WO2021092562A1 - Exon skipping of fc-epsilon-ri-beta and ms4a6a in combination for the treatment of allergic diseases - Google Patents

Exon skipping of fc-epsilon-ri-beta and ms4a6a in combination for the treatment of allergic diseases Download PDF

Info

Publication number
WO2021092562A1
WO2021092562A1 PCT/US2020/059682 US2020059682W WO2021092562A1 WO 2021092562 A1 WO2021092562 A1 WO 2021092562A1 US 2020059682 W US2020059682 W US 2020059682W WO 2021092562 A1 WO2021092562 A1 WO 2021092562A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
fcεriβ
ms4a6a
exon
antisense oligomer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/059682
Other languages
English (en)
French (fr)
Inventor
Glenn P. CRUSE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
North Carolina State University
Original Assignee
North Carolina State University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by North Carolina State University filed Critical North Carolina State University
Priority to JP2022526035A priority Critical patent/JP2023501347A/ja
Priority to CN202080092446.5A priority patent/CN115335078A/zh
Priority to EP20885567.6A priority patent/EP4054639A4/en
Priority to AU2020378207A priority patent/AU2020378207A1/en
Priority to US17/775,136 priority patent/US20220380777A1/en
Publication of WO2021092562A1 publication Critical patent/WO2021092562A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3233Morpholino-type ring
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/33Alteration of splicing

Definitions

  • the presently disclosed subject matter relates to the use of antisense oligonucleotides to modulate cell surface expression of Fc ⁇ RI ⁇ protein, thereby modulating IgE-mediated immune responses. More particularly, the presently disclosed subject matter relates in some embodiments to compositions and methods for modulating cell surface expression of Fc ⁇ RI ⁇ protein by inducing exon skipping in both Fc ⁇ RI ⁇ and MS4A6A pre-mRNAs.
  • Mast cells play a key role in allergic asthma through the release of mediators that drive inflammation and directly induce bronchoconstriction in response to IgE-directed antigens. Mast cells infiltrate key structures in the lung such as submucosal glands, airway epithelium and the airway smooth muscle (ASM) bundles in asthma.
  • ASM airway smooth muscle
  • Mast cell infiltration into the ASM in asthma is likely critical for the development of airway hyperresponsiveness since this key feature is one of the only immunopathological differences evident in asthmatics compared to patients with eosinophilic bronchitis, which is phenotypically similar to asthma except these patients do not exhibit airway hyperresponsiveness.
  • This feature of asthma strongly implicates mast cells as the driver of airway hyperresponsiveness.
  • emerging asthma therapies attempt to combat the effects of individual pleiotropic mediators or induce immune tolerance, which can be either ineffective or have serious adverse effects. None of the currently available drugs to treat asthma specifically target mast cell function.
  • the presently disclosed subject matter relies on a different approach, namely altering cellular responses to IgE-directed antigens.
  • This approach is based on the finding that one or more genes at human Ilql2-ql3 are strongly linked to allergy and asthma susceptibility, and the knowledge that the MS4A gene family is clustered around Ilql2-ql3. It is also known that the gene MS4A1, which encodes the protein CD20, and MS4A2, which encodes the Fc ⁇ RI ⁇ protein, are associated with activation and proliferation of B-cells and mast cells, respectively.
  • the human MS4A6A gene (also referred to herein and in the literature as the human MS4A6 gene) is also located within this region of human chromosome 11. Thus, these genes are considered candidates for the linkage of these genetic regions with allergy.
  • antisense oligomers comprising 10 to 50 linked nucleosides, wherein the antisense oligomers are targeted to a region of a pre-mRNA molecule encoding an MS4A6A protein or a region of a pre-mRNA molecule encoding an Fc ⁇ RI ⁇ protein.
  • the targeted regions may comprise sequences involved in splicing of the MS4A6A-encoding pre-mRNA and/or the Fc ⁇ RI ⁇ -encoding pre-mRNA such that hybridization of the antisense oligomer to the MS4A6A-encoding pre-mRNA and/or the Fc ⁇ RI ⁇ -encoding pre-mRNA alters splicing of the MS4A6A-encoding pre-mRNA and/or the Fc ⁇ RI ⁇ -encoding pre-mRNA.
  • Hybridization of the antisense oligomer to the MS4A6A-encoding pre-mRNA and/or the Fc ⁇ RI ⁇ - encoding pre-mRNA may in some embodiments reduce cell surface expression of a high affinity IgE receptor (Fc ⁇ RI).
  • the targeted region comprises at least a portion of a polynucleotide sequence selected from the group consisting of an intron sequence, an exon sequence, a sequence comprising an intron/exon junction, a splice donor sequence, a slice acceptor sequence, a splice enhancer sequence, a splice branch point sequence, a polypyrimidine tract, and/or an exon encoding a first transmembrane domain.
  • the targeted region of the MS4A6A-encoding pre-mRNA may comprise a polynucleotide sequence selected from an intron 3 sequence, an exon 4 sequence, a sequence comprising an intron 3/exon 4 junction, an exon 4 splice donor sequence, an exon 4 slice acceptor sequence, an exon 4 splice enhancer sequence, an exon 4 splice branch point sequence, or an exon 4 polypyrimidine tract.
  • the targeted region of the pre-mRNA comprises a polynucleotide sequence encoding the first transmembrane domain of the target protein.
  • one or more antisense oligomers are targeted to regions of an MS4A6A-encoding pre-mRNA transcribed from an MS4A6A gene (a “MS4A6A pre- mRNA”), and in some embodiments one or more antisense oligomers are targeted to regions of an Fc ⁇ RI ⁇ -encoding pre-mRNA transcribed from an MS4A2 gene (a “MS4A2 pre-mRNA”).
  • the MS4A6A and Fc ⁇ RI ⁇ proteins encoded by the transcription products may be from any mammal, including in some embodiments a human, in some embodiments a mouse, in some embodiments a dog, in some embodiments a cat, and in some embodiments a horse (e.g., the encoded MS4A6A and/or Fc ⁇ RI ⁇ protein may be a human MS4A6A and/or Fc ⁇ RI ⁇ protein, a murine MS4A6A and/or Fc ⁇ RI ⁇ protein, a canine MS4A6A and/or Fc ⁇ RI ⁇ protein, a feline MS4A6A and/or Fc ⁇ RI ⁇ protein, or an equine MS4A6A and/or Fc ⁇ RI ⁇ protein, or an MS4A6A and/or Fc ⁇ RI ⁇ protein from any other mammal).
  • a human MS4A6A and/or Fc ⁇ RI ⁇ protein a murine MS4A6A and/or Fc ⁇ RI ⁇ protein
  • the MS4A6A pre-mRNA and/or the Fc ⁇ RI ⁇ pre- mRNA encodes a human MS4A6A protein and/or Fc ⁇ RI ⁇ protein, respectively.
  • the human MS4A6A pre-mRNA comprises SEQ ID NO: 3 or a subsequence thereof.
  • the murine MS4A6 pre-mRNA comprises SEQ ID NO: 9 or a subsequence thereof.
  • the human MS4A6A protein comprises SEQ ID NO: 2 or a subsequence thereof.
  • the murine MS4A6 protein comprises SEQ ID NO: 8 or a subsequence thereof.
  • the human MS4A2 pre-mRNA comprises SEQ ID NO: 6 or a subsequence thereof. In some embodiments, the murine MS4A2 pre-mRNA comprises SEQ ID NO: 12 or a subsequence thereof. In some embodiments, the human MS4A2 protein comprises SEQ ID NO: 5 or a subsequence thereof. In some embodiments, the murine MS4A6A protein comprises SEQ ID NO: 11 or a subsequence thereof. In some embodiments, the murine MS4A6 nucleotide sequence corresponds to one of Accession NOs.
  • NM_027209.3, NM_028595.4, and NM_026835.2 of the GENBANK® biosequence database which encode the proteins disclosed as Accession Nos. NP_081485.2, NP_082871.2, and NP_081111.1 of the GENBANK® biosequence database, respectively.
  • Hybridization of antisense oligomers as set forth herein to MS4A6A pre-mRNAs and/or MS4A2 pre-mRNAs in some embodiments result in the production of a mature MS4A6A or MS4A2 mRNA molecule that lacks a portion or all of exon 4 (MS4A6A) or exon 3 (MS4A2) of the mature MS4A6A mRNA and/or the MS4A2 mRNA, respectively.
  • hybridization of an antisense oligomer as set forth herein to an MS4A2 pre-mRNA results in production of an mRNA molecule encoding a truncated Fc ⁇ RI ⁇ protein.
  • the truncated Fc ⁇ RI ⁇ protein may be t-Fc ⁇ RI ⁇ .
  • hybridization of an antisense oligomer as set forth herein to an MS4A6A pre-mRNA and/or to an MS4A2 pre-mRNA results in reduced localization of an Fc ⁇ RI ⁇ protein to the membrane of a cell expressing high affinity IgE receptor (Fc ⁇ RI).
  • the presently disclosed subject matter provides antisense oligomers comprising 10 to 50 linked nucleosides, wherein the 10 to 50 linked nucleosides comprise a targeting nucleic acid sequence sufficiently complementary to a target nucleic acid sequence in an MS4A6A-encoding pre-mRNA and/or an MS4A2-encoding pre- mRNA, such that the oligomer specifically hybridizes to the target sequence.
  • Hybridization of the antisense oligomer to the MS4A6A-encoding pre-mRNA and/or the MS4A6A-encoding pre-mRNA alters splicing of the pre-mRNA.
  • Hybridization of the antisense oligomer to the MS4A6A-encoding pre-mRNA and/or the MS4A6A-encoding pre-mRNA in some embodiments reduces cell surface expression of high affinity IgE receptor (Fc ⁇ RI).
  • Fc ⁇ RI high affinity IgE receptor
  • the targeting sequence in the antisense oligomer comprises at least 6 contiguous nucleobases fully complementary to at least 6 contiguous nucleobases in the target sequence, wherein the target sequence is a subsequence of any one of SEQ ID NOs: 3, 6, 9, and 12.
  • the targeting sequence in the antisense oligomer may be at least 80% complementary over its entire length to an equal length of contiguous nucleobases in the target sequence.
  • the targeting sequence may comprise at least a portion of a polynucleotide sequence selected from an intron sequence, an exon sequence, a sequence comprising an intron/exon junction, a splice donor sequence, a slice acceptor sequence, a splice enhancer sequence, a splice branch point sequence, a polypyrimidine tract, and/or an exon encoding a first transmembrane region.
  • the polynucleotide sequence is an MS4A2 sequence that is selected from an intron 2 sequence, an exon 3 sequence, a sequence comprising an intron 2/exon 3 junction, an exon 3 splice donor sequence, an exon 3 slice acceptor sequence, an exon 3 splice enhancer sequence, an exon 3 splice branch point sequence, an exon 3 polypyrimidine tract, an exon encoding the first transmembrane domain of MS4A2, or a combination thereof.
  • the polynucleotide sequence is an MS4A6A sequence that is selected from an intron 3 sequence, an exon 4 sequence, a sequence comprising an intron 3/exon 4 junction, an exon 4 splice donor sequence, an exon 4 slice acceptor sequence, an exon 4 splice enhancer sequence, an exon 4 splice branch point sequence, an exon 4 polypyrimidine tract, an exon encoding the first transmembrane domain of MS4A6A, or a combination thereof.
  • the target nucleic acid sequences may be in an MS4A6A- encoding pre-mRNA transcribed from an MS4A6A gene.
  • the encoded MS4A6A protein may be from any mammal, including a human, a mouse, a dog, a cat, or a horse.
  • the MS4A6A pre-mRNA encodes a human MS4A6A protein.
  • the target nucleic acid sequences may be in an MS4A6A-encoding pre- mRNA transcribed from an MS4A2 gene.
  • the encoded MS4A6A/Fc ⁇ RI ⁇ protein may be from any mammal, including a human, a mouse, a dog, a cat, or a horse.
  • the MS4A2 pre-mRNA encodes a human Fc ⁇ RI ⁇ protein.
  • the presently disclosed antisense oligomers can in some embodiments comprise, consist essentially of, or consist of 10 to 50 linked nucleosides, wherein the 10 to 50 linked nucleosides comprise, consist essentially of, or consist of a nucleic acid sequence at least partially complementary to a target nucleic acid sequence in a pre-mRNA molecule, which encodes a protein comprising in some embodiments SEQ ID NO: 2, in some embodiments SEQ ID NO: 5, in some embodiments SEQ ID NO: 8, and in some embodiments SEQ ID NO: 11.
  • the protein may be encoded by an MS4A6A transcript comprising either of SEQ ID NOs: 1 and 7 or an MS4A2 transcript comprising either of SEQ ID NOs: 4 and 10.
  • hybridization of the antisense oligomer to the pre-mRNA may alter splicing of the pre-mRNA. Hybridization of the antisense oligomer to the pre-mRNA may reduce cell surface expression of high affinity IgE receptor (Fc ⁇ RI).
  • an antisense oligomer of the presently disclosed subject matter targets an MS4A6A gene product, and in some embodiments the antisense oligomer comprises, consists essentially of, or consists of SEQ ID NO: 22.
  • an antisense oligomer of the presently disclosed subject matter targets an MS4A2 gene product, and in some embodiments the antisense oligomer comprises, consists essentially of, or consists of SEQ ID NO: 26.
  • the MS4A6A target sequence may comprise at least a portion of a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 3, 7, and 9, or an MS4A2 sequence comprising a portion of a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 4, 6, 10, and 12. The portion may be at least 10 contiguous nucleotides.
  • the target sequence may comprise a sequence at least 90% identical to a sequence selected from the group consisting of at least a portion of a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 3, 4, 6, 7, 9, 10, and 12.
  • the MS4A6A targeting sequence or the MS4A2 targeting sequence may comprise at least 10 contiguous nucleobases that are fully complementary in sequence to at least 10 contiguous nucleobases in a sequence selected from SEQ ID NOs: 1, 3, 4, 6, 7, 9, 10, and 12.
  • the targeting sequence may comprise a sequence at least 80% identical to a nucleotide sequence that is complementary to at least a portion of a sequence selected from SEQ ID NO: 1, 3, 4, 6, 7, 9, 10, and 12.
  • Exemplary, non-limiting MS4A2 target and targeting sequence are disclosed in U.S. Patent Application Publication No. 2019/0062756, which is incorporated by reference in its entirety, including the Sequence Listing.
  • antisense oligomers may be in some embodiments an antisense RNA molecule, which in some embodiments further comprises a modification selected from a nucleoside modification, an intemucleoside modification, a sugar modification, a sugar- internucleoside linkage modification, and combinations thereof. Such modifications may increase resistance to degradation of the antisense RNA molecule by a ribonuclease.
  • a morpholino oligomer is an exemplary, non-limiting modified antisense oligomer.
  • the presently disclosed subject matter also provides expression vectors that express an antisense oligomer as set forth herein, while in some embodiments the presently disclosed subject matter relates to pharmaceutical compositions comprising, consisting essentially of, or consisting of an antisense oligomer as set forth herein.
  • the presently disclosed subject matter relates to methods for modulating splicing of MS4A6A and/or MS4A2 mRNAs (for example, pre-mRNAs) in a cell by contacting the cell with one or more antisense oligomers, expression vectors, and/or compositions as set forth herein, thereby modulating splicing of the MS4A6A and/or MS4A2 mRNA.
  • MS4A6A and/or MS4A2 mRNAs for example, pre-mRNAs
  • the amount of full-length MS4A6A-encoding and/or MS4A2- encoding mRNA produced by the cell may be reduced by in some embodiments at least 50%, in some embodiments at least 60%, in some embodiments at least 70%, in some embodiments at least 80%, in some embodiments at least 90%, in some embodiments at least 95%, in some embodiments at least 97%, and in some embodiments at least 99%, or in some embodiments can be completely eliminated.
  • the presently disclosed subject matter relates to methods for reducing cell surface expression of Fc ⁇ RI in a cell.
  • the presently disclosed methods comprise contacting the cell with at least one antisense oligomer, expression vector, or composition as set forth herein, thereby reducing expression of Fc ⁇ RI on the surface of the cell.
  • the amount of Fc ⁇ RI expressed on the cell surface may be reduced by in some embodiments at least 50%, in some embodiments at least 60%, in some embodiments at least 70%, in some embodiments at least 80%, in some embodiments at least 90%, in some embodiments at least 95%, in some embodiments at least 97%, in some embodiments at least 99%, or in some embodiments can be completely eliminated.
  • the at least one antisense oligomer modulates splicing of an MS4A6A mRNA. In some embodiments, the at least one antisense oligomer modulates splicing of an MS4A2 mRNA.
  • the presently disclosed method comprises contacting the cell with at least two antisense oligomers, expression vectors, and/or compositions as set forth herein, wherein the at least two antisense oligomers, expression vectors, and/or compositions comprise at least one first antisense oligomer that modulates splicing of an MS4A6A mRNA and at least one second antisense oligomer that modulates splicing of an MS4A2/Fc ⁇ RI ⁇ mRNA.
  • the at least one first antisense oligomer comprises, consists essentially of, or consists of SEQ ID NO: 22.
  • the at least one second antisense oligomer targets an MS4A2 gene product, and in some embodiments the antisense oligomer comprises, consists essentially of, or consists of SEQ ID NO: 26.
  • the presently disclosed subject matter relates to methods for modulating Fc ⁇ RI receptor complex-dependent degranulation in a mast cell.
  • the presently disclosed methods comprise contacting the mast cell with at least one antisense oligomer, expression vector, and/or composition as set forth herein, thereby modulating Fc ⁇ RI receptor complex-dependent degranulation in the mast cell.
  • Fc ⁇ RI receptor complex-dependent degranulation may be reduced by in some embodiments at least 50%, in some embodiments at least 60%, in some embodiments at least 70%, in some embodiments at least 80%, in some embodiments at least 90%, in some embodiments at least 95%, in some embodiments at least 97%, in some embodiments at least 99%, or in some embodiments can be completely eliminated.
  • the presently disclosed method comprises contacting the mast cell with at least two antisense oligomers, expression vectors, and/or compositions as set forth herein, wherein the at least two antisense oligomers, expression vectors, and/or compositions comprise at least one first antisense oligomer that modulates splicing of an MS4A6A mRNA and at least one second antisense oligomer that modulates splicing of an MS4A2/Fc ⁇ RI ⁇ mRNA.
  • the at least one first antisense oligomer comprises, consists essentially of, or consists of SEQ ID NO: 22.
  • the at least one second antisense oligomer targets an MS4A2 gene product, and in some embodiments the antisense oligomer comprises, consists essentially of, or consists of SEQ ID NO: 26.
  • the presently disclosed subject matter relates to methods for modulating Fc ⁇ RI receptor complex-dependent mast-cell migration.
  • the presently disclosed methods comprise contacting the mast cell with at least one antisense oligomer, expression vector, and/or composition as set forth herein, thereby modulating Fc ⁇ RI receptor complex-dependent degranulation in the mast cell.
  • Fc ⁇ RI receptor complex-dependent degranulation may be reduced by in some embodiments at least 50%, in some embodiments at least 60%, in some embodiments at least 70%, in some embodiments at least 80%, in some embodiments at least 90%, in some embodiments at least 95%, in some embodiments at least 97%, in some embodiments at least 99%, or in some embodiments can be completely eliminated.
  • the presently disclosed method comprises contacting the mast cell with at least two antisense oligomers, expression vectors, and/or compositions as set forth herein, wherein the at least two antisense oligomers, expression vectors, and/or compositions comprise at least one first antisense oligomer that modulates splicing of an MS4A6A mRNA and at least one second antisense oligomer that modulates splicing of an MS4A2/Fc ⁇ RI ⁇ mRNA.
  • the at least one first antisense oligomer comprises, consists essentially of, or consists of SEQ ID NO: 22.
  • the at least one second antisense oligomer targets an MS4A2 gene product, and in some embodiments the antisense oligomer comprises, consists essentially of, or consists of SEQ ID NO: 26.
  • the presently disclosed subject matter relates to methods for modulating cytokine release.
  • the presently disclosed methods comprise contacting a cytokine-producing cell with at least one antisense oligomer, expression vector, and/or a composition as set forth herein, thereby modulating cytokine release.
  • the cytokine may be in some embodiments a vasoactive amine, in some embodiments a proteoglycan, in some embodiments a protease, in some embodiments a growth factor, in some embodiments a chemokine, in some embodiments a pro- inflammatory lipid mediator, in some embodiments a histamine, in some embodiments a serotonin, in some embodiments heparin, in some embodiments tryptase, in some embodiments chymase, in some embodiments TNF ⁇ , in some embodiments IL-1, in some embodiments IL-6, in some embodiments IL-8, in some embodiments IL-10, in some embodiments TNF ⁇ , in some embodiments VEGF, in some embodiments TGF ⁇ , in some embodiments CCL2-4, in some embodiments a prostaglandin, and/or in some embodiments a leukotriene.
  • a vasoactive amine in some embodiments a proteoglycan, in some embodiments a prote
  • the amount of at least one cytokine released may be reduced by in some embodiments at least 50%, in some embodiments at least 60%, in some embodiments at least 70%, in some embodiments at least 80%, in some embodiments at least 90%, in some embodiments at least 95%, in some embodiments at least 97%, in some embodiments at least 99%, or in some embodiments can be completely eliminated. These methods may be performed on a cell in culture or in the body of an individual.
  • the presently disclosed subject matter relates to methods for inhibiting an anaphylactic reaction in an individual by administering to the individual at least one antisense oligomer, expression vector, and/or composition as set forth herein.
  • the presently disclosed subject matter relates to methods for treating allergic conditions in individuals by administering one or more antisense oligomers, expression vectors, and/or composition as set forth herein, to an individual in need of such treatment.
  • the allergic condition treated may be asthma, atopic dermatitis, chronic rhinitis, chronic sinusitis, and/or allergic conjunctivitis.
  • the presently disclosed subject matter relates to methods for reducing the incidence and/or severity of an allergic reaction in an individual by administering one or more antisense oligomers, expression vectors, and/or compositions as set forth herein to an individual acutely and/or chronically experiencing allergic reactions or at risk of having an allergic reaction.
  • the presently disclosed subject matter relates to methods for treating an individual at risk of developing an anaphylactic reaction by administering one or more antisense oligomers, expression vectors, and/or compositions as set forth herein to the individual at risk of developing an anaphylactic reaction.
  • the presently disclosed subject matter relates to methods for treating a mast cell-related disease in an individual comprising administering one or more antisense oligomers, expression vectors, and/or compositions as set forth herein to an individual in need of such treatment.
  • the mast cell-related disease may be mastocytosis, or a mast cell tumor, including mastocytoma.
  • the individuals to whom the one or more antisense oligomers, expression vectors, and/or compositions as set forth herein are administered is a mammal, optionally a human, mouse, dog, cat, or horse.
  • compositions and methods for modulating expression of MS4A6A and MS4A2 gene products are provided.
  • FIGs 1A-1D Human Fc ⁇ RI ⁇ Splice Switching Oligonucleotides (SSOs) are ineffective at reducing Fc ⁇ RI function.
  • Figure 1A RT-PCR of Fc ⁇ RI ⁇ in human LAD2 cells demonstrated efficient exon skipping with a shift in size of 150 basepairs (bp) from the full length product (FL-Fc ⁇ RI ⁇ ) to the truncated product (t-Fc ⁇ RI ⁇ ). b-actin was used as a control.
  • Figure IB Transfection of Fc ⁇ RI ⁇ SSO into LAD2 cells resulted in a 58% reduction in surface Fc ⁇ RI expression without affecting KIT expression. Black bars: control; gray bars: Fc ⁇ RI ⁇ SSO.
  • Figure 1C Fc ⁇ RI ⁇ SSO transfection slightly, but significantly reduced IgE-dependent mast cell degranulation.
  • Data are mean ⁇ SEM from at least 3 independent experiments.
  • Statistics two way ANOVA and Sidak’s post- test. **p ⁇ 0.01; ***p ⁇ 0.001; ****p ⁇ 0.0001; n.s. not significant.
  • FIGS 2A-2C MS4A family expression in human LAD2 mast cells.
  • Figure 2A The majority of the MS4A gene family contain multiple splice variants. Thus, primers for all of the MS4A gene family were designed to amplify a region of mRNA that was identical between all known variants.
  • MS4A6A amplified two (2) bands and sequencing and cloning experiments determined that mast cells expressed a novel truncation of MS4A6A.
  • Figure 2B Mast cells expressed MS4A4 variant 1 and variant 3.
  • Figure 2C Graphic representation of the MS4A gene family members with full length (FL) and truncated (t) splice variants expressed in huMCs.
  • TM1-TM4 transmembrane domains 1-4, respectively.
  • ITAM immunoreceptor tyrosine-based activation motif, depicted with dark gray boxes. Light gray boxes: exons.
  • MS4A6A contains a putative hemi-ITAM.
  • MS4A6A sequencing showed that it contained a putative hemi-ITAM domain with the consensus sequence DxxYxxL in the C-terminus equivalent to the first DxxYxxL in the Fc ⁇ RI ⁇ ITAM.
  • the first tyrosine residue of the Fc ⁇ RI ⁇ ITAM is known to bind Lyn and the hemi-ITAM of MS4A6A contains the same sequence as the Lyn binding region of Fc ⁇ RI ⁇ .
  • FIGS 4A-4I Human mast cells express MS4A6A, which contains a potential hemi-ITAM motif and has a modest role in mast cell degranulation and surface Fc ⁇ RIa expression.
  • Figures 4A and 4B Transfection of human mast cells with GFP Fc ⁇ RI ⁇ and MS4A6A constructs showed good GFP expression.
  • Figure 4C Western blots from the transfected mast cells showed that an anti-MS4A6A (a-MS4A6) antibody bound to MS4A6A but not Fc ⁇ RI ⁇ .
  • a-b-actin b-actin detected with an anti- ⁇ -actin antibody: Figure 4D.
  • FIGS. 4E and 4F Quantification of protein expression by Western blot (Figure 4E) agreed with mRNA expression assessed by QPCR with shMS4A6A treatment ( Figure 4F).
  • Figures 4G and 4H shMS4A6A modestly, but significantly, reduced human mast cell degranulation (Figure 4G) and calcium influx (Figure 4H) in response to IgE crosslinking (XL).
  • Figure 41 shMS4A6A reduced surface Fc ⁇ RI ⁇ expression by roughly 40%. These data appeared to mirror the data of Fc ⁇ RI ⁇ SSO treatment reported previously (Cruse et al., 2016).
  • Figures 5A-5G Exon skipping of MS4A6A works comparably to Fc ⁇ RI ⁇ and SSOs targeting either Fc ⁇ RI ⁇ or MS4A6A alone are insufficient to stop degranulation of human mast cells, but combined SSOs targeting both proteins have a synergistic effect.
  • Figure 5A SSOs targeting either Fc ⁇ RI ⁇ or MS4A6A efficiently and specifically induced exon skipping of each mRNA. Double SSOs efficiently skipped both mRNAs.
  • Figures 5B and 5C Cell number and viability were not significantly affected by skipping.
  • Figure 5D Surface Fc ⁇ RIa expression was reduced by skipping either Fc ⁇ RI ⁇ (60%) or MS4A6A (40%), but skipping both significantly increased the reduction in receptor expression at the surface (80%).
  • Figure 5E Expression of the a and g subunits of Fc ⁇ RI were not affected by exon skipping, suggesting that the reduced Fc ⁇ RIa surface expression was due to trafficking.
  • Figures 5F and 5G Exon skipping either Fc ⁇ RI ⁇ or MS4A6A alone was ineffective at reducing degranulation, but exon skipping both mRNAs markedly reduced degranulation (Figure 5F) in response to IgE XL, but not in response to compound 48/80 ( Figure 5G) that acts through the GPCR MRGX2 receptor.
  • Figures 6A-6F Exon skipping of MS4A6A and Fc ⁇ RI ⁇ is comparable in primary human mast cells.
  • Figures 6A-6D To confirm the role of Fc ⁇ RI ⁇ and MS4A6A in human mast cells was also applicable to primary cells, cord blood-derived mast cells were employed. CBDMCs are immature cells that require priming with IL-4 to express Fc ⁇ RIa on the surface and to degranulate in response to IgE XL.
  • Figure 6E Once primed, exon skipping of Fc ⁇ RI ⁇ (dark gray; second from left in each group) and MS4A6A (light gray; third from left in each group) was comparable to LAD2 cells, except that CBDMCs were more sensitive to single skipping of both proteins as compared to skipping of both proteins together (medium gray; far right in each group). This was likely due to the low expression level of surface Fc ⁇ RIa (see Figure 6C) in these immature cells.
  • Figure 6F IgE-independent activation was examined by adding ionomycin and this was unaffected by SSOs. Example experiment shown. Black bars: control (far left in each group); Dark gray bars: Fc ⁇ RIa skipping alone (second from left in each group). Light gray bars: MS4A6 skipping alone (third from left in each group). Medium gray bars: Fc ⁇ RIa and MS4A6 skipping together (far right in each group).
  • FIG. 8A IL-8 cytokine release from CBDMCs in response to IgE XL presented as pg/ml.
  • Figure 8B Due to variation between CBDMC donors in the amount of cytokine released in response to IgE XL, data was analyzed as percent inhibition with SSO treatment for each donor, which effectively normalize the data for each donor.
  • SEQ ID NO: 1 is the nucleotide sequence of an exemplary human MS4A6A gene product of the presently disclosed subject matter. It corresponds to Accession No. NM_1 52852.3 of the GENBANK® biosequence database.
  • SEQ ID NO: 2 is the amino acid sequence encoded by SEQ ID NO: 1. It corresponds to Accession No. NP_690591.1 of the GENBANK® biosequence database.
  • the protein that corresponds to SEQ ID NO: 2 includes four (4) transmembrane domains, which include amino acids 49-71 (transmembrane domain 1; TM1), amino acids 86-105 (transmembrane domain 2; TM2), 112-134 (transmembrane domain 3; TM3), and amino acids 180-202 (transmembrane domain 4; TM4).
  • SEQ ID NO: 3 is an exemplary nucleotide sequence the human MS4A6A genomic locus. It corresponds to the reverse complement of nucleotides 60,171,607-60,184,666 of Accession No. NC_000011.10 of the GENBANK® biosequence database.
  • SEQ ID NO: 4 is the nucleotide sequence of an exemplary human MS4A2 gene product of the presently disclosed subject matter. It corresponds to Accession No. NM_000139.5 of the GENBANK® biosequence database.
  • SEQ ID NO: 5 is the amino acid sequence encoded by SEQ ID NO: 4. It corresponds to Accession No. NP_000130.1 of the GENBANK® biosequence database.
  • SEQ ID NO: 6 is an exemplary nucleotide sequence the human MS4A2 genomic locus. It corresponds to nucleotides 60,088,664-60,098,467 of Accession No. NC_000011.10 of the GENBANK® biosequence database.
  • SEQ ID NO: 7 is the nucleotide sequence of an exemplary murine MS4A6A gene product of the presently disclosed subject matter. It corresponds to Accession No. NM_027209.3 of the GENBANK® biosequence database.
  • SEQ ID NO: 8 is the amino acid sequence encoded by SEQ ID NO: 7. It corresponds to Accession No. NP_081485.2 of the GENBANK® biosequence database.
  • SEQ ID NO: 9 is an exemplary nucleotide sequence the murine MS4A6A genomic locus. It corresponds to nucleotides 11,518,519-11,530,403 of Accession No. NC_000085.6 of the GENBANK® biosequence database.
  • SEQ ID NO: 10 is the nucleotide sequence of an exemplary murine MS4A2 gene product of the presently disclosed subject matter. It corresponds to Accession No. NM_013516.2 of the GENBANK® biosequence database.
  • SEQ ID NO: 11 is the amino acid sequence encoded by SEQ ID NO: 10. It corresponds to Accession No. NP_038544.1 of the GENBANK® biosequence database.
  • SEQ ID NO: 12 is an exemplary nucleotide sequence the murine MS4A2 genomic locus. It corresponds to the reverse complement of nucleotides 11,615,520-11,623,719 of Accession No. NC_000085.6 of the GENBANK® biosequence database.
  • SEQ ID NOs: 13 and 14 are the sequences of exemplary oligonucleotide primers that can be employed to amplify a 472 basepair (bp) subsequence of the exemplary human MS4A6A gene product of SEQ ID NO: 1.
  • SEQ ID NO: 15 is the nucleotide sequence of exons 3-6 of the exemplary human
  • SEQ ID NO: 16 is the nucleotide sequence of the exemplary human MS4A6A gene product of SEQ ID NO: 1 after targeting designed to delete exon 4. It corresponds to exon 3 fused to exons 5 and 6 of SEQ ID NO: 1.
  • SEQ ID NO: 17 is the predicted amino acid sequence encoded by the exemplary human MS4A6A gene product of SEQ ID NO: 1 after targeting designed to delete exon 4. It corresponds to the amino acid sequence encoded by SEQ ID NO: 16, and also corresponds to amino acids 1-49 of SEQ ID NO: 2 fused to amino acids 95-247 of SEQ ID NO: 2.
  • SEQ ID NO: 18 is the predicted amino acid sequence encoded by the exemplary human MS4A2 gene product of SEQ ID NO: 4 after targeting designed to delete exon 3. It corresponds to amino acids 1-61 of SEQ ID NO: 5 fused to amino acids 108-244 of SEQ ID NO: 5.
  • SEQ ID NO: 19 presents an exemplary sequence with possible targets for oligo design (SEQ ID NO: 19) with respect to the human MS4A6A transcription products.
  • SEQ ID NOs: 20 and 21 present additional exemplary target sequences to target the human MS4A6A transcription products, and correspond to nucleotides 1-76 of SEQ ID NO: 19 and nucleotides 162-250 of SEQ ID NO: 19, respectively.
  • subsequences of SEQ ID NOs: 20 and 21 can be employed as exemplary target sequences, including but not limited to nucleotides 27-76 of SEQ ID NO: 20 and nucleotides 1-40 of SEQ ID NO: 21.
  • SEQ ID NOs: 22-25 present exemplary targeting and target sequences for targeting exon 4 of the human MS4A6A gene product.
  • SEQ ID NO: 22 is the nucleotide sequence of an exemplary oligonucleotide employed in the targeting experiments disclosed herein, which can target a human MS4A6A gene product comprising SEQ ID NO: 23, and
  • SEQ ID NO: 24 is the nucleotide sequence of an exemplary oligonucleotide that can target a human MS4A6A gene product comprising SEQ ID NO: 25.
  • SEQ ID NO: 26 is the nucleotide sequence of an exemplary oligonucleotide employed in the MS4A2 targeting experiments disclosed herein.
  • Fc ⁇ RI ⁇ Splice Switching Oligonucleotides eliminate critical protein- protein interactions resulting in loss of surface Fc ⁇ RI expression in mouse mast cells (MCs), but are less efficient in human cells (Cruse et al., 2016). It is possible that, in humans, Fc ⁇ RI ⁇ -like proteins from the same gene family as Fc ⁇ RI ⁇ (i.e., the MS4A gene family) can compensate for Fc ⁇ RI ⁇ , to act as novel regulators of, and potential subunits for Fc ⁇ RI.
  • MS4A2 human (hu)MCs express Fc ⁇ RI ⁇ (MS4A2), MS4A4, and MS4A6A, and it is possible that MS4A6A stabilizes surface expression of Fc ⁇ RI and initiates signaling through a C-terminal hemi-ITAM exhibiting redundancy with Fc ⁇ RI ⁇ . It is also possible that MS4A4 functions in Fc ⁇ RI signaling, but through a distinct mechanism from that of Fc ⁇ RI ⁇ and MS4A6A. MS4A4 does not contain an ITAM or hemi-ITAM and thus likely does not trigger signaling in the same way as Fc ⁇ RI ⁇ or MS4A6A.
  • MS4A4 promotes recruitment of Fc ⁇ RI complexes into lipid rafts to amplify signaling through PLC ⁇ l, increasing Ca 2+ release from stores and Store-Operated Ca 2+ Entry (SOCE).
  • SOCE Store-Operated Ca 2+ Entry
  • Fc ⁇ RI ⁇ and MS4A6A proteins compete to associate with Fc ⁇ RI and promote distinct signaling complexes through their IT AM and hemi-ITAM motifs, respectively.
  • the presently disclosed subject matter not only elucidates novel functions for understudied genes, but also facilitates translation of the presently disclosed therapeutic approaches to allergy into humans, to identifying innovative therapeutic targets, and to establishing novel IgE signaling mechanisms.
  • MS4A6A contains a potential hemi-ITAM making it unique within the MS4A family. Therefore, altered ratios of Fc ⁇ RI ⁇ and MS4A6A in Fc ⁇ RI complexes could act to fine-tune MC responsiveness in allergic individuals through deregulation of Fc ⁇ RI on and off signals.
  • alternative splicing can change protein function and interaction with receptors, adding another layer of regulation.
  • MCs play a key role in allergic diseases by releasing proinflammatory mediators in response to IgE and antigen (for reviews see Cruse & Bradding, 2016; Virk et al., 2016).
  • no currently available drugs directly and specifically target MC function.
  • Disclosed herein is a pioneering therapeutic strategy that utilizes SSOs to induce alternative splicing of Fc ⁇ RI ⁇ (Cruse et al., 2016).
  • Fc ⁇ RI ⁇ SSOs target protein-protein interactions resulting in loss of surface Fc ⁇ RI expression in mice demonstrating potential to improve care for asthma and other allergic diseases.
  • Fc ⁇ RI ⁇ SSOs are less effective in huMCs compared to mouse (mo) MCs (Cruse et al., 2016).
  • Fc ⁇ RI also exist as trimeric complexes that lack Fc ⁇ RI ⁇ and are expressed on several cell types (Bieber et al., 1992; Maurer et al., 1994; Maurer et al., 1996; Holloway et al., 2001; Cheung et al., 2010; Dehlink et al., 2010; Vasudev et al., 2012; Greer et al., 2014; Platzer et al., 2015). Mice do not express trimeric Fc ⁇ RI (Kinet, 1999; Kraft & Kinet, 2007; Gould & Sutton, 2008).
  • Fc ⁇ RI ⁇ may be less critical for Fc ⁇ RI trafficking in humans and trimeric Fc ⁇ RI could account for the lack of translation of Fc ⁇ RI ⁇ SSOs.
  • studies in mice with humanized Fc ⁇ RIa, which express trimeric Fc ⁇ RI combined with targeted disruption of Fc ⁇ RI ⁇ generates mice expressing only trimeric Fc ⁇ RI, and these mice demonstrate that trimeric Fc ⁇ RI does not elicit a strong degranulation response or a robust Ca 2+ signal (Dombrowicz et al., 1998). Therefore, data presented herein are incompatible with trimeric Fc ⁇ RI and suggested that the low efficacy of Fc ⁇ RI ⁇ SSOs in huMCs is through a different mechanism.
  • Fc ⁇ RI ⁇ -like proteins were proposed as a caveat of seminal experiments characterizing human and mouse Fc ⁇ RI (Alber et al., 1991).
  • the data presented herein show that Fc ⁇ RI ⁇ -like proteins exist.
  • the MS4A genes are a family of 16 genes in humans, that are related to MS4A1 (CD20) and MS4A2 (Fc ⁇ RI ⁇ ), and expressed in immune cells (Liang & Tedder, 2001; Liang et al., 2001). They are 4-pass transmembrane (TM) proteins with similar topology, but low homology to tetraspanins.
  • MS4A genes cluster around chromosome Ilql2-ql3 (Liang & Tedder, 2001; Liang et al., 2001), a region linked to allergy and asthma susceptibility (Lympany et al., 1992; Sandford et al., 1993; Stafford et al., 1994).
  • MS4A2, MS4A4A and MS4A6A have been associated with development of Alzheimer’s disease with genome-wide association studies (Hollingworth et al., 2011; Naj et al., 2011).
  • MS4A family members have also been implicated in neoplasia (Bangur et al., 2004; Koslowski et al., 2008; Dalerba et al., 2011; Michel et al., 2013; Ye et al., 2014).
  • MS4A proteins have been proposed to act as distinct Ca 2+ channels (Bubien et al., 1993; Koslowski et al., 2008).
  • MS4A proteins may act as chemoreceptors in olfactory necklace sensory neurons where they recognize various ligands including fatty acids and pheromones to trigger Ca 2+ responses in these specialized neurons (Greer et al., 2016).
  • a therapeutic strategy that utilizes exon skipping of a subunit of the high affinity IgE receptor, Fc ⁇ RI ⁇ , which is critical for trafficking the Fc ⁇ RI complex to the cell surface is disclosed in U.S. Patent Application Publication No. 2019/0062756.
  • Exon skipping of Fc ⁇ RI ⁇ with a Mast cell Targeting Oligonucleotide (MTO) thus eliminates its function in trafficking resulting in loss of surface Fc ⁇ RI expression and responsiveness to allergens in vitro and in vivo in mice, to specifically target and downregulate mast cells and basophils, which are critical for the immediate allergic response.
  • MTO Mast cell Targeting Oligonucleotide
  • the presently disclosed approach utilizes a novel platform for therapeutic antisense oligonucleotides to eliminate trafficking of the IgE receptor to the plasma membrane.
  • the power of this approach is that it targets a protein exclusively expressed in mast cells and basophils enabling the specific targeting of these cells and downregulation of their function.
  • Fc ⁇ RI ⁇ has been considered as a potential therapeutic target for allergy and asthma, but until the MTO discovery, no viable approach to target this gene with a drug had emerged.
  • Clinical therapeutic utility of antisense oligonucleotides that induce exon skipping has been demonstrated in Duchenne muscular dystrophy where the drugs are well tolerated.
  • the use of oligonucleotides to skip mutated exons requires sequencing of patient DNA to identify the causative mutation.
  • Exon 3 of Fc ⁇ RI ⁇ is critical for the function of Fc ⁇ RI ⁇ in trafficking the Fc ⁇ RI complex.
  • the highly conserved splicing of the corresponding exons encoding for the 1st and 2nd transmembrane domains of the majority of the MS4A proteins indicates that this exon could also be critical for their trafficking.
  • MS4A6A the same exon skipping methods that were successfully used for Fc ⁇ RI ⁇ are disclosed herein as applicable to MS4A6A. It was further identified that exon skipping MS4A6A results in reduction of surface Fc ⁇ RI expression comparable to knockdown of MS4A6A.
  • novel methods for treating atopic diseases including methods for treating diseases and syndromes mediated by the high-affinity Fc-epsilon receptor (Fc ⁇ RI).
  • Fc ⁇ RI high-affinity Fc-epsilon receptor
  • the presently disclosed subject matter is based in part on the inventors’ discovery of a novel, truncated isoform of the Fc ⁇ RI ⁇ protein (t-Fc ⁇ RI ⁇ ), which lacks the first and second membrane-spanning regions, and the mRNA transcript for which is truncated in exon 3 (Cruse et al., 2010; see also U.S. Patent Application Publication No. 2019/0062756, the contents of which are incorporated herein by reference in its entirety).
  • Antisense technology has been demonstrated to be an effective method for modifying the expression levels of gene products (see for example, U.S. Patent No. 8,765,703, U.S. Patent No. 8,946,183, and U.S. Patent Publication No. 2015/0376615, which are incorporated herein by reference in their entirety).
  • Antisense technology works by interfering with known steps in the normal processing of mRNA. Briefly, RNA molecules are transcribed from genomic DNA in the nucleus of the cell. These newly synthesized mRNA molecules, called primary mRNA or pre-mRNA, must be processed prior to transport to the cytoplasm for translation into protein at the ribosome. Such processing includes the addition of a 5’ methylated cap and the addition of a poly(A) tail to the 3 ’ end of the mRNA.
  • Introns are regions of a primary transcript (or the DNA encoding it) that are not included in the coding sequence of the mature mRNA.
  • Exons are regions of a primary transcript (or the DNA encoding it) that remain in the mature mRNA when it reaches the cytoplasm.
  • Splice junctions also referred to as splice sites, are utilized by cellular apparatus to determine which sequences are removed and where the ends to be joined start and stop.
  • sequences on the 5’ side of the junction are called the 5’ splice site, or splice donor site, whereas sequences on the 3’ side the junction are referred to as the 3’ splice site, or the splice acceptor site.
  • the 3’ end of an upstream exon is joined to the 5’ end of the downstream exon.
  • the un-spliced RNA (or pre-mRNA) has an exon/intron junction at the 5’ end of an intron and an intron/exon junction at the 3’ end of an intron. After the intron is removed, the exons are contiguous at what is sometimes referred to as the exon/exon junction or boundary in the mature mRNA.
  • Cryptic splice sites are those which are less often used but may be used when the usual splice site is blocked or unavailable. The use of different combinations of exons by the cell can result in multiple mRNA transcripts from a single gene.
  • an antisense oligonucleotide binds to a mRNA molecule transcribed from a gene of interest and inactivates (“turns off’) the mRNA by increasing its degradation or by preventing translation or translocation of the mRNA by steric hindrance.
  • AON antisense oligonucleotide
  • antisense technology can be used to affect splicing of a gene transcript.
  • the antisense oligonucleotide binds to a pre-spliced RNA molecule (pre-messenger RNA or pre-mRNA) and re-directs the cellular splicing apparatus, thereby resulting in modification of the exon content of the spliced mRNA molecule.
  • pre-spliced RNA molecule pre-messenger RNA or pre-mRNA
  • the overall sequence of a protein encoded by the modified mRNA differs from a protein translated from mRNA, the splicing of which was not altered (i.e., the full length, wild-type protein).
  • the protein that is translated from the altered mRNA may be truncated and/or it may be missing critical sequences required for proper function.
  • the compounds used to affect splicing are, or contain, oligonucleotides having a base sequence complementary to the mRNA being targeted. Such oligonucleotides are referred to herein as “antisense oligonucleotides” (AONs).
  • a method as set forth herein can generally be accomplished by contacting a cell expressing an MS4A2 transcript, with an antisense oligomer targeted to a region of the MS4A2 pre-mRNA. Such contact results in uptake of the antisense oligomer by the cell, hybridization of the oligomer to the MS4A2 mRNA, and subsequent modulation of splicing of the MS4A2 pre-mRNA. In some embodiments, such modulation of splicing of the MS4A2 mRNA decreases cell-surface expression of Fc ⁇ RI.
  • nucleic acid molecule refers to one or more nucleic acid molecules.
  • the terms “a”, “an”, “one or more” and “at least one” can be used interchangeably.
  • the terms “comprising”, “including” and “having” can be used interchangeably.
  • an MS4A6A gene refers to a gene encoding an MS4A6A protein from a mammal.
  • MS4A6A genes include, but are not limited to, Accession Numbers NM_152852.3 (human), NM_027209.3 (mouse MS4A6Ab, encoding NP_081485.2), NM_028595.4 (mouse MS4A6Ac, encoding NP_082871.2), and NM_026835.2 (mouse MS4A6Ad, encoding NP_081111.1) of the GENBANK® biosequence database.
  • an MS4A6A coding sequence refers to a nucleic acid sequence encoding at least a portion of an MS4A6A protein. Such a portion can be a fragment of the protein (e.g., a 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 contiguous amino acid segment from any part of the whole protein), an exon, or a domain (e.g., a transmembrane domain), or it can refer to the entire protein, including any splicing variants.
  • MS4A6A genes or coding sequences as set forth herein can be from any mammal having such gene or coding sequence.
  • the MS4A6A gene or coding sequence may be from a human, mouse, canine, feline or equine.
  • the MS4A6A genomic locus can be found on human chromosome 11 and on mouse chromosome 19.
  • the nucleotide sequences of the human and mouse MS4A6A genomic loci are presented in SEQ ID NOs: 3 and 9, respectively.
  • an MS4A6A transcript is an RNA molecule transcribed from an MS4A6A gene.
  • MS4A6A transcripts targeted by oligomers as set forth herein are primary transcripts or pre-mRNA molecules.
  • primary mRNA or pre-mRNA is an mRNA transcript that has not yet undergone splicing. Accordingly, a mature mRNA molecule is an mRNA molecule that has undergone splicing.
  • SEQ ID NO: 1 is an exemplary cDNA sequence derived from the human MS4A6A genomic locus.
  • the eight (8) exons noted in Table 1 correspond to the following nucleotide positions of SEQ ID NO: 1: 1-125 (exon 1), 126-478 (exon 2), 479-640 (exon 3), 641-775 (exon 4), 776-832 (exon 5), 833-1042 (exon 6), 1043-1144 (exon 7), and
  • the initiator codon corresponds to nucleotides 494-496 of SEQ ID NO: 1 and the stop codon (TAA) corresponds to nucleotides 1238-1240 of SEQ ID NO: 1.
  • Oligonucleotide primer hMS4A6A-Fw (5 ’ -GAGGACTC AGCTGGAACC AA- 3’; SEQ ID NO: 13) corresponds to nucleotides 451-470 of SEQ ID NO: 1, and oligonucleotide primer hMS4A6A-Rv (5 ’ -GGC AGAC AGAGC ACTC AGAA’ 3 ’ (SEQ ID NO: 14), which can be used with oligonucleotide primer hMS4A6A-Fw in a polymerase chain reaction (PCR) to amplify subsequences of the human MS4A6A transcript including to assay for deletions in the same, corresponds to the reverse complement of nucleotides 585-877 of SEQ ID NO: 1.
  • PCR polymerase chain reaction
  • an MS4A2 gene refers to a gene encoding an Fc ⁇ RI ⁇ protein from a mammal.
  • MS4A2 genes include, but are not limited to, Accession Numbers NM_000139.5 (human) and NM_013516.2 (mouse) of the GENBANK® biosequence database.
  • an MS4A2 coding sequence refers to a nucleic acid sequence encoding at least a portion of an Fc ⁇ RI ⁇ protein.
  • Such a portion can be a fragment of the protein (e.g., a 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 contiguous amino acid segment from any part of the whole protein), an exon, or a domain (e.g., a transmembrane domain), or it can refer to the entire protein, including any splicing variants.
  • MS4A2 genes or coding sequences as set forth herein can be from any mammal having such gene or coding sequence.
  • the MS4A2 gene or coding sequence may be from a human, mouse, canine, feline or equine.
  • the MS4A2 genomic locus can be found on human chromosome 11 and on mouse chromosome 19.
  • the nucleotide sequences of the human and mouse MS4A2 genomic loci are presented in SEQ ID NOs: 6 and 12, respectively.
  • an MS4A2 transcript is an RNA molecule transcribed from an
  • MS4A2 transcripts targeted by oligomers as set forth herein are primary transcripts or pre-mRNA molecules.
  • primary mRNA or pre-mRNA is an mRNA transcript that has not yet undergone splicing. Accordingly, a mature mRNA molecule is an mRNA molecule that has undergone splicing.
  • Exemplary antisense oligomers that can target human or mouse MS4A2 pre- mRNAs are disclosed in U.S. Patent Application Publication No. 2019/0062756, which is incorporated by reference in its entirety.
  • antisense oligomer refers to a polymeric molecule comprising nucleobases, which is capable of hybridizing to a sequence in a nucleic acid molecule, such as an mRNA molecule.
  • nucleobase refers to the heterocyclic base portion of a nucleoside.
  • a nucleobase is any group that contains one or more atoms, or groups of atoms, capable of hydrogen bonding to a base of another nucleoside.
  • modified nucleobases or nucleobase mimetics are also amenable to this disclosure.
  • modified nucleobase refers to a nucleobase that is similar in structure to the parent nucleobase, such as for example, a 7-deaza purine, a 5-methyl cytosine, a G-clamp, or a tricyclic phenoxazine nucleobase mimetic. Methods for preparation of these modified nucleobases are known to those skilled in the art.
  • nucleoside is a base-sugar combination.
  • the base portion of the nucleoside is normally a heterocyclic base (e.g., a nucleobase or simply a “base”).
  • the two most common classes of such heterocyclic bases are purines and the pyrimidines.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2’, 3’ or 5’ hydroxyl moiety of the sugar.
  • the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
  • the phosphate groups are commonly referred to as forming the intemucleoside backbone of the oligonucleotide.
  • the normal linkage or backbone of RNA and DNA is a 3’ to 5’ phosphodiester linkage.
  • RNA molecules often have a short half-life, making their use as therapeutic agents problematic.
  • chemical modifications in oligonucleotides can alter oligomer activity by, for example, increasing affinity of an antisense oligomer for its target RNA, increasing nuclease resistance (e.g., resistance to ribonucleases such as RNaseH), and/or altering the pharmacokinetics (e.g., half-life) of the oligomer.
  • sugars, nucleobases and/or internucleoside linkages with a group that maintains the ability of the oligomer to hybridize to its target sequence, but which imparts a desirable characteristic to the oligomer (e.g., resistance to degradation, increased half- life, etc.).
  • groups can be referred to as analogs (e.g., sugar analog, nucleobase analog, etc.).
  • an analog is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
  • Representative examples of a sugar mimetic include, but are not limited to, cyclohexenyl or morpholino.
  • a mimetic for a sugar- internucleoside linkage combination include, but are not limited to, peptide nucleic acids (PNA) and morpholino groups linked by uncharged, achiral linkages. In some instances, an analog is used in place of the nucleobase.
  • Representative nucleobase mimetics are well known in the art and include, but are not limited to, tricyclic phenoxazine analogs and universal bases (Berger et al., 2000, incorporated herein by reference). Examples of such sugar, nucleoside and nucleobase mimetics are disclosed in U.S. Patent Nos. 8,765,703 and 8,946,183, which are incorporated herein by reference). Methods of synthesis of sugar, nucleoside and nucleobase mimetics, and the use of such mimetics to produce oligonucleotides are well known to those skilled in the art.
  • oligomer includes oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics and chimeric combinations thereof. Such molecules are generally known to those skilled in the art. Oligomers as set forth herein include, but are not limited to, primers, probes, antisense compounds, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternate splicers, and siRNAs. As such, these compounds can be introduced in the form of single-stranded, double-stranded, circular, branched or hairpins and can contain structural elements such as internal or terminal bulges or loops.
  • EGS external guide sequence
  • Oligomers as set forth herein can be any length suitable for administering to a cell or individual in order to modulate splicing of an mRNA molecule.
  • antisense oligomers as set forth herein can comprise from about 10 to about 50 nucleobases (i.e. from about 10 to about 50 linked nucleosides).
  • nucleobases i.e. from about 10 to about 50 linked nucleosides.
  • antisense oligomers as set forth herein can comprise, or consist of, 10 to 30 nucleobases, or 10 to 25 nucleobases. Methods of determining the appropriate length for antisense oligomers as set forth herein are known to those skilled in the art.
  • the terms “targeted to,” “targeting,” and the like refer to a process of designing an antisense oligomer so that it specifically hybridizes with a desired nucleic acid molecule, such as a desired mRNA molecule.
  • the terms “hybridizes,” “hybridization,” “hybridize to,” and the like are terms of art, and refer to the pairing of nucleobases in complementary strands of oligonucleotides (e.g., an antisense oligomer and a target sequence in a mRNA molecule).
  • the most common mechanism of pairing involves hydrogen bonding, which may be Watson- Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases).
  • hydrogen bonding which may be Watson- Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases).
  • nucleobases complementary to the natural nucleobases thymidine and uracil, which pair through the formation of hydrogen bonds.
  • the natural base guanine is complementary to the natural bases cytosine and 5-methyl cytosine.
  • the phrase “specifically hybridizes” refers to the capacity of an antisense oligomer as set forth herein to preferentially bind an mRNA (e.g., a pre-mRNA) encoding an MS4A6A or Fc ⁇ RI ⁇ protein rather than binding an mRNA encoding a protein unrelated in structure to an MS4A6A or Fc ⁇ RI ⁇ protein.
  • an mRNA e.g., a pre-mRNA
  • an antisense oligomer that preferentially binds a target sequence is one that hybridizes with an mRNA encoding an MS4A6A or Fc ⁇ RI ⁇ protein (an MS4A6A or Fc ⁇ RI ⁇ pre-mRNA), but which does not exhibit significant hybridization with mRNA molecules encoding proteins unrelated in structure to an MS4A6A or Fc ⁇ RI ⁇ protein.
  • significant hybridization is, for example, binding of an oligomer as set forth herein to an mRNA encoding a protein unrelated in structure to an MS4A6A or Fc ⁇ RI ⁇ protein, with an affinity or avidity sufficiently high enough to interfere with the ability of the antisense oligomer to achieve the desired effect.
  • Such desired effects include, but are not limited to, modulation of splicing of an MS4A6A or MS4A2 pre-mRNA, reduction in the level of surface expression of Fc ⁇ RI protein, and a reduction or inhibition in allergic symptoms in an individual.
  • an antisense oligomer is considered specific for a target sequence (is specifically hybridizable, specifically hybridizes, etc.) when there is a sufficient degree of complementarity between the linear sequence of nucleobases in the antisense oligomer and a linear sequence of nucleobases in the target sequence, to avoid significant binding of the antisense oligomer to non-target nucleic acid sequences under conditions in which specific binding is desired (i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays).
  • the terms “complement,” “complementary,” “complementarity,” and the like refer to the capacity for precise pairing between nucleobases in an oligomer and nucleobases in a target sequence.
  • a nucleobase e.g., adenine
  • a nucleobase e.g., uracil
  • the terms complement, complementary, complementarity, and the like are viewed in the context of a comparison between a defined number of contiguous nucleotides in a first nucleic acid molecule (e.g., an oligomer) and a similar number of contiguous nucleotides in a second nucleic acid molecule (e.g., a mRNA molecule), rather than in a single base to base manner.
  • a first nucleic acid molecule e.g., an oligomer
  • a similar number of contiguous nucleotides in a second nucleic acid molecule e.g., a mRNA molecule
  • an antisense oligomer is 25 nucleotides in length
  • its complementarity with a target sequence is usually determined by comparing the sequence of the entire oligomer, or a defined portion thereof, with a number of contiguous nucleotides in a mRNA molecule.
  • An oligomer and a target sequence are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Positions are corresponding when the bases occupying the positions are spatially arranged such that, if complementary, the bases form hydrogen bonds.
  • the first nucleotide in the oligomer is compared with a chosen nucleotide at the start of the target sequence.
  • the second nucleotide in the oligomer (3’ to the first nucleotide) is then compared with the nucleotide directly 3’ to the chosen start nucleotide.
  • the terms “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of contiguous nucleobases such that stable and specific binding occurs between the antisense compound and a target nucleic acid.
  • Hybridization conditions under which a first nucleic acid molecule will specifically hybridize with a second nucleic acid molecule are commonly referred to in the art as stringent hybridization conditions. It is understood by those skilled in the art that stringent hybridization conditions are sequence-dependent and can be different in different circumstances. Thus, stringent conditions under which an oligomer as set forth herein specifically hybridizes to a target sequence are determined by the complementarity of the oligomer sequence and the target sequence and the nature of the assays in which they are being investigated. Persons skilled in the relevant art are capable of designing complementary sequences that specifically hybridize to a particular target sequence for a given assay or a given use.
  • the process of designing an antisense oligomer that is targeted to a nucleic acid molecule usually begins with identification of a target nucleic acid, the expression of which is to be modulated, and determining the sequence of the target nucleic acid molecule.
  • target nucleic acid nucleic acid encoding an MS4A6A or Fc ⁇ RI ⁇ protein
  • nucleic acid encoding an MS4A6A or Fc ⁇ RI ⁇ protein encompass, for example, DNA encoding an MS4A6A or Fc ⁇ RI ⁇ protein, RNA (including pre-mRNA and mRNA) transcribed from such DNA, and cDNA derived from such RNA.
  • the target nucleic acid can be a cellular gene (or pre-mRNA or mRNA transcribed therefrom), the expression of which is associated with a particular disorder or disease state.
  • a useful target nucleic acid encodes an MS4A6A protein or an Fc ⁇ RI ⁇ protein.
  • the target nucleic acid is an MS4A6A transcript or an MS4A2 transcript.
  • the target nucleic acid is an MS4A6A or an MS4A2 pre-mRNA.
  • the targeting process includes determining at least one target region in which the antisense interaction will occur, thereby modulating splicing of the target nucleic acid.
  • a target region is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
  • Exemplary target regions are those comprising sequences involved in splicing of pre-mRNA molecules. Examples of such identifiable structures, functions, or characteristics include, but are not limited to, at least a portion of an intron or exon, an intron/exon junction, a splice donor site, a splice acceptor site, a splice branch point or a splice enhancer site.
  • the target region comprises at least part of an intron or exon, a splice donor site, a splice acceptor site, a splice branch point, and/or a splice enhancer site.
  • the target region comprises at an intron or exon, a splice donor site, a splice acceptor site, a splice branch point, and/or a splice enhancer site.
  • a target sequence within the target region can then be identified.
  • a target sequence is a nucleic acid sequence in a target region, to which an antisense oligomer as set forth herein specifically hybridizes.
  • exemplary target sequences are those involved in splicing of pre-mRNA.
  • the nucleotide sequence of the antisense oligomer is designed so that it contains a region of contiguous nucleotides sufficiently complementary to the target sequence so that the antisense oligomer specifically hybridizes to the target nucleic acid.
  • a region of contiguous, complementary nucleotides in the oligomer can be referred to as an “antisense sequence” or a “targeting sequence.”
  • the targeting sequence is fully complementary to the target sequence.
  • the targeting sequence comprises an at least 6 contiguous nucleobase region that is fully complementary to an at least 6 contiguous nucleobase region in the target sequence.
  • the targeting sequence comprises an at least 8 contiguous nucleobase sequence that is fully complementary to an at least 8 contiguous nucleobase sequence in the target sequence. In some embodiments, the targeting sequence comprises an at least 10 contiguous nucleobase sequence that is fully complementary to an at least 10 contiguous nucleobase sequence in the target sequence. In some embodiments, the targeting sequence comprises an at least 12 contiguous nucleobase sequence that is fully complementary to an at least 12 contiguous nucleobase sequence in the target sequence. In some embodiments, the targeting sequence comprises an at least 14 contiguous nucleobase sequence that is fully complementary to an at least 14 contiguous nucleobase sequence in the target sequence.
  • the targeting sequence comprises an at least 16 contiguous nucleobase sequence that is fully complementary to an at least 16 contiguous nucleobase sequence in the target sequence. In some embodiments, the targeting sequence comprises an at least 18 contiguous nucleobase sequence that is fully complementary to an at least 18 contiguous nucleobase sequence in the target sequence. In some embodiments, the targeting sequence comprises an at least 20 contiguous nucleobase sequence that is fully complementary to an at least 20 contiguous nucleobase sequence in the target sequence.
  • the targeting sequence may make up the entirety of an antisense oligomer as set forth herein, or it may make up just a portion of an antisense oligomer as set forth herein.
  • all 30 nucleotides can be complementary to a 30 contiguous nucleotide target sequence.
  • only 20 contiguous nucleotides in the oligomer may be complementary to a 20-contiguous nucleotide target sequence, with the remaining 10 nucleotides in the oligomer being mismatched to nucleotides outside of the target sequence.
  • oligomers as set forth herein have a targeting sequence of at least 10 nucleobases, at least 11 nucleobases, at least 12 nucleobases, at least 13 nucleobases, at least 14 nucleobases, at least 15 nucleobases, at least 16 nucleobases, at least 17 nucleobases, at least 18 nucleobases, at least 19 nucleobases, at least 20 nucleobases, at least 21 nucleobases, at least 22 nucleobases, at least 23 nucleobases, at least 24 nucleobases, at least 25 nucleobases, at least 26 nucleobases, at least 27 nucleobases, at least 28 nucleobases, at least 29 nucleobases, or at least 30 nucleobases, at least 35 nucleobases, at least 40 nucleobases, at least 45 nucleobases, or at least 50 nucleobases in length or longer.
  • antisense oligomers as set forth herein may comprise up to about 20% nucleotides that are mismatched, thereby disrupting base pairing of the antisense oligomer to a target sequence, as long as the antisense oligomer specifically hybridizes to the target sequence.
  • antisense oligomers comprise no more than 20%, no more than about 15%, no more than about 10%, no more than about 5% or not more than about 3% of mismatches, or less.
  • mismatches do not occur at contiguous positions.
  • the mismatched positions are separated by runs (e.g., 3, 4, 5, etc.) of contiguous nucleotides that are complementary with nucleotides in the target sequence
  • percent identity is a common way of defining the number of mismatches between two nucleic acid sequences. For example, two sequences having the same nucleobase pairing capacity would be considered 100% identical. Moreover, it should be understood that both uracil and thymidine will bind with adenine. Consequently, two molecules that are otherwise identical in sequence would be considered identical, even if one had uracil at position x and the other had a thymidine at corresponding position x. Percent identity may be calculated over the entire length of the oligomeric compound, or over just a portion of an oligomer.
  • the percent identity of a targeting sequence to a target sequence can be calculated to determine the capacity of an oligomer comprising the targeting sequence to bind to a nucleic acid molecule comprising the target sequence.
  • the targeting sequence is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 98% identical or at least 99% identical over its entire length to a target sequence in a target nucleic acid molecule.
  • the targeting sequence is identical over its entire length to a target sequence in a target nucleic acid molecule.
  • an antisense oligomer need not be identical to the oligomer sequences disclosed herein to function similarly to the antisense oligomers described herein.
  • Non-identical versions are those wherein each base does not have 100% identity with the antisense oligomers disclosed herein.
  • a non-identical version can include at least one base replaced with a different base with different pairing activity (e.g., G can be replaced by C, A, or T).
  • Percent identity is calculated according to the number of bases that have identical base pairing corresponding to the oligomer to which it is being compared.
  • the non-identical bases may be adjacent to each other, dispersed throughout the oligomer, or both.
  • a 16-mer having the same sequence as nucleobases 2-17 of a 20-mer is 80% identical to the 20-mer.
  • a 20-mer containing four nucleobases not identical to the 20-mer is also 80% identical to the 20-mer.
  • a 14-mer having the same sequence as nucleobases 1-14 of an 18-mer is 78% identical to the 18-mer.
  • antisense oligomers as set forth herein comprise oligonucleotide sequences at least 80% identical, at least 85% identical, at least 90% identical, at least 92% identical, at least 94% identical at least 96% identical or at least 98% identical to sequences disclosed herein, as long as the antisense oligomers are able to modulate splicing of a desired mRNA molecule.
  • Antisense oligomers as set forth herein are capable of modulating splicing of mRNA molecules.
  • modulation refers to the ability of an antisense oligomer to affect the processing of a pre-mRNA transcript such that the resulting spliced mRNA molecule contains a desired combination of exons as a result of exon skipping (or exon inclusion), a deletion in one or more exons, or additional sequence not normally found in the spliced mRNA (e.g., intronic sequences).
  • modulation of splicing can refer to affecting the splicing of an MS4A6A pre-mRNA and/or an MS4A2 pre-mRNA such that the spliced mRNA (mature mRNA) is missing at least a portion, or the entirety, of one exon.
  • the spliced mRNA lacks at least a portion of exon 3.
  • splicing of an MS4A2 pre-mRNA, due to the influence of an antisense oligomer, to produce a truncated mRNA encoding a truncated Fc ⁇ RI ⁇ protein can be referred to as alternative splicing.
  • an MS4A2 mRNA transcript lacking at least a portion, or the entirety, of exon 3, due to the influence of an antisense oligomer is a product of alternative splicing.
  • modulation of splicing can refer to inducing alternative splicing of an MS4A2 pre-mRNA molecule, thereby reducing the level of mRNA molecules containing the entirely of exon 3, and increasing the level of mRNA molecules lacking at least a portion of exon 3.
  • some embodiments as set forth herein relate to an antisense oligomer comprising 10 to 50 linked nucleosides, wherein the oligomer is targeted to a region of an RNA molecule encoding an MS4A6 or Fc ⁇ RI ⁇ protein.
  • hybridization of the oligomer to the RNA molecule modulates splicing of the RNA molecule.
  • Some embodiments as set forth herein relate to antisense oligomers comprising a nucleic acid sequence sufficiently complementary to a target sequence in a target region of an MS4A6A mRNA molecule and/or an MS4A2 mRNA molecule, such that the antisense oligomer specifically hybridizes to the target sequence, thereby modulating splicing of an MS4A6A mRNA transcript and/or an MS4A2 mRNA transcript.
  • These antisense oligomers may consist of 10 to 50 linked nucleosides. These antisense oligomers may comprise 15 to 35 linked nucleotides. These antisense oligomers may consist of 15 to 35 linked nucleotides. These antisense oligomers may comprise or consist of 10 linked nucleosides, 11 linked nucleosides, 12 linked nucleosides, 13 linked nucleosides, 14 linked nucleosides, 15 linked nucleosides, 16 linked nucleosides, 17 linked nucleosides, 18 linked nucleosides, 19 linked nucleosides, 20 linked nucleosides, 21 linked nucleosides, 22 linked nucleosides, 23 linked nucleosides, 24 linked nucleosides, 25 linked nucleosides, 26 linked nucleosides, 27 linked nucleosides, 28 linked nucleosides, 29 linked nucleosides, 30 linked nucleosides, 31 linked nucleosides, 32 linked nu
  • the mRNA molecule may encode an MS4A6A protein or an Fc ⁇ RI ⁇ protein from any mammal that produces an MS4A6A protein or an Fc ⁇ RI ⁇ protein.
  • mammals include, but are not limited to, a human, a mouse, a dog, a cat, and a horse.
  • the mRNA comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to any one of SEQ ID NOs: 1, 4, 7, and 10.
  • the mRNA encodes a protein comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 2, 5, 8, and 11. In some embodiments, the mRNA encodes a protein comprising SEQ ID NO: 2 or SEQ ID NO: 5.
  • the RNA molecule may be an MS4A6A mRNA transcript or an MS4A2 transcript. In some embodiments, the RNA molecule is an MS4A6A mRNA molecule. In some embodiments, the RNA molecule is an MS4A2 mRNA molecule. In some embodiments, the RNA molecule is an MS4A6A pre-mRNA. In some embodiments, the RNA molecule is an MS4A2 pre-mRNA.
  • the target region targeted by the antisense oligomer can be any region of the RNA molecule that is functionally involved in splicing of the RNA molecule.
  • functionally involved in splicing is meant the sequences in the target region are utilized by the cellular splicing apparatus (e.g., the spliceosome or components thereof) to effect splicing of the mRNA molecule.
  • regions comprising intron sequences include, but are not limited to, regions comprising intron sequences, regions comprising exon sequences, regions comprising intron/exon junctions, regions comprising splice donor site sequences, regions comprising splice acceptor site sequences, regions comprising splice enhancer site sequences, regions comprising branch point sequences, and regions comprising polypyrimidine tracts.
  • regions comprising intron sequences regions comprising exon sequences, regions comprising intron/exon junctions, regions comprising splice donor site sequences, regions comprising splice acceptor site sequences, regions comprising splice enhancer site sequences, regions comprising branch point sequences, and regions comprising polypyrimidine tracts.
  • regions comprising intron sequences include, but are not limited to, regions comprising intron sequences, regions comprising exon sequences, regions comprising intron/exon junctions, regions comprising splice donor site sequences, regions comprising splice acceptor site sequences, regions
  • the target region comprises at least a portion of a sequence selected from the group consisting of an exon sequence, an intron sequence, a sequence comprising an exon/intron junction, a splice donor site sequence, a splice acceptor site sequence, a splice enhancer site sequence, a branch point sequence, and a polypyrimidine tract.
  • “at least a portion” refers to at least 5 nucleosides, at least 6 nucleosides, at least 7 nucleosides, at least 8 nucleosides, at least 9 nucleosides, at least 10 nucleosides, at least 11 nucleotides, at least 12 nucleosides, at least 13 nucleotides, at least 14 nucleosides, at least 15 nucleosides, at least 16 nucleosides, at least 17 nucleosides, at least 18 nucleosides, at least 19 nucleosides, or at least 20 nucleosides in length.
  • the at least a portion comprises at least 10%, at least 25%, at least 50%, at least 75%, at least 90%, at least 90%, at least 95% or at least 97% of a known splice donor site sequence, splice acceptor site sequence, splice enhancer site sequence, branch point sequence or polypyrimidine sequence.
  • the splice donor site sequence, splice acceptor site sequence, splice enhancer site sequence, branch point sequence, or polypyrimidine sequence may be from an MS4A6A pre-MRNA or an MS4A2 pre-MRNA.
  • the target region comprises at least a portion of an MS4A6A sequence or an MS4A2 sequence as set forth herein, which may be any one of SEQ ID Nos: 1, 3, 4, 6, 7, 9, 10, and 12, including in some embodiments a portion of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, or SEQ ID NO: 12.
  • the at least a portion comprises at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90% at least 95% or at least 97% of an MS4A6A sequence or an MS4A2 sequence as set forth herein.
  • the at least a portion comprises a polynucleotide sequence at least 80%, at least 90% at least 95% or at least 97% identical to a portion of an MS4A6A sequence or an MS4A2 sequence as set forth herein.
  • the target region comprises a nucleotide sequence at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to at least a portion of a sequence selected from the group consisting of SEQ ID NOs: 3, 6, 9, and 12. In some embodiments, the target region comprises at least a portion of a sequence selected from the group consisting of SEQ ID NOs: 3, 6, 9, and 12.
  • the antisense oligomer is targeted to a region or sequence involved in splicing of an MS4A6A pre-mRNA or an MS4A2 pre-mRNA.
  • the antisense oligomer is target to an MS4A6A or an MS4A2 intron sequence, an MS4A6A or an MS4A2 exon sequence, an MS4A6A or an MS4A2 splice donor site sequence, an MS4A6A or an MS4A2 splice acceptor site sequence, an MS4A6A or an MS4A2 splice enhancer site sequence, an MS4A6A or an MS4A2 branch point sequence, or an MS4A6A or an MS4A2 polypyrimidine tract.
  • the antisense oligomer is targeted to exon 4 of an MS4A6A pre-mRNA or exon 3 of an MS4A2 pre-mRNA. In some embodiments, the antisense oligomer is targeted to an MS4A6A exon 4 splice donor sequence or an MS4A2 exon 3 splice donor sequence, an MS4A6A exon 4 or MS4A2 exon 3 splice acceptor sequence, or an MS4A6A exon 4 or an MS4A2 exon 3 splice enhancer sequence.
  • the antisense oligomer comprises a targeting sequence at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% identical to a sequence fully complementary to at least a portion of a splice donor site sequence, a splice acceptor site sequence, a splice enhancer site sequence, a branch point sequence or a polypyrimidine sequence from an MS4A6A or an MS4A2 mRNA.
  • the antisense oligomer comprises a targeting sequence fully complementary to at least a portion of a splice donor site sequence, a splice acceptor site sequence, a splice enhancer site sequence, a branch point sequence, or a polypyrimidine sequence from an MS4A6A or an MS4A2 mRNA.
  • the antisense oligomer comprises a targeting sequence at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence fully complementary to at least a portion of a sequence selected from the group consisting of SEQ ID NOs: 3, 6, 9, and 12.
  • the antisense oligomer comprises a targeting sequence at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence fully complementary to at least a portion of a sequence selected from the group consisting of SEQ ID NOs: 3, 6, 9, and 12. The portion is in some embodiments least 10 nucleotides in length.
  • the antisense oligomer may modulate splicing of an MS4A6A pre-mRNA molecule or an MS4A2 pre-mRNA molecule.
  • the target region comprises at least a portion of a sequence selected from an MS4A6A or an MS4A2 splice donor site sequence, an MS4A6A or an MS4A2 splice acceptor site sequence, an MS4A6A or an MS4A2 splice enhancer site sequence, an MS4A6A or an MS4A2 branch point sequence, and an MS4A6A or an MS4A2 polypyrimidine sequence.
  • the at least a portion comprises at least 10%, at least 25%, at least 50%, at least 75%, at least 90% or at least 90% of an MS4A6A or an MS4A2 splice donor site sequence, an MS4A6A or an MS4A2 splice acceptor site sequence, an MS4A6A or an MS4A2 splice enhancer site sequence, an MS4A6A or an MS4A2 branch point sequence, or an MS4A6A or an MS4A2 polypyrimidine sequence.
  • the MS4A6A or MS4A2 splice donor site sequence, the MS4A6A or MS4A2 splice acceptor site sequence, the MS4A6A or MS4A2 splice enhancer site sequence, the MS4A6A or MS4A2 branch point sequence, or MS4A6A or the MS4A2 polypyrimidine sequence may be from exon 3 or exon 4 of an MS4A6A or an MS4A2 pre-mRNA.
  • the portion may be at least 10 nucleotides in length.
  • the antisense oligomer may modulate splicing of an MS4A6A or an MS4A2 pre-mRNA molecule.
  • the complementary nucleic acid sequence comprised by the antisense oligomer is at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% identical to a sequence fully complementary to at least a portion of a splice donor site sequence, splice acceptor site sequence, splice enhancer site sequence, branch point sequence or polypyrimidine sequence from an MS4A6A mRNA or an MS4A2 mRNA.
  • the complementary nucleic acid sequence comprised by the antisense oligomer comprises a sequence at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to a sequence fully complementary to a portion of a sequence selected from the group consisting of SEQ ID NOs: 3, 6, 9, or 12.
  • the portion can in some embodiments be at least 10 nucleotides in length.
  • the antisense oligomer can in some embodiments modulate splicing of an MS4A6A or an MS4A2 pre-mRNA molecule.
  • the target region comprises at least a portion of a sequence selected from an MS4A6A or an MS4A2 splice donor site sequence, an MS4A6A or an MS4A2 splice acceptor site sequence, an MS4A6A or an MS4A2 splice enhancer site sequence, an MS4A6A or an MS4A2 branch point sequence, and an MS4A6A or an MS4A2 polypyrimidine sequence, each of which is a subsequence of SEQ ID NO: 3 (e.g., an exemplary nucleotide sequence the human MS4A6A genomic locus), SEQ ID NO: 6 (e.g., an exemplary nucleotide sequence the human MS4A2 genomic locus), SEQ ID NO: 9 (e.g., an exemplary nucleotide sequence the murine MS4A6A genomic locus), or SEQ ID NO: 12 (e.g., an exemplary nucleotide sequence the
  • the target region comprises nucleotides on each side of an intron/exon boundary, which in some embodiments comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides 5’ to the intron/exon boundary, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides 3’ to the intron/exon boundary, or at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides 5’ to and 3’ to the intron/exon boundary, in any combination.
  • the intron/exon boundaries for the human and murine MS4A6A and MS4A2 genetic loci are set forth in Tables 1 and 2, respectively.
  • an “expression vector” is a nucleic acid molecule comprising a polynucleotide sequence functionally linked to a promoter, such that transcription of the polynucleotide sequence by a polymerase results in production of an antisense oligomer as set forth herein.
  • Exemplary expression vectors include polynucleotide molecules, in some embodiments DNA molecules, that are derived, for example, from a plasmid, bacteriophage, yeast or virus (e.g., adenovirus, adeno-associated virus, lentivirus, retrovirus, etc.), into which a polynucleotide can be inserted or cloned.
  • Suitable expression vectors are known to those skilled in the art.
  • Some embodiments of the presently disclosed subject matter as set forth herein relate to a pharmaceutical composition comprising an antisense oligomer or expression vector as set forth herein. Such compositions are suitable for the therapeutic delivery of antisense oligomers, or expression vectors, described herein.
  • compositions that comprise a therapeutically-effective amount of one or more of the antisense oligomers or expression vectors described herein, formulated together with one or more pharmaceutically-acceptable carriers (additives) and/or diluents. While it is possible in some embodiments for an antisense oligomers and/or expression vectors as set forth herein to be administered alone, in some embodiments the compounds of the presently disclosed subject matter are administered as a pharmaceutical composition.
  • compositions as set forth herein may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; (3) topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually; (6) ocularly; (7) transdermally; (8) inhaled into the lungs, for example, by nebulizer or aerosol inhaler; or (9) nasally.
  • antisense oligomers as set forth herein are capable of reducing cell-surface expression of FcRI, the product of the MS4A2 gene. Such reduction is achieved by modulating splicing of an mRNA molecule encoding an MS4A6A and/or a Fc ⁇ RI ⁇ protein. More specifically, antisense oligomers as set forth herein decrease the production of MS4A6A and/or Fc ⁇ RI ⁇ -encoding mRNA molecules comprising exon 4 or exon 3, respectively, and increase the production of MS4A6A and/or Fc ⁇ RI ⁇ -encoding mRNA molecules lacking exon 4 or exon 3, respectively.
  • MS4A6A and/or Fc ⁇ RI ⁇ -encoding mRNA molecules lack exon 4 or exon 3, respectively, the encoded MS4A6A and/or Fc ⁇ RI ⁇ proteins lack the first transmembrane domain, which is required for trafficking of Fc ⁇ RI complex to the cell membrane.
  • some embodiments of the presently disclosed subject matter as set forth herein relate to methods for modulating splicing of an MS4A6A and/or an Fc ⁇ RI ⁇ mRNA in a cell, the method comprising contacting the cell with one or more antisense oligomers as set forth herein.
  • the cell may be any cell expressing an MS4A6A and/or an Fc ⁇ RI ⁇ mRNA molecule. Accordingly, the cell can be a cell in culture, or a cell in the body of an individual.
  • the cell is an epidermal Langerhans cell, an eosinophil, a mast cell, or a basophil. In a specific embodiment, the cell is a mast cell.
  • the mRNA may comprise a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% identical to one of SEQ ID NOs: 1 and 7 (MS4A6A) or SEQ ID NOs: 4 and 10 (MS4A2).
  • the mRNA encodes a protein comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to one of SEQ ID NOs: 2 and 8 (MS4A6A) or SEQ ID NOs: 5 and 11 (MS4A2).
  • the mRNA encodes a protein comprising SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, or SEQ ID NO: 11.
  • the antisense oligomer hybridizes to a target region that is involved in splicing of an MS4A6A and/or MS4A2 pre-mRNA. In some embodiments, the antisense oligomer hybridizes to a target region in the mRNA comprising at least a portion of a sequence selected from the group consisting of an MS4A6A and/or an MS4A2 splice donor site sequence, an MS4A6A and/or an MS4A2 splice acceptor site sequence, an MS4A6A and/or an MS4A2 splice enhancer site sequence, an MS4A6A and/or an MS4A2 branch point sequence, and an MS4A6A and/or an MS4A2 polypyrimidine sequence.
  • the MS4A6A and/or MS4A2 splice donor site sequence, the MS4A6A and/or MS4A2 splice acceptor site sequence, the MS4A6A and/or MS4A2 splice enhancer site sequence, the MS4A6A and/or MS4A2 branch point sequence, or the MS4A6A and/or MS4A2 polypyrimidine sequence may be from exon 4 of an MS4A6A and/or exon 3 of an MS4A2 pre-mRNA.
  • Modulation of splicing of an MS4A6A and/or Fc ⁇ RI ⁇ pre-mRNA by antisense oligomers as set forth herein can result in production of a truncated mRNA (t-MS4A6A and/or t-Fc ⁇ RI ⁇ mRNA), which produces a truncated form of the MS4A6A and/or Fc ⁇ RI ⁇ protein.
  • t-MS4A6A and t-Fc ⁇ RI ⁇ mRNAs differ from full-length MS4A6A and Fc ⁇ RI ⁇ mRNAs (FL-MS4A6A and FL-Fc ⁇ RI ⁇ mRNAs, respectively) in that they are truncated in exon 4 or exon 3, respectively, thereby producing MS4A6A and Fc ⁇ RI ⁇ proteins lacking the first and second membrane-spanning regions.
  • the amount of FL-MS4A6A and FL-Fc ⁇ RI ⁇ mRNAs in mast cells is greater than the amount of t-MS4A6A and t- Fc ⁇ RI ⁇ mRNAs.
  • some embodiments of the presently disclosed subject matter as set forth herein relate to methods for altering the ratio of FL-MS4A6A and/or FL-Fc ⁇ RI ⁇ mRNAs to t-MS4A6A and/or t-Fc ⁇ RI ⁇ mRNAs in a mast cell, the method comprising contacting the mast cell with one or more antisense oligomers as set forth herein.
  • Contact of a mast cell with one or more antisense oligomers as set forth herein may cause a decrease in the amount of FL-MS4A6A and/or FL-Fc ⁇ RI ⁇ mRNAs and an increase in the amount of t-MS4A6A and/or t-Fc ⁇ RI ⁇ mRNAs.
  • Contact of a mast cell with an antisense oligomer as set forth herein may result in a decreased FL-MS4A6A mRNA/t-MS4A6A mRNA and/or FL-Fc ⁇ RI ⁇ mRNA/t-Fc ⁇ RI ⁇ mRNA ratio.
  • the amount of FL-MS4A6A and/or FL-Fc ⁇ RI ⁇ mRNAs produced by the cell is decreased by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, least 97%, or at least 99%.
  • the presently disclosed subject matter also relates in some embodiments to methods for reducing cell surface expression of Fc ⁇ RI protein in a cell, the method comprising contacting the cell with one or more antisense oligomers as set forth herein.
  • the cell can be any cell expressing an Fc ⁇ RI protein on its surface.
  • the cell can be a cell in culture (e.g., tissue culture) or a cell in the body of an individual.
  • the cell is an epidermal Langerhans cell, an eosinophil, a mast cell or a basophil.
  • the cell is a mast cell.
  • the amount of Fc ⁇ RI expressed on the surface of the cell is decreased by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, or at least 99%.
  • mast cells are tissue-bound cells of the innate immune system which are well known for immunoglobulin (Ig)E-triggered degranulation in allergic reactions. Consequently, mast cells express large quantities of Fc ⁇ RI receptor on their surface. As the binding of IgE to Fc ⁇ RI is essentially irreversible, mast cells are largely covered with IgE. The main function of mast cells is considered to be degranulation, with immunoglobulin (Ig)E as the main trigger. Once an IgE molecule encounters a specific antigen or allergen, IgE:Fc ⁇ RI-crossl inking and calcium influx leads to degranulation of the mast cells. As a result, histamine is released and causes the well-known symptoms such as bronchoconstriction or pruritus.
  • IgE:Fc ⁇ RI-crossl inking and calcium influx leads to degranulation of the mast cells. As a result, histamine is released and causes the well-known symptoms such as bronchoconstriction or pruritus.
  • one embodiment as set forth herein is a method for modulating Fc ⁇ RI-dependent mast-cell degranulation, the method comprising contacting a mast cell with an antisense oligomer as set forth herein.
  • the cell can be a cell in culture (e.g., tissue culture) or a cell in the body of an individual.
  • mast cells Upon activation, mast cells rapidly release pre-formed mediators from cytoplasmic granules, such as vasoactive amines (e.g., histamine and serotonin), proteoglycans (e.g., heparin), proteases (e.g., tryptases and chymases), and some pre-stored cytokines (e.g., TNF ⁇ ).
  • vasoactive amines e.g., histamine and serotonin
  • proteoglycans e.g., heparin
  • proteases e.g., tryptases and chymases
  • TNF ⁇ pre-stored cytokines
  • mediators including growth factors, cytokines, and chemokines, such as IL-1, IL-6, IL-8, IL-10, TNF ⁇ , VEGF, TGF ⁇ , CCL2-4, as well as pro-inflammatory lipid mediators, such as prostaglandins and leukotrienes.
  • one embodiment as set forth herein is a method for modulating the release of one or more mediators from a mast cell, the method comprising contacting a mast cell with an antisense oligomer as set forth herein, where the one or more mediators is selected from the group consisting of a mast cell-produced vasoactive amine, a mast cell-produced proteoglycan, a mast cell-produced protease, a cytokine, a growth factor, a chemokine, and a pro-inflammatory lipid mediator.
  • the one or more mediator may be any one of histamine, serotonin, heparin, tryptase, chymase, TNF ⁇ , IL-1, IL-6, IL-8, IL-10, TNF ⁇ , VEGF, TGF ⁇ , CCL2-4, a prostaglandin, and a leukotriene.
  • the mast cell can be a cell in culture, or a cell in the body of an individual.
  • mast cells As players in innate immunity, mast cells have the capacity to initiate and amplify immune responses (see Bulfone-Paus & Rahri, 2015).
  • Several lines of evidence have demonstrated that mast cells participate in the sensitization phase of acquired immune responses via the secretion of mediators, which sustain dendritic cell (DC) maturation, function, and recruitment to the tissue or their migration to local draining lymph nodes.
  • DC dendritic cell
  • mast cells also exert important effector functions, since mast cells and T cells of different origin and subsets establish tight cell-cell interactions and modulate their respective effector functions in a bidirectional manner; this has been shown in a variety of models.
  • one embodiment as set forth herein is a method for reducing an immune response in an individual, the method comprising administering an antisense oligomer as set forth herein to the individual.
  • Such immune response can, but need not be, IgE- mediated immune responses.
  • the antisense oligomers as set forth herein may be administered to any individual expressing an Fc ⁇ RI ⁇ protein.
  • the terms individual, subject, patient, and the like are meant to encompass any mammal that expresses an Fc ⁇ RI ⁇ protein, with an exemplary mammal being a human.
  • the terms individual, subject, and patient by themselves do not denote a particular age, sex, race, and the like.
  • individuals of any age are intended to be covered by this disclosure.
  • the methods as set forth herein can be applied to any race of human, including, for example, Caucasian (white), African-American (black), Native American, Native Hawaiian, Hispanic, Latino, Asian, and European.
  • such characteristics may be significant.
  • the significant characteristic(s) e.g., age, sex, race, etc.
  • the term “individual” encompasses both human and non-human animals. Suitable non-human animals to which antisense oligomers as set forth herein may be administered include, but are not limited to companion animals (i.e. pets), food animals, work animals, or zoo animals. Exemplary animals include, but are not limited to, cats, dogs, horses, ferrets and other Mustelids, cattle, sheep, swine, and rodents.
  • Antisense oligomers as set forth herein can be administered to an individual by any suitable route of administration.
  • routes include, but are not limited to, oral and parenteral routes, (e.g., intravenous (IV), subcutaneous, intraperitoneal (IP), and intramuscular), inhalation (e.g., nebulization and inhalation) and transdermal delivery (e.g., topical).
  • IV intravenous
  • IP intraperitoneal
  • transdermal delivery e.g., topical
  • Any methods effective to deliver an antisense oligomer as set forth herein into the bloodstream of an individual are also contemplated in these methods.
  • transdermal delivery of antisense oligomers may be accomplished by use of a pharmaceutically acceptable carrier adapted for topical administration.
  • Antisense oligomers can be administered in the absence of other molecules, such as proteins or lipids, or they be administered in a complex with other molecules, such as proteins or lipids.
  • the use of cationic lipids to encapsulate antisense oligomers is disclosed in U.S. Patent No. 8,569,256, and U.S. Patent No. 6,806,084, which are incorporated herein by reference in their entirety.
  • the use of peptide-linked morpholino antisense oligonucleotides is disclosed in U.S. Patent Application Publication No. 2015/0238627, which is incorporated herein by reference. IgE and IgE-mediated immune responses are known to be involved in numerous allergic conditions.
  • antisense oligomers as set forth herein can reduce Fc ⁇ RI-mediated responses
  • such antisense oligomers can be used to treat allergic conditions.
  • one embodiment as set forth herein is a method for treating an allergic condition in an individual, by administering to an individual in need of such treatment an antisense oligomer as set forth herein.
  • Allergic conditions being treated can be any condition mediated by a pathway comprising Fc ⁇ RI. Such conditions include, but are not limited to, asthma, food allergies allergic conjunctivitis, and atopic dermatitis.
  • Methods and compositions for designing and administering antisense oligomers to cells and to subjects are described in, for example, U.S. Patent Nos.
  • Dose ranges of antisense oligonucleotide according to the presently disclosed subject matter are in some embodiments designed on the basis of rising dose studies in clinical trials (in vivo use) for which rigorous protocol requirements exist.
  • a molecule or an oligonucleotide as defined herein can be used at a dose which ranges in some embodiments between 0.1 and 20 mg/kg and in some embodiments between 0.5 and 10 mg/kg.
  • a concentration of an antisense oligonucleotide as defined herein which ranges in some embodiments between 0.1 nM and 1 mM is used. In some embodiments, the concentration used is between 0.3 to 400 nM, and in some embodiments is between 1 to 200 nM. If several oligonucleotides are used, this concentration or dose can refer in some embodiments to the total concentration or dose of oligonucleotides and in some embodiments can refer to the concentration or dose of each oligonucleotide added.
  • oligonucleotide(s) as given above are exemplary concentrations or doses for in vitro or ex vivo uses.
  • concentration or dose of oligonucleotide(s) used can further vary and could need to be optimized further.
  • An oligonucleotide as defined herein for use according to the presently disclosed subject matter can be suitable for administration to a cell, tissue, and/or an organ in vivo of individuals affected by or at risk of developing undesirable allergic reactions, and can be administered in vivo, ex vivo or in vitro.
  • Said oligonucleotide can be directly or indirectly administrated to a cell, tissue, and/or an organ in vivo of an individual, and can be administered directly or indirectly in vivo, ex vivo, or in vitro.
  • An oligonucleotide of the presently disclosed subject matter can be indirectly administrated using suitable techniques known in the art.
  • An oligonucleotide can for example be provided to an individual or a cell, tissue, or organ of said individual in the form of an expression vector wherein the expression vector encodes one or more transcripts comprising said oligonucleotide or plurality of oligonucleotides.
  • the expression vector can in some embodiments be introduced into a cell, tissue, organ, or individual via a gene delivery vehicle.
  • a viral- based expression vector comprising an expression cassette or a transcription cassette that drives expression or transcription of a molecule as identified herein.
  • a preferred delivery vehicle is a viral vector such as an adeno-associated virus vector (AAV), or a retroviral vector such as a lentivirus vector (see e.g., De Angelis et al.; 2002; Goyenvalle et al.; 2004; Denti et al., 2006).
  • plasmids, artificial chromosomes including but not limited to plasmids suitable for targeted homologous recombination and integration in the human genome of cells, can be suitably applied for delivery of an oligonucleotide as defined herein.
  • the oligonucleotide can be delivered as is. However, the oligonucleotide can also be encoded by the viral vector. Typically, this is in the form of an RNA transcript that comprises the sequence of the oligonucleotide in a part of the transcript.
  • oligonucleotide and/or an equivalent thereof can be delivered as is to an individual, a cell, a tissue, and/or an organ of said individual.
  • oligonucleotide and/or an equivalent thereof is dissolved in a solution that is compatible with the delivery method.
  • the solution is a physiological salt solution.
  • an excipient that aids in delivery of each of the constituents as defined herein to a cell and/or into a cell, tissue, and/or organ.
  • excipients including, but are not limited to those capable of forming complexes, nanoparticles, micelles, vesicles, and/or liposomes that deliver each constituent as defined herein, complexed, associated with, and/or trapped in a vesicle or liposome through a cell membrane. Many of these excipients are known in the art.
  • Suitable excipients comprise polyethylenimine (PEI), or similar cationic polymers, including polypropyleneimine or polyethylenimine copolymers (PECs) and derivatives, synthetic amphiphils (SAINT- 18), LIPOFECTINTM brand lipofection enhancer, DOTAP, and/or viral capsid proteins that are capable of self assembly into particles that can deliver each constitutent as defined herein to a cell, tissue, and/or organ.
  • PECs polypropyleneimine or polyethylenimine copolymers
  • SAINT- 18 synthetic amphiphils
  • LIPOFECTINTM brand lipofection enhancer LIPOFECTINTM brand lipofection enhancer
  • DOTAP lipofection enhancer
  • viral capsid proteins that are capable of self assembly into particles that can deliver each constitutent as defined herein to a cell, tissue, and/or organ.
  • excipients have been shown to efficiently deliver an oligonucleotide such as antisense nucleic acids
  • LIPOFECTINTM brand lipofection enhancer represents an example of a liposomal transfection agent. It consists of two lipid components, a cationic lipid N-[l-(2,3 dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) (cp. DOTAP which is the methylsulfate salt) and a neutral lipid dioleoylphosphatidylethanolamine (DOPE). The neutral component mediates the intracellular release.
  • DOTMA cationic lipid N-[l-(2,3 dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride
  • DOPE neutral lipid dioleoylphosphatidylethanolamine
  • Another group of delivery systems are polymeric nanoparticles.
  • Polycations such like diethylaminoethylaminoethyl (DEAE)-dextran, which are well known as DNA transfection reagent can be combined with butylcyanoacrylate (PBCA) and hexylcyanoacrylate (PHCA) to formulate cationic nanoparticles that can deliver each constituent as defined herein, preferably an oligonucleotide across cell membranes into cells.
  • PBCA butylcyanoacrylate
  • PHCA hexylcyanoacrylate
  • the cationic peptide protamine offers an alternative approach to formulate an oligonucleotide with colloids.
  • This colloidal nanoparticle system can form so called proticles, which can be prepared by a simple self- assembly process to package and mediate intracellular release of an oligonucleotide.
  • the skilled person may select and adapt any of the above or other commercially available alternative excipients and delivery systems to package and deliver an oligonucleotide for use in the compositions and methods of the presently disclosed subject matter, particularly for use in humans.
  • an oligonucleotide could be covalently or non-covalently linked to a targeting ligand specifically designed to facilitate the uptake into the cell, cytoplasm and/or its nucleus.
  • a targeting ligand specifically designed to facilitate the uptake into the cell, cytoplasm and/or its nucleus.
  • ligand could comprise (i) a compound (including but not limited to peptide(-like) structures) recognizing cell, tissue or organ specific elements facilitating cellular uptake and/or (ii) a chemical compound able to facilitate the uptake in to cells and/or the intracellular release of an oligonucleotide from vesicles, e.g. endosomes or lysosomes.
  • an oligonucleotide is formulated in a composition or a medicament or a composition, which is provided with at least an excipient and/or a targeting ligand for delivery and/or a delivery device thereof to a cell and/or enhancing its intracellular delivery.
  • the presently disclosed subject matter also encompasses a pharmaceutically acceptable composition comprising an oligonucleotide and further comprising at least one excipient and/or a targeting ligand for delivery and/or a delivery device of said oligonucleotide to a cell and/or enhancing its intracellular delivery.
  • composition comprises an additional constituent such as an adjunct compound as later defined herein
  • each constituent of the composition may not be formulated in one single combination or composition or preparation.
  • the skilled person will know which type of formulation is the most appropriate for each constituent as defined herein.
  • a target cell is a mast cell.
  • tissue mast cells and other cell types already have antigen-specific IgE bound to Fc ⁇ RI, re exposure to the original or a cross-reactive bivalent or multivalent antigen results in the cross-linking of adjacent Fc ⁇ RI-bound IgE and the consequent aggregation of surface Fc ⁇ RI.
  • Fc ⁇ RI aggregation is of sufficient strength and duration, it triggers mast cells and basophils to initiate complex signaling events that ultimately result in the secretion of a diverse group of biologically active products.
  • mediators released shortly after antigen- and IgE-induced mast cell degranulation induce a response termed an immediate hypersensitivity (or early phase) reaction within minutes of their release.
  • some embodiments of the presently disclosed subject matter as set forth herein relate to methods for preventing or treating an anaphylactic reaction in an individual, the method comprising administering to an individual in need of such treatment one or more antisense oligomers as set forth herein.
  • the antisense oligomers as set forth herein may be administered in advance of an anaphylactic reaction or anticipated anaphylactic reaction in the individual.
  • the antisense oligomers as set forth herein is in some embodiments administered at regular intervals to prevent or reduce the incidence and/or severity of any anaphylactic reaction in an individual at risk of having an anaphylactic reaction or developing anaphylactic shock.
  • the individual being treated may or may not be at immediate risk for having an anaphylactic reaction.
  • mastocytosis is a rare mast cell activation disorder caused by an individual having too many mast cells and mast cell precursors. Because mast cells are involved in atopic responses, individuals suffering from mastocytosis are susceptible to hives, itching and anaphylactic shock.
  • one method as set forth herein is a method for treating an individual suffering from mastocytosis, the method comprising administering to an individual in need of such treatment an antisense oligomer as set forth herein.
  • the individual may or may not already be exhibiting symptoms of mastocytosis, such as itching, hives and anaphylaxis.
  • an antisense oligomer is administered to an individual at risk for developing symptoms of mastocytosis.
  • mast cells are produced in the bone marrow and are found throughout the connective tissue of the body. In some individuals, mast cells accumulate the skin, forming clusters that appear as a bump. Such clusters of mast cells are referred to as mastocytomas.
  • a common symptom resulting from a mastocytoma is itching, although afflicted individuals can also experience urticarial, pigmentosa, flushing, nausea, vomiting, diarrhea and abdominal pain.
  • One method as set forth herein is a method for treating an individual diagnosed with a mastocytoma or suspected of having a mastocytoma, by administering to the individual an antisense oligomer as set forth herein.
  • kits for modulating splicing of an MS4A6A and/or an Fc ⁇ RI ⁇ mRNA, reducing cell surface expression of an Fc ⁇ RI protein, modulating an anaphylactic reaction in an individual, and/or treating an individual for an allergic condition comprising at least one antisense oligomer as set forth herein.
  • the kit may also comprise instructions for using the kit, and various reagents, such as buffers, necessary to practice the methods as set forth herein.
  • kits may also comprise any material necessary to practice the methods as set forth herein, such as syringes, tubes, swabs, and the like.
  • the presently disclosed subject matter provides a composition or a preparation which is in the form of a kit of parts comprising an oligonucleotide and a further adjunct compound as later defined herein.
  • the presently disclosed subject matter also relates in some embodiments to methods for employing the antisense oligonucleotides to treat and/or prevent various diseases, disorders, and/or conditions in subjects in need thereof.
  • Exemplary such methods include, but are not limited to methods for modulating splicing of mRNAs encoding MS4A6A proteins in cells or tissues, methods for reducing cell surface expression of Fc ⁇ RI proteins in cells, methods for modulating Fc ⁇ RI receptor complex- dependent degranulation in mast cells, methods for modulating Fc ⁇ RI receptor complex- dependent mast-cell migration, methods for modulating cytokine release, methods for inhibiting anaphylaxis reactions in individuals, methods for treating allergic conditions in individuals, methods for reducing the incidence of allergic reactions in individuals, methods for treating individuals at risk of developing anaphylactic reactions, and methods for treating mast cell-related diseases in individuals.
  • Fc ⁇ RIB SSOs Eliminate Mouse Fc ⁇ RI To the Plasma Membrane Expression of a truncated isoform of Fc ⁇ RI ⁇ in MCs that lacks exon 3 (Cruse et al., 2010; Cruse et al, 2013) was identified. Exon 3 of MS4A2 encodes the 1st and 2nd TM domains of Fc ⁇ RI ⁇ . The 1st TM domain of Fc ⁇ RI ⁇ is critical for trafficking the Fc ⁇ RI complex to the plasma membrane (Singleton et al., 2009). It was predicted that alternative splicing of Fc ⁇ RI ⁇ results in loss of association with the Fc ⁇ RI complex.
  • Fc ⁇ RIB SSOs are Less Effective in huMCs These data demonstrated the potential of this approach to target MCs, if it translates to humans. However, Fc ⁇ RI ⁇ SSOs are less effective in huMCs.
  • Fc ⁇ RI ⁇ amplifies Fc ⁇ RI signaling by 10 fold in vitro and in vivo, as shown with humanized Fc ⁇ RIa (Alber et al., 1991; Dombrowicz et al., 1996; Dombrowicz et al., 1998; Donnadieu et al., 2000; On et al., 2004) and trimeric Fc ⁇ RI does not trigger robust Ca 2+ influx (Dombrowicz et al., 1998).
  • Fc ⁇ RI ⁇ may be dispensable for Fc ⁇ RI function in huMCs, where an Fc ⁇ RI ⁇ - like protein may compensate for Fc ⁇ RI ⁇ .
  • MS4A6A Promotes Surface Fc ⁇ RI Expression and IgE-dependent Degranulation That MS4A6A could traffic Fc ⁇ RI and act as an Fc ⁇ RI ⁇ -like protein was examined, because MS4A6A and MS4A2 (Fc ⁇ RI ⁇ ) have conserved features ( Figure 2C).
  • MS4A2 (Fc ⁇ RI ⁇ ) has a truncated isoform that does not traffic to the plasma membrane or associate with Fc ⁇ RI (Cruse et al., 2010; Cruse et al., 2013; Cruse et al., 2016). This alternative splicing of MS4A2 (Fc ⁇ RI ⁇ ) is likely a regulatory process to alter Fc ⁇ RI expression at the surface without requirement to alter the level of gene expression.
  • MS4A6A has equivalent alternative splicing (see Figures 2A and 2C). Sequencing the RT- PCR bands of MS4A6A confirmed that the novel alternative splicing exactly aligned with MS4A2 (Fc ⁇ RI ⁇ ). Sequencing also determined that MS4A6A contains a putative cytoplasmic hemi-ITAM that is predicted to have the capacity to bind Lyn kinase and signal similarly to the MS4A2 (Fc ⁇ RI ⁇ ) IT AM ( Figure 3). shRNA was first employed to knockdown gene expression using standard RNAi approaches with lentiviral delivery as described (Cruse et al., 2013; Cruse et al., 2015) to knockdown both MS4A6A isoforms.
  • MS4A6A and Fc ⁇ RI ⁇ were cloned and transfected into LAD2 cells with GFP tags to confirm expression by flow cytometry (see Figure 4A and 4B). After confirming transfection, cell lysates were extracted and stained by Western blot to validate MS4A6A antibody ( Figure 4C). Knockdown of MS4A6A variants was then performed and knockdown of both MS4A6A variants was confirmed by Western blot (see Figures 4D and 4E), as well as quantitative PCR ( Figure 4F).
  • the SSO method that was used to induce exon skipping targeting exon 3 of Fc ⁇ RI ⁇ with sequence ATAGATATATACTCACAAATATGGCTCC was employed herein in the context of exon skipping the target exon 4 of MS4A6A with the sequence TCTGGAT AGTCTGT GGGAAGAGAAA (SEQ ID NO: 22), and it was determined that
  • Fc ⁇ RI ⁇ exon 3 SSO was specific for exon skipping of MS4A2 (see Figure 5A).
  • Exon skipping with exon 3 of Fc ⁇ RI ⁇ or exon 4 of MS4A6A with SSOs did not significantly affect cell number (Figure 5B) or viability (Figure 5C).
  • MS4A6A exon 4 can be targeted comparably to Fc ⁇ RI ⁇ exon 3 by inducing alternative splicing to remove the first transmembrane domain of the MS4A6A or Fc ⁇ RI ⁇ protein, respectively.
  • the result of exon skipping either exon 3 of Fc ⁇ RI ⁇ or exon 4 of MS4A6A is a reduced surface expression of Fc ⁇ RIa, which is likely due to reduced trafficking to the plasma membrane.
  • the presently disclosed data suggest that the full length splice variants of both Fc ⁇ RI ⁇ and MS4A6A can form subunits of Fc ⁇ RI and traffic the receptor complex to the plasma membrane in human mast cells (see Figures 41 and 5D).
  • CBDMCs are known to maintain an immature phenotype and must be primed with IL-4 to respond to IgE crosslinking (Figure 6A) and upregulated surface expression of Fc ⁇ RI (see Figures 6C and 6D). Once primed, they responded and exon skipping of Fc ⁇ RI ⁇ exon 3 and MS4A6A exon 4 alone and in combination, were comparable to LAD2 mast cells ( Figure 6E).
  • the positive control with ionomycin ( Figure 6B) was not affected by exon skipping mRNA for either protein (Figure 6F).
  • Asthma and related allergic diseases are common. Asthma affects up to one in ten people in developed countries. About 10% of patients with asthma cannot be controlled with current therapeutic approaches. In addition to the significant morbidity associated with uncontrolled asthma, the economic burden is greater than tuberculosis and HIV/AIDS combined. Allergic diseases are increasing dramatically in prevalence and up to 50% of children in the developed world test positive to allergens and thus allergy medication is of great interest. Most current treatments target the effects of the mediators released by mast cells rather than targeting the mast cell directly, or use corticosteroids, which target a wide range of cells. The approach that is disclosed herein is a more direct approach.
  • MS4A6A membrane spanning 4A gene family member
  • Fc ⁇ RI ⁇ encoded by MS4A2
  • Fc ⁇ RI ⁇ another MS4A gene family member
  • MS4A6A is a protein of unknown function that is in the same gene family as Fc ⁇ RI ⁇ (MS4A2).
  • Fc ⁇ RI ⁇ also functions in a comparable way and again, the first two transmembrane domains are critical for its function in Fc ⁇ RI biology (Cruse et al., 2010, Cruse et al., 2013, Cruse et al., 2016).
  • exon skipping human Fc ⁇ RI ⁇ exon 3 to remove the first two transmembrane domains reduces Fc ⁇ RI surface expression, but is insufficient to eliminate degranulation in human mast cells in response to IgE activation.
  • MS4A6A exon 4 where exon skipping MS4A6A exon 4 to remove the first two transmembrane domains reduces surface Fc ⁇ RI expression, but fails to eliminate IgE-dependent degranulation in human mast cells.
  • AONs antisense oligonucleotides
  • inhaled micro-particles and topical creams have been reported and thus there are many applications for an AON drug that would reduce mast cell activation.
  • An aerosol of AONs delivered as an inhaler to the lung would target lung mast cells in asthma and protect against IgE-mediated lung inflammation and wheezing in asthma.
  • a nasal spray would target mast cells in the nasal mucosa that could be used to target these cells specifically in allergic rhinitis.
  • Allergy-associated FcR-b is a molecular amplifier of IgE-and IgG-mediated in vivo responses. Immunity 8:517-529.
  • Peripheral blood dendritic cells express Fc epsilon RI as a complex composed of Fc epsilon RI alpha-and Fc epsilon RI gamma-chains and can use this receptor for IgE-mediated allergen presentation.
  • Fc epsilon RI as a complex composed of Fc epsilon RI alpha-and Fc epsilon RI gamma-chains and can use this receptor for IgE-mediated allergen presentation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2020/059682 2019-11-08 2020-11-09 Exon skipping of fc-epsilon-ri-beta and ms4a6a in combination for the treatment of allergic diseases Ceased WO2021092562A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP2022526035A JP2023501347A (ja) 2019-11-08 2020-11-09 アレルギー性疾患を治療するためのFcεRIβ及びMS4A6Aを組み合わせたエクソンスキップ
CN202080092446.5A CN115335078A (zh) 2019-11-08 2020-11-09 组合用于治疗过敏疾病的FC-ε-RI-β和MS4A6A的外显子跳跃
EP20885567.6A EP4054639A4 (en) 2019-11-08 2020-11-09 EXON SKIPPING OF FC-EPSILON-RI-BETA AND MS4A6A IN COMBINATION FOR THE TREATMENT OF ALLERGIC DISEASES
AU2020378207A AU2020378207A1 (en) 2019-11-08 2020-11-09 Exon skipping of Fc-epsilon-RI-beta and MS4A6A in combination for the treatment of allergic diseases
US17/775,136 US20220380777A1 (en) 2019-11-08 2020-11-09 Exon skipping of fc-epsilon-ri-beta and ms4a6a in combination for the treatment of allergic diseases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962932664P 2019-11-08 2019-11-08
US62/932,664 2019-11-08

Publications (1)

Publication Number Publication Date
WO2021092562A1 true WO2021092562A1 (en) 2021-05-14

Family

ID=75849333

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/059682 Ceased WO2021092562A1 (en) 2019-11-08 2020-11-09 Exon skipping of fc-epsilon-ri-beta and ms4a6a in combination for the treatment of allergic diseases

Country Status (6)

Country Link
US (1) US20220380777A1 (cg-RX-API-DMAC7.html)
EP (1) EP4054639A4 (cg-RX-API-DMAC7.html)
JP (1) JP2023501347A (cg-RX-API-DMAC7.html)
CN (1) CN115335078A (cg-RX-API-DMAC7.html)
AU (1) AU2020378207A1 (cg-RX-API-DMAC7.html)
WO (1) WO2021092562A1 (cg-RX-API-DMAC7.html)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11268096B2 (en) 2016-02-01 2022-03-08 North Carolina State University Compounds for modulating Fc-epsilon-RI-beta expression and uses thereof
WO2024073589A3 (en) * 2022-09-28 2024-06-27 Atalanta Therapeutics, Inc. Compositions and methods for treatment of neuroinflammatory diseases

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112023062A (zh) * 2020-09-18 2020-12-04 北京基因安科技有限公司 一个用可溶性IgE受体抑制过敏反应的方法
CN116219009B (zh) * 2022-10-19 2024-10-01 杭州师范大学 小胶质细胞特异性表达的ms4a6a在胶质母细胞瘤治疗或预后评估试剂盒上的应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120029059A1 (en) * 2004-06-28 2012-02-02 The University Of Western Australia Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof
WO2019200383A1 (en) * 2018-04-13 2019-10-17 Ohio State Innovation Foundation Reagents and methods for autism and comorbidities thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040137566A1 (en) * 2001-12-10 2004-07-15 Tedder Thomas F. Identification of novel ms4a gene family members expressed by hematopoietic cells
EP2290087A3 (en) * 2004-12-22 2011-06-15 Genentech, Inc. Methods for producing soluble multi-membrane-spanning proteins
CN103074422A (zh) * 2012-12-29 2013-05-01 深圳市第三人民医院 Ms4a6a基因的用途
WO2017136435A1 (en) * 2016-02-01 2017-08-10 The Usa, As Represented By The Secretary, Department Of Health And Human Services Office Of Technology Transfer National Institute Of Health Compounds for modulating fc-epsilon-ri-beta expression and uses thereof
CN105969901B (zh) * 2016-07-27 2019-10-11 北京泱深生物信息技术有限公司 Ms4a6a作为多发性骨髓瘤诊治标志物的用途

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120029059A1 (en) * 2004-06-28 2012-02-02 The University Of Western Australia Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof
WO2019200383A1 (en) * 2018-04-13 2019-10-17 Ohio State Innovation Foundation Reagents and methods for autism and comorbidities thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CRUSE ET AL.: "Exon skipping of FceRlbeta eliminates expression of the high-affinity IgE receptor in mast cells with therapeutic potential for allergy", PNAS, vol. 113, no. 49, 6 December 2016 (2016-12-06), pages 14115 - 14120, XP055823249 *
LIANG ET AL.: "Structural organization of the human MS4A gene cluster on Chromosome 11q12", IMMUNOGENETICS, vol. 53, 21 June 2001 (2001-06-21), pages 357 - 368, XP009053461, DOI: 10.1007/s002510100339 *
See also references of EP4054639A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11268096B2 (en) 2016-02-01 2022-03-08 North Carolina State University Compounds for modulating Fc-epsilon-RI-beta expression and uses thereof
WO2024073589A3 (en) * 2022-09-28 2024-06-27 Atalanta Therapeutics, Inc. Compositions and methods for treatment of neuroinflammatory diseases

Also Published As

Publication number Publication date
JP2023501347A (ja) 2023-01-18
EP4054639A1 (en) 2022-09-14
EP4054639A4 (en) 2025-04-30
AU2020378207A1 (en) 2022-06-23
CN115335078A (zh) 2022-11-11
US20220380777A1 (en) 2022-12-01

Similar Documents

Publication Publication Date Title
US11596609B2 (en) Combinations of mRNAs encoding immune modulating polypeptides and uses thereof
US20230346928A1 (en) Mrna combination therapy for the treatment of cancer
US20220380777A1 (en) Exon skipping of fc-epsilon-ri-beta and ms4a6a in combination for the treatment of allergic diseases
KR102825946B1 (ko) IL4Rα, TRPA1, 또는 F2RL1을 표적화하는 RNA 복합체를 사용한 아토피 피부염 및 천식의 치료
CN101557831A (zh) 体内抑制在灵长类亨廷顿基因表达的方法和序列
EP3394093B1 (en) Methods of using ox40 ligand encoding polynucleotides
US20190241658A1 (en) Therapeutic mRNAs encoding anti CTLA-4 antibodies
US6025193A (en) Methods and compositions for diagnosis and treatment of pathological conditions related to abnormal dopamine receptor expression
KR20210110310A (ko) 올리고머 핵산 분자 및 그의 이용
US20220372492A1 (en) Compounds for modulating fc-epsilon-ri-beta expression and uses thereof
US20210363531A1 (en) Targeting kit with splice switching oligonucleotides to induce apoptosis of mast cells
US10537591B2 (en) Method for promoting muscle regeneration
US20150118744A1 (en) Oligonucleotide, glucocorticoid sensitivity enhancer, pharmaceutical composition, and expression vector
JPH09501057A (ja) 新規のオリゴヌクレオチド相互作用による血管細胞接着分子の発現の調節
JP2002519439A (ja) Il−15に標的されたアンチセンスオリゴヌクレオチド
WO2022022617A1 (en) Combinatory treatment of sma with sarna and mrna modulators
RU2839162C2 (ru) Молекула олигомерной нуклеиновой кислоты и ее применение
HK40092520A (zh) Sarna和mrna调节剂联合治疗sma
WO2024036343A2 (en) Synergistic nucleic acid based therapeutics and methods of use for treating genetic disorders
WO2024051765A1 (zh) 一种cd59基因沉默的t细胞及其应用
WO2026096962A1 (en) Methods and compounds for treating, ameliorating and/or preventing fibrotic diseases
US20240002848A1 (en) Compositions and methods for suppressing msutz
HK1260714A1 (en) Methods of using ox40 ligand encoding polynucleotides
HK1260714B (en) Methods of using ox40 ligand encoding polynucleotides

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20885567

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022526035

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020885567

Country of ref document: EP

Effective date: 20220608

ENP Entry into the national phase

Ref document number: 2020378207

Country of ref document: AU

Date of ref document: 20201109

Kind code of ref document: A