WO2021112310A1 - 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체, 이의 생산 방법 및 이의 용도 - Google Patents

다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체, 이의 생산 방법 및 이의 용도 Download PDF

Info

Publication number
WO2021112310A1
WO2021112310A1 PCT/KR2019/017246 KR2019017246W WO2021112310A1 WO 2021112310 A1 WO2021112310 A1 WO 2021112310A1 KR 2019017246 W KR2019017246 W KR 2019017246W WO 2021112310 A1 WO2021112310 A1 WO 2021112310A1
Authority
WO
WIPO (PCT)
Prior art keywords
hydroxy
skin
composition
polyunsaturated fatty
mono
Prior art date
Application number
PCT/KR2019/017246
Other languages
English (en)
French (fr)
Inventor
서정우
이종재
허선연
주정현
김철호
오백록
이길용
이경민
조희원
Original Assignee
한국생명공학연구원
코오롱인더스트리 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원, 코오롱인더스트리 주식회사 filed Critical 한국생명공학연구원
Priority to JP2022521086A priority Critical patent/JP7349569B2/ja
Priority to US17/767,425 priority patent/US20240000680A1/en
Priority to EP19955117.7A priority patent/EP4071241A4/en
Priority to CN201980101961.2A priority patent/CN114729335A/zh
Priority to PCT/KR2019/017246 priority patent/WO2021112310A1/ko
Publication of WO2021112310A1 publication Critical patent/WO2021112310A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/115—Fatty acids or derivatives thereof; Fats or oils
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • A61K31/202—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids having three or more double bonds, e.g. linolenic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/36—Carboxylic acids; Salts or anhydrides thereof
    • A61K8/365—Hydroxycarboxylic acids; Ketocarboxylic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A61K8/66—Enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C59/00—Compounds having carboxyl groups bound to acyclic carbon atoms and containing any of the groups OH, O—metal, —CHO, keto, ether, groups, groups, or groups
    • C07C59/40—Unsaturated compounds
    • C07C59/42—Unsaturated compounds containing hydroxy or O-metal groups
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y113/00—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
    • C12Y113/11—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of two atoms of oxygen (1.13.11)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y113/00—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
    • C12Y113/11—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of two atoms of oxygen (1.13.11)
    • C12Y113/11012—Linoleate 13S-lipoxygenase (1.13.11.12)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/40—Chemical, physico-chemical or functional or structural properties of particular ingredients
    • A61K2800/59—Mixtures
    • A61K2800/592—Mixtures of compounds complementing their respective functions
    • A61K2800/5922—At least two compounds being classified in the same subclass of A61K8/18
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/74—Biological properties of particular ingredients
    • A61K2800/78—Enzyme modulators, e.g. Enzyme agonists
    • A61K2800/782—Enzyme inhibitors; Enzyme antagonists
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/06—Ointments; Bases therefor; Other semi-solid forms, e.g. creams, sticks, gels
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C12P7/6432—Eicosapentaenoic acids [EPA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C12P7/6434—Docosahexenoic acids [DHA]

Definitions

  • the present invention relates to a method for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids, and to the use of a complex composition comprising derivatives of polyunsaturated fatty acids to improve skin wrinkles, improve skin inflammation, or strengthen skin barrier.
  • the inflammatory response plays an important role as the body's primary defense against pathogen infection and various toxic substances, but at the same time can act as an underlying factor inducing various chronic diseases, so it must be strictly controlled by a sophisticated regulatory mechanism in the body. It is a menstrual phenomenon.
  • Prostaglandin or leukotriene a derivative of arachidonic acid (C20: 4n-6), which is an omega-6 polyunsaturated fatty acid, is a representative inflammatory response initiation signal, which can cause various chronic diseases in the body. It induces an imbalance in the inflammatory response.
  • the inflammatory reaction initiation signal material is not produced, the inflammatory reaction is recognized to be naturally terminated, and various steroidal or non-steroidal anti-inflammatory drugs that inhibit the production of the material have been developed.
  • the SPM has the advantage of showing efficacy throughout the entire stage of the inflammatory reaction, unlike the existing steroid or non-steroidal anti-inflammatory drugs that mainly induce inhibition of the generation of inflammatory response initiation signal substances. Accordingly, using the SPM, various chronic inflammatory diseases (vascular, myocardial infarction, stroke, dementia, osteoarthritis, lung diseases including asthma, gastroenteritis, periodontitis, dry eye, fatty liver, and various chronic inflammatory diseases), infection sepsis, burns, Research is actively underway on the existence of therapeutic efficacy for various diseases such as wound healing, pain, cancer, and diabetes.
  • various chronic inflammatory diseases vascular, myocardial infarction, stroke, dementia, osteoarthritis, lung diseases including asthma, gastroenteritis, periodontitis, dry eye, fatty liver, and various chronic inflammatory diseases
  • infection sepsis infection sepsis
  • burns Research is actively underway on the existence of therapeutic efficacy for various diseases such as wound healing, pain, cancer, and diabetes.
  • the in vivo inflammatory response termination signal material SPM has a structure in which two or three hydroxyl groups are inserted into omega-3 polyunsaturated fatty acids, and is known to be produced in very small amounts through the continuous action of two or more enzymes. Accordingly, in order to generate sufficient SPM for the efficacy and therapeutic development of the inflammatory response termination signal material, efforts to manufacture it through an organic synthesis process are continuing (see Non-Patent Document 1), but the limitation is that the process is very complicated. exist.
  • the skin is an important organ that protects the human body from external harmful environment and an immune organ with the largest area.
  • the stratum corneum which constitutes the outermost layer of the skin, has resistance to physical and chemical damage and prevents microorganisms and harmful chemicals from penetrating into the body.
  • keratinocytes, Langerhans cells, fibroblasts, mast cells, dendritic cells, and capillary endothelial cells form a complex immune system to protect the human body through immune response when antigens penetrate from the outside.
  • the skin is constantly being stimulated from the outside (ultraviolet rays, chemicals, heat, physical friction), and recently, new irritants such as fine dust and blue light are increasing.
  • new irritants such as fine dust and blue light are increasing.
  • internal factors such as mental stress, sleep disorders, nutritional imbalance, and drug treatment are known to cause stress on the skin.
  • MMPs matrix metalloproteinases
  • substances used to inhibit skin aging include enzymes such as superoxide dismutase for removing active oxygen, antioxidants such as vitamin C and tocopherol, botulinum-related peptides, and vitamin A derivatives such as retinol.
  • enzymes such as superoxide dismutase for removing active oxygen
  • antioxidants such as vitamin C and tocopherol
  • botulinum-related peptides such as botulinum-related peptides
  • vitamin A derivatives such as retinol.
  • vitamin A derivatives have excellent collagen synthesis and are the most effective in removing wrinkles, but they have side effects such as instability to light or heat, causing skin irritation, and unstable content in the formulation.
  • Atopic dermatitis is a chronic inflammatory skin disease that causes dryness, pruritus, and eczema erythematosus as a disease caused by genetic, environmental, and immunological abnormalities and the breakdown of the skin barrier.
  • the prevalence is increasing worldwide due to environmental changes, eating habits, and environmental pollution, and interest in solutions is also increasing.
  • the cause is unknown, the underlying treatment is difficult, and most are dependent on symptomatic treatment.
  • hydroxylated derivatives of docosahexaenoic acid (DHA, C22: 6n-3) and eicosapentaenoic acid (EPA, C20: 5n-3) act on the termination mechanism of the inflammatory response. It was confirmed that it can act as a signal material, and those that act as a signal material for the termination mechanism of the inflammatory response were named SPM (specialized proresolving mediators; resolvins, protectins, maresins).
  • One object of the present invention is to provide an enzyme capable of producing mono-hydroxy or di-hydroxy derivatives from polyunsaturated fatty acids, and the production of polyunsaturated fatty acids in vivo or in vitro using the same. To provide a method capable of producing mono-hydroxy or di-hydroxy derivatives.
  • Another object of the present invention is to provide a cosmetic composition, or a food composition for improving skin condition through skin wrinkle prevention or improvement, skin aging prevention or improvement, skin inflammation prevention or improvement, skin regeneration and skin barrier strengthening.
  • Another object of the present invention is one selected from the group consisting of skin wounds, skin scars, dermatitis, atopic dermatitis, pruritus, eczematous skin disease, dry eczema, athlete's foot, erythema, urticaria, psoriasis, weak rash, acne and hair loss It is to provide a pharmaceutical composition for the prevention or treatment of the above skin diseases.
  • Another object of the present invention is to provide a method for improving skin condition comprising administering to an individual an effective amount of a complex composition containing a hydroxy derivative of a polyunsaturated fatty acid as an active ingredient.
  • Another object of the present invention is to provide a method for preventing or treating a skin disease, comprising administering to an individual a complex composition containing a hydroxy derivative of a polyunsaturated fatty acid as an active ingredient.
  • Another object of the present invention is to provide a use of a composite composition containing a hydroxy derivative of a polyunsaturated fatty acid as an active ingredient in the manufacture of a medicament for the prevention or treatment of skin diseases.
  • one aspect of the present invention is a mono-hydroxy or di-hydroxy of a polyunsaturated fatty acid comprising an amino acid sequence having at least 90% homology with SEQ ID NO: 1 or SEQ ID NO: 2
  • An enzyme for the production of di-hydroxy derivatives is provided.
  • Another aspect of the present invention comprises the step of reacting the enzyme for producing mono-hydroxy or di-hydroxy derivatives with polyunsaturated fatty acids. Mono-hydroxy or di- of polyunsaturated fatty acids in vitro. A method for producing a hydroxy derivative is provided.
  • Another aspect of the present invention relates to the steps of culturing a transformant transduced with a gene encoding an enzyme for producing mono-hydroxy or di-hydroxy derivatives in the presence of polyunsaturated fatty acids, and in the cultured culture
  • a method for producing a mono-hydroxy or di-hydroxy derivative of a polyunsaturated fatty acid in vivo comprising isolating the mono-hydroxy or di-hydroxy derivative of the polyunsaturated fatty acid.
  • Another aspect of the present invention provides a cosmetic composition for improving skin condition comprising 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5 and Protectin DX as active ingredients.
  • Another aspect of the present invention provides a food composition for improving skin condition comprising 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5 and Protectin DX as active ingredients.
  • Another aspect of the present invention provides a pharmaceutical composition for preventing or treating skin diseases comprising 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5 and Protectin DX as active ingredients.
  • Another aspect of the present invention is the step of administering an effective amount of a complex composition containing 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5 and Protectin DX as active ingredients to an individual in need of improvement of skin condition It provides a method for improving the skin condition comprising a.
  • Another aspect of the present invention is the step of administering a complex composition containing 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5 and Protectin DX as active ingredients to an individual in need of treatment of a skin disease. It provides a method for preventing or treating skin diseases, including.
  • Another aspect of the present invention is a complex composition containing 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5 and Protectin DX as active ingredients for use in the prevention or treatment of skin diseases is to provide
  • the enzyme of the present invention can produce mono-hydroxy or di-hydroxy derivatives in a single reaction using polyunsaturated fatty acids as substrates. It can be very usefully used for in vitro production.
  • the SPMs complex composition comprising docosahexaenoic acid hydroxy derivatives of the present invention increases collagen synthesis, restores damaged skin barrier, and reduces transdermal moisture loss, thereby inhibiting skin aging or improving skin wrinkles. .
  • the SPMs complex composition of the present invention has significantly improved the effect of inhibiting the expression of TNF- ⁇ , IL-6, increasing the expression of Filaggrin, Loricrin, and the antioxidant effect, thereby strengthening the skin barrier, and atopy. It is effective in preventing or treating various skin diseases including dermatitis.
  • FIG. 1 shows the results of SDS-PAGE checking whether the protein (A) including the amino acid sequence of SEQ ID NO: 1 and the protein (B) including the amino acid sequence of SEQ ID NO: 2 were overexpressed.
  • FIG 3 shows the results of normal phase HPLC analysis on the reaction product of the protein including the amino acid sequence of SEQ ID NO: 2 and docosahexanoenoic acid (DHA).
  • DHA docosahexanoenoic acid
  • Figures 4a-d are human 5LOX (AAA36183), which is a lipoxygenase enzyme having similar activity with respect to the protein (K1) comprising the amino acid sequence of SEQ ID NO: 1 and the protein (K2) comprising the amino acid sequence of SEQ ID NO: 2; It shows the results of analyzing the homology of amino acid sequences with human 12LOX (AAA51533), human 15LOX (AAA36183), soybean 15LOX (AAA33986), potato LOX (AAB81595) and red algae PhLOX2 (AGN54275), respectively.
  • SPM 1 a hydroxy derivative produced by a protein comprising the amino acid sequence of SEQ ID NO: 1 and a hydroxy derivative produced by a protein comprising the amino acid sequence of SEQ ID NO: 2 for human dermal fibroblasts ( The results of confirming the cytotoxicity of SPM 2) are shown.
  • SPM 1 is a hydroxy derivative (SPM 1) produced by a protein comprising the amino acid sequence of SEQ ID NO: 1 and a hydroxy derivative produced by a protein comprising the amino acid sequence of SEQ ID NO: 2 for human keratinocytes ( The results of confirming the cytotoxicity of SPM 2) are shown.
  • FIG. 7 and 8 show a hydroxy derivative (SPM 1) produced by a protein comprising the amino acid sequence of SEQ ID NO: 1 and a hydroxy derivative (SPM 1) produced by a protein comprising the amino acid sequence of SEQ ID NO: 2 with respect to human keratinocytes.
  • SPM 1 hydroxy derivative
  • SPM 2 hydroxy derivative
  • SPM 9 shows a hydroxy derivative (SPM 1) produced by a protein comprising the amino acid sequence of SEQ ID NO: 1 and a hydroxy derivative produced by a protein comprising the amino acid sequence of SEQ ID NO: 2 for human dermal fibroblasts ( The results of confirming the collagen production enhancing activity of SPM 2) are shown.
  • SPM 1 shows a hydroxy derivative (SPM 1) produced by a protein comprising the amino acid sequence of SEQ ID NO: 1 and a hydroxy derivative produced by a protein comprising the amino acid sequence of SEQ ID NO: 2 for human dermal fibroblasts ( Shows the results of confirming the collagenase production inhibitory activity of SPM 2).
  • Figure 11 shows the results of comparing the IL-6 expression inhibitory activity of the single component and the SPMs composite composition with respect to human keratinocytes:
  • Figure 11a shows IL by concentration of each of 17S-HDHA, Protectin DX and Resolvin D5 -6 shows the expression inhibitory activity
  • Figure 11b shows the IL-6 expression inhibitory activity for each concentration of the SPMs composite composition 1 to 3 of the present invention
  • Figure 11c is a synergistic IL- of the SPMs composite composition of the present invention compared to the single component 6 shows the inhibitory effect on expression [Untreated control: group not irradiated with UVB, Con(-): group not treated with anything after irradiating UVB, Con(+) HC: positive control treated with hydrocortisone after irradiating UVB ].
  • Figure 12 shows the results of confirming the procollagen synthesis effect of the single component and the SPMs complex composition on human dermal fibroblasts:
  • Figure 12a shows the procollagen synthesis effect by concentration of each of 17S-HDHA,
  • Protectin DX and Resolvin D5 12b shows the procollagen synthesis effect by concentration of the SPMS composite compositions 1 to 3 of the present invention,
  • FIG. 12c shows the synergistic procollagen synthesis effect of the SPMs composite composition of the present invention compared to the SPM alone component [ Untreated control: untreated group, Con(+) RP: positive control treated with retinyl palmitate].
  • Figure 13 shows the results of confirming the effect of improving the collagen degrading enzyme (MMP-1) expression inhibitory ability of the SPMs complex composition of the present invention on human dermal fibroblasts [Untreated control: group not irradiated with UVB, Control: UVB group untreated after irradiation, Retinoic acid: positive control treated with retinoic acid after UVB irradiation].
  • Untreated control group not irradiated with UVB
  • Control UVB group untreated after irradiation
  • Retinoic acid positive control treated with retinoic acid after UVB irradiation.
  • Figure 17 shows the results of confirming the skin barrier improvement effect of the SPMs complex composition of the present invention through the expression level of the core protein constituting the skin barrier:
  • Figure 17a is the result of confirming the increase in the expression of filaggrin
  • Figure 17b is a result confirming the increase in the expression of loricrin (loricrin) [untreated control: nothing treated group, Hyaluronic acid: a positive control treated with hyaluronic acid].
  • Figure 18 shows the results of confirming the skin barrier improvement effect by the SMPs complex composition of the present invention through the human efficacy evaluation:
  • Figure 18a shows the skin barrier index change (%)
  • Figure 18b is the skin barrier recovery rate (%) ) is shown.
  • Figure 19 shows the results of confirming the improvement effect of atopic dermatitis by the SMPs complex composition of the present invention through human efficacy evaluation:
  • Figure 19a shows the skin moisture change rate (%) in the lesion site
  • Figure 19b is at the lesion site It shows the change rate (%) of the amount of transdermal water loss
  • FIG. 19c shows the change rate (%) of the skin itch index at the lesion site.
  • FIG. 20 shows the results of confirming the effect of improving eye wrinkles and skin moisture by the SPMs complex composition of the present invention through the human efficacy evaluation:
  • FIG. 20a shows the rate of change of wrinkles around the eyes (%)
  • FIG. 20b is the amount of moisture in the skin around the eyes
  • FIG. 20c shows the moisture improvement rate (%) of the skin around the eyes.
  • One aspect of the present invention provides an enzyme for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids.
  • another aspect of the present invention provides a nucleic acid molecule encoding an enzyme for producing a mono-hydroxy or di-hydroxy derivative of the polyunsaturated fatty acid.
  • the enzyme for producing a mono-hydroxy or di-hydroxy derivative of a polyunsaturated fatty acid of the present invention comprises the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and mono-hydroxy or di-hydroxy of the polyunsaturated fatty acid It may be variants or fragments of amino acids having different sequences by deletion, insertion, substitution, or a combination of amino acid residues within a range that does not affect the function of the enzyme for generating derivatives. Amino acid exchange at the protein and peptide level that does not entirely alter the activity of the enzyme for the production of mono-hydroxy or di-hydroxy derivatives of the polyunsaturated fatty acids is known in the art.
  • the present invention includes a protein having an amino acid sequence substantially identical to a protein comprising the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and a variant thereof or an active fragment thereof.
  • the substantially identical protein means, but is not limited to, those having at least 90% amino acid sequence homology, preferably at least 93% homology, and most preferably at least 95% amino acid sequence homology, and having at least 90% amino acid sequence homology and identical It is included in the scope of the present invention if it has enzymatic activity.
  • the gene of the enzyme for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids preferably consists of the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 4.
  • the nucleic acid molecule encoding the enzyme for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids of the present invention and variants or active fragments thereof are amino acids of the enzyme and variants or active fragments thereof expressed from the coding region.
  • Various modifications may be made to the coding region within a range that does not change the sequence, and various mutations may be made within the range that does not affect the expression of the gene even in parts other than the coding region, and these mutated genes are also within the scope of the present invention.
  • the present invention includes a gene comprising a nucleotide sequence substantially identical to the nucleic acid molecule of SEQ ID NO: 3 or SEQ ID NO: 4, and a fragment of the gene.
  • the gene consisting of the substantially identical nucleotide sequence means those having 80% or more, preferably 90% or more, and most preferably 95% or more sequence homology, but is not limited thereto, and has 80% or more sequence homology. and if the encoded protein has the same enzymatic activity, it is included in the present invention.
  • nucleic acid bases are substituted, deleted, inserted or may be changed by a combination of , and these are also included in the scope of the present invention.
  • the amino acid sequence of SEQ ID NO: 1, which is included in the enzyme for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids, is preferably encoded by a gene consisting of the nucleotide sequence of SEQ ID NO: 3,
  • the amino acid sequence is preferably encoded by a gene consisting of the nucleotide sequence of SEQ ID NO: 4, but the present invention is not limited thereto, and as long as it can encode a protein of the present invention having the same amino acid sequence, SEQ ID NO: 3 or SEQ ID NO: It may also be encoded by a gene consisting of another nucleotide sequence substantially identical to the nucleotide sequence of 4.
  • Such nucleotide sequences may be single-stranded or double-stranded, and may be DNA molecules or RNA molecules.
  • the present inventors isolated and purified the protein having the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 in order to determine the function of the protein having the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 ( 1), as a result of studying its activity, the protein having the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 can produce mono-hydroxy or di-hydroxy derivatives in which two hydroxyl groups are introduced into polyunsaturated fatty acids. It was confirmed that it has an activity as an enzyme (see FIGS. 2 and 3).
  • Another aspect of the present invention provides a recombinant expression vector containing a gene for an enzyme for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids of the present invention, and a transformant into which the expression vector is introduced.
  • the recombinant expression vector of the present invention contains a gene for an enzyme for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids.
  • the expression vector includes, but is not limited to, a plasmid vector, a cosmid vector, a bacteriophage vector, and a viral vector.
  • the recombinant expression vector is a promoter, a terminator, an enhancer, depending on the type of host cell to produce the enzyme for producing the mono-hydroxy or di-hydroxy derivative of the polyunsaturated fatty acid of the present invention.
  • Expression control sequences such as, or sequences for secretion, etc. may be appropriately combined depending on the purpose.
  • the expression vector may further include a selection marker for selecting a host cell into which the vector is introduced, and in the case of an expression vector capable of replication, it may include an origin of replication.
  • the recombinant expression vector may include a sequence for facilitating purification of the expression protein, specifically, the gene encoding an enzyme for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids of the present invention.
  • a gene encoding a tag for isolation and purification may be operatively linked.
  • GST, poly-Arg, FLAG, histidine-tag, c-myc, etc. may be used alone or two or more of them may be sequentially connected.
  • a gene encoding an enzyme for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids may be cloned through a restriction enzyme cleavage site, and when a gene encoding a protein cleavage enzyme recognition site is used in the vector is linked in frame with the gene of the enzyme for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids, and when cleaved with a protein cleaving enzyme after obtaining the enzyme, An enzyme for producing mono-hydroxy or di-hydroxy derivatives of unsaturated fatty acids can be produced.
  • the enzyme gene (gene comprising the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 4) for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids of the present invention is transformed into a plasmid vector pET28a
  • a recombinant cloning vector was prepared by inserting into (+).
  • various vectors for prokaryotic cells or eukaryotic cells pPIC and pPICZ, etc.
  • various expression vectors other than the above vectors can be used depending on the purpose of expression.
  • the recombinant expression vector of the present invention contains an enzyme gene for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids, so it can be usefully used as a vector capable of producing it.
  • a recombinant expression vector containing a gene encoding an enzyme for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids is introduced into the transformant of the present invention.
  • Transformants can be prepared by transforming the recombinant expression vector according to the present invention into any suitable host cell selected from the group consisting of bacteria, yeast, E. coli, fungi, plant cells and animal cells depending on the purpose of expression.
  • the host cell may be Escherichia coli ( E. coli BL21(DE3), DH5 ⁇ , etc.) or yeast cells ( Saccharomyces genus, Pichia genus, etc.).
  • an appropriate culture method and medium conditions may be easily selected by those skilled in the art according to the type of host cell.
  • the method for introducing the recombinant expression vector for the production of the transformant of the present invention may use a known technique, that is, a heat shock method, an electric shock method, and the like.
  • a recombinant expression vector containing a gene encoding an enzyme for producing mono- or di-hydroxy derivatives of polyunsaturated fatty acids of the present invention is transformed into E. coli. Transformants were prepared.
  • the protein expressed from the transformant is a protein of a novel sequence having an enzyme activity for an enzyme for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids
  • the transformant is mass-cultured to express the gene By doing so, it is possible to facilitate mass production of an enzyme for producing mono-hydroxy or di-hydroxy derivatives of the polyunsaturated fatty acid.
  • Another aspect of the present invention provides a method for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids in vitro.
  • the method for producing a mono-hydroxy or di-hydroxy derivative of a polyunsaturated fatty acid in vitro is described in "1.
  • Mono-hydroxy or di-hydroxyl of a polyunsaturated fatty acid includes the step of reacting an enzyme for producing mono-hydroxy or di-hydroxy derivatives described in the section " Enzyme for (di-hydroxy) derivative production" with polyunsaturated fatty acids.
  • the polyunsaturated fatty acid is a fatty acid containing three or more double bonds between carbons, and may be an omega-3 fatty acid, and more specifically, may be docosahexanoic acid or eicosapentaenoic acid, but is not limited thereto. .
  • the polyunsaturated fatty acid when used as a substrate for an enzyme for producing mono-hydroxy or di-hydroxy derivatives, it contains a plurality of double bonds into which a hydroxy group can be introduced into the substrate, mono-hydroxy or Di-hydroxy derivative production can be achieved.
  • the method for producing a mono-hydroxy or di-hydroxy derivative of a polyunsaturated fatty acid in vitro of the present invention comprises preparing a mono-hydroxy or di-hydroxy derivative from a reaction product of the enzyme and a polyunsaturated fatty acid. It further comprises the step of recovering.
  • the recovery may be achieved by performing a method conventionally performed in the art, such as centrifugation and filtration, and may be achieved by additionally performing a purification process in a conventional manner.
  • the purification process may be performed alone or in combination of techniques such as solvent precipitation, dialysis, gel filtration, ion exchange, and chromatography such as reverse phase column chromatography.
  • the step of reacting the enzyme for producing mono-hydroxy or di-hydroxy derivative with polyunsaturated fatty acid may be carried out in a temperature range of 10 °C to 40 °C, preferably in a temperature range of 15 °C to 35 °C. Not limited.
  • the reacting step may be carried out in the range of pH 4 to pH 10, preferably in the range of pH 7 to pH 9, but is not limited thereto.
  • the activity of the enzyme for producing mono-hydroxy or di-hydroxy derivatives is maximized, so that mono-hydroxy or di-hydroxy derivatives can be more efficiently produced.
  • Another aspect of the present invention provides a method for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids in vivo.
  • the method for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids in vivo of the present invention is described in “2. Enzyme for producing mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids. Including the step of culturing the transformant described in the section “ Expression vectors and transformants ” in the presence of polyunsaturated fatty acids and isolating mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids from the cultured culture. do.
  • the enzyme for producing mono-hydroxy or di-hydroxy derivative may be expressed in the transformant into which the recombinant expression vector containing the gene valency encoding the mono-hydroxy or di-hydroxy derivative is introduced. Therefore, for the enzyme for producing mono-hydroxy or di-hydroxy derivatives present in the transformant, the above “ 1. mono-hydroxy or di-hydroxy of polyunsaturated fatty acid ) Enzymes for derivative production " The detailed description will be omitted by citing the description of the item.
  • the transformant expresses an enzyme for producing mono-hydroxy or di-hydroxy derivatives, by culturing it in a culture medium containing polyunsaturated fatty acid as a substrate, mono- without a separate process for separating the enzyme Hydroxy or di-hydroxy derivatives can be produced.
  • the transformant may be cultured according to a suitable medium and culture conditions known in the art. Those of ordinary skill in the art can easily adjust the medium and culture conditions according to the type of transformant selected for use.
  • the culturing method may include batch, continuous, fed-batch, or a combination culture thereof.
  • the medium may contain various carbon sources, nitrogen sources and trace element components.
  • the carbon source is, for example, glucose, sucrose, lactose, fructose, maltose, starch, carbohydrates such as cellulose, fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, organic acids such as acetic acid, or combinations thereof.
  • the culture may be performed using glucose as a carbon source.
  • the nitrogen sources include organic nitrogen sources such as peptone, yeast extract, broth, malt extract, corn steep liquor (CSL), and soybean wheat and inorganic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, or combinations thereof may be included.
  • the medium may contain, as a source of phosphorus, for example, potassium dihydrogen phosphate, dipotassium hydrogen phosphate and a corresponding sodium-containing salt, a metal salt such as magnesium sulfate or iron sulfate.
  • amino acids, vitamins, and appropriate precursors may be included in the medium.
  • the medium or individual components may be added to the culture medium batchwise or continuously.
  • an antifoaming agent such as fatty acid polyglycol ester during culture can suppress the formation of bubbles.
  • another aspect of the present invention provides a composition for improving skin conditions or preventing or treating skin diseases.
  • the present invention provides a composition for improving skin condition comprising 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5 and Protectin DX as active ingredients.
  • the 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5, and Protectin DX are lipoxygenase derived from an omega-3 fatty acid, that is, docosahexaenoic acid (DHA). ; LOX) metabolite and a specialized pro-resolving mediator (SPM).
  • the 17-hydroxydocosahexaenoic acid (17-HDHA) is ( ⁇ ) 17-hydroxy (dihydroxy)-4Z, 7Z, 10Z, 13Z, 15E, 19Z-docosahexaenoic acid (docosahexaenoic acid), It is represented by the structure of Formula 1 below.
  • Resolvin D5 (Resolvin D5; RvD5) is 7S, 17S- dihydroxy -4Z, 8E, 10Z, 13Z, 15E, 19Z- docosahexaenoic acid (docosahexaenoic acid), the structure of the following formula (2) is expressed as
  • the protectin DX (Protectin DX; PDX) is 10S,17S-dihydroxy (dihydroxy)-4Z,7Z,11E,13Z,15E,19Z-docosahexaenoic acid (docosahexaenoic acid) as an isomer of protectin D1 , is represented by the structure of Formula 3 below.
  • the 17-HDHA, Resolvin D5 and Protectin DX can be biosynthesized by treating the enzyme of SEQ ID NO: 1 or SEQ ID NO: 2 of the present invention to docosahexaenoic acid, chemically synthesized, or commercially purchased ones can be used. , but not limited thereto.
  • composition of the present invention may be for improving the skin condition.
  • the "skin condition" may be skin aging due to ultraviolet rays, freckles, freckles, skin wounds, dermatitis, atopic dermatitis, pruritus, eczematous skin disease, dry eczema, erythema, urticaria, psoriasis, weak rash or acne.
  • the aging of the skin includes symptoms such as decreased elasticity of the skin, decreased gloss, wrinkle generation, weakened regeneration or severe dryness, and includes both intrinsic and extrinsic aging caused by the passage of time or external environment.
  • the skin aging may be photoaging, and the photoaging refers to skin damage that occurs when the skin is repeatedly or long-term exposed to ultraviolet rays.
  • the wrinkle means a wrinkle that occurs in all body parts including the face, and includes both static rhytides and dynamic rhytides.
  • improving skin condition refers to prevention or improvement of skin wrinkles, prevention or improvement of skin aging, prevention or improvement of skin inflammation, proliferation and regeneration of skin cells, contraction or reduction of pores, or improvement of skin barrier function, skin It is a concept that includes alleviating irritation, antioxidant, and promoting collagen synthesis.
  • the meaning of "comprising as an active ingredient” is a degree that can exhibit a skin improvement effect, for example, wrinkle improvement, inflammation improvement, skin regeneration, atopic dermatitis improvement, or skin barrier strengthening, improvement. It means containing an effective amount.
  • the composition may promote collagen synthesis in cells or inhibit collagen degradation by inhibiting the expression or activity of matrix metalloproteinase (MMP).
  • MMP matrix metalloproteinase
  • the composition may, for example, inhibit the degradation of the extracellular matrix by inhibiting the expression or activity of MMP-1 that degrades type 1 collagen.
  • the composition may have antioxidant activity.
  • the composition may inhibit the formation of lipid peroxide.
  • the composition may inhibit an inflammatory factor.
  • the composition may inhibit NO, TNF- ⁇ , IL-6, which are inflammation initiators.
  • TNF- ⁇ tumor necrosis factor-a
  • IL-6 Interleukin-6
  • LPS lymphocytes activated by LPS
  • IL-6 is secreted by macrophages and T cells to stimulate an immune response to promote inflammation.
  • the complex composition comprising 17-HDHA, Resolvin D5 and Protectin DX of the present invention can implement excellent anti-inflammatory action by suppressing the expression of inflammatory cytokines TNF- ⁇ and IL-6, and oxidation occurring in the skin It has an excellent antioxidant effect that inhibits the formation of lipid peroxides caused by stress, and can improve skin resistance to external stimuli.
  • the composition may be to strengthen the skin barrier.
  • the stratum corneum which is the outermost layer of the epidermis of the skin barrier, is mainly composed of non-nucleated flat corneocytes.
  • the multi-lamellar lipid layer formed of intercellular lipids such as ceramide, cholesterol, and fatty acids synthesized by keratinocytes of the skin barrier maintained through the division and differentiation process of normal epidermal cells is a protective barrier to prevent moisture in the skin from evaporating. play a role Meanwhile, among these intercellular lipids, omega hydroxy ceramide is chemically covalently linked with involucrin, a protein of the outer layer of corneocytes, to form a corneocyte lipid envelope (CLE), thereby forming a multi-layered lipid membrane. It plays a role in physically stabilizing intercellular lipids in the form of intercellular lipids, thereby strengthening the barrier function.
  • intercellular lipids such as ceramide, cholesterol, and fatty acids synthesized by keratinocytes of the skin barrier maintained through the
  • composition of the present invention is delivered to the stratum corneum through skin application and promotes the differentiation of keratinocytes, has an effect of improving the thickness of the epidermal layer and has an excellent effect of restoring damage to the skin barrier. It can be usefully used for the treatment and prevention of induced skin diseases. Skin diseases caused by damage to the skin barrier include, but are not limited to, atopic dermatitis, xeroderma, psoriasis, ichthyosis, and acne.
  • Filaggrin is one of several structural proteins expressed by keratinocytes in the differentiation stage and is involved in differentiation from the basal layer of the epidermis to the stratum corneum. It is also used as a major indicator of skin moisture retention and skin membrane function.
  • the composite composition comprising 17-HDHA, Resolvin D5 and Protectin DX according to the present invention exhibits superior gene expression of filaggrin or loricrin. As it increases, it has an excellent skin barrier protection, strengthening, and improvement function.
  • the complex composition comprising 17-HDHA, Resolvin D5 and Protectin DX of the present invention contains the same concentration of each of these compounds by the combined synergistic action of 17-HDHA, Resolvin D5 and Protectin DX, which are contained as active ingredients. As compared to that used as, it is possible to implement a particularly remarkably improved IL-6 expression inhibitory effect and procollagen synthesis effect ( FIGS. 11 and 12 ).
  • the complex contains the 17-HDHA, Resolvin D5 and Protectin DX in a weight ratio of 3-85: 10-60: 5-50, for example 3:10:5 in a weight ratio, 5: It may be included in a weight ratio of 60:50, 85:10:5, but is not limited thereto.
  • 17-HDHA, Resolvin D5 and Protectin DX are used in a weight ratio of 3:47:50, a weight ratio of 25:56:19, and a complex composition comprising a weight ratio of 84:10:6. The skin improvement effect was confirmed.
  • composition for improving skin condition may be used as a cosmetic composition, a pharmaceutical composition, or a food composition.
  • the present invention provides a cosmetic composition for improving skin condition comprising 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5 and Protectin DX as active ingredients.
  • the complex composition including the 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5 and Protectin DX and the content related to skin condition improvement are the same as described above.
  • the complex composition of the present invention is used as a cosmetic composition
  • components commonly used in cosmetic compositions are included in addition to the 17-HDHA, Resolvin D5 and Protectin DX, for example, a sulphating agent, a stabilizer, a solubilizer, and a vitamin. , customary adjuvants such as pigments and fragrances, and carriers.
  • the cosmetic composition of the present invention can be prepared in any formulation conventionally prepared in the art, for example, solutions, suspensions (anhydrous and aqueous), anhydrous products (oil and glycol-based), emulsions, pastes, gels , mask, pack, powder, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation and spray, and the like, but are not limited thereto. More specifically, it may be prepared in the form of a flexible lotion (skin), a nourishing lotion (milk lotion), a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder. . In this case, the accessibility of the cosmetic composition can be further improved, and the chronic recurrence of atopic dermatitis can be prevented by implementing a moisturizing effect.
  • the formulation of the cosmetic composition is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide as a carrier component can be used
  • the formulation of the cosmetic composition is a powder or a spray
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component.
  • additional chlorofluorohydrocarbon, propellants such as propane/butane or dimethyl ether.
  • a solvent, solubilizer or emulsifier is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylglycol oil, glycerol fatty esters, fatty acid esters of polyethylene glycol or sorbitan.
  • the formulation of the cosmetic composition is a suspension
  • a liquid diluent such as water, ethanol or propylene glycol
  • a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester
  • Crystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth may be used.
  • the formulation of the cosmetic composition is surfactant-containing cleansing
  • Amide ether sulfates, alkylamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters can be used.
  • the cosmetic composition When the cosmetic composition is in the form of a soap, it may be prepared by including a skin moisturizer, an emulsifier, a water softener, etc. as an additive, and as a base material of the soap, vegetable oils such as palm oil, palm oil, soybean oil, olive oil, palm kernel oil, jooba oil, Animal oils and fats such as tallow, pork, brisket, and fish oil may be used, and as a moisturizing agent, glycerin, dethipritol, propylene glycol, butylene glycol, hexyl glycol, isopropyl myristate, aloe vera, sorbitol, etc.
  • a skin moisturizer such as palm oil, palm oil, soybean oil, olive oil, palm kernel oil, jooba oil
  • Animal oils and fats such as tallow, pork, brisket, and fish oil
  • a moisturizing agent glycerin, dethipritol, propylene glycol
  • the soap may further include an antibacterial agent, a foam inhibitor, a solvent, a corrosion inhibitor, a fragrance, a colorant, a sequestering agent, a preservative, and the like as additives.
  • the 17-HDHA, Resolvin D5 and Protectin DX in the composition may be included at a concentration of 30 ⁇ M or more, specifically 35 ⁇ M or more, more specifically 40 ⁇ M or more, but this is a cosmetic It depends on the form in which the composition is prepared and its specific application site (face or hand) or application dose, so it is not limited thereto.
  • the present invention provides a pharmaceutical composition for preventing or treating skin diseases comprising 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5 and Protectin DX as active ingredients.
  • the skin disease may be a skin wound, skin scar, dermatitis, atopic dermatitis, pruritus, eczematous skin disease, dry eczema, athlete's foot, erythema, urticaria, psoriasis, rash, acne or hair loss.
  • the complex composition including the 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5, and Protectin DX and the contents related to skin diseases are the same as described above.
  • composition when used as a pharmaceutical composition, in addition to the above, 17-HDHA, Resolvin D5, and Protectin DX may further include a pharmaceutically acceptable carrier or additive.
  • the meaning of 'pharmaceutically acceptable' means that it does not inhibit the activity of the active ingredient and does not have more toxicity than the application (prescription) target can adapt to.
  • the 'carrier' is defined as a compound that facilitates the addition of the compound into a cell or tissue.
  • the 17-HDHA, Resolvin D5 and Protectin DX of the present invention may be administered alone or in admixture with any convenient carrier, and the dosage form may be a single administration or repeated administration.
  • the pharmaceutical composition may be a solid formulation or a liquid formulation.
  • Solid preparations include, but are not limited to, powders, granules, tablets, capsules, suppositories, and the like.
  • Solid formulations may include, but are not limited to, carriers, flavoring agents, binders, preservatives, disintegrants, lubricants, fillers, and the like.
  • Liquid formulations include, but are not limited to, solutions such as water and propylene glycol solutions, suspensions, and emulsions, and may be prepared by adding suitable colorants, flavoring agents, stabilizers, and viscosifying agents.
  • the powder may be prepared by simply mixing 17-HDHA, Resolvin D5, and Protectin DX, which are the active ingredients of the present invention, with a suitable pharmaceutically acceptable carrier such as lactose, starch, microcrystalline cellulose.
  • the granules are prepared by mixing the 17-HDHA, Resolvin D5 and Protectin DX of the present invention, a suitable pharmaceutically acceptable carrier and a suitable pharmaceutically acceptable binder such as polyvinylpyrrolidone and hydroxypropyl cellulose, It can be prepared using a wet granulation method using a solvent such as water, ethanol, isopropanol, or a dry granulation method using a compressive force.
  • the tablet may be prepared by mixing the granules with a suitable pharmaceutically acceptable lubricant such as magnesium stearate, and then tableting using a tableting machine.
  • the 17-HDHA, resolvin D5 and protectin DX of the present invention are oral preparations, injections (eg, intramuscular injection, intraperitoneal injection, intravenous injection, infusion), subcutaneous administration, depending on the disease to be treated and the condition of the individual. injection, implant), inhalant, nasal administration, vaginal, rectal, sublingual, transdermal, topical, etc., but is not limited thereto.
  • injections eg, intramuscular injection, intraperitoneal injection, intravenous injection, infusion
  • subcutaneous administration depending on the disease to be treated and the condition of the individual. injection, implant
  • inhalant e.g., nasal administration, vaginal, rectal, sublingual, transdermal, topical, etc., but is not limited thereto.
  • it may be formulated into suitable dosage unit formulations comprising commonly used, non-toxic, pharmaceutically acceptable carriers, excipients, and vehicles.
  • the pharmaceutical composition of the present invention may be administered in a daily dose of about 0.0001 mg/kg to about 10 g/kg, and may be administered in a daily dose of about 0.001 mg/kg to about 1 g/kg.
  • the dosage may vary depending on the degree of purification of the mixture, the patient's condition (age, sex, weight, etc.), the severity of the condition being treated, and the like. If necessary, for convenience, the total daily dose may be divided and administered several times during the day.
  • the 17-HDHA, Resolvin D5 and Protectin DX in the composition may be included at a concentration of 30 ⁇ M or more, specifically 35 ⁇ M or more, more specifically 40 ⁇ M or more.
  • the present invention provides a food composition for improving skin condition comprising 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5 and Protectin DX as active ingredients.
  • the complex composition including the 17-hydroxydocosahexaenoic acid (17-HDHA), Resolvin D5 and Protectin DX and the content related to skin condition improvement are the same as described above.
  • composition when used as a food composition, it may contain acceptable food supplement additives, and may further include suitable carriers, excipients and diluents commonly used in the manufacture of food.
  • food means a natural product or processed product containing one or more nutrients, and specifically means a state that can be eaten directly through a certain amount of processing process.
  • Functional foods, beverages, food additives and beverage additives are used in the sense of including all. Examples of the food include various foods, beverages, gum, tea, vitamin complexes, functional foods, and the like.
  • the food of the present invention includes special nutritional food (eg, formula milk, infant food, etc.), processed meat products, fish meat products, tofu, jelly, noodles (eg, ramen, noodles, etc.), health supplements, seasoned foods ( Ex, soy sauce, soybean paste, red pepper paste, mixed soy sauce, etc.), sauces, sweets (eg snacks), dairy products (eg fermented milk, cheese, etc.), other processed foods, kimchi, pickled foods (various kimchi, pickles, etc.), beverages ( Examples include, but are not limited to, fruit and vegetable beverages, soy milk, fermented beverages, ice cream, etc.), natural seasonings (eg, ramen soup, etc.), vitamin complexes, alcoholic beverages, alcoholic beverages and other health supplements.
  • the functional food, beverage, food additive or beverage additive may be prepared by a conventional manufacturing method.
  • the 'functional food' refers to a food group or food composition that has added added value so that it acts and expresses the function of the food for a specific purpose using physical, biochemical, and bioengineering methods, etc. It refers to a food that is designed and processed to sufficiently express the control function of the body with respect to the living body, and specifically may be a health functional food.
  • the term 'health functional food' used in the present invention refers to food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, and pills using raw materials or ingredients having useful functions in the human body.
  • the term 'function' refers to obtaining useful effects for health purposes, such as regulating nutrients or physiological effects on the structure and function of the human body.
  • the health functional food of the present invention can be prepared by a method commonly used in the art, and during the manufacture, it can be prepared by adding raw materials and components commonly added in the art.
  • the formulation of the health functional food is also recognized as a health functional food, it can be prepared without limitation.
  • composition for food of the present invention can be prepared in various forms, and unlike general drugs, it has the advantage that there are no side effects that may occur during long-term administration of the drug using food as a raw material, and has excellent portability, and the present invention health functional food can be taken as a supplement to enhance the skin improvement effect.
  • the functional food may include a food pharmaceutically acceptable food supplement additive, and may further include an appropriate carrier, excipient and diluent commonly used in the manufacture of functional food.
  • the 17-HDHA, resolvin D5 and protectin DX in the composition may be included in a concentration of 30 ⁇ M or more, specifically 35 ⁇ M or more, more specifically 40 ⁇ M or more.
  • the food composition of the present invention may include sweeteners, flavoring agents, physiologically active ingredients, minerals, etc. in addition to the active ingredients thereof.
  • the sweetener may be used in an amount to give the food a suitable sweetness, and may be natural or synthetic.
  • examples of the natural sweetener include sugar sweeteners such as corn syrup solids, honey, sucrose, fructose, lactose, and maltose.
  • Flavoring agents may be used to improve taste or aroma, and both natural and synthetic ones may be used. Specifically, it is a case where a natural thing is used. In the case of using a natural one, the purpose of nutritional enhancement in addition to flavor may be concurrently used.
  • a natural flavoring agent it may be obtained from apple, lemon, tangerine, grape, strawberry, peach, etc., or it may be obtained from green tea leaf, dandelion, bamboo leaf, cinnamon, chrysanthemum leaf, jasmine, etc.
  • ginseng red ginseng
  • bamboo shoots aloe vera, ginkgo biloba, etc.
  • the natural flavoring agent may be a liquid concentrate or a solid extract.
  • a synthetic flavoring agent may be used, and the synthetic flavoring agent may be an ester, an alcohol, an aldehyde, a terpene, or the like.
  • catechins such as catechin, epicatechin, gallocatechin, and epigallocatechin
  • vitamins such as retinol, ascorbic acid, tocopherol, calciferol, thiamine, and riboflavin
  • minerals calcium, magnesium, chromium, cobalt, copper, fluoride, germanium, iodine, iron, lithium, magnesium, manganese, molybdenum, phosphorus, potassium, selenium, silicon, sodium, sulfur, vanadium, zinc, and the like can be used.
  • the food composition of the present invention may include a preservative, an emulsifier, an acidulant, a thickener, and the like, if necessary, in addition to the sweetener.
  • These preservatives, emulsifiers, etc. are preferably added in a trace amount as long as the use to which they are added can be achieved. Trace amount, expressed numerically, means in the range of from about 0.0005% to about 0.5% by weight based on the total weight of the food composition.
  • Preservatives that can be used include sodium calcium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate, EDTA (ethylenediaminetetraacetic acid) and the like.
  • emulsifier examples include gum acacia, carboxymethylcellulose, xanthan gum, pectin, and the like.
  • Acidulants that can be used include acidic acid, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, phosphoric acid and the like. Such acidulant may be added so that the food composition has an appropriate acidity for the purpose of inhibiting the growth of microorganisms in addition to the purpose of enhancing the taste.
  • Thickening agents that can be used include suspending agents, settling agents, gel-forming agents, bulking agents and the like.
  • the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4 encoding the amino acids of SEQ ID NO: 1 and SEQ ID NO: 2, respectively, were synthesized by requesting Bioneer Co., Ltd., and each of the synthesized nucleotide sequences was used as a template from SEQ ID NOs: 5 to Using the primer pair of 8, pre-denaturation was performed at 94°C for 5 minutes, followed by a cycle of reacting at 94°C for 30 seconds, 61°C for 30 seconds, and 72°C for 2 minutes. PCR repeating 20 times By performing the amplification of the genes of SEQ ID NO: 3 and SEQ ID NO: 4, respectively.
  • Each PCR product containing the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4 amplified as described above was inserted into a plasmid vector pET28a(+) (Novagen, USA) to prepare a recombinant expression vector, and nucleotide sequence analysis (Solgent) Through this, it was confirmed that the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4 were properly inserted.
  • Each of the recombinant expression vectors prepared in Example [1-1] was transformed into E. coli BL21 (DE3), each transformant was inoculated into 3 ml of LB medium, and the absorbance at 600 nm was 2.0.
  • the seed culture was incubated at 37°C until Then, the main culture was carried out by adding the seed culture medium to 500 ml of LB medium, and when the absorbance at 600 nm became 0.6, IPTG (isopropyl-1-thio- ⁇ -D-galactopyranoside) was added to the final concentration 1 mM was added to induce overexpression of the protein having the amino acid sequence of SEQ ID NO: 1 and the protein having the amino acid sequence of SEQ ID NO: 2.
  • the culture temperature was maintained at 37 °C, and after adding IPTG, the culture temperature was lowered to 20 °C.
  • the culture medium of the overexpression-induced transformant was centrifuged to separate the supernatant, and cells of the transformant were disrupted from the pellet from which the supernatant was separated to obtain a cell lysate of the transformant.
  • the protein having the amino acid sequence of SEQ ID NO: 1 and the cell lysate confirmed that the protein having the amino acid sequence of SEQ ID NO: 2 are overexpressed, using Ni-NTA adsorption chromatography, A protein having an amino acid sequence and a protein having an amino acid sequence of SEQ ID NO: 2 were isolated and purified.
  • each of these proteins 6KU or 10KU and docosahexaenoic acid ( 100 ⁇ M of docosahexaenoic acid; DHA) was reacted at pH 7 at room temperature for 30 minutes, 1 M sodium borohydride was added to a final concentration of 50 mM to reduce the reaction product, and then 5 ⁇ l/ml The reaction was terminated by the addition of acetic acid.
  • the normal phase HPLC analysis was performed on a supelcosil LC-Diol column (Supelco, 25 cm ⁇ 3 mm, 5 ⁇ m), consisting of 95% n-heptane, 5% isopropanol, 0.1% acetic acid, 0.1% 2,2-dimethoxypropane.
  • the mobile phase was developed at a flow rate of 0.5 ml/min, and 20 ml was developed for 40 minutes, and the compound in the reaction product was finally detected using a Diode Array Detector (DAD).
  • DAD Diode Array Detector
  • the protein having the amino acid sequence of SEQ ID NO: 1 and the protein having the amino acid sequence of SEQ ID NO: 2 were both 17S-monohydroxy-DHA, 7S, and 17S from DHA. It was confirmed that it can produce -di-hydroxy-DHA (resolvin D5), 10S,17S-dihydroxy-DHA (protectin DX), in each case the above three mono-hydroxy or di-hydroxy It was confirmed that the content of the derivative was present in the ratio as described in Table 3 below, respectively.
  • human 5LOX AAA36183
  • human 12LOX AAA51533
  • human 15LOX AAA36183
  • soybean 15LOX AAA33986
  • potato LOX AAB81595
  • red algae PhLOX2 AGN54275
  • the protein having the amino acid sequence of SEQ ID NO: 1 and the protein having the amino acid sequence of SEQ ID NO: 2 are human 5LOX (AAA36183), human 12LOX (AAA51533), human 15LOX (AAA36183), as shown in FIGS. ), soybean 15LOX (AAA33986), potato LOX (AAB81595) and red algae PhLOX2 (AGN54275) with very low sequence homology.
  • both the protein having the amino acid sequence of SEQ ID NO: 1 and the protein having the amino acid sequence of SEQ ID NO: 2 both have an N-terminal region that performs binding to membrane lipids, It was confirmed that high similarity was shown in the C-terminal region. In particular, His, His, His and Asn/Ser, which are residues binding to iron ions, and terminal amino acids were present, and it was confirmed that Ala, which is closely related to the hydroxylation properties of the enzyme, was present.
  • Example 2 the product obtained by reacting docosahexaenoic acid with the protein having SEQ ID NO: 1 of the present invention (SPM 1) and the product obtained by reacting the protein having the amino acid sequence of SEQ ID NO: 2 (SPM) 2) was treated with human dermal fibroblasts to confirm cytotoxicity, MMP-1 expression, and procollagen synthesis effects, and by treatment with human keratinocytes, cytotoxicity, TNF- ⁇ expression and Changes in IL-6 expression were confirmed.
  • both reaction products SPM 1, SPM 2 showed a cell viability of 90% or more at all concentrations, and from this, the product produced from DHA by the protein of the present invention It can be seen that all of them are non-cytotoxic.
  • Human keratinocytes were aliquoted in a 48-well plate at a concentration of 4x10 4 pieces/well and incubated at 5% CO 2 , 37° C. for 24 hours, then the medium was removed and the starvation state was maintained with DMEM Serum Free media for 24 hours. did.
  • the SPM 1 and SPM 2 were diluted with DMEM (2% FBS) to make 1 ppm, and then diluted sequentially to 0.1, 0.01, and 0.001 ppm, and then cultured as above to remove the medium 1 to human keratinocytes. treated for hours. Then, for TNF- ⁇ or IL-6 expression, the medium was exchanged with 250 ⁇ l of DPBS (WelGENE), irradiated with UVB of 160 mJ/cm 2 , and then treated with SPM 1 and SPM 2 again and cultured for 24 hours.
  • DMEM 2% FBS
  • the amount of TNF- ⁇ was measured using Human TNF- ⁇ DuoSet ELISA (R&D system), and the amount of IL-6 was measured using Human IL-6 DuoSet ELISA (R&D system), respectively.
  • the cells adhering to the bottom were washed with DPBS, dissolved with 1N NaOH, and the amount of protein was measured through BCA analysis to measure the amount of synthesis of TNF- ⁇ or IL-6 per predetermined protein.
  • the effect of the two reaction products SPM 1 and SPM 2 was confirmed by using a case in which nothing was treated as a negative control and a case in which 10 ppm of dexamethasone was treated as a positive control.
  • TNF- ⁇ As shown in FIG. 7 , the expression of TNF- ⁇ was increased by about 2 times by irradiating UVB, and thus the increased expression of TNF- ⁇ was about 10ppm as dexamethasone was treated. On the other hand, it was reduced by about 35%, by about 24% by 1 ppm of SPM 1, and by about 56% by 1 ppm of SPM 2, and this inhibitory effect on the expression of TNF- ⁇ was dependent on the treatment concentration of SPM 1 and 2 showed a trend.
  • IL-6 As shown in FIG. 8, the expression of IL-6 was increased by about 1.6 times by irradiating UVB, and thus the increased expression of IL-6 was treated with 10 ppm of dexamethasone. On the other hand, it was reduced by about 88% with 1 ppm SPM 1, and about 92% reduced by 1 ppm SPM 2, and this inhibitory effect of IL-6 expression was also reduced by the treatment concentration of SPM 1 and 2 showed a tendency to depend on
  • Collagen a major component of the extracellular matrix, is synthesized in the form of a precursor called procollagen.
  • the procollagen is known to be cut and separated from collagen molecules when a polymerization reaction occurs. By measuring the amount of procollagen, the degree of collagen biosynthesis in the cell can be estimated.
  • Human dermal fibroblasts were treated with SPM 1 and SPM 2 at concentrations of 0.01, 0, 1, and 1 ppm, respectively, and cultured for 24 hours, and then the cultured cell medium was collected and procollagen typeI c-peptide (PIP) EIA kit. (TAKARA, MK101) was used to measure the amount of procollagen. At this time, the effect of the two reaction products SPM 1 and SPM 2 was confirmed by using a case in which nothing was treated as a negative control and a case in which 26.2 ppm of retinyl palmitate was treated as a positive control.
  • PIP procollagen typeI c-peptide
  • both reaction products showed a higher amount of procollagen than the negative control that was not treated with anything.
  • SPM 2 a higher amount of procollagen was confirmed compared to the positive control (retinyl palmitate at 26.2 ppm) at a concentration of 0.1 ppm or more. From this, it can be seen that all products produced from DHA by the protein of the present invention improve the procollagen synthesis ability.
  • MMPs matrix metalloproteinases
  • MMP-1 is an enzyme that degrades collagen.
  • the expression level of MMP-1 in the cell was confirmed.
  • the medium was exchanged with DPBS (WelGENE) at a concentration of 250 ⁇ l/well, and UVB of 100 mJ/cm 2 was irradiated, and the SPM 1 and SPM 2 were 0.01, 0,1 and 1 ppm, respectively.
  • DMEM 2% FBS
  • the amount of MMP-1 was measured using a human total MMP-1 ELISA kit (R&D systems, DY901). At this time, the effect of the two reaction products SPM 1 and SPM 2 was confirmed by using a case in which nothing was treated as a negative control and a case in which 6 ppm of retinoic acid was treated as a positive control.
  • the expression of MMP-1 increased by about 2 times by irradiating UVB, and the increased expression of MMP-1 decreased by about 70% by treatment with 6 ppm of retinoic acid.
  • SPM 1 when SPM 1 was treated, it was reduced by 17.2% and 80.1% at 0.1 ppm and 1ppm, respectively, and when SPM 2 was treated, it was reduced by 11.4% at 0.01ppm, 26.1% at 0.1ppm, and 63.3% at 1ppm.
  • the MMP-1 expression inhibitory effect also showed a tendency dependent on the treatment concentration of SPM 1 and 2.
  • Lipoxygenase having the amino acid sequence of SEQ ID NO: 1 was added to various concentrations of docosahexaenoic acid (DHA) and reacted for 30 minutes at pH 7, room temperature, and 1 M of 1 M to a final concentration of 50 mM After reducing the reaction product by adding sodium borohydride, 5 ⁇ l/ml of acetic acid was added to terminate the reaction. After purifying the reaction product using a solid phase cartridge (SPE, C18 500 mg), types of compounds in the reaction product were analyzed using Normal phase HPLC.
  • DHA docosahexaenoic acid
  • 17S-HDHA, Resolvin D5 (7S, 17S-diHDHA), and Protectin DX (10S, 17S-diHDHA) were prepared from the SPMs complex composition of Example [5-1] by prep HPLC with a C18 column or Diol column. Each product was separated and purified for use.
  • the complex compositions (Complexes 1 to 3) of 17-HDHA, Resolvin D5, and Protectin DX and each SPM-only material were used as HaCaT, which is a Changes in IL-6 expression were confirmed by treatment with cells.
  • human keratinocytes were aliquoted in a 48-well plate at a concentration of 4x10 4 pieces/well and incubated at 5% CO 2 , 37° C. for 24 hours, then the medium was removed and the starvation state was treated with DMEM Serum Free media. It was maintained for 24 hours.
  • the SPMs complex composition was diluted with DMEM (FBS 2%) to 0.5, 1, 2 and 5 ⁇ g/ml, and then cultured as described above and treated with human keratinocytes from which the medium was removed for 1 hour. Then, for IL-6 expression, the medium was exchanged with 250 ⁇ l of DPBS (WelGENE), irradiated with UVB of 160 mJ/cm 2 , treated with SPMs again, and cultured for 24 hours. And after collecting the medium, the amount of IL-6 was measured using Human IL-6 DuoSet ELISA (R&D system), respectively, and the cells attached to the bottom were washed with DPBS, and then dissolved with 1N NaOH for BCA analysis.
  • DMEM FBS 2%)
  • the amount of protein was measured through the to measure the amount of IL-6 synthesis per a given protein.
  • the case where nothing was treated after UVB irradiation was Con(-)
  • the case treated with 10 ⁇ M of hydrocortisone was Con(+)
  • the SPMs composite composition of the present invention and each single component IL-6 expression inhibitory effect was confirmed.
  • the expression of IL-6 was increased by irradiating the human keratinocytes with UVB, and the increased expression of IL-6 was 2 ⁇ g/ml of 17S-HDHA and protectin.
  • DX and Resolvin D5 were treated, respectively, compared to Con(-), they were reduced by 10.8%, 11.8%, and 0.5%, respectively, and showed a tendency dependent on the concentration of SPM treatment.
  • the expression of IL-6 was increased by irradiation with UVB, and the increased expression of IL-6 was the SPMs composite composition of the present invention (composition 1, 2, 3)
  • composition 1, 2, 3 When 2 ⁇ g/ml was treated, it was reduced by 18%, 33.8%, and 29.5%, respectively, compared to Con(-), and showed a tendency dependent on the concentration of SPM treatment.
  • composition 1 was 18%, composition 2 33.8%, and composition 3 29.5% expression of IL-6 compared to Con(-) This was reduced, and it was confirmed that the effect of reducing the expression of IL-6 was increased compared to when the SPM alone component was treated at the same concentration.
  • the SPMs composite composition of the present invention has a significantly increased inflammatory alleviation effect compared to the single component.
  • the above results mean that due to the synergistic effect of 17S-HDHA, PDX and RvD5, their usage can be reduced when using them as a complex composition than when using them alone, and from this, potential potential that may appear when using SPM in excess It can be seen that side effects can be prevented
  • Collagen a major component of the extracellular matrix, is synthesized in the form of a precursor called procollagen.
  • the procollagen is known to be cut and separated from collagen molecules when a polymerization reaction occurs. By measuring the amount of procollagen, the degree of collagen biosynthesis in the cell can be estimated.
  • Human dermal fibroblasts were treated with the SPM alone material and their complex compositions (compositions 1 to 3) at concentrations of 0.1, 1, 2, and 5 ⁇ g/ml, respectively, and cultured for 24 hours, then the cultured cell medium After collection, the amount of procollagen was measured with a procollagen typeI c-peptide (PIP) EIA kit (TAKARA, MK101). At this time, when nothing was treated as an untreated control, and when 50 ⁇ M of retinyl palmitate was treated as Con(+), SPM single component and their complex compositions (compositions 1 to 3) ) was confirmed.
  • PIP procollagen typeI c-peptide
  • 17-HDHA, Protectin DX, and Resolvin D5 all showed a higher amount of procollagen than the untreated control.
  • Protectin DX and Resolvin D5 showed higher amounts of procollagen than the positive control (50 ⁇ M retinyl palmitate) at a concentration of 1 ⁇ g/ml or higher.
  • compositions 1 to 3 with different mixing ratios showed two to three times more procollagen than the untreated control.
  • a greater amount of procollagen was confirmed in all of Compositions 1 to 3 compared to Con(+) treated with 50 ⁇ M retinyl palmitate at a concentration of 0.1 ⁇ g/ml or more.
  • the SPMs composite composition of the present invention significantly improves the procollagen synthesis ability.
  • the SPMs composite composition (compositions 1, 2, and 3) all showed a higher amount of procollagen than 17-HDHA, protectin Dx, or resolvin D5 alone components. .
  • the SPMs composite composition of the present invention has a significantly increased procollagen synthesis ability compared to the single component.
  • the above results mean that due to the synergistic effect of 17S-HDHA, PDX and RvD5, their usage can be reduced when using them as a complex composition than when using them alone, and from this, potential potential that may appear when using SPM in excess It can be seen that side effects can be prevented
  • MMP-1 Collagen degrading enzyme
  • MMPs matrix metalloproteinases
  • MMP-1 is an enzyme that degrades collagen.
  • the expression level of MMP-1 in the cell was confirmed.
  • the medium was exchanged with DPBS (WelGENE) at a concentration of 250 ⁇ l/well, and UVB of 100 mJ/cm 2 was irradiated, and the composition 2 was 0.1, 1, 2, and It was treated with DMEM (2% FBS) diluted to a concentration of 5 ppm and cultured for 48 hours.
  • DMEM 2% FBS
  • the amount of MMP-1 was measured using a human total MMP-1 ELISA kit (R&D systems, DY901). At this time, the case in which nothing was treated as a negative control, and when 20 ⁇ M of retinoic acid was treated as a positive control, the effect of composition 2 was confirmed.
  • the expression of MMP-1 increased by about 2 times by irradiating UVB, and the increased expression of MMP-1 decreased by about 70% by treatment with 20 ⁇ M of retinoic acid.
  • the SPMs complex composition was treated, it was reduced by 11.4% at 0.01 ppm, 26.1% at 0.1 ppm, and 63.3% at 1 ppm, and this MMP-1 expression inhibitory effect also tends to depend on the concentration of the treatment of the SPMs complex composition. was shown.
  • the SPMs composite composition of the present invention is excellent in the effect of improving skin wrinkles.
  • TNF- ⁇ As a representative inflammatory cytokine, TNF- ⁇ is known to exacerbate inflammatory skin diseases when its expression level is increased. TNF- ⁇ , a tumor necrosis factor, is an important factor that plays the most central role in many inflammatory responses, and the regulation of TNF- ⁇ expression plays an important role in inflammatory diseases. Therefore, in order to confirm the anti-inflammatory effect of the SPMs complex composition of the present invention, the expression pattern of TNF- ⁇ was confirmed.
  • human keratinocytes were aliquoted in a 48-well plate at a concentration of 4x10 4 pieces/well, and incubated at 5% CO 2 , 37° C. for 24 hours, the medium was removed and the starvation state was treated with DMEM Serum Free media. held for hours.
  • composition 2 was diluted with DMEM (2% FBS) to 0.5, 1, 2 and 5 ⁇ g/ml, and then cultured as above and treated with human keratinocytes from which the medium was removed for 1 hour. Then, for TNF- ⁇ expression, the medium was exchanged with 250 ⁇ l of DPBS (WelGENE), irradiated with UVB of 160 mJ/cm 2 , treated with SPMs again, and cultured for 24 hours.
  • DMEM 2% FBS
  • DPBS DPBS
  • the amount of TNF- ⁇ was measured using Human TNF- ⁇ DuoSet ELISA (R&D system), respectively, and the cells attached to the bottom were washed with DPBS, and then dissolved with 1N NaOH for BCA analysis The amount of TNF- ⁇ was measured per protein by measuring the amount of protein through the At this time, the case in which nothing was treated as a negative control, and the case treated with 10 ⁇ M of hydrocortisone as a positive control, the effect of the SPMs complex composition was confirmed.
  • TNF- ⁇ As a result, in the case of TNF- ⁇ , as shown in FIG. 14, the expression of TNF- ⁇ increased by about 5 times by irradiating UVB, and the increased expression of TNF- ⁇ was treated with 10 ⁇ M of hydrocortisone. On the other hand, it was reduced by about 52% according to the SPMs complex composition, and was reduced by about 49% by the 1ppm SPMs complex composition, and this TNF- ⁇ expression inhibitory effect showed a tendency dependent on the treatment concentration of the SPMs complex composition.
  • the SPMs composite composition of the present invention has an excellent effect of terminating inflammation.
  • Nitric oxide a type of reactive oxygen species that is known to play an important role in inducing inflammation, is a highly reactive biogenic molecule. NO, a key molecule involved in the inflammatory response, is an inflammatory mediator and accelerates the inflammatory response, further exacerbating the inflammatory response. Therefore, the amount of NO production was confirmed with respect to the stimulus induced by fine dust.
  • the amount of NO generated from the cells was measured using the Griess Reagent System to measure the nitrite concentration in the cell culture medium, and the NO concentration in the culture medium was determined using a standard curve for each concentration of sodium nitrite.
  • the SPMs complex composition of the present invention has an effect of alleviating inflammation.
  • Lipid peroxiation of cells is one of the mechanisms of cellular damage that occurs during aging or disease in animals and plants, and the degree of cellular damage can be confirmed by measuring total malondialdehyde (MDA), a product of lipid peroxidation. Therefore, the amount of MDA produced by the SPMs complex composition was confirmed for the stimulus induced by fine dust.
  • MDA malondialdehyde
  • MDA malondialdehyde
  • TSA thiobarbituric acid
  • the SPMs composite composition of the present invention has an effect of inhibiting skin aging.
  • Filaggrin, Loricrin, and Involucrin are known as core proteins constituting the skin barrier.
  • filaggrin is a protein produced by decomposition of profilagrin, which constitutes keratohyaline granule (KG) present in granule cells of the epidermis, and plays an important role in the skin barrier by aggregating keratin filaments in keratinocytes. Therefore, it was attempted to confirm the skin barrier strengthening effect by confirming the expression of filaggrin and loricrin by the sample.
  • Human keratinocytes were cultured in DMEM medium under the same conditions as in Example 9.
  • the cultured cells were treated with the SPMs complex composition of the present invention by concentration and cultured, then RNA was extracted and RT-PCR was performed.
  • the amplified gene was analyzed using the Gel documentation system and Image J program.
  • the SPMs complex composition of the present invention has the effect of strengthening the skin barrier.
  • a cream (Cream S) was prepared with the composition shown in Table 11 below using the SPMs complex composition.
  • ceramide cream (cream C) and base cream (cream B) were also prepared with the following composition.
  • the human efficacy evaluation for skin barrier improvement was conducted on 12 women (mean age 45 years ⁇ 5.54).
  • the forearm was used as the test site, and the physical damage was divided into 3 parts of the test part and the control part (no application) and applied to 4 parts, and then Cream S (SPM cream), Cream C (Ceramide cream), and Cream B (Base cream) were applied. It was allowed to be used twice a day for 1 week and twice a day at each designated site, and device measurement was performed in comparison with the control site (no application).
  • Measurements and efficacy questionnaire evaluation were conducted before skin damage, immediately after skin damage, 1 day, 4 days, and 7 days after using the test product.
  • the skin barrier improvement effect was confirmed by measuring TEWL (Transepidermal Water Loss) using Tewameter TM300.
  • the ceramide cream which is most widely used as a skin barrier improvement material, has no significant improvement compared to the base cream, whereas the SPM cream has a statistically significant skin barrier improvement effect compared to the non-applied group and the base cream.
  • the skin barrier recovery rate %
  • a human efficacy evaluation was conducted for relieving itching caused by dryness in 22 subjects. After measuring skin moisture, 11 people were randomly assigned to each of the test products Cream S and Cream C by matching the mean values between the groups to use each product. The forearm and dryness lesions were used as test sites, and device measurement and efficacy questionnaire evaluation were conducted before product use, 2 weeks after product use, and 4 weeks after product use.
  • the improvement effect of atopic dermatitis was confirmed by measuring skin moisture using Comeometer CM825, measuring skin moisture loss using Tewameter TM300, and evaluating improvement during itching (VAS).
  • the most widely used ceramide cream for alleviating the dry symptoms of atopic dermatitis showed an increase in skin moisture content compared to before product use, but there was no statistical significance, whereas the SPM cream was statistically significant at the lesion site. was confirmed to exhibit the skin moisture improvement effect of (2 weeks, 4 weeks of use; ⁇ 0.014, p ⁇ 0.0115).
  • the SPM cream of the present invention improves skin barrier and improves skin barrier and itchiness at an equivalent level or higher than ceramide, which is generally used as a functional material for improving skin pruritus, moisture, and itching caused by dry skin such as atopic dermatitis. It can be seen that the improvement effect is exhibited.
  • the human efficacy evaluation was conducted for 20 selected test subjects on the improvement of wrinkles around the eyes and skin moisture of Cream A and Cream S.
  • the eye area was used as the test site, and 10 subjects were instructed to use Cream A and the remaining 10 subjects to use Cream S twice a day for 8 weeks, respectively.
  • the effect of improving wrinkles and skin moisture was confirmed through instrumental measurement on the test subjects.
  • Antera 3D CS was used to measure wrinkles around the eyes, and a Comeometer was used to measure skin moisture.
  • the skin wrinkle improvement rate (%) of Cream A containing retinol, a functionally notified wrinkle improvement ingredient was not statistically significant compared to before product use, but SPM cream was used at 4 weeks and 8 weeks of use. It was confirmed that the skin wrinkle improvement rate (%) was significant compared to before (t-test (equal variance hypothetical group, two-sided test); *, p ⁇ 0.05); **, p ⁇ 0.01; ***, p ⁇ 0.001).
  • the SPM cream of the present invention exhibits an effect of improving the amount of moisture in the skin around the eyes and improving the skin wrinkles around the eyes at a level equal to or higher than that of retinol, which is a raw material for improving wrinkles.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Dermatology (AREA)
  • Epidemiology (AREA)
  • Birds (AREA)
  • Emergency Medicine (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Cosmetics (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 다중불포화지방산의 하이드록시 유도체 생성용 효소, 이를 이용한 다중불포화지방산의 하이드록시 유도체 생산 방법, 및 다중불포화지방산 하이드록시 유도체들을 포함하는 SPMs 복합 조성물에 관한 것이다. 상기 효소는 단 한번의 반응으로 다중불포화지방산의 하이드록시 유도체를 생산해 낼 수 있어서 생체 외 생산에 매우 유용하게 이용될 수 있고, 다중불포화지방산 하이드록시 유도체들을 포함하는 SPMs 복합 조성물은 콜라겐 생성을 촉진하고, NO 생성과 TNF-α, IL-6의 발현을 억제하며, 필라그린(Filaggrin), 로리크린(Loricrin)의 발현을 증가시키므로, 피부 노화나 주름을 예방 또는 개선하거나, 피부 장벽을 강화하거나, 아토피피부염을 포함하는 피부 질환을 예방, 개선 또는 치료하는데 유용하게 이용할 수 있다.

Description

다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체, 이의 생산 방법 및 이의 용도
본 발명은 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법 및 다중불포화지방산의 유도체들을 포함하는 복합 조성물의 피부 주름 개선, 피부 염증 개선 또는 피부 장벽 강화 용도에 관한 것이다.
염증 반응은 병원균의 감염 및 각종 독성물질에 대한 인체의 일차적인 방어 수단으로서 중요한 역할을 하지만, 동시에 다양한 만성질환을 유발하는 기저 요인으로 작용할 수 있기 때문에, 체내의 정교한 조절 기작에 의해 엄격히 조절되어야 하는 생리 현상이다.
오메가-6 다중불포화지방산에 해당하는 아라키돈산(arachidonic acid, C20: 4n-6)의 유도체인 프로스타그란딘(prostaglandin) 혹은 류코트리엔(leukotriene)은 대표적인 염증반응 개시 신호물질로서, 체내에서 다양한 만성질환을 유발할 수 있는 염증반응의 불균형을 유도한다. 일반적으로, 염증반응 반응의 종결은 염증반응 개시 신호물질이 생성되지 않으면, 염증반응은 자연스럽게 종결되는 것으로 인식되어 상기 물질의 생성을 저해하는 다양한 스테로이드 또는 비스테로이드 계열의 항염증 치료제들이 개발되었다. 그러나 최근 염증반응의 종결 기작도 정교한 조절 과정에 의해 이루어지고, 그 과정에 오메가-3 다중불포화지방산 도코사헥사노엔산(docosahexaenoic acid; DHA, C22: 6n-3) 및 에이코사펜타엔산(eicosapentaenoic acid; EPA, C20: 5n-3)의 수산화 유도체가 상기 염증 반응의 종결 기작에 작용하는 신호물질로서의 역할로 작용할 수 있음이 확인되었다. 이렇게 염증 반응의 종결 기작의 신호물질로 작용하는 것들을 SPM(specialized proresolving mediators; resolvins, protectins, maresins)이라고 명명하였는데, 이들은 기존의 항염증 치료제인 코르티코스테로이드(corticosteroids) 및 NSAID(non-steroid anti-inflammatory drug) 아스피린에 비해 월등한 효과를 발휘하는 것으로 확인되었다.
또한 상기 SPM은 주로 염증 반응 개시 신호물질의 생성 억제를 유도하는 기존의 스테로이드 또는 비스테로이드 계열 항염증 치료제와 달리 염증 반응 전(全)단계에 걸쳐 효능을 보이는 장점이 있다. 이에, 상기 SPM을 이용하여 각종 만성염증 질환(혈관, 심근경색, 뇌졸중, 치매, 골관절염, 천식을 비롯한 폐질환, 위장관염, 치주염, 안구 건조증, 지방간 등 각종 만성염증 질환), 감염 패혈증, 화상, 창상 회복, 통증, 암, 당뇨 등과 같은 다양한 질환에 대한 치료 효능의 존재 여부에 대해 연구가 활발하게 진행 중이다.
한편, 생체 내 염증반응 종결 신호 물질 SPM은 오메가-3 다중불포화지방산에 하이드록시기가 2개 혹은 3개가 삽입된 구조로, 두 가지 이상의 효소들의 연속적인 작용을 통해 매우 극미량 생성되는 것으로 알려져 있다. 이에, 염증반응 종결 신호물질의 효능 및 치료제 개발을 위하여 충분한 SPM을 생성하기 위하여, 유기합성 공정을 통하여 제조하기 위한 노력이 지속되고 있으나(비특허문헌 1 참고), 그 공정이 매우 복잡하다는 한계점이 존재한다.
이에, 생체 외 효소 반응을 통하여 오메가-3 다중불포화지방산을 이용하여 모노-하이드록시 또는 디-하이드록시 유도체를 효율적으로 생산할 수 있는 기술 개발의 필요성이 지속적으로 요구되고 있는 실정이다.
한편, 피부는 외부 유해 환경으로부터 인체를 보호하는 중요한 기관이자 가장 큰 면적을 가진 면역 기관이다. 피부의 최외곽을 구성하고 있는 각질층은 물리적, 화학적 손상에 대한 저항력을 가지며 미생물과 유해한 화학 물질 등이 체내로 침투하는 것을 방지한다. 또한 각질형성세포, 랑게르한스세포, 섬유아세포, 비만세포, 수지상세포 및 모세혈관 내피세포 등이 복잡한 면역체계를 형성하여 외부로부터 항원 침투 시 면역반응을 통해 인체를 보호한다.
피부는 끊임없이 외부로부터 자극 (자외선, 화학물질, 열, 물리적 마찰)을 받고 있으며 최근에는 미세먼지, blue light 등과 같이 새로운 자극원이 늘어나고 있다. 뿐만 아니라 정신적인 스트레스, 수면장애, 영양 불균형 그리고 약물치료 등의 내적인 요인도 피부에 스트레스를 주는 원인으로 알려져 있다.
최근 연구에 따르면 피부의 자극으로 인해 염증반응이 일어나며 이러한 염증반응이 피부의 노화를 초래한다는 연구 결과들이 발표되고 있다. Franceschi는 2000년 inflammaging이라는 용어를 처음 사용하여 염증과 노화의 상관관계를 설명하였고, 만성적인 염증이 노화나 노화와 연관된 질병인 당뇨, 동맥경화, 치매 등의 원인이 된다는 연구결과가 지속적으로 발표가 되고 있다.
염증 개시 단계에 분비되는 전염증성 사이토카인 (pro-inflammatory cytokine)은 기질금속단백질분해효소 (Matrix metalloproteinases, MMPs)의 발현을 촉진한다. MMPs 증가는 피부노화와 직접적으로 관련이 있다고 알려져 있으며 피부의 구성성분 중 70%를 차지하는 콜라겐 등을 분해하여 주름 생성과 탄력감소 등의 노화를 촉진한다.
일반적으로 피부노화를 억제하기 위해 사용되는 물질로는 활성산소 제거를 위한 Superoxide dismutase 등의 효소 또는 비타민C, 토코페롤 등의 항산화제, 보툴리움 관련 펩타이드 그리고 레티놀과 같은 비타민 A 유도체 등이 있다. 이 중 비타민 A 유도체류가 콜라겐 합성능이 뛰어나 주름 제거의 효과가 가장 뛰어난 반면 빛이나 열에 불안정 하여 피부 자극을 유발하는 등의 부작용이 있고 제형 내 함량이 불안정한 문제가 있다.
아토피 피부염은 유전적, 환경적, 면역학적 이상반응과 피부장벽의 붕괴로 인해 발병되는 질환으로 건조증, 소양증, 홍반성 습진을 야기하는 만성 염증성 피부질환이다. 최근 전세계적으로 환경변화, 식습관 및 환경오염 등에 의해 유병률이 증가하고 있어 해결 수단에 대한 관심도 증가하고 있다. 그러나 원인이 규명되지 않아 근본적인 치료가 어려워 대부분이 증상 치료에 의존하고 있다.
한편, 도코사헥사노엔산(docosahexaenoic acid; DHA, C22: 6n-3) 및 에이코사펜타엔산(eicosapentaenoic acid; EPA, C20: 5n-3)의 수산화 유도체는 염증 반응의 종결 기작에 작용하는 신호물질로 작용할 수 있음이 확인되었으며, 이렇게 염증 반응의 종결 기작의 신호물질로 작용하는 것들을 SPM(specialized proresolving mediators; resolvins, protectins, maresins)이라고 명명하였다.
최근 상기 SPM을 이용하여 각종 만성염증 질환(예: 혈관, 심근경색, 뇌졸중, 치매, 골관절염, 천식을 비롯한 폐질환, 위장관염, 치주염, 안구 건조증, 지방간 등), 감염 패혈증, 화상, 창상 회복, 통증, 암, 당뇨 치료제로 연구가 활발하게 진행되어 왔으나, 피부 노화 개선, 피부 장벽 강화 및 아토피 피부염에 미치는 효과에 대한 연구와 실험은 미미한 실정이다.
본 발명의 일 목적은 다중불포화지방산으로부터 모노-하이드록시 또는 디-하이드록시 유도체를 생성할 수 있는 효소와, 이를 이용하여 인 비보(in vivo) 또는 인 비트로(in vitro) 내에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체를 생산할 수 있는 방법을 제공하는 것이다.
본 발명의 다른 목적은 피부 주름 예방 또는 개선, 피부 노화 예방 또는 개선, 피부 염증 예방 또는 개선, 피부 재생 및 피부 장벽 강화를 통해 피부 상태를 개선하기 위한 화장료 조성물, 또는 식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 피부 상처, 피부 흉터, 피부염, 아토피 피부염, 소양증, 습진성 피부질환, 건성 습진, 무좀, 홍반, 두드러기, 건선, 약발진, 여드름 및 탈모로 이루어진 군에서 선택되는 1종 이상의 피부 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 다중불포화지방산의 하이드록시 유도체를 유효성분으로 함유하는 복합 조성물의 유효량을 개체에 투여하는 단계를 포함하는 피부 상태를 개선시키는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 다중불포화지방산의 하이드록시 유도체를 유효성분으로 함유하는 복합 조성물을 개체에 투여하는 단계를 포함하는 피부 질환의 예방 또는 치료방법을 제공하는 것이다.
본 발명의 또 다른 목적은 피부 질환의 예방 또는 치료를 위한 의약의 제조에 있어서, 다중불포화지방산의 하이드록시 유도체를 유효성분으로 함유하는 복합 조성물의 용도를 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명의 일 측면은 서열번호 1 또는 서열번호 2과 90% 이상의 상동성을 가지는 아미노산 서열을 포함하는 다중불포화지방산의 모노-하이드록시(mono-hydroxy) 또는 디-하이드록시(di-hydroxy) 유도체생성용 효소를 제공한다.
본 발명의 다른 측면은 상기 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소를 다중불포화지방산과 반응시키는 단계를 포함하는, 인 비트로(in vitro)에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법을 제공한다.
본 발명의 또 다른 측면은 상기 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소를 암호화하는 유전자가 형질도입된 형질전환체를, 다중불포화지방산의 존재 하에서 배양하는 단계 및 상기 배양된 배양물에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체를 분리하는 단계를 포함하는, 인 비보(in vivo)에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법을 제공한다.
본 발명의 또 다른 측면은, 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 포함하는 피부 상태 개선용 화장료 조성물을 제공한다.
본 발명의 또 다른 측면은 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 포함하는 피부 상태 개선용 식품 조성물을 제공한다.
본 발명의 또 다른 측면은 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 포함하는 피부 질환의 예방 또는 치료용 약학 조성물을 제공한다.
본 발명의 또 다른 측면은 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 함유하는 복합 조성물의 유효량을 피부 상태 개선이 필요한 개체에 투여하는 단계를 포함하는 피부 상태를 개선시키는 방법을 제공한다.
본 발명의 또 다른 측면은 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 함유하는 복합 조성물을 피부 질환의 치료가 필요한 개체에 투여하는 단계를 포함하는 피부 질환의 예방 또는 치료방법을 제공한다.
본 발명의 또 다른 측면은 피부 질환의 예방 또는 치료에 사용하기 위한 용도의, 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 함유하는 복합 조성물을 제공하는 것이다.
본 발명의 효소는 다중불포화지방산을 기질로 이용하여 모노-하이드록시 또는 디-하이드록시 유도체를 단 한번의 반응으로 생산해 낼 수 있는바, 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생체 외 생산에 매우 유용하게 이용될 수 있다.
본 발명의 도코사헥사엔산 하이드록시 유도체들을 포함하는 SPMs 복합 조성물은 콜라겐 합성을 증가시키고 손상된 피부 장벽을 회복시키며 경피 수분 손실을 감소시키는바, 피부 노화를 억제하거나 피부 주름을 개선하는 효과가 있다.
또한, 본 발명의 SPMs 복합 조성물은 TNF-α, IL-6의 발현 억제 효과, 필라그린(Filaggrin), 로리크린(Loricrin) 발현 증가 효과 및 항산화 효과가 현저하게 향상되어 피부 장벽을 강화시키며, 아토피 피부염을 포함하는 다양한 피부 질환을 예방 또는 치료하는 효과가 있다.
다만, 본 발명의 효과는 상기에서 언급한 효과로 제한되지 아니하며, 언급되지 않은 또 다른 효과들은 하기의 기재로부터 당업자에게 명확히 이해될 수 있을 것이다.
도 1은 서열번호 1의 아미노산 서열을 포함하는 단백질(A)과 서열번호 2의 아미노산 서열을 포함하는 단백질(B)의 과발현 여부를 SDS-PAGE로 확인한 결과를 나타낸 것이다.
도 2는 서열번호 1의 아미노산 서열을 포함하는 단백질과 도코사헥사노엔산(DHA)의 반응 생성물을 대상으로 순상 HPLC 분석을 수행한 결과를 나타낸 것이다.
도 3은 서열번호 2의 아미노산 서열을 포함하는 단백질과 도코사헥사노엔산(DHA)의 반응 생성물을 대상으로 순상 HPLC 분석을 수행한 결과를 나타낸 것이다.
도 4a-d는 서열번호 1의 아미노산 서열을 포함하는 단백질(K1)과 서열번호 2의 아미노산 서열을 포함하는 단백질(K2)에 대하여, 유사한 활성을 갖는 리폭시게나아제 효소인 인간 5LOX(AAA36183), 인간 12LOX(AAA51533), 인간 15LOX(AAA36183), 콩 15LOX(AAA33986), 감자 LOX(AAB81595) 및 홍조류 PhLOX2(AGN54275)와 각각 아미노산 서열의 상동성을 분석한 결과를 나타낸 것이다.
도 5는 인간 진피 섬유아세포에 대한, 서열번호 1의 아미노산 서열을 포함하는 단백질에 의해 생성된 하이드록시 유도체(SPM 1)와 서열번호 2의 아미노산 서열을 포함하는 단백질에 의해 생성된 하이드록시 유도체(SPM 2)의 세포 독성을 확인한 결과를 나타낸 것이다.
도 6은 인간 각질형성세포에 대한, 서열번호 1의 아미노산 서열을 포함하는 단백질에 의해 생성된 하이드록시 유도체(SPM 1)와 서열번호 2의 아미노산 서열을 포함하는 단백질에 의해 생성된 하이드록시 유도체(SPM 2)의 세포 독성을 확인한 결과를 나타낸 것이다.
도 7 및 도 8은 인간 각질형성세포에 대하여, 서열번호 1의 아미노산 서열을 포함하는 단백질에 의해 생성된 하이드록시 유도체(SPM 1)와 서열번호 2의 아미노산 서열을 포함하는 단백질에 의해 생성된 하이드록시 유도체(SPM 2)의 TNF-α 발현 억제 활성(도 7) 및 IL-6 발현 억제 활성(도 8)을 확인한 결과를 나타낸 것이다.
도 9는 인간 진피 섬유아세포에 대하여, 서열번호 1의 아미노산 서열을 포함하는 단백질에 의해 생성된 하이드록시 유도체(SPM 1)와 서열번호 2의 아미노산 서열을 포함하는 단백질에 의해 생성된 하이드록시 유도체(SPM 2)의 콜라겐 생성 향상 활성을 확인한 결과를 나타낸 것이다.
도 10은 인간 진피 섬유아세포에 대하여, 서열번호 1의 아미노산 서열을 포함하는 단백질에 의해 생성된 하이드록시 유도체(SPM 1)와 서열번호 2의 아미노산 서열을 포함하는 단백질에 의해 생성된 하이드록시 유도체(SPM 2)의 콜라겐 분해효소 생성 저해 활성을 확인한 결과를 나타낸 것이다.
도 11은 인간 각질형성세포에 대하여, 단독 성분 및 SPMs 복합 조성물의 IL-6 발현 억제 활성을 비교한 결과를 나타낸 것이다: 도 11a는 17S-HDHA, 프로텍틴 DX 및 레졸빈 D5 각각의 농도별 IL-6 발현 억제 활성을 나타낸 것이고, 도 11b는 본 발명의 SPMs 복합 조성물 1 내지 3의 농도별 IL-6 발현 억제 활성을 나타낸 것이고, 도 11c는 단독 성분 대비 본 발명의 SPMs 복합 조성물의 상승적 IL-6 발현 억제 효과를 나타낸 것이다[Untreated control: UVB를 조사하지 않은 군, Con(-): UVB를 조사한 후 아무것도 처리하지 않은 군, Con(+) H.C.: UVB를 조사한 후 하이드로코르티손을 처리한 양성 대조군].
도 12는 인간 진피 섬유아세포에 대하여, 단독 성분 및 SPMs 복합 조성물의 프로콜라겐 합성 효과를 확인한 결과를 나타낸 것이다: 도 12a는 17S-HDHA, 프로텍틴 DX 및 레졸빈 D5 각각의 농도별 프로콜라겐 합성 효과를 나타낸 것이고, 도 12b는 본 발명의 SPMS 복합 조성물 1 내지 3의 농도별 프로콜라겐 합성 효과를 나타낸 것이고, 도 12c는 SPM 단독 성분 대비 본 발명의 SPMs 복합 조성물의 상승적 프로콜라겐 합성 효과를 나타낸 것이다[Untreated control: 아무것도 처리하지 않은 군, Con(+) R.P.: 레티닐팔미테이트를 처리한 양성 대조군].
도 13은 인간 진피 섬유아세포에 대하여, 본 발명의 SPMs 복합 조성물의 콜라겐 분해효소(MMP-1) 발현 억제능 향상 효과를 확인한 결과를 나타낸 것이다[Untreated control: UVB를 조사하지 않은 군, Control: UVB를 조사한 후 아무것도 처리하지 않은 군, Retinoic acid: UVB를 조사한 후 레티노산을 처리한 양성 대조군].
도 14는 인간 각질형성세포에 대하여, 본 발명의 SPMs 복합 조성물의 TNF-α 발현 억제능 향상 효과를 확인한 결과를 나타낸 것이다[Untreated control: UVB를 조사하지 않은 군, Control: UVB를 조사한 후 아무것도 처리하지 않은 군, Hydrocortisone: UVB를 조사한 후 하이드로코르티손을 처리한 양성 대조군].
도 15는 본 발명의 SPMs 복합 조성물의 NO 생성 감소 효과를 확인한 결과를 나타낸 것이다[Untreated control: UVB를 조사하지 않은 군, Control: UVB를 조사한 후 아무것도 처리하지 않은 군, Hydrocortisone: UVB를 조사한 후 하이드로코르티손을 처리한 양성 대조군, Vit.C: UVB를 조사한 후 비타민 C를 처리한 양성 대조군].
도 16은 미세먼지로 유도된 자극에 대하여, 본 발명의 SPMs 복합 조성물의 지질과산화물 생성 감소 효과를 확인한 결과를 나타낸 것이다[Untreated control: 미세먼지를 처리하지 않은 군, Control: 미세먼지로 자극 유도 후 아무것도 처리하지 않은 군, Hydrocortisone: 미세먼지로 자극 유도 후 하이드로코르티손을 처리한 양성 대조군, Vit.C: 미세먼지로 자극 유도 후 비타민 C를 처리한 양성 대조군].
도 17은 본 발명의 SPMs 복합 조성물에 의한 피부장벽 개선 효과를 피부장벽을 구성하는 핵심 단백질의 발현 수준을 통해 확인한 결과를 나타낸 것이다: 도 17a는 필라그린(filaggrin)의 발현 증가를 확인한 결과이고, 도 17b는 로리크린(loricrin)의 발현 증가를 확인한 결과이다[Untreated control: 아무것도 처리하지 않은 군, Hyaluronic acid: 히알루론산을 처리한 양성 대조군].
도 18은 인체효능평가를 통하여, 본 발명의 SMPs 복합 조성물에 의한 피부장벽 개선 효과를 확인한 결과를 나타낸 것이다: 도 18a는 피부장벽지수 변화율(%)을 나타낸 것이고, 도 18b는 피부장벽 회복율(%)을 나타낸 것이다.
도 19는 인체효능평가를 통하여, 본 발명의 SMPs 복합 조성물에 의한 아토피피부염 개선 효과를 확인한 결과를 나타낸 것이다: 도 19a는 병변 부위에서 피부수분변화율(%)을 나타낸 것이고, 도 19b는 병변 부위에서 경피수분손실량 변화율(%)을 나타낸 것이며, 도 19c는 병변 부위에서 피부가려움지수 변화율(%)을 나타낸 것이다.
도 20은 인체효능평가를 통하여, 본 발명의 SPMs 복합 조성물에 의한 눈가주름 및 피부수분개선 효과를 확인한 결과를 나타낸 것이다: 도 20a는 눈가주름 변화율(%)을 나타낸 것이고, 도 20b는 눈가피부 수분량을 나타낸 것이며, 도 20c는 눈가피부 수분 개선율(%)을 나타낸 것이다.
이하, 본 발명을 상세히 설명한다.
다중불포화지방산의 모노-하이드록시(mono-hydroxy) 또는 디-하이드록시(di-hydroxy) 유도체 생성용 효소
본 발명의 일 측면은 다중불포화지방산의 모노-하이드록시(mono-hydroxy) 또는 디-하이드록시(di-hydroxy) 유도체 생성용 효소를 제공한다.
또한, 본 발명의 다른 측면은, 상기 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소를 암호화하는 핵산분자를 제공한다.
본 발명의 상기 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소는 서열번호 1 또는 서열번호 2의 아미노산 서열을 포함하고, 상기 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소의 기능에 영향을 미치지 않는 범위 내에서, 아미노산 잔기의 결실, 삽입, 치환 또는 이들의 조합에 의해서 상이한 서열을 가지는 아미노산의 변이체들, 또는 단편들일 수 있다. 상기 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소의 활성을 전체적으로 변경시키지 않는 단백질 및 펩티드 수준에서의 아미노산 교환은 당해 분야에 공지되어 있다. 경우에 따라서는 인산화(phosphorylation), 황화(sulfation), 아크릴화(acrylation), 당화(glycosylation), 메틸화(methylation), 파네실화(farnesylation) 등으로 변형될 수 있다. 따라서 본 발명은 서열번호 1 또는 서열번호 2의 아미노산 서열을 포함하는 단백질과 실질적으로 동일한 아미노산 서열을 갖는 단백질 및 이의 변이체 또는 이의 활성 단편을 포함한다. 상기 실질적으로 동일한 단백질이란 90％ 이상, 바람직하게는 93％ 이상, 가장 바람직하게는 95％ 이상의 아미노산 서열의 상동성을 갖는 것들을 의미하나 이에 한정되지 않으며, 90% 이상의 아미노산 서열의 상동성을 가지며 동일한 효소 활성을 가진다면 본 발명의 범위에 포함된다.
상기 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소의 유전자는 서열번호 3 또는 서열번호 4의 뉴클레오티드 서열로 이루어진 것이 바람직하다. 그러나 본 발명의 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소 및 이의 변이체 또는 이의 활성 단편을 암호화하는 핵산분자는 암호화 영역으로부터 발현되는 상기 효소 및 이의 변이체 또는 이의 활성 단편의 아미노산 서열을 변화시키지 않는 범위 내에서 암호화 영역에 다양한 변형이 이루어질 수 있고, 암호화 영역을 제외한 부분에서도 유전자의 발현에 영향을 미치지 않는 범위 내에서 다양한 변이가 이루어질 수 있으며, 이러한 변이 유전자 역시 본 발명의 범위에 포함된다. 따라서 본 발명은 서열번호 3 또는 서열번호 4의 핵산분자와 실질적으로 동일한 뉴클레오티드 서열로 이루어진 유전자 및 상기 유전자의 단편을 포함한다. 상기 실질적으로 동일한 뉴클레오티드 서열로 이루어진 유전자란 80％ 이상, 바람직하게는 90％ 이상, 가장 바람직하게는 95％ 이상의 서열 상동성을 갖는 것들을 의미하나, 이에 한정되는 것은 아니며, 80% 이상의 서열 상동성을 가지며 암호화된 단백질이 동일한 효소 활성을 가진다면 본 발명에 포함된다. 상기와 같이, 본 발명의 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소의 유전자는 이와 동등한 활성을 갖는 단백질을 암호화하는 한, 하나 이상의 핵산 염기가 치환, 결실, 삽입 또는 이들의 조합에 의해 변이될 수 있으며, 이들 또한 본 발명의 범위에 포함된다.
상기 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소에 포함되는, 서열번호 1의 아미노산 서열은 바람직하게는 서열번호 3의 뉴클레오티드 서열로 이루어진 유전자에 의해 암호화되고, 서열번호 2의 아미노산 서열은 바람직하게는 서열번호 4의 뉴클레오티드 서열로 이루어진 유전자에 의해 암호화되나, 본 발명은 이에 한정되지 않고, 동일 아미노산 서열을 갖는 본 발명의 단백질을 암호화할 수 있는 한, 서열번호 3 또는 서열번호 4의 뉴클레오티드 서열과 실질적으로 동일한 다른 뉴클레오티드 서열로 이루어진 유전자에 의해 암호화될 수도 있다. 이러한 뉴클레오티드 서열은 단일 가닥 또는 이중 가닥일 수 있으며, DNA 분자 또는 RNA 분자일 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 서열번호 1 또는 서열번호 2의 아미노산 서열을 갖는 단백질의 기능을 규명하기 위하여 상기 서열번호 1 또는 서열번호 2의 아미노산 서열을 갖는 단백질을 분리 및 정제하였고(도 1 참고), 그 활성을 연구한 결과 상기 서열번호 1 또는 서열번호 2의 아미노산 서열을 갖는 단백질이 다중불포화지방산에 2개의 수산기가 도입된 모노-하이드록시 또는 디-하이드록시 유도체를 생성할 수 있는 효소로서의 활성을 가진다는 것을 확인하였다(도 2, 3 참고).
다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소의 발현 벡터 및 형질전환체
본 발명의 또 다른 측면은 본 발명의 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소의 유전자가 포함된 재조합 발현 벡터 및 상기 발현 벡터가 도입된 형질전환체를 제공한다.
본 발명의 재조합 발현 벡터는 상기 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소의 유전자를 포함한다.
상기 발현 벡터는 플라스미드 벡터, 코즈미드 벡터, 박테리오파이지 벡터 및 바이러스 벡터 등을 포함하나 이에 한정되지 않는다.
상기 재조합 발현 벡터는 본 발명의 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소를 생산하고자 하는 숙주 세포의 종류에 따라 프로모터(promoter), 터미네이터(terminator), 엔핸서(enhancer) 등과 같은 발현조절서열, 또는 분비를 위한 서열 등을 적절히 목적에 따라 조합할 수 있다.
상기 발현 벡터는 벡터가 도입된 숙주 세포를 선택하기 위한 선택 마커를 추가로 포함할 수 있고, 복제 가능한 발현 벡터인 경우 복제 기원을 포함할 수 있다.
또한, 상기 재조합 발현 벡터는 발현 단백질의 정제를 용이하게 하기 위한 서열을 포함할 수 있으며, 구체적으로 본 발명의 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소를 암호화하는 유전자에 작동 가능하도록 분리정제용 태그를 암호화하는 유전자가 연결될 수 있다. 이때, 상기 분리정제용 태그는 GST, poly-Arg, FLAG, 히스티딘-태그(His-tag) 및 c-myc 등이 단독으로 사용되거나 이들 중 두 개 이상을 순차적으로 연결하여 사용할 수도 있다.
상기 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소를 암호화하는 유전자는 제한효소 절단위치를 통해 클로닝될 수 있으며, 상기 벡터에 단백질 절단효소 인식부위를 암호화하는 유전자가 사용된 경우에는 상기 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소의 유전자와 틀이 맞도록(in frame) 연결되어, 상기 효소를 수득한 후 단백질 절단 효소로 절단 시, 원래 형태의 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소가 생산될 수 있도록 할 수 있다.
본 발명의 구체적인 실시예에서는, 본 발명의 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소 유전자(서열번호 3 또는 서열번호 4의 뉴클레오티드 서열을 포함하는 유전자)를 플라스미드 벡터인 pET28a(+)에 삽입함으로써 재조합 클로닝 벡터를 제조하였다. 상기의 클로닝 벡터의 제조에 이용된 pET28a(+) 이외에도 다양한 원핵세포용 벡터 또는 진핵세포용(pPIC 및 pPICZ 등) 벡터가 알려져 있으므로 발현의 목적에 따라 상기 벡터 이외의 다양한 발현 벡터를 이용할 수 있다.
본 발명의 상기 재조합 발현 벡터는 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소 유전자가 포함되어 있어 이를 생산할 수 있는 벡터로서 유용하게 이용될 수 있다.
또한, 본 발명의 형질전환체에는 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소를 암호화하는 유전자를 포함하는 재조합 발현 벡터가 도입된다.
본 발명에 따른 상기 재조합 발현 벡터를 발현 목적에 따라 박테리아, 효모, 대장균, 진균류, 식물 세포 및 동물 세포로 구성된 군으로부터 선택되는 어느 하나의 적절한 숙주 세포에 형질전환시킴으로써 형질전환체를 제조할 수 있다. 예컨대, 상기 숙주 세포는 대장균(E. coli BL21(DE3), DH5α등) 또는 효모 세포 (Saccharomyces 속, Pichia 속 등) 등 일 수 있다. 이때, 숙주 세포의 종류에 따라 적절한 배양 방법 및 배지 조건 등은 당해 분야의 공지 기술로부터 당업자가 용이하게 선택할 수 있다.
본 발명의 형질전환체의 제조를 위한 재조합 발현 벡터의 도입 방법은 공지의 기술, 즉 열 충격법, 전기충격법 등을 사용할 수 있다.
본 발명의 구체적인 실시예에서, 대장균을 숙주 세포로 하여 본 발명의 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소를 암호화하는 유전자를 포함하는 재조합 발현 벡터를 대장균에 형질전환시켜 형질전환체를 제조하였다.
상기 형질전환체로부터 발현된 단백질은 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소는 효소 활성을 가지는 신규한 서열의 단백질이므로, 상기 형질전환체를 대량 배양하여 상기 유전자를 발현시킴으로써 상기 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소의 대량생산을 용이하게 할 수 있다.
인 비트로( in vitro )에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법
본 발명의 또 다른 측면은 인 비트로(in vitro)에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법을 제공한다.
본 발명의 인 비트로(in vitro)에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법은 상기 "1. 다중불포화지방산의 모노-하이드록시(mono-hydroxy) 또는 디-하이드록시(di-hydroxy) 유도체 생성용 효소 "항목에서 설명한 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소와 다중불포화지방산을 반응시키는 단계를 포함한다. 상기 다중불포화지방산은 탄소 간의 이중결합이 3개 이상 포함되어 있는 지방산으로, 오메가-3 지방산일 수 있으며, 보다 구체적으로는 도코사헥사노엔산 또는 에이코사펜타엔산일 수 있으나, 이에 한정되지 아니한다. 이와 같이, 상기 다중불포화지방산을 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소의 기질로 이용하는 경우, 기질 내 하이드록시기가 도입될 수 있는 이중 결합을 다수 포함하고 있는 바, 모노-하이드록시 또는 디-하이드록시 유도체 생성이 달성될 수 있다.
본 발명의 상기 인 비트로(in vitro)에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법은, 상기 효소와 다중불포화지방산의 반응물로부터 모노-하이드록시 또는 디-하이드록시 유도체를 회수하는 단계를 더 포함한다.
상기 회수는 원심분리, 여과 등 당해 분야에서 통상적으로 수행되는 방법을 실시함으로써 달성될 수 있고, 통상의 방식으로 정제하는 과정을 추가적으로 수행함으로써 달성될 수 있다. 예를 들어, 상기 정제하는 과정은 용매 침전, 투석, 겔 여과, 이온 교환, 역상 칼럼 크로마토그래피와 같은 크로마토그래피 등의 기법을 단독 또는 조합하여 수행할 수 있다.
상기 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소와 다중불포화지방산을 반응시키는 단계는 10 ℃ 내지 40 ℃의 온도 범위, 바람직하게는 15 ℃ 내지 35 ℃의 온도 범위에서 수행될 수 있으나, 이에 한정되지 아니한다. 또한 상기 반응시키는 단계는 pH 4 내지 pH 10의 범위, 바람직하게는 pH 7 내지 pH 9의 범위에서 수행될 수 있으나, 이에 한정되지 아니한다. 상기 온도 및 pH의 범위에서 수행하는 경우, 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소의 활성이 최대가 됨으로써 모노-하이드록시 또는 디-하이드록시 유도체를 더욱 효율적으로 생산해 낼 수 있다.
인 비보( in vivo ) 내에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법
본 발명의 다른 측면은 인 비보(in vivo)에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법을 제공한다.
본 발명의 인 비보(in vivo)에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법은 상기 “2. 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소의 발현 벡터 및 형질전환체 ” 항목에서 설명한 형질전환체를 다중불포화지방산의 존재 하에서 배양하는 단계 및 상기 배양된 배양물에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체를 분리하는 단계를 포함한다.
상기 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소를 암호화하는 유전자가가 포함된 재조합 발현 벡터가 도입된 형질전환체에서는 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소가 발현될 수 있기 때문에, 상기 형질전환체 내에 존재하는 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소에 대해서는 상기 "1. 다중불포화지방산의 모노-하이드록시(mono-hydroxy) 또는 디-하이드록시(di-hydroxy) 유도체 생성용 효소 "항목의 설명을 원용하여 상세한 설명은 생략하도록 한다.
상기 형질전환체는 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소가 발현되기 때문에, 이를 이용하면 다중불포화지방산을 기질로 포함하는 배양 배지에서 배양시킴으로써, 효소를 분리하는 별도의 과정 없이도 모노-하이드록시 또는 디-하이드록시 유도체를 생산할 수 있다.
상기 형질전환체의 배양은 본 기술 분야에 알려진 적당한 배지와 배양 조건에 따라 이루어질 수 있다. 통상의 기술자라면 선택되는 형질전환체의 종류에 따라 배지 및 배양조건을 용이하게 조정하여 사용 할 수 있다. 배양 방법은 회분식, 연속식, 유가식, 또는 이들의 조합 배양을 포함할 수 있다.
상기 배지는 다양한 탄소원, 질소원 및 미량원소 성분을 포함할 수 있다.
상기 탄소원은, 예를 들면, 포도당, 자당, 유당, 과당, 말토오스, 전분, 셀룰로오스와 같은 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유와 같은 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤 및 에 탄올과 같은 알코올, 아세트산과 같은 유기산, 또는 이들의 조합을 포함할 수 있다. 상기 배양은 글루코스를 탄소원으로 하여 수행될 수 있다. 상기 질소원은, 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액(CSL), 및 대두밀과 같은 유기 질소원 및 요소, 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄과 같은 무기 질소원, 또는 이들의 조합을 포함할 수 있다. 상기 배지는 인의 공급원으로서, 예를 들면, 인산이수소 칼륨, 인산수소이칼륨 및 상응하는 소듐-함유 염, 황산마그네슘 또는 황산철과 같은 금속염을 포함할 수 있다.
또한 아미노산, 비타민, 및 적절한 전구체 등이 배지에 포함될 수 있다. 상기 배지 또는 개별 성분은 배양액에 회분식 또는 연속식으로 첨가될 수 있다.
또한, 배양 중에 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다.
피부 상태 개선용 또는 피부 질환의 예방 또는 치료용 조성물
한편, 본 발명의 또 다른 측면은 피부 상태 개선용 또는 피부 질환의 예방 또는 치료용 조성물을 제공한다.
구체적인 일 구현예에서, 본 발명은 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 포함하는 피부 상태 개선용 조성물을 제공한다.
상기 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5, 및 프로텍틴 DX는 오메가-3 지방산, 즉 도코사헥사엔산 (docosahexaenoic acid; DHA)로부터 유래된 리폭시게나제 (lipoxygenase; LOX) 대사 산물이며, 염증해소촉진물질 (specialized pro-resolving mediator; SPM)이다.
상기 17-하이드록시도코사헥사엔산(17-HDHA)은 (±) 17-하이드록시 (dihydroxy)-4Z, 7Z, 10Z, 13Z, 15E, 19Z-도코사헥사엔산 (docosahexaenoic acid)으로서, 하기 화학식 1의 구조로 표현된다.
[화학식 1]
Figure PCTKR2019017246-appb-I000001
상기 레졸빈 D5 (Resolvin D5; RvD5)는 7S, 17S- 디하이드록시 (dihydroxy)-4Z, 8E, 10Z, 13Z, 15E, 19Z- 도코사헥사엔산 (docosahexaenoic acid)으로서, 하기 화학식 2의 구조로 표현된다.
[화학식 2]
Figure PCTKR2019017246-appb-I000002
상기 프로텍틴 DX(Protectin DX; PDX)는 10S,17S-디히드록시 (dihydroxy)-4Z,7Z,11E,13Z,15E,19Z-도코사헥사엔산(docosahexaenoic acid)으로서 프로텍틴 D1의 이성질체이며, 하기 화학식 3의 구조로 표현된다.
[화학식 3]
Figure PCTKR2019017246-appb-I000003
상기 17-HDHA, 레졸빈 D5 및 프로텍틴 DX는 본 발명의 서열번호 1 또는 서열번호 2의 효소를 도코사헥사엔산에 처리하여 생합성하거나, 화학적으로 합성하거나, 상업적으로 구입한 것을 사용할 수 있으나, 이에 제한되지 않는다.
본 발명의 구체적인 실시예에서, 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 포함하는 복합 조성물을 인간 진피 섬유아세포에 처리한 결과, UV 조사에 의해 증가된 염증 인자들의 발현을 억제하고 프로콜라겐 합성을 증가시키는 것을 확인하였다. 특히 본 발명의 복합 조성물이 단독 화합물 대비 콜라겐 합성 효과 및 염증 억제 효과가 상승적으로 유도하는 것을 확인하였다. 나아가, 인체적용실험에서 본 발명의 복합 조성물은 손상된 피부 장벽을 회복시키고, 경피 수분 손실을 감소시킴으로써 아토피로 인한 피부 건조증 및 가려움증을 완화시키는 것을 확인하였다.
따라서, 본 발명의 조성물은 피부 상태를 개선하기 위한 것일 수 있다.
본 발명에서 “피부 상태”는 자외선에 의한 피부 노화, 기미, 주근깨, 피부 상처, 피부염, 아토피 피부염, 소양증, 습진성 피부질환, 건성 습진, 홍반, 두드러기, 건선, 약발진 또는 여드름 일 수 있다.
상기 피부의 노화는 피부의 탄력 감소, 윤기 감소, 주름 생성, 재생력 약화 또는 심한 건조 등의 증상이 나타나는 것으로, 시간의 흐름 또는 외부 환경 등에 의해 유발되는 내인성 노화와 외인성 노화를 모두 포함한다. 특히, 상기 피부 노화는 광노화일 수 있고, 상기 광노화는 피부가 자외선에 반복적으로 또는 장기간 노출될 때 발생하는 피부 손상을 의미한다.
또한, 상기 주름은 안면을 포함하는 모든 신체 부위에서 발생하는 주름을 의미하고, 정적인 주름(static rhytides)과 동적인 주름(dynamic rhytides)을 모두 포함하는 것이다.
본 발명에서 “피부 상태 개선”이란, 피부 주름의 예방 또는 개선, 피부 노화의 예방 또는 개선, 피부 염증의 예방 또는 개선, 피부 세포의 증식 및 재생, 모공 수축, 축소, 또는 피부 장벽 기능 개선, 피부자극 완화, 항산화, 콜라겐 합성 증진 등을 모두 포함하는 개념이다.
본 발명에 있어서, “유효성분으로 포함하는”의 의미는 피부 개선 효과를 나타낼 수 있는, 예컨대, 주름 개선, 염증 개선, 피부 재생, 아토피피부염 개선, 또는 피부장벽 강화, 개선을 나타낼 수 있는 정도의 유효량을 함유하는 것을 의미한다.
본 발명의 일 구현예에 의하면, 상기 조성물은 세포 중 콜라겐의 합성을 촉진하거나, 메탈로프로테나제 (matrix metalloproteinase; MMP)의 발현 또는 활성을 억제하여 콜라겐 분해를 억제하는 것일 수 있다. 상기 조성물은 예를 들면, 타입 1 콜라겐을 분해하는 MMP-1의 발현 또는 활성을 억제하여 세포외기질의 분해를 억제하는 것일 수 있다.
본 발명의 일 구현예에 의하면, 상기 조성물은 항산화 활성을 갖는 것일 수 있다. 상기 조성물은 지질 과산화물 생성을 억제하는 것일 수 있다. 본 발명의 다른 일 구현예에 의하면, 상기 조성물은 염증 인자를 억제하는 것일 수 있다. 상기 조성물은 염증개시인자인 NO, TNF-α, IL-6를 억제하는 것일 수 있다.
상기 TNF-α (tumor necrosis factor-a) 및 IL-6(Interleukin-6)은 대표적인 염증 유도 사이토카인으로, TNF-α는 그람음성 세균의 세포막에 있는 내독소(endotoxin)인 지질다당류(Lipopolysaccharide:LPS)에 의해 활성화된 림프구에 의해서 만들어지는 pro-inflammatory 사이토카인이며, IL-6는 대식세포 및 T세포에 의해 분비되어 면역 반응을 자극하여 염증을 촉진한다.
상기 본 발명의 17-HDHA, 레졸빈 D5 및 프로텍틴 DX를 포함하는 복합 조성물은 염증성 사이토카인인 TNF-α 및 IL-6의 발현을 억제하여 우수한 항염 작용을 구현할 수 있으며, 피부에 발생하는 산화적 스트레스에 의한 지질 과산화물의 생성을 억제하는 항산화 효과가 우수하여 외부 자극에 대한 피부 저항 능력을 향상시킬 수 있다.
본 발명의 또 다른 일 구현예에 의하면, 상기 조성물은 피부 장벽을 강화하는 것일 수 있다.
상기 피부장벽(skin barrier)는 표피의 최외곽 층인 각질층(stratum corneum)은 주로 무핵의 편평한 각질세포(corneocyte)로 이루어져 있다. 정상적인 표피세포의 분열 및 분화과정을 통해 유지되는 피부장벽의 각질세포가 합성하는 세라마이드, 콜레스테롤, 및 지방산과 같은 세포간 지질로 형성된 다층지질막(multi lamella lipid layer)는 피부 내의 수분이 증발하지 않도록 방어막 역할을 한다. 한편, 이들 세포간 지질 중 오메가 히드록시 세라마이드는 각질세포(corneocyte) 외곽층의 단백질인 인볼루크린(involucrin)과 화학적 공유결합으로 연결되어 각질세포지질막(corneocyte lipid envelope, CLE)을 형성함으로써 다층 지질막 형태의 세포간 지질을 물리적으로 안정화시키는 역할을 하여 장벽기능을 강화시키는 역할을 하게 된다.
본 발명의 조성물은 피부 도포를 통해 각질층에 전달되어 각질세포의 분화를 촉진시켜, 표피층의 두께를 두껍게 개선시키는 효과가 있을 뿐 아니라, 피부장벽 손상을 회복시키는 효과가 우수하여 피부장벽의 손상에 의해 유발 되는 피부질환의 치료 및 예방에 유용하게 사용할 수 있다. 상기 피부장벽 손상에 의해 유발되는 피부질환으로는 아토피 피부염(atopic dermatitis), 피부건조증(xeroderma), 건선(psoriasis), 어린선(ichthyosis), 여드름 등이 있으나, 이에 한정되는 것은 아니다.
또한, 피부 장벽 강화 효과는 필라그린 및 로리크린의 발현 증가를 통해 확인하였다. 필라그린은 각질형성세포가 분화단계에서 발현시키는 여러 구조 단백질 중 하나로 표피의 기저층으로부터 각질층까지 분화가 이루어지도록 하는데 관여하며, 피부 조직의 수분유지에 필수적인 천연보습인자(Natural moisture factor, NMF)의 주체를 이루기도 해 피부의 수분 유지 및 피부막기능의 주요한 지표로 사용되는데, 본 발명에 따른 17-HDHA, 레졸빈 D5 및 프로텍틴 DX를 포함하는 복합 조성물은 필라그린 또는 로리크린의 유전자 발현이 월등히 증가됨에 따라 우수한 피부 장벽 보호, 강화, 개선 기능을 가진다.
본 발명의 17-HDHA, 레졸빈 D5 및 프로텍틴 DX를 포함하는 복합 조성물은 유효 성분으로 함유하고 있는, 17-HDHA, 레졸빈 D5 및 프로텍틴 DX의 복합 상승 작용에 의해 이들 화합물 각각을 동일 농도로 사용한 것과 비교하여, 특히 현저하게 향상된 IL-6 발현 억제 효과 및 프로콜라겐 합성 효과를 구현할 수 있다(도 11 및 도 12).
본 발명의 일 구현예에서, 상기 복합물은 상기 17-HDHA, 레졸빈 D5 및 프로텍틴 DX를 3~85: 10~60: 5~50 중량비, 예를 들면 3:10:5의 중량비, 5:60:50의 중량비, 85:10:5의 중량비로 포함할 수 있으나 이에 한정되는 것은 아니다. 본 발명의 일 실시예에서는 17-HDHA, 레졸빈 D5 및 프로텍틴 DX를 3:47:50의 중량비, 25:56:19의 중량비, 84:10:6의 중량비로 포함하는 복합 조성물을 사용하여 피부 개선 효과를 확인하였다.
한편, 상기 피부 상태 개선용 조성물은 화장료 조성물, 약학적 조성물, 또는 식품 조성물로 이용할 수 있다.
따라서, 일 측면에서 본 발명은 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 포함하는 피부 상태 개선용 화장료 조성물을 제공한다.
상기 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 포함하는 복합 조성물 및 피부 상태 개선과 관련된 내용은 전술한 바와 같다.
본 발명의 복합 조성물이 화장료 조성물로 활용되는 경우, 상기 17-HDHA, 레졸빈 D5 및 프로텍틴 DX 외에, 화장료 조성물에 통상적으로 이용되는 성분들이 포함되며, 예컨대 황산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제, 그리고 담체를 포함한다.
본 발명의 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액(무수 및 수계), 무수 생성물(오일 및 글리콜계), 유탁액, 페이스트, 젤, 마스크, 팩, 분말, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수(스킨), 영양 화장수(밀크로션), 영양 크림, 맛사지 크림, 에센스, 아이크림, 클렌징 크림, 클렌징 폼, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다. 이러한 경우, 상기 화장료 조성물의 접근성이 더욱 향상될 수 있으며, 보습 효과를 구현하여 아토피 피부염의 만성적인 재발을 예방할 수 있다.
상기 화장료 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성 유, 식물성 유, 왁스, 파라핀, 전분, 트라가칸타, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.
상기 화장료 조성물의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 하이드록사이드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.
상기 화장료 조성물의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.
상기 화장료 조성물의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소 결정성 셀룰로오스, 알루미늄 메타하이드록사이드, 벤토나이트, 아가 또는 트라가칸타 등이 이용될 수 있다.
상기 화장료 조성물의 제형이 계면-활성제 함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
상기 화장료 조성물이 비누 형태인 경우에는 첨가제로서 피부 보습제, 유화제, 경수연화제 등을 포함하여 제조될 수 있으며, 상기 비누의 기재로서는 야자유, 팜유, 대두유, 올리브유, 팜핵유, 호오바유 등의 식물유지나 우지, 돈지, 양지, 어유 등의 동물 유지가 사용될 수 있고, 보습제로서는 글리세린, 데티프리톨, 프로필렌글리콜, 부틸렌글리콜, 헥실 글리콜, 이소프로필미리스테이트, 알로에베라, 솔비톨 등이 사용될 수 있으며, 유화제로서 천연오일, 왁스, 탄화수소류 등이 사용 가능하며, 경수 연화제로서는 테트라소듐 이디티에이 등이 사용될 수 있으나 이에 한정되지 않는다.
상기 비누에는 첨가제로서 항균제, 거품억제제, 용매, 부식방지제, 향료, 색소, 금속이온 봉쇄제, 방부제 등을 추가적으로 포함할 수 있다.
본 발명의 조성물이 화장료 조성물로 사용될 경우, 상기 조성물 내의 상기 17-HDHA, 레졸빈 D5 및 프로텍틴 DX는 30μM 이상, 구체적으로는 35μM 이상, 보다 구체적으로는 40μM 이상의 농도로 포함될 수 있으나, 이는 화장료 조성물이 제조되는 형태에 따라 또 그것의 구체적인 적용 부위(얼굴이나 손)나 적용 용량에 따라 달라지는 것이므로, 이에 한정되지 않는다.
다른 일 측면에서 본 발명은 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 포함하는 피부 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
상기 피부 질환은 피부 상처, 피부 흉터, 피부염, 아토피 피부염, 소양증, 습진성 피부질환, 건성 습진, 무좀, 홍반, 두드러기, 건선, 약발진, 여드름 또는 탈모 일 수 있다.
상기 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 포함하는 복합 조성물 및 피부 질환과 관련된 내용은 전술한 바와 같다.
상기 조성물이 약학적 조성물로 활용되는 경우, 상기 외에, 17-HDHA, 레졸빈 D5 및 프로텍틴 DX 약학적으로 허용가능한 담체(carrier) 또는 첨가제를 더 포함할 수 있다.
상기 '약학적으로 허용가능한'의 의미는 유효성분의 활성을 억제하지 않으면서 적용(처방) 대상이 적응 가능한 이상의 독성을 지니지 않는다는 의미이다. 상기 '담체'는 세포 또는 조직 내로의 화합물의 부가를 용이하게 하는 화합물로 정의된다.
본 발명의 상기 17-HDHA, 레졸빈 D5 및 프로텍틴 DX는 단독으로 또는 어떤 편리한 담체 등과 함께 혼합하여 투여될 수 있고, 그러한 투여 제형은 단회 투여 또는 반복 투여 제형일 수 있다. 상기 약학적 조성물은 고형 제제 또는 액상 제제일 수 있다. 고형 제제는 산제, 과립제, 정제, 캅셀제, 좌제 등이 있으나, 이에 한정되는 것은 아니다. 고형 제제에는 담체, 착향제, 결합제, 방부제, 붕해제, 활택제, 충진제 등이 포함될 수 있으나 이에 한정되는 것은 아니다. 액상 제제로는 물, 프로필렌 글리콜 용액 같은 용액제, 현탁액제, 유제 등이 있으나, 이에 한정되는 것은 아니며, 적당한 착색제, 착향제, 안정화제, 점성화제 등을 첨가하여 제조할 수 있다. 예를 들어, 산제는 본 발명의 유효 성분인 17-HDHA, 레졸빈 D5 및 프로텍틴 DX와 유당, 전분, 미결정셀룰로오스 등 약제학적으로 허용가능한 적당한 담체를 단순 혼합함으로써 제조될 수 있다. 과립제는 본 발명의 상기17-HDHA, 레졸빈 D5 및 프로텍틴 DX, 약학적으로 허용가능한 적당한 담체 및 폴리비닐피롤리돈, 하이드록시프로필셀룰로오스 등의 약학적으로 허용가능한 적당한 결합제를 혼합한 후, 물, 에탄올, 이소프로판올 등의 용매를 이용한 습식과립법 또는 압축력을 이용한 건식과립법을 이용하여 제조될 수 있다. 또한 정제는 상기 과립제를 마그네슘스테아레이트 등의 약학적으로 허용가능한 적당한 활택제와 혼합한 후, 타정기를 이용하여 타정함으로써 제조될 수 있다.
본 발명의 상기 17-HDHA, 레졸빈 D5 및 프로텍틴 DX는 치료해야 할 질환 및 개체의 상태에 따라 경구제, 주사제(예를 들어, 근육주사, 복강주사, 정맥주사, 주입(infusion), 피하주사, 임플란트), 흡입제, 비강투여제, 질제, 직장투여제, 설하제, 트랜스더말제, 토피칼제 등으로 투여될 수 있으나, 이에 한정되는 것은 아니다. 투여 경로에 따라 통상적으로 사용되고 비독성인, 약학적으로 허용가능한 운반체, 첨가제, 비히클을 포함하는 적당한 투여 유닛 제형으로 제제화될 수 있다.
본 발명의 약학적 조성물은 매일 약 0.0001 mg/kg 내지 약 10 g/kg이 투여될 수 있으며, 약 0.001 mg/kg 내지 약 1 g/kg의 1일 투여 용량으로 투여될 수 있다. 그러나 상기 투여량은 상기 혼합물의 정제 정도, 환자의 상태(연령, 성별, 체중 등), 치료하고 있는 상태의 심각성 등에 따라 다양할 수 있다. 필요에 따라 편리성을 위하여 1일 총 투여량을 하루 동안 여러 번 나누어 투여될 수 있다.
본 발명의 조성물이 약학적 조성물로 사용될 경우, 상기 조성물 내의 상기 17-HDHA, 레졸빈 D5 및 프로텍틴 DX는 30μM 이상, 구체적으로는 35μM 이상, 보다 구체적으로는 40μM 이상의 농도로 포함될 수 있다.
또 다른 일 측면에서 본 발명은 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 포함하는 피부 상태 개선용 식품 조성물을 제공한다.
상기 17-하이드록시도코사헥사엔산(17-HDHA), 레졸빈 D5 및 프로텍틴 DX를 포함하는 복합 조성물 및 피부 상태 개선과 관련된 내용은 전술한 바와 같다.
상기 조성물이 식품 조성물로 이용되는 경우, 허용가능한 식품 보조 첨가제를 포함할 수 있으며, 식품의 제조에 통상적으로 사용되는 적절한 담체, 부형제 및 희석제를 더욱 포함할 수 있다.
본 발명에서 식품은 영양소를 한 가지 또는 그 이상 함유하고 있는 천연물 또는 가공품을 의미하며, 구체적으로 어느 정도의 가공 공정을 거쳐 직접 먹을 수 있는 상태가 된 것을 의미하며, 통상적인 의미로서, 각종 식품, 기능성 식품, 음료, 식품 첨가제 및 음료 첨가제를 모두 포함하는 의미로 사용된다. 상기 식품의 예로서 각종 식품류, 음료, 껌, 차, 비타민 복합제, 기능성 식품 등이 있다. 추가로, 본 발명의 식품에는 특수영양식품(예, 조제유류, 영,유아식 등), 식육가공품, 어육제품, 두부류, 묵류, 면류(예, 라면류, 국수류 등), 건강보조식품, 조미식품(예, 간장, 된장, 고추장, 혼합장 등), 소스류, 과자류(예, 스넥류), 유가공품(예, 발효유, 치즈 등), 기타 가공식품, 김치, 절임식품(각종 김치류, 장아찌 등), 음료(예, 과실, 채소류 음료, 두유류, 발효음료류, 아이스크림류 등), 천연조미료(예, 라면 스프 등), 비타민 복합제, 알코올 음료, 주류 및 그 밖의 건강보조식품류를 포함하나 이에 한정되지 않는다. 상기 기능성 식품, 음료, 식품첨가제 또는 음료첨가제는 통상의 제조방법으로 제조될 수 있다.
상기 '기능성 식품'이란 식품에 물리적, 생화학적, 생물공학적 수법 등을 이용하여 해당 식품의 기능을 특정 목적에 작용, 발현하도록 부가가치를 부여한 식품군이나 식품 조성이 갖는 생체방어리듬조절, 질병 방지와 회복 등에 관한 체내조절기능을 생체에 대하여 충분히 발현하도록 설계하여 가공한 식품을 의미하며, 구체적으로는 건강기능식품일 수 있다.
본 발명에서 사용되는 용어 '건강기능식품'이란 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 정제, 캅셀, 분말, 과립, 액상 및 환 등의 형태로 제조 및 가공한 식품을 말한다. 여기서 '기능'이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻는 것을 의미한다. 본 발명의 건강기능식품은 당업계에서 통상적으로 사용되는 방법에 의하여 제조가능하며, 상기 제조 시에는 당업계에서 통상적으로 첨가하는 원료 및 성분을 첨가하여 제조할 수 있다. 또한 상기 건강기능식품의 제형 또한 건강기능식품으로 인정되는 제형이면 제한없이 제조될 수 있다. 본 발명의 식품용 조성물은 다양한 형태의 제형으로 제조될 수 있으며, 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용 시 발생할 수 있는 부작용 등이 없는 장점이 있고, 휴대성이 뛰어나, 본 발명의 건강기능식품은 피부 개선 효과를 증진시키기 위한 보조제로 섭취가 가능하다.
또한, 상기 기능성 식품에는 식품학적으로 허용 가능한 식품 보조 첨가제를 포함할 수 있으며, 기능성 식품의 제조에 통상적으로 사용되는 적절한 담체, 부형제 및 희석제를 더욱 포함할 수 있다.
또한, 상기 식품 조성물에서, 상기 조성물 내의 상기 17-HDHA, 레졸빈 D5 및 프로텍틴 DX는 30μM 이상, 구체적으로는 35μM 이상, 보다 구체적으로는 40μM 이상의 농도로 포함될 수 있다.
본 발명의 식품 조성물에는 그 유효성분 이외에 감미제, 풍미제, 생리활성 성분, 미네랄 등이 포함될 수 있다. 감미제는 식품이 적당한 단맛을 나게 하는 양으로 사용될 수 있으며, 천연의 것이거나 합성된 것일 수 있다. 구체적으로는 천연 감미제를 사용하는 경우인데, 천연 감미제로서는 옥수수 시럽 고형물, 꿀, 수크로오스, 프록토오스, 락토오스, 말토오스 등의 당 감미제를 들 수 있다. 풍미제는 맛이나 향을 좋게 하기 위하여 사용될 수 있는데, 천연의 것과 합성된 것 모두 사용될 수 있다. 구체적으로는 천연의 것을 사용하는 경우이다. 천연의 것을 사용할 경우에 풍미 이외에 영양 강화의 목적도 병행할 수 있다. 천연 풍미제로서는 사과, 레몬, 감귤, 포도, 딸기, 복숭아 등에서 얻어진 것이거나 녹차잎, 둥굴레, 대잎, 계피, 국화 잎, 자스민 등에서 얻어진 것일 수 있다. 또한, 인삼(홍삼), 죽순, 알로에 베라, 은행 등에서 얻어진 것을 사용할 수 있다. 천연 풍미제는 액상의 농축액이나 고형상의 추출물일 수 있다. 경우에 따라서 합성 풍미제가 사용될 수 있는데, 합성 풍미제는 에스테르, 알콜, 알데하이드, 테르펜 등이 이용될 수 있다. 생리 활성 물질로서는 카테킨, 에피카테킨, 갈로카테킨, 에피갈로카테킨 등의 카테킨류나, 레티놀, 아스코르브산, 토코페롤, 칼시페롤, 티아민, 리보플라빈 등의 비타민류 등이 사용될 수 있다. 미네랄로서는 칼슘, 마그네슘, 크롬, 코발트, 구리, 불소화물, 게르마늄, 요오드, 철, 리튬, 마그네슘, 망간, 몰리브덴, 인, 칼륨, 셀레늄, 규소, 나트륨, 황, 바나듐, 아연 등이 사용될 수 있다.
또한, 본 발명의 식품 조성물은 상기 감미제 등 이외에도 필요에 따라 보존제, 유화제, 산미료, 점증제 등을 포함할 수 있다. 이러한 보존제, 유화제 등은 그것이 첨가되는 용도를 달성할 수 있는 한 극미량으로 첨가되어 사용되는 것이 바람직하다. 극미량이란 수치적으로 표현할 때 식품 조성물 전체 중량을 기준으로 할 때 약 0.0005 중량％ 내지 약 0.5 중량％ 범위를 의미한다. 사용될 수 있는 보존제로서는 소듐 소르브산칼슘, 소르브산나트륨, 소르브산칼륨, 벤조산칼슘, 벤조산나트륨, 벤조산칼륨, EDTA(에틸렌디아민테트라아세트산) 등을 들 수 있다. 사용될 수 있는 유화제로서는 아카시아검, 카르복시메틸셀룰로스, 잔탄검, 펙틴 등을 들 수 있다. 사용될 수 있는 산미료로서는 연산, 말산, 푸마르산, 아디프산, 인산, 글루콘산, 타르타르산, 아스코르브산, 아세트산, 인산 등을 들 수 있다. 이러한 산미료는 맛을 증진시키는 목적 이외에 미생물의 증식을 억제할 목적으로 식품 조성물이 적정 산도로 되도록 첨가될 수 있다. 사용될 수 있는 점증제로서는 현탁화 구현제, 침강제, 겔형성제, 팽화제 등을 들 수 있다.
이하, 본 발명을 실시예에 의하여 상세히 설명한다.
단, 하기 실시예는 본 발명을 구체적으로 예시하는 것이며, 본 발명의 내용이 하기 실시예에 의해 한정되지 아니한다.
[실시예 1]
서열번호 1, 2의 아미노산 서열을 포함하는 단백질의 제조
[1-1] 단백질의 발현용 벡터 제작
서열번호 1 및 서열번호 2의 아미노산을 각각 암호화하는 서열번호 3 및 서열번호 4의 뉴클레오티드 서열을 ㈜바이오니아社 에 의뢰하여 각각 합성하였고, 상기 합성된 각각의 뉴클레오티드 서열을 주형으로 서열번호 5 내지 서열번호 8의 프라이머 쌍을 이용하여 94℃에서 5분 동안 전변형(pre-denaturation) 시킨 다음, 94℃에서 30초, 61℃에서 30초, 72℃에서 2분 동안 반응시키는 사이클을 20회 반복하는 PCR을 수행함으로써 상기 서열번호 3 및 서열번호 4의 유전자를 각각 증폭하였다.
단백질 프라이머 뉴클레오티드 서열(5'->3') 서열번호
서열번호 1의 아미노산 정방향 CATATGATGTTTGGCATCTTCGACAAGG 5
역방향 CTCGAGTTAGATAGAGATACTGTTCGGGATCCCC 6
서열번호 2의 아미노산 정방향 CATATGATGACAGGTGGGATGTTTGGAC 7
역방향 CTCGAGTTAGATGGAAATACTGTTGGGAATTCCTTTG 8
상기와 같이 증폭된 서열번호 3 및 서열번호 4의 뉴클레오티드 서열을 포함하는 각각의 PCR 산물을 플라스미드 벡터 pET28a(+)(Novagen, 미국)에 삽입하여 재조합 발현 벡터를 제작하였고, 뉴클레오티드 서열 분석(Solgent)을 통해 상기 서열번호 3 및 서열번호 4의 뉴클레오티드 서열이 제대로 삽입되었음을 확인하였다.
[1-2] 단백질의 발현 및 정제
상기 실시예 [1-1]에서 제조된 각각의 재조합 발현 벡터를 대장균 BL21(DE3)에 형질전환하고, 각각의 형질전환체를 3㎖의 LB 배지에 접종하고 600㎚에서의 흡광도가 2.0이 될 때까지 37℃에서 종균 배양하였다. 그런 다음, 상기 종균 배양된 배양액을 500㎖의 LB 배지에 첨가하여 본 배양을 실시하였고, 600㎚에서의 흡광도가 0.6이 될 때 IPTG(isopropyl-1-thio-β-D-galactopyranoside)를 최종 농도 1mM이 되도록 첨가하여 서열번호 1의 아미노산 서열을 갖는 단백질과 서열번호 2의 아미노산 서열을 갖는 단백질의 과발현을 유도하였다. 상기와 같이 과발현을 유도하는 과정에서, IPTG를 첨가하기 전에는 배양 온도를 37℃로 유지하였고, IPTG를 첨가한 후에는 배양 온도를 20℃로 낮추었다.
상기 과발현이 유도된 형질전환체의 배양액을 원심분리하여 상등액을 분리하고, 상등액을 분리해 낸 펠렛에서 형질전환체의 세포를 파쇄하여 형질전환체의 세포 용해물(cell lysate)을 수득하였다.
상기와 같이 수득된 세포 용해물 100㎕를 대상으로 SDS-PAGE를 수행한 결과, 도 1에 도시된 바와 같이, 약 96.9KDa의 크기를 갖는 서열번호 1의 아미노산 서열을 갖는 단백질(도 1의 (A))과 약 96.8KDa의 크기를 갖는 서열번호 2의 아미노산 서열을 갖는 단백질(도 1의 (B))이 과발현된 것을 확인하였다.
상기와 같이 서열번호 1의 아미노산 서열을 갖는 단백질 및 서열번호 2의 아미노산 서열을 갖는 단백질이 과발현되어 있는 것으로 확인된 세포 용해물을 대상으로, Ni-NTA 흡착 크로마토그래피를 이용하여, 서열번호 1의 아미노산 서열을 갖는 단백질과 서열번호 2의 아미노산 서열을 갖는 단백질을 분리 및 정제하였다.
[실시예 2]
단백질의 활성 확인 - 모노-하이드록시 또는 디-하이드록시 유도체 생성 활성의 확인
상기 실시예 [1-2]에서 정제 및 분리한 서열번호 1의 아미노산 서열을 갖는 단배질과 서열번호 2의 아미노산 서열을 갖는 단백질에 대하여, 이들 각각의 단백질 6KU 또는 10KU와 도코사헥사엔산(docosahexaenoic acid; DHA) 100 μM을 pH 7, 실온에서 30분 동안 반응 시키고, 최종 농도가 50 mM이 되도록 1 M의 수소화붕소나트륨(sodium borohydride)을 첨가하여 반응 산물을 환원시킨 뒤, 5 ㎕/ml의 아세트산을 첨가하여 상기 반응을 종료시켰다.
고체상 카트리지(SPE, C18 500mg)를 이용하여 상기 반응 산물을 정제한 뒤, 순상 HPLC(Normal phase HPLC) 를 이용하여 상기 반응 생성물 내의 화합물의 종류를 분석하였다.
구체적으로, 상기 순상 HPLC 분석은 supelcosil LC-Diol컬럼(Supelco, 25cm×3mm, 5㎛)에, 95% n-헵탄, 5% 이소프로판올, 0.1% 아세트산, 0.1% 2,2-디메톡시프로판으로 구성된 이동상을 유량 0.5ml/min의 속도로, 40분 동안 20㎖ 전개하였으며, DAD(Diode Array Detector)를 이용하여 반응 산물 내의 화합물을 최종적으로 검출하는 방법으로 수행되었다.
그 결과, 도 2, 도 3에 도시된 바와 같이, 상기 서열번호 1의 아미노산 서열을 갖는 단백질과 상기 서열번호 2의 아미노산 서열을 갖는 단백질은 모두 DHA로부터 17S-모노하이드록시-DHA, 7S,17S-디-하이드록시-DHA(resolvin D5), 10S,17S-디하이드록시-DHA(protectin DX)를 생성할 수 있는 것으로 확인되었고, 각각의 경우에 위 3가지 모노-하이드록시 또는 디-하이드록시 유도체의 함량이 각각 아래 표 3에 기재된 바와 같은 비율로 존재하는 것으로 확인되었다.
효소 2차 구조 함량(비율)
서열번호 1의 아미노산 서열을갖는 단백질에 의해 생성된 유도체 17S-모노하이드록시-DHA 1.03㎎ (25.06%)
7S,17S-디-하이드록시-DHA(resolvin D5) 2.43㎎ (59.04%)
10S,17S-디하이드록시-DHA(protectin DX) 0.66㎎ (15.98%)
서열번호 2의 아미노산 서열을갖는 단백질에 의해 생성된 유도체 17S-모노하이드록시-DHA 0.53㎎ (20.98%)
7S,17S-디-하이드록시-DHA(resolvin D5) 1.79㎎ (71.45%)
10S,17S-디하이드록시-DHA(protectin DX) 0.19㎎(7.44%)
[실시예 3]
단백질의 아미노산 서열 분석
서열번호 1의 아미노산 서열을 갖는 단백질과 서열번호 2의 아미노산 서열을 갖는 단백질을 대상으로, 인간 5LOX(AAA36183), 인간 12LOX(AAA51533), 인간 15LOX(AAA36183), 콩 15LOX(AAA33986), 감자 LOX(AAB81595) 및 홍조류 PhLOX2(AGN54275)와 대비하여, 아미노산 서열의 상동성 분석 및 계통 분석을 수행하였다.
그 결과, 서열번호 1의 아미노산 서열을 갖는 단백질과 서열번호 2의 아미노산 서열을 갖는 단백질은, 도 4a-d에 도시된 바와 같이, 인간 5LOX(AAA36183), 인간 12LOX(AAA51533), 인간 15LOX(AAA36183), 콩 15LOX(AAA33986), 감자 LOX(AAB81595) 및 홍조류 PhLOX2(AGN54275)와 매우 낮은 서열 상동성을 나타내는 것으로 확인되었다.
또한, 도 4a-d에서 알 수 있는 바와 같이, 상기 서열번호 1의 아미노산 서열을 갖는 단백질과 서열번호 2의 아미노산 서열을 갖는 단백질 모두 막지질과의 결합을 수행하는 N-말단 영역이 존재하고, C-말단 영역에서 높은 유사성을 보이는 것으로 확인되었다. 특히, 철 이온과 결합하는 잔기인 His, His, His 및 Asn/Ser, 말단 아미노산이 존재하였고, 효소의 수산화 특성과 밀접하게 관계가 있는 Ala이 존재하는 것으로 확인되었다.
또한, 상기 서열번호 1의 아미노산 서열을 갖는 단백질과 상기 서열번호 2의 아미노산 서열을 갖는 단백질의 2차 구조를 분석한 결과, α-헬릭스, 확장된 가닥 및 랜덤 코일이 각각 아래 표 3에 기재된 바와 같은 비율로 존재하는 것으로 확인되었다.
효소 2차 구조 비율
서열번호 1의 아미노산 서열을 갖는 단백질 α-헬릭스 33.14%
확장된 가닥 26.33%
랜덤 코일 40.53%
서열번호 2의 아미노산 서열을 갖는 단백질 α-헬릭스 31.83%
확장된 가닥 29.17%
랜덤 코일 39.00%
[실시예 4]
본 발명의 단백질의 효소 활성에 의해 생성된 반응 생성물의 효과 확인 - 피부 노화 및 주름 개선 억제
상기 실시예 2에서와 같이, 도코사헥사엔산을, 본 발명의 서열번호 1을 갖는 단백질과 반응시켜 얻은 생성물(SPM 1)과 서열번호 2의 아미노산 서열을 갖는 단백질과 반응시켜 얻은 생성물(SPM 2)을 인간 진피 섬유아세포(human dermal fibroblast)에 처리하여 세포 독성, MMP-1 발현 및 프로콜라겐 합성 효과를 확인하였고, 인간 각질형성세포(human keratinocyte)에 처리하여 세포 독성, TNF-α 발현 및 IL-6 발현의 변화를 확인하였다.
[4-1] 세포 독성 확인
인간 진피 섬유아세포와 인간 각질형성세포에 상기 SPM 1과 SPM 2를 각각 0.001, 0.01, 0,1 및 1ppm의 농도로 처리하여 세포의 생존률(cell viability)을 확인하였다.
그 결과, 도 5와 도 6에 도시된 바와 같이, 두 반응 생성물(SPM 1, SPM 2) 모두 모든 농도에서 90% 이상의 세포 생존율을 나타내었고, 이로부터 본 발명의 단백질에 의해 DHA로부터 생성되는 생성물은 모두 세포 독성이 없음을 알 수 있다.
[4-2] TNF-α 및 IL-6의 발현 억제능 향상 효과 확인
인간 각질형성세포를 48웰 플레이트에 4x104개/웰의 농도로 분주하고 5% CO2, 37℃에서 24시간 동안 배양한 후, 배지를 제거하고 DMEM Serum Free media로 기아 상태를 24시간 동안 유지하였다.
상기 SPM 1 및 SPM 2를 DMEM(FBS 2%)으로 희석하여 1ppm으로 만들고, 이를 순차적으로 희석하여 0.1, 0.01 및 0.001ppm으로 만든 다음, 상기와 같이 배양되어 배지가 제거된 인간 각질형성세포에 1시간 동안 처리하였다. 그런 다음, TNF-α또는 IL-6 발현을 위해 배지를 250㎕의 DPBS(WelGENE)로 교환하고 160mJ/㎠의 UVB를 조사한 뒤, 다시 SPM 1 및 SPM 2를 처리한 후 24시간 동안 배양하였다. 그리고 배지를 수거한 뒤, Human TNF-α DuoSet ELISA(R&D system)를 사용하여 TNF-α의 양을, 그리고 Human IL-6 DuoSet ELISA(R&D system)를 사용하여 IL-6의 양을 각각 측정하고, 바닥에 부착되어 있는 세포를 DPBS로 세척한 후, 1N NaOH로 용해시켜 BCA 분석을 통해 단백질 양을 측정하여 일정 단백질당 TNF-α 또는 IL-6의 합성량을 측정하였다. 이때, 아무 것도 처리하지 않은 경우를 음성 대조군으로, 그리고 10ppm의 덱사메타손(dexamethasone)을 처리한 경우를 양성 대조군으로 하여, 두 반응 생성물 SPM 1, SPM 2의 효과를 확인하였다.
먼저, TNF-α의 경우, 도 7에 도시된 바와 같이, UVB를 조사함으로써 TNF-α의 발현이 약 2배 정도 증가하였고, 이렇게 증가된 TNF-α의 발현은 10ppm의 덱사메타손을 처리함에 따라 약 35% 정도 감소되는 한편, 1ppm의 SPM 1에 의해 약 24% 정도, 그리고 1ppm의 SPM 2에 의해 약 56% 정도 감소되었으며, 이러한 TNF-α의 발현 억제 효과는 SPM 1, 2의 처리 농도에 의존적인 경향을 나타내었다.
다음으로, IL-6의 경우, 도 8에 도시된 바와 같이, UVB를 조사함으로써 IL-6의 발현이 약 1.6배 정도 증가하였고, 이렇게 증가된 IL-6의 발현은 10 ppm의 덱사메타손을 처리함에 따라 약 88% 정도 감소되는 한편, 1ppm의 SPM 1에 의해 약 35% 정도, 그리고 1ppm의 SPM 2에 의해 약 92% 정도 감소되었으며, 이러한 IL-6의 발현 억제 효과 역시 SPM 1, 2의 처리 농도에 의존적인 경향을 나타내었다.
상기와 같은 결과로부터, 본 발명의 단백질에 의해 DHA로부터 생성되는 생성물은 모두 염증을 종결시키는 효과가 있음을 알 수 있다.
[4-3] 프로콜라겐(procollagen) 합성능 향상 효과 확인
세포외기질의 주요 구성 성분인 콜라겐은 프로콜라겐이라는 전구 물질의 형태로 합성된다. 상기 프로콜라겐은 중합 반응이 일어날 때 콜라겐 분자로부터 절단, 분리되는 것으로 알려져 있는바, 프로콜라겐의 양을 측정함으로써 세포 내에서의 콜라겐 생합성 정도를 가늠할 수 있다.
인간 진피 섬유아세포에 상기 SPM 1과 SPM 2를 각각 0.01, 0,1 및 1ppm의 농도로 처리하고 24시간 동안 배양한 다음, 배양된 세포의 배지를 수거하여 procollagen typeI c-peptide (PIP) EIA 키트(TAKARA, MK101)로 프로콜라겐의 양을 측정하였다. 이때, 아무 것도 처리하지 않은 경우를 음성 대조군으로, 그리고 26.2ppm의 레티닐 팔미테이트(retinyl palmitate)를 처리한 경우를 양성 대조군으로 하여, 두 반응 생성물 SPM 1, SPM 2의 효과를 확인하였다.
그 결과, 도 9에 도시된 바와 같이, 두 반응 생성물(SPM 1, 2) 모두 아무것도 처리하지 않은 음성 대조군에 비해 더 많은 양의 프로콜라겐이 확인되었다. 특히 SPM 2의 경우 0.1ppm 이상의 농도에서 양성 대조군(26.2ppm의 레티닐 팔미테이트)에 비해, 더 많은 양의 프로콜라겐이 확인되었다. 이로부터 본 발명의 단백질에 의해 DHA로부터 생성되는 생성물은 모두 프로콜라겐의 합성능을 향상시킴을 알 수 있다.
[4-4] 콜라겐 분해효소(MMP-1) 발현 억제능 향상 효과 확인
MMPs(matrix metalloproteinases)는 단백질 분해 활성을 갖는 효소로, 세포외기질을 구성하는 단백질들을 분해하여 세포외기질을 구성하는 단백질과 세포의 결합에 중요한 영향을 미치게 된다. MMPs는 28개의 타입으로 존재하며, 이 중 MMP-1은 콜라겐을 분해하는 효소로 본 실시예에서는 세포 내 MMP-1의 발현 정도를 확인하였다.
인간 진피 섬유아세포를 24시간 동안 배양한 다음 배지를 250㎕/웰 농도의 DPBS(WelGENE)로 교환하고 100mJ/㎠의 UVB를 조사한 뒤, 상기 SPM 1과 SPM 2가 각각 0.01, 0,1 및 1ppm의 농도로 희석된 DMEM(2% FBS)을 처리하여 48시간 배양하였다. 배양된 세포의 배지를 수거한 뒤 human total MMP-1 ELISA kit(R&D systems, DY901)를 사용하여 MMP-1 양을 측정하였다. 이때, 아무 것도 처리하지 않은 경우를 음성 대조군으로, 그리고 6ppm의 레티노산(retinoic acid)를 처리한 경우를 양성 대조군으로 하여, 두 반응 생성물 SPM 1, SPM 2의 효과를 확인하였다.
그 결과, 도 10에 도시된 바와 같이, UVB를 조사함으로써 MMP-1의 발현이 약 2배 정도 증가하였고, 이렇게 증가된 MMP-1의 발현은 6ppm의 레티노산을 처리함에 따라 약 70% 정도 감소되는 한편, SPM 1을 처리한 경우에는 0.1ppm과 1ppm에서 각각 17.2%, 80.1% 감소되었고, SPM 2를 처리한 경우에는 0.01ppm에서 11.4%, 0.1ppm에서 26.1%, 그리고 1ppm에서 63.3% 감소되었으며, 이러한 MMP-1의 발현 억제 효과 역시 SPM 1, 2의 처리 농도에 의존적인 경향을 나타내었다.
[실시예 5]
SPMs 복합 조성물의 제조 및 단독 화합물의 준비
[5-1] 17-HDHA, 레졸빈 D5 및 프로텍틴 DX의 복합 조성물 (이하,'SPMs 복합 조성물'이라고 함)
서열번호 1의 아미노산 서열을 갖는 리폭시게나아제를 다양한 농도의 도코사헥사엔산(docosahexaenoic acid; DHA)에 첨가하여 pH 7, 실온에서 30분 동안 반응 시키고, 최종 농도가 50 mM이 되도록 1 M의 수소화붕소나트륨(sodium borohydride)을 첨가하여 반응 산물을 환원시킨 뒤, 5 ㎕/ml의 아세트산을 첨가하여 상기 반응을 종료시켰다. 고체상 카트리지(SPE, C18 500mg)를 이용하여 상기 반응 산물을 정제한 뒤, 순상 HPLC(Normal phase HPLC) 를 이용하여 상기 반응 생성물 내의 화합물의 종류를 분석하였다.
그 결과, DHA로부터 17S-HDHA, 레졸빈 D5 (7S, 17S-diHDHA), 프로텍틴 DX (10S, 17S-diHDHA)가 생성된 것을 확인하였고, 이로부터 각각 아래 표 4에 기재된 바와 같은 비율로 혼합된 상태로 존재하는 SPMs 복합 조성물인 Complex 1 내지 3을 제조하였다.
　 Complex 1 Complex 2 Complex 3
17S-HDHA 3 25 84
레졸빈D5 47 56 10
프로텍틴 DX 50 19 6
[5-2] 17-HDHA, 레졸빈 D5 및 프로텍틴 DX의 분리 및 정제
17S-HDHA, 레졸빈 D5 (7S, 17S-diHDHA), 프로텍틴 DX (10S, 17S-diHDHA) 는 상기 실시예 [5-1]의 SPMs 복합 조성물로부터 C18 컬럼 혹은 Diol 컬럼을 장착한 prep HPLC 를 통해 각각의 산물을 분리 정제하여 사용하였다.
[실시예 6]
SPMs 복합 조성물에 의한 상승적 IL-6의 발현 억제 효과 확인
SPMs 복합 조성물의 상승적 염증 완화 효과를 확인하기 위하여, 17-HDHA, 레졸빈 D5 및 프로텍틴 DX의 복합 조성물(Complex 1 내지 3) 및 각각의 SPM 단독 물질을 인간 각질형성세포(human keratinocyte)인 HaCaT 세포에 처리하여 IL-6 발현의 변화를 확인하였다.
[6-1] 실험방법
구체적으로, 먼저 인간 각질형성세포를 48웰 플레이트에 4x104개/웰의 농도로 분주하고 5% CO2, 37℃에서 24시간 동안 배양한 후, 배지를 제거하고 DMEM Serum Free media로 기아 상태를 24시간 동안 유지하였다.
상기 SPMs 복합 조성물을 DMEM(FBS 2%)으로 희석하여 0.5, 1, 2 및 5 μg/ml로 만든 다음, 상기와 같이 배양되어 배지가 제거된 인간 각질형성세포에 1시간 동안 처리하였다. 그런 다음, IL-6 발현을 위해 배지를 250㎕의 DPBS(WelGENE)로 교환하고 160mJ/㎠의 UVB를 조사한 뒤, 다시 SPMs를 처리한 후 24시간 동안 배양하였다. 그리고 배지를 수거한 뒤, Human IL-6 DuoSet ELISA(R&D system)를 사용하여 IL-6의 양을 각각 측정하고, 바닥에 부착되어 있는 세포를 DPBS로 세척한 후, 1N NaOH로 용해시켜 BCA 분석을 통해 단백질 양을 측정하여 일정 단백질당 IL-6의 합성량을 측정하였다. 이때, UVB 조사 후 아무 것도 처리하지 않은 경우를 Con(-)로, 그리고 10μM의 하이드로코르티손 (hydrocortisone)을 처리한 경우를 Con(+)로 하여, 본 발명의 SPMs 복합 조성물 및 각각의 단독 성분의 IL-6 발현 억제 효과를 확인하였다.
[6-2] SPM 단독 성분의 IL-6 억제 효과 확인
그 결과, 표 5 및 도 11a에 나타난 바와 같이, 인간 각질형성세포에 UVB를 조사함으로써 IL-6의 발현이 증가하였고, 이렇게 증가된 IL-6의 발현은 2μg/ml의 17S-HDHA, 프로텍틴 DX 및 레졸빈 D5 각각을 처리하였을 때 Con(-) 대비 각각 10.8%, 11.8%, 0.5% 정도 감소되었으며, SPM의 처리 농도에 의존적인 경향을 나타내었다.
이로부터, 17-HDHA, 프로텍틴 DX, 레졸빈 D5는 모두 염증 완화 효능을 갖는 것을 알 수 있다.
샘플 UVB 농도 (μg/ml) IL-6 발현 (% of control)
평균
Untreated control - - 23.64
Con(-) + - 100
Con(+) H.C. + 10μM 31.23
17S-HDHA + 0.1 89.63
+ 1 83
+ 2 89.17
+ 5 81.66
PDX + 0.1 95.36
+ 1 102.69
+ 2 88.13
+ 5 86.72
RvD5 + 0.1 99.58
+ 1 109.86
+ 2 99.49
+ 5 83.38
[6-3] SPMs 복합 조성물의 IL-6 억제 효과 확인
다음으로, SPMs 복합 조성물의 경우 표 3 및 도 1b에 나타난 바와 같이, UVB를 조사함으로써 IL-6의 발현이 증가하였고, 이렇게 증가된 IL-6의 발현은 본 발명의 SPMs 복합 조성물(조성 1, 2, 3) 2μg/ml를 처리하였을 때 Con(-) 대비 각각 18%, 33.8%, 29.5% 정도 감소되었으며, SPM의 처리 농도에 의존적인 경향을 나타내었다.
이로부터 본 발명의 SPMs 복합 조성물들은 모두 우수한 염증 완화 효능을 갖는다는 것을 알 수 있다.
샘플 UVB 농도 (μg/ml) IL-6 발현 (% of control)
평균
Untreated control - - 15.62
Con(-) + - 100
Con(+) H.C. + 10μM 42.82
조성 1(17S-HDHA: RvD5: PDX= 3: 47:50) + 0.1 74.66
+ 1 72.49
+ 2 72.98
+ 5 64.93
조성 2(17S-HDHA: RvD5: PDX= 25:56:19) + 0.1 71.28
+ 1 64.98
+ 2 66.18
+ 5 62.03
조성 3(17S-HDHA: RvD5: PDX= 84:10:6) + 0.1 80.61
+ 1 78.63
+ 2 70.52
+ 5 68.19
[6-4] SPMs 복합 조성물의 상승적 IL-6 억제 효과 확인
하기 표 7 및 도 11c에 나타난 바와 같이, 2μg/ml의 복합 조성물을 처리하는 경우, Con(-) 대비 조성 1은 18%, 조성2는 33.8%, 조성3은 29.5% 정도 IL-6의 발현이 감소되어, SPM 단독 성분을 동일한 농도로 처리하였을 때 대비 IL-6의 발현 감소 효과가 상승된 것으로 확인되었다.
UVB 20mJ/cm2
Con (-) 17S-HDHA PDX RvD5 조성 1 조성 2 조성 3
100 89.17 88.13 99.49 72.98 66.18 70.52
이로부터, 본 발명의 SPMs 복합 조성물은 단독 성분 대비 현저하게 상승된 염증 완화 효과를 가지는 것을 알 수 있다. 또한, 상기 결과는 17S-HDHA, PDX 및 RvD5의 시너지 효과로 인해 이들을 단독으로 사용할 때 보다 복합 조성물로 사용할 때 그 사용량을 감소시킬 수 있음을 의미하며, 이로부터 SPM을 과량 사용할 경우 나타날 수 있는 잠재적인 부작용을 방지할 수 있음을 알 수 있다.
[실시예 7]
SPMs 복합 조성물에 의한 상승적 프로콜라겐(procollagen) 합성 효과 확인
세포외기질의 주요 구성 성분인 콜라겐은 프로콜라겐이라는 전구 물질의 형태로 합성된다. 상기 프로콜라겐은 중합 반응이 일어날 때 콜라겐 분자로부터 절단, 분리되는 것으로 알려져 있는바, 프로콜라겐의 양을 측정함으로써 세포 내에서의 콜라겐 생합성 정도를 가늠할 수 있다.
[7-1] 실험방법
인간 진피 섬유아세포에 상기 SPM 단독 물질 및 이들의 복합 조성물(조성 1 내지 3)을 각각 0.1, 1, 2 및 5 μg/ml의 농도로 처리하고 24시간 동안 배양한 다음, 배양된 세포의 배지를 수거하여 procollagen typeI c-peptide (PIP) EIA 키트(TAKARA, MK101)로 프로콜라겐의 양을 측정하였다. 이때, 아무 것도 처리하지 않은 경우를 Untreated control로, 그리고 50 μM의 레티닐 팔미테이트(retinyl palmitate)를 처리한 경우를 Con(+)로 하여, SPM 단독 성분 및 이들의 복합 조성물(조성 1 내지 3)의 효과를 확인하였다.
[7-2] SPM 단독 성분의 프로콜라겐 합성 효과 확인
하기 표 8 및 도 12a에 도시된 바와 같이, 17-HDHA, 프로텍틴 DX 및 레졸빈 D5 모두 Untreated control에 비해 더 많은 양의 프로콜라겐이 확인되었다. 특히 프로텍틴 DX와 레졸빈 D5는 1 μg/ml 이상의 농도에서 양성 대조군(50 μM의 레티닐 팔미테이트)에 비해, 더 많은 양의 프로콜라겐이 확인되었다.
이로부터 17-HDHA, 프로텍틴 DX, 레졸빈 D5는 모두 프로콜라겐의 합성능을 향상시킴을 알 수 있다.
샘플 농도 (μg/ml) 프로콜라겐 합성 (% of control)
평균
Untreated control - 100
Con(+) R.P. 50μM 249.88
17S-HDHA 0.01 212.76
0.1 237.76
1 235.8
2 255.32
PDX 0.01 237.15
0.1 244.1
1 251.41
2 254.1
RvD5 0.01 245.68
0.1 248
1 249.34
2 255.32
[7-3] SPMs 복합 조성물의 프로콜라겐 합성 효과 확인
다음으로, SPMs 복합 조성물의 경우, 하기 표 9 및 도 12b에 나타난 바와 같이, 혼합 비율을 달리한 조성 1 내지 3 모두 Untreated control에 비해 2배 내지 3배 이상 더 많은 양의 프로콜라겐이 확인되었다. 특히 SPMs 복합 조성물은 조성 1 내지 3 모두 0.1 μg/ml 이상의 농도에서 50 μM의 레티닐 팔미테이트를 처리한 Con(+)에 비해, 더 많은 양의 프로콜라겐이 확인되었다.
이로부터 본 발명의 SPMs 복합 조성물은 모두 프로콜라겐의 합성능을 현저하게 향상 시킴을 알 수 있다.
샘플 농도 (μg/ml) 프로콜라겐 합성 (% of control)
평균
Untreated control - 100
Con(+) R.P. 50μM 240.2
조성 1(17S-HDHA: RvD5: PDX= 3: 47:50) 0.01 218.2
0.1 259.3
1 289.5
2 302.7
조성 2(17S-HDHA: RvD5: PDX= 25:56:19) 0.01 225.6
0.1 265.2
1 302
2 307.1
조성 3(17S-HDHA: RvD5: PDX= 84:10:6) 0.01 220.7
0.1 267.3
1 301.1
2 304.4
[7-4] SPMs 복합 조성물의 상승적 프로콜라겐 합성 효과 확인
하기 표 10 및 도 12c에 도시된 바와 같이, SPMs 복합 조성물(조성 1, 2, 3)은 모두 17-HDHA, 프로텍틴 Dx 또는 레졸빈 D5 단독 성분에 비해, 더 많은 양의 프로콜라겐이 확인되었다.
Untreated control 17S-HDHA PDX RvD5 조성 1 조성 2 조성 3
100 255.32 254.1 255.32 302.7 307.1 304.4
이로부터 본 발명의 SPMs 복합 조성물은 단독 성분 대비 현저하게 상승된 프로콜라겐 합성능을 가지는 것을 알 수 있다. 또한, 상기 결과는 17S-HDHA, PDX 및 RvD5의 시너지 효과로 인해 이들을 단독으로 사용할 때 보다 복합 조성물로 사용할 때 그 사용량을 감소시킬 수 있음을 의미하며, 이로부터 SPM을 과량 사용할 경우 나타날 수 있는 잠재적인 부작용을 방지할 수 있음을 알 수 있다.
[실시예 8]
SPMs 복합 조성물에 의한 콜라겐 분해효소(MMP-1) 발현 억제능 향상 효과 확인
MMPs(matrix metalloproteinases)는 단백질 분해 활성을 갖는 효소로, 세포외기질을 구성하는 단백질들을 분해하여 세포외기질을 구성하는 단백질과 세포의 결합에 중요한 영향을 미치게 된다. MMPs는 28개의 타입으로 존재하며, 이 중 MMP-1은 콜라겐을 분해하는 효소로 본 실시예에서는 세포 내 MMP-1의 발현 정도를 확인하였다.
구체적으로, 인간 진피 섬유아세포를 24시간 동안 배양한 다음 배지를 250㎕/웰 농도의 DPBS(WelGENE)로 교환하고 100mJ/㎠의 UVB를 조사한 뒤, 상기 조성 2가 각각 0.1, 1, 2, 및 5ppm의 농도로 희석된 DMEM(2% FBS)을 처리하여 48시간 배양하였다. 배양된 세포의 배지를 수거한 뒤 human total MMP-1 ELISA kit(R&D systems, DY901)를 사용하여 MMP-1 양을 측정하였다. 이때, 아무 것도 처리하지 않은 경우를 음성 대조군으로, 그리고 20μM의 레티노산(retinoic acid)를 처리한 경우를 양성 대조군으로 하여, 조성 2의 효과를 확인하였다.
그 결과, 도 13에 도시된 바와 같이, UVB를 조사함으로써 MMP-1의 발현이 약 2배 정도 증가하였고, 이렇게 증가된 MMP-1의 발현은 20μM의 레티노산을 처리함에 따라 약 70% 정도 감소되는 한편, SPMs 복합 조성물을 처리한 경우에는 0.01ppm에서 11.4%, 0.1ppm에서 26.1%, 그리고 1ppm에서 63.3% 감소되었으며, 이러한 MMP-1의 발현 억제 효과 역시 SPMs 복합 조성물의 처리 농도에 의존적인 경향을 나타내었다.
이로부터, 본 발명의 SPMs 복합 조성물은 피부 주름을 개선하는 효과가 우수한 것을 알 수 있다.
[실시예 9]
SPMs 복합 조성물에 의한 TNF-α 발현 억제능 향상 효과 확인
TNF-α는 대표적인 염증성 cytokine으로서 발현양이 증가하면 염증성 피부질환을 심화시키는 것으로 알려져 있다. 종양괴사인자인 TNF-α는 많은 염증반응에서 가장 중추적 역할을 하는 중요인자로서 TNF-α의 발현조절은 염증성 질환에서 중요한 역할을 한다. 따라서 본 발명의 SPMs 복합 조성물의 염증완화 효과를 확인하기 위하여 TNF-α의 발현 양상을 확인하였다.
구체적으로, 인간 각질형성세포를 48웰 플레이트에 4x104개/웰의 농도로 분주하고 5% CO2, 37℃에서 24시간 동안 배양한 후, 배지를 제거하고 DMEM Serum Free media로 기아 상태를 24시간 동안 유지하였다.
상기 조성 2를 DMEM(FBS 2%)으로 희석하여 0.5, 1, 2 및 5 μg/ml로 만든 다음, 상기와 같이 배양되어 배지가 제거된 인간 각질형성세포에 1시간 동안 처리하였다. 그런 다음, TNF-α 발현을 위해 배지를 250㎕의 DPBS(WelGENE)로 교환하고 160mJ/㎠의 UVB를 조사한 뒤, 다시 SPMs를 처리한 후 24시간 동안 배양하였다. 그리고 배지를 수거한 뒤, Human TNF-α DuoSet ELISA(R&D system)를 사용하여 TNF-α의 양을 각각 측정하고, 바닥에 부착되어 있는 세포를 DPBS로 세척한 후, 1N NaOH로 용해시켜 BCA 분석을 통해 단백질 양을 측정하여 일정 단백질당 TNF-α의 합성량을 측정하였다. 이때, 아무 것도 처리하지 않은 경우를 음성 대조군으로, 그리고 10 μM의 하이드로코르티손(hydrocortisone)을 처리한 경우를 양성 대조군으로 하여, SPMs 복합 조성물의 효과를 확인하였다.
그 결과, TNF-α의 경우, 도 14에 도시된 바와 같이, UVB를 조사함으로써 TNF-α의 발현이 약 5배 정도 증가하였고, 이렇게 증가된 TNF-α의 발현은 10μM의 하이드로코르티손을 처리함에 따라 약 52% 정도 감소되는 한편, 1ppm의 SPMs 복합 조성물에 의해 약 49% 정도 감소되었으며, 이러한 TNF-α의 발현 억제 효과는 SPMs 복합 조성물의 처리 농도에 의존적인 경향을 나타내었다.
이로부터, 본 발명의 SPMs 복합 조성물은 염증을 종결시키는 효과가 우수한 것을 알 수 있다.
[실시예 10]
SPMs 복합 조성물에 의한 NO 생성 감소능 향상 효과 확인
활성산소의 일종으로 염증 유발에 중요한 역할을 하는 것으로 알려진 nitric oxide (NO)는 높은 반응성을 가진 생체 생성분자이다. 염증반응에 관여되는 핵심적인 분자인 NO는 염증매개물로 염증반응을 가속화시켜 염증 반응을 더욱 악화시킨다. 따라서 미세먼지로 유도된 자극에 대하여 NO 생성량을 확인 하였다.
구체적으로, 세포로부터 생성된 NO의 양을 세포 배양액 중에 존재하는 nitrite 농도를 Griess Reagent System을 이용하여 측정하였고 sodium nitrite의 농도별 표준곡선을 이용하여 배양액의 NO 농도를 결정하였다.
그 결과, 도 15에 도시된 바와 같이 SPMs 복합 조성물을 0.1~5 ppm 처리한 세포에서 NO의 생성이 39.2~ 70%까지 감소되는 것을 확인하였다.
이로부터, 본 발명의 SPMs 복합 조성물이 염증을 완화시키는 효과가 있음을 알 수 있다.
[실시예 11]
SPMs 복합 조성물에 의한 지질과산화물 생성량 감소능 향상 효과 확인
세포의 지질과산화(Lipid peroxiation)는 동식물에서 노화나 질병상태에서 발생하는 세포손상(cellular damage) 메커니즘 중의 하나로 lipid peroxidation의 산물인 total malondialdehyde (MDA) 측정을 통해 세포 손상 정도를 확인할 수 있다. 따라서 미세먼지로 유도된 자극에 대하여 SPMs 복합 조성물에 의한 MDA 생성량을 확인하였다.
구체적으로, Lipid peroxidation의 산물인 total malondialdehyde (MDA)의 양을 thiobarbituric Acid (TBA)와 반응시켜 MDA-TBA adduct를 TBARS Method로 측정하였다.
그 결과, 도 16에 도시된 바와 같이 SPMs 복합 조성물을 0.1~5 ppm 처리한 세포에서 MDA의 생성이 19.1~62.7%까지 감소되는 것을 확인하였다.
이로부터, 본 발명의 SPMs 복합 조성물이 피부 노화를 억제하는 효과가 있음을 알 수 있다.
[실시예 12]
SPMs 복합 조성물에 의한 피부장벽 개선능 향상 효과 확인
피부장벽을 구성하는 핵심 단백질로는 필라그린(Filaggrin), 로리크린(Loricrin) 및 인볼루크린(Involucrin) 이 알려져 있다. 이중 필라그린은 표피의 과립세포에 존재하는 keratohyaline granule (KG)을 구성하는 프로필라그린이 분해됨으로써 생성되는 단백질로 각질형성세포 내에서 케라틴 필라멘트를 응집하여 피부장벽에 중요한 역할을 담당한다. 따라서 시료에 의한 필라그린 및 로리크린의 발현을 확인하여 피부 장벽 강화 효과를 확인하고자 하였다.
인간 각질형성세포를 DMEM 배지에서 실시예 9와 동일한 조건에서 배양하였다. 피부 장벽 개선능과 관련된 유전자 발현을 확인하기 위해 배양된 세포에 본 발명의 SPMs 복합 조성물을 농도 별로 처리하여 배양한 뒤 RNA를 추출하였고 RT-PCR을 수행하였다. 증폭된 유전자는 Gel documentation system과 Image J 프로그램을 이용하여 분석하였다.
그 결과, 도 17a 및 도 17b에 도시된 바와 같이 양성대조군인 hyaluronic acid를 50 ppm 처리 시 필라그린은 52.6%, 로리크린은 97.7% 발현이 증가하였고 본 발명의 SPMs 복합 조성물을 0.1~5ppm 처리 시 필라그린은 31.3~52.8%, 로리크린은 31.8~88.5% 증가함을 확인 하였다.
이로부터, 본 발명의 SPMs 복합 조성물이 피부 장벽을 강화시키는 효과가 있음을 알 수 있다.
[실시예 13]
SPMs 크림을 이용한 인체효능평가
SPMs 복합 조성물을 이용하여 아래 표 11과 같은 조성으로 크림(크림S)을 제조하였다. 비교 실험을 위하여, 세라마이드 크림 (크림C)과 베이스크림 (크림B)도 아래와 같은 조성으로 제조하였다.
크림S 크림C 크림B
SPMs 복합 조성물 2.00 - -
세라마이드 AC45 - 1.00 -
글리세린 5.00 5.00 5.00
1,2-헥산디올 2.00 2.00 2.00
오일 적량 적량 적량
방부제 적량 적량 적량
정제수 적량 적량 적량
(단위: 중량부)
[13-1] SPMs 크림에 의한 피부장벽 개선 효능 확인
여성 12명 (평균연령 45세 ± 5.54)을 대상으로 피부 장벽 개선 인체효능평가를 실시하였다. 전완부를 시험부위로 하였으며, 물리적 손상을 시험부위 3 부위와 대조부위(무도포)로 나누어 4 부위에 가한 후, 크림S (SPM 크림), 크림C (Ceramide 크림), 크림B (Base 크림)를 각각 정해진 부위에 1주간, 1일 2회 사용하도록 하고, 대조부위(무도포)와 비교하여 기기측정을 진행하였다. 피부 손상 전, 피부손상 직후, 시험 제품 사용 1일 후, 4일 후, 7일 후에 측정 및 유효성 설문평가를 진행하였다. 피부장벽개선 효과는 Tewameter TM300을 이용하여 TEWL(Transepidermal Water Loss; 경피수분손실량)을 측정하여 확인하였다.
그 결과, 도 18a에 도시된 바와 같이 피부장벽개선 소재로 가장 널리 사용되고 있는 세라마이드크림은 Base 크림 대비, 유의적 개선 없는 반면, SPM 크림은 무도포군 및 Base 크림 대비, 통계적으로 유의미하게 피부장벽개선효능을 나타내었다(등분산가정두집단 양측검정, t-test; 사용 4일 후 p<0.034, 사용 7일 후 p<0.027). 또한, 피부장벽회복율(%) 비교 결과, 도 18b에 도시된 바와 같이 Base 크림 및 세라마이드 크림 대비, SPM 크림이 비교우위에 있음이 확인되었다(Wilcoxon 부호순위검정; * p≤0.05, ** p≤0.01, *** p≤0.001)
[13-2] SPMs 크림에 의한 아토피피부염 개선 효능 확인
시험대상자 22명을 대상으로 건조증에 기인한 가려움증 완화에 대한 인체효능평가를 실시하였다. 피부 수분 측정 후 군간 평균값을 맞추어 시험제품 크림S, 크림C를 11명씩 무작위 배정하여 각 제품을 사용하도록 하였다. 전완부와 건조증 병변 부위를 시험부위로 하였으며, 제품 사용 전, 제품 사용 2주 후, 제품 사용 4주 후에 기기 측정 및 유효성 설문평가를 진행하였다.
아토피피부염 개선 효과는 Comeometer CM825를 이용한 피부 수분 측정, Tewameter TM300을 이용한 피부 수분손실량 측정, 가려움중 개선도 평가(VAS)를 통해 확인하였다.
피부 보습 효과 확인
도 19a에 도시된 바와 같이, 아토피성 피부염의 건조증상 완화를 위해 가장 널리 사용되고 있는 세라마이드 크림은 제품사용 전 대비, 피부수분량 증가 수치는 보이나 통계학적 유의성 없는 반면, SPM 크림은 통계적으로 유의미하게 병변 부위의 피부수분개선효능을 나타내는 것으로 확인되었다(사용 2주, 4주; <0.014, p<0.0115).
병변부위 피부장벽 개선 효과 확인
도 19b에 도시된 바와 같이, 경피수분손실량 변화율에 있어서도 세라마이드크림은 제품사용 전 대비, 경피수분손실량 감소 수치는 보이나 통계학적 유의성이 없는 반면, SPM 크림은 통계적으로 유의미하게 병변 부위의 경피수분손실 개선 효능을 나타내었다 (사용 4주; P<0.01451).
가려움증 개선 효과 확인
도 19c에 도시된 바와 같이, 가려움증 개선 효과에 있어서는 SPM 크림과 세라마이드 크림 모두 사용 2주, 4주 후 통계적으로 유의하게 가려움증 지수가 개선되는 것으로 확인되었다.
이로부터, 본 발명의 SPM 크림은 피부장벽개선, 아토피와 같은 피부건조증으로 기인한 피부소양증, 수분, 가려움증 개선 기능성 소재로 범용적으로 사용되고 있는 세라마이드보다 동등 수준 이상으로 피부 보습, 피부장벽 개선 및 가려움증 개선 효과를 나타내는 것을 알 수 있다.
[13-3] SPMs 크림에 의한 눈가주름 및 피부수분개선 효과 확인
선정된 시험대상자 20명을 대상으로 크림A, 크림S의 눈가 주름 및 피부 수분 개선에 대한 인체효능평가를 실시하였다. 눈가를 시험부위로 하였으며, 10명의 시험대상자는 크림A를 나머지 10명의 시험대상자는 크림S를 각각 8주간 1일 2회 사용하도록 하였다. 시험제품 사용 전, 사용 4주 후, 사용 8주 후에 시험대상자를 대상으로 기기측정을 통해 주름 및 피부수분 개선 효과를 확인하였다.
구체적으로 눈가 주름 측정은 Antera 3D CS 를 사용하였고, 피부 수분 측정은 Comeometer 를 사용하여 측정하였다.
눈가주름 개선 효과 확인
도 20a에 도시된 바와 같이, 주름개선 기능성 고시성분 레티놀이 함유된 크림A의 피험자별 피부주름 개선율(%)은 제품사용 전 대비, 통계적 유의성이 없으나, SPM 크림은 사용 4주, 8주에서 사용 전 대비 유의적인 피부주름개선율(%)을 나타내는 것으로 확인되었다(t-test (등분산가정두집단, 양측검정); *, p≤0.05); **, p≤0.01; ***, p≤0.001).
눈가 보습효과 확인
도 20b 및 도 20c에 도시된 바와 같이, SPM 크림과 레티놀 크림 사용 8주에서 눈가 피부의 수분이 통계적으로 유의하게 증가하였으며, SPM크림과 레티놀 크림 간의 통계적 유의차는 없었다.
이로부터, 본 발명의 SPM 크림은 주름개선 고시원료인 레티놀과 동등 수준 이상으로 눈가 피부수분량 및 눈가 피부주름 개선 효과를 나타내는 것을 알 수 있다.
상기에서는 본 발명의 바람직한 실시예를 예시적으로 설명하였으나, 본 발명의 범위는 상기와 같은 특정 실시예에만 한정되지 아니하며, 해당 분야에서 통상의 지식을 가진 자라면 본 발명의 특허청구범위에 기재된 범주 내에서 적절하게 변경이 가능할 것이다.

Claims (27)

  1. 서열번호 1 또는 서열번호 2의 아미노산 서열과 90% 이상의 상동성을 가지는 아미노산 서열을 포함하는, 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체(mono-hydroxy or di-hydroxy derivatives) 생성용 효소.
  2. 청구항 1에 있어서,
    상기 다중불포화지방산은 도코사헥사노엔산(DHA) 또는 에이코사펜타엔산(EPA)인, 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소.
  3. 청구항 1의 모노-하이드록시 또는 디-하이드록시 유도체 생성용 효소를 암호화하는 핵산분자.
  4. 청구항 3에 있어서,
    상기 핵산분자는 서열번호 3 또는 서열번호 4의 뉴클레오티드 서열로 이루어지는 핵산분자.
  5. 청구항 3의 핵산분자를 포함하는 재조합 발현벡터.
  6. 청구항 5의 재조합 발현벡터가 숙주세포에 도입된 형질전환체.
  7. 청구항 1의 효소를 다중불포화지방산과 반응시키는 단계;를 포함하는, 인 비트로(in vitro)에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법.
  8. 청구항 7에 있어서,
    상기 효소와 다중불포화지방산 반응물로부터 모노-하이드록시 또는 디-하이드록시 유도체를 회수하는 단계;를 더 포함하는, 인 비트로(in vitro)에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법.
  9. 청구항 7에 있어서,
    상기 반응시키는 단계는 10 ℃ 내지 40 ℃ 및 pH 4 내지 pH 10의 조건에서 배양하는, 인 비트로(in vitro)에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법.
  10. 청구항 7에 있어서,
    상기 다중불포화지방산은 DHA(Docosahexaenoic acid) 또는 EPA(Eicosapentaenoic acid)인, 인 비트로(in vitro)에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법.
  11. 청구항 6의 형질전환체를 다중불포화지방산의 존재 하에서 배양하는 단계; 및
    상기 배양된 배양물에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체를 분리하는 단계;를 포함하는, 인 비보(in vivo)에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법.
  12. 청구항 11에 있어서,
    상기 다중불포화지방산은 DHA(Docosahexaenoic acid) 또는 EPA(Eicosapentaenoic acid)인, 인 비보(in vivo)에서 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체의 생산 방법.
  13. 17-하이드록시도코사헥사엔산, 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 포함하는 피부 상태 개선용 복합 조성물.
  14. 청구항 13에 있어서,
    상기 피부 상태의 개선은 피부 주름 예방 또는 개선, 피부 노화 예방 또는 개선, 피부 염증 예방 또는 개선, 피부 재생 및 피부 장벽 강화로 이루어진 군에서 선택되는 1종 이상인, 피부 상태 개선용 복합 조성물.
  15. 청구항 13에 있어서,
    상기 피부 상태는 자외선에 의한 광노화, 기미, 주근깨, 피부 상처, 피부염, 아토피 피부염, 소양증, 습진성 피부질환, 건성 습진, 홍반, 두드러기, 건선, 약발진, 및 여드름으로 이루어진 군으로부터 선택된 어느 하나 이상인 것인, 피부 상태 개선용 복합 조성물.
  16. 청구항 13에 있어서,
    상기 조성물은 i) 세포 중 콜라겐의 합성을 촉진하거나, ii) 콜라겐 분해를 억제하거나, iii) 메탈로프로테나제-1 (matrix metalloproteinase-1; MMP-1)의 발현 또는 활성을 억제하는 것인, 피부 상태 개선용 복합 조성물.
  17. 청구항 13에 있어서,
    상기 조성물은 항산화 활성을 갖는 것인, 피부 상태 개선용 복합 조성물.
  18. 청구항 13에 있어서,
    상기 조성물은 염증 인자를 억제하는 것인, 피부 상태 개선용 복합 조성물.
  19. 청구항 13에 있어서,
    상기 조성물은 필라그린(Filaggrin) 또는 로리크린(Loricrin)의 발현을 증가시키는 것인, 피부 상태 개선용 복합 조성물.
  20. 청구항 13에 있어서,
    상기 17-하이드록시도코사헥사엔산, 레졸빈 D5 및 프로텍틴 DX을 3~85: 10~60: 6~50 중량비로 포함하는 것인, 피부 상태 개선용 복합 조성물.
  21. 청구항 13에 있어서,
    상기 조성물은 화장료 조성물인 피부 상태 개선용 복합 조성물.
  22. 청구항 13에 있어서,
    상기 조성물은 식품 조성물인 피부 상태 개선용 복합 조성물.
  23. 17-하이드록시도코사헥사엔산, 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 포함하는 피부 질환의 예방 또는 치료용 약학적 조성물.
  24. 청구항 23에 있어서,
    상기 피부 질환은 피부 상처, 피부 흉터, 피부염, 아토피 피부염, 소양증, 습진성 피부질환, 건성 습진, 무좀, 홍반, 두드러기, 건선, 약발진, 여드름 및 탈모로 이루어진 군에서 선택되는 1종 이상인, 약학적 조성물.
  25. 17-하이드록시도코사헥사엔산, 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 함유하는 복합 조성물의 유효량을 피부 상태 개선이 필요한 개체에 투여하는 단계를 포함하는 피부 상태를 개선시키는 방법.
  26. 17-하이드록시도코사헥사엔산, 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 함유하는 복합 조성물의 유효량을 피부 질환 치료가 필요한 개체에 투여하는 단계를 포함하는 피부 질환의 예방 또는 치료방법.
  27. 피부 질환의 예방 또는 치료에 사용하기 위한 용도의, 17-하이드록시도코사헥사엔산, 레졸빈 D5 및 프로텍틴 DX를 유효성분으로 함유하는 복합 조성물.
PCT/KR2019/017246 2019-12-06 2019-12-06 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체, 이의 생산 방법 및 이의 용도 WO2021112310A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP2022521086A JP7349569B2 (ja) 2019-12-06 2019-12-06 多価不飽和脂肪酸のモノ－ヒドロキシまたはジ－ヒドロキシ誘導体、その生産方法およびその用途
US17/767,425 US20240000680A1 (en) 2019-12-06 2019-12-06 Mono-hydroxy or di-hydroxy derivatives of polyunsaturated fatty acids, production method therefor, and use thereof
EP19955117.7A EP4071241A4 (en) 2019-12-06 2019-12-06 MONO- OR DIHYDROXY DERIVATIVES OF POLY UNSATURATED FATTY ACIDS, METHOD FOR THEIR PRODUCTION AND THEIR USE
CN201980101961.2A CN114729335A (zh) 2019-12-06 2019-12-06 多不饱和脂肪酸的单羟基或二羟基衍生物、其制备方法及其用途
PCT/KR2019/017246 WO2021112310A1 (ko) 2019-12-06 2019-12-06 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체, 이의 생산 방법 및 이의 용도

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2019/017246 WO2021112310A1 (ko) 2019-12-06 2019-12-06 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체, 이의 생산 방법 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2021112310A1 true WO2021112310A1 (ko) 2021-06-10

Family

ID=76222008

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/017246 WO2021112310A1 (ko) 2019-12-06 2019-12-06 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체, 이의 생산 방법 및 이의 용도

Country Status (5)

Country Link
US (1) US20240000680A1 (ko)
EP (1) EP4071241A4 (ko)
JP (1) JP7349569B2 (ko)
CN (1) CN114729335A (ko)
WO (1) WO2021112310A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111989399B (zh) * 2018-04-16 2024-07-12 韩国生命工学研究院 多不饱和脂肪酸的多羟基衍生物的制备方法
KR20220159751A (ko) * 2021-05-26 2022-12-05 (주)아모레퍼시픽 미백용 조성물 및 이를 이용한 피부 미백방법

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090003281A (ko) * 2006-03-31 2009-01-09 디에스엠 아이피 어셋츠 비.브이. 신체적 외관의 개선을 위한 화합물 및 화합물의 조합물의 신규한 용도
JP2016537411A (ja) * 2013-10-29 2016-12-01 ディグニティ サイエンシス リミテッド １５−ヒドロキシ脂肪酸誘導体の作製方法
KR20180096157A (ko) * 2017-02-20 2018-08-29 서울대학교병원 프로텍틴 dx를 유효성분으로 포함하는 피부 노화 예방 또는 치료용 조성물 및 그의 용도
KR101971481B1 (ko) * 2017-11-13 2019-04-23 한국생명공학연구원 조류 유래 리폭시게나아제 효소를 이용한 다중불포화지방산의 유도체를 생산하는 방법

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL2858496T3 (pl) * 2012-05-10 2023-09-11 Solutex Na Llc Oleje o działaniu przeciwzapalnym zawierające naturalne wyspecjalizowane mediatory prorozdzielcze i ich prekursory
EP3267990A4 (en) * 2015-03-10 2018-09-05 ELC Management LLC Methods and compositions for treating skin to resolve inflammation and screening for actives that stimulate pro-resolution pathways
GB201522132D0 (en) * 2015-12-15 2016-01-27 Glaxosmithkline Biolog Sa Vaccine
CN111989399B (zh) * 2018-04-16 2024-07-12 韩国生命工学研究院 多不饱和脂肪酸的多羟基衍生物的制备方法

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090003281A (ko) * 2006-03-31 2009-01-09 디에스엠 아이피 어셋츠 비.브이. 신체적 외관의 개선을 위한 화합물 및 화합물의 조합물의 신규한 용도
JP2016537411A (ja) * 2013-10-29 2016-12-01 ディグニティ サイエンシス リミテッド １５−ヒドロキシ脂肪酸誘導体の作製方法
KR20180096157A (ko) * 2017-02-20 2018-08-29 서울대학교병원 프로텍틴 dx를 유효성분으로 포함하는 피부 노화 예방 또는 치료용 조성물 및 그의 용도
KR101971481B1 (ko) * 2017-11-13 2019-04-23 한국생명공학연구원 조류 유래 리폭시게나아제 효소를 이용한 다중불포화지방산의 유도체를 생산하는 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN 19 May 2013 (2013-05-19), ANONYMOUS: "Lipoxygenase [Oscillatoria acuminata)", XP055832074, retrieved from NCBI Database accession no. WP_015148841.1 *
See also references of EP4071241A4 *

Also Published As

Publication number Publication date
US20240000680A1 (en) 2024-01-04
EP4071241A4 (en) 2023-10-18
JP2022552232A (ja) 2022-12-15
EP4071241A1 (en) 2022-10-12
CN114729335A (zh) 2022-07-08
JP7349569B2 (ja) 2023-09-22

Similar Documents

Publication Publication Date Title
WO2021112310A1 (ko) 다중불포화지방산의 모노-하이드록시 또는 디-하이드록시 유도체, 이의 생산 방법 및 이의 용도
WO2020091440A9 (ko) 3,5-디카페오일퀴닉산을 유효성분으로 함유하는 피부장벽 손상 개선용 및/또는 피부 염증 완화용 조성물
WO2020171364A1 (ko) 님트리 잎 추출물을 포함하는 화장료 조성물
WO2011136573A2 (ko) 비만 치료 및 항산화 활성을 갖는 효모 가수분해물
WO2017146414A1 (ko) α-테르피네올을 유효성분으로 함유하는 피부 보습 및 피부 주름 개선용 조성물
WO2018186640A1 (ko) 오시멘 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2015037778A1 (ko) 리그난 화합물을 유효 성분으로 포함하는 암의 예방 또는 치료용 조성물
WO2017213346A1 (ko) 디오스민 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
WO2015111832A1 (ko) 지실 추출물을 포함하는 전립선 관련 질환의 예방 또는 치료용 조성물
WO2018186641A1 (ko) 피페로날 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2018186644A1 (ko) 자스몬 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2018186643A1 (ko) 신코닌 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2022085858A1 (ko) 황칠 추출물을 포함하는 미백 또는 주름 개선용 조성물
WO2014003232A1 (ko) 황칠나무 추출물을 유효성분으로 포함하는 발모 촉진용 조성물
WO2017188690A1 (ko) 페닐아세트알데히드를 포함하는, 유방암 줄기세포 성장 억제용 조성물
WO2017142265A1 (ko) 아디프산을 유효성분으로 함유하는 피부주름개선 및 피부탄력증진용 조성물
WO2020027534A1 (ko) 푸니칼라진을 포함하는 par2 활성 억제용 조성물
Thao et al. Chemicals from Cimicifuga dahurica and their inhibitory effects on pro-inflammatory cytokine production by LPS-stimulated bone marrow-derived dendritic cells
WO2018186639A1 (ko) 요놀 또는 이의 염을 유효성분으로 함유하는 피부주름 개선, 보습, 탄력증진, 각질제거, 홍반억제 또는 피부광노화 개선용 조성물
WO2016190689A2 (ko) 근육 질환 예방, 개선 또는 치료용 또는 근 기능 개선용 조성물
KR20240017335A (ko) 신규 페닐프로파노이드 화합물
WO2019203540A2 (ko) 다중불포화지방산의 멀티-하이드록시 유도체 생산 방법
WO2021187959A1 (ko) 글리세롤 글루코시드계 화합물 및 이를 포함하는 자외선 차단용 또는 항염증용 조성물
WO2023128630A1 (ko) 담팔수 추출물을 포함하는 피부 개선용 화장료 조성물
WO2023113431A1 (ko) 신규한 균주 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19955117

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022521086

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 17767425

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019955117

Country of ref document: EP

Effective date: 20220706