WO2021076941A1 - Gene therapy for alzheimer's disease - Google Patents

Gene therapy for alzheimer's disease Download PDF

Info

Publication number
WO2021076941A1
WO2021076941A1 PCT/US2020/056051 US2020056051W WO2021076941A1 WO 2021076941 A1 WO2021076941 A1 WO 2021076941A1 US 2020056051 W US2020056051 W US 2020056051W WO 2021076941 A1 WO2021076941 A1 WO 2021076941A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
composition
sequence
sequences
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/056051
Other languages
English (en)
French (fr)
Other versions
WO2021076941A9 (en
Inventor
Ronald G. Crystal
Katie STILES
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cornell University
Original Assignee
Cornell University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AU2020367437A priority Critical patent/AU2020367437B2/en
Priority to CN202080073402.8A priority patent/CN114761569A/zh
Priority to US17/769,255 priority patent/US20230405148A1/en
Priority to BR112022007010A priority patent/BR112022007010A2/pt
Priority to KR1020227016247A priority patent/KR20220082050A/ko
Priority to MX2022004524A priority patent/MX2022004524A/es
Priority to JP2022522814A priority patent/JP2023500793A/ja
Priority to CA3157864A priority patent/CA3157864A1/en
Application filed by Cornell University filed Critical Cornell University
Priority to EP20804387.7A priority patent/EP4045653A1/en
Publication of WO2021076941A1 publication Critical patent/WO2021076941A1/en
Publication of WO2021076941A9 publication Critical patent/WO2021076941A9/en
Priority to IL292148A priority patent/IL292148A/en
Anticipated expiration legal-status Critical
Priority to ZA2022/05344A priority patent/ZA202205344B/en
Priority to CONC2022/0006367A priority patent/CO2022006367A2/es
Priority to AU2025200812A priority patent/AU2025200812A1/en
Priority to JP2025233417A priority patent/JP2026041903A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/775Apolipopeptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • A01K2217/052Animals comprising random inserted nucleic acids (transgenic) inducing gain of function
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0306Animal model for genetic diseases
    • A01K2267/0312Animal model for Alzheimer's disease
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • C12N2310/531Stem-loop; Hairpin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • Apolipoprotein E is an important central nervous system (CNS) apolipoprotein intimately involved in the pathogenesis of the most common late- onset familial and sporadic forms of Alzheimer’s disease (AD; Yu et ai., 2014).
  • CNS central nervous system
  • AD Alzheimer’s disease
  • 3 common APOE alleles e4, e3, and e2 that encode the 3 APOE isoforms expressed primarily in the liver and brain.
  • APOE4 carriers have a markedly increased risk of developing AD (3-15 fold for heterozygotes and homozygotes, respectively, compared with APOE3 homozygotes) and an earlier age-of-onset for developing the disease (approximately 5 years for each e4 allele; Corder et al.,1993; Farrer et ah, 1997; Lambert et al., 2013; Saunders et at., 1993; Strittmatter et a!., 1993).
  • the fact that 45% of AD patients carry at least 1 e4 allele makes APOE4 by far the most common genetic risk factor for late-onset AD, the most common form of AD.
  • APOE2 is a protective allele reducing AD risk by approximately 50% and markedly delaying the age-of-onset (Corder et ah, 1994; Farrer et al., 1997: Suri et al., 2013; Talbot et al., 1994; Yu et al., 2014).
  • APOE3 the most common isoform, and APOE2 and APOE4, are due to differences in amino acids at 1 of 2 positions, residues 112 (APOE4) and 158 (APOE2), which are cysteine-arginine interchanges (Hatters et al., 2006).
  • a gene therapy vector for Alzheimer's disease.
  • a gene therapy vector comprises an AAV expression vector encoding the human APOE2 gene and either in cis or in tram artificial microRNA(s) that target endogenous APGE4.
  • This vector system silences the expression of detrimental endogenous APOE4 in combination with supplementation of the beneficial APOE2 gene from a gene therapy vector, e.g., an AAV vector.
  • exemplary artificial microRNA sequences were designed that target the endogenous APOE4 mRNA for suppression.
  • microRNAs may be incorporated in sequences that are 5' to the APOE2 coding sequence, e.g., in a n intron such as the CAG promoter intron, or sequences that are 3’ to the APOE2 coding sequence, e.g., sequences that are 5’ to the polyA tail of the vector transgene plasmid coding for the human APOE2 coding sequence.
  • the microRNA(s) may be inserted between a PollTI promoter, e.g., a U6 promoter, and a terminator following the polyA site of the APOE2 expression cassette.
  • the vector-derived human APOE2 DNA sequence optionally includes silent nucleotide changes to decrease or inhibit suppression by the microRNAs and in one embodiment may include a tag such as a HA tag for detection, e.g., for pre-clinical detection studies.
  • the expression construct is packaged into an AAV capsid of a serotype that targets astrocytes and glial cells (for example AAV9) the prominent sites of endogenous APOE expression in the CNS, but can be provided in other vectors, e.g., other viral vectors, plasmids, nanoparticle or liposomes.
  • a gene therapy vector comprising a first promoter operably linked to a nucleic acid sequence comprising an open reading frame encoding APQE2 and a 3’ untranslated region, and an isolated nucleotide sequence is provided comprising one or more RNAi nucleic acid sequences for inhibition of APOE4 mRNA.
  • the vector comprises the nucleotide sequence.
  • the nucleotide sequence is inserted 5’ or 3’ to the open reading frame.
  • the nucleotide sequence is inserted 5’ and 3’ to the open reading frame.
  • the nucleotide sequence is on a different vector.
  • the isolated nucleotide sequence comprises a second promoter operably linked to the one or more RNAi nucleic acid sequences.
  • the gene therapy vector is a viral vector.
  • the different vector is a viral vector, in one embodiment, the viral vector is an AAV, adenovirus, ientiviras, herpesvirus or retrovirus vector. In one embodiment, the AAV is AAV5, AAV9 or AAVrhlO.
  • the APOE4 is human APOE4.
  • the APOE2 is human APOE2.
  • the first promoter is a Poll promoter, e.g., a constitutive promoter or a reguiatable promoter, for example, an inducible promoter.
  • the second promoter is a PoHII promoter, in one embodiment, the isolated nucleotide sequence comprises nucleic acid for one or more miRNA comprising two or more of the RNAi nucleic acid sequences, e.g., one or more RNAi sequences are embedded in a miRNA sequence. In one embodiment, the RNAi comprises siRNA including a plurality of siRNA sequences.
  • the RNAi comprises shRNA sequences of about 15 to 25 nucleotides in length.
  • the open reading frame for APOE2 comprises a plurality of silent nucleotide substitutions relative to SEQ ID NO:6, e.g., the open reading frame comprises SEQ ID NO:7 or nucleotide sequence with at least 70%, 75% 80%, 85%, 90%, 95%, 97% or 98% nucleic acid sequence identity to SEQ ID NO:7 and encodes APOE2, or the open reading frame encodes APOE2 and comprises a nucleotide sequence with at least 70%, 75% 80%, 85%, 90%, 95%, 97% or 98% nucleic acid sequence identity to GAAAGAACTCA AAGCTTATA AGAGCGAGCTGGAGG (SEQ ID NO: 13) but which sequence is not SEQ ID NO:7.
  • the plurality of tire silent nucleotide substitutions in the APOE2 open reading frame are not in the RNAi nucleic acid sequence in the isolated nucleotide sequence, that is the sequence with the nucleotide substitutions differs from the RNAi nucleotide sequence so that the rnRNA having the nucleotide substitutions does not hind to, e.g., for a duplex with, the RNAi sequences, e.g., isolated RNAi or RNAi sequences expressed from a vector. In one embodiment, at least 50%, 60%,
  • codons in the open reading frame for APOE2 have a silent nucleotide substitution. In one embodiment, at least 5%, 10%, 20%, 30%, or 40%, of codons in the open reading frame for APOE2 have a silent nucleotide substitution, e.g., in a portion of APOE2 sequences that correspond to the RNAi sequences.
  • the silent nucleotide substitutions in a human APOE2 coding sequence result in a sequence that differs from endogenous human APOE4 sequences and differs from the APOE4 RNAi sequences
  • the APOE4 that is inhibited has a sequence having at least 80%, 85%, 90%, 95% or more amino acid sequence identity to a polypeptide encoded by SEQ ID NO:22.
  • the APOE2 has a sequence having at least 80%, 85%, 90%, 95% or more amino acid sequence identity to a polypeptide encoded by SEQ ID NO:9.
  • the one or more RNAi nucleic acid sequences have at least 60%, 70%, 80%, 90% or more nucleotide sequence identity to one of SEQ ID Nos. 1 -4 or 20-22 or the complement thereof.
  • the vector has a first Poll promoter operably linked to a nucleic acid sequence comprising an open reading frame encoding human APOE2 and an isolated nucleotide sequence having one or more RNAi nucleic acid sequences for inhibition of human APOE4 rnRNA.
  • the nucleotide sequence is inserted 5’ to the open reading frame. In one embodiment, the nucleotide sequence is inserted 3’ to the open reading frame.
  • the nucleotide sequence is inserted 5’ and 3’ to the open reading frame.
  • the isolated nucleotide sequence comprises a second promoter operably linked to the one or more RNAi nucleic acid sequences.
  • the RNAi nucleic acid sequence is about 125 to 500, e.g., about 150 to 175, nucleotides in length.
  • the gene therapy vector may have 2, 3, 4 or more copies of the RNAi nucleic acid sequence which may include miRNA sequences, e.g., miRNA sequences which flank the APOE4 inhibitory sequences.
  • a method to prevent, inhibit or treat Alzheimer’s disease in a mammal comprising: administering to the mammal an effective amount of a composition comprising the gene therapy vector.
  • the composition comprises nanoparticles comprising the gene therapy vector or the different vector, or both.
  • the gene therapy vector or the different vector, or both comprise a viral vector.
  • the mammal is a E2/E4 heterozygote.
  • the mammal is a E4/E4 homozygote.
  • the composition is systemically administered.
  • the composition is orally administered.
  • the composition is intravenously administered.
  • the composition is locally administered.
  • the composition is injected.
  • the composition is administered to the central nervous system. In one embodiment, the composition is administered to the brain. In one embodiment, the composition is a sustained release composition. In one embodiment, the mammal is a human. In one embodiment, the RNAi nucleic acid sequences comprise a plurality of miRNA sequences.
  • a method to prevent, inhibit or treat a disease associated with APOE4 expression in a mammal comprising: administering to the mammal an effective amount of a composition comprising the gene therapy vector.
  • the composition comprises liposomes comprising the gene therapy vector or the different vector, or both.
  • the composition comprises nanoparticles comprising the gene therapy vector or the different vector, or both.
  • the gene therapy vector or the different vector, or both comprise a viral vector.
  • the mammal is a E2/E4 heterozygote.
  • the mammal is a E4/E4 homozygote.
  • the composition is systemically administered. In one embodiment, the composition is orally administered.
  • the composition is intravenously administered. In one embodiment, the composition is locally administered. In one embodiment, the composition is injected. In one embodiment, the composition is administered to the central nervous system. In one embodiment, the composition is administered to the brain. In one embodiment, the composition is a sustained release composition. In one embodiment, the mammal is a human. In one embodiment, the RNAi sequences comprise a plurality of miRNA sequences.
  • FIGURES Figure 1 Production of inhibitory RNAs from an exemplary target transcript template (Boudreau and Davidson. 2012. Methods in Enzymology, Volume 507).
  • Figure 3 Exemplary constructs for miRNA insertion(s).
  • Figure 5 Single vector construct with two sites for miRNA sequences.
  • Figure 6. APOE knock down of expression by four different siRNAs in vitro.
  • Figure 7 Use of mirlSS scaffold as an exemplary scaffold for miRNA expression.
  • a “vector” refers to a macromolecule or association of macromolecules that comprises or associates with a polynucleotide, and which can be used to mediate delivery of the polynucleotide to a cell, either in vitro or in vivo.
  • Illustrative vectors include, for example, plasmids, viral vectors, liposomes and other gene delivery vehicles.
  • the polynucleotide to be delivered may comprise a coding sequence of interest in gene therapy (such as a gene encoding a protein of therapeutic interest), a coding sequence of interest in vaccine development (such as a polynucleotide expressing a protein, polypeptide or peptide suitable for eliciting an immune response in a mammal), and/or a selectable or detectable marker.
  • Transduction are terms referring to a process for the introduction of an exogenous polynucleotide into a host cell leading to expression of the polynucleotide, e.g., the transgene in the cell, and includes the use of recombinant virus to introduce the exogenous polynucleotide to the host cell.
  • Transduction, transfection or transformation of a polynucleotide in a cell may be determined by methods well known to the art including, but not limited to, protein expression (including steady state levels), e.g., by ELISA, flow cytometry and Western blot, measurement of DNA and RNA by hybridization assays, e.g., Northern blots, Southern blots and gel shift mobility assays.
  • Methods used for the introduction of the exogenous polynucleotide include well-known techniques such as viral infection or transfection, lipofection, transformation and electroporation, as well as other non-viral gene delivery techniques.
  • the introduced polynucleotide may be stably or transiently maintained in the host cell.
  • Gene delivery refers to the introduction of an exogenous polynucleotide into a cell for gene transfer, and may encompass targeting, binding, uptake, transpat, localization, replicon integration and expression.
  • Gene transfer refers to the introduction of an exogenous polynucleotide into a cell which may encompass targeting, binding, uptake, transport, localization and replicon integration, but is distinct from and does not imply subsequent expression of the gene.
  • Gene expression or “expression” refers to the process of gene transcription, translation, and post-translational modification.
  • infectious virus or viral particle is one that comprises a polynucleotide component which it is capable of delivering into a cell for which the viral species is trophic.
  • the term does not necessarily imply any replication capacity of the virus.
  • polynucleotide refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or analogs thereof.
  • a polynucleotide may comprise modified nucleotides, such as methylated or capped nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer.
  • polynucleotide refers interchangeably to double- and single-stranded molecules. Unless otherwise specified or required, any embodiment described herein that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form.
  • an “isolated” polynucleotide e.g., plasmid, virus, polypeptide or other substance refers to a preparation of the substance devoid of at least some of the other components that may also be present where the substance or a similar substance naturally occurs or is initially prepared from. Thus, for example, an isolated substance may be prepared by using a purification technique to enrich it from a source mixture. Isolated nucleic acid, peptide or polypeptide is present in a form or setting that is different from that in which it is found in nature.
  • a given DNA sequence e.g., a gene
  • RNA sequences such as a specific mRNA sequence encoding a specific protein, are found in the cell as a mixture with numerous other mRNAs that encode a multitude of proteins.
  • the isolated nucleic acid molecule may be present in single-stranded or double- stranded form. When an isolated nucleic acid molecule is to be utilized to express a protein, the molecule will contain at a minimum the sense or coding strand (i.e., the molecule may single-stranded), but may contain both the sense and anti-sense strands (i.e., the molecule may be double-stranded).
  • Enrichment can be measured on an absolute basis, such as weight per volume of solution, or it can be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments of this invention are envisioned. Thus, for example, a 2-fold enrichment, 10-fold enrichment, 100-fold enrichment, or a 1000-fold enrichment.
  • a “transcriptional regulatory sequence” refers to a genomic region that controls the transcription of a gene or coding sequence to which it is operably linked.
  • Transcriptional regulatory sequences of use in the present invention generally include at least one transcriptional promoter and may also include one or more enhancers and/or terminators of transcription.
  • “Operably linked” refers to an arrangement of two or more components, wherein the components so described are in a relationship permitting them to function in a coordinated manner.
  • a transcriptional regulatory sequence or a promoter is operably linked to a coding sequence if the TRS or promoter promotes transcription of the coding sequence.
  • An operably linked TRS is generally joined in cis with the coding sequence, but it is not necessarily directly adjacent to it.
  • Heterologous means derived from a genotypically distinct entity from the entity to which it is compared.
  • a polynucleotide introduced by genetic engineering techniques into a different cell type is a heterologous polynucleotide (and, when expressed, can encode a heterologous polypeptide).
  • a transcriptional regulatory element such as a promoter that is removed from its native coding sequence and operably linked to a different coding sequence is a heterologous transcriptional regulatory element.
  • a “terminator” refers to a polynucleotide sequence that tends to diminish or prevent read-through transcription (i.e., it diminishes or prevent transcription originating on one side of the terminator from continuing through to the other side of the terminator).
  • the degree to which transcription is disrupted is typically a function of the base sequence and/or the length of the terminator sequence.
  • transcriptional termination sequences are specific sequences that tend to disrupt read-through transcription by RNA polymerase, presumably by causing the RNA polymerase molecule to stop and/or disengage from the DNA being transcribed.
  • sequence-specific terminators include polyadenylation (“poly A”) sequences, e.g., SV40 polyA.
  • poly A polyadenylation
  • insertions of relatively long DNA sequences between a promoter and a coding region also tend to disrupt transcription of the coding region, generally in proportion to the length of the intervening sequence. This effect presumably arises because there is always some tendency for an RNA polymerase molecule to become disengaged from the DNA being transcribed, and increasing the length of the sequence to be traversed before reaching the coding region would generally increase the likelihood that disengagement would occur before transcription of the coding region was completed or possibly even initiated.
  • Terminators may thus prevent transcription from only one direction (“uni-directional” terminators) or from both directions (“bi-directional” terminators), and may be comprised of sequence-specific termination sequences or sequence-non-specific terminators or both.
  • sequence-specific termination sequences or sequence-non-specific terminators or both.
  • “Host cells,” “cell lines,” “cell cultures,” “packaging cell line” and other such terms denote higher eukaryotic cells, such as mammalian cells including human cells, useful in the present invention, e.g., to produce recombinant virus or recombinant fusion polypeptide. These cells include the progeny of the original cell that was transduced. It is understood that the progeny of a single cell may not necessarily be completely identical (in morphology or in genomic complement) to the original parent cell.
  • Recombinant as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction and/or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature.
  • a recombinant virus is a viral particle comprising a recombinant polynucleotide. The terms respectively include replicates of the original polynucleotide construct and progeny of the original virus construct.
  • control element or “control sequence” is a nucleotide sequence involved in an interaction of molecules that contributes to the functional regulation of a polynucleotide, including replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. The regulation may affect the frequency, speed, or specificity of the process, and may be enhancing or inhibitory in nature.
  • Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers.
  • a promoter is a DNA region capable under certain conditions of binding RNA polymerase and initiating transcription of a coding region usually located downstream (in the 3’ direction) from the promoter. Promoters include AAV promoters, e.g., P5, P19, P40 and AAV ITR promoters, as well as heterologous promoters.
  • An “expression vector” is a vector comprising a region which encodes a gene product of interest, and is used for effecting the expression of the gene product in an intended target cell.
  • An expression vector also comprises control elements operatively linked to the encoding region to facilitate expression of the protein in the target.
  • the combination of control elements and a gene or genes to which they are operably linked for expression is sometimes referred to as an “expression cassette,” a large number of which are known and available in the art or can be readily constructed from components that are available in the art.
  • polypeptide and protein are used interchangeably herein to refer to polymers of amino acids of any length.
  • the terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, acetylation, phosphonylation, lipidation, or conjugation with a labeling component.
  • exogenous when used in relation to a protein, gene, nucleic acid, or polynucleotide in a cell or organism refers to a protein, gene, nucleic acid, or polynucleotide which has been introduced into the cell or organism by artificial or natural means.
  • An exogenous nucleic acid may be from a different organism or cell, or it may be one or more additional copies of a nucleic arid which occurs naturally within the organism or cell.
  • an exogenous nucleic arid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic arid sequence than that found in nature, e.g., an expression cassette which links a promoter from one gene to an open reading frame for a gene product from a different gene.
  • Transformed or transgenic is used herein to include any host cell or cell line, which has been altered or augmented by the presence of at least one recombinant DNA sequence.
  • the host cells of the present invention are typically produced by transfection with a DNA sequence in a plasmid expression vector, as an isolated linear DNA sequence, or infection with a recombinant viral vector.
  • sequence homology means the proportion of base matches between two nucleic acid sequences or the proportion amino acid matches between two amino acid sequences. When sequence homology is expressed as a percentage, e.g., 50%, the percentage denotes the proportion of matches over the length of a selected sequence that is compared to some other sequence. Gaps (in either of the two sequences) are permitted to maximize matching; gap lengths of 15 bases or less are usually used, 6 bases or less e.g., with 2 bases or less.
  • the sequence homology between the target nucleic acid and the oligonucleotide sequence is generally not less than 17 target base matches out of 20 possible oligonucleotide base pair matches (85%); not less than 9 matches out of 10 possible base pair matches (90%), or not less than 19 matches out of 20 possible base pair matches (95%).
  • Two amino acid sequences are homologous if there is a partial or complete identity between their sequences. For example, 85% homology means that 85% of the amino acids are identical when the two sequences are aligned for maximum matching. Gaps (in either of the two sequences being matched) are allowed in maximizing matching; gap lengths of 5 or less or with 2 or less.
  • two protein sequences or polypeptide sequences derived from them of at least 30 amino acids in length
  • the two sequences or parts thereof are more homologous if their amino acids are greater than or equal to 50% identical when optimally aligned using the ALIGN program.
  • a polynucleotide sequence is structurally related to all or a portion of a reference polynucleotide sequence, or that a polypeptide sequence is structurally related to all or a portion of a reference polypeptide sequence, e.g., they have at least 80%, 85%, 90%, 95% or more, e.g., 99% or 100%, sequence identity.
  • the term “complementary to” is used herein to mean that the complementary sequence is homologous to all or a portion of a reference polynucleotide sequence.
  • the nucleotide sequence “TATAC” corresponds to a reference sequence “TATAC” and is complementary to a reference sequence “GTATA”.
  • sequence identity means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison.
  • percentage of sequence identity means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison.
  • percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • the identical nucleic acid base e.g., A, T, C, G, U, or I
  • substantially identical denote a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 85 percent sequence identity, e.g., at least 90 to 95 percent sequence identity, or at least 99 percent sequence identity as compared to a reference sequence over a comparison window of at least 20 nucleotide positions, frequently over a window of at least 20-50 nucleotides, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the polynucleotide sequence which may include deletions or additions which total 20 percent or less of the reference sequence over the window of comparison.
  • Constant amino acid substitutions are, for example, aspartic- glutamic as polar acidic amino acids; lysine/arginine/histidine as polar basic amino acids; leucine/isoleucine/methionine/valine/alanine/glycine/proline as non-polar or hydrophobic amino acids; serine/ threonine as polar or uncharged hydrophilic amino acids.
  • Conservative amino acid substitution also includes groupings based on side chains.
  • a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino adds having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur- containing side chains is cysteine and methionine.
  • Naturally occurring residues are divided into groups based on common side-chain properties: (1) hydrophobic: norieudne, met, ala, val, leu, ile; (2) neutral hydrophilic: cys, ser, thr; (3) acidic: asp, glu; (4) basic: asn, gin, his, lys, arg; (5) residues that influence chain orientation: gly, pro; and (6) aromatic; trp, tyr, phe.
  • Non-conservative substitutions entail exchanging a member of one of the classes described above for another.
  • Exemplary human APOE sequences include but are not limited to: mkvlwaallv tflagcqakv eqavetepep elrqqtewqs gqrwelaigr fwdylrwvqt Iseqvqeell ssqvtqelra lmdetmkelk aykseleeql tpvaeetrar Iskelqaaqa rlgadmedvc grlvqyrgev qarr.lgqstee lrvrlashir kirkrllrda ddlqkrlavy qagaregaer glsairerlg plveqgrvra atvgslagqp iqeraqawge rlrarmeemg srtrdrldev keqvaevrak leeqaqiri qaeafqarlk
  • Iseqvqeell ssqvtqelra lmdetmkelk aykseleeql tpvaeetrar Iskelqaaqa rlgadmedvc grlvqyrgev qamlgqstee lrvrlashlr kirkrllrda ddlqkclavy qagaregaer glsairerlg plveqgrvra atvgslagqp Iqeraqawge rlrarmeemg srtrdrldev keqvaevrak leeqaqqirl qaeafqarik swfeplvedm qrqwaglvek vqaavgtsaa pvpsdnh.
  • SEQ ID NO: 10 includes kv eqavetepep elrqqtewqs gqrwelalgr fwdylrwvqt
  • Iseqvqeell ssqvtqelra lmdetmkelk aykseleeql tpvaeetrar Iskelqaaqa rlgadmedvr grlvqyrgev qamlgqstee lrvrlashlr kirkrllrda ddlqkrlavy qagaregaer glsairerlg plveqgrvra atvgslagqp Iqeraqawge rlrarmeemg srtrdrldev keqvaevrak leeqaqqirl qaeafqarik swfeplvedm qrqwaglvek vqaavgtsaa pvpsdnh.
  • Exemplary human APOE nucleic acid sequences include but are not limited to: ggaacttgat gctcagagag gacaagtcat ttgcccaagg tcacacagct ggcaactggc agagccagga ttcacgcct ggcaatttga ctccagaatc ctaaccttaa cccagaagca cggcttcaag cccctggaaa ccacaatacc tgtggcagcc agggggt gctggaaa ccacaatacc tgtggcagcc agggggt gctggaatct catttcacat gtggggaggg ggctccctg tgctcaaggt cacaaccaaa gaggaagctg tgattaaaac ccaggtccca ttgcaaagc
  • AD Alzheimer's disease
  • APOE4 Alzheimer's disease
  • AD Alzheimer's disease
  • inheritance of the APOE2 gene is protective, reducing the risk of developing AD by about 50% and delaying the age of onset.
  • APOE4 is associated with increased brain amyloid load and greater memory impairment in AD.
  • APOE2 attenuates these effects.
  • the odds ratio of developing AD with E4/E4 homozygous genotype is 14.9 and is reduced to 2.6 in E2/E4 heterozygotes.
  • APOE4 may be associated with abnormal brain function apart from its role in promoting amyloid production.
  • the present disclosure provides for a gene therapy vector for expression of APOE2, sequences to inhibit APOE4 expression, and methods of using the APOE2 and APOE4 inhibitory sequences.
  • the disclosure provides a gene therapy vector comprising a nucleic acid sequence which encodes APOE2 and may include inhibitory sequences of endogenous APOE4 expression, or in one embodiment may include another vector for expression of the inhibitory sequences or a composition having the inhibitory RNA sequences.
  • a gene therapy vector comprising a nucleic acid sequence which encodes APOE2 and may include inhibitory sequences of endogenous APOE4 expression, or in one embodiment may include another vector for expression of the inhibitory sequences or a composition having the inhibitory RNA sequences.
  • a “gene therapy vector” is thus any molecule or composition that has the ability to cany a heterologous nucleic acid sequence into a suitable host cell where synthesis of the encoded protein takes place.
  • a gene therapy vector is a nucleic acid molecule that has been engineered, using recombinant DNA techniques that are known in the art, to incorporate the heterologous nucleic acid sequence, e.g., heterologous with respect to the other vector sequences such as the promoter or vector backbone sequences such as viral sequences.
  • the gene therapy vector is comprised of DNA. Examples of suitable DNA-based gene therapy vectors include plasmids and viral vectors.
  • gene therapy vectors that are not based solely on nucleic acids, such as liposomes or nanoparticles, may also be employed.
  • the gene therapy vector can be based on a single type of nucleic acid (e.g., a plasmid) or include non-nucleic acid molecules (e.g., a lipid or a polymer).
  • the gene therapy vector can be integrated into the host cell genome, or can be present in the host cell in the form of an episome.
  • Gene or siRNA delivery vectors within the scope of the disclosure include, but are not limited to, isolated nucleic acid, e.g., plasmid-based vectors which may be extrachromosomally maintained, and viral vectors, e.g., recombinant adenovirus, retrovirus, lcntivirus, herpesvirus, poxvirus, papilloma virus, or adeno-associated virus, including viral and non-viral vectors which are present in liposomes, e.g., neutral or cationic liposomes, such as DOSP A/DOPE, DOGS/DOPE or DMRIE/DOPE liposomes, and/or associated with other molecules such as DNA-anti-DNA antibody-cationic lipid (DOTMA/DOPE) complexes or natural or synthetic polymers.
  • viral vectors e.g., recombinant adenovirus, retrovirus, lcntivirus, herpesvirus, poxvirus, papillo
  • Gene delivery vectors may be administered via any route including, but not limited to, intracranial, intrathecal, intramuscular, buccal, rectal, intravenous or intracoronary administration, and transfer to cells may be enhanced using electroporation and/or iontophoresis, and/or scaffolding such as extracellular matrix or hydrogels, e.g., a hydrogel patch.
  • the gene therapy vector or the other vector is a viral vector.
  • Suitable viral vectors include, for example, retroviral vectors, lentivirus vectors, herpes simplex virus (HSV)-based vectors, parvovirus-based vectors, e.g., adeno-associated virus (AAV)-based vectors, AAV-adenoviral chimeric vectors, and adenovirus-based vectors.
  • HSV herpes simplex virus
  • AAV adeno-associated virus
  • Retroviral vectors exhibit several distinctive features including their ability to stably and precisely integrate into the host genome providing long-term transgene expression. These vectors can be manipulated ex vivo to eliminate infectious gene particles to minimize the risk of systemic infection and patient- to-patient transmission. Pseudotyped retroviral vectors can alter host cell tropism. Lentiviruses
  • Lendviruses are derived from a family of retroviruses that include human immunodeficiency virus and feline immunodeficiency virus. However, unlike retroviruses that only infect dividing cells, lendviruses can infect both dividing and nondividing cells. Although lendviruses have specific tropisms, pseudotyping the viral envelope with vesicular stomatitis virus yields virus with a broader range (Schnepp et al., Meth. Mol. Med.. 69:427 (2002)).
  • Adenoviral vectors may be rendered replication-incompetent by deleting the early (El A and E1B) genes responsible for viral gene expression from the genome and are stably maintained into the host cells in an extrachromosomal form. These vectors have the ability to transfect both replicating and nonreplicating cells. Adenoviral vectors have been shown to result in transient expression of therapeutic genes in vivo, peaking at 7 days and lasting approximately 4 weeks. In addition, adenoviral vectors can be produced at very high titers, allowing efficient gene therapy with small volumes of virus. Adeno-associated virus vectors
  • adeno-associated viruses are derived from nonpathogenic parvoviruses, evoke essentially no cellular immune response, and produce transgene expression lasting months in most systems. Moreover, like adenovirus, adeno-associated virus vectors also have the capability to infect replicating and nonreplicating cells.
  • AAV vectors include but are not limited to AAVl, AAV2, AAV5, AAV7, AAV8, AAV9 or AAVrhlO, including chimeric viruses where the AAV genome is from a different source than the capsid.
  • Plasmid DNA is often referred to as "naked DNA" to indicate the absence of a more elaborate packaging system.
  • Direct injection of plasmid DNA to myocardial cells in vivo has been accomplished.
  • Plasmid-based vectors are relatively nonimmunogenic and nonpathogenic, with the potential to stably integrate in the cellular genome, resulting in long-term gene expression in postmitotic cells in vivo.
  • plasmid DNA is rapidly degraded in the blood stream; therefore, the chance of transgene expression in distant organ systems is negligible.
  • Plasmid DNA may be delivered to cells as part of a macromolecular complex, e.g., a liposome or DNA-protein complex, and delivery may be enhanced using techniques including electroporation.
  • the disclosure provides an adeno-associated virus (AAV) vector which comprises, consists essentially of, or consists of a nucleic acid sequence encoding APOE2.
  • AAV adeno-associated virus
  • tire AAV vector consists essentially of a nucleic acid sequence encoding APOE2
  • additional components can be included that do not materially affect the AAV vector (e.g., genetic elements such as poly(A) sequences or restriction enzyme sites that facilitate manipulation of the vector in vitro).
  • the AAV vector consists of a nucleic acid sequence which encodes APOE2
  • the AAV vector does not comprise any additional components (i.e., components that are not endogenous to AAV and are not required to effect expression of the nucleic acid sequence).
  • Adeno-associated virus is a member of the Parvoviridae family and comprises a linear, single-stranded DNA genome of less than about 5,000 nucleotides.
  • AAV requires co-infection with a helper virus (i.e., an adenovirus or a herpes virus), or expression of helper genes, for efficient replication.
  • helper virus i.e., an adenovirus or a herpes virus
  • helper genes for efficient replication.
  • AAV vectors used for administration of therapeutic nucleic acids typically have approximately 96% of the parental genome deleted, such that only the terminal repeats (ITRs), which contain recognition signals for DNA replication and packaging, remain. This eliminates immunologic CM- toxic side effects due to expression of viral genes.
  • delivering specific AAV proteins to producing cells enables integration of the AAV vector comprising AAV ITRs into a specific region of the cellular genome, if desired (see, e.g., U.S. Patents 6,342,390 and 6,821,511). Host cells comprising an integrated AAV genome show no change in cell growth or morphology (see, for example, U.S. Patent 4,797,368).
  • the AAV ITRs flank the unique coding nucleotide sequences for the non-structural replication (Rep) proteins and the structural capsid (Cap) proteins (also known as virion proteins (VPs)).
  • the terminal 145 nucleotides are self- complementary and are organized so that an energetically stable intramolecular duplex forming a T-shaped hairpin may be formed. These hairpin structures function as an origin for viral DNA replication by serving as primers for the cellular DNA polymerase complex.
  • the Rep genes encode the Rep proteins Rep78, Rep68, Rep52, and Rep40. Rep78 and Rep68 are transcribed from the p5 promoter, and Rep 52 and Rep40 are transcribed from the pl9 promoter.
  • the Rep78 and Rep68 proteins are multifunctional DNA binding proteins that perform helicase and nickase functions during productive replication to allow for the resolution of AAV termini (see, e.g., Im et al., Cell. 61:447 (1990)). These proteins also regulate transcription from endogenous AAV promoters and promoters within helper viruses (see, e.g., Pereira et al., J. Virol.. 71:1079 (1997)). The other Rep proteins modify the function of Rep78 and Rep68.
  • the cap genes encode the capsid proteins VP1 , VP2, and VP3. The cap genes are transcribed from the p40 promoter.
  • the AAV vector may be generated using any AAV serotype known in the art.
  • AAV serotypes and over 100 AAV variants have been isolated from adenovirus stocks or from human or nonhuman primate tissues (reviewed in, e.g., Wu et al., Molecular Therapy. 14/3): 316 (2006)).
  • the AAV serotypes have genomic sequences of significant homology at the nucleic acid sequence and amino acid sequence levels, such that different serotypes have an identical set of genetic functions, produce virions which are essentially physically and functionally equivalent, and replicate and assemble by practically identical mechanisms.
  • AAV serotypes 1-5 and 7-9 are defined as “true” serotypes, in that they do not efficiently cross-react with neutralizing sera specific for all other existing and characterized serotypes.
  • AAV serotypes 6, 10 (also referred to as RhlO), and 11 are considered “variant” serotypes as they do not adhere to the definition of a “true” serotype.
  • AAV serotype 2 (AAV2) has been used extensively for gene therapy applications due to its lack of pathogenicity, wide range of infectivity, and ability to establish long-term transgene expression (see, e.g., Carter, Hum. Gene Ther.. 16:541 (2005); and Wu et al., supra).
  • Genome sequences of various AAV serotypes and comparisons thereof are disclosed in, for example, GenBank Accession numbers U89790, J01901, AF043303, and AF085716; Chiorini et al., J. Virol.. 71:6823 (1997); Srivastava et al., J. Virol . 45:555 (1983); Chiorini et al., J. Virol.. 71:1309 (1999); Rutledge et aL, J. Virol.. 72:309 (1998); and Wu et al., J. Virol- 74:8635 (2000)).
  • AAV rep and ITR sequences are particularly conserved across most AAV serotypes.
  • the Rep78 proteins of AAV2, AAV3A, AAV3B, AAV4, and AAV6 are reportedly about 89-93% identical (see Bantel-Schaal et al., J. Virol.. 73(2):939 (1999)).
  • AAV serotypes 2, 3A, 3B, and 6 share about 82% total nucleotide sequence identity at the genome level (Bantel-Schaal et al., supra).
  • the rep sequences and ITRs of many AAV serotypes are known to efficiently cross-complement (e.g., functionally substitute) corresponding sequences from other serotypes during production of AAV particles in mammalian cells.
  • the cap proteins which determine the cellular tropicity of the AAV particle, and related cap protein-encoding sequences, are significantly less conserved than Rep genes across different AAV serotypes.
  • the AAV vector can comprise a mixture of serotypes and thereby be a “chimeric” or “pseudotyped” AAV vector.
  • a chimeric AAV vector typically comprises AAV capsid proteins derived from two or more (e.g., 2, 3, 4, etc.) different AAV serotypes.
  • a pseudotyped AAV vector comprises one or more ITRs of one AAV serotype packaged into a capsid of another AAV serotype.
  • Chimeric and pseudotyped AAV vectors are further described in, for example, U.S. Patent No. 6,723,551; Flotte, Mol. Ther.. 13(11:1 (2006); Gao et al., J. Virol.. 7&:6381 (2004); Gao et al., Proc. Natl Acad. Sci. USA. 22:11854 (2002); De et al., Mol. Ther.. 13:67 (2006); and Gao et al., Mol. Ther.. 13:77 (2006).
  • the AAV vector is generated using an AAV that infects humans (e.g., AAV2).
  • the AAV vector is generated using an AAV that infects non-human primates, such as, for example, the great apes (e.g., chimpanzees), Old World monkeys (e.g., macaques), and New World monkeys (e.g., marmosets)
  • the AAV vector is generated using an AAV that infects a non-human primate pseudotyped with an AAV that infects humans. Examples of such pseudotyped AAV vectors are disclosed in, e.g., Cearley et aL, Molecular Therapy. 13:528 (2006).
  • an AAV vector can be generated which comprises a capsid protein from an AAV that infects rhesus macaques pseudotyped with AAV2 inverted terminal repeats (ITRs).
  • the AAV vector comprises a capsid protein from AAVIO (also referred to as “AAVrh.10”), which infects rhesus macaques pseudotyped with AAV2 ITRs (see, e.g., Watanabe et al., Gene Ther.. 17(81:1042 (2010); and Mao et al., Hum. Gene Therapy. 22:1525 (2011)).
  • the AAV vector may comprise expression control sequences, such as promoters, enhancers, polyadenylation signals, transcription terminators, internal ribosome entry sites (IRES), and the like, that provide for the expression of the nucleic acid sequence in a host cell, as well as, in one embodiment, sequences for APOE4 RNAi.
  • expression control sequences are known in the art and described in, for example, Goeddel, Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press, San Diego, CA. (1990).
  • promoters including constitutive, inducible, and repressible promoters, from a variety of different sources are well known in the art.
  • Representative sources of promoters include for example, virus, mammal, insect, plant, yeast, and bacteria, and suitable promoters from these sources are readily available, or can be made synthetically, based on sequences publicly available, for example, from depositories such as the ATCC as well as other commercial or individual sources.
  • Promoters can be unidirectional (i.e., initiate transcription in one direction) or bi-directional (i.e., initiate transcription in either a 3 * or 5’ direction).
  • Non-limiting examples of promoters include, for example, the ⁇ 7 bacterial expression system, pBAD (araA) bacterial expression system, the cytomegalovirus (CMV) promoter, the SV40 promoter, and the RSV promoter.
  • Inducible promoters include, for example, the Tet system (U.S. Patent Nos. 5,464,758 and 5,814,618), the Ecdysone inducible system (No et al., Proc. Natl. Acad. Sci..
  • Enhancer refers to a DNA sequence that increases transcription of, for example, a nucleic acid sequence to which it is operably linked. Enhancers can be located many kilobases away from the coding region of the nucleic acid sequence and can mediate the binding of regulatory factors, patterns of DNA methylation, or changes in DNA structure. A large number of enhancers from a variety of different sources are well known in the art and are available as or within cloned polynucleotides (from, e.g., depositories such as the ATCC as well as other commercial or individual sources). A number of polynucleotides comprising promoters (such as the commonly-used CMV promoter) also comprise enhancer sequences.
  • Enhancers can be located upstream, within, or downstream of coding sequences.
  • the nucleic arid sequence encoding APOE2 is operably linked to a CMV enhancer/chicken beta-actin promoter (also referred to as a “CAG promoter”) (see, e.g., Niwa et al., Gene. 108:193 (1991); Daly et al., Proc. Natl. Acad. Sri. U.S.A.. 96:2296 (1999); and Sondhi et al., Mol. Ther.. 15:481 (2007)).
  • CMV enhancer/chicken beta-actin promoter also referred to as a “CAG promoter”
  • AAV vectors are produced using well characterized plasmids.
  • human embryonic kidney 293T cells are transfected with one of the transgene specific plasmids and another plasmid containing tire adenovirus helper and AAV rep and cap genes (specific to AAVrh.10, 8 or 9 as required). After 72 hours, the cells are harvested and the vector is released from the cells by five freeze/thaw cycles. Subsequent centrifugation and benzonase treatment removes cellular debris and unencapsidated DNA. Iodixanol gradients and ion exchange columns may be used to further purify each AAV vector. Next, the purified vector is concentrated by a size exclusion centrifuge spin column to the required concentration.
  • the buffer is exchanged to create the final vector products formulated (for example) in lx phosphate buffered saline.
  • the viral titers may be measured by TaqMan ® real-time PCR and the viral purity may be assessed by SDS-PAGE.
  • compositions comprising, consisting essentially of, or consisting of the above-described gene therapy vector and a pharmaceutically acceptable (e.g., physiologically acceptable) carrier, or a vector for expression of RNAi.
  • a pharmaceutically acceptable carrier e.g., physiologically acceptable
  • additional components can be included that do not materially affect the composition (e.g., adjuvants, buffers, stabilizers, anti-inflammatory agents, solubilizers, preservatives, etc.).
  • the composition consists of the gene therapy vector and the pharmaceutically acceptable carrier, the composition does not comprise any additional components.
  • Any suitable carrier can be used within the context of the disclosure, and such carriers are well known in the art.
  • compositions can be generated in accordance with conventional techniques described in, e.g., Remington: The Science and Practice of Pharmacy, 21st Edition, Lippincott Williams & Wilkins, Philadelphia, PA (2001).
  • Suitable formulations for the composition include aqueous and non- aqueous solutions, isotonic sterile solutions, which can contain anti-oxidants, buffers, and bacteriostats, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • the formulations can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water, immediately prior to use.
  • Extemporaneous solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
  • the carrier is a buffered saline solution.
  • the gene therapy vector is administered in a composition formulated to protect the gene therapy vector from damage prior to administration.
  • the composition can be formulated to reduce loss of the gene therapy vector on devices used to prepare, store, or administer the gene therapy vector, such as glassware, syringes, or needles.
  • the composition can be formulated to decrease the light sensitivity and/or temperature sensitivity of the gene therapy vector.
  • the composition may comprise a pharmaceutically acceptable liquid carrier, such as, for example, those described above, and a stabilizing agent selected from the group consisting of polysorbate 80, L-arginine, polyvinylpyrrolidone, trehalose, and combinations thereof.
  • a stabilizing agent selected from the group consisting of polysorbate 80, L-arginine, polyvinylpyrrolidone, trehalose, and combinations thereof.
  • Formulations for gene therapy vector -containing compositions are further described in, for example, Wright et al., Curr. Opin. Drug Discov. De ⁇ >el ., 6(2): 174-178 (2003) and Wright et al., Molecular Therapy, 12: 171-178 (2005))
  • the composition also can be formulated to enhance transduction efficiency.
  • the gene therapy vector can be present in a composition with other therapeutic or biologically-active agents.
  • factors that control inflammation such as ibuprofen or steroids, can be part of the composition to reduce swelling and inflammation associated with in vivo administration of the gene therapy vector.
  • Immune system stimulators or adjuvants e.g., interleukins, lipopolysaccharide, and double-stranded RNA, can be administered to enhance or modify an immune response.
  • Antibiotics i.e., microbicides and fungicides, can be present to treat existing infection and/or reduce the risk of future infection, such as infection associated with gene therapy procedures.
  • Injectable depot forms are made by forming microencapsule matrices of the subject compounds in biodegradable polymers such as polylactide- polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue.
  • a formulation comprises a biocompatible polymer selected from the group consisting of polyamides, polycarbonates, polyalkylenes, polymers of acrylic and methacrylic esters, polyvinyl polymers, polyglycolides, polysiloxanes, polyurethanes and co-polymers thereof, celluloses, polypropylene, polyethylenes, polystyrene, polymers of lactic arid and glycolic acid, polyanhydrides, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), polysaccharides, proteins, polyhyaluronic acids, polycyanoacrylates, and blends, mixtures, or copolymers thereof.
  • a biocompatible polymer selected from the group consisting of polyamides, polycarbonates, polyalkylenes, polymers of acrylic and methacrylic esters, polyvinyl polymers, polyglycolides, polysiloxanes, polyurethanes and co
  • the composition can be administered in or on a device that allows controlled or sustained release, such as a sponge, biocompatible meshwork, mechanical reservoir, or mechanical implant.
  • a device that allows controlled or sustained release such as a sponge, biocompatible meshwork, mechanical reservoir, or mechanical implant.
  • Implants see, e.g., U.S. Patent No. 5,443,505
  • devices see, e.g., U.S. Patent No. 4,863,457
  • an implantable device e.g., a mechanical reservoir or an implant or a device comprised of a polymeric composition
  • Tire composition also can be administered in the form of sustained-release formulations (see, e.g., U.S. Patent No.
  • 5,378,475) comprising, for example, gel foam, hyaluronic acid, gelatin, chondroitin sulfate, a polyphosphoester, such as bis-2-hydroxyethyl-terephthalate (BHET), and/or a polylactic-glycolic arid.
  • BHET bis-2-hydroxyethyl-terephthalate
  • compositions comprising the gene therapy vectors may be intracerebral (including but not limited to intraparenchymal, intraventricular, or intracistemal), intrathecal (including but not limited to lumbar or cistema magna), or systemic, including but not limited to intravenous, or any combination thereof, using devices known in the art. Delivery may also be via surgical implantation of an implanted device.
  • the dose of the gene therapy vector in the composition administered to the mammal will depend on a number of factors, including the size (mass) of the mammal, the extent of any side-effects, the particular route of administration, and the like.
  • the method comprises administering a “therapeutically effective amount” of the composition comprising the gene therapy vector described herein.
  • a “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result.
  • the therapeutically effective amount may vary according to factors such as the extent of pathology, age, sex, and weight of the individual, and the ability of the gene therapy vector to elicit a desired response in the individual.
  • the dose of gene therapy vector in the composition required to achieve a particular therapeutic effect typically is administered in units of vector genome copies per cell (gc/cell) or vector genome copies/per kilogram of body weight (gc/kg).
  • gc/cell vector genome copies per cell
  • gc/kg vector genome copies/per kilogram of body weight
  • Tire therapeutically effective amount may be between 1 x 10 10 genome copies to 1 x 10 13 genome copies.
  • the therapeutically effective amount may be between 1 x 10 11 genome copies to 1 x 10 14 genome copies.
  • the therapeutically effective amount may be between 1 x 10 12 genome copies to 1 x 10 15 genome copies.
  • the therapeutically effective amount may be from 1 x 10 13 genome copies (gc) to 1 x 10 16 gc, e.g., from 1 x 10 13 gc to 1 x 10 14 gc, 1 x 10 14 gc to 1 x 10 15 gc, or 1 x 10 15 gc to 1 x 10 14 gc.
  • the dose ranges may be from 1.4 x 10 8 gc/kg to 1.4 x 10" gc/kg, 1.4 x 10 9 gc/kg to 1.4 x 10 12 gc/kg, 1.4 x 10 10 gc/kg to 1.4 x 10 13 gc/kg, or 1.4 x 10 11 gc/kg to 1.4 x 10 14 gc/kg.
  • the composition is administered once to the mammal. It is believed that a single administration of the composition will result in expression of APOE2, and suppression of APOE4 expression, in the mammal with minimal side effects. However, in certain cases, it may be appropriate to administer the composition multiple times during a therapeutic period to ensure sufficient exposure of cells to the composition. For example, the composition may be administered to the mammal two or more times (e.g., 2, 3, 4, 5, 6, 6, 8, 9, or 10 or more times) during a therapeutic period.
  • compositions which comprise a therapeutically-effective amount of gene therapy vector comprising a nucleic acid sequence which encodes an APOE2 and a sequence which inhibits APOE4 expression.
  • the subject may be any animal, including a human and non-human animal.
  • Non-human animals include all vertebrates, e.g., mammals and nonmammals, such as non-human primates, sheep, dogs, cats, cows, horses, chickens, amphibians, and reptiles, although mammals are envisioned as subjects, such as non-human primates, sheep, dogs, cats, cows and horses.
  • the subject may also be livestock such as, cattle, swine, sheep, poultry, and horses, or pets, such as dogs and cats.
  • subjects include human subjects suffering from or at risk for the medical diseases and disorders described herein.
  • the subject is generally diagnosed with the condition by skilled artisans, such as a medical practitioner.
  • the methods described herein can be employed for subjects of any species, gender, age, ethnic population, or genotype. Accordingly, the term subject includes males and females, and it includes elderly, elderly-to-adult transition age subjects adults, adult-to-pre-adult transition age subjects, and preadults, including adolescents, children, and infants.
  • human ethnic populations include Caucasians, Asians, Hispanics, Africans, African Americans, Native Americans, Semites, and Pacific Islanders. The methods may be more appropriate for some ethnic populations such as Caucasians, especially northern European populations, as well as Asian populations.
  • subject also includes subjects of any genotype or phenotype as long as they are in need of treatment, as described above.
  • the subject can have the genotype or phenotype for any hair color, eye color, skin color or any combination thereof.
  • subject includes a subject of any body height, body weight, or any organ or body part size or shape.
  • Biodegradable nanoparticles may include or may be formed from biodegradable polymeric molecules which may include, but are not limited to polylactic acid (PLA), polyglycolic acid (PGA), co-polymers of PLA and PGA (i.e., polyactic-co-glycolic acid (PLGA)), poly-e-caprolactone (PCL), polyethylene glycol (PEG), poly(3-hydroxybutyrate), poly(p-dioxanone), polypropylene fumarate, poly(orthoesters), polyol/diketene acetals addition polymers, poly-alkyl-cyano-acrylates (PAC), poly(sebacic anhydride) (PSA), poly(carboxybiscarboxyphenoxyphenoxy hexone (PCPP) poly[bis (p- carboxypheonoxy)methane](PCPM), copolymers of
  • the biodegradable nanoparticles may be prepared by methods known in the art. (See, e.g., Nagavarma et aL, Asian J. of Pharma. And Clin. Res., Vol 5, Suppl 3, 2012, pages 16-23; Cismaru et al., Rev. Roum. Chim., 2010, 55(8), 433-442; and International Application Publication Nos. WO 2012/115806; and WO 2012/054425; the contents of which are incorporated herein by reference in their entireties).
  • Suitable methods for preparing the nanoparticles may include methods that utilize a dispersion of a preformed polymer, which may include but are not limited to solvent evaporation, nanoprecipitation, emulsification/solvent diffusion, salting out, dialysis, and supercritical fluid technology.
  • the nanoparticles may be prepared by forming a double emulsion (e.g., water-in-oil-in-water) and subsequently performing solvent-evaporation.
  • the nanoparticles obtained by the disclosed methods may be subjected to further processing steps such as washing and lyophilization, as desired.
  • the nanoparticles may be combined with a preservative (e.g., trehalose).
  • the nanoparticles have a mean effective diameter of less than 1 micron, e.g., the nanoparticles have a mean effective diameter of between about 25 nm and about 500 nm, e.g., between about 50 nm and about 250 run, about 100 nm to about 150 nm, or about 450 nm to 650 nm.
  • the size of the particles may be assessed by known methods in the art, which may include but are not limited to transmission electron microscopy (TEM), scanning electron microscopy (SEM), Atomic Force Microscopy (AFM), Photon Correlation Spectroscopy (PCS), Nanoparfiele Surface Area Monitor (NS AM), Condensation Particle Counter (CPC), Differential Mobility Analyzer (DMA), Scanning Mobility Particle Sizer (SMPS), Nanoparticle Tracking Analysis (NT A), X-Ray Diffraction (XRD), Aerosol Time of Flight Mass Spectroscopy ( A TPMS), and Aerosol Particle Mass Analyzer (APM).
  • TEM transmission electron microscopy
  • SEM scanning electron microscopy
  • AFM Atomic Force Microscopy
  • PCS Photon Correlation Spectroscopy
  • N AM Nanoparfiele Surface Area Monitor
  • CPC Condensation Particle Counter
  • DMA Differential Mobility Analyzer
  • SPS Scanning Mobility Particle Sizer
  • NT A X
  • the biodegradable nanoparticles may have a zeta-potential that facilitates uptake by a target cell.
  • the nanoparticles have a zeta-potential greater than 0.
  • the nanoparticles have a zeta-potential between about 5 mV to about 45 mV, between about 15 mV to about 35 mV, or between about 20 mV and about 40 mV.
  • Zeta-potential may be determined via characteristics that include electrophoretic mobility or dynamic electrophoretic mobility. Electrokinetic phenomena and electroacoustic phenomena may be utilized to calculate zeta-potential.
  • a non -viral delivery vehicle comprises polymers including but not limited to poly(lactic-co-glycolic acid) (PLGA), polylactic acid (PLA), linear and/or branched PEI with differing molecular weights (e.g., 2, 22 and 25 kDa), dendrimers such as polyamidoamine (PAMAM) and polymethoacrylates; lipids including but not limited to cationic liposomes, cationic emulsions, DOTAP, DOTMA, DMRIE, DOSPA, distearoylphosphatidylcholine (DSPC), DOPE, or DC-cholesterol; peptide based vectors including hut not limited to Poly-L-lysine or protamine; or poly( ⁇ -amino ester), chitosan, PEI-polyethylene glycol, PEI-mannose-dextrose, DOTAP- cholesterol or RNAiMAX.
  • PLGA poly(lactic-co-glycolic acid)
  • the delivery vehicle is a glyeopolymer-based delivery vehicle, poly(glycoamidoamine)s (PGAAs), that have the ability to complex with various polynucleotide types and form nanoparticles.
  • G mesogalactarate
  • M D-mannarate
  • T L-tartarate
  • oligoethyleneamine monomers containing between 1-4 ethylenamines (Liu and Reineke, 2006).
  • the delivery vehicle comprises polyethyleneimine (PEI), PolyaTnidoamine (PAMAM), PEL-PEG, PEI-PEG-mannose, dextran-PEI, OVA conjugate, PLGA microparticles, or PLGA microparticles coated with PAMAM, or any combination thereof.
  • the disclosed cationic polymer may include, but are not limited to, polyamidoamine (PAMAM) dendrimers.
  • Polyamidoamine dendrimers suitable for preparing the presently disclosed nanoparticles may include 3rd-, 4th-, 5th-, or at least 6th -generation dendrimers.
  • the delivery vehicle comprises a lipid, e.g., N-[1- (2,3-dioleoyloxy)propel]- N, N, N-trirnethylammonium (DOTMA), 2,3- dioleyloxy- N-[2-spermine carboxamide] ethyl - N, N-dimethy1- 1 - propanammonium trifluoracetate (DOSPA, Lipofectamine); l,2-dioleoyl-3- trimethylammoniurn-propane (DOTAP); N-[l-(2,3-dimyristloxy) propyl]; N,N- dimethyl- N-(2-hydroxyethyl) ammonium bromide (DMRIE), 3-P-[ N-( N, N- di methyl aminoethane) carbamoyl] cholesterol (DC-Chol); dioctadecyl amidogiyceryl spermine (DOGS, Transfectam); or
  • the positively charged hydrophilic head group of cationic lipids usually consists of monoamine such as tertiary and quaternary amines, polyamine, amidinium, or guanidinium group.
  • monoamine such as tertiary and quaternary amines, polyamine, amidinium, or guanidinium group.
  • pyridinium lipids have been developed (Zhu et al., 2008; van der Woude et al., 1997; Hies et al., 2004).
  • other types of heterocyclic head group include imidazole, piperizine and amino acid.
  • the main function of cationic head groups is to condense negatively charged nucleic acids by means of electrostatic interaction to slightly positively charged nanoparticles, leading to enhanced cellular uptake and endosomal escape.
  • Lipids having two linear fatty acid chains such as DOTMA, DOTAP and SAINT-2, or DODAC, may be employed as a delivery vehicle, as well as tetraalkyl lipid chain surfactant, the dimer of N,N-dioleyl-N,N- dimethylammonium chloride (DODAC). All the trans- orientated lipids regardless of their hydrophobic chain lengths (C 16:1 ,C 18:1 and C 20:1 ) appear to enhance the transfection efficiency compared with their cis-orientated counterparts.
  • DODAC N,N-dioleyl-N,N- dimethylammonium chloride
  • the structures of cationic polymers useful as a delivery vehicle include but are not limited to linear polymers such as chitosan and linear poly(ethyleneimine), branched polymers such as branch poly(ethyleneirnine) (PEI), circle-like polymers such as cyclodextrin, network (crosslinked) type polymers such as crosslinked poly( amino acid) (PAA), and dendrimers.
  • Dendrimers consist of a central core molecule, from which several highly branched arms 'grow' to form a tree -like structure with a manner of symmetry or asymmetry. Examples of dendrimers include polyamidoamme (PAMAM) and polypropylenimine (PPI) dendrimers.
  • DOPE and cholesterol are commonly used neutral co-lipids for preparing cationic liposomes.
  • Pluronic (poloxamer), a non- ionic polymer and SP1017, which is the combination of Pluronics L61 and F127, may also he used.
  • PLGA particles are employed to increase the encapsulation frequency although complex formation with PLL may also increase the encapsulation efficiency.
  • Other cationic materials for example,
  • PEI DOTMA, DC-Chol, or CTAB
  • DOTMA docosapentasaline
  • DC-Chol docosaline
  • CTAB CTAB
  • complexes are embedded in or applied to a material including but not limited to hydrogels of poloxamers, polyacrylamide, poly(2- hydroxyethyl methacrylate), carboxyvinyl-polyiners (e.g., Carbopol 934, Goodrich Chemical Co.), cellulose derivatives, e.g., methyl cellulose, cellulose acetate and hydroxypropyl cellulose, polyvinyl pyrrolidone or polyvinyl alcohols, or combinations thereof.
  • a material including but not limited to hydrogels of poloxamers, polyacrylamide, poly(2- hydroxyethyl methacrylate), carboxyvinyl-polyiners (e.g., Carbopol 934, Goodrich Chemical Co.), cellulose derivatives, e.g., methyl cellulose, cellulose acetate and hydroxypropyl cellulose, polyvinyl pyrrolidone or polyvinyl alcohols, or combinations thereof.
  • a biocompatible polymeric material is derived from a biodegradable polymeric such as collagen, e.g., hydroxy lated collagen, fibrin, polylactic-polyglycolic acid, or a poly anhydride.
  • a biodegradable polymeric such as collagen, e.g., hydroxy lated collagen, fibrin, polylactic-polyglycolic acid, or a poly anhydride.
  • Other examples include, without limitation, any biocompatible polymer, whether hydrophilic, hydrophobic, or amphiphilic, such as ethylene vinyl acetate copolymer (EVA), polymethyl methacrylate, polyamides, polycarbonates, polyesters, polyethylene, polypropylenes, polystyrenes, polyvinyl chloride, polytetrafluoroethylene, N- isopropylacrylamide copolymers, polyiethylene oxide)/poly(propylene oxide) block copolymers, poly(ethylene glycol)/poly(D,L-lactide-co
  • the biocompatible material includes polyethyleneterephalate, polytetrafluoroethylene, copolymer of polyethylene oxide and polypropylene oxide, a combination of polyglycolic acid and polyhydroxyalkanoate, gelatin, alginate, poly-3-hydroxybutyrate, poly-4- hydroxybutyrate, and polyhydroxyoctanoate, and polyacrylonitrilepolyvinylchlorides.
  • the following polymers may be employed, e.g., natural polymers such as starch, chitin, glycosaminoglycans, e.g., hyaluronic acid, dermatan sulfate and chrondrotin sulfate, and microbial polyesters, e.g., hydroxyalkanoates such as hydroxyvalerate and hydroxybutyrate copolymers, and synthetic polymers, e.g., poly(orthoesters) and poly anhydrides, and including homo and copolymers of glycolide and lactides (e.g., poly(L-lactide, poly(L-lactide-co-D,L-lactide), poly(L-lactide-co-glycolide, poly glycolide and poly(DX-lactide), pol(D,L-lactide-coglycolide), poly( lactic acid colysine) and polycaprolactone.
  • natural polymers such as starch,
  • the biocompatible material is derived from isolated extracellular matrix (ECM).
  • ECM may be isolated from endothelial layers of various cell populations, tissues and/or organs, e.g., any organ or tissue source including the dermis of the skin, liver, alimentary, respiratory, intestinal, urinary or genital tracks of a warm blooded vertebrate.
  • ECM employed in the invention may be from a combination of sources, isolated ECM may be prepared as a sheet, in particulate form, gel form and the like.
  • the biocompatible scaffold polymer may comprise silk, elastin, chitin, chitosan, poly(d-hydroxy acid), poly(anhydrides), or poly (orthoesters). More particularly, the biocompatible polymer may be formed polyethylene glycol, poly (lactic acid), poly(glyeolic acid), copolymers of lactic and glycolic acid, copolymers of lactic and glycolic acid with polyethylene glycol, poly(E- eaprolactone), poly(3-hydroxybutyrate), poly(p-dioxanone), polypropylene fumarate, polyiorthoesters), polyol/diketene acetals addition polymers, poly(sebaeie anhydride) (PSA), poly(carboxybiscarboxyphenoxyphenoxy hex one (PCPP) poly [bis (p-carboxypheonoxy) methane] (PCPM), copolymers of SA, CPP and CPM, poly(amino acids), poly(ps
  • the polymer may be formed of any of a wide range of materials including polymers, including naturally occurring polymers, synthetic polymers, or a combination thereof.
  • the scaffold comprises biodegradable polymers.
  • a naturally occurring biodegradable polymer may be modified to provide for a synthetic biodegradable polymer derived from the naturally occurring polymer.
  • the polymer is a poly (laetic acid) ("PLA”) or poly(lactie-co-glyeolic acid)
  • the scaffold polymer includes but is not limited to alginate, chitosan, poly(2-hydroxyethylmethacrylate), xyloglucan, co- polymers of 2-methacryloyloxyethyl phosphorylcholine, poly(vinyl alcohol), silicone, hydrophobic polyesters and hydrophilic polyester, polyflactide-co- glycolide), N-isoproyl acrylamide copolymers, poly(ethylene oxide)/poly(propylene oxide), poiylactic acid, poly(orthoesters), poly anhydrides, polyurethanes, copolymers of 2-hydroxyethylmethacrylate and sodium methacrylate, phosphorylcholine, cyclodextrins, polysulfone and polyvinylpyrrolidine, starch, poly-D,L-lactic acid-para-dioxanone-polyethylene glycol block copolymer, polypropylene, poly (ethylene terephthalate),
  • the nucleic acids or vectors can be administered in dosages of at least about 0.0001 mg/kg to about 1 mg/kg, of at least about 0.001 mg/kg to about 0.5 mg/kg, at least about 0.01 mg/kg to about 0.25mg/kg or at least about 0.01 mg/kg to about 0.25 mg/kg of body weight, although other dosages may provide beneficial results.
  • the nucleic acids or vectors can be administered in dosages of at least about 0.0001 mg/kg to about 1 mg/kg, of at least about 0.001 mg/kg to about 0.5 mg/kg, at least about 0.01 mg/kg to about 0.25 mg/kg or at least about 0.01 mg/kg to about 0.25 mg/kg of body weight, although other dosages may provide beneficial results.
  • a gene therapy vector comprising a promoter operably linked to a nucleic acid sequence comprising an open reading frame encoding APOE2 and a 3’ untranslated region (3’ UTR), and a nucleotide sequence having RNAi sequences corresponding to APOE4 for inhibition of APOE4 mRNA.
  • Jhe vector comprises the nucleotide sequence, in one embodiment, the nucleotide sequence is 5’ or 3' to the open reading frame. In one embodiment, the nucleotide sequence is 5’ and 3’ to the open reading frame. In one embodiment, the nucleotide sequence is on a different vector.
  • the vector is a viral vector
  • the viral vector is an AAV, adenovirus, lenti virus, herpesvirus or retrovirus vector.
  • the AAV is AAV5, AAV9 or AAVrhlQ.
  • the APOE4 is human APOE4.
  • the APOE2 is human APOE2.
  • the nucleotide sequence is linked to a second promoter.
  • the second promoter is a Po1lII promoter.
  • the RNAi comprises miRNA including a plurality of miRNA sequences.
  • the RNAi comprises siRNA including a plurality of siRNA sequences.
  • tire open reading frame comprises a plurality of silent nucleotide substitutions. In one embodiment, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the codons have a silent nucleotide substitution.
  • the open reading frame further comprises a peptide tag.
  • the tag comprises HA, histidine tag, AviTag, maltose binding tag, Strep-tag, FLAG-tag, V5-tag, Myc-tag, Spot-tag, T7 tag, or NE-tag.
  • the cell is a mammalian cell, in one embodiment, the cell is a human cell. In one embodiment, the mammal is a non-human primate. In one embodiment, the mammal is a human.
  • a method to prevent, inhibit or heat Alzheimer’s disease in a mammal comprising: administering to the mammal an effective amount of a composition comprising the gene therapy vector.
  • a method to prevent, inhibit or dear a disease associated with APOE4 expression in a mammal comprising: administering to the mammal an effective amount of a composition comprising the gene therapy vector.
  • a composition comprises liposomes comprising the vector.
  • the composition comprises nanoparticles comprising the nucleic acid, in one embodiment, the gene therapy vector comprises a viral vector.
  • the mammal is a E2/E4 heterozygote. In one embodiment, the mammal is a E4/E4 homozygote.
  • the composition is systemically administered, in one embodiment, the composition is orally administered. In one embodiment, the composition is intravenously administered. In one embodiment, the composition is locally administered. In one embodiment, the composition is injected. In one embodiment, the composition is administered to the central nervous system. In one embodiment, the composition is administered to the brain. In one embodiment, the composition is a sustained release composition.
  • the mammal is a human.
  • the RNAi sequences comprise a plurality of miRNA sequences, e.g., identical miRNA sequences.
  • AD Alzheimer’s disease
  • Adeno-associated virus (AAV) delivery of the human APOE2 gene to murine models of AD expressing human APOE4 demonstrated reduced amyloid-b peptide and amyloid burden.
  • the odds ratio of developing AD is reduced in E2/ ⁇ 4 heterozygotes compared with E4/E4 homozygotes (2.6 vs. 14.9).
  • gene therapy such as AAV therapy is designed to deliver both the human APOE2 gene coding sequence and artificial RNAs such as microRNA(s) (miRNA) targeted to the endogenous APOE4.
  • miRNA microRNA(s)
  • siRNA interacts with mRNA to silence translation.
  • a DNA sequence such as a gene therapy expression vector
  • the targeting sequence must be embedded in a small hairpin RNA (shRNA) or iniRNA scaffold
  • shRNA small hairpin RNA
  • the vector-expressed artificial miRNAs are similar to endogenous RNAi's and undergo two processing steps. Since miRNAs are expressed at lower levels they are less likely to induce liver and CNS toxicity upon delivery by gene therapy vectors.
  • knockdown with miRNA against all isoforms of endogenous APOE may be accomplished using multiple miRNAs targeting different sections of APOE mRNA, thereby enhancing silencing.
  • vector-derived human APOE2 may contain silent mutations in the coding sequence to prevent silencing.
  • the miRNA having the RNAi sequences to inhibit APOE4 expression may be inserted into 5’ non-coding sequences, e.g., an intron, and/or 3’ non-coding sequences. Multiple miRNAs can be placed in tandem for enhanced silencing of, e.g., APOE4. It was found that the level of hAPOE2-HA and miRNA expression were similar. There was a lower level of miRNA expression (compared with an U6 promoter) which in turn results in fewer off- target effects and lower potential for toxicity.
  • a constitutive promoter such as CAG drives hAPOE2-HA and an U6 promoter (an exemplary Pol III promoter) promoter drives miRNA.
  • multiple miRNAs are placed in tandem to enhance silencing of APOE4, e.g., 2, 3 4 or more miRNAs.
  • Pol III promoters are used for transcription of rRNA, tRNA, and/or miRNA.
  • a vector may have a defined terminator, e.g., no poly A is needed since PoUII transcription is terminated by an oligo (dT) stretch in the non-template strand (dA in the template strand ) ).
  • a two vector system may be employed where the second vector includes a stuffer sequence, e.g., for a reporter gene, to maintain length and track expression.
  • the disclosure provides for a vector, e.g., a viral vector such as an AAV vector, delivering both the human APOE2 gene and artificial miRNAs targeting human APOE4.
  • a viral vector such as an AAV vector
  • These gene therapy vectors can be used to mitigate the risk of AD development in APOE4 homozygous individuals (as well as E2/E4 heterozygotes) by tipping tire balance toward the expression of tire beneficial APOE2 allele.
  • the vector is useful in disorders or diseases which may benefit from increased APOE2 and/or decreased APOE4.
  • the vector is delivered to a mammal such as human at risk of AD.
  • AD currently affects 5 million people in the US and worldwide prevalence is expected to rise to 65 million by 2030.
  • Global prevalence of the APOE4 allele is 15% and about 50% of AD patients carry at least one APOE4 allele.
  • Detrimental APOE4 gene is targeted for decreased expression while protective APOE2 expression is provided and the risk related to APOE4 is further reduced compared to a gene therapy that only delivers APOE2.
  • Figure 5 shows a system where miRNA knocks down all APOE isoform expression and where the vector derived APOE2 is resistant to miRNA.
  • the level of hApoE2-HA and miRNA expression were similar and a lower level of miRNA expression (compared with 116 promoter) may mean less silencing, however, there are also fewer off-targets and toxicity.
  • miRNA can be inserted in the CAG intron or 3’ untranslated region.
  • Figure 6 depicts testing of APOE knockdown efficiency by siRNAs in U87 cells.
  • siRNAs targeting the coding sequence of APOE were generated based on a compari son of multiple siRNA design algorithms.
  • siRNAs were transfected into U87 cells (astroglioma cell line), and APOE rnRNA copies were quantified by RT-qPCR. The identified sequences were as follows:
  • Non-targeting siRNA is GTAGCGACTAAACACATGAuu (SEQ ID NOG)
  • siRNAs include:
  • GCCGATGACCTGCAGAAGCuu SEQ ID NO:20
  • GCGCGCGGATGGAGGAGATuu SEQ ID NO:21
  • GTAAGCGGCTCCTCCGCGAuu SEQ ID NO:22
  • siRNA The sequence from one siRNA (#2 above) was converted into a miRNA.
  • a scaffold based on a modified version of mirl55 (Fowler et al. 2015 Nuci.
  • any miRNA backbone may be employed, e.g., mir2L mir30 or mir33.
  • a miR from siRNA#2 the following may be employed: CTGGAGGCTTGCTGAAGGCTGTATGCTGATTTGTAGGCCTTCAACTCC T
  • the miRNA has one or more of: a U or A at guide position 1 relative to the 5 ’ microprocessor cleavage site, U or A at positions 2- 7, 10-14 and 17, and G or C at positions 19-21, and/or G/C content of 36.4% to 45.5%, and/or a guide strand that is 2 nucleotides longer than passenger strand, and/or mismatches in 1) a loop where 3 to 5 adjacent nucleotides of the guide strand are not base paired with target strand, 2) a 3 bp spaced mismatch where 2 single guide strand nucleotide mismatches are separated by 3 guide/passenger base pairs and/or 3) a 4 bp spaced mismatch where 2 single guide strand nucleotide mismatches are separated by 4 guide/passenger base pairs.
  • Mismatches in the passenger strand were chosen for optimal GC content and position. Mfold was used to predict miRNA hairpin secondary structures. Two tandem copies of the miRNA were cloned into either the CAG intron or the 3’ untranslated region of the pAAV expression cassette. Up to four copies of the miRNA (of that length) can be inserted within the AAV size limits.
  • Vector derived APOE2 was modified to be resistant to silencing by the targeting miRNA mentioned above (see underlined sequence below). Silent changes were made in the nucleotide sequence of the miRNA targeting region (red/bold).
  • CTGTGCCCAGCGACAATCAC (SEQ ID NO:26);
  • CTGTGCCCAGCGACAATCAC (SEQ ID NO:27);
  • CTGTGCCCAGCGACAATCAC (SEQ ID NO:29);
  • CTGTGCCCAGCGACAATCAC SEQ ID NO:30
  • CTGTGCCCAGCGACAATCAC (SEQ ID NO:32).
  • Vectors may be tested in non-human animals such as mice.
  • the vector includes sequences from the AAV9-CAG-APOE2 vector (AAV9-APOE2), the adeno-associated viral vector serotype 9 expressing the APOE2 behind the chicken ⁇ actin promoter or from the AAVrh.10-CAG- APOE2 vector (AAVrh.10-APOE2), the rhesus adeno-associated viral vector serotype 10 expressing the APOE2 transgene behind the chicken ⁇ actin promoter.
  • AAV9-APOE2 vector AAV9-APOE2 vector
  • AAVrh.10-APOE2 vector AAVrh.10-APOE2 vector
  • the rhesus adeno-associated viral vector serotype 10 expressing the APOE2 transgene behind the chicken ⁇ actin promoter.
  • the AAVrh.10 and AAV9 vectors may be produced and purified as described previously (Sondhi et ah, 2007, 2012; Zolotukhin et ah, 2002). Briefly, the vectors are produced by cotransfection of HEK293T ceils with an expression cassette plasmid and adenoviral helper plasmids.
  • the packaging cell line, HEK293T is maintained in Duibecco’s modified Eagles medium, supplemented with 5% fetal bovine serum, 100 U/mL penicillin, 100 mg/mL streptomycin, and maintained at 37°C with 5% CO2.
  • the cells are plated at 30%-40% confluence in CellSTACKS (Corning, Tewksbury, MA) for 24 hours (or when at 70%-80% confluence) followed by transfection with plasmids using the PEIpro procedure.
  • the cells are incubated at 37°C for 3 days before harvesting and lysing by 5 freeze/thaw cycles.
  • the resulting cell lysate is treated with 50 U/mL of Benzonase at 37°C for 30 minutes.
  • the cell lysate is purified by iodixanoi density gradient followed by Q-HP ion-exchange chromatography.
  • the cell lysate is precipitated in PEG (final concentration of PEG: 8%) overnight. After centrifugation, the supernatant is discarded and the pellet is resuspended in 15 mL lysis buffer (150 niM NaCl, 50 niM Tris-HC1, pH 8.5). The sample is purified by centrifugation through 1.37 g/mL CsCl in a 38.5 mL polyaliomer tube using an SW28 rotor at 24,000 rpm (182,000g), at 20°C for 24 hours. A 21-gauge needle (Hamilton, Reno, NV) is inserted through the bottom side of the centrifuge tube and 1 mL fractions are collected.
  • PEG final concentration of PEG: 8%
  • Vector-containing fractions are determined by dot blot with a 32 P- labe!ed probe containing the sequence of the vector constructs.
  • the positive fractions are subsequently pooled and diluted with 1.37 g/mL CsCl, and the samples are loaded into a 13.5 mL Quick-Seal tube and centrifuged in an ultra- centrifuge (Beckman LE-80K; Beckman Coulter, Fullerton, CA) 90 Ti rotor, at 67,000 rpm (384,000g), 20°C for 16-20 hours. Fractions (0.5 mL) are collected, and the positive fractions were pooled.
  • the purified AAVrh.10 or AAV9 vectors ttre concentrated in phosphate-buffered saline (PBS).
  • PBS phosphate-buffered saline
  • Vector genome titer is determined by Taq-Man quantitative polymerase chain reaction.
  • the purified vectors are sterile filtered; tested 14 days for growth on medium supporting the growth of aerobic bacteria, anaerobic bacteria, or fungi; tested for endotoxin; and demonstrated to be mycoplasma free. .
  • the AAV preparation (2 mL, 1.0 x 10 10 vg or at another dose) may be injected using, e.g., a 33-gauge needle (Hamilton) and a syringe pump (KD Scientific, Holliston, MA) at a rate of 0.2 mL /min.
  • a 33-gauge needle Hamilton
  • a syringe pump KD Scientific, Holliston, MA
  • Schmechel et al Proc. Natl. Acad. Sci. U.S.A., 90:9649e9653 (1993). Schmued and Hopkins, Brain Res.. 874:123 (2000).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Toxicology (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
PCT/US2020/056051 2019-10-16 2020-10-16 Gene therapy for alzheimer's disease Ceased WO2021076941A1 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
CA3157864A CA3157864A1 (en) 2019-10-16 2020-10-16 Gene therapy for alzheimer's disease
CN202080073402.8A CN114761569A (zh) 2019-10-16 2020-10-16 阿尔茨海默氏病的基因疗法
EP20804387.7A EP4045653A1 (en) 2019-10-16 2020-10-16 Gene therapy for alzheimer's disease
BR112022007010A BR112022007010A2 (pt) 2019-10-16 2020-10-16 Terapia gênica para doença de alzheimer
KR1020227016247A KR20220082050A (ko) 2019-10-16 2020-10-16 알츠하이머병에 대한 유전자 요법
MX2022004524A MX2022004524A (es) 2019-10-16 2020-10-16 Tratamiento génico para la enfermedad de alzheimer.
JP2022522814A JP2023500793A (ja) 2019-10-16 2020-10-16 アルツハイマー病に対する遺伝子治療方法
AU2020367437A AU2020367437B2 (en) 2019-10-16 2020-10-16 Gene therapy for Alzheimer's disease
US17/769,255 US20230405148A1 (en) 2019-10-16 2020-10-16 Gene therapy for alzheimer's disease
IL292148A IL292148A (en) 2019-10-16 2022-04-11 Gene therapy for Alzheimer's disease
ZA2022/05344A ZA202205344B (en) 2019-10-16 2022-05-13 Gene therapy for alzheimer's disease
CONC2022/0006367A CO2022006367A2 (es) 2019-10-16 2022-05-16 Tratamiento génico para la enfermedad de alzheimer
AU2025200812A AU2025200812A1 (en) 2019-10-16 2025-02-06 Gene therapy for Alzheimer's disease
JP2025233417A JP2026041903A (ja) 2019-10-16 2025-12-05 アルツハイマー病に対する遺伝子治療方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962915988P 2019-10-16 2019-10-16
US62/915,988 2019-10-16

Publications (2)

Publication Number Publication Date
WO2021076941A1 true WO2021076941A1 (en) 2021-04-22
WO2021076941A9 WO2021076941A9 (en) 2021-10-07

Family

ID=73288693

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/056051 Ceased WO2021076941A1 (en) 2019-10-16 2020-10-16 Gene therapy for alzheimer's disease

Country Status (13)

Country Link
US (1) US20230405148A1 (https=)
EP (1) EP4045653A1 (https=)
JP (2) JP2023500793A (https=)
KR (1) KR20220082050A (https=)
CN (1) CN114761569A (https=)
AU (2) AU2020367437B2 (https=)
BR (1) BR112022007010A2 (https=)
CA (1) CA3157864A1 (https=)
CO (1) CO2022006367A2 (https=)
IL (1) IL292148A (https=)
MX (1) MX2022004524A (https=)
WO (1) WO2021076941A1 (https=)
ZA (1) ZA202205344B (https=)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3887396A4 (en) * 2018-11-28 2022-09-07 Prevail Therapeutics, Inc. GENE THERAPIES FOR NEURODEGENERATIVE DISEASES
WO2023198745A1 (en) * 2022-04-12 2023-10-19 Uniqure Biopharma B.V. Nucleic acid regulation of apoe
WO2024011237A1 (en) * 2022-07-08 2024-01-11 Cornell University Methods and pharmaceutical compositions for the treatment and the prevention of alzheimers disease
WO2025213111A3 (en) * 2024-04-05 2025-12-04 Cornell University Aav expression of mirna to suppress human apoe mrna
US12611467B2 (en) 2020-11-25 2026-04-28 Cornell University APOE gene therapy

Citations (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4797368A (en) 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
US4863457A (en) 1986-11-24 1989-09-05 Lee David A Drug delivery device
US5378475A (en) 1991-02-21 1995-01-03 University Of Kentucky Research Foundation Sustained release drug delivery devices
US5443505A (en) 1993-11-15 1995-08-22 Oculex Pharmaceuticals, Inc. Biocompatible ocular implants
US5464758A (en) 1993-06-14 1995-11-07 Gossen; Manfred Tight control of gene expression in eucaryotic cells by tetracycline-responsive promoters
US5578709A (en) 1993-03-09 1996-11-26 Middlesex Sciences, Inc. Macromolecular microparticles and methods of production
US5603960A (en) 1993-05-25 1997-02-18 O'hagan; Derek T. Preparation of microparticles and method of immunization
US5723269A (en) 1992-07-24 1998-03-03 Takeda Chemical Industries, Ltd. Microparticle preparation and production thereof
US5814618A (en) 1993-06-14 1998-09-29 Basf Aktiengesellschaft Methods for regulating gene expression
US5871747A (en) 1992-09-11 1999-02-16 Institut Pasteur Antigen-carrying microparticles and their use in the indication of humoral or cellular responses
US5981719A (en) 1993-03-09 1999-11-09 Epic Therapeutics, Inc. Macromolecular microparticles and methods of production and use
US6022564A (en) 1996-10-09 2000-02-08 Takeda Chemical Industries, Ltd. Method for producing a microparticle
US6090925A (en) 1993-03-09 2000-07-18 Epic Therapeutics, Inc. Macromolecular microparticles and methods of production and use
US6210707B1 (en) 1996-11-12 2001-04-03 The Regents Of The University Of California Methods of forming protein-linked lipidic microparticles, and compositions thereof
US6264987B1 (en) 2000-05-19 2001-07-24 Alkermes Controlled Therapeutics Inc. Ii Method for preparing microparticles having a selected polymer molecular weight
US6309569B1 (en) 1998-05-13 2001-10-30 Microbiological Research Authority Encapsulation of bioactive agents
US6342390B1 (en) 1994-11-23 2002-01-29 The United States Of America As Represented By The Secretary Of Health And Human Services Lipid vesicles containing adeno-associated virus rep protein for transgene integration and gene therapy
US6565777B2 (en) 1998-05-13 2003-05-20 Microbiological Research Authority Encapsulation of bioactive agents
US6723551B2 (en) 2001-11-09 2004-04-20 The United States Of America As Represented By The Department Of Health And Human Services Production of adeno-associated virus in insect cells
US6884435B1 (en) 1997-01-30 2005-04-26 Chiron Corporation Microparticles with adsorbent surfaces, methods of making same, and uses thereof
US6913767B1 (en) 1993-10-25 2005-07-05 Genentech, Inc. Compositions for microencapsulation of antigens for use as vaccines
US7112715B2 (en) 2000-10-03 2006-09-26 Gie-Cerbm, Centre Europeen De Recherche En Biologie Et En Medecine (Gie) Transgenic mouse for targeted recombination mediated by modified Cre-ER
US20070081972A1 (en) 2005-09-30 2007-04-12 The University Of Iowa Research Foundation Polymer-based delivery system for immunotherapy of cancer
WO2012054425A2 (en) 2010-10-18 2012-04-26 University Of Iowa Research Foundation Biodegradable particulate formulations
WO2012115806A1 (en) 2011-02-24 2012-08-30 University Of Iowa Research Foundation New biodegradable polymers with sulfenamide bonds for drug delivery applications
WO2013172964A1 (en) * 2012-05-18 2013-11-21 University Of Iowa Research Foundation Methods and compositions for treating amyloid deposits
WO2015077473A1 (en) * 2013-11-20 2015-05-28 University Of Iowa Research Foundation Methods and compositions for treating amyloid deposits
WO2018045347A1 (en) * 2016-09-02 2018-03-08 Spark Therapeutics, Inc. Methods and vectors for treating cns disorders
WO2020112802A1 (en) * 2018-11-28 2020-06-04 Prevail Therapeutics, Inc. Gene therapies for neurodegenerative disease

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1752536A4 (en) * 2004-05-11 2008-04-16 Alphagen Co Ltd POLYNUCLEOTIDE CAUSING RNA INTERFERENCE AND METHOD OF REGULATING GENE EXPRESSION WITH THE USE OF THE SAME
CA2643048A1 (en) * 2006-02-21 2007-08-30 Oklahoma Medical Research Foundation Treatment of alzheimer's disease with inhibitors of apoe binding to apoe receptor
KR20140102327A (ko) * 2007-02-06 2014-08-21 유태준 유전자 요법을 사용한 신경퇴행성 질환의 치료 및 예방
WO2013181618A2 (en) * 2012-05-31 2013-12-05 The Trustees Of Columbia University In The City Of New York Methods to treat alzheimer's disease using apoe inhibitors
US11071791B2 (en) * 2018-01-26 2021-07-27 Wisconsin Alumni Research Foundation Vector for gene silencing and replacement and methods of use thereof

Patent Citations (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4797368A (en) 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
US4863457A (en) 1986-11-24 1989-09-05 Lee David A Drug delivery device
US5378475A (en) 1991-02-21 1995-01-03 University Of Kentucky Research Foundation Sustained release drug delivery devices
US5723269A (en) 1992-07-24 1998-03-03 Takeda Chemical Industries, Ltd. Microparticle preparation and production thereof
US5871747A (en) 1992-09-11 1999-02-16 Institut Pasteur Antigen-carrying microparticles and their use in the indication of humoral or cellular responses
US6090925A (en) 1993-03-09 2000-07-18 Epic Therapeutics, Inc. Macromolecular microparticles and methods of production and use
US5578709A (en) 1993-03-09 1996-11-26 Middlesex Sciences, Inc. Macromolecular microparticles and methods of production
US5981719A (en) 1993-03-09 1999-11-09 Epic Therapeutics, Inc. Macromolecular microparticles and methods of production and use
US5603960A (en) 1993-05-25 1997-02-18 O'hagan; Derek T. Preparation of microparticles and method of immunization
US5464758A (en) 1993-06-14 1995-11-07 Gossen; Manfred Tight control of gene expression in eucaryotic cells by tetracycline-responsive promoters
US5814618A (en) 1993-06-14 1998-09-29 Basf Aktiengesellschaft Methods for regulating gene expression
US6913767B1 (en) 1993-10-25 2005-07-05 Genentech, Inc. Compositions for microencapsulation of antigens for use as vaccines
US5443505A (en) 1993-11-15 1995-08-22 Oculex Pharmaceuticals, Inc. Biocompatible ocular implants
US6821511B2 (en) 1994-11-23 2004-11-23 The United States Of America As Represented By The Department Of Health And Human Services Methods of using adeno-associated virus rep protein
US6342390B1 (en) 1994-11-23 2002-01-29 The United States Of America As Represented By The Secretary Of Health And Human Services Lipid vesicles containing adeno-associated virus rep protein for transgene integration and gene therapy
US6022564A (en) 1996-10-09 2000-02-08 Takeda Chemical Industries, Ltd. Method for producing a microparticle
US6210707B1 (en) 1996-11-12 2001-04-03 The Regents Of The University Of California Methods of forming protein-linked lipidic microparticles, and compositions thereof
US6528087B2 (en) 1996-11-12 2003-03-04 The Regents Of The University Of California Kits for forming protein-linked lipidic microparticles
US6884435B1 (en) 1997-01-30 2005-04-26 Chiron Corporation Microparticles with adsorbent surfaces, methods of making same, and uses thereof
US6309569B1 (en) 1998-05-13 2001-10-30 Microbiological Research Authority Encapsulation of bioactive agents
US6565777B2 (en) 1998-05-13 2003-05-20 Microbiological Research Authority Encapsulation of bioactive agents
US6379704B2 (en) 2000-05-19 2002-04-30 Alkermes Controlled Therapeutics Inc. Ii Method for preparing microparticles having a selected polymer molecular weight
US6534092B2 (en) 2000-05-19 2003-03-18 Alkermes Controlled Therapeutics, Inc. Ii Method for preparing microparticles having a selected polymer molecular weight
US6264987B1 (en) 2000-05-19 2001-07-24 Alkermes Controlled Therapeutics Inc. Ii Method for preparing microparticles having a selected polymer molecular weight
US7112715B2 (en) 2000-10-03 2006-09-26 Gie-Cerbm, Centre Europeen De Recherche En Biologie Et En Medecine (Gie) Transgenic mouse for targeted recombination mediated by modified Cre-ER
US6723551B2 (en) 2001-11-09 2004-04-20 The United States Of America As Represented By The Department Of Health And Human Services Production of adeno-associated virus in insect cells
US20070081972A1 (en) 2005-09-30 2007-04-12 The University Of Iowa Research Foundation Polymer-based delivery system for immunotherapy of cancer
WO2012054425A2 (en) 2010-10-18 2012-04-26 University Of Iowa Research Foundation Biodegradable particulate formulations
WO2012115806A1 (en) 2011-02-24 2012-08-30 University Of Iowa Research Foundation New biodegradable polymers with sulfenamide bonds for drug delivery applications
WO2013172964A1 (en) * 2012-05-18 2013-11-21 University Of Iowa Research Foundation Methods and compositions for treating amyloid deposits
WO2015077473A1 (en) * 2013-11-20 2015-05-28 University Of Iowa Research Foundation Methods and compositions for treating amyloid deposits
WO2018045347A1 (en) * 2016-09-02 2018-03-08 Spark Therapeutics, Inc. Methods and vectors for treating cns disorders
WO2020112802A1 (en) * 2018-11-28 2020-06-04 Prevail Therapeutics, Inc. Gene therapies for neurodegenerative disease

Non-Patent Citations (89)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. AF085716
BAEK ET AL., PLOS ONE, vol. 5, 2010, pages e13468
BALES ET AL., J. NEUROSCI., vol. 29, 2009, pages 3603e3612
BALES ET AL., NAT. GENET., vol. 17, 1997
BANTEL-SCHAAL ET AL., J. VIROL., vol. 73, no. 2, 1999, pages 1309
BOREL ET AL.: "Pathways to inhibit mRNA", MOL THER, vol. 22, 2014, pages 692 - 701
BOUDREAUDAVIDSON: "Production of inhibitory RNAs from an exemplary target transcript template", METHODS IN ENZYMOLOGY, vol. 507, 2012
BOYLES ET AL., J. CLIN. INVEST., vol. 76, 1985, pages 1501el513
CARRASQUILLO ET AL., NEUROBIOL. AGING, vol. 36, 2015, pages 60e67
CARTER, HUM. _ GENE THER., vol. 16, 2005, pages 541
CASTELLANO ET AL., SCI. TRANSL. MED., vol. 3, 2011, pages 89ra57
CEARLEY ET AL., MOLECULAR THERAPY, vol. 13, no. 3, 2006, pages 528
CEARLEYWOLFE, J. NEUROSCI., vol. 27, 2007, pages 9928
CHERNICK DUSTIN ET AL: "Peripheral versus central nervous system APOE in Alzheimer's disease: Interplay across the blood-brain barrier", NEUROSCIENCE LETTERS, ELSEVIER, AMSTERDAM, NL, vol. 708, 7 June 2019 (2019-06-07), XP085799834, ISSN: 0304-3940, [retrieved on 20190607], DOI: 10.1016/J.NEULET.2019.134306 *
CHIORINI ET AL., J. VIROL., vol. 71, 1997, pages 6823
CISMARU ET AL., REV. ROUM. CHIM., vol. 55, no. 8, 2010, pages 433 - 442
CORDER ET AL., NAT. GENET., vol. 7, 1994, pages 180e184
CORDER ET AL., SCIENCE, vol. 261, 1993, pages 921e923
DALY ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 96, 1999, pages 2296
DANIEL K. FOWLER ET AL: "Improved knockdown from artificial microRNAs in an enhanced miR-155 backbone: a designer's guide to potent multi-target RNAi", NUCLEIC ACIDS RESEARCH, vol. 44, no. 5, 17 November 2015 (2015-11-17), GB, pages e48 - e48, XP055480853, ISSN: 0305-1048, DOI: 10.1093/nar/gkv1246 *
DEANE ET AL., J. CLIN. INVEST., vol. 118, 2008, pages 4002e4013
DEMATTOS ET AL., NEUROCHEM. INT., vol. 39, 2001, pages 415e425
DIBATTISTA ET AL., CURR. ALZHEIMER RES., vol. 13, 2016, pages 1200
DODART ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 102, 2005, pages 1211e1216
E. HUDRY ET AL: "Gene Transfer of Human Apoe Isoforms Results in Differential Modulation of Amyloid Deposition and Neurotoxicity in Mouse Brain", SCIENCE TRANSLATIONAL MEDICINE, vol. 5, no. 212, 20 November 2013 (2013-11-20), US, pages 212ra161 - 212ra161, XP055219657, ISSN: 1946-6234, DOI: 10.1126/scitranslmed.3007000 *
FAGAN ET AL., NEUROBIOL. DIS., vol. 9, 2002, pages 305e318
FAN ET AL., BIOFACTORS, vol. 35, 2009, pages 239e248
FARRER ET AL., JAMA, vol. 278, 1997, pages 1349el356
FOWLER ET AL., NUCL ACIDS RES., vol. 44, 2015, pages e48
GAMES ET AL., NATURE, vol. 373, 1995, pages 523e527
GAO ET AL., J. VIROL., vol. 78, 2004, pages 6381
GAO ET AL., MOL. THER., vol. 13, no. 1, 2006, pages 77
GAO ET AL., PROC. NATL. ACAD. SCI. USA., vol. 99, 2002, pages 11854
GOEDDEL: "Gene Expression Technology: Methods in Enzymology", vol. 185, 1990, ACADEMIC PRESS
HAASSSELKOE, NAT. REV. MOL. CELL BIOL., vol. 8, 2007, pages 101e112
HARDYSELKOE, SCIENCE, vol. 297, 2002, pages 353e356
HASHIMOTO ET AL., J. NEUROSCI., vol. 32, 2012, pages 15181e15192
HATTERS ET AL., TRENDS BIOCHEM. SCI., vol. 31, 2006, pages 445e454
HEFFERNAN AET, J. MOL. NEUROSCI., vol. 60, 2016, pages 316
HOLTZMAN ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 97, 2000, pages 2892e2897
HUDRY ET AL., SCI. TRANSL. MED., vol. 5, 2013, pages 212ra161
IM ET AL., CELL, vol. 61, 1990, pages 447
INDRA ET AL., NUC. ACID. RES., vol. 27, 1999, pages 4324
JOHNSON-WOOD ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 94, 1997, pages 1550el555
KIM ET AL., J. NEUROSCI., vol. 31, 2011, pages 18007e18012
KIM ET AL., NEURON, vol. 63, 2009, pages 287e303
KRAMERFUSSENEGGER, METHODS MOL. BIOL., vol. 308, 2005, pages 123
KUMARI ET AL., COLLOIDS AND SURFACES B: BIOINTERFACES, vol. 75, 2010, pages 1 - 18
LAMBERT ET AL., NAT. GENET., vol. 45, 2013, pages 1452el458
LEMEREMASLIAH, NAT. REV. NEUROL., vol. 6, 2010, pages 108el19
LIU ET AL., NAT. REV. NEUROL., vol. 9, 2013, pages 106el18
LONG WU ET AL: "Human ApoE Isoforms Differentially Modulate Brain Glucose and Ketone Body Metabolism: Implications for Alzheimer's Disease Risk Reduction and Early Intervention", THE JOURNAL OF NEUROSCIENCE, vol. 38, no. 30, 2 July 2018 (2018-07-02), US, pages 6665 - 6681, XP055766409, ISSN: 0270-6474, DOI: 10.1523/JNEUROSCI.2262-17.2018 *
MANELLI ET AL., J. MOL. NEUROSCI., vol. 23, 2004, pages 235e246
MAO ET AL., HUM. GENE THERAPY, vol. 22, 2011, pages 1525
MIRNA SAFIEH ET AL: "ApoE4: an emerging therapeutic target for Alzheimer's disease", BMC MEDICINE, vol. 17, no. 1, 20 March 2019 (2019-03-20), XP055767787, DOI: 10.1186/s12916-019-1299-4 *
MORRIS ET AL., ANN. NEUROL, vol. 67, 2010, pages 122e131
MUÑOZ SONIA SANZ ET AL: "Understanding the Role of ApoE Fragments in Alzheimer's Disease", NEUROCHEMICAL RESEARCH, PLENUM PRESS, NEW YORK, US, vol. 44, no. 6, 17 September 2018 (2018-09-17), pages 1297 - 1305, XP036785635, ISSN: 0364-3190, [retrieved on 20180917], DOI: 10.1007/S11064-018-2629-1 *
NAGAVARMA ET AL., ASIAN J. OF PHARMA. AND CLIN. RES., vol. 5, 2012, pages 16 - 23
NIWA ET AL., GENE, vol. 108, 1991, pages 193
NO ET AL., PROC. NATL. ACAD. SCI., vol. 93, 1996, pages 3346
NUC. ACID. RES., vol. 28, 2000, pages e99
RAMANAN ET AL., MOL. PSYCHIATRY, vol. 19, 2013, pages 351e357
REBECK ET AL., NEURON, vol. 11, 1993, pages 575e580
REIMAN ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 106, 2009, pages 6820e6825
ROSENBERG ET AL., HUM. GENE THER. CLIN. DEV., vol. 29, 2018, pages 24
RUTLEDGE ET AL., J. VIROL., vol. 72, 1998, pages 309
SAFIEH ET AL., BMC MEDICINE, vol. 17, 2019, pages 64
SAUNDERS ET AL., NEUROLOGY, vol. 43, 1993, pages 1467e1472
SCHMUEDHOPKINS, BRAIN RES., vol. 874, 2000, pages 123
SCHNEPP ET AL., METH. MOI. MED., vol. 69, 2002, pages 427
SONDHI ET AL., HUM. GENE THER. METHOD, vol. 23, 2012, pages 324e335
SONDHI ET AL., MOL. THER., vol. 15, 2007, pages 481e491
SRIVASTAVA, J. VIROL., vol. 45, 1983, pages 555
STRITTMATTER ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 90, 1993, pages 1977e1981
SULLIVAN ET AL., J. BIOL. CHEM, vol. 272, 1997, pages 17972e17980
SULLIVAN ET AL., NEUROBIOL. AGING., vol. 32, 2011, pages 791e801
SURI ET AL., NEUROSCI. BIOBEHAV. REV., vol. 37, 2013, pages 2878e2886
TALBOT ET AL., LANCET, vol. 343, 1994, pages 1432e1433
TSIRKA ET AL., PROC. NATL. ACAD. SCI., vol. 94, 1997, pages 9779
WALKER ET AL., ACTA NEUROPATHOL., vol. 100, 2000, pages 36e42
WATANABE ET AL., GENE THER., vol. 17, no. 8, 2010, pages 1042
WRIGHT ET AL., CURR. OPIN. DRUG DISCOV. DEVEL., vol. 6, no. 2, 2003, pages 174 - 178
WRIGHT ET AL., MOLECULAR THERAPY, vol. 12, 2005, pages 171 - 178
WU ET AL., J. VIROL., vol. 74, 2000, pages 8635
YOUMANS ET AL., J. BIOL. CHEM., vol. 287, 2012, pages 41774e41786
YU ET AL., ANNU. REV. NEUROSCI., vol. 37, 2014, pages 79e100
ZHAO ET AL., NEUROBIOL AGING, vol. 44, 2016, pages 159
ZHAO LINGZHI ET AL: "Intracerebral adeno-associated virus gene delivery of apolipoprotein E2 markedly reduces brain amyloid pathology in Alzheimer's disease mouse models", NEUROBIOLOGY OF AGING, TARRYTOWN, NY, US, vol. 44, 30 April 2016 (2016-04-30), pages 159 - 172, XP029606048, ISSN: 0197-4580, DOI: 10.1016/J.NEUROBIOLAGING.2016.04.020 *
ZOLOTUKHIN ET AL., METHODS, vol. 28, 2002, pages 158el67

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3887396A4 (en) * 2018-11-28 2022-09-07 Prevail Therapeutics, Inc. GENE THERAPIES FOR NEURODEGENERATIVE DISEASES
US12611467B2 (en) 2020-11-25 2026-04-28 Cornell University APOE gene therapy
WO2023198745A1 (en) * 2022-04-12 2023-10-19 Uniqure Biopharma B.V. Nucleic acid regulation of apoe
WO2024011237A1 (en) * 2022-07-08 2024-01-11 Cornell University Methods and pharmaceutical compositions for the treatment and the prevention of alzheimers disease
WO2025213111A3 (en) * 2024-04-05 2025-12-04 Cornell University Aav expression of mirna to suppress human apoe mrna

Also Published As

Publication number Publication date
US20230405148A1 (en) 2023-12-21
CA3157864A1 (en) 2021-04-22
JP2026041903A (ja) 2026-03-10
JP2023500793A (ja) 2023-01-11
ZA202205344B (en) 2023-03-29
AU2020367437B2 (en) 2024-11-07
BR112022007010A2 (pt) 2022-07-12
AU2025200812A1 (en) 2025-02-27
MX2022004524A (es) 2022-07-21
EP4045653A1 (en) 2022-08-24
WO2021076941A9 (en) 2021-10-07
KR20220082050A (ko) 2022-06-16
IL292148A (en) 2022-06-01
AU2020367437A1 (en) 2022-06-02
CO2022006367A2 (es) 2022-08-09
CN114761569A (zh) 2022-07-15

Similar Documents

Publication Publication Date Title
JP7504967B2 (ja) MeCP2発現カセット
JP7182873B2 (ja) 多重ベクターシステム及びその使用
JP2023123765A (ja) 中枢神経系を標的化したaavベクター
AU2020367437B2 (en) Gene therapy for Alzheimer's disease
KR20220107243A (ko) Apoe 유전자 요법
AU2017227776A1 (en) AAV vectors for treatment of dominant retinitis pigmentosa
JP2025170347A (ja) 遺伝子治療発現カセットからの発現レベルを調節するための方法
WO2016073900A1 (en) Compositions and methods of treating usher syndrome iii
US20220162641A1 (en) Factor h vectors and uses thereof
WO2021183433A1 (en) Gene replacement therapy for foxg1 syndrome
AU2020212026A1 (en) Highly efficient transduction and lateral spread in the retina by a novel AAV virus enhanced by rational design
US20230414787A1 (en) Gene knock-out for treatment of glaucoma
HK40073494A (en) Gene therapy for alzheimer's disease
WO2025213111A2 (en) Aav expression of mirna to suppress human apoe mrna
US20250320503A1 (en) Aav vectors encoding sod1-targeting artificial mirnas (ami-rna)
CA3225080A1 (en) Kcnv2 gene therapy
WO2024229049A1 (en) Dual aav vectors for treating stargardt disease
TW202603169A (zh) Acta1表現控制元件
EA051485B1 (ru) Генная терапия kcnv2

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20804387

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3157864

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 17769255

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2022522814

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022007010

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 20227016247

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: NC2022/0006367

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 2020804387

Country of ref document: EP

Effective date: 20220516

ENP Entry into the national phase

Ref document number: 2020367437

Country of ref document: AU

Date of ref document: 20201016

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112022007010

Country of ref document: BR

Free format text: APRESENTE CESSAO DA PRIORIDADE US 62/915,988 ASSINADA PELOS INVENTORES RONALD G. CRYSTAL E KATIE STILES PARA CORNELL UNIVERSITY.

ENP Entry into the national phase

Ref document number: 112022007010

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20220412

REG Reference to national code

Ref country code: BR

Ref legal event code: B01Y

Ref document number: 112022007010

Country of ref document: BR

Kind code of ref document: A2

Free format text: ANULADA A PUBLICACAO CODIGO 1.5 NA RPI NO 2686 DE 28/06/2022 POR TER SIDO INDEVIDA.

WWP Wipo information: published in national office

Ref document number: NC2022/0006367

Country of ref document: CO