WO2021092064A1 - Trem compositions for con-rare codons and related uses - Google Patents

Trem compositions for con-rare codons and related uses Download PDF

Info

Publication number
WO2021092064A1
WO2021092064A1 PCT/US2020/058948 US2020058948W WO2021092064A1 WO 2021092064 A1 WO2021092064 A1 WO 2021092064A1 US 2020058948 W US2020058948 W US 2020058948W WO 2021092064 A1 WO2021092064 A1 WO 2021092064A1
Authority
WO
WIPO (PCT)
Prior art keywords
trem
con
fragment
seq
codon
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/058948
Other languages
English (en)
French (fr)
Inventor
Christine Elizabeth HAJDIN
David Arthur Berry
Theonie ANASTASSIADIS
Noubar Boghos Afeyan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Flagship Pioneering Inc
Original Assignee
Flagship Pioneering Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Flagship Pioneering Inc filed Critical Flagship Pioneering Inc
Priority to AU2020379762A priority Critical patent/AU2020379762A1/en
Priority to EP20817113.2A priority patent/EP4055163A1/en
Priority to CN202080077056.0A priority patent/CN115003810A/zh
Priority to US17/774,410 priority patent/US20220364092A1/en
Priority to KR1020227018837A priority patent/KR20220128611A/ko
Priority to MX2022005362A priority patent/MX2022005362A/es
Priority to CA3160097A priority patent/CA3160097A1/en
Priority to JP2022525706A priority patent/JP2023500116A/ja
Publication of WO2021092064A1 publication Critical patent/WO2021092064A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides

Definitions

  • Exemplary haploinsufficiency disorders include GLUT1 deficiency syndrome 1, GLUT1 deficiency syndrome 2, a disorder caused by a GATA2 mutation (e.g., GATA2 deficiency; monocyte, B and NK lymphocyte deficiency; Emberger syndrome; monocytopenia and mycobacterium avium complex/dendritic cell), Coffin-Siris syndrome 2, Charcot-Marie-Tooth disease, Robinow syndrome, Takenouchi-Kosaki syndrome, chromosome 1p35 deletion syndrome, chromosome 2p12-p11.2 deletion syndrome, WHIM syndrome, Mowat-Wilson syndrome, and Dravet syndrome.
  • the target cell or tissue comprises a metabolic state or condition.
  • a method of treating a subject having a disease associated with a contextually-rare codon comprising ⁇ acquiring knowledge of the presence of a nucleic acid sequence, e.g., a DNA or RNA, having the con-rare codon (“con-rare codon nucleic acid sequence”) in a target cell or tissue sample from the subject; and administering to the subject an effective amount of a composition comprising a tRNA effector molecule (TREM) which corresponds to the con-rare codon of the nucleic acid sequence, thereby treating the disease in the subject.
  • a nucleic acid sequence e.g., a DNA or RNA
  • con-rare codon nucleic acid sequence e.g., a DNA or RNA
  • TAM tRNA effector molecule
  • the method comprises acquiring a value for a con-rare codon in the nucleic acid sequence, e.g., DNA or RNA, wherein the value is a function of one or more of the following factors, e.g., by evaluating or determining one or more of the following factors ⁇ (1) the sequence of the codon; (2) the availability of a corresponding tRNA, e.g., charged tRNA, for that con-rare codon in a target cell or tissue, e.g., one or more iso-acceptor tRNA molecules; (3) the expression profile (or proteomic properties) of the target cell or tissue (e.g., the abundance of expression of other proteins which include the con-rare codon); (4) the proportion of the tRNAs corresponding to the con-rare codon which are charged; (5) the iso-decoder isotype of the tRNA corresponding to the con-rare codon; and (6) a target cell or tissue characterization selected from ⁇ (i)
  • codon X is a con-rare codon if less than 3% of the existing, functionally available, temporally available, or translationally-competent tRNAs in that same cell correspond to codon X.
  • con-rarity takes into account both the supply of tRNAs corresponding to the codon and the demand placed on that supply in the context of a specific or selected cell or tissue.
  • Methods disclosed here comprise a TREM composition, and uses thereof, having a TREM which corresponds to a con-rare codon.
  • the target cell or tissue comprises or is associated, or correlated (negatively or positively) with, an unwanted characteristic or a selected characteristic.
  • the target cell or tissue comprises or is associated, or correlated (negatively or positively) with, a disease or disorder.
  • the disease or disorder comprises a cancer or a haploinsufficiency disorder.
  • the target cell or tissue is characterized by unwanted proliferation, e.g., benign or malignant proliferation.
  • the target cell or tissue comprises a product, e.g., a nucleic acid (e.g., a RNA), protein, lipid, or sugar, associated with, or correlated (negatively or positively) with, a disorder or disease.
  • a product e.g., a nucleic acid (e.g., a RNA), protein, lipid, or sugar, associated with, or correlated (negatively or positively) with, a disorder or disease.
  • the disease or disorder comprises a cancer or a haploinsufficiency disorder.
  • the production parameter comprises an expression parameter or a signaling parameter, e.g., as described herein.
  • E16 comprises an expression parameter or a signaling parameter, e.g., as described herein.
  • a method of treating a subject having a disease associated with a contextually-rare codon (“con-rare codon”) comprising ⁇ acquiring knowledge of the presence of a nucleic acid sequence, e.g., a DNA or RNA, having the con-rare codon (“con-rare codon nucleic acid sequence”) in a target cell or tissue sample from the subject; and administering to the subject an effective amount of a composition comprising a tRNA effector molecule (TREM) which corresponds to the con-rare codon of the nucleic acid sequence, thereby treating the disease in the subject.
  • TAM tRNA effector molecule
  • the con-rare codon meets a reference value for one or more of the following ⁇ (1) the sequence of the codon; (2) the availability of a corresponding tRNA, e.g., charged tRNA, for that con-rare codon in a target cell or tissue, e.g., one or more iso-acceptor tRNA molecules; (3) the expression profile (or proteomic properties) of the target cell or tissue (e.g., the abundance of expression of other proteins which include the con-rare codon); (4) the proportion of the tRNAs corresponding to the con-rare codon which are charged; and (5) the iso-decoder isotype of the tRNA corresponding to the con-rare codon; E44.
  • the method of any of the preceding embodiments wherein at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 99%, or 100% (by weight or number) of the TREMs in the TREM composition correspond to a con-rare codon.
  • the TREM composition comprises TREMs that correspond to a plurality of con-rare codons.
  • the TREM composition comprises: a first TREM which corresponds to a first con-rare codon; and an additional TREM which corresponds to a different con-rare codon.
  • the cell is a non-mammalian cell, e.g., a bacterial cell, an insect cell or a yeast cell.
  • E78. The method of any of the preceding embodiments, wherein the cell is a host cell chosen from ⁇ a HeLa cell, a HEK293T cell (e.g., a Freestyle 293-F cell), a HT-1080 cell, a PER.C6 cell, a HKB-11 cell, a CAP cell, a HuH-7 cell, a BHK 21 cell, an MRC-S cell, a MDCK cell, a VERO cell, a WI-38 cell, or a Chinese Hamster Ovary (CHO) cell.
  • a Hosar cells chosen from ⁇ a HeLa cell, a HEK293T cell (e.g., a Freestyle 293-F cell), a HT-1080 cell, a PER.C6 cell, a HKB-11 cell, a CAP cell, a Hu
  • a method of modulating a production parameter of an RNA, or a protein encoded by an RNA, in a cell comprising ⁇ optionally, acquiring knowledge of the presence of an RNA having a contextually-rare codon (“con-rare codon RNA”) in the cell, modulating a culture parameter such that a production parameter of the RNA or protein encoded by the RNA is modulated.
  • the host cell is a non- mammalian cell, e.g., a bacterial cell, a yeast cell or an insect cell.
  • the TREM is a GMP- grade composition comprising a recombinant TREM (e.g., a TREM composition made in compliance with cGMP, and/or in accordance with similar requirements) comprising an RNA sequence at least 80% identical to an RNA sequence encoded by a DNA sequence listed in Table 1, or a fragment or functional fragment thereof.
  • the TREM comprises one or more post-transcriptional modifications listed in Table 2.
  • composition comprising a recombinant TREM is between 0.5g to 500g, between 0.5g to 400g, between 0.5g to 300g, between 0.5g to 200g, between 0.5g to 100g, between 0.5g to 50g, between 0.5g to 40g, between 0.5g to 30g, between 0.5g to 20g, between 0.5g to 10g, between 0.5g to 9g, between 0.5g to 8g, between 0.5g to 7g, between 0.5g to 6g, between 0.5g to 5g, between 0.5g to 4g, between 0.5g to 3g, between 0.5g to 2g, between 0.5g to 1g, between 1g to 500g, between 2g to 500g, between 5g to 500g, between 10g to 500g, between 20g to 500g, between 30g to 500g, between 40g to 500g, between 50g to 500g, between 100g to 500g, between 200g to 500g, between 300g to 500g,
  • the TREM composition comprises one or more, e.g., a plurality, of TREMs.
  • the TREM composition (or an intermediate in the production of a TREM composition) comprises one or more of the following characteristics ⁇ (i) purity of at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%; (ii) host cell protein (HCP) contamination of less than 0.1ng/ml, 1ng/ml, 5ng/ml, 10ng/ml, 15ng/ml, 20ng/ml, 25ng/ml, 30ng/ml, 35ng/ml, 40ng/ml, 50ng/ml, 60ng/ml, 70ng/ml, 80ng/ml, 90ng/ml, or 100ng/ml; (ii)
  • TREM fragment is produced by fragmenting an expressed TREM after production of the TREM by the cell, e.g., a TREM produced by the host cell is fragmented after release or purification from the host cell, e.g., the TREM is fragmented ex vivo.
  • a gene e.g., a gene encoding an enzyme from Table 2
  • nuclease activity e.g., endonuclease activity or ribonuclease activity
  • E163. The method of any one of embodiments E153-E162, wherein the host cell is a mammalian cell capable of a post-transcriptional modification, of the TREM, e.g., a post-transcriptional modification selected from Table 2.
  • E164. The method of any one of embodiments E153-E163, wherein the host cell comprises a HeLa cell, a HEK293 cell, a HT-1080 cell, a PER.C6 cell, a HKB-11 cell, a CAP cell or a HuH- 7 cell.
  • E165. The method of any one of embodiments E153-E164, wherein the host cell has increased expression of an oncogene, e.g., Ras, c-myc or c-jun.
  • an oncogene e.g., Ras, c-myc or c-jun.
  • FIGS.3A-3B show an exemplary method of TREM purification.
  • FIG.3A depicts the tRNA isolation method used for tRNA enrichment and isolation from cells. A phenol-chloroform (P/C) extraction is first used to remove cellular materials. The RNA fraction is flowed through a column, such as an miRNeasy column, to enrich for RNAs over 200 nucleotides and by a LiCl precipitation that serves to remove large RNAs.
  • P/C phenol-chloroform
  • FIG.5 is a set of images depicting that two Cy3-labeled TREMs (Cy3-iMet-1 and Cy3- iMet-2) can be delivered via liposome transfection to cells, namely to U2OS, HeLa, and H2199 cell lines.
  • FIGS.6A-6C are graphs showing an increase in cell growth in three cells lines after transfection with a TREM corresponding to the initiator methionine (iMet), as described in Example 9.
  • FIG.6A is a graph showing increased % cellular confluency (a measure of cell growth) of U20S cells transfected with Cy3-labeled iMet-CAT-TREM or transfected with a Cy3- labeled non-targeted control.
  • FIG.6B is a graph showing increased % cellular confluency (a measure of cell growth) of H1299 cells transfected with Cy3-labeled iMet-CAT-TREM or transfected with a Cy3-labeled non-targeted control.
  • FIG.6C is a graph showing increased % cellular confluency (a measure of cell growth) of Hela cells transfected with Cy3-labeled iMet- CAT-TREM or transfected with a Cy3-labeled non-targeted control.
  • con-rarity can be identified or evaluated by ⁇ (i) direct determination of whether a con-rare codon or candidate con-rare codon is limiting for a production parameter, e.g., in an assay analogous to that of Example 3; (ii) whether a con-rare or candidate con-rare codon meets a predetermined value, e.g., a standard or reference value (e.g., as described herein), of one or more, or all of factors (1)-(7); or (i) and (ii).
  • con-rarity can be identified or evaluated by a production parameter, e.g., an expression parameter or a signaling parameter, e.g., as described herein.
  • the con-modified nucleic acid sequence has one more or one less, e.g., two more or two lesser, con-rare codons, than a reference nucleic acid sequence.
  • the con-modified nucleic acid sequence has a codon with con-rarity that differs from the con-rarity of the corresponding codon in a reference nucleic acid sequence.
  • the reference nucleic acid sequence can be, e.g., any selected sequence, a parental sequence, a starting sequence, a wildtype or naturally occurring sequence that encodes the same amino acid at the corresponding codon, a wildtype or naturally occurring sequence that encodes the same polypeptide, or a conventionally codon-optimized sequence.
  • Directly acquiring refers to performing a process (e.g., performing an analytical method) to obtain the value.
  • Indirectly acquiring refers to receiving the value from another party or source (e.g., a third party laboratory that directly acquired the or value).
  • a “cognate adaptor function TREM,” as that term is used herein, refers to a TREM which mediates initiation or elongation with the AA (the cognate AA) associated in nature with the anti-codon of the TREM.
  • a sequence having a derivative of any one of ribonucleotides A, G, C or U is a non- naturally occurring sequence.
  • An “oncogene,” as that term is used herein, refers to a gene that modulates one or more cellular processes including ⁇ cell fate determination, cell survival and genome maintenance.
  • an oncogene provides a selective growth advantage to the cell in which it is present, e.g., deregulated, e.g., genetically deregulated (e.g., mutated or amplified) or epigenetically deregulated.
  • a pharmaceutical composition e.g., a pharmaceutical composition comprising a TREM
  • a pharmaceutical composition is free, substantially free, or has less than a pharmaceutically acceptable amount, of host cell proteins, DNA, e.g., host cell DNA, endotoxins, and bacteria.
  • a pharmaceutical composition e.g., a pharmaceutical composition comprising a TREM
  • cGMP current good manufacturing practice
  • a pharmaceutical composition e.g., a pharmaceutical composition comprising a TREM is sterile, e.g., the composition or preparation supports the growth of fewer than 100 viable microorganisms as tested under aseptic conditions, the composition or preparation meets the standard of USP ⁇ 71>, and/or the composition or preparation meets the standard of USP ⁇ 85>.
  • a “synthetic TREM,” as that term is used herein, refers to a TREM which was synthesized other than in a cell having an endogenous nucleic acid encoding the TREM, e.g., by cell-free solid phase synthesis.
  • a synthetic TREM can have the same, or a different, sequence, set of post-transcriptional modifications, or tertiary structure, as a native tRNA.
  • a “TREM expressed in a heterologous cell,” as that term is used herein, refers to a TREM made under non-native conditions.
  • a TREM i
  • a TREM i
  • a reference e.g., at
  • the THD has at least 75, 80, 85, 85, 90, 95, or 100% identity with a naturally occurring THD, e.g., a THD encoded by a nucleic acid in Table 1.
  • the TREM can comprise a fragment or analog of a THD, e.g., a THD encoded by a nucleic acid in Table 1, which fragment in embodiments has THD activity and in other embodiments does not have THD activity.
  • a TREM comprises a linker, e.g., an RNA linker, e.g., a flexible RNA linker, which provides for covalent linkage between a first and a second structure or domain.
  • an RNA linker comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 ribonucleotides.
  • a TREM can comprise one or a plurality of linkers, e.g., in embodiments a TREM comprising (a), (b), (c), (d) and (e) can have a first linker between a first and second domain, and a second linker between a third domain and another domain.
  • a TREM comprises a TREM domain, e.g., a domain described herein, comprising an RNA sequence encoded by DNA sequence listed in Table 1, or a fragment or functional fragment thereof.
  • a TREM comprises a TREM domain, e.g., a domain described herein, comprising an RNA sequence encoded by DNA sequence at least 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99% identical with a DNA sequence listed in Table 1, or a fragment or functional fragment thereof.
  • a TREM is 76-90 nucleotides in length.
  • a TREM or a fragment or functional fragment thereof is between 10-90 nucleotides, between 10-80 nucleotides, between 10-70 nucleotides, between 10-60 nucleotides, between 10-50 nucleotides, between 10-40 nucleotides, between 10-30 nucleotides, between 10-20 nucleotides, between 20- 90 nucleotides, between 20-80 nucleotides, 20-70 nucleotides, between 20-60 nucleotides, between 20-50 nucleotides, between 20-40 nucleotides, between 30-90 nucleotides, between 30- 80 nucleotides, between 30-70 nucleotides, between 30-60 nucleotides, or between 30-50 nucleotides.
  • a tumor suppressor provides a selective growth advantage to the cell in which it is deregulated, e.g., genetically deregulated (e.g., mutated or deleted) or epigenetically deregulated.
  • exemplary tumor suppressors include p53 or Rb.
  • “Pairs with” or “pairing,” as those terms are used herein, refer to the correspondence of a codon with an anticodon and includes fully complementary codon ⁇ anticodon pairs as well as “wobble” pairing, in which the third position need not be complementary. Fully complementary pairing refers to pairing of all three positions of the codon with the corresponding anticodon according to Watson-Crick base pairing.
  • a con-rare codon is a codon that is limiting for a production parameter, e.g., an expression parameter or a signaling parameter, for a nucleic acid sequence, e.g., a DNA or an RNA, or a protein encoded by a nucleic acid sequence, e.g., a DNA or an RNA.
  • Contextual rareness or con-rarity can be identified or evaluated by determining if the addition of a tRNA corresponding to a con-rare codon modulates, typically increases, a production parameter for a target nucleic acid sequence, e.g., target, e.g., gene.
  • a codon is determined to be contextually rare (con-rare) if the con- rarity meets a reference value, e.g., a pre-determined or pre-selected reference value, e.g., a threshold, e.g., an internal threshold, e.g., as described herein.
  • a reference value is a value under which e.g., 1.5X sigma of the normally fit distribution to that codon frequency.
  • Proteome codon count refers to the sum (for all of the proteins of a set of reference proteins in a target cell (or tissue)) of the number of times the codon is used in a protein of the reference set multiplied by the value of that protein’s abundance.
  • Proteome codon count can be expressed as ⁇ (protein abundance x protein codon count)R1-Rn, wherein R is the set of proteins.
  • the range of values for tRNA frequency can divided into subranges, e.g., into quartiles, quintiles, deciles, or percentiles.
  • con-rarity or an element of con- rarity
  • con-rarity can be defined or evaluated as a codon which meets a selected reference for proteome codon count and meets a selected reference for tRNA frequency.
  • a codon is con-rare (or satisfies an element of con-rarity) if it is in fifth decile or above for proteome codon count and in the fifth decile, or lower, for tRNA frequency, or has a value for PCC-tF corresponding to satisfying such selected subranges or sets of subranges.
  • a codon is con-rare (or satisfies an element of con-rarity) if it is in fourth decile or above for proteome codon count and in the fourth decile, or lower, for tRNA frequency, or has a value for PCC-tF corresponding to satisfying such selected subranges or sets of subranges.
  • a bioreactor is maintained under conditions that promote growth of the host cell, e.g., at a temperature (e.g., 37°C) and gas concentration (e.g., 5% CO2) that is permissive for growth of the host cell.
  • a bioreactor unit can perform one or more, or all, of the following ⁇ feeding of nutrients and/or carbon sources, injection of suitable gas (e.g., oxygen), inlet and outlet flow of fermentation or cell culture medium, separation of gas and liquid phases, maintenance of temperature, maintenance of oxygen and CO2 levels, maintenance of pH level, agitation (e.g., stirring), and/or cleaning/sterilizing.
  • a host cell can be modified to optimize the production of a TREM, e.g., to have optimized TREM yield, purity, structure (e.g., folding), or stability.
  • a host cell can be modified (e.g., using a method described herein), to increase or decrease the expression of a desired molecule, e.g., gene, which optimizes production of the TREM, e.g., optimizes yield, purity, structure or stability of the TREM.
  • a host cell can be epigenetically modified, e.g., using a method described herein, to increase or decrease the expression of a desired gene, which optimizes production.
  • Exemplary molecules involved in tRNA or TREM modulation include ⁇ RNA Polymerase III (Pol III) and Pol III accessory molecules (e.g., TFIIIB); Maf1, Trm1, Mck1 or Kns 1; enzymes involved in tRNA or TREM modification, e.g., genes listed in Table 2; or molecules with nuclease activity, e.g., or one or more of Dicer, Angiogenin, RNaseA, RNaseP, RNaseZ, Rny1 or PrrC.
  • RNA Polymerase III e.g., TFIIIB
  • Maf1, Trm1, Mck1 or Kns 1 enzymes involved in tRNA or TREM modification, e.g., genes listed in Table 2
  • enzymes involved in tRNA or TREM modification e.g., genes listed in Table 2
  • molecules with nuclease activity e.g., or one or more of Dicer, Angiogenin, RNaseA, RNaseP, RNaseZ, R
  • Exemplary methods of decreasing the expression of a gene include ⁇ (a) contacting the host cell with a nucleic acid (e.g., DNA, or RNA) encoding an inhibitor of the gene (e.g., a dominant negative variant or a negative regulator of the gene or protein encoded by the gene); (b) contacting the host cell with a peptide that inhibits the target protein; (c) contacting the host cell with a molecule (e.g., a small RNA (e.g., a micro RNA, or a small interfering RNA) or a low molecular weight compound) that modulates, e.g., inhibits the expression of the target gene; or (d) contacting the host cell with a gene editing moiety (e.g., a zinc finger nuclease (ZFN) or a Cas9/CRISPR molecule) that inhibits (e.g., mutates or knocks- out) the expression of the target gene.
  • a nucleic acid e
  • a TREM comprises at least 30 consecutive nucleotides of an RNA sequence encoded by a DNA sequence at least 60%, 65%, 70%, 75%, 80%, 82%, 85%, 87%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to a DNA sequence provided in Table 1, e.g., any one of SEQ ID NOs ⁇ 1-451 disclosed in Table 1.
  • a TREM (e.g., a TREM corresponding to a con-rare codon), e.g., an exogenous TREM comprises (a) and (d).
  • a TREM e.g., a TREM corresponding to a con-rare codon
  • an exogenous TREM comprises (c) and (d).
  • TREM fragments In an embodiment, a TREM (e.g., a TREM corresponding to a con-rare codon) comprises a fragment (sometimes referred to herein as a TREM fragment), e.g., a fragment of a RNA encoded by a deoxyribonucleic acid sequence disclosed in Table 1.
  • a TREM fragment (e.g., a TREM corresponding to a con-rare codon) comprises a sequence of a length of between 10-90 ribonucleotides (rnt), between 10-80 rnt, between 10-70 rnt, between 10-60 rnt, between 10-50 rnt, between 10-40 rnt, between 10-30 rnt, between 10-20 rnt, between 20-90 rnt, between 20-80 rnt, 20-70 rnt, between 20-60 rnt, between 20-50 rnt, between 20-40 rnt, between 30-90 rnt, between 30-80 rnt, between 30-70 rnt, between 30-60 rnt, or between 30-50 rnt.
  • rnt ribonucleotides
  • a TREM disclosed herein (e.g., a TREM corresponding to a con-rare codon), comprises an additional moiety, e.g., a fusion moiety.
  • a TREM disclosed herein (e.g., a TREM corresponding to a con-rare codon), comprises a consensus sequence of Formula I ZZZ, wherein ZZZ indicates any of the twenty amino acids and Formula I corresponds to all species.
  • a TREM disclosed herein (e.g., a TREM corresponding to a con-rare codon), comprises a consensus sequence of Formula II ZZZ, wherein ZZZ indicates any of the twenty amino acids and Formula II corresponds to mammals.
  • a TREM disclosed herein (e.g., a TREM corresponding to a con-rare codon), comprises a consensus sequence of Formula III ZZZ, wherein ZZZ indicates any of the twenty amino acids and Formula III corresponds to humans.
  • a TREM disclosed herein comprises the sequence of Formula III GLU, R 0 - R 1 -R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 6 0-R 6 1-R 6 2-R 6
  • a TREM disclosed herein comprises the sequence of Formula I GLY, R 0 - R 1 -R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 6
  • a TREM disclosed herein comprises the sequence of Formula II HIS, R 0 - R 1 -R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 6 0-R 6 1-R 6 2-R 6
  • a TREM disclosed herein comprises the sequence of Formula II ILE, R 0 - R 1 - R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 6 0-R 6 1-R 6 2-R 6
  • a TREM disclosed herein comprises the sequence of Formula I MET, R 0 - R 1 -R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 5 ⁇ -R 5 ⁇ -R 5 ⁇ -
  • a TREM disclosed herein comprises the sequence of Formula II MET, R 0 - R 1 - R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 6 0-R 6 1-R 6 2-R 6
  • a TREM disclosed herein comprises the sequence of Formula I LYS, R 0 - R 1 -R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 5 ⁇ -R 5 ⁇ -R 5 ⁇
  • a TREM disclosed herein comprises the sequence of Formula II LYS, R 0 - R 1 - R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 6 0-R 6 1-R 6 2-R
  • a TREM disclosed herein comprises the sequence of Formula III LYS, R 0 - R 1 - R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 6 0-R 6 1-R 6 2-R
  • a TREM disclosed herein comprises the sequence of Formula I PHE, R 0 - R 1 -R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇
  • a TREM disclosed herein comprises the sequence of Formula III PHE, R 0 - R 1 -R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 6 0-R 6 1-R 6 2-R 6
  • a TREM disclosed herein comprises the sequence of Formula II PRO, R 0 - R 1 - R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 23 -R 24 -R 25 -R 26 -R 27 -R 28 -R 2 ⁇ -R 30 -R 31 -R 32 -R 33 -R 34 -R 35 -R 36 -R 37 -R 38 -R 3 ⁇ -R 40 -R 41 -R 42 - R 43 - R 44 -R 45 - R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 -R 5
  • a TREM disclosed herein comprises the sequence of Formula II THR, R 0 - R 1 - R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 6 0-R 6 1-R 6 2-R 6
  • a TREM disclosed herein comprises the sequence of Formula I TYR, R 0 - R 1 -R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 5 ⁇ -R 5 ⁇ -R 5 ⁇
  • a TREM disclosed herein comprises the sequence of Formula I VAL, R 0 - R 1 - R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 6 ⁇ -R 6 -R 7 -R 8
  • a TREM disclosed herein comprises the sequence of Formula II VAL, R 0 - R 1 - R 2 - R 3 -R 4 -R 5 -R 6 -R 7 -R 8 -R 9 -R 10 -R 11 -R 12 -R 13 -R 1 4-R 1 5-R 1 6-R 1 7-R 1 8-R 1 ⁇ -R 2 0-R 2 1-R 2 2- R 2 3-R 2 4-R 2 5-R 2 6-R 2 7-R 2 8-R 2 ⁇ -R 3 0-R 3 1-R 3 2-R 3 3-R 3 4-R 3 5-R 3 6-R 3 7-R 3 8-R 3 ⁇ -R 4 0-R 4 1-R 4 2- R 4 3- R 4 4-R 4 5- R 4 6- [R 4 7]x1-R 4 8-R 4 ⁇ -R 5 0-R 5 1-R 5 2-R 5 3-R 5 4-R 5 5-R 5 6-R 5 7-R 5 8-R 5 ⁇ -R 6 0-R 6 1-R 6 2-R 6
  • the TREM is a TREM fragment, e.g., a fragment of a tRNA encoded by a deoxyribonucleic acid sequence disclosed in Table 1.
  • the TREM includes less than the full sequence of a tRNA, e.g., less than the full sequence of a tRNA with the same anticodon, from the same species as the subject being treated, or both.
  • the expressed TREM can be purified from the host cell or host cell culture to produce a TREM composition, e.g., as described herein. Purification of the TREM can be performed by affinity purification, e.g., as described in the MACS Isolation of specific tRNA molecules protocol, or other methods known in the art. In an embodiment, a TREM is purified by a method described in Example 1. In an embodiment, a method of making a TREM, e.g., TREM composition, comprises contacting a TREM with a reagent, e.g., a capture reagent comprising a nucleic acid sequence complimentary with a TREM.
  • a reagent e.g., a capture reagent comprising a nucleic acid sequence complimentary with a TREM.
  • the method comprises, renaturing the TREM, after hybridization and/or release from the capture reagent.
  • a method of making a TREM e.g., TREM composition, comprises contacting a TREM with a reagent, e.g., a separation reagent, e.g., a chromatography reagent.
  • a charged TREM e.g., a TREM charged with a cognate AA or a non- cognate AA
  • can be uncharged e.g., by dissociating the AA, e.g., by incubating the TREM at a high temperature.
  • an exogenous nucleic acid e.g., a DNA or RNA
  • encoding a TREM comprises a nucleic acid sequence at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a plurality of RNA sequences encoded by a DNA sequence disclosed in Table 1, e.g., any one of SEQ ID NOs ⁇ 1-451 as disclosed in Table 1.
  • a TREM composition e.g., a composition comprising a TREM, e.g., a pharmaceutical composition comprising a TREM, comprises a pharmaceutically acceptable excipient.
  • exemplary excipients include those provided in the FDA Inactive Ingredient Database (https ⁇ //www.accessdata.fda.gov/scripts/cder/iig/index.Cfm).
  • a TREM composition e.g., a composition comprising a TREM, e.g., a pharmaceutical composition comprising a TREM, comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or 150 grams of TREM.
  • a TREM composition e.g., a composition comprising a TREM is purified by affinity purification, e.g., as described in the MACS Isolation of specific tRNA molecules protocol, or by a method described in Example 1.
  • a TREM composition e.g., a composition comprising a TREM is purified by liquid chromatography, e.g., reverse-phase ion-pair chromatography (IP-RP), ion-exchange chromatography (IE), affinity chromatography (AC), size-exclusion chromatography (SEC), and combinations thereof. See, e.g., Baronti et al. Analytical and Bioanalytical Chemistry (2016) 410 ⁇ 3239–3252.
  • the TREM (e.g., the TREM composition or an intermediate in the production of the TREM composition) has a purity of at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, i.e., by mass.
  • the TREM (e.g., the TREM composition or an intermediate in the production of the TREM composition) has a host cell protein (HCP) contamination of less than 0.1ng/ml, 1ng/ml, 5ng/ml, 10ng/ml, 15ng/ml, 20ng/ml, 25ng/ml, 30ng/ml, 35ng/ml, 40ng/ml, 50ng/ml, 60ng/ml, 70ng/ml, 80ng/ml, 90ng/ml, 100ng/ml, 200ng/ml, 300ng/ml, 400ng/ml, or 500ng/ml.
  • HCP host cell protein
  • the TREM (e.g., the TREM composition or an intermediate in the production of the TREM composition) has a host cell protein (HCP) contamination of less than 0.1ng, 1ng, 5ng, 10ng, 15ng, 20ng, 25ng, 30ng, 35ng, 40ng, 50ng, 60ng, 70ng, 80ng, 90ng, 100ng, 200ng, 300ng, 400ng, or 500ng per milligram (mg) of the composition.
  • HCP host cell protein
  • the TREM (e.g., the TREM composition or an intermediate in the production of the TREM composition) is sterile, e.g., the composition or preparation supports the growth of fewer than 100 viable microorganisms as tested under aseptic conditions, the composition or preparation meets the standard of USP ⁇ 71>, and/or the composition or preparation meets the standard of USP ⁇ 85>.
  • the TREM e.g., the TREM composition or an intermediate in the production of the TREM composition
  • a viral contaminant e.g., any residual virus, present in the composition is inactivated or removed.
  • In-vivo administration may be via, e.g., by local, systemic and/or parenteral routes, for example intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, ocular, nasal, urogenital, intradermal, dermal, enteral, intravitreal, intracerebral, intrathecal, or epidural.
  • a TREM composition e.g., a composition comprising a TREM, or a pharmaceutical composition comprising a TREM disclosed herein is administered to a subject having a symptom or disorder disclosed herein, e.g., a disorder associated with a con-rare codon.
  • a TREM composition e.g., a composition comprising a TREM or a pharmaceutical composition comprising a TREM disclosed herein is administered to a cell from a subject having a symptom or disorder disclosed herein, e.g., a disorder associated with a con- rare codon.
  • administration of the TREM composition e.g., a composition comprising a TREM, or the pharmaceutical composition comprising a TREM modulates a production parameter of an RNA, or a protein encoded by the RNA, having a con-rare codon.
  • the TREM composition e.g., a composition comprising a TREM or pharmaceutical composition comprising a TREM can be administered to the cell in vivo, in vitro or ex vivo.
  • a TREM composition or a pharmaceutical composition comprising a TREM disclosed herein is administered to a tissue in a subject having a symptom or disorder disclosed herein, e.g., a disorder associated with a con-rare codon.
  • Vectors and Carriers In some embodiments the TREM, or TREM composition, or pharmaceutical composition comprising a TREM described herein, is delivered to cells, e.g. mammalian cells or human cells, using a vector.
  • the vector may be, e.g., a plasmid or a virus.
  • delivery is in vivo, in vitro, ex vivo, or in situ.
  • the virus is an adeno associated virus (AAV), a lentivirus, an adenovirus.
  • AAV adeno associated virus
  • the system or components of the system are delivered to cells with a viral-like particle or a virosome.
  • the delivery uses more than one virus, viral-like particle or virosome.
  • Carriers A TREM, TREM composition, or a pharmaceutical composition comprising a TREM described herein may comprise, may be formulated with, or may be delivered in, a carrier.
  • Viral genomes are known in the art as useful vectors for delivery because the polynucleotides contained within such genomes are typically incorporated into the nuclear genome of a mammalian cell by generalized or specialized transduction. These processes occur as part of the natural viral replication cycle, and do not require added proteins or reagents in order to induce gene integration.
  • viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, human papilloma virus, human foamy virus, and hepatitis virus, for example.
  • retroviruses include ⁇ avian leukosis-sarcoma, avian C-type viruses, mammalian C-type, B-type viruses, D-type viruses, oncoretroviruses, HTLV-BLV group, lentivirus, alpharetrovirus, gammaretrovirus, spumavirus (Coffin, J. M., Retroviridae ⁇ The viruses and their replication, Virology (Third Edition) Lippincott-Raven, Philadelphia, 1996).
  • murine leukemia viruses include murine leukemia viruses, murine sarcoma viruses, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, Gibbon ape leukemia virus, Mason Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus and lentiviruses.
  • vectors are described, for example, in US Patent No.5,801,030, the teachings of which are incorporated herein by reference.
  • the system or components of the system are delivered to cells with a viral-like particle or a virosome.
  • Cell and vesicle-based carriers A TREM, a TREM composition or a pharmaceutical composition comprising a TREM described herein can be administered to a cell in a vesicle or other membrane-based carrier.
  • a TREM, TREM composition or pharmaceutical composition comprising a TREM described herein is administered in or via a cell, vesicle or other membrane- based carrier.
  • the TREM, TREM composition or pharmaceutical composition comprising a TREM can be formulated in liposomes or other similar vesicles.
  • Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to generate liposomes as drug carriers. Methods for preparation of multilamellar vesicle lipids are known in the art (see for example U.S. Pat. No.6,693,086, the teachings of which relating to multilamellar vesicle lipid preparation are incorporated herein by reference).
  • vesicle formation can be spontaneous when a lipid film is mixed with an aqueous solution, it can also be expedited by applying force in the form of shaking by using a homogenizer, sonicator, or an extrusion apparatus (see, e.g., Spuch and Navarro, Journal of Drug Delivery, vol.2011, Article ID 469679, 12 pages, 2011. doi ⁇ 10.1155/2011/469679 for review).
  • Extruded lipids can be prepared by extruding through filters of decreasing size, as described in Templeton et al., Nature Biotech, 15 ⁇ 647-652, 1997, the teachings of which relating to extruded lipid preparation are incorporated herein by reference.
  • Lipid nanoparticles are another example of a carrier that provides a biocompatible and biodegradable delivery system for a TREM, TREM composition or pharmaceutical composition comprising a TREM described herein.
  • Nanostructured lipid carriers are modified solid lipid nanoparticles (SLNs) that retain the characteristics of the SLN, improve drug stability and loading capacity, and prevent drug leakage.
  • Polymer nanoparticles are an important component of drug delivery. These nanoparticles can effectively direct drug delivery to specific targets and improve drug stability and controlled drug release.
  • Lipid–polymer nanoparticles (PLNs) a new type of carrier that combines liposomes and polymers, may also be employed.
  • Example 1a Quantitative tRNA Profiling by Oxford Nanopore sequencing This Example describes the quantification of tRNA levels in a cell line or tissue type which is useful for identifying con-rare codons and candidate con-rare codons.
  • Transfer RNA levels are determined using Oxford Nanopore direct RNA sequencing, as previously described in Sadaoka et al., Nature Communications (2019) 10, 754. Briefly, cells transfected with a tRNA molecule are lysed and total RNA is purified using a method such as phenol chloroform. RNAs smaller than 200 nucleotides are separated from the lysate using a small RNA isolation kit per manufacturer’s instructions, to generate a small RNA (sRNA) fraction.
  • sRNA small RNA
  • a reverse transcription reaction is performed to generate cDNA using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) or a thermostable group II intron RT (TGIRT, InGex LLC) that is less sensitive to RNA structure and modifications.
  • a sequencing adapter is ligated onto the cDNA mixture by incubating the cDNA mixture with RNA adapter, T4 ligase and ligation buffer following the standard protocol for Oxford Nanopore resulting in a cDNA library. Nanopore sequencing is then performed on the libraries and the sequences are mapped to a genomic database, in this example to the genomic tRNA database, GtRNAdb.
  • Example 1b Quantitative tRNA Profiling by next generation sequencing This Example describes the quantification of tRNA levels in a cell line or tissue type. Transfer RNA levels are determined using next generation sequencing, as previously described in Pinkard et al., Nature Communications (2020) 11, 4104. Briefly, cells transfected with a tRNA molecule are lysed and total RNA is purified using a method such as phenol chloroform. RNAs smaller than 200 nucleotides are separated from the lysate using a small RNA isolation kit per manufacturer’s instructions, to generate a small RNA (sRNA) fraction.
  • sRNA small RNA
  • Cell cultured in media containing isotope-labeled amino acids incorporate the isotope-labeled amino acids into all of the proteins translated after incubation with said isotope-labeled amino acids.
  • all peptides containing a single arginine will be 6 Da heavier in cells cultured in the presence of instead of isotope-labeled amino acid compared to cells cultured with natural amino acids.
  • Cultured are lysed and sonicated.
  • Cell lysates (e.g., about100 g) are diluted in 8 M urea in 0.1 M Tris-HCl followed by protein digestion with trypsin according to the FASP protocol (Wisniewski, J. R., et al.
  • Con-rarity is a function of normalized proteome codon count and the tRNA expression level. In an embodiment, the con-rarity is determined by dividing the normalized proteome codon count by the tRNA expression level determined by Nanopore or other tRNA sequencing experiment. This provides a measure of codon usage that is contextually dependent on the tRNA profile, e.g., tRNA abundance levels.
  • Example 4 Identification of a nucleic acid sequence having con-rare codons (A) This Example describes the identification of a nucleic acid sequence having con-rare codons or candidates for con-rare codons. Con-rare codons are identified as described in Example 3. Codon count per nucleic acid sequence Using the coding DNA sequences (CDS) defined using National Center for Biotechnology Information (NCBI https ⁇ //www.ncbi.nlm.nih.gov/) or other database, all human gene sequences are segmented into codons and summed per codon to give a codon count per nucleic acid sequence, e.g., gene.
  • CDS coding DNA sequences
  • NCBI https ⁇ //www.ncbi.nlm.nih.gov/ National Center for Biotechnology Information
  • Con-rare count per nucleic acid sequence Each codon, per nucleic acid sequence, is classified as a con-rare codon or a con- abundant codon. The counts for all con-rare codons, for each nucleic acid sequence, are summed and normalized to the sequence length. Determining a nucleic acid sequence having con-rare codons The con-rare codon count is fit to a normalized distribution. A nucleic acid sequence that meets a reference value, e.g., a pre-determined reference value, is classified as a nucleic acid sequence having con-rare codons.
  • a reference value e.g., a pre-determined reference value
  • Codon count per nucleic acid sequence Using the coding DNA sequences (CDS) defined using National Center for Biotechnology Information (NCBI https ⁇ //www.ncbi.nlm.nih.gov/) or other database, all human gene sequences are segmented into codons and summed per codon to give a codon count per nucleic acid sequence, e.g., gene. Determining a nucleic acid sequence having con-rare codons Each codon, per nucleic acid sequence, is classified as a con-rare codon or a con- abundant codon. For each con-rare codon, the counts per nucleic acid sequence is fit to a normalized distribution.
  • the admixture is then incubated with binding buffer previously heated to 45°C and streptavidin-conjugated RNase-free magnetic beads for 3 hours to allow binding of the DNA-tRNA complexes to the beads.
  • the mixture is then added to a pre- equilibrated column in a magnetic field separator rack and washed 4 times.
  • the TREM retained on the beads are eluted three times by adding elution buffer pre-heated to 80°C and then admixed with a pharmaceutically acceptable excipient to make a test TREM product.
  • TREM preparation and a control agent are contacted by transfection, electroporation or liposomal delivery, with a cultured cell line, such as HeLa, HEP- 3B or HEK293T, a tissue or a subject, for a time sufficient for the TREM preparation to modulate a translation level or activity of the cell, relative to the control agent.
  • a cultured cell line such as HeLa, HEP- 3B or HEK293T
  • tissue or a subject for a time sufficient for the TREM preparation to modulate a translation level or activity of the cell, relative to the control agent.
  • Example 11 Manufacture of TREMs in modified mammalian production host cell expressing an oncogene This example describes the manufacturing of a TREM in mammalian host cells modified to overexpress myc.
  • HeLa cells ATCC® CCL-2TM
  • HEP-3B cells ATCC® HB-8064TM
  • a plasmid containing the gene sequence coding for the c-myc oncogene protein e.g., pcDNA3-cmyc (Addgene plasmid # 16011)
  • the resulting cell line is referred to herein as HeLamyc+ host cells or HEP-3Bmyc+ host cells.
  • TREM expressing lentivirus HEK293T cells are co-transfected with 3 ⁇ g of each packaging vector (pRSV-Rev, pCMV-VSVG-G and pCgpV) and 9 ⁇ g of the plasmid comprising a TREM as described in Example 9, using Lipofectamine 2000 according to manufacturer’s instructions. After 24 hours, the media is replaced with fresh antibiotic-free media and after 48 hours, virus-containing supernatant is collected and centrifuged for 10 min at 2000 rpm before being filtered through a 0.45 ⁇ m filter.
  • each packaging vector pRSV-Rev, pCMV-VSVG-G and pCgpV
  • Transduction of host cells with TREM expressing lentivirus 2 mL of virus prepared as described above is used to transduce 100,000 HeLamyc+ host cells or HEP-3Bmyc+ host cells, in the presence of 8 ⁇ g/mL polybrene. Forty-eight hours after transduction, puromycin (at 2 ⁇ g/mL) antibiotic selection is performed for 2–7 days alongside a population of untransduced control cells.
  • the TREMs are isolated, purified, and formulated as described in Example 9 or 10 to result in a composition comprising a TREM or preparation comprising a TREM.
  • Example 13 Manufacture of TREM in modified mammalian production host cell overexpressing an oncogene and a tRNA modifying enzyme
  • This Example describes the manufacturing of a TREM in mammalian host cells modified to overexpress Myc and Trm1. Plasmid generation In this example, a plasmid comprising a TREM is generated as described in Example 9 or 10. Host cell modification, transduction and purification A human cell line, such as HEK293T, stably overexpressing Myc oncogene is generated by transduction of retrovirus expressing the myc oncogene from the pBABEpuro-c-myc T58A plasmid into HEK293T cells.
  • HEK293T cells are transfected using the calcium phosphate method with the human c-myc retroviral vector, pBABEpuro-c-myc T58A and the packaging vector, ⁇ 2 vector. After 6 hours, transfection media is removed and replaced with fresh media. After a 24-hour incubation, media is collected and filtered through a 0.45um filter.
  • retroviral infection HEK293T cells are infected with retrovirus and polybrene (8ug/ml) using spin infection at 18oC for 1 hour at 2500 rpm. After 24 hours, the cell culture medium is replaced with fresh medium and 24 hours later, the cells are selected with 2 ⁇ g/mL puromycin.
  • the test TREM in this example tRNA-Ile-GAT, is produced such that it contains the sequence of the tRNA-Ile- GAT body but with the anticodon sequence corresponding to CUA instead of GAT.
  • HeLa cells are co-transfected with 50 ng of TREM and with 200 ng of a DNA plasmid encoding a mutant GFP containing a UAG stop codon at the S29 position as described in Geslain et al.2010. J Mol Biol.396 ⁇ 821–831.
  • HeLa cells transfected with the GFP plasmid alone serve as a negative control. After 24 hours, cells are collected and analyzed for fluorescence recovery by flow cytometry.
  • the fluorescence is read out with an emission peak at 509nm (excitation at 395nm).
  • the methods described in this example can be adopted for use to evaluate the functionality of the TREM, or if the TREM can rescue the stop mutation in the GFP molecule and can produce the full-length fluorescent protein.
  • In vitro translational assay This assay describes a test TREM having translational adaptor molecule function by successfully being incorporated into a nascent polypeptide chain in an in vitro translation reaction.
  • the sRNA fraction is incubated with annealing buffer and the biotinylated capture probe corresponding to a DNA probe that is complementary to a unique region of the TREM being purified, in this example, a probe with the sequence 3′ biotin- CCAATGGATTTCTATCCATCGCCTTAACCACTCGGCCACGACTACAAAA is used to purify the TREM comprising tRNA-Ser-AGA.
  • the mixture is incubated at 90°C for 2-3 minutes and quickly cooled down to 45°C and incubated overnight at 45°C.
  • Plasmid generation To generate a plasmid to produce a TREM in bacteria, a tRNA gene, in this example, a DNA fragment containing at least one copy of the tRNA-Lys-UUU gene with the sequence GCCCGGATAGCTCAGTCGGTAGAGCATCAGACTTTTAATCTGAGGGTCCAGGGTTCA AGTCCCTGTTCGGGCG is synthesized and cloned into a bacterial tRNA expression vector as previously described in Ponchon et al., Nat Protoc 4, 947-959 (2009).
  • RNAs e.g., tRNAs
  • the mixture is incubated at 90°C for 2-3 minutes and quickly cooled down to 45°C and incubated overnight at 45°C.
  • the admixture is then incubated with binding buffer previously heated to 45°C and streptavidin-conjugated RNase-free magnetic beads for 3 hours to allow binding of the DNA-tRNA complexes to the beads.
  • the mixture is then added to a pre-equilibrated column in a magnetic field separator rack and washed 4 times.
  • the TREM retained on the beads are eluted three times by adding elution buffer pre-heated to 80°C and then admixed with a pharmaceutically acceptable excipient to make a test TREM product.
  • RNA phorphoroamedites are sequentially added in a desired order to a growing chain immobilized on a solid support (e.g. controlled pore glass).
  • Each cycle of addition has multiple steps, including ⁇ (i) deblocking the DMT group protecting the 5′-hydroxyl of the growing chain, (ii) coupling the growing chain to an incoming phosphoramidite building block, (iii) capping any chain molecules still featuring a 5′-hydroxyl, i.e. those that failed to couple with the desired incoming building block, and (iv) oxidation of the newly formed tricoordinated phosphite triester linkage.
  • the chain is cleaved from the solid support and all protecting groups except for the DMT group protecting the 5′-hydroxyl are removed.
  • the chain is then purified by RP-HPLC (e.g., DMT-on purification) and the fraction containing the chain is subjected to deprotection of the DMT group under acidic conditions, affording the final TREM.
  • the TREM will feature a 5′-phosphate and a 3′-OH.
  • the TREM is then admixed with a pharmaceutically acceptable excipient to make a test TREM product.
  • the TREM produced by the chemical synthesis reaction is then aminoacylated in vitro using aminoacyl tRNA synthetase, as previously described in Stanley, Methods Enzymol 29 ⁇ 530–547 (1974). Briefly, the TREM is incubated for 30 min at 37 °C with its synthetase and its cognate amino, in this example, with threonyl-tRNA synthetase and threonine, respectively, and then phenol extracted, filtered using a Nuc-trap column, and ethanol precipitated. The TREM is then admixed with a pharmaceutically acceptable excipient to make a test TREM product.
  • a DNA plasmid containing a bacteriophage T7 promoter followed by the tRNA-Leu-CAA gene sequence is linearized and transcribed in vitro with T7 RNA polymerase at 37 °C for 45 min and then phenol extracted, filtered using a Nuc-trap column, and ethanol precipitated.
  • the TREM is then admixed with a pharmaceutically acceptable excipient to make a test TREM product.
  • the TREM is heated and cooled to refold the TREM.
  • the TREM produced by the IVT reaction is then aminoacylated in vitro using aminoacyl tRNA synthetase, as previously described in Stanley, Methods Enzymol 29 ⁇ 530–547 (1974). Briefly, the TREM is incubated for 30 min at 37 °C with its synthetase and its cognate amino, in this example, with leucyl-tRNA synthetase and leucine, respectively, and then phenol extracted, filtered using a Nuc-trap column, and ethanol precipitated. The TREM is then admixed with a pharmaceutically acceptable excipient to make a test TREM product.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Cosmetics (AREA)
  • Detergent Compositions (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2020/058948 2019-11-04 2020-11-04 Trem compositions for con-rare codons and related uses Ceased WO2021092064A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
AU2020379762A AU2020379762A1 (en) 2019-11-04 2020-11-04 TREM compositions for con-rare codons and related uses
EP20817113.2A EP4055163A1 (en) 2019-11-04 2020-11-04 Trem compositions for con-rare codons and related uses
CN202080077056.0A CN115003810A (zh) 2019-11-04 2020-11-04 用于con-稀有密码子的trem组合物及相关用途
US17/774,410 US20220364092A1 (en) 2019-11-04 2020-11-04 Trem compositions for con-rare codons and related uses
KR1020227018837A KR20220128611A (ko) 2019-11-04 2020-11-04 맥락적 희귀 코돈용 trem 조성물 및 관련 용도
MX2022005362A MX2022005362A (es) 2019-11-04 2020-11-04 Composiciones de trem para codones con-raros y usos relacionados.
CA3160097A CA3160097A1 (en) 2019-11-04 2020-11-04 Trem compositions for con-rare codons and related uses
JP2022525706A JP2023500116A (ja) 2019-11-04 2020-11-04 con-希少コドンのためのTREM組成物及び関連する使用

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962930361P 2019-11-04 2019-11-04
US62/930,361 2019-11-04

Publications (1)

Publication Number Publication Date
WO2021092064A1 true WO2021092064A1 (en) 2021-05-14

Family

ID=73654885

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/058948 Ceased WO2021092064A1 (en) 2019-11-04 2020-11-04 Trem compositions for con-rare codons and related uses

Country Status (9)

Country Link
US (1) US20220364092A1 (https=)
EP (1) EP4055163A1 (https=)
JP (1) JP2023500116A (https=)
KR (1) KR20220128611A (https=)
CN (1) CN115003810A (https=)
AU (1) AU2020379762A1 (https=)
CA (1) CA3160097A1 (https=)
MX (1) MX2022005362A (https=)
WO (1) WO2021092064A1 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021243290A1 (en) * 2020-05-29 2021-12-02 Flagship Pioneering Innovations Vi, Llc Trem compositions and methods relating thereto
WO2021243301A3 (en) * 2020-05-29 2021-12-30 Flagship Pioneering Innovations Vi, Llc. Trem compositions and methods relating thereto
US11661600B2 (en) 2017-11-02 2023-05-30 University Of Iowa Research Foundation Methods of rescuing stop codons via genetic reassignment with ACE-tRNA

Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5801030A (en) 1995-09-01 1998-09-01 Genvec, Inc. Methods and vectors for site-specific recombination
US6693086B1 (en) 1998-06-25 2004-02-17 National Jewish Medical And Research Center Systemic immune activation method using nucleic acid-lipid complexes
WO2007083094A1 (en) * 2006-01-18 2007-07-26 University Court Of The University Of Dundee Prevention/treatment of ichthyosis vulgaris, atopy and other disorders
WO2012006551A2 (en) * 2010-07-08 2012-01-12 The Brigham And Women's Hospital, Inc. Neuroprotective molecules and methods of treating neurological disorders and inducing stress granules
WO2015073587A2 (en) 2013-11-18 2015-05-21 Rubius Therapeutics, Inc. Synthetic membrane-receiver complexes
WO2015153102A1 (en) 2014-04-01 2015-10-08 Rubius Therapeutics, Inc. Methods and compositions for immunomodulation
WO2016183482A1 (en) 2015-05-13 2016-11-17 Rubius Therapeutics, Inc. Membrane-receiver complex therapeutics
WO2017123646A1 (en) 2016-01-11 2017-07-20 Rubius Therapeutics, Inc. Compositions and methods related to multimodal therapeutic cell systems for cancer indications
WO2018009838A1 (en) 2016-07-07 2018-01-11 Rubius Therapeutics, Inc. Compositions and methods related to therapeutic cell systems expressing exogenous rna
WO2018102740A1 (en) 2016-12-02 2018-06-07 Rubius Therapeutics, Inc. Compositions and methods related to cell systems for penetrating solid tumors
WO2018151829A1 (en) 2017-02-17 2018-08-23 Rubius Therapeutics, Inc. Functionalized erythroid cells
WO2018208728A1 (en) 2017-05-08 2018-11-15 Flagship Pioneering, Inc. Compositions for facilitating membrane fusion and uses thereof
WO2020069199A1 (en) * 2018-09-26 2020-04-02 Case Western Reserve University Methods and compositions for increasing protein expression and/or treating a haploinsufficiency disorder
WO2020150608A1 (en) * 2019-01-18 2020-07-23 Flagship Pioneering, Inc. Trem compositions and uses thereof
WO2020243560A1 (en) * 2019-05-31 2020-12-03 Flagship Pioneering, Inc. Uses of trem compositions to modulate trna pools

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006105038A2 (en) * 2005-03-25 2006-10-05 The Uab Research Foundation Methods of altering gene expression and methods of treatment utilizing same
US20120077224A1 (en) * 2009-06-05 2012-03-29 The Salk Institute For Biological Studies unnatural amino acid incorporation in eukaryotic cells
AU2013327059B2 (en) * 2012-10-02 2018-11-08 Vaxiion Therapeutics, Llc Immunomodulatory minicells and methods of use

Patent Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5801030A (en) 1995-09-01 1998-09-01 Genvec, Inc. Methods and vectors for site-specific recombination
US6693086B1 (en) 1998-06-25 2004-02-17 National Jewish Medical And Research Center Systemic immune activation method using nucleic acid-lipid complexes
WO2007083094A1 (en) * 2006-01-18 2007-07-26 University Court Of The University Of Dundee Prevention/treatment of ichthyosis vulgaris, atopy and other disorders
WO2012006551A2 (en) * 2010-07-08 2012-01-12 The Brigham And Women's Hospital, Inc. Neuroprotective molecules and methods of treating neurological disorders and inducing stress granules
WO2015073587A2 (en) 2013-11-18 2015-05-21 Rubius Therapeutics, Inc. Synthetic membrane-receiver complexes
US9644180B2 (en) 2013-11-18 2017-05-09 Rubius Therapeutics, Inc. Synthetic membrane-receiver complexes
WO2015153102A1 (en) 2014-04-01 2015-10-08 Rubius Therapeutics, Inc. Methods and compositions for immunomodulation
WO2016183482A1 (en) 2015-05-13 2016-11-17 Rubius Therapeutics, Inc. Membrane-receiver complex therapeutics
WO2017123646A1 (en) 2016-01-11 2017-07-20 Rubius Therapeutics, Inc. Compositions and methods related to multimodal therapeutic cell systems for cancer indications
WO2017123644A1 (en) 2016-01-11 2017-07-20 Rubius Therapeutics, Inc. Compositions and methods related to multimodal therapeutic cell systems for immune indications
WO2018009838A1 (en) 2016-07-07 2018-01-11 Rubius Therapeutics, Inc. Compositions and methods related to therapeutic cell systems expressing exogenous rna
WO2018102740A1 (en) 2016-12-02 2018-06-07 Rubius Therapeutics, Inc. Compositions and methods related to cell systems for penetrating solid tumors
WO2018151829A1 (en) 2017-02-17 2018-08-23 Rubius Therapeutics, Inc. Functionalized erythroid cells
WO2018208728A1 (en) 2017-05-08 2018-11-15 Flagship Pioneering, Inc. Compositions for facilitating membrane fusion and uses thereof
WO2020069199A1 (en) * 2018-09-26 2020-04-02 Case Western Reserve University Methods and compositions for increasing protein expression and/or treating a haploinsufficiency disorder
WO2020150608A1 (en) * 2019-01-18 2020-07-23 Flagship Pioneering, Inc. Trem compositions and uses thereof
WO2020243560A1 (en) * 2019-05-31 2020-12-03 Flagship Pioneering, Inc. Uses of trem compositions to modulate trna pools

Non-Patent Citations (28)

* Cited by examiner, † Cited by third party
Title
"Pharmaceutical Biotechnology: Fundamentals and Applications", 2013, SPRINGER
BALI VEDRANA ET AL: "Decoding mechanisms by which silent codon changes influence protein biogenesis and function", INTERNATIONAL JOURNAL OF BIOCHEMISTRY AND CELL BIOLOGY, PERGAMON, GB, vol. 64, 26 March 2015 (2015-03-26), pages 58 - 74, XP029228367, ISSN: 1357-2725, DOI: 10.1016/J.BIOCEL.2015.03.011 *
BARONTI ET AL., ANALYTICAL AND BIOANALYTICAL CHEMISTRY, vol. 410, 2018, pages 3239 - 3252
BORDEIRA-CARRIÇO RENATA ET AL: "Cancer syndromes and therapy by stop-codon readthrough", TRENDS IN MOLECULAR MEDICINE FEB 2010,, vol. 18, no. 11, 1 November 2012 (2012-11-01), pages 667 - 678, XP002794329, ISSN: 1471-499X *
CAYAMA ET AL., NUCLEIC ACIDS RESEARCH, vol. 28, no. 12, 2000, pages e64
COFFIN, J. M.: "Virology", 1996, LIPPINCOTT-RAVEN, article "Retroviridae: The viruses and their replication"
CUI ET AL., NUCLEIC ACIDS RES., vol. 46, no. 12, 2018, pages 6387 - 6400
GEIGER ET AL., MOLECULAR AND CELLULAR PROTEOMICS, vol. 10, 2012, pages 754
GESLAIN ET AL., JMOL BIOL., vol. 396, 2010, pages 821 - 831
HA ET AL., ACTA PHARMACEUTICA SINICA B, vol. 6, July 2016 (2016-07-01), pages 287 - 296, Retrieved from the Internet <URL:https://doi.org/10.1016/j.apsb.2016.02.001>
HUANG ET AL., NATURE COMMUNICATIONS, vol. 8, 2017, pages 423
LI ET AL., NANOMATERIALS, vol. 7, 2017, pages 122
MORRILL SUMMER A. ET AL: "Why haploinsufficiency persists", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, 29 May 2019 (2019-05-29), US, XP055778088, ISSN: 0027-8424, Retrieved from the Internet <URL:https://www.pnas.org/content/pnas/116/24/11866.full.pdf> DOI: 10.1073/pnas.1900437116 *
P. P. CHAN ET AL: "GtRNAdb: a database of transfer RNA genes detected in genomic sequence", NUCLEIC ACIDS RESEARCH, vol. 37, no. Database, 1 January 2009 (2009-01-01), GB, pages D93 - D97, XP055406955, ISSN: 0305-1048, DOI: 10.1093/nar/gkn787 *
PARMLEY JOANNA L. ET AL: "Clustering of Codons with Rare Cognate tRNAs in Human Genes Suggests an Extra Level of Expression Regulation", PLOS GENETICS, vol. 5, no. 7, 1 January 2009 (2009-01-01), pages e1000548, XP055778002, ISSN: 1553-7390, DOI: 10.1371/journal.pgen.1000548 *
PESTOVA ET AL., RNA, vol. 7, no. 10, 2001, pages 1496 - 505
PINKARD ET AL., NATURE COMMUNICATIONS, vol. 11, 2020, pages 4104
PONCHON ET AL., NAT PROTOC, vol. 4, 2009, pages 947 - 959
RAPPSILBER ET AL., NATURE PROTOCOLS, 2007
SADAOKA ET AL., NATURE COMMUNICATIONS, vol. 10, 2019, pages 754
SHI ET AL., PROC NATL ACAD SCI USA., vol. 111, no. 28, 2014, pages 10131 - 10136
SPUCHNAVARRO, JOURNAL OF DRUG DELIVERY, vol. 2011, 2011, pages 12
STANLEY, METHODS ENZYMOL, vol. 29, 1974, pages 530 - 547
TEMPLETON ET AL., NATURE BIOTECH, vol. 15, 1997, pages 647 - 652
TYANOVA S ET AL., NAT. PROTOCOLS, vol. 11, no. 12, 2016, pages 2301 - 19
WISNIEWSKI, J. R. ET AL.: "Combination of FASP and StageTip-based fractionation allows in-depth analysis of the hippocampal membrane proteome", J. PROTEOME RES., vol. 8, 2009, pages 5674 - 5678
WISNIEWSKI, J. R. ET AL.: "Universal sample preparation method for proteome analysis", NAT. METHODS, vol. 6, 2009, pages 359 - 362, XP055527538, DOI: 10.1038/nmeth.1322
ZAHN: "Overexpression of an mRNA dependent on rare codons inhibits protein synthesis and cell growth.", JOURNAL OF BACTERIOLOGY, vol. 178, no. 10, 1 May 1996 (1996-05-01), pages 2926 - 2933, XP055059438, ISSN: 0021-9193, DOI: 10.1128/jb.178.10.2926-2933.1996 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11661600B2 (en) 2017-11-02 2023-05-30 University Of Iowa Research Foundation Methods of rescuing stop codons via genetic reassignment with ACE-tRNA
US12559749B2 (en) 2017-11-02 2026-02-24 University Of Iowa Research Foundation Methods of rescuing stop codons via genetic reassignment with ACE-tRNA
US12565649B2 (en) 2017-11-02 2026-03-03 University Of Iowa Research Foundation Methods of rescuing stop codons via genetic reassignment with ACE-tRNA
WO2021243290A1 (en) * 2020-05-29 2021-12-02 Flagship Pioneering Innovations Vi, Llc Trem compositions and methods relating thereto
WO2021243301A3 (en) * 2020-05-29 2021-12-30 Flagship Pioneering Innovations Vi, Llc. Trem compositions and methods relating thereto

Also Published As

Publication number Publication date
CN115003810A (zh) 2022-09-02
JP2023500116A (ja) 2023-01-04
KR20220128611A (ko) 2022-09-21
AU2020379762A1 (en) 2022-05-26
MX2022005362A (es) 2022-09-23
US20220364092A1 (en) 2022-11-17
CA3160097A1 (en) 2021-05-14
EP4055163A1 (en) 2022-09-14

Similar Documents

Publication Publication Date Title
EP3976782A1 (en) Uses of trem compositions to modulate trna pools
US20220112489A1 (en) Trem compositions and uses thereof
BR112021007025A2 (pt) composições e métodos para imunoterapia
CN111405912A (zh) 用于基因组编辑的多核苷酸、组合物及方法
WO2021092064A1 (en) Trem compositions for con-rare codons and related uses
CN120283052A (zh) 用于表观遗传调控hbv基因表达的组合物和方法
US20230374456A1 (en) T-Cell Immunoglobulin and Mucin Domain 3 (TIM3) Compositions and Methods for Immunotherapy
WO2022012531A1 (zh) 一种经修饰的免疫细胞的制备方法
JP2024505678A (ja) 免疫療法のためのリンパ球活性化遺伝子3(lag3)組成物及び方法
WO2022170172A1 (en) Natural killer cell receptor 2b4 compositions and methods for immunotherapy
JP2023534304A (ja) Line1の阻害剤及びその使用
US20220364075A1 (en) Methods of modifying a nucleic acid sequence
HK40114401A (zh) 用於基因组编辑的多核苷酸、组合物和方法
CN118660960A (zh) 用于基因组编辑的多核苷酸、组合物和方法
EP4392060A1 (en) Programmed cell death protein 1 (pd1) compositions and methods for cell-based therapy
HK40058210A (en) Compositions and methods for immunotherapy
von Niessen Optimization of RNA cancer vaccines using 3’UTR sequences selected for stabilization of RNA Dissertation zur Erlangung des Grades Doktor der Naturwissenschaften

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20817113

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022525706

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3160097

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020379762

Country of ref document: AU

Date of ref document: 20201104

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020817113

Country of ref document: EP

Effective date: 20220607