It was confirmed that the diol was produced in high yield (refer to FIGS. 9, 10a, and 10b).
  • Cultivation of the recombinant microorganism as described above can be made according to a suitable medium and culture conditions known in the art. Those skilled in the art to which the present invention pertains can easily adjust the medium and culture conditions according to the type of host cell of the selected recombinant microorganism.
  • the culturing method may include batch, continuous, fed-batch, or a combination culture thereof.
  • the medium may contain various carbon sources, nitrogen sources and trace element components.
  • the carbon source is, for example, glucose, sucrose, lactose, fructose, maltose, starch, carbohydrates such as cellulose, fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, organic acids such as acetic acid, or combinations thereof.
  • the culture may be performed using glucose as a carbon source.
  • the nitrogen sources include organic nitrogen sources such as peptone, yeast extract, broth, malt extract, corn steep liquor (CSL), and soybean wheat and inorganic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, or combinations thereof may be included.
  • the medium may contain, as a source of phosphorus, for example, potassium dihydrogen phosphate, dipotassium hydrogen phosphate and a corresponding sodium-containing salt, a metal salt such as magnesium sulfate or iron sulfate.
  • amino acids, vitamins, and appropriate precursors may be included in the medium.
  • the medium or individual components may be added to the culture medium batchwise or continuously.
  • an antifoaming agent such as fatty acid polyglycol ester during culture can suppress the formation of bubbles.
  • Culturing of the recombinant microorganism as described above may be carried out at 20 °C to 60 °C, preferably at 25 °C to 55 °C, more preferably at 30 °C to 50 °C.
  • a sufficient amount of intermediate product is not produced, resulting in a problem that the production amount of heavy chain ⁇ , ⁇ -diol, which is the final product, is not sufficient.
  • the culturing of the recombinant microorganism as described above may be carried out at pH 5 to pH 10, preferably at pH 8.5 to pH 10, but is not limited thereto.
  • the culture pH conditions of the transformants as described above can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the culture medium of the recombinant microorganism.
  • the culture pH condition of the recombinant microorganism is out of the above range, it is difficult to grow the recombinant microorganism, so the production amount of heavy chain ⁇ , ⁇ -diol, which is the final product, or not sufficient occurs.
  • Yarrowia lipolytica is used as a microorganism having both the ⁇ -oxidation metabolic pathway and the ⁇ -oxidation metabolic pathway of hydrocarbons for producing diol, and a plasmid for genetic manipulation of it is E. coli (E. coli DH5 ⁇ ) was used for amplification.
  • the wild-type Yarrowia lipolytica strain for genetic manipulation, or the recombinant microorganisms of Table 4 prepared by knocking out the gene therefrom, were maintained at -70°C in 25% glycerol, and the stock strain was transferred to YPD agar medium (10 g /L yeast extract, 20 g/L Bacto peptone, 20 g/L glucose, and 20 g/L agarose) and incubated overnight at 30°C.
  • YPD agar medium (10 g /L yeast extract, 20 g/L Bacto peptone, 20 g/L glucose, and 20 g/L agarose
  • the target gene was knocked out through homologous recombination using the URA3 gene as a selection marker ( FIG. 2 ).
  • the URA3 gene was amplified from a wild-type Yarrowia lipolytica strain.
  • PCR was performed with the primer pairs shown in Table 1 below to amplify the 5'- and 3'-flanking regions of each target gene listed in Table 2 from Yarrowia lipolytica genomic DNA.
  • Regions of homology to the knock-out and pop-out cassettes were obtained by PCR overlap, and this fragment fragment was transformed into Yarrowia lipolytica. Subsequently, Boeke et al. (1984), 5-fluoro orotic acid (5-FOA) selection and uracil marker rescue were performed. It was confirmed whether the target gene was properly knocked out by performing PCR using the genomic DNA as a template using the primer pairs shown in Table 1 above. Genomic DNA was obtained using a genetic DNA extraction kit (Gene all biotechnology, Korea). A Biometra T3000 thermocycler with Prime star DNA polymerase (Takara, Japan) was used for PCR amplification. The amplified fragment was purified with a QIAgen purification kit (Qiagen, Germany), and the DNA fragment was recovered from an agarose gel using a QIAquick gel extraction kit (Qiagen, Germany).
  • the plasmid pGEM-T-easy vector (Promega, USA) was used as the backbone of the expression vector in Yarrowia lipolytica.
  • the URA3 gene used as a selection marker was amplified from the genomic DNA (gDNA) of the Yarrowia lipolytica Po1g strain by PCR using primer sets YlURA3 1F Kpn and YlURA3 2B Spe.
  • the PCR product was digested with KpnI/SpeI and inserted into the pGEM-T-easy vector digested with KpnI and SpeI.
  • the resulting plasmid was designated pYIGEM_URA3. Both the TEF promoter and autonomously replicating sequence (GenBank no.
  • X68252 were amplified from the gDNA of the Yarrowia lipolytica Po1g strain using primer sets Y1TEFp sph 1F / YlTEFp Nde Hind 2R and Y1ARS1 1K Kpn Hind / Y1ARS1 2R Nco.
  • Each obtained PCR product was digested with SphI / HindIII for TEF promoter and HindIII / NcoI for ARS; The two digested fragments were ligated with SphI/NcoI digested pYIGEM_URA3.
  • the resulting plasmid was designated as pYIGEM (Fig. 3).
  • Open reading frames (ORFs) of each ALK gene from Yarrowia lipolytica were ALKX_AF1/ ALKX_AR1 and ALKX_AF2 / ALKX_AR2 It was amplified from Yarrowia genomic DNA via PCR using primers (Table 2). The amplified fragment of each ALK was digested with HindIII and BamHI, and the digested fragment was inserted between HindIII and BamHI of pYIGEM. Each resulting expression vector was designated as pYIGEM_ALK_X (Table 3).
  • ARS autonomous replicating sequence (Genbank no. X68252) [f] Actinobacter sp. The sequence of the ER membrane anchoring ALK1 was fused to the N-terminus of CYP153A13 derived from CYP153A13 and CYP153A derived from Marinobacter aquaeolei VT8.
  • the strain to be cultured was inoculated the day before in 3 ml YPD medium (Bacto Laboratories, Yeast extract 10g/L, Bacto peptone 20g/L, glucose 20g/L) and grown at 30°C at 200rpm for one day.
  • mL of the pre-cultured medium was added to 100 mL of growth phase medium (50 g/L glucose, 10 g/L yeast extract, 6.7 g/L yeast nitrogen base w/o amino acids (YNB), 5 g/L (NH 4 ) 2 SO 4 , 0.05 g/L uracil, and 0.1 M potassium phosphate buffer pH 6.0) were placed in a 1L baffled flask and incubated for one day at 30° C. 200 rpm on a plate stirrer.
  • growth phase medium 50 g/L glucose, 10 g/L yeast extract, 6.7 g/L yeast nitrogen base w/o amino acids (YNB), 5 g/L (NH 4 ) 2 SO 4 , 0.05 g/L uracil, and 0.1 M potassium phosphate buffer pH 6.0
  • the cell density at 600 nm reached approximately 40 (OD 600) 50 mL of the culture medium cultured in the growth phase medium was added to the conversion phase medium (30 g/L glucose, 3 g/L yeast extract, 6.7 g/L YNB w/o).
  • 1-10 g/L of n-dodecane or 1-dodecanol dissolved in 0.05% tween 80 was used as a substrate.
  • the biomass was measured using a UV spectrophotometer (Uvikon XL, France Secomam) at an absorbance of 600 nm.
  • Substrates and products were identified and quantified by a gas chromatography-mass spectrometry system (GC-MS) equipped with a quadrupole electron selective ionization detector (EI) operated at 70 eV.
  • GC-MS gas chromatography-mass spectrometry system
  • EI quadrupole electron selective ionization detector
  • An Agilent HP-5MS column (30 m in length, 0.25 mm in inner diameter and 0.25 ⁇ m in film thickness) was used with a 10:1 split ratio.
  • Helium was used as the carrier gas and the oven temperature ranged from 150°C to 172°C.
  • Extraction of substrates and products for GC-MS analysis was performed using acid-treated culture medium and an equal volume of chloroform.
  • N,O-bis(trimethyl silyl)trifluoroacetamide BSTFA was added to the extracted samples (1:2, v/v) and the mixture was incubated at 60°C for 20 min. Tetradecane was used as an internal standard.
  • NHEJ non-homologous end joining
  • HR homologous recombination
  • the two-molecule deletion cassette used to remove the target gene was site-specifically inserted into the genome via URA3 split marker recombination.
  • the insertion site was confirmed by PCR.
  • pop-out of URA3 via selection of 5'-FOA plate was performed. This strategy allowed the construction of various strains in which an infinite number of genes were knocked out and the ⁇ -oxidation pathway/ ⁇ -oxidation pathway was engineered (Fig. 4).
  • the cytochrome p450 monooxygenase gene (ALK1-12) present in the wild-type Yarrowia lipolytica strain, as well as the fatty alcohol dehydrogenase gene (ADH1-8, FADH) involved in the ⁇ -oxidative metabolic pathway , fatty alcohol oxidase gene (FAO), fatty aldehyde dehydrogenase gene (FALDH1 ⁇ 4), and acyl-CoA oxidase gene (ACO1 ⁇ 6) involved in ⁇ -oxidative metabolic pathway part or all of knock-out A total of 9 types of recombinant microorganisms were prepared (Table 4 and FIG. 4).
  • YID01 strain blocking the ⁇ -oxidation metabolic pathway in Yarrowia lipolytica by knocking out six genes encoding acyl-CoA oxidase (ACO1-6) to prevent degradation of metabolites produced through ⁇ -oxidation.
  • ACO1-6 acyl-CoA oxidase
  • the YID01 strain could not utilize a bifunctional chemical and a hydrophobic substrate as the sole carbon source. These properties allowed the YID01 strain to be used as a reference variant for the production of ⁇ , ⁇ -diol.
  • a YID02 strain was prepared by knocking out.
  • a gene encoding one fatty alcohol oxidase (FAO1 ), a gene encoding four fatty alcohol dehydrogenaene ( FADH1-4 ) and nine fatty alcohol dehydrogenaane are encoded.
  • the genes ( ADH1-8, FADH ) were sequentially knocked out, respectively, to prepare a YID03 strain, a YID04 strain and a YID05 strain (FIG. 5 (a)).
  • YID03 strain, YID04 strain and YID05 strain prepared as above produced 1,12-dodecanediol from n-dodecane or 1-dodecanol, respectively (FIG.
  • n-dodecane was 4.47w0.38, 10.91w1.13, and 11.1w1.33, 1-dodecanol was 3.10w0.58, 6.14w0.73, and 9.62w0.98 mg/L).
  • ⁇ , ⁇ -diol was produced only in strains in which the fatty alcohol oxidase gene ( FAO ) was knocked out, indicating that fatty alcohol oxidase (FAO) plays an important role in the production of ⁇ , ⁇ -diol. .
  • acyl -CoA oxidase gene (ACO1-6), fatty alcohol oxidase gene (FAO), fatty alcohol dehydrogenase gene (FADH1-4) and fatty alcohol dehydrogenase genes rust (ADH1-8, FADH) -
  • peroxidation products including 1,12-dodecanoic acid and ⁇ -hydroxydodecanoic acid were generated as more than 90% of the total oxidized products (FIG. 5(b)).
  • This result suggests that there are other enzyme(s) in Yarrowia lipolytica that can continue further oxidation after the terminus of the n-alkane is oxidized by endogenous monooxygenase.
  • Yarrowia lipolytica possesses 12 monooxygenases (ALK1-12) belonging to the CYP52 family.
  • major monooxygenases such as ALK3 and ALK6 generate peroxides.
  • ALK3 and ALK6 were selected because they are deeply involved in the peroxidation of n-alkanes to fatty acids (FIG. 7(a)).
  • a recombinant microorganism in which the ALK3 gene, the ALK6 gene and both of these genes are knocked out was prepared for the YID05 strain. They were named YID06, YID07 and YID08, respectively (FIG. 7(b)).
  • the amount of 1,12-dodecanedioic acid was reduced by about 28%, while the amount of 1,12-dodecanediol produced from n-dodecane was increased by about 60%.
  • the by-product, peroxide was still produced in excess of 90% of the total oxidation products.
  • All 12 ALK genes in the prepared YID05 strain were knocked out to prepare a YID09 strain (FIG. 8 (a)). And in order to express each ALK, an expression vector in which each ALK gene is controlled by the TEF1 promoter was constructed and transformed into the YID09 strain, respectively.
  • Individual strains expressing each ALK were incubated with n-dodecane in flasks, and in the cultures 1,12-dodecanedioic acid (1,12-DDDA), 12-hydroxydodecanoic acid (12-HDA) ), 1-dodecanoic acid (1-DDA) and 1-dodecanol (1-DO) were measured and the results are shown in FIG. 8(b).
  • ALK8 ALK11 and ALK12 were confirmed to exhibit relatively weak oxidative activity towards the terminal of n-dodecane. All ALKs produced peroxidized products representing more than 80% of the total product, suggesting that all ALKs were involved in the oxidation of fatty alcohols and ⁇ -aldehyde fatty acids while alkanes were metabolized.
  • the 1,12-dodecanedioic acid produced by ALK1 and ALK2 accounts for 70% of the total product, whereas the 1,12-dodecanedioic acid produced by ALK3, ALK6, ALK9 and ALK10 accounts for 45-60% of the total product.
  • ALK4 and ALK7 produced 47.4% and 44.2% of 12-hydroxydodecanoic acid and 32.3% and 10.81% of 1-dodecanoic acid, respectively. None of the ALKs produced 1,12-dodecandiol, but the amount of 1-dodecanol was only 4% of the total. Once 1-dodecanol is produced by ALKs, it is believed that the sequential oxidation activity of 1-dodecanol to 1-dodecanoic acid is higher than the oxidation activity of the carbon at the opposite end.
  • the ALKs have some obstacles in producing ⁇ , ⁇ -diol in high yield from n-alkanes.
  • CYP153A monooxygenase belonging to bacterial class I P450, catalyzes the ⁇ -oxidation of saturated and unsaturated fatty acids and alkanes.
  • expression vectors for CYP153A13 A.sp and CYP153A33 M.aq were constructed.
  • genes encoding CYP153A13 A.sp and CYP153A33 M.aq monooxygenase were fused to the sequence of the ER membrane-anchored ALK1 gene. The fused gene was controlled by the constitutive TEF1 promoter.
  • the expression vector was introduced into the YID09 strain (FIG. 9 (a)), and the transformant was cultured with n-dodecane in a flask, and 1,12-dodecanedioic acid (1,12-DDDA) in the culture. ), 12-hydroxydodecanoic acid (12-HDA), 1-dodecanoic acid (1-DDA), 1-dodecanol (1-DOL) and 1,12-dodecanediol (1,12-DIO) The resulting amount was measured and the results are shown in FIGS. 9 (b) and (c).
  • the endogenous CPRb of Y. lipolytica was used as a reductase partner for CYP153A13 A.sp and CYP153A33 M.aq.
  • each expression vector was introduced into the YID09 strain, and the transformant was cultured with n-dodecane.
  • 1,12-dodecanedioic acid (1,12-DDDA), 12-hydroxydodecanoic acid (12-HDA), 1-dodecanoic acid (1-DDA), 1-dodecanol (1- DOL) and 1,12-dodecanediol (1,12-DIO) were measured, and the results are shown in FIGS. 10 (a) and (b).
  • the recombinant microorganism in which the endogenous monooxygenase gene was knocked out and the exogenous CYP153A M.aq gene was introduced contained 160 times more 1,12-dodecanediol than the YID05 strain containing the endogenous monooxygenase as it is. It was confirmed to produce (FIG. 10 (b)).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 중쇄 디올을 생산하는 재조합 미생물 및 이를 이용하여 중쇄 디올을 생산하는 방법에 관한 것으로, 본 발명의 재조합 미생물은 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서, ω-산화 대사 경로와 β-산화 대사 경로에 관여하는 일부 효소의 활성이 감소 또는 상실되는 한편, ω-산화 대사 경로에 관여하는 특정 효소가 도입됨으로써 중쇄 α,ω-디올을 높은 수율로 생산할 수 있다.

Description

중쇄 디올을 생산하는 재조합 균주 및 이를 이용한 중쇄 디올의 생산방법
본 발명은 중쇄 디올을 생산하는 재조합 균주 및 이를 배양하여 중쇄 디올을 생산하는 방법에 관한 것이다.
바이오플랫폼 화합물은 바이오매스 유래 원료를 기반으로 하여 생물학적 또는 화학적 전환을 통해 생산된 것으로, 고분자 모노머, 신소재 등의 합성에 사용되고 있다.
바이오플랫폼 화합물 중 α,ω-디올은 폴리에스테르의 단량체로 사용되는 물질로서, 폴리에스테르는 그 뛰어난 성질로부터 섬유용, 필름용, 병용을 비롯해 널리 여러 가지 용도로 사용되고 있다. 예를 들면, 에틸렌글리콜과 테레프탈산의 중축합으로 얻어지는 폴리에틸렌테레프탈레이트는 기계적 강도, 화학 특성 등에 뛰어나서 많은 용도에 사용되고 있고, 의료용(衣料用)으로 가장 적합한 합성 섬유로서 전세계에서 대량 생산되고 있다. 또한, 1,3-프로판디올과 테레프탈산을 원료로 하는 폴리트리메틸렌테레프탈레이트는 최근 저렴한 1,3-프로판디올 합성법이 개발된 것도 있어서 시장은 증가 경향에 있고, 신장탄성 회복성이 뛰어나고, 영률이 낮은 폴리머 특성을 살린 소프트한 촉감의 의료 용도로서의 전개가 기대된다. 아울러, 최근에는 석유 자원의 고등(高騰)·고갈을 우려하여 바이오매스 자원 유래의 폴리에스테르가 주목받고 있다.
α,ω-디올의 생산은 화학적 합성이나 미생물 발효를 통한 생물학적 방법으로 이루어질 수 있는데, 이러한 생물학적 방법을 이용할 경우에는 대사공학 기술을 이용한 신규 균주 개발 및 발효공정의 최적화가 요구된다.
종래에 α,ω-디올을 생산할 수 있는 균주로는 β-산화 대사 경로와 ω-산화 대사 경로를 함께 갖고 있는 미생물이 이용될 수 있고, 예컨대 크렙실라 옥시토카(Klebsiella oxytoca), 크렙실라 뉴모니애(Klebsiella pneumoniae), 애어로박터 애어로제네스(Aerobacter aerogenes), 재조합 사카로마이세스 세레비지애(Saccharomyces cerevisiae) 등의 균주들은 2,3-부탄디올을 고수율 및 고생산성으로 생산할 수 있는 것으로 알려져 있다(KR10-2012-0107021A, KR10-2012-0128776A, KR10-2015-0068581A). 그러나, 이들 미생물 중 일부는 병원성 미생물로 분류되고 있어 안전 및 산업화 측면에 제약이 따르고, 또한 현재 산업 규모의 제조는 단쇄 디올 생합성에만 국한되어 있으며, 중쇄 또는 장쇄의 α,ω-디올에 대한 연구는 미흡한 실정이다.
한편, 대장균(E. coli)에서 알칸 화합물로부터 시토크롬 p450 효소를 이용하여 1,12-디올을 생산하는 기술이 알려져 있으나(Scheps et al., Organic & Biomolecular Chemistry, 9:17, 6727-6733 (2011)), 대장균 시스템은 CYP 발현을 위해 고가의 헴(heme 또는 haem) 전구체 및 내인성 전자 전달계가 필요하고, 소수성 기질의 흡수가 제한적이라는 점에서 중쇄 디올의 대규모 생산에는 한계가 있다.
따라서, 환경적인 문제를 일으키지 않으면서도, 가격적인 면에서 효율적인 중쇄 디올의 대량 생산 방법에 대한 연구가 여전히 요구되고 있다.
본 발명은 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서, ω-산화 대사 경로와 β-산화 대사 경로에 관여하는 일부 효소의 활성이 감소 또는 상실되는 한편, ω-산화 대사 경로에 관여하는 특정 효소가 도입된 재조합 미생물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 재조합 미생물을 배양함으로써, 지방산 유래의 알코올 또는 알칸으로부터 보다 향상된 수율로 중쇄 디올을 생산하는 방법을 제공하는 것을 목적으로 한다.
상기 기술적 과제를 달성하기 위하여, 본 발명의 일 측면은 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서, ω-산화 대사 경로에 관여하는 효소들 중 유전자, 지방 알코올 옥시다아제의 일부 또는 전부의 활성이 감소 또는 상실되고, 선택적으로 지방 알코올 디하이드로게나아제 및/또는 지방 알데히드 디하이드로게나아제의 활성이 감소 또는 상실되며, β-산화 대사 경로 중의 아실-CoA 옥시다아제의 활성이 감소 또는 상실되는 한편, 상기 ω-산화 대사 경로에 관여하는 내인성 모노옥시게나아제의 활성이 감소 또는 상실된 재조합 미생물을 제공한다.
본 발명의 일 구현예에 따르면, 상기 재조합 미생물은 상기 내인성 모노옥시게나아제의 활성이 감소 또는 상실된 것에 더하여, 적어도 하나의 외인성 모노옥시게나아제가 도입되어 활성을 나타내는 것 일 수 있다. 상기 외인성 모노옥시게나아제는 박테리아 유래의 시토크롬 P450 효소일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 따르면, 상기 내인성 모노옥시게나아제, 지방 알코올 디하이드로게나아제, 지방 알코올 옥시다아제 유전자 및 아실-CoA 옥시다아제는 각각 독립적으로 미생물 내에 존재하는 상동형(isoform) 효소들 중 일부 또는 전부의 활성이 감소 또는 상실된 것 일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 따르면, 상기 미생물은 효모일 수 있으나 이에 한정되는 것은 아니다. 본 발명의 바람직한 구현예에 따르면, 상기 효모는 야로위아 속, 사카로마이에스 속, 피키아 속 및 캔디다 속으로 이루어진 군으로부터 선택되는 어느 하나의 속에 포함되는 것일 수 있으나 이에 한정되는 것은 아니다.
본 발명의 다른 측면은, 상기 재조합 미생물을 중쇄 알칸 및 중쇄 지방 알코올 중 적어도 하나가 공급되는 환경에서 배양하는 단계를 포함하는 중쇄 디올의 생산 방법을 제공한다.
본 발명의 재조합 미생물은, 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서 ω-산화 대사 경로에 관여하는 지방 알코올 옥시다아제와 선택적으로 지방 알코올 디하이드로게나아제 및/또는 지방 알데히드 디하이드로게나아제의 활성을 감소 또는 상실시키고, 동시에 β-산화 대사 경로에 관여하는 아실-CoA 옥시다아제의 활성을 감소 또는 상실시켜 지방 알코올의 추가적인 산화와 β-산화 대사를 모두 차단하는 한편, 상기 ω-산화 대사 경로에 관여하는 내인성 모노옥시게나아제의 활성을 감소 또는 상실시키고, 나아가 선택적으로 외인성 모노옥시게나아제를 도입하여 과산화 활성을 낮춤으로써, 야생형의 미생물이나 종래의 재조합 미생물에 비해, 중쇄의 알칸이나 1차 알코올로부터 중쇄 디올을 훨씬 높은 수율로 생산할 수 있는 장점이 있다.
도 1은 화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서 일어나는 ω-산화 대사 경로와 β-산화 대사 경로와 그 생성물 및 관련 효소의 종류를 개략적으로 도시한 것이다.
도 2는 선별 마커로서 URA3를 이용한 상동 재조합 과정을 나타낸 것으로서, HR은 상동 영역이고 RS는 반복 시퀀스를 나타낸다.
도 3은 본 발명의 균주 개량을 제작하는데 이용된 벡터 pYIGEM의 맵을 도시한 것이다.
도 4는 본 발명의 실시예들에서 제조한 재조합 미생물들에서 녹-아웃된 유전자의 종류를 나타낸 것으로서, 붉은 색으로 표시된 네모는 해당 유전자가 제거된 것을 의미한다.
도 5는 본 발명의 실시예들에서 재조합 미생물들을 제조하는 과정에서 유전자를 녹-아웃시킨 일련의 과정(a)과, 상기와 같은 과정을 통해 제작된 각 단계의 재조합 미생물들에서 n-알칸 또는 지방 알코올으로부터 중쇄 디올을 생산하는 수율을 확인한 결과로서, (b)는 n-알칸을 기질로 이용한 경우의 결과이고, (c)는 n-알칸올을 기질로 이용한 경우의 결과이다(1,12-DDDA: 1,12-도데칸이산; 12-HDA: 12-히드록시도데칸산; 1,12-DIOL: 1,12-도데칸디올).
도 6은 표준 및 배양액에서 1,12-도데칸디올의 GC-MS 분석 결과를 나타낸 것이다.
도 7은 야로위아 리폴리티카의 내인성 모노옥시게나아제의 기질 선호도(a)와, ALK3 및/또는 ALK6 유전자를 결실시킨 재조합 미생물 균주에서 n-알칸이 중쇄 α,ω-디올로 전환되는 정도를 확인한 결과를 나타낸 것으로서, (b)는 YID05 균주로부터 ALK3 및/또는 ALK6 유전자를 녹-아웃시켜 재조합 미생물들을 제작하는 일련의 과정을 나타낸 것이며, (c)는 상기 재조합 미생물을 배양한 배양물에서 n-도데칸 및 1-도데칸올이 1,12-도데칸디올로 전환된 정도를 확인한 결과를 나타낸 것이다(1,12-DDDA: 1,12-도데칸이산; 12-HDA: 12-히드록시도데칸산; 1,12-DIOL: 1,12-도데칸디올).
도 8은 야로위아 리폴리티카의 내인성 모노옥시게나아제 각각의 과산화 활성을 확인하기 위한 전략과 그에 따른 결과를 나타낸 것으로서, (a)는 내인성 모노옥시게나아제가 모두 녹-아웃된 재조합 미생물(YID09 균주)에서 각각의 ALK 유전자의 발현시켜 개별 ALK의 과산화 활성을 확인하는 전략을 개략적으로 나타낸 것이고, (b)는 각각의 ALK 유전자를 개별적으로 발현하는 재조합 미생물의 배양물에서 n-알칸이 산화되어 생성된 산화물의 종류와 비율을 분석한 결과를 나타낸 것이다(1,12-DDDA: 1,12-도데칸이산; 12-HDA: 12-히드록시도데칸산; 1-DDA: 도데칸산; 1,12-DIOL: 1,12-도데칸디올).
도 9는 내인성 모노옥시게나아제가 모두 녹-아웃된 재조합 미생물(YID09 균주)에서 박테리아 유래의 외인성 모노옥시게나아제의 도입한 효과를 확인하기 위한 전략과 그에 따른 결과를 나타낸 것으로서, (a)는 내인성 모노옥시게나아제가 모두 녹-아웃된 YID09 균주에서 박테리아 유래의 모노옥시게나아제인 CYP15A 유전자를 발현시켜 과산화 활성의 정도를 확인하는 전략을 개략적으로 나타낸 것이고, (b)와 (c)는 상기 박테리아 유래의 모노옥시게나아제가 도입된 재조합 미생물의 배양물에서 생성된 생성물의 종류와 생성량을 확인한 결과를 나타낸 것이다(1,12-DDDA: 1,12-도데칸이산; 12-HDA: 12-히드록시도데칸산; 1-DDA: 도데칸산; 1-DOL: 1-도데칸올; 1,12-DIOL: 1,12-도데칸디올).
도 10a는 내인성 모노옥시게나아제가 모두 녹-아웃된 YID09 균주에 다양한 종류의 박테리아 유래 외인성 모노옥시게나아제를 도입한 후, 그 배양물에서 생성된 생성물의 종류와 생성량을 확인한 결과를 나타낸 것이다(1,12-DDDA: 1,12-도데칸이산; 12-HDA: 12-하이드록시도데칸산; 1-DDA: 도데칸산; 1-DOL: 1-도데칸올; 1,12-DIOL: 1,12-도데칸디올).
도 10b는 내인성 모노옥시게나아제가 모두 녹-아웃된 YID09 균주에 다양한 종류의 박테리아 유래 외인성 모노옥시게나아제를 도입한 후, 그 배양물에서 생성된 1,12-도데칸디올의 생산량을 나타낸 것이다.
먼저, 본 명세서에서 사용된 용어를 정의한다.
본 명세서에서, 용어 "ω-산화"는 지방산의 메틸기 말단이 산화되어 디카르복시산이 형성되는 대사 과정을 의미하고, 용어 "β-산화"는 지방산의 카르복시기에서 β-자리의 탄소원자가 산화되어 아세틸-CoA를 방출하면서 그때마다 탄소 원자수가 2개 감소된 지방산으로 점차 분해되어 가는 대사 과정을 의미한다. 상기 ω-산화 및 β-산화의 개념과 이러한 대사 과정에 관여하고 있는 효소들에 대해서는 생화학 분야의 통상의 기술자에게 있어서 널리 알려져 있다. 예컨대, ω-산화에 있어서, 지방산이 기질로 이용될 경우에는 먼저 시토크롬 P450(내인성 모노옥시게나아제) 및 NADPH-시토크롬 P450 리덕타아제(reductase)의 작용에 의해 ω-히드록시 지방산이 생성되고, 상기 ω-히드록시 지방산은 지방 알코올 디하이드로게나아제 및 지방 알코올 옥시다아제의 작용에 의해 ω-알데히드 지방산으로 전환되며, 상기 ω-알데히드 지방산은 지방 알데히드 디하이드로게나아제의 작용에 의해 α,ω-디카르복시산으로 전환된다. 또한, β-산화에 있어서, 지방산(Cn)이 기질로 이용될 경우에는 먼저 지방 아세틸-CoA 합성효소(synthetase)의 작용에 의해 지방 아실-CoA(Cn)가 생성되고, 상기 지방 아실-CoA(Cn)는 아실-CoA 디하이드로게나아제 및 아실-CoA 옥시다아제의 작용에 의해 트랜스-Δ2-엔오일-CoA(Cn)으로 전환되고, 상기 트랜스-Δ2-엔오일-CoA(Cn)는 엔오일-CoA 히드라타아제(hydratase)의 작용에 의해 L-β-히드록시아실 CoA(Cn)으로 전환되며, 상기 L-β-히드록시아실 CoA(Cn)는 3-히드록시아실-CoA 디하이드로게나아제의 작용에 의해 β-케토아실 CoA(Cn)로 전환되고, 상기 β-케토아실 CoA(Cn)는 3-케토아실 CoA 티올라아제(thiolase)의 작용에 의해 아세틸-CoA와 탄소 원자수가 2개 감소된 아실-CoA(Cn-2)로 분해된다. 이렇게 생성된 아실-CoA(Cn-2)는 다시 상기와 같은 과정을 거치게 되고, 이를 반복할수록 지방산의 탄소수가 점점 감소되면서 최종적으로 탄소수가 적은 단쇄의 지방산으로 전환된다. 한편, 상기 ω-산화 대사 경로를 통해 생성된 α,ω-디카르복시산은 지방 아실-CoA(Cn)로 전환된 후 상기 β-산화 대사 경로를 거치게 되고, 이를 통해 아세틸-CoA와 탄소 원자수가 2개 감소된 지방 아실-CoA(Cn-2)로 전환된다(도 1 참고).
본 명세서에서, 용어 "관여"한다는 것은 어떤 효소가 상기 ω-산화 또는 β-산화의 대사 과정의 적어도 어느 한 단계에 이용되어 바로 전 단계에서 생성된 생성물을 바로 다음 단계의 반응물로 전환시키는 과정에 참여한다는 것을 의미하고, 상기 효소의 활성이 감소 또는 상실되면 상기 ω-산화 또는 β-산화의 대사 과정에서 상기 효소가 이용되는 단계의 효율이 저하되거나, 상기 단계에서의 전환이 거의 또는 전혀 일어나지 않는다는 의미이다.
본 명세서에서, 용어 "활성이 감소 또는 상실"된다는 것은 효소가 충분한 활성을 나타내지 못하거나, 또는 전혀 활성을 나타내지 못하는 상태는 물론, 상기 효소가 충분히 발현되지 못하거나 또는 전혀 발현되지 못하는 상태까지 포괄하는 의미이다. 상기와 같이 효소의 활성을 감소 또는 상실시키는 방법은 생화학 분야의 통상의 기술자들에게 널리 알려져 있다. 예컨대, 효소의 활성을 감소시키는 방법으로는 그 효소를 암호화하는 유전자를 녹-다운(knock-down)시켜 발현량을 감소시키거나, 또는 그 효소의 활성 도메인에 일부 아미노산들의 치환, 결실 등과 같은 돌연변이를 유발시켜 효소 자체의 활성을 저하시키는 방법이 있을 수 있다. 또한, 효소의 활성을 상실시키는 방법으로는 그 효소를 암호화하는 유전자를 완전히 녹-아웃(knock-out)시켜 그 효소의 발현 자체를 차단하거나, 또는 그 효소의 활성 도메인을 녹-아웃시켜 그 효소가 발현되더라도 활성을 전혀 가지지 못하도록 하는 방법이 있을 수 있다. 상기와 같은 녹-다운, 녹-아웃, 돌연변이 유발 등의 기술은 역시 생화학 분야의 통상의 기술자들에게 널리 알려진 방법들이 이용될 수 있다.
본 명세서에서, 용어 "지방(fatty)"은 탄소수가 많은, 예컨대 탄소수 5 내지 30개의 탄소 사슬을 가진다는 의미로서, "지방(fatty) 알코올"은 탄소수 5 내지 30개의 탄소 사슬을 갖는 직쇄 또는 분지쇄의 알코올이라는 의미이고, "지방(fatty) 알데히드"는 탄소수 5 내지 30개의 탄소 사슬을 갖는 직쇄 또는 분지쇄의 알데히드라는 의미이다.
이하, 본 발명을 상세히 설명한다.
본 발명의 일 측면에 따르면, 본 발명은 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서, 상기 ω-산화 대사 경로에 관여하는 지방 알코올 옥시다아제의 일부 또는 전부의 활성이 감소 또는 상실되고, 상기 β-산화 대사 경로에 관여하는 아실-CoA 옥시다아제의 일부 또는 전부의 활성이 감소 또는 상실된 한편, 상기 ω-산화 대사 경로에 관여하는 내인성 모노옥시게나아제의 일부 또는 전부의 활성이 감소된 재조합 미생물을 제공한다.
상기 미생물은 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 임의의 미생물이 제한없이 이용될 수 있고, 구체적으로 도 1에 도시된 바와 같은 ω-산화 대사의 경로를 거쳐 탄화수소를 α,ω-디카르복시산으로 전환할 수 있고, β-산화 대사의 경로를 통해 지방산을 아세틸-CoA와 아실-CoA로 분해할 수 있는 미생물이라면 종래에 알려진 것들은 물론, 앞으로 밝혀질 것들까지도 제한없이 이용될 수 있을 것이다. 이러한 미생물은 본 발명이 속하는 기술분야의 통상의 기술자에게 널리 알려져 있는 것이거나 통상의 기술자들이 쉽게 판단할 수 있는 것이고, 대표적으로 효모(yeast)를 들 수 있다. 상기 효모는 사카로마이세스(Saccharomyces), 클루이베로미세스(Kluyveromyces), 캔디다(Candida), 피키아(Pichia), 쉬조사카로미세스(Schizosaccharomyces), 한세눌라(Hansenula), 클로에케라(Kloeckera), 쉬와니오미세스(Schwanniomyces), 야로위아(Yarrowia), 크립토코쿠스(Cryptococcus), 데바로미세스(Debaromyces), 사카로미세콥시스(Saccharomycecopsis), 사카로미코데스(Saccharomycodes), 위케르하미아(Wickerhamia), 위케르하미엘라(Wickerhamiella), 데바요미세스(Debayomyces), 한세니아스포라(Hanseniaspora), 오가타에아(Ogataea), 쿠라이쉬아(Kuraishia), 코마가타엘라(Komagataella), 메트쉬니코위아(Metschnikowia), 윌리옵시스(Williopsis), 나카자와에아(Nakazawaea), 토룰라스포라(Torulaspora), 불레라(Bullera), 로도토룰라(Rhodotorula), 스포로볼로미세스(Sporobolomyces) 등의 속에 포함되는 것일 수 있고, 보다 구체적으로는 클루이베로미세스 락티스(Kluyveromyces lactis), 사카로마이세스 세레비지애(Saccharomyces cerevisiae), 한세눌라 폴리모르파(Hansenula polymorpha), 야로위아 리폴리티카(Yarrowia lipolytica), 캔디다 트로피칼리스(Candida tropicalis), 캔디다 인판티콜라(Candida infanticola), 캔디다 마이코더마(Candida mycoderma), 피키아 파스토리스(Pichia pastoris), 피키아 알코홀로피아(Pichia alcoholophia), 위케르하미엘라 소르보필라(Wickerhamiella sorbophila) 등일 수 있다. 이 중, 본 발명의 구체적인 실시예들에서는 상기와 같은 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물로 대표적인 야로위아 리폴리티카를 이용하여 본 발명의 실시가능성을 확인하였다.
상기 지방 알코올 옥시다아제는 상기 ω-산화 대사 경로에 관여하여 지방 알코올을 지방 알데히드로 전환시키는 활성을 가지는 효소로서, EC 1.1.3.20로 분류되는 것일 수 있고, 구체적인 미생물의 종류에 따라서 FAO, FAOT, LCAO 등으로 불릴 수 있다. 또한, 상기 지방 알코올 옥시다아제는 미생물의 종류에 따라 구체적인 아미노산 서열이 다소 다를 수 있지만, ω-산화 대사 경로에 관여하여 지방 알코올을 지방 알데히드로 전환시키는 활성을 가지는 것으로서, 서열번호 22의 염기 서열에 의해 암호화되는 폴리펩티드와 적어도 60%, 적어도 70%, 적어도 80%, 바람직하게는 적어도 90%, 더욱 바람직하게는 적어도 95%, 더욱 더 바람직하게는 적어도 99%, 가장 바람직하게는 100%의 아미노산 서열 상동성을 나태나는 것이라면, 모두 본 발명의 상기 지방 알코올 옥시다아제에 해당되는 것일 수 있다. 또한, 상기 지방 알코올 옥시다아제는, 미생물의 종류에 따라 구체적인 염기 서열은 다소 다를 수 있지만, 서열번호 22의 염기 서열과 적어도 60%, 적어도 70%, 적어도 80%, 바람직하게는 적어도 90%, 더욱 바람직하게는 적어도 95%, 더욱 더 바람직하게는 적어도 99%, 가장 바람직하게는 100%의 상동성을 나태나는 염기 서열을 포함하는 유전자에 의해 암호화될 수 있다.
본 발명의 재조합 미생물에서 상기 지방 알코올 옥시다아제는 그 활성이 감소 또는 상실된 것일 수 있다. 상기와 같이 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서 지방 알코올 옥시다아제의 활성을 감소 또는 상실시킴으로써, 상기 미생물에서의 ω-산화 대사 경로를 통한 지방 알코올의 지방 알데히드로의 전환이 감소되거나 차단될 수 있다.
이때, 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물 내에 상기 지방 알코올 옥시다아제의 상동형(isoform) 효소들이 존재하는 경우, 상기 상동형 효소들은 그 일부 또는 전부의 활성이 감소 또는 상실될 수 있다. 예컨대, 캔디다 트로피칼리스의 경우, FAO1, FAO1B, FAO2, FAO2B로 지칭되는 상동형 지방 알코올 옥시다아제들이 존재하고 있고, 이러한 경우 상기 FAO1, FAO1B, FAO2 및 FAO2B로 이루어지는 군으로부터 선택되는 적어도 하나의 지방 알코올 옥시다아제의 활성이 감소 또는 상실될 수도 있고, 이들 모두의 활성이 감소 또는 상실될 수도 있다. 상기 지방 알코올 옥시다아제의 상동형 효소들의 활성을 감소 또는 상실시키는 범위와 정도에 따라, ω-산화 대사 경로에서 지방 알코올의 추가적인 산화가 차단되는 정도가 결정될 수 있다. 예컨대, 상기 지방 알코올 옥시다아제의 상동형 효소들의 일부보다는 전부에 대하여, 그리고 활성을 감소시키기 보다는 상실시키는 경우, ω-산화 대사 경로에서 지방 알코올의 추가적인 산화를 차단하는 효율을 더욱 더 향상시킬 수 있다.
본 발명의 재조합 미생물의 경우, ω-산화 대사 경로를 통한 지방 알코올의 추가적인 산화 방지 효율을 더욱 향상시키기 위하여, 상기 지방 알코올 옥시다아제의 활성이 감소 또는 상실된 것에 더하여, 추가적으로 상기 ω-산화 대사 경로에 관여하는 지방 알코올 디하이드로게나아제의 일부 또는 전부, 또는 상기 ω-산화 대사 경로에 관여하는 지방 알데히드 디하이드로게나아제의 일부 또는 전부의 활성이 감소 또는 상실된 것일 수 있다.
상기 지방 알코올 디하이드로게나아제는 상기 ω-산화 대사 경로에 관여하여 지방 알코올을 지방 알데히드로 전환시키는 활성을 가지는 효소로서, EC 1.1.1.192로 분류되는 것일 수 있고, 구체적인 미생물의 종류에 따라서 ADH, FADH 등으로 불릴 수 있다. 또한, 상기 지방 알코올 디하이드로게나아제는 미생물의 종류에 따라 구체적인 아미노산 서열이 다소 다를 수 있지만, ω-산화 대사 경로에 관여하여 지방 알코올을 지방 알데히드로 전환시키는 활성을 가지는 것으로서, 서열번호 13 내지 21의 염기 서열에 의해 암호화되는 각각의 폴리펩티드와 적어도 60%, 적어도 70%, 적어도 80%, 바람직하게는 적어도 90%, 더욱 바람직하게는 적어도 95%, 더욱 더 바람직하게는 적어도 99%, 가장 바람직하게는 100%의 아미노산 서열 상동성을 나태나는 것이라면, 모두 본 발명의 상기 지방 알코올 디하이드로게나아제에 해당되는 것일 수 있다. 또한, 상기 지방 알코올 디하이드로게나아제는, 미생물의 종류에 따라 구체적인 염기 서열은 다소 다를 수 있지만, 서열번호 13 내지 21의 염기 서열 각각과 적어도 60%, 적어도 70%, 적어도 80%, 바람직하게는 적어도 90%, 더욱 바람직하게는 적어도 95%, 더욱 더 바람직하게는 적어도 99%, 가장 바람직하게는 100%의 상동성을 나태나는 염기 서열을 포함하는 유전자들에 의해 암호화될 수 있다.
본 발명의 재조합 미생물에서 상기 지방 알코올 디하이드로게나아제는 그 활성이 감소 또는 상실된 것일 수 있다. 상기와 같이 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서 지방 알코올 디하이드로게나아제의 활성을 감소 또는 상실시킴으로써, 상기 미생물에서의 ω-산화 대사 경로를 통한 지방 알코올의 지방 알데히드로의 전환이 감소되거나 차단될 수 있다.
이때, 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물 내에 상기 지방 알코올 디하이드로게나아제의 상동형(isoform) 효소들이 존재하는 경우, 상기 상동형 효소들은 그 일부 또는 전부의 활성이 감소 또는 상실될 수 있다. 예컨대, 본 발명의 구체적인 실시예에서 대표적으로 이용한 야로위아 리폴리티카의 경우, ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 및 FADH라고 지칭되는 9개의 상동형 지방 알코올 디하이드로게나아제들이 존재하고 있고, 상기 ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 및 FADH는 각각 서열번호 13 내지 21의 염기 서열에 의해 암호화되는데, 이러한 경우 상기 ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, ADH8 및 FADH로 이루어지는 군으로부터 선택되는 적어도 하나의 지방 알코올 디하이드로게나아제의 활성이 감소 또는 상실될 수도 있고, 9개 모두의 활성이 감소 또는 상실될 수도 있다. 상기 지방 알코올 디하이드로게나아제의 상동형 효소들의 활성을 감소 또는 상실시키는 범위와 정도에 따라, ω-산화 대사 경로가 차단되는 정도가 결정될 수 있다. 예컨대, 상기 지방 알코올 디하이드로게나아제의 상동형 효소들의 일부보다는 전부에 대하여, 그리고 활성을 감소시키기 보다는 상실시키는 경우, ω-산화 대사 경로에서 지방 알코올의 추가적인 산화를 차단하는 효율을 더욱 더 향상시킬 수 있다.
상기 지방 알데히드 디하이드로게나아제는 상기 ω-산화 대사 경로에 관여하여 지방 알데히드를 지방산으로 전환시키는 활성을 가지는 효소로서, EC 1.2.1.48로 분류되는 것일 수 있고, 구체적인 미생물의 종류에 따라서 ALDH, FALDH 등으로 불릴 수 있다. 또한, 상기 지방 알데히드 디하이드로게나아제는 미생물의 종류에 따라 구체적인 아미노산 서열이 다소 다를 수 있지만, ω-산화 대사 경로에 관여하여 지방 알데히드를 지방산으로 전환시키는 활성을 가지는 것으로서, 서열번호 23 내지 26의 염기 서열에 의해 암호화되는 각각의 폴리펩티드와 적어도 60%, 적어도 70%, 적어도 80%, 바람직하게는 적어도 90%, 더욱 바람직하게는 적어도 95%, 더욱 더 바람직하게는 적어도 99%, 가장 바람직하게는 100%의 아미노산 서열 상동성을 나태나는 것이라면, 모두 본 발명의 상기 지방 알데히드 디하이드로게나아제에 해당되는 것일 수 있다. 또한, 상기 지방 알데히드 디하이드로게나아제는, 미생물의 종류에 따라 구체적인 염기 서열은 다소 다를 수 있지만, 서열번호 23 내지 26의 염기 서열 각각과 적어도 60%, 적어도 70%, 적어도 80%, 바람직하게는 적어도 90%, 더욱 바람직하게는 적어도 95%, 더욱 더 바람직하게는 적어도 99%, 가장 바람직하게는 100%의 상동성을 나태나는 염기 서열을 포함하는 유전자들에 의해 암호화될 수 있다.
본 발명의 재조합 미생물에서 상기 지방 알데히드 디하이드로게나아제는 그 활성이 감소 또는 상실된 것일 수 있다. 상기와 같이 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서 지방 알데히드 디하이드로게나아제의 활성을 감소 또는 상실시킴으로써, 상기 미생물에서의 ω-산화 대사 경로를 통한 지방 알데히드의 지방산으로의 전환이 감소되거나 차단될 수 있다.
이때, 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물 내에 상기 지방 알데히드 디하이드로게나아제의 상동형(isoform) 효소들이 존재하는 경우, 상기 상동형 효소들은 그 일부 또는 전부의 활성이 감소 또는 상실될 수 있다. 예컨대, 본 발명의 구체적인 실시예에서 대표적으로 이용한 야로위아 리폴리티카의 경우, FALDH1, FALDH2, FALDH3 및 FALDH4라고 지칭되는 4개의 상동형 지방 알데히드 디하이드로게나아제들이 존재하고 있고, 상기 FALDH1, FALDH2, FALDH3 및 FALDH4는 각각 서열번호 23 내지 26의 염기 서열에 의해 암호화되는데, 이러한 경우 상기 FALDH1, FALDH2, FALDH3 및 FALDH4로 이루어지는 군으로부터 선택되는 적어도 하나의 지방 알데히드 디하이드로게나아제의 활성이 감소 또는 상실될 수도 있고, 4개 모두의 활성이 감소 또는 상실될 수도 있다. 상기 지방 알데히드 디하이드로게나아제의 상동형 효소들의 활성을 감소 또는 상실시키는 범위와 정도에 따라, ω-산화 대사 경로가 차단되는 정도가 결정될 수 있다. 예컨대, 상기 지방 알데히드 디하이드로게나아제의 상동형 효소들의 일부보다는 전부에 대하여, 그리고 활성을 감소시키기 보다는 상실시키는 경우, ω-산화 대사 경로에서 지방 알데히드의 추가적인 산화를 차단하는 효율을 더욱 더 향상시킬 수 있다.
상기 아실-CoA 옥시다아제는 상기 β-산화 대사 경로에 관여하여 지방 아실-CoA를 트랜스-Δ2-엔오일-CoA로 전환시키는 활성을 가지는 효소로서, EC 1.3.3.6으로 분류되는 것일 수 있고, 구체적인 미생물의 종류에 따라서 ACO, ACOX, COX, POX 등으로 불릴 수 있다. 또한, 상기 아실-CoA 옥시다아제는 미생물의 종류에 따라 구체적인 아미노산 서열이 다소 다를 수 있지만, β-산화 대사 경로에 관여하여 지방 아실-CoA를 트랜스-Δ2-엔오일-CoA로 전환시키는 활성을 가지는 것으로서, 서열번호 27 내지 32의 염기 서열에 의해 암호화되는 각각의 폴리펩티드와 적어도 60%, 적어도 70%, 적어도 80%, 바람직하게는 적어도 90%, 더욱 바람직하게는 적어도 95%, 더욱 더 바람직하게는 적어도 99%, 가장 바람직하게는 100%의 아미노산 서열 상동성을 나태나는 것이라면, 모두 본 발명의 상기 아실-CoA 옥시다아제에 해당되는 것일 수 있다. 또한, 상기 아실-CoA 옥시다아제는, 미생물의 종류에 따라 구체적인 염기 서열은 다소 다를 수 있지만, 서열번호 27 내지 32의 염기 서열 각각과 적어도 60%, 적어도 70%, 적어도 80%, 바람직하게는 적어도 90%, 더욱 바람직하게는 적어도 95%, 더욱 더 바람직하게는 적어도 99%, 가장 바람직하게는 100%의 상동성을 나태나는 염기 서열을 포함하는 유전자들에 의해 암호화될 수 있다.
본 발명의 재조합 미생물에서 상기 아실-CoA 옥시다아제는 그 활성이 감소 또는 상실된 것일 수 있다. 상기와 같이 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서 아실-CoA 옥시다아제의 활성을 감소 또는 상실시킴으로써, 상기 미생물에서의 β-산화 대사 경로를 통한 지방 아실-CoA의 트랜스-Δ2-엔오일-CoA로의 전환이 감소되거나 차단될 수 있다. 특히, 상기 아실-CoA 옥시다아제는 β-산화 대사 경로의 초기 단계에 관여하는 효소이므로, 상기와 같이 아실-CoA 옥시다아제의 활성을 감소 또는 상실시킴으로써, 지방 아실-CoA가 β-산화 대사 경로로 진입하는 것 자체를 차단하여 궁극적으로 β-산화 대사 경로 자체를 차단할 수 있다.
이때, 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물 내에 상기 아실-CoA 옥시다아제의 상동형(isoform) 효소들이 존재하는 경우, 상기 상동형 효소들은 그 일부 또는 전부의 활성이 감소 또는 상실될 수 있다. 예컨대, 본 발명의 구체적인 실시예에서 대표적으로 이용한 야로위아 리폴리티카의 경우, ACO1(POX1), ACO2(POX2), ACO3(POX3), ACO4(POX4), ACO5(POX5) 및 ACO6(POX6)라고 지칭되는 6개의 상동형 아실-CoA 옥시다아제들이 존재하고 있고, 상기 ACO1(POX1), ACO2(POX2), ACO3(POX3), ACO4(POX4), ACO5(POX5) 및 ACO6(POX6)는 각각 서열번호 27 내지 32의 염기 서열에 의해 암호화되는데, 이러한 경우 상기 ACO1(POX1), ACO2(POX2), ACO3(POX3), ACO4(POX4), ACO5(POX5) 및 ACO6(POX6)로 이루어지는 군으로부터 선택되는 적어도 하나의 아실-CoA 옥시다아제의 활성이 감소 또는 상실될 수도 있고, 6개 모두의 활성이 감소 또는 상실될 수도 있다. 상기 아실-CoA 옥시다아제의 상동형 효소들의 활성을 감소 또는 상실시키는 범위와 정도에 따라, β-산화 대사 경로가 차단되는 정도가 결정될 수 있다. 예컨대, 상기 아실-CoA 옥시다아제의 상동형 효소들의 일부보다는 전부에 대하여, 그리고 활성을 감소시키기 보다는 상실시키는 경우, β-산화 대사 경로의 차단 효율을 더욱 더 향상시킬 수 있다.
상기 내인성(endogenous) 모노옥시게나아제는 상기 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에 본래부터 존재하면서, 상기 ω-산화 대사 경로에 관여하여 알칸 또는 지방산의 말단에 히드록시기를 도입시키는 효소로서, 알칸을 지방 알코올로 젼환시키거나, 지방산을 ω-히드록시 지방산으로 전환시키는 활성을 가지는 것이다. 상기 내인성 모노옥시게나아제는 EC 1.14로 분류되는 것일 수 있고, 구체적인 미생물의 종류에 따라서 ALK, CYP, Cyt-P450 등으로 불릴 수 있다. 또한, 상기 내인성 모노옥시게나아제는 미생물의 종류에 따라 구체적인 아미노산 서열이 다소 다를 수 있지만, ω-산화 대사 경로에 관여하여 알칸을 지방 알코올로 젼환시키거나, 지방산을 ω-히드록시 지방산으로 전환시키는 활성을 가지는 것으로서, 서열번호 1 내지 12의 염기 서열에 의해 암호화되는 각각의 폴리펩티드와 적어도 60%, 적어도 70%, 적어도 80%, 바람직하게는 적어도 90%, 더욱 바람직하게는 적어도 95%, 더욱 더 바람직하게는 적어도 99%, 가장 바람직하게는 100%의 아미노산 서열 상동성을 나태나는 것이라면, 모두 본 발명의 상기 내인성 모노옥시게나아제에 해당되는 것일 수 있다. 또한, 상기 내인성 모노옥시게나아제는, 미생물의 종류에 따라 구체적인 염기 서열은 다소 다를 수 있지만, 서열번호 1 내지 12의 염기 서열 각각과 적어도 60%, 적어도 70%, 적어도 80%, 바람직하게는 적어도 90%, 더욱 바람직하게는 적어도 95%, 더욱 더 바람직하게는 적어도 99%, 가장 바람직하게는 100%의 상동성을 나태나는 염기 서열을 포함하는 유전자들에 의해 암호화될 수 있다.
한편, 상기 내인성 모노옥시게나아제는 알칸을 지방 알코올로, 그리고 지방산을 ω-히드록시 지방산으로 전환시키기도 하지만, 그 산화 활성이 과하여 알칸을 지방 알코올로 산화시키는데 그치지 않고 지방 알데히드로, 지방산을 ω-히드록시 지방산으로 산화시키는데 그치지 않고 ω-알데히드 지방산으로 과산화시키기도 한다. 따라서 본 발명의 재조합 미생물에서 상기 내인성 모노옥시게나아제의 과산화 활성을 억제하게 위하여, 상기 내인성 모노옥시게나아제는 그 활성이 감소 또는 상실된 것일 수 있다. 상기와 같이 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서 내인성 모노옥시게나아제의 활성을 감소 또는 상실시킴으로써, 상기 미생물에서의 ω-산화 대사 경로를 통한 알칸이나 지방산의 과산화를 방지할 수 있고, 나아가 중쇄 디올의 생산성을 더욱 향상시킬 수 있다.
이때, 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물 내에 상기 내인성 모노옥시게나아제의 상동형(isoform) 효소들이 존재하는 경우, 상기 상동형 효소들은 그 일부 또는 전부의 활성이 감소 또는 상실될 수 있다. 예컨대, 본 발명의 구체적인 실시예에서 대표적으로 이용한 야로위아 리폴리티카의 경우, ALK1, ALK2, ALK3, ALK4, ALK5, ALK6, ALK7, ALK8, ALK9, ALK10, ALK11 및 ALK12라고 지칭되는 12개의 상동형 내인성 모노옥시게나아제들이 존재하고 있고, 상기 ALK1, ALK2, ALK3, ALK4, ALK5, ALK6, ALK7, ALK8, ALK9, ALK10, ALK11 및 ALK12는 각각 서열번호 1 내지 12의 염기 서열에 의해 암호화되는데, 이러한 경우 상기 ALK1, ALK2, ALK3, ALK4, ALK5, ALK6, ALK7, ALK8, ALK9, ALK10, ALK11 및 ALK12로 이루어지는 군으로부터 선택되는 적어도 하나의 내인성 모노옥시게나아제의 활성이 감소 또는 상실될 수도 있고, 상기 적어도 하나의 내인성 모노옥시게나아제는 ALK3 및 ALK6 중 적어도 하나를 포함하는 것일 수 있고, 상기 ALK1, ALK2, ALK3, ALK4, ALK5, ALK6, ALK7, ALK8, ALK9, ALK10, ALK11 및 ALK12 모두의 활성이 감소 또는 상실될 수도 있다. 상기 내인성 모노옥시게나아제의 상동형 효소들의 활성을 감소 또는 상실시키는 범위와 정도에 따라, 알칸이나 지방산이 과산화되는 정도가 결정될 수 있다. 예컨대, 상기 내인성 모노옥시게나아제의 상동형 효소들의 일부 보다는 전부에 대하여, 그리고 활성을 감소시키기 보다는 상실시키는 경우, 알칸이나 지방산의 과산화 방지 정도를 더욱 더 향상시킬 수 있다.
본 발명의 구체적인 실시예에서는, 야로위아 리폴리티카에서 상기 내인성 모노옥시게나아제 중 일부(ALK3 및 ALK6 중 적어도 하나)의 활성을 상실시키고, 이를 중쇄의 n-알칸 또는 중쇄의 1차 알코올이 포함된 배지에서 배양하였을 때, 상기 내인성 모노옥시게나아제의 활성이 그대로 존재하는 경우에 비해, 과산화 생성물(디카르복시산)의 생성은 감소되는 반면, 중쇄 디올의 생산성은 향상됨을 확인하였다(도 7 참고).
본 발명의 재조합 미생물의 경우, 중쇄 디올의 생산성을 더욱 향상시키기 위하여, 상기 내인성 모노옥시게나아제의 일부 또는 전부의 활성이 감소 또는 상실된 것에 더하여, 추가적으로 적어도 하나의 외인성(exogenous) 모노옥시게나아제가 도입되어 활성을 나타내는 것일 수 있다.
상기 외인성 모노옥시게나아제는 상기 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에 본래부터 존재하는 것이 아니라, 다른 생물종에서 유래한 것으로서, 기본적으로 상기 내인성 모노옥시게나아제와 동일하게 알칸 또는 지방산의 말단에 히드록시기를 도입시키는 활성, 다시 말해서 알칸을 지방 알코올로 젼환시키거나, 지방산을 ω-히드록시 지방산으로 전환시키는 활성을 가지는 것이고, EC 1.14로 분류되는 것일 수 있다. 다만, 상기 외인성 모노옥시게나아제는 알칸이나 지방산을 지방 알데히드나 ω-알데히드 지방산으로 과산화시키는 활성이 상기 내인성 모노옥시게나아제보다 낮은 것일 수 있다.
다시 말해서, 상기 외인성 모노옥시게나아제는 알칸이나 지방산을 지방 알코올이나 ω-히드록시 지방산으로만 산화시키고, 지방 알데히드나 ω-알데히드 지방산으로까지 과산화시키지 않는 것이라면, 어떠한 것이든 제한없이 이용될 수 있다. 구체적으로, 상기 외인성 모노옥시게나아제는 박테리아에서 유래한 것일 수 있고, 박테리아 유래의 시토크롬 P450 효소일 수 있다. 또한, 상기 외인성 모노옥시게나아제는 서열번호 33의 염기 서열에 의해 암호화되는 CYP153A13, 서열번호 34의 염기 서열에 의해 암호화되는 CYP153A33, 서열번호 35의 염기 서열에 의해 암호화되는 nfa22930(CYP154), 서열번호 36의 염기 서열에 의해 암호화되는 nfa33510(CYP151A), 서열번호 37의 염기 서열에 의해 암호화되는 nfa22290(CYP140A) 등으로 이루어진 군에서 선택되는 적어도 하나일 수 있으나 이에 한정되는 것은 아니다.
본 발명의 구체적인 실시예에서는, 야로위아 리폴리티카에서 야생형의 내인성 모노옥시게나아제의 상동형 효소 모두의 활성을 상실시키는 한편, 박테리아 유래의 외인성 모노옥시게나아제를 도입하여, 이를 중쇄의 n-알칸 또는 중쇄의 1차 알코올이 포함된 배지에서 배양하였을 때, 중쇄 디올의 생산성이 현저하게 향상됨을 확인하였다(도 9, 도 10a, 도 10b 참고).
본 발명의 일 구현예에 따르면, 상기 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서, 지방 알코올 옥시다아제, 지방 알코올 디하이드로게나아제, 지방 알데히드 디하이드로게나아제, 아실-CoA 옥시다아제 및 내인성 모노옥시게나아제 모두에 대하여, 그의 모든 상동형 효소의 활성을 상실시키고, 박테리아 유래의 외인성 모노옥시게나아제를 도입할 수 있다.
또한, 본 발명에 있어서, 본 기술분야에 공지된 통상의 유전자 재조합 기술을 이용하여 상기 지방 알코올 옥시다아제, 지방 알코올 디하이드로게나아제, 지방 알데히드 디하이드로게나아제, 아실-CoA 옥시다아제 및 내인성 모노옥시게나아제의 일부 또는 전부의 활성이 감소 또는 상실되고, 적어도 하나의 외인성 모노옥시게나아제가 도입된 재조합 미생물을 제조할 수 있다. 본 발명에서 사용될 수 있는 유전자 재조합 기술로는 형질전환(transformation), 형질도입(transduction), 형질주입(transfection), 미세주입(microinjection), 전기천공(electroporation) 등의 방법을 예시할 수 있으나, 이에 한정되는 것은 아니다.
상기와 같이, ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서, ω-산화 대사 경로에 관여하는 효소들 중 유전자, 지방 알코올 옥시다아제의 일부 또는 전부의 활성이 감소 또는 상실되고, 선택적으로 지방 알코올 디하이드로게나아제 및/또는 지방 알데히드 디하이드로게나아제의 활성이 감소 또는 상실되며, β-산화 대사 경로 중의 아실-CoA 옥시다아제의 활성이 감소 또는 상실되는 한편, 상기 ω-산화 대사 경로에 관여하는 내인성 모노옥시게나아제의 활성이 감소 또는 상실된 재조합 미생물의 경우, 알칸이 기질로 공급되면 활성이 감소 또는 상실된 내인성 모노옥시게나아제인 시토크롬 P450와 NADPH-시토크롬 P450 리덕타아제의 작용에 의해 두 말단 중 어느 한 쪽이 산화되어 1차 알코올(지방 알코올)이 형성되지만, 지방 알코올 옥시다아제의 일부 또는 전부, 그리고 선택적으로 지방 알코올 디하이드로게나아제나 지방 알데히드 디하이드로게나아제의 일부 또는 전부의 활성이 감소 또는 상실되어 있기 때문에 1차 알코올(지방 알코올)의 추가적인 산화가 제한된다. 그리고, 상기와 같이 형성된 1차 알코올(지방 알코올)은 다시 기질이 되어 활성이 감소 또는 상실된 시토크롬 P450 및 NADPH-시토크롬 P450 리덕타아제의 작용에 의해 다른 쪽 말단이 산화됨으로써 2차 알코올인 α,ω-디올이 형성된다. 상기와 같이 알칸을 기질로 이용하게 되면 2차례에 걸친 산화 반응을 통해 디올이 형성되지만, 기질로 알칸이 아닌 1차 알코올(지방 알코올)을 이용하게 되면 1차례의 산화만으로 2차 알코올인 α,ω-디올이 형성된다.
또한, 높은 과산화 활성을 가지는 내인성 모노옥시게나아제의 일부 또는 전부의 활성이 감소 또는 상실되어 있으므로, 1차 알코올(지방 알코올)이 지방 알데히드로 과산화되는 정도가 감소하게 되고, 그 결과 상기 내인성 모노옥시게나아제의 활성이 감소 또는 상실되기 전에 비해 1차 알코올의 과산화 생성물은 감소하며, 다른 쪽 말단이 산화되어 형성되는 α,ω-디올의 생성량이 증가하게 된다.
또한, 상기와 같이 높은 과산화 활성을 가지는 내인성 모노옥시게나아제의 일부 또는 전부의 활성이 감소 또는 상실된 한편, 상기 내인성 모노옥시게나아제보다 과산화 활성이 낮은 박테리아 유래의 외인성 모노옥시게나아제가 도입된 경우에는, 재조합 미생물 내 모노옥시게나아제의 과산화 활성은 전체적으로 현저하게 감소된 반면, 재조합 미생물 내 모노옥시게나아제의 산화 활성(알칸이나 지방 알코올의 말단에 히드록시기를 도입시키는 활성)은 전체적으로 현저히 증가되어 있으므로, 역시 1차 알코올의 과산화 생성물은 더욱 감소하며, α,ω-디올의 생성량이 월등하게 증가하게 된다.
본 발명의 다른 측면에 따르면, 상기 재조합 미생물을 이용하여 중쇄의 디올을 생산하는 방법을 제공한다.
본 발명의 중쇄 디올의 생산 방법은 상기 재조합 미생물을 알칸 및 지방 알코올 중 적어도 하나가 공급되는 환경에서 배양하는 단계를 포함한다.
상기 알칸은 중쇄의 알칸일 수 있고, 예컨대 탄소수가 5 내지 30개, 바람직하게는 탄소수가 6 내지 20개, 보다 바람직하게는 탄소수가 8 내지 16개인 알칸일 수 있다. 또한, 상기 알칸은 직쇄 또는 분지쇄일 수 있고, 바람직하게는 직쇄일 수 있다. 또한, 상기 지방 알코올은 중쇄의 1차 알코올일 수 있고, 예컨대 탄소수가 5 내지 30개, 바람직하게는 탄소수가 6 내지 20개, 보다 바람직하게는 탄소수가 8 내지 16개인 1차 알코올일 수 있다. 또한, 상기 지방 알코올 역시 직쇄 또는 분지쇄일 수 있고, 바람직하게는 직쇄일 수 있다. 또한, 상기 알칸이나 지방 알코올은 둘 중 어느 하나만이 공급될 수 있고, 둘이 혼합된 상태로 공급될 수도 있다.
상기 알칸 및 지방 알코올 중 적어도 하나가 공급되는 환경은 외부에서 인위적으로 알칸이나 지방 알코올을 공급해 주거나 배양에 이용되는 배지 내에 알칸이나 지방 알코올을 첨가하여 함께 공급해 주는 것일 수도 있고, 상기 공급은 연속적이거나 간헐적일 수 있다.
상기 중쇄 디올은 탄소수가 5 내지 30개, 바람직하게는 탄소수가 6 내지 20개, 보다 바람직하게는 탄소수가 8 내지 16개인 직쇄 또는 분지쇄의 탄화수소의 양 말단에 히드록시기가 도입된 α,ω-디올일 수 있다.
상기 중쇄 디올의 생산 방법은 β-산화 대사 경로가 차단되고, ω-산화 대사 경로에서 지방 알코올에 대한 과산화 활성이 제어된 본 발명의 상기 재조합 미생물의 대사 과정을 활용하는 것이므로, 상술한 바와 같은 원리로 알칸이나 지방 알코올로부터 α,ω-디올을 생산하는 것이다. 따라서 공급되는 알칸이나 지방 알코올의 종류에 따라 생성되는 α,ω-디올의 종류 또한 달라지는 것이고, 중쇄의 알칸이나 지방 알코올이 공급되는 경우 중쇄의 α,ω-디올이 생성된다. 예컨대, 탄소수가 8개인 옥탄이나 1-옥탄올이 공급되면 α,ω-디올로 1,8-옥탄디올이 생성되고, 탄소수가 12개인 도데칸이나 1-도데칸올이 공급되면 α,ω-디올로 1,12-도데칸디올이 생성되며, 탄소수가 16개인 헥사데칸이나 1-헥사데칸올이 공급되면 α,ω-디올로 1,16-헥사데칸디올이 생성되는 것이다. 본 발명의 구체적인 실시예에서는, 여러 중쇄의 알칸이나 1차 알코올 중 대표적으로 탄소수가 12개인 도데칸과 1-도데칸올을 각각 본 발명의 재조합 미생물에 공급하여 배양한 결과, 1,12-도데칸디올이 높은 수율로 생성됨을 확인하였다(도 9, 도 10a, 도 10b 참고).
상기와 같은 재조합 미생물의 배양은 본 발명이 속하는 기술분야에 알려진 적당한 배지와 배양 조건에 따라 이루어질 수 있다. 본 발명이 속하는 기술분야의 통상의 기술자라면 선택되는 재조합 미생물의 숙주세포의 종류에 따라 배지 및 배양조건을 용이하게 조정하여 사용할 수 있다. 배양 방법은 회분식, 연속식, 유가식, 또는 이들의 조합 배양을 포함할 수 있다.
상기 배지는 다양한 탄소원, 질소원 및 미량원소 성분을 포함할 수 있다.
상기 탄소원은, 예를 들면, 포도당, 자당, 유당, 과당, 말토오스, 전분, 셀룰로오스와 같은 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유와 같은 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤 및 에탄올과 같은 알코올, 아세트산과 같은 유기산, 또는 이들의 조합을 포함할 수 있다. 상기 배양은 글루코스를 탄소원으로 하여 수행될 수 있다. 상기 질소원은, 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액(CSL), 및 대두밀과 같은 유기 질소원 및 요소, 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄과 같은 무기 질소원, 또는 이들의 조합을 포함할 수 있다. 상기 배지는 인의 공급원으로서, 예를 들면, 인산이수소칼륨, 인산수소이칼륨 및 상응하는 소듐-함유 염, 황산마그네슘 또는 황산철과 같은 금속염을 포함할 수 있다.
또한, 아미노산, 비타민, 및 적절한 전구체 등이 배지에 포함될 수 있다. 상기 배지 또는 개별 성분은 배양액에 회분식 또는 연속식으로 첨가될 수 있다.
또한, 배양 중에 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다.
상기와 같은 재조합 미생물의 배양은 20℃ 내지 60℃에서 수행될 수 있고, 바람직하게는 25℃ 내지 55℃, 보다 바람직하게는 30℃ 내지 50℃에서 수행될 수 있다. 상기 재조합 미생물의 배양이 20℃ 미만 또는 60℃ 초과의 온도 범위에서 수행될 경우 충분한 양의 중간 생성물이 생성되지 않아, 결국 최종 생산물인 중쇄의 α,ω-디올의 생성량 또는 충분해지지 못하는 문제가 발생하게 된다.
또한, 상기와 같은 재조합 미생물의 배양은 pH 5 내지 pH 10에서 수행될 수 있고, 바람직하게는 pH 8.5 내지 pH 10에서 수행될 수 있으나, 이에 한정하지 아니한다. 상기와 같은 형질 전환체의 배양 pH 조건은 재조합 미생물의 배양 배지에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 첨가함으로써 조정할 수 있다. 재조합 미생물의 배양 pH 조건이 상기 범위를 벗어나는 경우 재조합 미생물의 생장하기 어렵기 때문에 최종 생산물인 중쇄의 α,ω-디올의 생성량 또는 충분해지지 못하는 문제가 발생하게 된다.
이하, 본 발명을 실시예에 의하여 상세히 설명한다.
단, 하기 실시예는 본 발명을 구체적으로 예시하는 것이며, 본 발명의 내용이 하기 실시예에 의해 한정되지 아니한다.
1. 재료 및 방법
1-1. 미생물
디올을 생산하기 위한 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물로 야로위아 리폴리티카(Yarrowia lipolytica)를 사용하고, 이를 유전자 조작하기 위한 플라스미드는 대장균(E. coli DH5α)을 사용하여 증폭하였다. 유전자 조작을 위한 야생형의 야로위아 리폴리티카 균주나, 이로부터 유전자를 녹-아웃시켜 제조된 표 4의 재조합 미생물들은 25% 글리세롤에서 -70℃로 유지시켰고, 스톡 균주를 YPD 한천 배지(10 g/L yeast extract, 20 g/L Bacto peptone, 20 g/L glucose, and 20 g/L agarose)에 도말하여 30℃에서 밤새 배양하였다.
1-2. 효모의 게놈에서 유전자의 녹-아웃
야생형의 야로위아 리폴리티카에서 표적 유전자는 URA3 유전자를 선별 마커로 사용하여 상동 재조합을 통해 녹-아웃되었다(도 2). URA3 유전자는 야생형의 야로위아 리폴리티카 균주로부터 증폭되었다. 야로위아 리폴리티카의 글루타메이트 생성 유전자(GLT1) 또는 MATB2 5'-UTR 영역 또는 살모넬라 엔테리카(Salmonella enterica)의 ATP 포스포리보실트랜스퍼라제 유전자(HisG)로부터 부분 서열을 함유하는 반복 서열(RS)을 pGEM T easy 벡터(Promega)에 클로닝하였다. 하기 표 1에 기재된 프라이머쌍으로 PCR을 수행하여 야로위아 리폴리티카 게놈 DNA로부터 표 2에 기재된 각각의 표적 유전자의 5'- 및 3'- 플랭킹 영역을 증폭시켰다.
이름 프라이머 염기서열 (5'-> 3') 서열번호
pop-out vector cloning HisG1-BglII F aattgggcccagatctcagaccggttcagacaggat 38
HisG1-EcoRI R tctctgggcggaattcggaggtgcggatatgaggta 39
HisG1-NotI F tgtttctcggcggccgccagaccggttcagacaggat 40
HisG1-BamHI R tccaacgcgtggatccggaggtgcggatatgaggta 41
HisG2-BglII F aattgggcccagatctaacgctacctcgaccagaaa 42
HisG2-EcoRI R tctctgggcggaattctcttctcgatcggcagtacc 43
HisG2-NotI F tgtttctcggcggccgcaacgctacctcgaccagaaa 44
HisG2-BamHI R tccaacgcgtggatcctcttctcgatcggcagtacc 45
HisG3-BglII F aattgggcccagatctgtgatctgacgcctgatgg 46
HisG3-EcoRI R tctctgggcggaattctcagggtattgaagctcatgg 47
HisG3-NotI F tgtttctcggcggccgcgtgatctgacgcctgatgg 48
HisG3-BamHI R tccaacgcgtggatcctcagggtattgaagctcatgg 49
glt1-BglII F aattgggcccagatcttcagaacttgcgccgataaa 50
glt1-EcoRI R tctctgggcggaattcctttgccagctagaccatagag 51
glt1-NotI F tgtttctcggcggccgctcagaacttgcgccgataaa 52
glt1-BamHI R tccaacgcgtggatccctttgccagctagaccatagag 53
glt2-BglII F aattgggcccagatctattggcgggttcgttactt 54
glt2-EcoRI R tctctgggcggaattccctggaagaaggccgtattatc 55
glt2-NotI F tgtttctcggcggccgcattggcgggttcgttactt 56
glt2-BamHI R tccaacgcgtggatcccctggaagaaggccgtattatc 57
ACO1 deletion POX1-F1 ttcctcaatggtggagaaga 58
POX1-R1 tctttatcctgtctgaaccggtctggtaccatagtccttgccatgc 59
POX1-F2 atcgctacctcatatccgcacctcccttctgtcccccgagtttct 60
POX1-R2 aagaagggcttgagagtcg 61
ACO2 deletion POX2-F1 cccaacaacactggcac 62
POX2-R1 tctttatcctgtctgaaccggtctgctcctcatcgtagatggc 63
POX2-F2 atcgctacctcatatccgcacctccgacaagacccgacaggc 64
POX2-R2 agaccagagtcctcttcg 65
ACO3 deletion POX3-F1 accttcacagagccaccca 66
POX3-R1 atggctctctgggcggtgttgggggtgttgatgatg 67
POX3-F2 ttgttgtgtttctcgcaaggttctcatcgaggcctg 68
POX3-R2 aggaaaggtcgaagagtgctct 69
ACO4 deletion POX4-F1 actgcgagagcgatctg 70
POX4-R1 tctttatcctgtctgaaccggtctgttcatgagcatgtagtttcg 71
POX4-F2 atcgctacctcatatccgcacctccgaggacgacaaagccggag 72
POX4-R2 agagcagagtcctcctcaa 73
ACO5 deletion POX5-F1 aacttcctcacaggcagcgagc 74
POX5-R1 atggctctctgggcggagtagagagtgggagttgaggtc 75
POX5-F2 ttgttgtgtttctcgccccgtcaaggacgctgag 76
POX5-R2 acagtaaggtggggcttgactc 77
ACO6 deletion POX6-F1 agtccctcaacacgtttaccg 78
POX6-R1 tctttatcctgtctgaaccggtctgccatttagtggcagcaacgtt 79
POX6-F2 atcgctacctcatatccgcacctccgagctctgatcaaccgaacc 80
POX6-R2 aggaagggtctaatgacaga 81
FALDH1 deletion FALDH1-F1 aatcactcctcctacgc 82
FALDH1-R1 tctttatcctgtctgaaccggtctgtggtctcggggacacctc 83
FALDH1-F2 atcgctacctcatatccgcacctccccatcatcaagccccgaa 84
FALDH1-R2 accgacataatctgagcaat 85
FALDH2 deletion FALDH2-F1 accactaggtgagatcgag 86
FALDH2-R1 tctttatcctgtctgaaccggtctgctccgacactaccggaacgc 87
FALDH2-F2 atcgctacctcatatccgcacctcccttgctcccacagttgtt 88
FALDH2-R2 gatcacccagaaccatagc 89
FALDH3 deletion FALDH3-F1 gtgacccccaccacgtcac 90
FALDH3-R1 tctttatcctgtctgaaccggtctgttctgacattttcagcgccac 91
FALDH3-F2 atcgctacctcatatccgcacctccccattacgagcgtttgacgg 92
FALDH3-R2 cagggctggggaccacc 93
FALDH4 deletion FALDH4-F1 taccgactggaccagattc 94
FALDH4-R1 tctttatcctgtctgaaccggtctgcggcagtggcaatgatcttac 95
FALDH4-F2 atcgctacctcatatccgcacctccgactcgattcatcgctcctac 96
FALDH4-R2 caaatctttcggaagattcgg 97
FAO deletion FAO-F1 atcattgtcggtggaggaac 98
FAO-R1 acgcctttctggtcgaggtagcgttgcgtagtcgtaaggctggac 99
FAO-F2 attctggtactgccgatcgagaagaccgtcatcggtgagattctt 100
FAO-R2 attcgaggtcggagatcctt 101
ADH1 deletion ADH1-F1 cccagaaggctgtcattttc 102
ADH1-R1 acgcctttctggtcgaggtagcgtttcgcagttcttggggatatg 103
ADH1-F2 attctggtactgccgatcgagaagagccgacaaggagaagatgtg 104
ADH1-R2 caatcttgccctcctccat 105
ADH2 deletion ADH2-F1 ccagaagggtgtcatcttcg 106
ADH2-R1 acgcctttctggtcgaggtagcgttatcgcagttcttgggaatgt 107
ADH2-F2 attctggtactgccgatcgagaagaccgacaaggagaagatgtgc 108
ADH2-R2 caatcttgccctcctccata 109
ADH3 deletion ADH3-F1 agaaagccgtcatcttcgag 110
ADH3-R1 ttgcacaagtaacgaacccgccaattcacagttcttggggatgtg 111
ADH3-F2 ggagataatacggccttcttccagggctgacaaggagaagatgtgc 112
ADH3-R2 acttggagcagtccagaacg 113
ADH4 deletion ADH4-F1 gtcaaaacgtcgacgaacct 114
ADH4-R1 aggtatttatcggcgcaagttctgaggcttgaggtcaatgtcgat 115
ADH4-F2 ctcctctatggtctagctggcaaaggacatggaggcccactctaa 116
ADH4-R2 agtactcccaagcgtcctca 117
ADH5 deletion ADH5-F1 gagagccgctttcaccac 118
ADH5-R1 aggtatttatcggcgcaagttctgaagagcctggtaggcagtgag 119
ADH5-F2 ctcctctatggtctagctggcaaagttccaggacgtgatcaagga 120
ADH5-R2 taaggatgatcttgccggtag 121
ADH6 deletion ADH6-F1 gacccagaaagccattgtgt 122
ADH6-R1 aggtatttatcggcgcaagttctgaagccacctgagaaaggtctg 123
ADH6-F2 ctcctctatggtctagctggcaaagcaccgaggagaaggagaaga 124
ADH6-R2 tccctcctccatcaaggtaa 125
ADH7 deletion ADH7-F1 gacgttcccaagacacaaaag 126
ADH7-R1 aggtatttatcggcgcaagttctgaaggcgtactgctggaaagag 127
ADH7-F2 ctcctctatggtctagctggcaaagacccacaccaaggagctg 128
ADH7-R2 caacgacacgaccaacaatc 129
ADH8 deletion ADH8-F1 atcgcgccaacttgtttaat 130
ADH8-R1 aggtatttatcggcgcaagttctgacaccttctctcgtgggatgt 131
ADH8-F2 ctcctctatggtctagctggcaaagtgtgttgagtctggcaaagc 132
ADH8-R2 tcaagtccatggcatcaaac 133
FADH deletion FADH-F1 ccgaaggaaagaccatcact 134
FADH-R1 ttgcacaagtaacgaacccgccaatagaaggaagagcagcccata 135
FADH-F2 ggagataatacggccttcttccagggcttgggcttacaagtttgg 136
FADH-R2 tcggtgaaggcagagttgat 137
ALK1 deletion ALK1-F1 gtctttctgctagcctac 138
ALK1-R1 acgcctttctggtcgaggtagcgttgaagagctcttgggcatcaaag 139
ALK1-F2 attctggtactgccgatcgagaagactacctgcgatacgttc 140
ALK1-R2 gagccttggtggtcttg 141
ALK2 deletion ALK2-F1 cgttttggccgttgc 142
ALK2-R1 acgcctttctggtcgaggtagcgttgttgttgggaattcgc 143
ALK2-F2 attctggtactgccgatcgagaagagcgagtacctgcgatttg 144
ALK2-R2 gcgttaatgagcttctcg 145
ALK3 deletion ALK3-F1 gctcgaaatactgattggag 146
ALK3-R1 acgcctttctggtcgaggtagcgttcgcccttgaagttgtctacac 147
ALK3-F2 attctggtactgccgatcgagaagagcagtgtgagtacctgcgttatg 148
ALK3-R2 tcaactaactactgtaccctc 149
ALK4 deletion ALK4-F1 gaccaatcttacgatcgtgc 150
ALK4-R1 acgcctttctggtcgaggtagcgttctgcatgagtctttcg 151
ALK4-F2 attctggtactgccgatcgagaagactcaagaagctgcgagctg 152
ALK4-R2 cttcatcgacacccaaac 153
ALK5 deletion ALK5-F1 caactctttggcgtcc 154
ALK5-R1 acgcctttctggtcgaggtagcgttgagtgagtcgagtcgag 155
ALK5-F2 attctggtactgccgatcgagaagagctccgaagtgctattc 156
ALK5-R2 catcttgacccaaacacc 157
ALK6 deletion ALK6-F1 cttggccttggccattc 158
ALK6-R1 acgcctttctggtcgaggtagcgttccttcttgatggtcttgaaaag 159
ALK6-F2 attctggtactgccgatcgagaagaggtgatactcccgacgaattg 160
ALK6-R2 ctactccatcttcaaccaaac 161
ALK7 deletion ALK7-F1 cgatactggtgctggctttc 162
ALK7-R1 acgcctttctggtcgaggtagcgttctcttgcaaactgaggacg 163
ALK7-F2 attctggtactgccgatcgagaagacgactacctgcgatacgtg 164
ALK7-R2 ctcctggtgacacagagtc 165
ALK8 deletion ALK8-F1 ctgatcatccccattacgctc 166
ALK8-R1 cagcgccatcaggcgtcagatcacgtttcaagggaagacaaggg 167
ALK8-F2 gaccatgagcttcaataccctgactgactttgggaccagcac 168
ALK8-R2 gactcatggtgatatggg 169
ALK9 deletion ALK9-F1 cagcttccatcttccccggttc 170
ALK9-R1 cagcgccatcaggcgtcagatcacgctcgagagtgttgccatc 171
ALK9 amplification ALK9-F agcaataggaaagcttatgctgggaagaactctc 172
ALK9-R ggatccgcaattaacactagttcttcttgtacaac 173
ALK10 amplification ALK10-F agcaataggaaagcttatgattctactctacgtcc 174
ALK10-R ggatccgcaattaacatcacggtaagttatttgtgc 175
ALK11 amplification ALK11-F agcaataggaaagcttatgctcttaccactgcttt 176
ALK11-R ggatccgcaattaacatcacttgacccgaatcctc 177
ALK12 amplification ALK12-F agcaataggaaagcttatgctcgaaatactgattg 178
ALK12-R ggatccgcaattaacatcaactaactactgtaccc 179
경로 효소 유전자 GenBank accession No. 서열번호
ω-Oxidation pathway Cytochrome P450 ALK1 YALI0E25982g 1
ALK2 YALI0F01320g 2
ALK3 YALI0A20130g 3
ALK4 YALI0B13816g 4
ALK5 YALI0B13838g 5
ALK6 YALI0B01848g 6
ALK7 YALI0A15488g 7
ALK8 YALI0C12122g 8
ALK9 YALI0B06248g 9
ALK10 YALI0B20702g 10
ALK11 YALI0C10054g 11
ALK12 YALI0A20130g 12
Alcohol dehydrogenase ADH1 YALI0D25630g 13
ADH2 YALI0E17787g 14
ADH3 YALI0A16379g 15
ADH4 YALI0E15818g 16
ADH5 YALI0D02167g 17
ADH6 YALI0A15147g 18
ADH7 YALI0E07766g 19
ADH8 YALI0C12595g 20
FADH YALI0F09603g 21
Fatty-alcohol oxidase FAO YALI0B14014g 22
Fatty aldehyde dehydrogenase FALDH1 YALI0A17875g 23
FALDH2 YALI0E15400g 24
FALDH3 YALI0B01298g 25
FALDH4 YALI0F23793g 26
β-Oxidation pathway Acyl-CoA oxidase ACO1 YALI0E32835g 27
ACO2 YALI0F10857g 28
ACO3 YALI0D24750g 29
ACO4 YALI0E27654g 30
ACO5 YALI0C23859g 31
ACO6 YALI0E06567g 32
녹-아웃 및 팝-아웃 카세트에 대한 상동성 영역을 PCR 중첩에 의해 수득하고, 이 분절 단편을 야로위아 리폴리티카에 형질전환시켰다. 이어서, Boeke et al.(1984)의 방법에 따라 5-플루오로 오로틱산(5-FOA) 선택 및 우라실 마커 구출을 수행하였다. 상기 표 1에 기재된 프라이머쌍을 이용하여 게놈 DNA를 주형으로 하여 PCR을 수행함으로써 표적 유전자가 제대로 녹-아웃되었는지 확인하였다. 유전자 DNA 추출 키트(Gene all biotechnology, Korea)를 이용하여 게놈 DNA를 얻었다. Prime star DNA 중합 효소(Takara, Japan)를 갖는 Biometra T3000 열 순환기를 PCR 증폭에 사용하였다. 증폭된 단편을 QIAgen 정제 키트(Qiagen, Germany)로 정제하고, DNA 단편을 QIAquick 겔 추출 키트(Qiagen, Germany)를 사용하여 아가로스겔로부터 회수하였다.
1-3. 모노옥시게나아제 발현 벡터의 구축
플라스미드 pGEM-T-easy 벡터(Promega, USA)를 야로위아 리폴리티카에서 발현 벡터의 골격으로 사용하였다. 선별 마커로서 사용된 URA3 유전자를 프라이머 세트 YlURA3 1F Kpn 및 YlURA3 2B Spe를 사용하여 PCR에 의해 야로위아 리폴리티카 Po1g 균주의 게놈 DNA (gDNA)로부터 증폭시켰다. PCR 생성물을 KpnI/SpeI로 분해하고 KpnI 및 SpeI로 분해된 pGEM-T-easy 벡터에 삽입하였다. 생성된 플라스미드를 pYIGEM_URA3으로 지정하였다. TEF 프로모터 및 자율 복제 서열(GenBank no. X68252) 모두 프라이머 세트 Y1TEFp sph 1F / YlTEFp Nde Hind 2R 및 Y1ARS1 1K Kpn Hind / YlARS1 2R Nco를 사용하여 야로위아 리폴리티카 Po1g 균주의 gDNA로부터 증폭시켰다. 각기　수득된 PCR 생성물을 TEF 프로모터의 경우 SphI / HindIII, ARS의 경우 HindIII / NcoI로 분해하였다; 2 개의 분해된 단편을 SphI / NcoI 분해된 pYIGEM_URA3으로 라이게이션하였다. 생성된 플라스미드를 pYIGEM로 지정하였다(도 3). 야로위아 리폴리티카에서 각각의 ALK 유전자의 오픈 리딩 프레임(ORF)을 ALKX_AF1 / ALKX_AR1 및 ALKX_AF2 / ALKX_AR2 프라이머를 사용하여 PCR을 통해 야로위아의 게놈 DNA로부터 증폭시켰다(표 2). 각 ALK의 증폭된 단편을 HindIII 및 BamHI로 분해하고, 분해된 단편을 pYIGEM의 HindIII 및 BamHI 사이에 삽입 하였다. 각각의 결과 발현 벡터를 pYIGEM_ALK_X로 지정 하였다(표 3).
야로위아 리폴리티카에서 박테리아 CYP153A 모노옥시게나아제에 대한 발현 벡터를 구축하기 위해, ALK1의 ER 막 고정을 위한 서열 (atgtccaacgccctcaacctgtcgctggcgctcggcgtctttctgctagcctactatggcttctccgtgatccagtaccgcatcaaaacccgcaagctcgaaaagaagtggaagtgtggtaagcccaaggatatttcacgattc: 서열번호 180)을 정렬(align) PCR에 의해 박테리아 CYP153A 모노옥시게나아제의 N-말단에 융합시켰다. 융합된 유전자를 HindIII 및 BamHI로 분해하고, 분해된 단편을 pYIGEM의 HindIII 및 BamHI 사이에 삽입 하였다. 각각의 결과 제조된 발현 벡터를 pYIGEM_CYP153_X로 지정하였다(표 3).
발현 벡터 설명
pYUHisG1 pGEM T easy derivative, URA3 [a] maker, HisG1 [b] pop-out cassette
pYUHisG2 pGEM T easy derivative, URA3 maker, HisG2 [b] pop-out cassette
pYUGlt2 pGEM T easy derivative, URA3 maker, Glt2 [c] pop-out cassette
pYUGlt3 pGEM T easy derivative, URA3 maker, Glt3 [c] pop-out cassette
pYIGEM pGEM T easy derivative, TEF [d] promoter, URA3 maker, ARS [e]
pYIALK_1 pYIEGM derivative, ALK1
pYIALK_2 pYIEGM derivative, ALK2
pYIALK_3 pYIEGM derivative, ALK3
pYIALK_4 pYIEGM derivative, ALK4
pYIALK_5 pYIEGM derivative, ALK5
pYIALK_6 pYIEGM derivative, ALK6
pYIALK_7 pYIEGM derivative, ALK7
pYIALK_8 pYIEGM derivative, ALK8
pYIALK_9 pYIEGM derivative, ALK9
pYIALK_10 pYIEGM derivative, ALK10
pYIALK_11 pYIEGM derivative, ALK11
pYIALK_12 pYIEGM derivative, ALK12
pYICYP153_13 pYIEGM derivative, Actinobacter sp.-derived CYP153A13 [f]
pYICYP153_33 pYIEGM derivative, Marinobacter aquaeolei VT8-derived CYP153A33 [f]
[a] URA3: 야로위아 리폴리티카에서 오로티딘 5'-인산 디카르복실라아제(orotidine 5’-phosphate decarboxylase)를 암화화하는 유전자
[b] HisG1 및 HisG2: 살모넬라 티피무리움에서 ATP 포스포리보실트랜스퍼라아제(ATP phosphoribosyltransferase)를 암호화하는 유전자
[c] Glt1 및 Glt2: 바실러스 서브틸리스에서 글루탐산 합성효소(glutamate synthase)를 암호화하는 유전자
[d] 야로위아 리폴리티카에서 번역연장인자(Translation elongation factor) EF-1α (Genebank accession no. YALI0C09141p)
[e] ARS: autonomous replicating sequence (Genbank no. X68252)
[f] Actinobacter sp. 유래의 CYP153A13와 Marinobacter aquaeolei VT8 유래의 CYP153A의 N-말단에 ALK1을 앵커링(anchoring)하는 ER 막의 서열을 융합시켰다.
1-4. 재조합 균주의 배양
배양 테스트할 균주를 전날 3 ㎖ YPD 배지(Bacto Laboratories, Yeast extract 10g/L, Bacto peptone 20g/L, glucose 20g/L)에 접종하여 30℃에서 200rpm으로 하루 동안 키웠다. 이어서, 전배양한 배양액 1 mL를 100mL의 성장기 배지(50 g/L glucose, 10 g/L yeast extract, 6.7 g/L yeast nitrogen base w/o amino acids (YNB), 5 g/L (NH4)2SO4, 0.05 g/L uracil, and 0.1 M potassium phosphate buffer pH 6.0) 를 함유하는 1L baffled 플라스크에 넣고, 플레이트 교반기에서 30℃ 200 rpm으로 하루 동안 배양하였다. 600 nm에서 세포 밀도가 대략 40에 도달할 때 (OD 600), 성장기 배지에서 배양한 배양액 50 mL를 전환기 배지(30 g/L glucose, 3 g/L yeast extract, 6.7 g/L YNB w/o amino acids, 5 g/L (NH4)2SO4, 0.05 g/L uracil, 0.1 M potassium phosphate buffer pH 7.6) 50 mL를 함유하는 250mL baffled 플라스크에 넣어, 30℃에서 200 rpm으로 하루 또는 이틀 동안 배양하였다. 이때, 기질로는 0.05% tween 80에 용해된 n-도데칸 또는 1-도데칸올 1~10 g/L를 사용하였다.
1-5. 시료의 분석 방법
600 nm의 흡광도에서 UV 분광 광도계(Uvikon XL, France Secomam)를 사용하여 바이오매스를 측정하였다. 기판 및 생성물은 70eV에서 작동되는 4 중 극자 전자 선택 이온화 검출기(EI)가 장착된 가스 크로마토그래피-질량 분석 시스템(GC-MS)에 의해 식별되고 정량화되었다. Agilent HP-5MS 컬럼(길이 30m, 내경 0.25mm 및 필름 두께 0.25μm)을 10:1 분할 비율로 사용하였다. 캐리어 가스로서 헬륨을 사용하였고, 오븐 온도는 150℃ 내지 172℃ 범위였다. 산-처리 배양 배지 및 동등한 부피의 클로로포름을 사용하여 GC-MS 분석을 위한 기질 및 생성물의 추출을 수행하였다. 시알릴화를 위해, N, O- 비스 (트리메틸 실릴) 트리 플루오로 아세트 아미드(BSTFA)를 추출된 샘플(1:2, v/v)에 첨가하고, 혼합물을 60℃에서 20분 동안 배양하였다. 내부 표준으로서 테트라데칸이 사용되었다.
2. 실험 결과 및 고찰
2-1. 녹-아웃 균주의 제작
ω-산화 및 β-산화의 각 단계에는 여러 유전자가 관여한다.　따라서, 소수성 기질로부터 α,ω-디올의 생산에 적합한 야로위아 리폴리티카 균주를 조작하는 것은 게놈 전체 변형을 수반하였다. 야로위아 리폴리티카에서, 비 동종 말단 결합(NHEJ)은 DNA에서 이중 가닥 파괴를 복구하기 위해 상동 재조합(HR)보다 많이 사용된다. HR 효율성을 개선하기 위해 NHEJ 기반 이중 가닥 파손(DSB) 복구를 담당하는 KU70 유전자를 파괴한 다음 선별 마커로 사용되는 URA3 유전자와 함께 2 분자 PCR 기반 유전자 표적화 방법을 사용했다. 표적 유전자를 제거하기 위해 사용된 2 분자 결실 카세트를 URA3 스플릿 마커 재조합을 통해 게놈에 부위 특이적으로 삽입하였다. 삽입 부위는 PCR을 통해 확인하였고. 이어서 5'-FOA 플레이트의 선택을 통한 URA3의 팝-아웃을 수행하였다. 이 전략을 통해 무한한 수의 유전자를 녹-아웃시키고 ω-산화 경로/β-산화 경로가 조작된 다양한 균주의 구성이 가능하였다(도 4).
그 결과, 야생형 야로위아 리폴리티카 균주에 존재하는 시토크롬 p450 모노옥시게나아제 유전자(ALK1~12)를 비롯하여, ω-산화 대사 경로에 관여하는 지방 알코올 디하이드로게나아제 유전자(ADH1~8, FADH), 지방 알코올 옥시다아제 유전자(FAO), 지방 알데히드 디하이드로게나아제 유전자(FALDH1~4)와, β-산화 대사 경로에 관여하는 아실-CoA 옥시다아제 유전자(ACO1~6)의 일부 또는 전부가 녹-아웃된 총 9종의 재조합 미생물을 제작하였다(표 4 및 도 4).
개발균주 특징
YID01 MatA, leu2-270, ura3-302::△ura3△ku70△aco1-6::URA3
YID02 MatA, leu2-270, ura3-302::△ura3△ku70△aco1-6△faldh1-4::URA3
YID03 MatA, leu2-270, ura3-302::△ura3△ku70△aco1-6△faldh1-4△fao::URA3
YID04 MatA, leu2-270, ura3-302::△ura3△ku70△aco1-6△faldh1-4△fao△adh1-8::URA3
YID05 MatA, leu2-270, ura3-302::△ura3△ku70△aco1-6△faldh1-4△fao△adh1-8△fadh::URA3
YID06 MatA, leu2-270, ura3-302::△ura3△ku70△aco1-6△faldh1-4△fao△adh1-8△fadh△alk3::URA3
YID07 MatA, leu2-270, ura3-302::△ura3△ku70△aco1-6△faldh1-4△fao△adh1-8△fadh△alk6::URA3
YID08 MatA, leu2-270, ura3-302::△ura3△ku70△aco1-6△faldh1-4△fao△adh1-8△fadh△alk3△alk6::URA3
YID09 MatA, leu2-270, ura3-302::△ura3△ku70△aco1-6△faldh1-4△fao△adh1-8△fadh△alk1-12::URA3
2-2. 효모 기반의 중쇄-디올 생합성 플랫폼의 개발
먼저, ω-산화를 통해 생성된 대사 산물의 분해를 막기 위해, 아실-CoA 옥시다아제를 암호화하는 6개의 유전자(ACO1-6)를 녹-아웃시킴으로써 야로위아 리폴리티카에서 β-산화 대사 경로를 차단하였다(YID01 균주). 상기 YID01 균주는 이작용성 화학 물질과 소수성 기질을 유일한 탄소원으로 이용할 수 없었다. 이러한 특성 덕분에 YID01 균주를 α,ω-디올의 생산을 위한 기준 변이체로 사용할 수 있었다.
배양 배지에서 α,ω-디올을 축적할 수 있는 균주를 개발하기 위해, ω-산화 대사 경로에 관여하여 알데히드기를 카르복실기로 산화시키는 지방 알데히드 디하이드로게나아네를 암호화하는 4개의 유전자(FALDH1-4)를 녹-아웃시킴으로써 YID02 균주를 제작하였다.
다음으로, 상기 YID02 균주의 게놈에서 1개의 지방 알코올 옥시다아제를 암호화하는 유전자(FAO1), 4개의 지방 알코올 디하이드로게나아네를 암호화하는 유전자(FADH1-4) 및 9개의 지방 알코올 디하이드로게나아네를 암호화하는 유전자(ADH1-8, FADH)를 각각 순차적으로 녹-아웃시켜 YID03 균주, YID04 균주 및 YID05 균주를 제작하였다(도 5의 (a)). 상기와 같이 제작된 YID03 균주, YID04 균주 및 YID05 균주는 n-도데칸 또는 1-도데칸올로부터 각각 1,12-도데칸디올을 생산하였으며(도 5의 (b) 및 (c)), 이는 GC-MS를 통해 확인되었다(도 6: n-도데칸은 4.47ㅁ0.38, 10.91ㅁ1.13, 및 11.1ㅁ1.33, 1-도데칸올은 3.10ㅁ0.58, 6.14ㅁ0.73, 및 9.62ㅁ0.98 mg/L). 흥미롭게도, 지방 알코올 옥시다아제 유전자(FAO)가 녹-아웃된 균주들에서 비로소 α,ω-디올이 생산되었고, 이는 지방 알코올 옥시다아제(FAO)가 α,ω-디올의 생성에 중요한 역할을 한다는 것을 나타낸다.
한편, 아실-CoA 옥시다아제 유전자(ACO1-6), 지방 알코올 옥시다아제 유전자(FAO), 지방 알코올 디하이드로게나아제 유전자(FADH1-4) 및 지방 알코올 디하이드로게나아제 유전자(ADH1-8, FADH)를 녹-아웃시켰음에도 불구하고, 1,12-도데칸이산 및 ω-하이드록시도데칸산을 포함하는 과산화 생성물은 총 산화된 생성물의 90% 이상으로 생성되었다(도 5의 (b)). 이 결과는 야로위아 리폴리티카에 n-알칸의 말단이 내인성 모노옥시게나아제에 의해 산화 된 후에 추가적인 산화를 계속할 수 있는 다른 효소(들)이 존재함을 시사한다.
2-3. 효모의 내인성 모노옥시게나아제 유전자의 결실
야로위아 리폴리티카는 CYP52 계열에 속하는 12개의 모노옥시게나아제(ALK1-12)를 보유하고 있다. 먼저, ALK3 및 ALK6와 같은 주요 모노옥시게나아제가 과산화물을 생성한다고 가정하였다. ALK3 및 ALK6는 n-알칸의 지방산으로의 과산화에 깊이 관여하기 때문에 선택되었다(도 7의 (a)). ALK3 유전자 및 ALK6 유전자의 녹-아웃이 과산화물의 생성에 어떻게 영향을 미치는지를 확인하기 위하여, YID05 균주를 대상으로 ALK3 유전자, ALK6 유전자 및 이들 두 유전자 모두가 녹-아웃된 재조합 미생물을 제작하였고, 이들을 각각 YID06, YID07 및 YID08이라고 명명하였다(도 7의 (b)).
상기 세 재조합 미생물 YID06 내지 YID08은, 도 7의 (c)에 나타낸 바와 같이, n-도데칸으로부터 1,12-도데칸디올로의 생산성이 향상된 것으로 확인되었다. 특히, 상기 YID08 군주를 함유하는 플라스크에서 1,12-도데칸이산의 양은 약 28% 감소된 반면, n-도데칸으로부터 생성된 1,12-도데칸디올의 양은 약 60% 증가되었다. 그러나, 부산물인 과산화물은 여전히 총 산화 생성물의 90%를 초과하여 생성되었다.
2-4. 내인성 모노옥시게나아제 유전자의 종류에 따른 과산화 활성 확인
상기 제작된 YID05 균주에서 12개의 모든 ALK 유전자들을 녹-아웃시켜 YID09 균주를 제작하였다(도 8의 (a)). 그리고 각각의 ALK를 발현시키기 위하여, 각각의 ALK 유전자가 TEF1 프로모터에 의해 제어되는 발현 벡터를 구축하여, 상기 YID09 균주에 각각 형질전환시켰다. 각각의 ALK를 발현하는 개별 균주를 플라스크에서 n-도데칸과 함께 배양시켰고, 그 배양물에서 1,12-도데칸디온산(1,12-DDDA), 12-히드록시도데칸산(12-HDA), 1-도데칸산(1-DDA) 및 1-도데칸올(1-DO)가 생성된 양을 측정하여 그 결과를 도 8의 (b)에 도시하였다.
도 8의 (b)에 따르면, 다른 ALK들에 비해, ALK8, ALK11 및 ALK12는 n-도데칸의 말단에 대하여 비교적 약한 산화 활성을 나타내는 것으로 확인되었다. 모든 ALK들은 총 생성물의 80% 이상을 나타내는 과산화된 생성물의 생성하였고, 모든 ALK들이 알칸이 대사되는 동안 지방 알코올 및 ω-알데히드 지방산의 산화에 관여했음을 알 수 있다. ALK1 및 ALK2에 의해 생성된 1,12-도데칸디온산은 총 생성물의 70%인 반면, ALK3, ALK6, ALK9 및 ALK10에 의해 생성된 1,12-도데칸디오산은 총 생성물의 45~60%의 범위에 있었다. ALK4 및 ALK7은 각각 47.4% 및 44.2%의 12-히드록시도데칸산과 32.3% 및 10.81%의 1-도데칸산을 생성하였다. ALK들 중 어느 것도 1,12-도데칸디올을 생성하지는 못했지만, 1-도데칸올의 생성량은 전체의 4%에 불과했다. 일단 ALK들에 의해 1-도데칸올이 생성되면, 1-도데칸올의 1-도데칸산으로의 연속 산화 활성이 반대쪽 말단의 탄소에 대한 산화 활성보다 더 높은 것으로 사료된다.
이로부터, 상기 ALK들은 n-알칸으로부터 α,ω-디올을 높은 수율로 생산하는데 어느 정도 장애가 있음을 알 수 있다.
2-5. 효모에 외인성 박테리아 모노옥시게나아제의 도입
박테리아 클래스 I P450에 속하는 CYP153A 모노옥시게나아제는 포화 및 불포화 지방산 및 알칸의 ω-산화를 촉매한다. 야로위아 리폴리이카에서 n-알칸으로부터 α,ω-디올의 생산에 대한 CYP153A의 효과를 확인하기 위하여, CYP153A13A.sp 및 CYP153A33M.aq에 대한 발현 벡터를 구축했다. 구축된 벡터에서 CYP153A13A.sp 및 CYP153A33M.aq 모노옥시게나아제를 암호화하는 유전자는 ER 막 고정 ALK1 유전자의 서열에 융합되었다. 융합된 유전자는 구성적 TEF1 프로모터에 의해 제어되었다. 발현 벡터를 상기 YID09 균주에 도입하고(도 9의 (a)), 형질전환체를 플라스크에서 n-도데칸과 함께 배양하였고, 그 배양물에서 1,12-도데칸디온산(1,12-DDDA), 12-히드록시도데칸산(12-HDA), 1-도데칸산(1-DDA), 1-도데칸올(1-DOL) 및 1,12-도데칸디올(1,12-DIO)이 생성된 양을 측정하여 그 결과를 도 9의 (b) 및 (c)에 도시하였다. 야로위아 리폴리티카의 내인성 CPRb는 CYP153A13A.sp와 CYP153A33M.aq의 환원 효소 파트너로 사용되었다.
그 결과, 도 9b 및 9c에 도시된 바와 같이, CYP153A13A.sp와 CYP153A33M.aq 모두 YID05 균주(11.1 mg/L)에 비해 훨씬 높은 수준으로 1,12-도데칸디올을 생성 하는 것으로 확인되었다(도 9의 (b) 및 (c)).
2-6. 효모에 다양한 박테리아 모노옥시게나아제의 도입
다른 종류의 박테리아의 모노옥시게나아제를 사용하였을 때에도 n-알칸으로부터 중쇄 α,ω-디올을 높은 수준으로 생산할 수 있는지 확인하고자 하였다.
구체적으로, CYP153A13A.sp, CYP153A33M.aq, nfa22290, nfa22930과 nfa33510에 대한 발현 벡터를 구축한 후, 각 발현 벡터를 상기 YID09 균주에 도입한 후 형질전환체를 n-도데칸과 함께 배양하였고, 그 배양물에서 1,12-도데칸디온산(1,12-DDDA), 12-히드록시도데칸산(12-HDA), 1-도데칸산(1-DDA), 1-도데칸올(1-DOL) 및 1,12-도데칸디올(1,12-DIO)이 생성된 양을 측정하여 그 결과를 도 10의 (a) 및 (b)에 도시하였다.
효소 유전자 박테리아 균주 서열번호
Cytochrome P450
monooxygenase		 CYP153A13 M.aquaeolei 33
CYP153A33 Alcanivorax borkumensis 34
nfa22930 (CYP154) Nocardia farcinica 35
nfa33510 (CYP151A) Nocardia farcinica 36
nfa22290 (CYP140A) Nocardia farcinica 37
그 결과, 내인성 모노옥시게나아제를 가지는 YID05 균주에 비해, 상기 내인성 모노옥시게나아제 유전자가 녹-아웃되고 외인성 모노옥시게나아제 유전자가 도입된 모든 재조합 미생물에서 과산화 활성이 낮은 것으로 확인되었고(도 10의 (a)), 1,12-도데칸디올이 더 높은 수준으로 생성되는 것으로 확인되었다(도 10의 (b)). 특히, 내인성 모노옥시게나아제 유전자를 녹-아웃시키고 외인성 CYP153AM.aq 유전자를 도입한 재조합 미생물은 내인성 모노옥시게나제를 그대로 포함하는 YID05 균주에 비해 1,12-도데칸디올을 160배 더 많이 생산하는 것으로 확인되었다(도 10의 (b)).
상기에서는 본 발명의 바람직한 실시예를 예시적으로 설명하였으나, 본 발명의 범위는 상기와 같은 특정 실시예에만 한정되지 아니하며, 해당 분야에서 통상의 지식을 가진 자라면 본 발명의 특허청구범위에 기재된 범주 내에서 적절하게 변경이 가능할 것이다.

Claims (16)

  1. 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물에서, 상기 ω-산화 대사 경로에 관여하는 지방 알코올 옥시다아제의 일부 또는 전부의 활성이 감소 또는 상실되고, 상기 β-산화 대사 경로에 관여하는 아실-CoA 옥시다아제의 일부 또는 전부의 활성이 감소 또는 상실되며,
    추가적으로 상기 ω-산화 대사 경로에 관여하는 내인성 모노옥시게나아제의 일부 또는 전부의 활성이 감소 또는 상실되고,
    중쇄의 알칸, 1차 알코올 또는 이들의 혼합물로부터 중쇄의 α,ω-디올을 생산할 수 있는 재조합 미생물.
  2. 청구항 1에 있어서,
    상기 지방 알코올 옥시다아제는 서열번호 22의 염기 서열에 의해 암호화되는 FAO인 재조합 미생물.
  3. 청구항 1에 있어서,
    상기 아실-CoA 옥시다아제의 일부 또는 전부는 서열번호 27의 염기 서열에 의해 암호화되는 POX1, 서열번호 28의 염기 서열에 의해 암호화되는 POX2, 서열번호 29의 염기 서열에 의해 암호화되는 POX3, 서열번호 30의 염기 서열에 의해 암호화되는 POX4, 서열번호 31의 염기 서열에 의해 암호화되는 POX5 및 서열번호 32의 염기 서열에 의해 암호화되는 POX6로 이루어진 군에서 선택되는 적어도 하나인 재조합 미생물.
  4. 청구항 1에 있어서,
    상기 재조합 미생물은 추가적으로 상기 ω-산화 대사 경로에 관여하는 지방 알코올 디하이드로게나아제의 일부 또는 전부, 또는 상기 ω-산화 대사 경로에 관여하는 지방 알데히드 디하이드로게나아제의 일부 또는 전부의 활성이 감소 또는 상실된 것인 재조합 미생물.
  5. 청구항 4에 있어서,
    상기 지방 알코올 디하이드로게나아제의 일부 또는 전부는 서열번호 13의 염기 서열에 의해 암호화되는 ADH1, 서열번호 14의 염기 서열에 의해 암호화되는 ADH2, 서열번호 15의 염기 서열에 의해 암호화되는 ADH3, 서열번호 16의 염기 서열에 의해 암호화되는 ADH4, 서열번호 17의 염기 서열에 의해 암호화되는 ADH5, 서열번호 18의 염기 서열에 의해 암호화되는 ADH6, 서열번호 19의 염기 서열에 의해 암호화되는 ADH7, 서열번호 20의 염기 서열에 의해 암호화되는 ADH8 및 서열번호 21의 염기 서열에 의해 암호화되는 FADH로 이루어진 군으로부터 선택되는 적어도 하나인 재조합 미생물.
  6. 청구항 4에 있어서,
    상기 지방 알데히드 디하이드로게나아제의 일부 또는 전부는 서열번호 23의 염기 서열에 의해 암호화되는 FALDH1, 서열번호 24의 염기 서열에 의해 암호화되는 FALDH2, 서열번호 25의 염기 서열에 의해 암호화되는 FALDH3, 서열번호 26의 염기 서열에 의해 암호화되는 FALDH4로 이루어진 군에서 선택되는 적어도 하나인 재조합 미생물.
  7. 청구항 1에 있어서,
    상기 내인성 모노옥시게나아제의 일부 또는 전부는 서열번호 1의 염기 서열에 의해 암호화되는 ALK1, 서열번호 2의 염기 서열에 의해 암호화되는 ALK2, 서열번호 3의 염기 서열에 의해 암호화되는 ALK3, 서열번호 4의 염기 서열에 의해 암호화되는 ALK4, 서열번호 5의 염기 서열에 의해 암호화되는 ALK5, 서열번호 6의 염기 서열에 의해 암호화되는 ALK6, 서열번호 7의 염기 서열에 의해 암호화되는 ALK7, 서열번호 8의 염기 서열에 의해 암호화되는 ALK8, 서열번호 9의 염기 서열에 의해 암호화되는 ALK9, 서열번호 10의 염기 서열에 의해 암호화되는 ALK10, 서열번호 11의 염기 서열에 의해 암호화되는 ALK11, 및 서열번호 12의 염기 서열에 의해 암호화되는 ALK12로 이루어진 군에서 선택되는 적어도 하나인 재조합 미생물.
  8. 청구항 1 내지 청구항 7 중 어느 한 항에 있어서,
    상기 재조합 미생물에서 추가적으로 적어도 하나의 외인성 모노옥시게나아제가 도입되어 활성을 나타내고,
    상기 외인성 모노옥시게나아제는 상기 내인성 모노옥시게나아제에 비해 상기 ω-산화 대사 경로 과정에서 발생하는 중간 생성물에 대한 과산화 활성이 낮은 것인 재조합 미생물.
  9. 청구항 8에 있어서,
    상기 외인성 모노옥시게나아제는 박테리아 유래의 시토크롬 P450 효소인, 재조합 미생물.
  10. 청구항 9에 있어서,
    상기 외인성 모노옥시게나아제는 서열번호 33의 염기 서열에 의해 암호화되는 CYP153A13, 서열번호 34의 염기 서열에 의해 암호화되는 CYP153A33, 서열번호 35의 염기 서열에 의해 암호화되는 nfa22930, 서열번호 36의 염기 서열에 의해 암호화되는 nfa33510 및 서열번호 37의 염기 서열에 의해 암호화되는 nfa22290으로 이루어진 군에서 선택되는 적어도 하나인 재조합 미생물.
  11. 청구항 1에 있어서,
    상기 탄화수소의 ω-산화 대사 경로와 β-산화 대사 경로를 모두 가지고 있는 미생물은 효모인 재조합 미생물.
  12. 청구항 11에 있어서,
    상기 효모는 야로위아 속, 사카로마이에스 속, 피키아 속 및 캔디다 속으로 이루어진 군에서 선택되는 어느 하나의 속에 포함되는 것인 재조합 미생물.
  13. 청구항 12에 있어서,
    상기 효모는 야로위아 리폴리티카인 재조합 미생물.
  14. 청구항 1의 재조합 미생물을 중쇄 알칸 및 중쇄 지방 알코올 중 적어도 하나가 공급되는 환경에서 배양하는 단계;를 포함하는 중쇄 디올의 생산 방법으로서,
    상기 중쇄는 탄소수가 5 내지 28인 것인 방법.
  15. 청구항 14에 있어서,
    상기 중쇄는 탄소수 8 내지 16을 갖는 것인 중쇄 디올의 생산 방법.
  16. 청구항 14 내지 청구항 15 중 어느 한 항에 있어서,
    상기 디올은 α,ω-디올인 중쇄 디올의 생산 방법.
PCT/KR2020/017700 2019-12-06 2020-12-04 중쇄 디올을 생산하는 재조합 균주 및 이를 이용한 중쇄 디올의 생산방법 WO2021112641A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0161900 2019-12-06
KR1020190161900A KR102307507B1 (ko) 2019-12-06 2019-12-06 중쇄 디올을 생산하는 재조합 균주 및 이를 이용한 중쇄 디올의 생산방법

Publications (1)

Publication Number Publication Date
WO2021112641A1 true WO2021112641A1 (ko) 2021-06-10

Family

ID=76222606

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/017700 WO2021112641A1 (ko) 2019-12-06 2020-12-04 중쇄 디올을 생산하는 재조합 균주 및 이를 이용한 중쇄 디올의 생산방법

Country Status (2)

Country Link
KR (1) KR102307507B1 (ko)
WO (1) WO2021112641A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150039055A (ko) * 2013-10-01 2015-04-09 삼성전자주식회사 대장균 내에서 1,4-부탄디올의 생합성에 사용되는 효소, 이의 변이체 및 이를 이용한 1,4-부탄디올 생산방법
KR20170049434A (ko) * 2015-10-27 2017-05-10 한국생명공학연구원 중쇄 디올의 생산 방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150039055A (ko) * 2013-10-01 2015-04-09 삼성전자주식회사 대장균 내에서 1,4-부탄디올의 생합성에 사용되는 효소, 이의 변이체 및 이를 이용한 1,4-부탄디올 생산방법
KR20170049434A (ko) * 2015-10-27 2017-05-10 한국생명공학연구원 중쇄 디올의 생산 방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DANIEL SCHEPS, SUMIRE HONDA MALCA, SVEN M. RICHTER, KAROLINE MARISCH, BETTINA M. NESTL, BERNHARD HAUER: "Synthesis of ω-hydroxy dodecanoic acid based on an engineered CYP153A fusion construct", MICROBIAL BIOTECHNOLOGY, 1 August 2013 (2013-08-01), pages n/a - n/a, XP055115867, ISSN: 17517915, DOI: 10.1111/1751-7915.12073 *
DATABASE NUCLEOTIDE 6 June 2017 (2017-06-06), ANONYMOUS: "Yarrowia lipolytica CLIB122 YALI0F01320p partial mRNA", XP055818655, retrieved from NCBI Database accession no. XM_504857 *
FICKERS, P. ; BENETTI, P.H. ; WACHE, Y. ; MARTY, A. ; MAUERSBERGER, S. ; SMIT, M.S. ; NICAUD, J.M.: "Hydrophobic substrate utilisation by the yeast Yarrowia lipolytica, and its potential applications", FEMS YEAST RESEARCH, WILEY-BLACKWELL PUBLISHING LTD., GB, NL, vol. 5, no. 6-7, 1 April 2005 (2005-04-01), GB, NL, pages 527 - 543, XP027680460, ISSN: 1567-1356 *

Also Published As

Publication number Publication date
KR20210071575A (ko) 2021-06-16
KR102307507B1 (ko) 2021-10-01

Similar Documents

Publication Publication Date Title
US8252579B2 (en) Evolved micro-organisms for the production of 1,2-propanediol
Lu et al. Biosynthesis of monomers for plastics from renewable oils
CN104685058B (zh) 制造4-羟基丁酸酯、1，4-丁二醇和相关化合物的微生物和方法
ES2905957T3 (es) Expresión funcional de monooxigenasas y métodos de uso
US10640796B2 (en) Yeast strains with reduced fatty alcohol oxidase activity and method for the production of omega-hydroxy fatty acids and dicarboxylic acids
US8507250B2 (en) Methods and genetically engineered micro-organisms for the combined production of PDO, BDO and PHP by fermentation
US8597931B2 (en) Mutant yeast strains capable of accumulating a large quantity of lipids
EP2505656A1 (en) Method of producing 3-hydroxypropionic acid using malonic semialdehyde reducing pathway
US10246726B2 (en) Photosynthetic production of 3-hydroxybutyrate from carbon dioxide
KR20130093481A (ko) 에틸렌 글리콜을 생산하기 위한 미생물 및 방법
KR101674361B1 (ko) 유기산 제조에서의 모나스쿠스의 용도
US9994877B2 (en) Yeast cell having acid tolerance, method of preparing yeast cell and use thereof
Babaei et al. Engineering oleaginous yeast as the host for fermentative succinic acid production from glucose
US9758770B2 (en) Genetically engineered and acid-resistant yeast cell with enhanced activity of radiation sensitivity complementing kinase and method of producing lactate by using the yeast cell
CN105296371B (zh) 具有改进的生产力的酵母和产生产物的方法
WO2015100338A2 (en) Methods and organisms with increased carbon flux efficiencies
WO2021112641A1 (ko) 중쇄 디올을 생산하는 재조합 균주 및 이를 이용한 중쇄 디올의 생산방법
Jang et al. Whole cell biotransformation of 1-dodecanol by Escherichia coli by soluble expression of ADH enzyme from Yarrowia lipolytica
WO2010050231A1 (ja) シロ－イノシトール産生細胞および当該細胞を用いたシロ－イノシトール製造方法
EP2694646B1 (en) Production of butanol by fermentation
US9598709B2 (en) Genetically engineered and stress resistant yeast cell with enhanced MSN2 activity and method of producing lactate using the same
KR20130037608A (ko) 카프로산 생산용 재조합 미생물 및 이를 이용하여 카프로산을 대량 생산하는 방법
US11091741B2 (en) Method for producing medium chain diol
Grimm et al. Biocatalytic applications of autotrophic organisms
Park et al. Biosynthesis of aliphatic plastic monomers with amino residues in Yarrowia lipolytica

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20895837

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20895837

Country of ref document: EP

Kind code of ref document: A1