WO2021071292A9 - 락토바실러스 플란타럼 균주 등을 이용한 호흡기 질환 개선용 조성물 - Google Patents

락토바실러스 플란타럼 균주 등을 이용한 호흡기 질환 개선용 조성물 Download PDF

Info

Publication number
WO2021071292A9
WO2021071292A9 PCT/KR2020/013749 KR2020013749W WO2021071292A9 WO 2021071292 A9 WO2021071292 A9 WO 2021071292A9 KR 2020013749 W KR2020013749 W KR 2020013749W WO 2021071292 A9 WO2021071292 A9 WO 2021071292A9
Authority
WO
WIPO (PCT)
Prior art keywords
extract
lactobacillus plantarum
composition
respiratory
cells
Prior art date
Application number
PCT/KR2020/013749
Other languages
English (en)
French (fr)
Other versions
WO2021071292A3 (ko
WO2021071292A2 (ko
Inventor
이소영
김승용
남영도
박소림
신동욱
신희순
엄지은
정선영
최대운
Original Assignee
한국식품연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국식품연구원 filed Critical 한국식품연구원
Priority to CN202080072761.1A priority Critical patent/CN114615898A/zh
Priority to EP20875412.7A priority patent/EP4042880A4/en
Priority to US17/767,181 priority patent/US20220369684A1/en
Publication of WO2021071292A2 publication Critical patent/WO2021071292A2/ko
Publication of WO2021071292A3 publication Critical patent/WO2021071292A3/ko
Publication of WO2021071292A9 publication Critical patent/WO2021071292A9/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/747—Lactobacilli, e.g. L. acidophilus or L. brevis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/28—Asteraceae or Compositae (Aster or Sunflower family), e.g. chamomile, feverfew, yarrow or echinacea
    • A61K36/282—Artemisia, e.g. wormwood or sagebrush
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2400/00—Lactic or propionic acid bacteria
    • A23V2400/11—Lactobacillus
    • A23V2400/169—Plantarum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/30—Extraction of the material
    • A61K2236/33—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/30—Extraction of the material
    • A61K2236/37—Extraction at elevated pressure or temperature, e.g. pressurized solvent extraction [PSE], supercritical carbon dioxide extraction or subcritical water extraction
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/225—Lactobacillus
    • C12R2001/25—Lactobacillus plantarum

Definitions

  • the present invention Lactobacillus plantarum ( Lactobacillus plantarum ) KF511 strain, pink needle flower ( Epilobium angustifolium L. ) Extract or Artemisia capillaris Thunb. Food composition for enhancing respiratory function and improving respiratory diseases using an extract; Health functional food containing the food composition; And it relates to a pharmaceutical composition for preventing or treating respiratory diseases comprising an extract of wormwood as an active ingredient.
  • Bronchial asthma is an allergic disease characterized by reversible airway obstruction, airway hypersensitivity (increased airway resistance), mucus hypersecretion, and high serum IgE levels.
  • TH2 T helper 2
  • inflammatory cells such as T cells, eosinophils, and mast cells are proliferated, differentiated and activated, It is recognized as a chronic inflammatory disease because it migrates and infiltrates the tissues around the airways and airways (J Clin Invest, 111: 291-297, 2003; N Engl J. Med. 2001; 44(5): 350-62; Toshio Hirano). , Cytokine molecular biology, World Science, 2002). Therefore, inhibition of infiltration of inflammatory cells such as eosinophils is one of the important targets in the development of a therapeutic agent for asthma.
  • COPD chronic obstructive pulmonary disease
  • COPD chronic lung disease 2019
  • COPD chronic lung disease 2019
  • inflammation inflammation, protease activation in the lungs, oxidative stress, etc. are involved, and cells involved in inflammation are mainly neutrophils, macrophages, and T lymphocytes.
  • neutrophils secrete substances such as elastase, collagenase, proteases such as MPO (myeloperoxidase), arachidonic acid metabolites (arachidonate), reactive oxygen free radicals, etc.
  • bronchoalveolar lavage is used as a means to check the course of diseases such as COPD and asthma.
  • BALF bronchoalveolar lavage fluid
  • inflammatory cytokines, reactive oxygen species, leukotrienes, and activation Inflammatory mediators such as complement increase
  • neutrophils which account for less than 5% of the normal lung, increase to the extent that they account for 80% of the total cells.
  • An object of the present invention is Lactobacillus plantarum ( Lactobacillus plantarum ) KF511 strain, its culture, its concentrate or its dried product; Pink needle flower ( Epilobium angustifolium L. ) extract; Or Artemisia capillaris Thunb. It is to provide a food composition for enhancing respiratory function and improving respiratory diseases comprising an extract as an active ingredient, and a health functional food comprising the composition.
  • Another object of the present invention is Lactobacillus plantarum ( Lactobacillus plantarum ) KF511 strain, its culture medium, its concentrate or its dried product; It is to provide a pharmaceutical composition for the prevention or treatment of respiratory diseases comprising a pink needle flower extract or wormwood extract as an active ingredient.
  • Lactobacillus plantarum Lactobacillus plantarum
  • KF511 strain pink needle flower ( Epilobium angustifolium L. ) extract or Artemisia capillaris Thunb. ) extract
  • PMA phorbol
  • CSE Cigarette Smoke Extraction
  • lung tissue damage in a mouse model of respiratory disease induced by CSE and PPE, and contains total cells, macrophages, lymphocytes, eosinophils, and neutrophils in BALF.
  • the present invention was completed by confirming that there is an activity of inhibiting the infiltration of immune cells such as, and inhibiting the secretion of inflammatory cytokines and chemokines in BALF and lung tissue.
  • Lactobacillus plantarum Lactobacillus plantarum
  • KF511 strain Lactobacillus plantarum
  • a food composition for enhancing respiratory function and improving respiratory diseases comprising a pink needle flower extract or a wormwood extract as an active ingredient
  • a health functional food comprising the composition.
  • Lactobacillus plantarum refers to microorganisms of the genus Lactobacillus commonly found in various fermented foods and the intestinal tract of humans, which correspond to gram-positive bacteria. Lactobacillus plantarum is known to have the largest genome among lactic acid bacteria, and an appropriate pH required for growth and proliferation is 3.4 to 8.8, and an appropriate temperature range is 12°C to 40°C.
  • the Lactobacillus plantarum strain may be specifically "Lactobacillus plantarum KF511", and more specifically, it may be deposited under the accession number KCCM 12573P.
  • the strain is isolated and identified from fermented food, kimchi, the medium composition for its culture is MRS medium, the culture conditions are pH 6.5 ⁇ 0.2, temperature 37° C., and stirring culture for 24 hours, oxygen demand is facultative anaerobic, and freezing Strain preservation is possible through dry preservation or cell suspension freezing.
  • the Lactobacillus plantarum KF511 strain of the present invention has a 16s rDNA sequence (SEQ ID NO: 1) with a length of 1499 kb.
  • Lactobacillus plantarum KF511 strain of the present invention was deposited with the Korea Microorganism Conservation Center (KCCM), an international depository under the Budapest Treaty, as of August 21, 2019, and was given an accession number KCCM 12573P.
  • KCCM Korea Microorganism Conservation Center
  • the term "culture medium” or “culture” refers to a medium containing by-products and strains generated through metabolism of a strain by culturing a strain in a medium, specifically Lactobacillus planta. It may mean a culture solution or a culture of the rum KF511 strain.
  • the concentrate or dilution of the medium, the dried product obtained by drying the medium, the prepared or purified product of the medium, or a mixture thereof may also be included as an active ingredient in the composition of the present invention.
  • pink needle flower ( Epilobium angustifolium L. ) is a perennial plant of the dicotyledonous plant, giltaceae, and is also referred to as double needle flower and large needle flower. It is known that rhizomes and the like are medicinal, but nothing is known about the respiratory function enhancement, respiratory disease improvement, prevention or therapeutic activity of the pink needle flower extract or fraction.
  • artemisia capillaris Thunb. is a dicotyledonous perennial plant of the order Asteraceae of the order Asteraceae, also called wormwood or wormwood. Young shoots are edible and are known to be effective for use as a diuretic or for jaundice as a whole, but nothing is known about the respiratory function enhancement, improvement of respiratory diseases, prevention or treatment activity of wormwood extract or fractions.
  • extract refers to a plant to be extracted, that is, a stem, leaf, fruit, flower, root, or mixture thereof of a plant to be extracted, that is, water, a lower alcohol having 1 to 4 carbon atoms (methanol, ethanol, butanol, etc.) , methylene chloride, ethylene, acetone, hexane, ether, chloroform, ethyl acetate, butyl acetate, N,N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), 1,3-butylene glycol, propylene glycol, or these means an extract obtained by leaching using a mixed solvent of , an extract obtained using a supercritical extraction solvent such as carbon dioxide, pentane, or a fraction obtained by fractionating the extract, and the extraction method is based on the polarity of the active material, the degree of extraction, and the degree of preservation.
  • a lower alcohol having 1 to 4 carbon atoms methanol, ethanol, butanol,
  • any method such as chilling, reflux, warming, ultrasonic radiation, and supercritical extraction may be applied.
  • the fractionated extract a fraction obtained by suspending the extract in a specific solvent and mixing and standing still with a solvent having a different polarity, and adsorbing the crude extract to a column filled with silica gel, etc., hydrophobic solvent, hydrophilic solvent, or a mixed solvent thereof It is meant to include the fraction obtained as a mobile phase.
  • the meaning of the extract includes a concentrated liquid extract or solid extract from which the extraction solvent has been removed by freeze drying, vacuum drying, hot air drying, spray drying, or the like.
  • it means an extract obtained by using water, ethanol, or a mixed solvent thereof as an extraction solvent, and more preferably an extract obtained by using a mixed solvent of water and ethanol as an extraction solvent.
  • active ingredient refers to a component that alone exhibits a desired activity, or can exhibit activity together with a carrier that does not itself have activity.
  • the term "enhancement of respiratory function” refers to maintaining the original functions of respiratory organs such as nasal passages, pharynx, larynx, trachea, bronchial tubes and lungs in a healthy state, or according to smoking, fine dust, neutrophil neutrophil activation or other respiratory diseases. It refers to any action that improves the function of the respiratory organs, which has been deteriorated due to symptoms, to the original healthy state.
  • the term "respiratory disease” refers to a disease occurring in the respiratory organs of an individual, such as the nasal cavity, pharynx, larynx, trachea, bronchi, and lung.
  • the respiratory disease is a respiratory disease caused by smoking or fine dust. ; Or it may mean a lung disease accompanied by netosis (Netosis), but is not particularly limited thereto.
  • the respiratory disease may refer to a pulmonary disease accompanied by symptoms of sputum, dyspnea, airway hypersensitivity, airway obstruction, mucus hypersecretion, decreased expiratory flow rate and/or impaired gas exchange, and more specifically asthma , chronic obstructive pulmonary disease (COPD), tracheitis, bronchitis, diffuse interstitial lung disease, acute respiratory distress syndrome (ARDS), acute lung injury, cystic fibrosis, capillary Bronchitis (bronchiolitis), influenza virus infection (influenza virus infection), pneumonia (pneumonia), tuberculosis (tuberculosis) and transfusion-related acute lung injury (transfusion-related acute lung injury) may mean one or more selected from the group consisting of, , most specifically asthma or COPD.
  • the active ingredient may be included in any amount (effective amount) according to the specific use, formulation, purpose of formulation, etc. as long as it can exhibit respiratory function enhancement and respiratory disease improvement activity, and preventive or therapeutic activity for respiratory disease.
  • a typical effective amount may be determined within the range of 0.001 weight % to 20.0 weight % based on the total weight of the composition.
  • the “effective amount” means when the composition of the present invention is administered to an individual subject to the application of the composition of the present invention during the administration period as suggested by those skilled in the art, respiratory function enhancement and respiratory disease improvement, prevention or therapeutic effect, asthma or It refers to the amount of the active ingredient included in the composition of the present invention, which can exhibit the intended functional and pharmacological effects such as the improvement effect of COPD.
  • Such an effective amount can be determined empirically by one of ordinary skill in the art within the scope of ordinary skill in the art.
  • composition of the present invention may be applied may be a mammal such as a dog, a cat, a cow, a horse, a pig, or a human, and a human may be preferable.
  • the food composition of the present invention may include Lactobacillus plantarum KF511 having a number of 10 1 to 10 12 CFU bacteria, preferably 10 6 to 10 12 CFU, as an active ingredient.
  • composition of the present invention in addition to the active ingredient, anti-inflammatory activity, anti-allergic activity, etc.
  • active ingredient anti-inflammatory activity
  • anti-allergic activity etc.
  • safety has already been verified in the art and has the corresponding activity
  • It may further include any compound or natural extract.
  • Such compounds or extracts include compounds or extracts and pharmaceuticals listed in compendial documents such as pharmacopeias of each country ('Korean Pharmacopoeia' in Korea) and health functional food regulations of each country ('health functional food standards and specifications', announced by the Ministry of Food and Drug Safety in Korea).
  • pharmacopeias of each country 'Korean Pharmacopoeia' in Korea
  • health functional food regulations of each country 'health functional food standards and specifications', announced by the Ministry of Food and Drug Safety in Korea.
  • Each country's laws governing the manufacture and sale of compounds, extracts, and health functional foods that have been approved for items in accordance with the laws of each country (the 'Pharmaceuticals Act' in Korea) that regulate manufacturing and sales ('Health Functional Food Act' in Korea) Depending on the functionalities recognized compounds or extracts may be included.
  • a complex of MSM dimethylsulfonylmethane
  • N-acetylglucosamine etc.
  • Actinidia extract, leaf extract, complexes such as picaopreto powder, PLAG (1-palmitoyl-2-linoleoyl-3-acetyl-rac-glycerol), etc. will correspond to these compounds or extracts, but is not particularly limited thereto .
  • One or more of these compounds or natural extracts may be included in the composition of the present invention together with the active ingredient.
  • composition of the present invention may be identified as a food composition in a specific embodiment, and the food may include health functional (sex) food.
  • the term "health functional food” refers to food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. using raw materials or ingredients useful for the human body.
  • the “functionality” refers to obtaining useful effects for health purposes such as regulating nutrients or physiological actions with respect to the structure and function of the human body.
  • the health functional food of the present invention can be prepared by a method commonly used in the art, and at the time of manufacture, it can be prepared by adding raw materials and components commonly added in the art.
  • the formulation of the health functional food is also recognized as a health functional food, it may be manufactured without limitation.
  • the food composition of the present invention can be prepared in various forms, and unlike general drugs, it has the advantage that there are no side effects that may occur during long-term administration of the drug using food as a raw material, and has excellent portability, Health functional food can be taken as an adjuvant to enhance asthma or COPD improvement effect, and further enhance respiratory function and respiratory disease improvement effect.
  • the food composition of the present invention may be prepared in any form, for example, beverages such as tea, juice, carbonated beverages, and ionic beverages, processed oils such as milk and yogurt, gums, rice cakes, Korean sweets, bread, Foods such as confectionery and noodles, tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jellies, bars, and the like can be manufactured into health functional food preparations.
  • the food composition of the present invention may have any product classification in terms of legal and functional classification as long as it conforms to the enforcement regulations at the time of manufacture and distribution.
  • it is a health functional food according to the 'Health Functional Food Act' in Korea, or confectionery, beans, tea, and beverages according to each food type according to the Food Ordinance of the Korea 'Food Sanitation Act' ('Food Standards and Specifications' notified by the Ministry of Food and Drug Safety) , food for special use, and the like.
  • the food composition of the present invention may contain food additives in addition to the active ingredient.
  • Food additives can be generally understood as substances that are added to and mixed with or infiltrated into food in manufacturing, processing or preserving food. Since they are consumed daily and for a long period of time with food, their safety must be ensured. Food additives with guaranteed safety are limited in terms of ingredients or functions in the Food Additives Ordinance in accordance with the laws of each country that regulate the manufacture and distribution of food ('Food Sanitation Act' in Korea). In the Korean Food Additives Code (“Food Additive Standards and Specifications” notified by the Ministry of Food and Drug Safety), food additives are classified into chemically synthetic products, natural additives, and mixed preparations in terms of ingredients. These food additives are sweeteners and flavorants in terms of function. It is classified into an agent, a preservative, an emulsifier, an acidulant, and a thickener.
  • the sweetener is used to impart an appropriate sweetness to food, and natural or synthetic ones may be used.
  • a natural sweetener is used.
  • sugar sweeteners such as corn syrup solids, honey, sucrose, fructose, lactose, and maltose.
  • the flavoring agent may be used to improve taste or flavor, and both natural and synthetic ones may be used. Preferably, it is a case where a natural thing is used. In the case of using a natural one, the purpose of nutritional enhancement in addition to flavor may be concurrently used.
  • the natural flavoring agent may be obtained from apples, lemons, tangerines, grapes, strawberries, peaches, or the like, or obtained from green tea leaves, horseradish leaves, bamboo leaves, cinnamon, chrysanthemum leaves, jasmine, and the like. In addition, those obtained from ginseng (red ginseng), bamboo shoots, aloe vera, ginkgo biloba, etc. can be used.
  • the natural flavoring agent may be a liquid concentrate or a solid extract. In some cases, a synthetic flavoring agent may be used, and the synthetic flavoring agent may include esters, alcohols, aldehydes, terpenes, and the like.
  • Calcium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate, EDTA (ethylenediaminetetraacetic acid), etc. can be used as the preservative, and as the emulsifier, acacia gum, carboxymethylcellulose, xanthan gum, Pectin and the like may be used, and acidulant, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, phosphoric acid, and the like may be used. Acidulant may be added so that the food composition has an appropriate acidity for the purpose of inhibiting the growth of microorganisms in addition to the purpose of enhancing the taste.
  • a suspending agent As the thickener, a suspending agent, a settling agent, a gel-forming agent, a bulking agent, and the like may be used.
  • the food composition of the present invention may contain, in addition to the food additives as described above, physiologically active substances or minerals known in the art for the purpose of supplementing and reinforcing functionality and nutrition and guaranteed stability as food additives.
  • physiologically active substances include catechins contained in green tea, vitamins such as vitamin B1, vitamin C, vitamin E, and vitamin B12, tocopherol, dibenzoylthiamine, and the like.
  • Minerals include calcium preparations such as calcium citrate, stearic acid
  • Magnesium preparations, such as magnesium, iron preparations, such as iron citrate, chromium chloride, potassium iodide, selenium, germanium, vanadium, zinc, etc. are mentioned.
  • the food composition of the present invention may contain the food additives as described above in an appropriate amount to achieve the purpose depending on the type of product, and with respect to other food additives that may be included in the food composition of the present invention, You can refer to the Food Additives Ordinance.
  • Lactobacillus plantarum Lactobacillus plantarum KF511 strain, its culture, its concentrate or its dried product; It provides a pharmaceutical composition for the prevention or treatment of respiratory diseases, comprising a pink needle flower extract or wormwood extract as an active ingredient.
  • Lactobacillus plantarum, Lactobacillus plantarum KF511, culture medium, pink needle flower, wormwood, extract, active ingredients and respiratory diseases are the same as described above.
  • prevention refers to any act of suppressing or delaying symptoms of respiratory diseases of an individual by administering a composition comprising a culture solution of the Lactobacillus plantarum KF511 strain according to the present invention.
  • treatment refers to any action in which symptoms according to respiratory diseases of an individual are improved or cured by administration of a composition comprising a culture solution of the Lactobacillus plantarum KF511 strain according to the present invention.
  • the pharmaceutical composition of the present invention may include Lactobacillus plantarum KF511 having a number of 10 1 to 10 12 CFU bacteria, preferably 10 6 to 10 12 CFU, as an active ingredient.
  • the pharmaceutical composition of the present invention may be prepared as an oral dosage form or a parenteral dosage form according to the route of administration by a conventional method known in the art, including a pharmaceutically acceptable carrier in addition to the active ingredient.
  • the administration route may be any suitable route including topical route, oral route, intravenous route, intramuscular route, and direct absorption through mucosal tissue, and two or more routes may be used in combination.
  • An example of the combination of two or more routes is a case in which two or more formulations of drugs according to the route of administration are combined. For example, one drug is first administered by an intravenous route and the other drug is secondarily administered by a local route.
  • Pharmaceutically acceptable carriers are well known in the art according to administration routes or formulations, and specifically, reference may be made to the pharmacopoeia of each country including the 'Korean Pharmacopoeia'.
  • composition of the present invention is prepared as an oral dosage form, powders, granules, tablets, pills, dragees, capsules, liquids, gels, syrups, suspensions, wafers, together with a suitable carrier according to methods known in the art.
  • suitable carriers include sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, and xylitol, starches such as corn starch, potato starch, wheat starch, cellulose, methylcellulose, ethylcellulose, sodium carboxymethylcellulose, Cellulose such as hydroxypropylmethylcellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, magnesium stearate, mineral oil, malt, gelatin, talc, polyol, vegetable oil, ethanol, grease Serol etc. are mentioned.
  • sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, and xylitol
  • starches such as corn starch, potato starch, wheat starch, cellulose, methylcellulose, ethylcellulose, sodium carboxymethylcellulose
  • Cellulose such as hydroxypropylmethylcellulose, polyvinylpyrroli
  • an appropriate binder, lubricant, disintegrant, colorant, diluent, etc. may be included as needed.
  • Suitable binders include starch, magnesium aluminum silicate, starch ferrist, gelatin, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone, glucose, corn sweetener, sodium alginate, polyethylene glycol, wax, and the like, and oleic acid as lubricant.
  • agar agar
  • bentonite xanthan gum
  • starch alginic acid or its sodium salt.
  • examples of the diluent include lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, glycine, and the like.
  • the pharmaceutical composition of the present invention When the pharmaceutical composition of the present invention is prepared for parenteral use, it may be formulated in the form of injections, transdermal administrations, nasal inhalants and suppositories together with suitable carriers according to methods known in the art.
  • an aqueous isotonic solution or suspension may be used as a suitable carrier, and specifically, PBS (phosphate buffered saline) containing triethanolamine, sterile water for injection, or isotonic solution such as 5% dextrose may be used.
  • PBS phosphate buffered saline
  • sterile water for injection or isotonic solution such as 5% dextrose
  • isotonic solution such as 5% dextrose
  • transdermal administration it can be formulated in the form of ointments, creams, lotions, gels, external solutions, pasta agents, liniment agents, air rolls, and the like.
  • a nasal inhalant it can be formulated in the form of an aerosol spray using a suitable propellant such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, etc., and when formulated as a suppository, the carrier is Witepsol ( witepsol), tween 61, polyethylene glycols, cacao fat, laurin fat, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearate, sorbitan fatty acid esters, and the like can be used.
  • Witepsol witepsol
  • tween 61 polyethylene glycols, cacao fat, laurin fat, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearate, sorbitan fatty acid esters, and the like can be used.
  • a preferred dosage of the pharmaceutical composition of the present invention is in the range of 0.001 mg/kg to 10 g/kg per day, preferably 0.001 mg/kg to 1 g, depending on the patient's condition, weight, sex, age, patient's severity, and administration route. It can be in the range /kg. Administration may be performed once or divided into several times a day. Such dosages should not be construed as limiting the scope of the invention in any respect.
  • Lactobacillus plantarum KF511 strain of the present invention pink needle flower extract or wormwood extract inhibits the secretion of MUC5AC in a mucus hypersecretion model using human respiratory epithelial cells (H292), and neutrophil extracellular trap (Neutrophil extracellular) traps), suppresses the expression of inflammatory cytokines by Cigarette Smoke Extraction (CSE) of the bronchial epithelial cell line NCI-H292 cells, and furthermore, the lung in a mouse model of respiratory disease induced by CSE and PPE.
  • CSE Cigarette Smoke Extraction
  • Figure 1 shows the total number of cells counted from bronchoalveolar lavage (BALF) after administration of ROF as a Lactobacillus plantarum KF511 strain of the present invention and a positive control for a PPE/CSE-induced respiratory disease (COPD) mouse model. it has been shown
  • FIG 4 shows the results of staining the lung tissue extracted from the respiratory disease (COPD) mouse model.
  • KC Cytokine and Chemokine
  • MCP-1 MCP-1
  • MDC MIP-2
  • TARC TARC
  • GM-CSF INF-gamma
  • IL-6 IL-6
  • IL-17 BALF of a respiratory disease (COPD) mouse model.
  • FIG. 6 shows Cytokine and Chemokine (KC, MCP-1, MDC, MIP-2, TARC, GM-CSF, INF-gamma, IL-1beta, IL-6, IL-) from lung tissue of a respiratory disease (COPD) mouse model. 17) shows the results of the analysis.
  • FIG. 7 shows the results of measuring the ratio of B cells in the lung tissue after treating the Lactobacillus plantarum KF511 strain in lung tissue derived from a respiratory disease (COPD) mouse model for each concentration.
  • COPD respiratory disease
  • FIG. 10 shows the total number of cells counted from bronchoalveolar lavage (BALF) after administration of ROF as a pink needle flower extract of the present invention and a positive control for a PPE/CSE-induced respiratory disease (COPD) mouse model.
  • BALF bronchoalveolar lavage
  • COF PPE/CSE-induced respiratory disease
  • FIG. 11 shows the results of analyzing immune cells (Macrophage, Lympocyte, Neutrophils and Eosinophil) in BALF through Diff-Quick staining.
  • FIG 12 shows the results of staining the lung tissue extracted from the respiratory disease (COPD) mouse model.
  • Figure 13 shows the results of evaluating the MUC5AC inhibitory activity in NCI-H292 cells according to the treatment with a pink needle flower extract.
  • bronchoalveolar lavage fluid BALF
  • COPD respiratory disease
  • Diff-Quick staining shows the results of analysis of immune cells (Macrophage, Lympocyte, Neutrophils and Eosinophil) in BALF.
  • FIG 17 shows the results of staining the lung tissue extracted from the respiratory disease (COPD) mouse model.
  • FIG. 18 shows the results of confirming the damage inhibition activity of NCI-H292 cells induced by fine dust according to the treatment with Mugwort extract.
  • Example 1 Lactobacillus plantarum KF511 strain isolation and identification
  • the Lactobacillus plantarum strain according to the present invention was isolated from the traditionally prepared kimchi using Lactobacillus MRS agar medium (MRS medium, BD288130, Difco, USA), and the isolated strain was identified through 16S rDNA sequencing. did. As a result of identification, the 16s rDNA base sequence (SEQ ID NO: 1) of the strain showed 99.93% homology with the existing Lactobacillus plantarum ATCC14917(T) strain.
  • the composition of the medium for culturing the strain is MRS medium, the culture conditions are pH 6.5 ⁇ 0.2, temperature 37° C., and stirring culture for 24 hours, oxygen demand is facultative anaerobic, and strain preservation is possible through freeze-drying preservation or cell suspension freezing. possible.
  • the present inventors named the strain Lactobacillus plantarum ( Lactobacillus plantarum ) KF511, and deposited with the International Microorganism Conservation Center (KCCM) on August 21, 2019, and was given an accession number KCCM 12573P.
  • KCCM International Microorganism Conservation Center
  • a pink needle flower (extraction part: above-ground part) extract was prepared and the activity of improving lung disease was confirmed.
  • the extract was obtained in powder form by adding 10 times the weight of 70% ethanol to the dry powder of each natural product to be extracted, extracting it twice at 50° C. for 6 hours, filtering, concentrating under reduced pressure, and freeze-drying.
  • wormwood (extraction part: above-ground part) extract was prepared and the activity of improving lung disease was confirmed.
  • the extract was obtained in powder form by adding 10 times the weight of 70% ethanol to the dry powder of each natural product to be extracted, extracting it twice at 50° C. for 6 hours, filtering, concentrating under reduced pressure, and freeze-drying.
  • the sample treatment group was orally administered with a sample of 10 7 to 10 9 CFU/head for 24 days from one week before the start of COPD induction until dissection, and the naive and COPD groups were administered the same amount of PBS.
  • the positive control group the Roflumilast (ROF) group
  • ROF Rost
  • 1.2 units of Porcine Pancreatic Elastase (PPE) and 100% Cigarette Smoke Extraction (CSE) were used for COPD induction.
  • bronchoalveolar lavage fluid (BALF). 10 uL of the recovered BALF solution was mixed with Accustain T solution in the same amount, 12 uL was injected into the Accuchip channel, and total cells were automatically counted with a cell counter (ADAM-MC, NANOENTEK. INC, Korea) (FIG. 1).
  • the recovered BALF was separated into a supernatant and a cell pellet through centrifugation at 300 ⁇ g for 5 minutes.
  • the cell pellet was resuspended by adding 700 ⁇ L of PBS, and 150 ⁇ L of this BALF suspension was centrifuged with a Cytospin device (Centrifuge 5403, Eppendorf, Hamburg, Germany) at 1000 rpm, 10 min, 4°C to place BALF cells on a slide. attached. Thereafter, the cells were stained using Diff-Quick staining reagent according to the protocol of the manufacturer (1-5-1 Wakinohamakaigandori, chuo-ku, Kobe, Japan), and then observed under a microscope ( FIGS. 2 and 3 ).
  • Lung tissue was removed from the dissected respiratory disease (COPD) model mouse, the lung mesenchymal was removed, and fixed in 10% neutral buffered formalin for 3 days.
  • the fixed tissue was dehydrated with ethyl alcohol and xylene, embedded in paraffin, trimmed, and sliced to a thickness of 5 ⁇ m. After attaching the prepared section to the slide, it was stained with H&E to confirm the general shape, and then observed under a microscope (FIGS. 4, 12, and 17).
  • BALF bronchoalveolar lavage fluid
  • Respiratory disease (COPD) model After adding PBS corresponding to 10 times the weight of mouse lung tissue, grinding with a homogenizer, and centrifugation at 12,000 rpm, 20 min conditions. The recovered supernatant was used for cytokines and chemokines analysis (KC, MCP-1, MDC, MIP-2, TARC, GM-CSF, INF-gamma, IL-1beta, IL-6, IL-17). After taking 30 uL of the supernatant for the analysis of cytokines and chemokines, the experiment was performed according to the protocol of the manufacturer (Quansis biosciences) of the Q-plex ELISA array kit. The results are shown for each cytokine or chemokines in FIG. 6 .
  • Lung tissue was recovered from a respiratory disease (COPD) model mouse, and the lung tissue was minced using dissecting scissors. The sliced lung tissue was put in a GentleMACS C tube, and enzymes D and A were treated according to the protocol of the manufacturer (miltenyi Biotec), and the tissue was unicellularized with a MACS dissociator. After the single-celled cells were subjected to red blood cell lysis, the number of cells in each group was measured. Cells were made at a concentration of 1 ⁇ 10 7 cells/mL, and 200 ⁇ L per well was dispensed in a 96-well V-bottom plate.
  • COPD respiratory disease
  • Fc blockTM Before staining immune cell-related surface markers, treat Fc blockTM with 0.8 ⁇ L/20 ⁇ L/well using FACS buffer (PBS + 8% NaHCO3 + 1% FBS + 10% NaN3), then pipetting and refrigerate at 4°C. was left for 15 minutes. For washing, the supernatant was removed by centrifugation at 1800 rpm for 3 minutes.
  • FACS buffer PBS + 8% NaHCO3 + 1% FBS + 10% NaN3
  • the diluted antibodies were treated with 20 ⁇ L/well and reacted at room temperature for 30 minutes. Then, it is washed with PBS, and the cells are suspended in PBS. The suspended cells were analyzed using a flow cytometer, Cytoflex (Beckman Coulter). The results are shown according to the treatment concentration of each Lactobacillus plantarum KF511 (LPKF511) strain in FIG. 7 .
  • IgA was measured according to the experimental method of the ELISA kit (eBioscience, USA). Capture antibody was diluted with Coating Buffer, and 100 ⁇ l per well was dispensed in a 96-well Immunoplate, and then left at 4°C for about a day. The next day, after washing twice using a washing buffer, 250 ⁇ of blocking buffer was dispensed per well and left at room temperature for 2 hours. After washing 4 times after the blocking process, the standard sample and the BALF solution of each group were diluted with Assay Buffer, dispensed 100 ⁇ per well, and left at room temperature for 2 hours.
  • the Detection-Antibody was diluted with Assay Buffer, dispensed at 100 ⁇ L per well, and left at room temperature for 1 hour. After washing the solution 4 times, 100 ⁇ L of substrate solution was dispensed per well, left at room temperature for 15 minutes, and 100 ⁇ L of Stop solution was added per well to terminate the reaction. Thereafter, absorbance was measured at a wavelength of 450 nm and quantified using a standard curve using Standard. The results are shown according to the treatment concentration of each Lactobacillus plantarum KF511 (LPKF511) strain in FIG. 8 .
  • Mucin a glycoprotein in mucus, is produced by mucin genes, and the expression of secretory mucin, MUC5AC, plays an important role in the respiratory region. Therefore, in this experiment, the inhibitory ability of MUC5AC of the Lactobacillus plantarum KF511 strain was confirmed using NCI-H292 cells, a mucinous epithelial cancer cell line of human respiratory epithelial cells.
  • H292 cells For culture of H292 cells, RPMI 1640 medium containing 10% Fetal bovine serum (FBS), 100 unit/ml penicillin and 100 mg/ml streptomycin was used. H292 cells were inoculated in a 48- well cell culture plate at a concentration of 4 ⁇ 10 4 cells/well and cultured for 24 hours at 37°C under conditions of providing 5% carbon dioxide (CO2). After culturing for 24 hours, the culture medium was replaced with a medium in which the concentration of FBS was lowered to 0.2%, and starvation was performed for 24 hours at 37°C and under the conditions of providing 5% carbon dioxide (CO2). After that, all samples and stimulants were treated using RPMI1640 medium without serum added.
  • FBS Fetal bovine serum
  • penicillin 100 unit/ml
  • streptomycin 100 mg/ml streptomycin
  • PMA Phorbol 12-myristate 13-acetate
  • the culture supernatant was dispensed into 96-well immunoplates by 100 ⁇ L, dried in a dry oven at 50° C., and washed three times with PBS containing 0.05% tween 20. After that, the same washing method as above was used between all steps. 200 ⁇ L of 1% BSA (Bovine serum albumin) was dispensed per well, and blocking was performed for 1 hour, followed by washing. MUC5AC antibody (abcam) was diluted 500-fold, dispensed at 100 ⁇ L per well, and reacted for 2 hours.
  • BSA Bovine serum albumin
  • bronchoalveolar lavage fluid (BALF). 10 uL of the recovered BALF solution was mixed with Accustain T solution in the same amount, 12 uL was injected into the Accuchip channel, and total cells were automatically counted with a cell counter (ADAM-MC, NANOENTEK. INC, Korea) ( FIGS. 10 and 15 ).
  • the recovered BALF was separated into a supernatant and a cell pellet by centrifugation at 300 ⁇ g for 5 minutes.
  • the cell pellet was resuspended by adding 700 ⁇ L of PBS, and 150 ⁇ L of this BALF suspension was centrifuged with a Cytospin device (Centrifuge 5403, Eppendorf, Hamburg, Germany) at 1000 rpm, 10 min, 4°C to place BALF cells on a slide. attached. Thereafter, the cells were stained using a Diff-Quick staining reagent according to the protocol of the manufacturer (1-5-1 Wakinohamakaigandori, chuo-ku, Kobe, Japan), and then observed under a microscope ( FIGS. 11 and 16 ).
  • H292 cells For culture of H292 cells, RPMI 1640 medium containing 10% Fetal bovine serum (FBS), 100 unit/ml penicillin and 100 mg/ml streptomycin was used. H292 cells were inoculated in a 48-well cell culture plate at a concentration of 4 ⁇ 10 4 cells/well and cultured for 24 hours at 37° C. under conditions providing 5% carbon dioxide (CO 2 ). After culturing for 24 hours, the culture medium was replaced with a medium in which the concentration of FBS was lowered to 0.2%, and starvation was performed for 24 hours at 37° C. under conditions of providing 5% carbon dioxide (CO 2 ). After that, all samples and stimulants were treated using RPMI1640 medium without serum added.
  • FBS Fetal bovine serum
  • penicillin 100 unit/ml
  • streptomycin 100 mg/ml streptomycin
  • PMA Phorbol 12-myristate 13-acetate
  • the final concentration was 2 ng/mL
  • PBS containing 0.05% tween 20 was used as a stimulant.
  • 200 ⁇ L of 1% BSA (Bovine serum albumin) was dispensed per well, and blocking was performed for 1 hour, followed by washing.
  • MUC5AC antibody (abcam) was diluted 500-fold, dispensed at 100 ⁇ L per well, and reacted for 2 hours. After washing, goat anti-mouse IgG HRP (abcam) was diluted 2000-fold, dispensed 100 ⁇ L per well, and reacted for 1 hour under light blocking. After dispensing 100 ⁇ L of substrate solution (BD) per well, and blocking the light for 30 minutes, the reaction was stopped by adding 50 ⁇ L of stop solution per well. Absorbance was measured at 450 nm using an ELISA reader, and the inhibitory ability of MUC5AC showed the degree of inhibition during sample treatment compared to the production ability of MUC5AC by PMA based on control cells that were not treated with anything.
  • BD substrate solution
  • the remaining cells were treated with 500 ⁇ L/well of water soluble tetrazolium salt (WST) reagent diluted 1/10 with RPMI1640 + 10% FBS + 1% P/S medium, and incubator at 37°C, 5% CO2 for 50 After reacting for minutes, absorbance was measured at 450 nm to confirm cell viability (WST), and concentrations with lower viability than the control group were excluded from the MUC5AC analysis. The results are shown in FIG. 13 for each treatment concentration of the pink needle flower extract, and it was confirmed that MUC5AC production was suppressed by the treatment of the pink needle flower extract.
  • WST water soluble tetrazolium salt
  • A549 cells prepared at a concentration of 1 ⁇ 10 5 cells/mL in a 96-well plate were passaged at 200 ⁇ L/well and cultured for 24 hours, and then stimulant (TNF-) using MEM + 10% FBS + 1% P/S medium. ⁇ ; final 5 ng/mL) and samples (final; 3.12, 6.25, 12.5, 25 ⁇ g/mL) were diluted by reflecting the desired final concentration, and 200 uL per well was treated. After overnight incubation, the culture supernatant was recovered and used for IL-8 measurement. Human IL-8 was measured by the ELISA method, and was performed according to the protocol of the manufacturer (BD). At this time, the supernatant for IL-8 measurement was diluted 40-fold and analyzed.
  • the remaining cells were treated with MEM + 10% FBS + 1% P/S medium at 100 ⁇ L/well, and 20 ⁇ L/well of MTT (Thiazolyl blue tetrazolium bromide, Sigma) reagent prepared at a concentration of 2 mg/mL was treated. After incubation at 37°C, 5% CO2 incubator for 4 hours, 100 ⁇ L/well of 10% SDS solution was treated and absorbance was measured at 570 nm the next day to check cell viability (MTT). were excluded from the Cain analysis. As a result, it was confirmed that the level of inflammatory cytokines (IL-8) was suppressed depending on the treatment concentration of the pink needle flower extract (FIG. 14).
  • MTT Thiazolyl blue tetrazolium bromide
  • H292 cells were used by putting a cover glass in each well of a 6-well cell culture plate and then using collagen coating.
  • cell matrix type IC Nita
  • DPBS phosphatidylcholine
  • H292 cells were inoculated at a concentration of 3 ⁇ 10 5 cells/well and cultured for 24 hours at 37° C. under conditions providing 5% carbon dioxide (CO 2 ). After culturing for 24 hours, the culture medium was replaced with a medium in which the concentration of FBS was lowered to 0.2%, and starvation was performed for 24 hours at 37° C. under conditions of providing 5% carbon dioxide (CO 2 ).
  • NCI-H292 cells were treated with fine dust (CRM) and mugwort samples and cultured, and then the cells were recovered using QiAzol Lysis Reagent (QIAGEN).
  • RNA extraction was performed according to the manufacturer's protocol using RNeasy Mini kit (QIAGEN), and Maxime RT Premix (iNtRoN) was used for cDNA synthesis.
  • the gene was amplified using the synthesized cDNA, SYBR Green PCR kit (QIAGEN) and primer pair.
  • MUC5AC primer (Forward: TCAACGGAGACTGCGAGTACAC, Reverse CTTGATGGCCTTGGAGCA) was used for the analysis.
  • Real-time PCR was incubated at 95 o C for 15 minutes, 95 o C for 15 sec, 60 o C for 15 sec, and 72 o C for 15 sec, and 50 cycles were repeated. It was confirmed that the mRNA expression level of MUC5AC was suppressed during sample treatment compared to the production capacity of MUC5AC by CRM on the basis of control cells that were not treated with anything. As a result, it was confirmed that the MUC5AC mRNA expression level was reduced to a level similar to that of the control group not treated with anything (FIG. 19).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Pulmonology (AREA)
  • Botany (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Biotechnology (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Medical Informatics (AREA)
  • Molecular Biology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

본 발명은 락토바실러스 플란타럼(Lactobacillus plantarum) KF511 균주, 분홍바늘꽃(Epilobium angustifolium L.) 추출물 또는 사철쑥(Artemisia capillaris Thunb.) 추출물을 이용한 호흡기 기능 강화 및 호흡기 질환 개선용 식품 조성물; 상기 식품 조성물을 포함하는 건강기능식품; 및 사철쑥 추출물을 유효성분으로 포함하는 호흡기 질환 예방 또는 치료용 약제학적 조성물에 관한 것이다. 본 발명의 락토바실러스 플란타럼(Lactobacillus plantarum) KF511 균주, 분홍바늘꽃 추출물 또는 사철쑥 추출물은 사람 호흡기 상피세포(H292)를 이용한 점액과분비 모델에서 MUC5AC의 분비를 억제하고, 호중구 세포외 트랩(Neutrophil extracellular traps)의 네토시스(Netosis) 활성화를 억제하며, 기관지 상피세포주 NCI-H292 세포의 CSE(Cigarette Smoke Extraction)에 의한 염증성 사이토카인 발현을 억제하고, 나아가 CSE와 PPE로 유도된 호흡기 질환 마우스 모델에서 폐 조직 손상을 억제하며, BALF 내 총 세포, 대식세포, 림프구, 호산구, 호중구 등 면역세포 침윤을 억제하고 BALF 및 폐 조직에서 염증성 사이토카인과 케모카인 분비를 억제하는 활성을 나타낸다.

Description

락토바실러스 플란타럼 균주 등을 이용한 호흡기 질환 개선용 조성물
본 발명은 락토바실러스 플란타럼(Lactobacillus plantarum) KF511 균주, 분홍바늘꽃(Epilobium angustifolium L.) 추출물 또는 사철쑥(Artemisia capillaris Thunb.) 추출물을 이용한 호흡기 기능 강화 및 호흡기 질환 개선용 식품 조성물; 상기 식품 조성물을 포함하는 건강기능식품; 및 사철쑥 추출물을 유효성분으로 포함하는 호흡기 질환 예방 또는 치료용 약제학적 조성물에 관한 것이다.
기관지 천식은 가역적인 기도 폐쇄, 기도의 과민성(기도 저항의 증가), 점액의 과분비, 혈청 중 IgE의 높은 수치가 특징인 알레르기성 질환이다. 기도 내로 흡입된 여러 항원에 의하여 자극된 TH2(T helper 2) 타입 면역세포가 IL-4, 5, 13 등을 생성하면 T 세포, 호산구, 비만세포 등의 염증 세포들이 증식, 분화 및 활성화되어 기도와 기도 주변 조직으로 이동, 침윤하기 때문에 만성 염증질환으로도 인식되고 있다(J Clin Invest, 111: 291-297, 2003; N Engl J. Med. 2001; 44(5): 350-62; Toshio Hirano, Cytokine molecular biology, World Science, 2002). 따라서, 천식 치료제의 개발에 있어서 호산구 등 염증세포의 침윤 등의 억제가 중요 표적 중 하나이다.
만성 폐쇄성 폐질환(chronic obstructive pulmonary disease, COPD)은 기침, 객담, 호흡 곤란, 호기 유속의 감소, 가스 교환의 장애 등을 보이는 만성 기도 질환으로서, 해마다 전세계적으로 그 발병 인구가 증가하고 있으며, 2020년에는 인류의 사망원인 중 3번째 원인이 될 것으로 예측되고 있다(Am J Respir Crit Care Med, 2013, 187: 347-365; Am J Respir Crit Care Med, 2009, 180:396-406).
COPD는 흡연, 대기오염, 화학물질, 직업성 인자, 유전적 소인 등 다양한 원인에 의해서 발병하는데, 이중 흡연이 주요한 원인으로 지목되고 있으며, 실제 COPD 환자의 80% 이상이 흡연자로 밝혀진 바 있다(Biol Pharm Bull, 2012, 35:1752-1760). COPD의 발병 기전에는 염증, 폐에서의 단백분해효소 활성화, 산화적 스트레스(oxidative stress) 등이 관여하며, 염증에 관여하는 세포는 주로 호중구와 대식세포, T 림프구 등이다. 이러한 염증세포들은 활성산소종(reactive oxygen species), 다양한 염증성 사이토카인, 조직 손상을 야기하는 여러 단백분해 효소들을 생성한다(대한결핵 및 호흡기학회 호흡기학 서울: 군자출판사; 2007, p 301-5;Am J Respir Crit Care Med, 1997 155, 1441-1447; Am J Physiol Lung CellMol Physiol, 2010, 298:L262-L269). 특히, 호중구는 세포 외로 엘라스타아제, 콜라게나아제, MPO(myeloperoxidase)와 같은 단백질분해효소(proteases), 아라키돈산 대사물(arachidonate), 활성산소종(reactive oxygen free radical) 등의 물질을 분비하여 폐손상을 야기함으로써 COPD가 발병하는데 중요한 역할을 하는 것으로 알려져 있으며, 따라서 COPD 치료제의 개발에 있어 중요한 표적이 되고 있다(Am J Respir Cell Mol Biol, 2013, 48:531-539; Eur Respir J, 1998, 12:1200-1208).
최근 호중구 세포외 트랩(Neutrophil extracellular traps)의 네토시스(Netosis) 활성화가 COPD를 비롯한 만성 폐/호흡기 질환의 발병 기전에 관여하는 것으로 보고되어 있다(PLoS One. 2014 May 15; 9(5): e97784; Respir Res. 2015 May 22; 16:59.; J Immunol Res. 2017;2017:6710278; Respirology. 2016 Apr; 21(3): 467-75).
현재 COPD, 천식 등 질환의 경과 등을 보기 위한 수단으로 기관지폐포세척술(bronchoalveolar lavage: BAL)이 이용되는데, 기관지폐포세척액(bronchoalveolar lavage fluid: BALF) 내에는 염증성 사이토카인, 활성 산소종, 류코트리엔, 활성화 보체 등 염증 매개 물질들이 증가하고, 정상 폐에서 5% 미만을 차지하는 호중구가 전체 세포의 80%를 차지할 정도로 증가한다(Am J Respir Crit Care Med 154(1): 76-81, 1996).
이제까지 COPD나 천식을 직접적으로 개선시키는 약물은 보고된 바 없으며, 현재의 COPD나 천식 치료제로는 증상과 합병증을 감소시키기 위한 것으로 기관지확장제(β2-작용제, 항콜린제, methylxanthines)와 스테로이드제(흡입, 경구) 등이 주로 사용되고 있다.
본 발명의 목적은 락토바실러스 플란타럼(Lactobacillus plantarum) KF511 균주, 이의 배양액, 그의 농축액 또는 그의 건조물; 분홍바늘꽃(Epilobium angustifolium L.) 추출물; 또는 사철쑥(Artemisia capillaris Thunb.) 추출물을 유효성분으로 포함하는 호흡기 기능 강화 및 호흡기 질환 개선용 식품 조성물, 상기 조성물을 포함하는 건강기능식품을 제공하는 것이다.
본 발명의 다른 목적은 락토바실러스 플란타럼(Lactobacillus plantarum) KF511 균주, 이의 배양액, 그의 농축액 또는 그의 건조물; 분홍바늘꽃 추출물 또는 사철쑥 추출물을 유효성분으로 포함하는 호흡기 질환 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
본 발명자들은 아래의 실시예 및 실험예에서 확인되는 바와 같이, 락토바실러스 플란타럼(Lactobacillus plantarum) KF511 균주, 분홍바늘꽃(Epilobium angustifolium L.) 추출물 또는 사철쑥(Artemisia capillaris Thunb.) 추출물이 PMA(phorbol myristate acetate)에 의해 유도된 호중구 세포외 트랩(Neutrophil extracellular traps)의 네토시스(Netosis) 활성화를 억제하고, 기관지 상피세포주인 NCI-H292 세포의 CSE(Cigarette Smoke Extraction)에 의한 염증성 사이토카인 발현을 억제하며, 나아가 CSE와 PPE로 유도된 호흡기 질환 마우스 모델에서 폐 조직 손상을 억제하고, BALF 내에 총 세포(Total cell), 대식세포(macrophages), 림프구(Lymphocytes), 호산구(Eosinophil), 호중구(Neutrophil) 등의 면역세포 침윤을 억제하며, BALF 및 폐 조직에서 염증성 사이토카인과 케모카인 분비를 억제하는 활성이 있음을 확인함으로써 본 발명을 완성하였다.
상기 목적을 달성하기 위한 본 발명의 일 양태는 락토바실러스 플란타럼(Lactobacillus plantarum) KF511 균주, 이의 배양액, 그의 농축액 또는 그의 건조물; 분홍바늘꽃 추출물 또는 사철쑥 추출물을 유효성분으로 포함하는 호흡기 기능 강화 및 호흡기 질환 개선용 식품 조성물; 및 상기 조성물을 포함하는 건강기능식품을 제공한다.
본 발명에서 용어 "락토바실러스 플란타럼(Lactobacillus plantarum)"은 다양한 발효 식품 및 사람의 장관으로부터 흔히 발견되는 락토바실러스 속 미생물을 의미하는 것으로, 이는 그람 양성 세균에 해당한다. 락토바실러스 플란타럼은 젖산균 중 가장 큰 유전체(genome)를 갖는 것으로 알려져 있으며, 성장 및 증식에 필요한 적정 pH는 3.4 내지 8.8, 적정 온도 범위는 12℃내지 40℃이다.
본 발명에서 상기 락토바실러스 플란타럼 균주는, 구체적으로 "락토바실러스 플란타럼 KF511"일 수 있으며, 보다 구체적으로는 기탁번호 KCCM 12573P로 기탁된 것일 수 있다. 상기 균주는 발효 식품인 김치로부터 분리 및 동정된 것으로, 이의 배양을 위한 배지 조성은 MRS 배지이고, 배양 조건은 pH 6.5 ± 0.2, 온도 37℃및 24시간 교반 배양이며, 산소 요구성은 통성혐기성이고 동결건조보존 또는 세포현탁액 동결을 통해 균주 보존이 가능하다. 한편, 본 발명의 락토바실러스 플란타럼 KF511 균주는 1499kb 길이의 16s rDNA 서열(서열번호 1)을 갖는다.
본 발명의 상기 락토바실러스 플란타럼 KF511 균주는 2019년 8월 21일자로 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(KCCM)에 기탁되어 기탁번호 KCCM 12573P를 부여받았다.
본 출원에서의 용어 "배양액" 또는 "배양물"은 균주를 배지에 배양하여 균주가 영양분을 섭취하고 물질대사를 통해 생겨난 부산물과 균주 등이 포함된 배지를 의미하는 것으로, 구체적으로 락토바실러스 플란타럼 KF511 균주의 배양액 또는 배양물을 의미할 수 있다. 또한, 상기 배지의 농축액 또는 희석액, 상기 배지를 건조하여 얻은 건조물, 상기 배지의 조정제물이나 정제물, 또는 이들의 혼합물 또한 본 발명의 조성물 내 유효성분으로 포함될 수 있다.
본 발명에서 용어 "분홍바늘꽃(Epilobium angustifolium L.)"은 쌍떡잎식물 도금양목 바늘꽃과의 여러해살이풀로, 두메바늘꽃, 큰바늘꽃으로도 불리운다. 뿌리줄기 등을 약용하는 것으로 알려져 있으나, 분홍바늘꽃 추출물 또는 분획물의 호흡기 기능 강화, 호흡기 질환 개선, 예방 또는 치료 활성에 대해서는 전혀 알려진 바가 없다.
본 발명에서 용어 "사철쑥(Artemisia capillaris Thunb.)"은 쌍떡잎식물 초롱꽃목 국화과의 여러해살이풀로, 애탕쑥 또는 인진쑥으로도 불리운다. 어린 순은 식용하며 포기 전체를 이뇨제로 쓰거나 황달에 효과가 있음이 알려져 있으나, 사철쑥 추출물 또는 분획물의 호흡기 기능 강화, 호흡기 질환 개선, 예방 또는 치료 활성에 대해서는 전혀 알려진 바가 없다.
본 발명에서 용어 "추출물"은 추출 대상인 식물, 즉 분홍바늘꽃 또는 사철쑥의 줄기, 잎, 열매, 꽃, 뿌리, 이들의 혼합물 등을 물, 탄소수 1 내지 4의 저급 알콜(메탄올, 에탄올, 부탄올 등), 메틸렌클로라이드, 에틸렌, 아세톤, 헥산, 에테르, 클로로포름, 에틸 아세테이트, 부틸아세테이트, N,N-디메틸포름아미드(DMF), 디메틸설폭사이드(DMSO), 1,3-부틸렌글리콜, 프로필렌글리콜 또는 이들의 혼합 용매를 사용하여 침출하여 얻어진 추출물, 이산화탄소, 펜탄 등 초임계 추출 용매를 사용하여 얻어진 추출물 또는 그 추출물을 분획하여 얻어진 분획물을 의미하며, 추출 방법은 활성물질의 극성, 추출 정도, 보존 정도를 고려하여 냉침, 환류, 가온, 초음파 방사, 초임계 추출 등 임의의 방법을 적용할 수 있다. 분획된 추출물의 경우 추출물을 특정 용매에 현탁시킨 후 극성이 다른 용매와 혼합·정치시켜 얻은 분획물, 상기 조추출물을 실리카겔 등이 충진된 칼럼에 흡착시킨 후 소수성 용매, 친수성 용매 또는 이들의 혼합 용매를 이동상으로 하여 얻은 분획물을 포함하는 의미이다. 또한 상기 추출물의 의미에는 동결건조, 진공건조, 열풍건조, 분무건조 등의 방식으로 추출 용매가 제거된 농축된 액상의 추출물 또는 고형상의 추출물이 포함된다. 바람직하게는 추출용매로서 물, 에탄올 또는 이들의 혼합 용매를 사용하여 얻어진 추출물, 더 바람직하게는 추출용매로서 물과 에탄올의 혼합 용매를 사용하여 얻어진 추출물을 의미한다.
본 발명에서 용어 "유효성분"이란 단독으로 목적하는 활성을 나타내거나, 또는 그 자체는 활성이 없는 담체와 함께 활성을 나타낼 수 있는 성분을 의미한다.
본 발명에서 용어 "호흡기 기능 강화"는 비강, 인두, 후두, 기관, 기관지 및 폐 등 호흡 기관의 본래 기능을 건강한 상태로 유지시키거나, 흡연, 미세먼지, 호중구 네토시스 활성화 또는 기타 호흡기 질환 등에 따른 증상으로 인해 저하된 호흡 기관의 기능을 본래 건강한 상태로 개선시키는 모든 행위를 의미한다.
또한, 본 발명에서 용어 "호흡기 질환"은 비강, 인두, 후두, 기관, 기관지 및 폐 등 개체의 호흡 기관에 발생하는 질환을 의미하는 것으로, 구체적으로 상기 호흡기 질환은 흡연 또는 미세먼지에 의한 호흡기 질환; 또는 네토시스(Netosis)를 수반하는 폐질환을 의미할 수 있으나, 이에 특별히 제한되는 것은 아니다. 보다 구체적으로, 상기 호흡기 질환은 객담, 호흡 곤란, 기도 과민성, 기도 폐쇄, 점액 과분비, 호기 유속의 감소 및/또는 가스 교환의 장애 증상을 수반하는 폐질환을 의미할 수 있고, 보다 더 구체적으로 천식, 만성폐쇄성폐질환(COPD), 기관염(tracheitis), 기관지염(bronchitis), 미만성 간질성 폐질환, 급성 호흡곤란 증후군(acute respiratory distress syndrome, ARDS), 급성 폐손상, 낭성 섬유증(cystic fibrosis), 모세기관지염(bronchiolitis), 인플루엔자 바이러스 감염증(influenza virus infection), 폐렴(pneumonia), 결핵(tuberculosis) 및 수혈관련급성폐장애(transfusion-related acute lung injury)로 구성된 군으로부터 선택되는 하나 이상을 의미할 수 있으며, 가장 구체적으로는 천식 또는 COPD를 의미할 수 있다.
본 발명의 조성물에서 유효성분은 호흡기 기능 강화 및 호흡기 질환 개선 활성, 호흡기 질환에 대한 예방 또는 치료 활성을 나타낼 수 있는 한 그 구체적 용도, 제형, 배합 목적 등에 따라 임의의 양(유효량)으로 포함될 수 있는데, 통상적인 유효량은 조성물 전체 중량을 기준으로 할 때 0.001 중량 % 내지 20.0 중량 % 범위 내에서 결정될 수 있다. 상기 "유효량"이란 본 발명 조성물의 적용 대상인 개체에게 당업계의 통상의 기술자의 제언에 의한 투여 기간 동안 본 발명의 조성물이 투여될 때, 호흡기 기능 강화 및 호흡기 질환 개선, 예방 또는 치료 효과, 천식 또는 COPD의 개선 효과 등 의도한 기능적, 약리학적 효과를 나타낼 수 있는, 본 발명의 조성물에 포함되는 유효성분의 양을 말한다. 이러한 유효량은 당업계의 통상의 기술자가 통상의 능력 범위 내에서 실험적으로 결정될 수 있다.
본 발명의 조성물이 적용될 수 있는 대상은 개, 고양이, 소, 말, 돼지, 인간 등의 포유동물일 수 있으며, 인간인 경우가 바람직할 수 있다.
본 발명의 식품 조성물은 유효성분으로 101내지 1012 CFU 균수, 바람직하게는 106 내지 1012 CFU 균수를 갖는 락토바실러스 플란타럼 KF511를 포함할 수 있다.
또한, 본 발명의 조성물은 유효성분 이외에, 항염증 활성, 항알러지 활성 등 유사 활성의 부가를 통한 복용이나 섭취의 편리성을 증진시키기 위하여, 당업계에서 이미 안전성이 검증되고 해당 활성을 갖는 것으로 공지된 임의의 화합물이나 천연 추출물을 추가로 포함할 수 있다.
이러한 화합물 또는 추출물에는 각국 약전(한국에서는 '대한민국약전'), 각국 건강기능식품공전(한국에서는 식약처 고시인 '건강기능식품 기준 및 규격') 등의 공정서에 실려 있는 화합물 또는 추출물, 의약품의 제조·판매를 규율하는 각국의 법률(한국에서는 '약사법')에 따라 품목 허가를 받은 화합물 또는 추출물, 건강기능식품의 제조·판매를 규율하는 각국 법률(한국에서는 '건강기능식품에 관한 법률')에 따라 기능성이 인정된 화합물 또는 추출물이 포함될 수 있다. 예컨대, 한국 '건강기능식품에 관한 법률'에 따라, 항염증 기능성이 인정된 MSM(dimethylsulfonylmethane), N-아세틸글루코사민 등과, 항알러지 기능성이 인정된 Enterococcus faecalis 가열 처리 건조 분말, 구아바 잎 추출물 등의 복합물, 다래 추출물, 소엽 추출물, 피카오프레토 분말 등의 복합물, PLAG(1-palmitoyl-2-linoleoyl-3-acetyl-rac-glycerol) 등이 이러한 화합물 또는 추출물에 해당할 것이며, 이에 특별히 제한되는 것은 아니다. 이러한 화합물 또는 천연 추출물은 본 발명의 조성물에 그 유효성분과 함께 하나 이상 포함될 수 있다.
본 발명의 조성물은 구체적인 양태에 있어서 식품 조성물로서 파악할 수 있으며, 상기 식품에는 건강기능(성)식품이 포함될 수 있다.
본 발명에서 용어 "건강기능식품"이란, 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 정제, 캅셀, 분말, 과립, 액상 및 환 등의 형태로 제조 및 가공한 식품을 말한다. 상기 "기능성" 은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻는 것을 의미한다. 본 발명의 건강기능식품은 당업계에서 통상적으로 사용되는 방법에 의하여 제조 가능하며, 상기 제조시에는 당업계에서 통상적으로 첨가하는 원료 및 성분을 첨가하여 제조할 수 있다. 또한 상기 건강기능식품의 제형 또한 건강기능식품으로 인정되는 제형이면 제한 없이 제조될 수 있다. 본 발명의 식품 조성물은 다양한 형태의 제형으로 제조될 수 있으며, 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용 시 발생할 수 있는 부작용 등이 없는 장점이 있고, 휴대성이 뛰어나, 본 발명의 건강기능식품은 천식 또는 COPD 개선 효과, 나아가 호흡기 기능 강화 및 호흡기 질환 개선 효과를 증진시키기 위한 보조제로 섭취가 가능하다.
본 발명의 식품 조성물은 어떠한 형태로도 제조될 수 있으며, 예컨대 차, 쥬스, 탄산음료, 이온음료 등의 음료류, 우유, 요구루트 등의 가공 유류(乳類), 껌류, 떡, 한과, 빵, 과자, 면 등의 식품류, 정제, 캡슐, 환, 과립, 액상, 분말, 편상, 페이스트상, 시럽, 겔, 젤리, 바 등의 건강기능식품 제제류 등으로 제조될 수 있다. 또한, 본 발명의 식품 조성물은 법률상·기능상의 구분에 있어서 제조·유통 시점의 시행 법규에 부합하는 한 임의의 제품 구분을 띨 수 있다. 예컨대 한국 '건강기능식품에관한법률'에 따른 건강기능식품이거나, 한국 '식품위생법'의 식품공전(식약처 고시 '식품의 기준 및 규격')상 각 식품유형에 따른 과자류, 두류, 다류, 음료류, 특수용도식품 등일 수 있다.
또한, 본 발명의 식품 조성물에는 그 유효성분 이외에 식품첨가물이 포함될 수 있다. 식품첨가물은 일반적으로 식품을 제조, 가공 또는 보존함에 있어 식품에 첨가되어 혼합되거나 침윤되는 물질로서 이해될 수 있는데, 식품과 함께 매일 그리고 장기간 섭취되므로 그 안전성이 보장되어야 한다. 식품의 제조·유통을 규율하는 각국 법률(한국에서는 '식품위생법')에 따른 식품첨가물공전에는 안전성이 보장된 식품첨가물이 성분 면에서 또는 기능 면에서 한정적으로 규정되어 있다. 한국 식품첨가물공전(식약처 고시 '식품첨가물 기준 및 규격')에서는 식품첨가물이 성분 면에서 화학적 합성품, 천연 첨가물 및 혼합 제제류로 구분되어 규정되어 있는데, 이러한 식품첨가물은 기능 면에 있어서는 감미제, 풍미제, 보존제, 유화제, 산미료, 점증제 등으로 구분된다.
상기 감미제는 식품에 적당한 단맛을 부여하기 위하여 사용되는 것으로, 천연의 것이거나 합성된 것을 사용할 수 있다. 바람직하게는 천연 감미제를 사용하는 경우인데, 천연 감미제로서는 옥수수 시럽 고형물, 꿀, 수크로오스, 프룩토오스, 락토오스, 말토오스 등의 당 감미제를 들 수 있다.
상기 풍미제는 맛이나 향을 좋게 하기 위하여 사용될 수 있는데, 천연의 것과 합성된 것 모두 사용될 수 있다. 바람직하게는 천연의 것을 사용하는 경우이다. 천연의 것을 사용할 경우에 풍미 이외에 영양 강화의 목적도 병행할 수 있다. 천연 풍미제로서는 사과, 레몬, 감귤, 포도, 딸기, 복숭아 등에서 얻어진 것이거나 녹차잎, 둥굴레, 대잎, 계피, 국화 잎, 자스민 등에서 얻어진 것일 수 있다. 또 인삼(홍삼), 죽순, 알로에 베라, 은행 등에서 얻어진 것을 사용할 수 있다. 천연 풍미제는 액상의 농축액이나 고형상의 추출물일 수 있다. 경우에 따라서 합성 풍미제가 사용될 수 있는데, 합성 풍미제로서는 에스테르, 알콜, 알데하이드, 테르펜 등이 이용될 수 있다.
상기 보존제로서는 소르브산칼슘, 소르브산나트륨, 소르브산칼륨, 벤조산칼슘, 벤조산나트륨, 벤조산칼륨, EDTA(에틸렌디아민테트라아세트산) 등이 사용될 수 있고, 또 유화제로서는 아카시아검, 카르복시메틸셀룰로스, 잔탄검, 펙틴 등이 사용될 수 있으며, 산미료로서는 연산, 말산, 푸마르산, 아디프산, 인산, 글루콘산, 타르타르산, 아스코르브산, 아세트산, 인산 등이 사용될 수 있다. 산미료는 맛을 증진시키는 목적 이외에 미생물의 증식을 억제할 목적으로 식품 조성물이 적정 산도로 되도록 첨가될 수 있다.
상기 점증제로서는 현탁화 구현제, 침강제, 겔형성제, 팽화제 등이 사용될 수 있다.
본 발명의 식품 조성물은 전술한 바의 식품첨가물 이외에, 기능성과 영양성을 보충, 보강할 목적으로 당업계에 공지되고 식품첨가물로서 안정성이 보장된 생리활성 물질이나 미네랄류를 포함할 수 있다. 상기 생리활성 물질로는 녹차 등에 포함된 카테킨류, 비타민 B1, 비타민 C, 비타민 E, 비타민 B12 등의 비타민류, 토코페롤, 디벤조일티아민 등을 들 수 있으며, 미네랄류로서는 구연산칼슘 등의 칼슘 제제, 스테아린산마그네슘 등의 마그네슘 제제, 구연산철 등의 철 제제, 염화크롬, 요오드칼륨, 셀레늄, 게르마늄, 바나듐, 아연 등을 들 수 있다.
본 발명의 식품 조성물에는 전술한 바의 식품첨가물이 제품 유형에 따라 그 목적을 달성할 수 있는 적정량으로 포함될 수 있으며, 본 발명의 식품 조성물에 포함될 수 있는 기타의 식품첨가물과 관련하여서는 각국 식품공전이나 식품첨가물 공전을 참조할 수 있다.
상기 목적을 달성하기 위한 본 발명의 다른 하나의 양태는 락토바실러스 플란타럼(Lactobacillus plantarum) KF511 균주, 이의 배양액, 그의 농축액 또는 그의 건조물; 분홍바늘꽃 추출물 또는 사철쑥 추출물을 유효성분으로 포함하는 호흡기 질환 예방 또는 치료용 약제학적 조성물을 제공한다. 상기 용어 락토바실러스 플란타럼, 락토바실러스 플란타럼 KF511, 배양액, 분홍바늘꽃, 사철쑥, 추출물, 유효성분 및 호흡기 질환 등은 전술한 바와 같다.
본 발명의 용어 "예방"은 본 발명에 따른 락토바실러스 플란타럼 KF511 균주의 배양액 등을 포함하는 조성물의 투여로 개체의 호흡기 질환에 따른 증상을 억제 또는 지연시키는 모든 행위를 말한다.
본 발명의 용어 "치료"는 본 발명에 따른 락토바실러스 플란타럼 KF511 균주의 배양액 등을 포함하는 조성물의 투여로 개체의 호흡기 질환에 따른 증상이 호전되거나 완치되는 모든 행위를 의미한다.
본 발명의 약제학적 조성물은 유효성분으로 101 내지 1012 CFU 균수, 바람직하게는 106 내지 1012 CFU 균수를 갖는 락토바실러스 플란타럼 KF511를 포함할 수 있다.
본 발명의 상기 약제학적 조성물은 유효성분 이외에 약제학적으로 허용되는 담체를 포함하여 당업계에 공지된 통상의 방법으로 투여 경로에 따라 경구용 제형 또는 비경구용 제형으로 제조될 수 있다. 구체적으로, 상기 투여 경로는 국소 경로, 경구 경로, 정맥 내 경로, 근육 내 경로, 및 점막 조직을 통한 직접 흡수를 포함하는 임의의 적절한 경로일 수 있으며, 두 가지 이상의 경로를 조합하여 사용할 수도 있다. 두 가지 이상 경로의 조합의 예는 투여 경로에 따른 두 가지 이상의 제형의 약물이 조합된 경우로서 예컨대 1차로 어느 한 약물은 정맥 내 경로로 투여하고 2차로 다른 약물은 국소 경로로 투여하는 경우이다.
약학적으로 허용되는 담체는 투여 경로나 제형에 따라 당업계에 주지되어 있으며, 구체적으로는 '대한민국약전'을 포함한 각국의 약전을 참조할 수 있다.
본 발명의 약제학적 조성물이 경구용 제형으로 제조될 경우, 적합한 담체와 함께 당업계에 공지된 방법에 따라 분말, 과립, 정제, 환제, 당의정제, 캡슐제, 액제, 겔제, 시럽제, 현탁액, 웨이퍼 등의 제형으로 제조될 수 있다. 이때 적합한 담체의 예로서는 락토스, 글루코스, 슈크로스, 덱스트로스, 솔비톨, 만니톨, 자일리톨 등의 당류, 옥수수 전분, 감자 전분, 밀 전분 등의 전분류, 셀룰로오스, 메틸셀룰로오스, 에틸셀룰로오스, 나트륨 카르복시메틸셀룰로오스, 하이드록시프로필메틸셀룰로오스 등의 셀룰로오스류, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 마그네슘 스테아레이트, 광물유, 맥아, 젤라틴, 탈크, 폴리올, 식물성유, 에탄올, 그리세롤 등을 들 수 있다. 제제화활 경우 필요에 따라적절한 결합제, 윤활제, 붕해제, 착색제, 희석제 등을 포함시킬 수 있다. 적절한 결합제로서는 전분, 마그네슘 알루미늄 실리케이트, 전분페리스트, 젤라틴, 메틸셀룰로스, 소듐 카복시메틸셀룰로스, 폴리비닐피롤리돈, 글루코스, 옥수수 감미제, 소듐 알지네이트, 폴리에틸렌 글리콜, 왁스 등을 들 수 있고, 윤활제로서는 올레산나트륨, 스테아르산나트륨, 스테아르산마그네슘, 벤조산나트륨, 초산나트륨, 염화나트륨, 실리카, 탈쿰, 스테아르산, 그것의 마그네슘염과 칼슘염, 폴리데틸렌글리콜 등을 들 수 있으며, 붕해제로서는 전분, 메틸 셀룰로스, 아가(agar), 벤토나이트, 잔탄 검, 전분, 알긴산 또는 그것의 소듐 염 등을 들 수 있다. 또 희석제로서는 락토즈, 덱스트로즈, 수크로즈, 만니톨, 소비톨, 셀룰로스, 글라이신 등을 들 수 있다.
본 발명의 약제학적 조성물이 비경구용 제형으로 제조될 경우, 적합한 담체와 함께 당업계에 공지된 방법에 따라 주사제, 경피 투여제, 비강 흡입제 및 좌제의 형태로 제제화될 수 있다. 주사제로 제제화할 경우 적합한 담체로서는 수성 등장 용액 또는 현탁액을 사용할 수 있으며, 구체적으로는 트리에탄올 아민이 함유된 PBS(phosphate buffered saline)나 주사용 멸균수, 5% 덱스트로스 같은 등장 용액 등을 사용할 수 있다. 경피 투여제로 제제화할 경우 연고제, 크림제, 로션제, 겔제, 외용액제, 파스타제, 리니멘트제, 에어롤제 등의 형태로 제제화할 수 있다. 비강 흡입제의 경우 디클로로플루오로메탄, 트리클로로플루오로메탄, 디클로로테트라플루오로에탄, 이산화탄소 등의 적합한 추진제를 사용하여 에어로졸 스프레이 형태로 제제화할 수 있으며, 좌제로 제제화할 경우 그 담체로는 위텝솔(witepsol), 트윈(tween) 61, 폴리에틸렌글리콜류, 카카오지, 라우린지, 폴리옥시에틸렌 소르비탄 지방산 에스테르류, 폴리옥시에틸렌 스테아레이트류, 소르비탄 지방산 에스테르류 등을 사용할 수 있다.
약제학적 조성물의 구체적인 제제화와 관련하여서는 당업계에 공지되어 있으며, 예컨대 문헌[Remington's Pharmaceutical Sciences(19th ed., 1995)] 등을 참조할 수 있다. 상기 문헌은 본 명세서의 일부로서 간주 된다.
본 발명의 약제학적 조성물의 바람직한 투여량은 환자의 상태, 체중, 성별, 연령, 환자의 중증도, 투여 경로에 따라 1일 0.001mg/kg ~ 10g/kg 범위, 바람직하게는 0.001mg/kg ~ 1g/kg 범위일 수 있다. 투여는 1일 1회 또는 수회로 나누어 이루어질 수 있다. 이러한 투여량은 어떠한 측면으로든 본 발명의 범위를 제한하는 것으로 해석되어서는 아니 된다.
본 발명의 락토바실러스 플란타럼(Lactobacillus plantarum) KF511 균주, 분홍바늘꽃 추출물 또는 사철쑥 추출물은 사람 호흡기 상피세포(H292)를 이용한 점액과분비 모델에서 MUC5AC의 분비를 억제하고, 호중구 세포외 트랩(Neutrophil extracellular traps)의 네토시스(Netosis) 활성화를 억제하며, 기관지 상피세포주 NCI-H292 세포의 CSE(Cigarette Smoke Extraction)에 의한 염증성 사이토카인 발현을 억제하고, 나아가 CSE와 PPE로 유도된 호흡기 질환 마우스 모델에서 폐 조직 손상을 억제하며, BALF 내 총 세포, 대식세포, 림프구, 호산구, 호중구 등 면역세포 침윤을 억제하고 BALF 및 폐 조직에서 염증성 사이토카인과 케모카인 분비를 억제하는 활성을 나타낸다.
도 1은 PPE/CSE로 유도된 호흡기 질환(COPD)마우스 모델에 대해 본 발명의 락토바실러스 플란타럼 KF511 균주 및 양성 대조군으로 ROF를 투여한 후 기관지폐포세척액(BALF)로부터 계수된 총 세포수를 나타낸 것이다.
도 2 및 도 3은 Diff-Quick 염색을 통한 BALF 내 면역세포(Macrophage, Lympocyte, Neutrophils 및 Eosinophil)를 분석한 결과를 나타낸 것이다.
도 4는 호흡기 질환(COPD) 마우스 모델로부터 적출된 폐 조직을 염색한 결과를 나타낸 것이다.
도 5는 호흡기 질환(COPD) 마우스 모델의 BALF 내 Cytokine 및 Chemokine(KC, MCP-1, MDC, MIP-2, TARC, GM-CSF, INF-gamma, IL-6, IL-10, IL-17)을 분석한 결과를 나타낸 것이다.
도 6은 호흡기 질환(COPD) 마우스 모델의 폐 조직으로부터 Cytokine 및 Chemokine(KC, MCP-1, MDC, MIP-2, TARC, GM-CSF, INF-gamma, IL-1beta, IL-6, IL-17)을 분석한 결과를 나타낸 것이다.
도 7은 호흡기 질환(COPD) 마우스 모델 유래의 폐 조직에 락토바실러스 플란타럼 KF511 균주를 농도 별로 처리 후 폐 조직 내 B cell의 비율을 측정한 결과를 나타낸 것이다.
도 8은 호흡기 질환(COPD) 마우스 모델에 대해 락토바실러스 플란타럼 KF511 균주를 농도 별로 처리 후 BALF 내 IgA 함량을 측정한 결과를 나타낸 것이다.
도 9는 사람 호흡기 상피세포의 점액상피 암 세포주인 NCI-H292 세포에 대해 락토바실러스 플란타럼 KF511 균주를 농도 별로 처리 후 MUC5AC의 발현 정도를 측정한 결과를 나타낸 것이다.
도 10은 PPE/CSE로 유도된 호흡기 질환(COPD)마우스 모델에 대해 본 발명의 분홍바늘꽃 추출물 및 양성 대조군으로 ROF를 투여한 후 기관지폐포세척액(BALF)로부터 계수된 총 세포수를 나타낸 것이다.
도 11은 Diff-Quick 염색을 통한 BALF 내 면역세포(Macrophage, Lympocyte, Neutrophils 및 Eosinophil)를 분석한 결과를 나타낸 것이다.
도 12는 호흡기 질환(COPD) 마우스 모델로부터 적출된 폐 조직을 염색한 결과를 나타낸 것이다.
도 13은 분홍바늘꽃 추출물 처리에 따라 NCI-H292 세포에서 MUC5AC 억제 활성을 평가한 결과를 나타낸 것이다.
도 14는 분홍바늘꽃 추출물의 처리 농도에 따른 A549 세포에서 염증성 사이토카인(IL-8)의 억제 활성을 평가한 결과를 나타낸 것이다.
도 15 및 16은 PPE/CSE로 유도된 호흡기 질환(COPD)마우스 모델에 대해 본 발명의 사철쑥 추출물 및 양성 대조군으로 ROF를 투여한 후 기관지폐포세척액(BALF)로부터 계수된 총 세포수; 및 Diff-Quick 염색을 통한 BALF 내 면역세포(Macrophage, Lympocyte, Neutrophils 및 Eosinophil)를 분석한 결과를 나타낸 것이다.
도 17은 호흡기 질환(COPD) 마우스 모델로부터 적출된 폐 조직을 염색한 결과를 나타낸 것이다.
도 18은 사철쑥 추출물 처리에 따라 미세먼지에 의해 유도되는 NCI-H292 세포의 손상 억제 활성을 확인한 결과를 나타낸 것이다.
도 19는 사철쑥 추출물 처리에 따라 NCI-H292 세포에서 MUC5AC mRNA의 발현량을 측정한 결과를 나타낸 것이다.
이하, 본 발명을 하기 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예만으로 한정되는 것은 아니다.
실시예 1: 락토바실러스 플란타럼 KF511 균주 분리 및 동정
본 발명에 따른 락토바실러스 플란타럼 균주는 락토바실러스 MRS 한천 배지(MRS 배지, BD288130, 디프코사, 미국)를 이용하여 전통식으로 제조된 김치로부터 분리하였으며, 16S rDNA 시퀀싱을 통해 상기 분리된 균주를 동정하였다. 동정 결과, 상기 균주의 16s rDNA 염기서열(서열번호 1)은 기존의 락토바실러스 플란타럼 ATCC14917(T) 균주와 99.93%의 상동성을 보였다. 상기 균주의 배양을 위한 배지 조성은 MRS 배지이고, 배양조건은 pH 6.5 ± 0.2, 온도 37℃및 24시간 교반 배양이며, 산소 요구성은 통성혐기성이고, 동결건조보존 또는 세포현탁액 동결을 통해 균주 보존이 가능하다.
본 발명자들은 상기 균주를 락토바실러스 플란타럼(Lactobacillus plantarum) KF511로 명명하고, 국제미생물기탁기관인 한국미생물보존센터(KCCM)에 2019년 8월 21일자로 기탁하였으며, 수탁번호 KCCM 12573P를 부여받았다.
실시예 2: 분홍바늘꽃 추출물 및 사철쑥 추출물 준비
분홍바늘꽃(추출 부위: 지상부) 추출물을 제조하여 폐질환 개선 활성을 확인하였다. 추출물은 각 추출 대상 천연물의 건조 분말에 10배 중량의 70% 에탄올을 가하여 50℃에서 6시간씩 2회 반복 추출하여 여과한 후 감압농축 및 동결건조하여 분말상으로 얻었다.
또한, 사철쑥(추출 부위: 지상부) 추출물을 제조하여 폐질환 개선 활성을 확인하였다. 추출물은 각 추출 대상 천연물의 건조 분말에 10배 중량의 70% 에탄올을 가하여 50℃에서 6시간씩 2회 반복 추출하여 여과한 후 감압농축 및 동결건조하여 분말상으로 얻었다.
실험예 1: PPE+CSE-induced 호흡기 질환(COPD) 마우스 모델
오리엔트 바이오 사에서 BALB/C 마우스(male, 5주령)를 구입하여 1주일간 순화하였으며, n=10로 그룹화 하였다. 샘플 처리군은 COPD 유도 시작 일주일 전부터 해부전까지 24일간 107~109 CFU/head의 샘플을 경구 투여하였으며, Naive와 COPD 군은 동량의 PBS를 투여하였다. 이 때 양성 대조군인 Roflumilast(ROF) 군은 유도 시작 후 매일 10 mg/kg 농로 경구 투여하였다. COPD 유도에는 Porcine Pancreatic Elastase (PPE) 1.2 unit과 100% Cigarette Smoke Extraction (CSE)를 사용하였다. PPE 1.2 unit은 7일에 한번씩 intra nasal을 통해 총 3회 투입하였으며, CSE는 PPE 처리 다음날부터 3일간 intra nasal을 통해 20 ㎕ 처리하되, 마지막 PPE 처리 후에는 CSE를 처리하지 않고 다음 날 해부를 진행하였다. 해부는 흡입 마취기를 이용하여 isoflurane으로 마취시킨 후 진행하였다. 실험기간 동안 사료와 음용수는 자율급식 형태로 제공하였으며, 24℃, 습도 60% 환경에서 사육하였다.
실험예 2: BALF 내 침투된 총 세포수 및 Diff-Quick 염색을 통한 BALF 내 면역세포 분석
2-1: BALF 내 침투된 총 세포수
호흡기 질환(COPD) 모델 마우스의 기도를 통해 PBS 1 mL을 주입한 후 가볍게 마사지하여 700 μL의 기관지폐포세척액 (bronchoalveolar lavage fluid; BALF)을 회수하였다. 회수한 BALF액 10 uL를 Accustain T solution과 동량 혼합하여 Accuchip channel에 12 uL 주입 한 후 cell counter (ADAM-MC, NANOENTEK. INC, Korea)로 total cell을 자동 계수하였다(도 1).
2-2: Diff-Quick 염색을 통한 BALF 내 면역세포 분석
회수한 BALF는 300Хg, 5분 조건에서 원심분리를 통해 상층액과 세포 pellet으로 분리하였다. cell pellet은 PBS 700 μL를 첨가하여 재현탁하였으며, 이 BALF 현탁액 150 μL를 Cytospin device(Centrifuge 5403, Eppendorf, Hamburg, Germany)로 1000 rpm, 10 min, 4℃조건에서 원심분리하여 slide에 BALF 세포를 부착시켰다. 이 후 Diff-Quick staining reagent를 사용하여 제조사 (1-5-1 Wakinohamakaigandori, chuo-ku, Kobe, Japan)의 프로토콜에 준하여 세포를 염색한 후 현미경으로 관찰하였다(도 2 및 도 3).
실험예 3: 조직 분석 (Histological examination)
해부한 호흡기 질환(COPD) 모델 마우스로부터 폐 조직을 적출하여 폐의 중간엽을 제거한 후 10% neutral buffered formalin에 3일간 고정하였다. 고정한 조직을 ethyl alcohol과 xylene으로 탈수 시킨 후 파라핀으로 포매 한 후 삭정하고 5 um 두께로 박절하였다. 준비한 절편을 슬라이드에 부착시킨 후, 일반적인 형태를 확인하기 위해 H&E로 염색한 후 현미경으로 관찰하였다(도 4, 도 12, 도 17).
실험예 4: BALF 내 Cytokines 및 Chemokines 분석
호흡기 질환(COPD) 모델 마우스의 기도를 통해 PBS 1 mL을 주입한 후 가볍게 마사지하여 700 μL의 기관지폐포세척액(bronchoalveolar lavage fluid; BALF)을 회수하였다. 회수한 BALF는 300Хg, 5분 조건에서 원심분리하여 상층액을 분리 한 후 cytokines 및 chemokines 분석(KC, MCP-1, MDC, MIP-2, TARC, GM-CSF, INF-gamma, IL-6, IL-10, IL-17)에 사용하였다. cytokines 및 chemokines 분석을 위해 상층액 30 uL를 취한 후 Q-plex ELISA array kit의 제조사(Quansis biosciences 社) 프로토콜에 따라 실험을 진행하였다. 그 결과는 도 5에 각각의 cytokine 또는 chemokines 별로 나타내었다.
실험예 5: 폐 조직의 Cytokines 및 Chemokines 분석
호흡기 질환(COPD) 모델 마우스 폐 조직 무게의 10배에 해당하는 PBS를 첨가하고 homogenizer로 분쇄한 후 12,000 rpm, 20 min 조건에서 원심분리하였다. 회수한 상등액은 cytokines 및 chemokines 분석 (KC, MCP-1, MDC, MIP-2, TARC, GM-CSF, INF-gamma, IL-1beta, IL-6, IL-17)에 사용하였다. cytokines 및 chemokines 분석을 위해 상층액 30 uL를 취한 후 Q-plex ELISA array kit의 제조사(Quansis biosciences 社) 프로토콜에 따라 실험을 진행하였다. 그 결과는 도 6에 각각의 cytokine 또는 chemokines 별로 나타내었다.
실험예 6: 폐 조직 내 면역세포 비율 측정
호흡기 질환(COPD) 모델 마우스로부터 폐 조직을 회수하고, 해부용 가위를 이용하여 폐 조직을 세절하였다. GentleMACS C tube에 세절한 폐 조직을 넣고, 제조사(miltenyi Biotec社)의 프로토콜에 따라 enzyme D와 A를 처리하여 MACS dissociator로 조직을 단세포화 하였다. 단세포화 된 세포는 red blood cell lysis을 처리하여 거친 뒤, 각 그룹별로 세포수를 측정하였다. 세포는 1Х107 cells/mL 농도로 만들어, 96 well V-bottom plate에 well당 200μL씩 분주하였다. 면역세포와 관련된 표면 마커를 염색하기 전에 FACS buffer (PBS + 8% NaHCO3 + 1% FBS + 10% NaN3)를 이용하여 Fc blockTM 을 0.8 μL/20 μL/well로 처리한 다음 피펫팅하여 4℃냉장고에서 15분간 방치하였다. 세척을 위해, 1800rpm에서 3분간 원심분리를 하여 상등액을 제거하였다. 다양한 면역세포들의 표면 마커들을 염색하기 위해 관련된 항체들을 제조사(Biolegend社)의 염색 농도 권장량에 따라 각각 계산하여 FACS buffer에 희석하여 준비하였다.
실험에는 FITC anti-mouse I-A/I-E, PE anti-mouse CD11c, PerCP/Cy5.5 anti-mouse Ly-6C antibody, APC anti-mouse CD64(FcγRI), Alexa Fluor 700 anti-mouse Ly-6G, APC/Fire 750 anti-mouse CD45 antibody, Brilliant Violet 421 anti-mouse CD24, Brilliant Violet 510 anti-mouse/human CD11b antibody를 사용하였다. 희석한 항체들을 20 μL/well로 처리하여 상온에서 30분간 반응하였다. 이후, PBS를 이용하여 세척하고, 세포를 PBS에 현탁시킨다. 현탁한 세포는 유세포분석기인 Cytoflex (Beckman Coulter社)를 이용하여 분석하였다. 그 결과는 도 7 에 락토바실러스 플란타럼 KF511(LPKF511) 균주 각각의 처리 농도에 따라 나타내었다.
실험예 7: BALF 내 IgA 함량 측정
IgA의 측정은 ELISA kit (eBioscience, USA) 의 실험 방법에 따라 측정하였다. Capture antibody를 Coating Buffer로 희석시켜 96 well Immunoplate에 Well 당 100 μ씩 분주한 후 4℃에서 하루 정도 방치하였다. 다음 날, Washing buffer를 이용하여 2회 Washing 후, Blocking buffer를 Well당 250 μ씩 분주하고 상온에서 2시간 방치하였다. Blocking 과정이 끝난 뒤 4회 Washing 후, Standard 시료와 각 군들의 BALF 용액을 Assay Buffer로 희석하여 Well 당 100 μ씩 분주하고 상온에서 2시간 방치하였다. 용액을 4회 Washing 후, Detection-Antibody를 Assay Buffer로 희석하여 well당 100 μL씩 분주하고 상온에서 1시간 방치하였다. 용액을 4회 Washing 후, Substrate solution을 well당 100 μL씩 분주한 후 상온에서 15분간 방치하고 Stop solution을 well당 100 μL씩 첨가하여 반응을 종료 시켰다. 이 후, 450nm의 파장에서 흡광도를 측정하고 Standard를 이용한 표준 곡선으로 정량하였다. 그 결과는 도 8에 락토바실러스 플란타럼 KF511(LPKF511) 균주 각각의 처리 농도에 따라 나타내었다.
실험예 8: NCI-H292를 이용한 MUC5AC 억제능 확인
점액 내 당단백질인 뮤신은 점액 유전자에 의해 생성되며, 특히 분비형 점소인 MUC5AC의 발현은 호흡기 영역에서 중요한 역할을 한다. 이에 본 실험에서는 사람 호흡기 상피세포의 점액 상피 암 세포주인 NCI-H292 세포를 이용하여 락토바실러스 플란타럼 KF511 균주의 MUC5AC의 억제능을 확인하고자 하였다.
8-1: H292 세포 배양
H292 세포의 배양은 10% FBS(Fetal bovine serum), 100 unit/ml의 penicillin과 100mg/ml의 streptomycin이 포함된 RPMI 1640 배지를 사용하였다. H292세포는 48well cell culture plate에 4Х104 cell/well 농도로 접종하여 37℃, 5%의 이산화탄소(CO2)를 제공하는 조건에서 24시간 동안 배양하였다. 24시간 배양 후에는 배양배지의 조성에서 FBS의 농도를 0.2 %로 낮춘 배지로 교체하여 37℃, 5%의 이산화탄소(CO2)를 제공하는 조건에서 24시간동안 starvation을 진행하였다. 이후 샘플 및 자극 물질 처리는 모두 serum이 첨가되지 않은 RPMI1640 배지를 사용하였다. 자극물질은 PMA(Phorbol 12-myristate 13-acetate)를 사용하였고 최종농도 2 ng/mL가 되도록 하여 KF511 106-9 cell/well과 동시처리 후 24시간 배양하였다. 배양 상등액은 회수하여 ELISA 분석방법을 이용한 MUC5AC 측정에 사용하였다.
8-2: MUC5AC 측정
배양 상등액은 96 well immunoplate에 100μL씩 분주하여 50℃의 드라이 오븐에서 모두 건조시킨 후 0.05% tween 20이 첨가된 PBS로 3회 세척하였다. 이후 모든 단계 사이에는 위와 동일한 세척방법을 사용하였다. 1% BSA(Bovine serum albumin)는 well당 200μL씩 분주하여 1시간동안 블라킹을 진행한 뒤 세척하였다. MUC5AC antibody(abcam)는 500배 희석하여 well당 100μL씩 분주하여 2시간동안 반응시켰다. 세척 후 goat anti-mouse IgG HRP(abcam)은 2000배 희석하여 well당 100μL씩 분주 후 차광하여 1시간동안 반응시켰다. substrate solution(BD)을 well당 100μL씩 분주한 뒤 차광하여 30분간 반응시킨 뒤 stop solution을 well 당 50μL씩 첨가하여 반응을 멈췄다. ELISA reader를 이용하여 450nm에서 흡광도를 측정하였고 MUC5AC의 억제능은 아무것도 처리하지 않은 대조군 세포를 기준으로 하였을 때 PMA에 의한 MUC5AC의 생성능 대비 샘플 처리 시 억제된 정도를 나타내었다.
MUC5AC의 생성능을 확인한 결과, 자극을 주지 않은 대조군 세포와 비교하여 PMA의 경우 MUC5AC의 생성을 2.5배 정도 증가시킨 것을 확인하였다. 그에 반해 락토바실러스 플란타럼 KF511(LPKF511) 균주를 처리한 경우 그 처리 농도에 의존적으로 MUC5AC의 생성이 유의적으로 감소되는 것을 확인하였다(도 9).
실험예 9: BALF 내 침투된 총 세포수 및 Diff-Quick 염색을 통한 BALF 내 면역세포 분석
9-1: BALF 내 침투된 총 세포수
호흡기 질환(COPD) 모델 마우스의 기도를 통해 PBS 1 mL을 주입한 후 가볍게 마사지하여 700 μL의 기관지폐포세척액 (bronchoalveolar lavage fluid; BALF)을 회수하였다. 회수한 BALF액 10 uL를 Accustain T solution과 동량 혼합하여 Accuchip channel에 12 uL 주입 한 후 cell counter (ADAM-MC, NANOENTEK. INC, Korea)로 total cell을 자동 계수하였다(도 10, 도 15).
9-2: Diff-Quick 염색을 통한 BALF 내 면역세포 분석
회수한 BALF는 300×g, 5분 조건에서 원심분리를 통해 상층액과 세포 pellet으로 분리하였다. cell pellet은 PBS 700 μL를 첨가하여 재현탁하였으며, 이 BALF 현탁액 150 μL를 Cytospin device(Centrifuge 5403, Eppendorf, Hamburg, Germany)로 1000 rpm, 10 min, 4℃ 조건에서 원심분리하여 slide에 BALF 세포를 부착시켰다. 이 후 Diff-Quick staining reagent를 사용하여 제조사 (1-5-1 Wakinohamakaigandori, chuo-ku, Kobe, Japan)의 프로토콜에 준하여 세포를 염색한 후 현미경으로 관찰하였다(도 11, 도 16).
실험예 10: NCI-H292 세포를 이용한 MUC5AC 억제활성 측정
H292 세포의 배양은 10% FBS(Fetal bovine serum), 100 unit/ml의 penicillin과 100mg/ml의 streptomycin이 포함된 RPMI 1640 배지를 사용하였다. H292세포는 48well cell culture plate에 4×104 cell/well 농도로 접종하여 37℃, 5%의 이산화탄소(CO2)를 제공하는 조건에서 24시간 동안 배양하였다. 24시간 배양 후에는 배양배지의 조성에서 FBS의 농도를 0.2 %로 낮춘 배지로 교체하여 37℃, 5%의 이산화탄소(CO2)를 제공하는 조건에서 24시간동안 starvation을 진행하였다. 이후 샘플 및 자극 물질 처리는 모두 serum이 첨가되지 않은 RPMI1640 배지를 사용하였다. 자극물질은 PMA(Phorbol 12-myristate 13-acetate)를 사용하였고 최종농도 2 ng/mL가 되도록 하여 분홍바늘꽃과 동시처리 후 24시간 배양하였다. 배양 상등액은 96 well immunoplate에 100μL씩 분주하여 50℃의 드라이오븐에서 모두 건조시킨 후 0.05% tween 20이 첨가된 PBS로 3회 세척하였다. 이후 모든 단계 사이에는 위와 동일한 세척방법을 사용하였다. 1% BSA(Bovine serum albumin)는 well당 200μL씩 분주하여 1시간동안 블라킹을 진행한 뒤 세척하였다. MUC5AC antibody(abcam)는 500배 희석하여 well당 100μL씩 분주하여 2시간 동안 반응시켰다. 세척 후 goat anti-mouse IgG HRP(abcam)은 2000배 희석하여 well당 100μL씩 분주 후 차광하여 1시간동안 반응시켰다. substrate solution(BD)을 well당 100μL씩 분주한 뒤 차광하여 30분간 반응시킨 뒤 stop solution을 well 당 50μL씩 첨가하여 반응을 멈췄다. ELISA reader를 이용하여 450nm에서 흡광도를 측정하였고 MUC5AC의 억제능은 아무것도 처리하지 않은 대조군 세포를 기준으로 하였을 때 PMA에 의한 MUC5AC의 생성능 대비 샘플 처리 시 억제된 정도를 나타내었다. 상징액을 회수 후, 남은 세포에는 RPMI1640 + 10% FBS + 1% P/S 배지로 1/10 희석한 Water soluble tetrazolium salt (WST) 시약을 500 μL/well 처리하여 37℃, 5% CO2 incubator에서 50 분간 반응 시킨 후 450nm에서 흡광도를 측정하여 세포 생존율 (WST)을 확인하였으며, 대조군보다 생존율이 떨어지는 농도는 MUC5AC 분석에서 제외하였다. 그 결과는 도 13에 분홍바늘꽃 추출물의 처리 농도 별로 나타내었으며, 분홍바늘꽃 추출물의 처리에 따라 MUC5AC 생산이 억제됨을 확인하였다.
실험예 11: A549 세포를 이용한 염증성 사이토카인 (IL-8) 억제활성 평가
96 well plate에 1×105 cells/mL 농도로 준비한 A549 세포를 200 μL/well로 계대하여 24시간 배양한 후, MEM + 10% FBS + 1% P/S 배지를 이용하여 자극물질 (TNF-α; 최종 5 ng/mL)과 샘플 (최종; 3.12, 6.25, 12.5, 25 μg/mL)을 원하는 최종농도를 반영하여 희석한 후, well당 200 uL씩 처리하였다. 하룻밤 배양 후, 배양 상징액을 회수하여 IL-8 측정에 사용하였다. Human IL-8는 ELISA법으로 측정하였으며, 제조사(BD社)의 프로토콜에 따라 진행하였다. 이때, IL-8 측정용 상징액은 40배로 희석하여 분석하였다. 상징액을 회수 하고 남은 세포에는 MEM + 10% FBS + 1% P/S 배지로 100 μL/well 처리하고, 2mg/mL 농도로 준비한 MTT(Thiazolyl blue tetrazolium bromide, Sigma社) 시약을 20 μL/well 처리하여 37℃, 5% CO2 incubator에서 4 시간 반응 시킨 후, 10% SDS 용액을 100 μL/well 처리하여 다음날 570nm에서 흡광도를 측정하여 세포 생존율 (MTT)을 확인하였으며, 대조군보다 생존율이 떨어지는 농도는 사이토카인 분석에서 제외하였다. 그 결과, 분홍바늘꽃 추출물의 처리 농도에 의존적으로 염증성 사이토카인(IL-8) 수준이 억제됨을 확인하였다(도 14).
실험예 12: 미세먼지에 의해 유도되는 NCI-H292 세포 손상 억제활성
H292세포는 6well cell culture plate의 well마다 cover glass를 넣은 뒤 콜라겐 코팅하여 사용하였다. 콜라겐 코팅은 Cell matrix type I-C(Nitta)를 0.02N HCl에 15배 희석하여 well 마다 30분간 처리 한 뒤 DPBS로 3번 세척 후 사용하였다. H292세포는 3×105 cells/well 농도로 접종하여 37℃, 5%의 이산화탄소(CO2)를 제공하는 조건에서 24시간 동안 배양하였다. 24시간 배양 후에는 배양배지의 조성에서 FBS의 농도를 0.2 %로 낮춘 배지로 교체하여 37℃, 5%의 이산화탄소(CO2)를 제공하는 조건에서 24시간동안 starvation을 진행하였다. 이후 샘플 및 자극 물질 처리는 모두 serum이 첨가되지 않은 RPMI1640 배지를 사용하였다. 자극물질은 CRM(Urban aerosols No.28, NIES)을 사용하였고, 최종농도가 100 μg/mL가 되도록 하여 사철쑥과 동시처리 후 24시간 배양하였다. 배양 완료 후 DPBS로 2회 세척하였고 cover glass는 회수하여 Diff Quick(Sysmex) 염색을 진행하였다. 염색은 제조사(Sysmex社)의 프로토콜에 따라 염색 Solution 3가지를 순차적으로 염색을 진행하였다. 염색 완료 후에는 현미경관찰을 통해 CRM에 의한 세포의 손상정도와 비교하여 보호효과를 확인하였다(도 18).
실험예 13: NCI-H292 세포를 이용한 MUC5AC mRNA 발현량 분석
실험예 1의 방법에 준하여 NCI-H292 세포에 미세먼지(CRM)와 사철쑥 시료를 처리하고 배양한 후 세포는 QiAzol Lysis Reagent(QIAGEN)을 사용하여 회수하였다. RNA 추출은 RNeasy Mini kit(QIAGEN) 를 사용하여 제조사의 프로토콜에 따라 진행하였고 cDNA합성은 Maxime RT Premix(iNtRoN)를 사용하였다. 합성된 cDNA와 SYBR Green PCR kit(QIAGEN) 및 프라이머 쌍을 이용하여 유전자를 증폭하였다. 분석에는 MUC5AC primer (Forward: TCAACGGAGACTGCGAGTACAC, Reverse CTTGATGGCCTTGGAGCA)를 사용하였다. Real-time PCR은 95oC에서 15분, 95oC에서 15초, 60oC에서 15초, 72oC에서 15초 반응시켰으며 50 사이클을 반복하였다. MUC5AC의 mRNA 발현량은 아무것도 처리하지 않은 대조군 세포를 기준으로 하였을 때 CRM에 의한 MUC5AC의 생성능 대비 샘플 처리 시 억제된 정도를 확인하였다. 그 결과, 사철쑥 추출물을 처리한 경우 MUC5AC mRNA 발현량이 아무것도 처리하지 않은 대조군과 유사한 수준으로 감소됨을 확인하였다(도 19).
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2020013749-appb-I000001

Claims (12)

  1. 락토바실러스 플란타럼(Lactobacillus plantarum) 균주, 이의 배양액, 그의 농축액 또는 그의 건조물; 분홍바늘꽃(Epilobium angustifolium L.) 추출물; 또는 사철쑥(Artemisia capillaris Thunb.) 추출물을 유효성분으로 포함하는, 호흡기 기능 강화 및 호흡기 질환 개선용 식품 조성물.
  2. 제1항에 있어서, 상기 락토바실러스 플란타럼은 기탁번호 KCCM 12573P로 기탁된 락토바실러스 플란타럼 KF511 균주인, 조성물.
  3. 제1항에 있어서, 상기 추출물은 물, 에탄올 또는 이들의 혼합용매 추출물인 것을 특징으로 하는 조성물.
  4. 제1항에 있어서, 상기 호흡기 질환은 기침, 객담, 호흡 곤란, 기도 과민성, 기도 폐쇄, 점액 과분비, 호기 유속의 감소 및/또는 가스 교환의 장애 증상을 수반하는 폐질환인 것을 특징으로 하는, 조성물.
  5. 제1항에 있어서, 상기 호흡기 질환은 천식, COPD, 미만성 간질성 폐질환, 급성호흡곤란증후군(acute respiratory distress syndrome, ARDS) 또는 급성 폐손상인 것을 특징으로 하는, 조성물.
  6. 제5항에 있어서, 상기 호흡기 질환은 천식 또는 COPD인 것을 특징으로 하는, 조성물.
  7. 제1항 내지 제6항 중 어느 한 항의 식품 조성물을 포함하는, 건강기능식품.
  8. 락토바실러스 플란타럼(Lactobacillus plantarum) 균주, 이의 배양액, 그의 농축액 또는 그의 건조물; 분홍바늘꽃 추출물; 또는 사철쑥 추출물을 유효성분으로 포함하는, 호흡기 질환 예방 또는 치료용 약제학적 조성물.
  9. 제8항에 있어서,
    상기 락토바실러스 플란타럼은 기탁번호 KCCM 12573P로 기탁된 락토바실러스 플란타럼 KF511 균주인, 조성물.
  10. 제8항에 있어서, 상기 추출물은 물, 에탄올 또는 이들의 혼합용매 추출물인 것을 특징으로 하는 조성물.
  11. 제8항에 있어서,
    상기 호흡기 질환은 천식, COPD, 미만성 간질성 폐질환, 급성호흡곤란증후군(acute respiratory distress syndrome, ARDS) 또는 급성 폐손상인 것을 특징으로 하는, 조성물.
  12. 제11항에 있어서, 상기 호흡기 질환은 천식 또는 COPD인 것을 특징으로 하는, 조성물.
PCT/KR2020/013749 2019-10-08 2020-10-08 락토바실러스 플란타럼 균주 등을 이용한 호흡기 질환 개선용 조성물 WO2021071292A2 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN202080072761.1A CN114615898A (zh) 2019-10-08 2020-10-08 利用植物乳杆菌菌株等的呼吸系统疾病改善用组合物
EP20875412.7A EP4042880A4 (en) 2019-10-08 2020-10-08 COMPOSITION USING LACTOBACILLUS PLANTARUM STRAIN OR SIMILAR FOR THE RELIEF OF RESPIRATORY DISEASES
US17/767,181 US20220369684A1 (en) 2019-10-08 2020-10-08 Composition for improving respiratory diseases using lactobacillus plantarum strain

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
KR10-2019-0124489 2019-10-08
KR10-2019-0124492 2019-10-08
KR20190124486 2019-10-08
KR20190124489 2019-10-08
KR10-2019-0124486 2019-10-08
KR20190124492 2019-10-08

Publications (3)

Publication Number Publication Date
WO2021071292A2 WO2021071292A2 (ko) 2021-04-15
WO2021071292A3 WO2021071292A3 (ko) 2021-06-10
WO2021071292A9 true WO2021071292A9 (ko) 2021-07-22

Family

ID=75437982

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/013749 WO2021071292A2 (ko) 2019-10-08 2020-10-08 락토바실러스 플란타럼 균주 등을 이용한 호흡기 질환 개선용 조성물

Country Status (4)

Country Link
US (1) US20220369684A1 (ko)
EP (1) EP4042880A4 (ko)
CN (1) CN114615898A (ko)
WO (1) WO2021071292A2 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114344343B (zh) * 2021-12-30 2024-02-09 南京医科大学 植物乳杆菌在制备抗急性肺损伤药物中的应用

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101287120B1 (ko) * 2011-10-28 2013-07-17 대상에프앤에프 주식회사 락토바실러스 플란타륨 ｄｓｒ ｃｋ10또는 락토바실러스 플란타륨 ｄｓｒ ｍ2를 유효성분으로 함유하는 암 치료용 조성물
US9587284B2 (en) * 2014-02-21 2017-03-07 Asian Probiotics and Prebiotics Ltd. Lactic acid bacterium having immunomodulatory and anti-allergic effects and pharmaceutical composition containing the same
CN104996994A (zh) * 2015-04-24 2015-10-28 劲膳美生物科技股份有限公司 慢性阻塞性肺疾病特定全营养配方食品
KR20170032815A (ko) * 2015-09-15 2017-03-23 경희대학교 산학협력단 신규 유산균 및 퇴행성 뇌질환 또는 인지기능의 예방, 개선 또는 치료용 조성물
CN106262931A (zh) * 2016-08-04 2017-01-04 吉林省农业科学院 植物乳杆菌在制备抗过敏产品中的应用
WO2018191073A1 (en) * 2017-04-12 2018-10-18 The Uab Research Foundation Inhaled respiratory probiotics for lung diseases of infancy, childhood and adulthood
KR102038380B1 (ko) * 2017-05-08 2019-10-30 전남대학교 산학협력단 락토바실러스 플란타럼으로부터 유래된 당단백질 l67을 포함하는 알레르기 질환의 예방 또는 치료용 조성물

Also Published As

Publication number Publication date
EP4042880A2 (en) 2022-08-17
US20220369684A1 (en) 2022-11-24
CN114615898A (zh) 2022-06-10
EP4042880A4 (en) 2023-10-25
WO2021071292A3 (ko) 2021-06-10
WO2021071292A2 (ko) 2021-04-15

Similar Documents

Publication Publication Date Title
WO2012165843A2 (ko) 생약 추출물 또는 이의 유산균 발효물을 포함하는 호흡기 질환의 예방 또는 치료용 조성물
KR102646341B1 (ko) 사철쑥 추출물을 유효성분으로 포함하는 호흡기 질환 개선용 조성물
KR102247367B1 (ko) 모과나무 추출물을 이용한 호흡기 질환 개선용 조성물
KR102467856B1 (ko) 분홍바늘꽃 추출물을 유효성분으로 포함하는 호흡기 질환 개선용 조성물
WO2021071292A9 (ko) 락토바실러스 플란타럼 균주 등을 이용한 호흡기 질환 개선용 조성물
KR102252124B1 (ko) 소태나무 추출물을 이용한 호흡기 질환 개선용 조성물
KR20190133637A (ko) 복령피 추출물을 이용한 만성폐쇄성폐질환 개선용 조성물
KR102302910B1 (ko) 생열귀나무 추출물을 이용한 호흡기 질환 개선용 조성물
KR102185827B1 (ko) 아커만시아 뮤시니필라 균주를 포함하는 아토피성 질환 예방 또는 치료용 약학적 조성물
KR102328744B1 (ko) 락토바실러스 플란타럼 균주를 유효성분으로 포함하는 호흡기 질환 개선용 조성물
KR102309911B1 (ko) 신규한 아커만시아 뮤시니필라 ak32 균주의 발견 및 장 손상의 예방 또는 치료를 위한 응용
KR102254572B1 (ko) 향유 추출물을 이용한 만성폐쇄성폐질환 개선용 조성물
KR102434641B1 (ko) 페디오코쿠스 펜토사세우스를 이용한 호흡기 기능 개선용 식품 조성물
KR102273066B1 (ko) 나한송 추출물을 이용한 만성폐쇄성폐질환 개선용 조성물
KR102346724B1 (ko) 바늘꽃 추출물을 이용한 천식 또는 만성폐쇄성폐질환 개선용 조성물
KR20200027453A (ko) 호장근 추출물을 이용한 호흡기 질환 개선용 조성물
WO2019225995A1 (ko) 바늘꽃 추출물 등을 이용한 천식 또는 만성폐쇄성폐질환 개선용 조성물
WO2020050633A1 (ko) 갯대추나무 추출물 등을 포함하는 호흡기 질환 개선용 조성물
KR102256880B1 (ko) 갯대추나무 추출물을 이용한 호흡기 질환 개선용 조성물
KR20200135640A (ko) 강황 추출물, 황금 추출물 등을 이용한 천식 또는 만성폐쇄성폐질환 개선용 조성물
KR102273075B1 (ko) 괭이눈 추출물을 이용한 호흡기 질환 개선용 조성물
WO2024112112A1 (ko) 흑미강발효분말 정제분획을 유효성분으로 포함하는 천식 치료용 조성물
KR20220047193A (ko) 더위지기 추출물을 포함하는 진해 또는 거담용 조성물
KR20210047813A (ko) 물레나물 추출물 등을 포함하는 호흡기 질환 개선용 조성물
KR20200134819A (ko) 보리수 추출물 등을 이용한 천식 또는 만성폐쇄성폐질환 개선용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20875412

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020875412

Country of ref document: EP

Effective date: 20220509