WO2021067480A1 - Compositions and methods for treatment of hepatitis b virus infection - Google Patents
Compositions and methods for treatment of hepatitis b virus infection Download PDFInfo
- Publication number
- WO2021067480A1 WO2021067480A1 PCT/US2020/053606 US2020053606W WO2021067480A1 WO 2021067480 A1 WO2021067480 A1 WO 2021067480A1 US 2020053606 W US2020053606 W US 2020053606W WO 2021067480 A1 WO2021067480 A1 WO 2021067480A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- uracil
- arm region
- nucleic acid
- poly
- pamp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/425—Thiazoles
- A61K31/428—Thiazoles condensed with carbocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
- A61K31/52—Purines, e.g. adenine
- A61K31/522—Purines, e.g. adenine having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/66—Phosphorus compounds
- A61K31/675—Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
- A61K31/7072—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid having two oxo groups directly attached to the pyrimidine ring, e.g. uridine, uridylic acid, thymidine, zidovudine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7115—Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55555—Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
Definitions
- Hepatitis B virus is a global public health problem with more than 250 million people chronically infected worldwide.
- Chronic HBV infection is a leading cause of liver disease including liver cirrhosis, hepatocellular carcinoma (HCC), and liver failure such that HBV infection causes over 700,000 deaths annually [WHO, 2017]
- HBV is a small, hepatotropic DNA virus that replicates in part through reverse transcription. HBV specifically enters hepatocytes through the sodium-taurocholate cotransporting polypeptide (NTCP) receptor to replicate and produce virion. After entry into the hepatocyte cytosol, the viral nucleocapsid is translocated to the nucleus for disassembly and release of the viral relaxed circular (RC) DNA. In the nucleus, the RC DNA is converted to covalently closed circular DNA (cccDNA) that is a long-lived viral mini-chromosome serving as the main template for the synthesis of all HBV RNA transcripts including pregenomic (pg) RNA, pre-S, S, and X viral RNAs.
- NTCP sodium-taurocholate cotransporting polypeptide
- the mature nucleocapsid-containing RC DNA acquires an envelope via budding at the endoplasmic reticulum (ER) and then produces progeny virion.
- ER endoplasmic reticulum
- a portion of the pool of mature HBV nucleocapsids is used to facilitate further cccDNA synthesis in a process called the intracellular amplification pathway. This process facilitates the pool of cccDNA to be maintained as a steady-state population of 3-50 molecules per cell marking chronic infection. Removal of cccDNA from the liver either through its eradication from infected cells or depletion of infected cells is considered to be essential for HBV cure.
- N-Ag-IFNa pegylated interferon alpha
- these therapies can suppress active viral replication, reduce cccDNA levels, and can slow disease progression, they do not eliminate the nuclear pool of cccDNA, and are associated with significant side-effects in treated patients.
- the persistence of cccDNA is established to be 6-22 weeks in vivo in which lifelong treatment with antiviral therapy is required for a majority of patients to continuously suppress viral replication.
- IFN- based therapy for chronic HBV is poorly tolerated and only a low frequency of treated patients show complete loss of HBsAg that defines clinical HBV cure.
- the disclosure provides a method for suppressing hepatitis B virus (HBV) covalently-closed-circular DNA (cccDNA) levels in an infected cell.
- the method comprises contacting the infected cell with an agent that induces interferon regulatory factor 3 (IRF3) activation in the infected cell.
- IRF3 interferon regulatory factor 3
- “Suppressing cccDNA” can comprise inhibiting cccDNA formation in the infected cell or reducing the stability of existing cccDNA in the infected cell.
- the agent induces IRF3 activation by inducing a retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) signaling pathway.
- RLR retinoic acid-inducible gene I
- the agent is or comprises a nucleic acid molecule comprising a pathogen- associated molecular pattern (PAMP), wherein the PAMP comprises: a 5' arm region comprising a terminal triphosphate; a poly uracil core comprising at least 8 contiguous uracil residues; and a 3' arm region comprising at least 8 nucleic acid residues, wherein the 5' most nucleic acid residue of the 3' arm region is not a uracil, and wherein the 3' arm region is at least 30% uracil residues.
- the agent is a small molecule agent.
- the small molecule agent is or comprises a benzothiazol-derivative molecule, such as a small molecule agent comprising the chemical formula N-(6-benzamido-l,3-benzothiazol-2-yl)naphthalene-2-carboxamide.
- the method comprises contacting the cell with a combination of a nucleic acid molecule comprising a pathogen-associated molecular pattern (PAMP) and a small molecule agent (e.g., a benzothiazol-derivative molecule, e.g., N-(6-benzamido-l,3- benzothiazol-2-yl)naphthalene-2-carboxamide).
- PAMP pathogen-associated molecular pattern
- the method further comprises contacting the cell with a nucleoside reverse transcriptase inhibitor (NRTI).
- NRTI nucleoside reverse transcriptase inhibitor
- the NRTI is selected from Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Tenofovir, Tenofovir alafenamide (TAF), Clevudine, Besivo, Zadaxin, Remdesivir, and the like.
- the cell is a hepatocyte.
- the disclosure provides a method of treating or preventing a hepatitis B virus (HBV) infection in a subject in need thereof.
- the method comprises administering to the subject a therapeutically effective amount of composition that induces interferon regulatory factor 3 (IRF3) activation in infected cells of the subject.
- IRF3 interferon regulatory factor 3
- the composition comprises a nucleic acid molecule comprising a pathogen-associated molecular pattern (PAMP), wherein the PAMP comprises: a 5' arm region comprising a terminal triphosphate; a poly uracil core comprising at least 8 contiguous uracil residues; and a 3' arm region comprising at least 8 nucleic acid residues, wherein the 5' most nucleic acid residue of the 3' arm region is not a uracil and wherein the 3' arm region is at least 30% uracil residues.
- the agent is a small molecule agent that induces RIG-I signaling.
- the small molecule agent is or comprises a benzothiazol-derivative molecule, such as a small molecule agent comprises the chemical formula N-(6- benzamido-l,3-benzothiazol-2-yl)naphthalene-2-carboxamide.
- the method comprises administering to the subject therapeutically effective amounts of the nucleic acid molecule comprising a pathogen-associated molecular pattern (PAMP) and the small molecule agent in combination or coordination.
- PAMP pathogen-associated molecular pattern
- the method further comprises administering the subject a nucleoside reverse transcriptase inhibitor (NRTI).
- NRTI nucleoside reverse transcriptase inhibitor
- the NRTI is selected from Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Tenofovir, Tenofovir alafenamide (TAF), Clevudine, Besivo, Zadaxin, Remdesivir, and the like.
- the NRTI can be administered in combination or coordination with the one or more agents that induce(s) interferon regulatory factor 3 (IRF3) activation in infected cells of the subject.
- IRF3 interferon regulatory factor 3
- the disclosure provides a composition for treating a hepatitis B virus (HBV) infection in a subject comprising: a RIG-I agonist, a vehicle for intracellular delivery, and a pharmaceutically acceptable carrier.
- HBV hepatitis B virus
- the RIG-I agonist is or comprises a nucleic acid molecule comprising a pathogen-associated molecular pattern (PAMP), wherein the PAMP comprises: a 5' arm region comprising a terminal triphosphate; a poly uracil core comprising at least 8 contiguous uracil residues; and a 3' arm region comprising at least 8 nucleic acid residues, wherein the 5' most nucleic acid residue of the 3' arm region is not a uracil and wherein the 3' arm region is at least 30% uracil residues.
- the RIG-I agonist is or comprises is a small molecule agent.
- the small molecule agent is or comprises a benzothiazol-derivative molecule, such as a small molecule agent comprising the chemical formula N-(6- benzamido-l,3-benzothiazol-2-yl)naphthalene-2-carboxamide.
- the composition comprises a combination of the nucleic acid molecule comprising a pathogen-associated molecular pattern (PAMP) and the small molecule agent (e.g., benzothiazol-derivative molecule, e.g., comprising the chemical formula N-(6-benzamido- l,3-benzothiazol-2-yl)naphthalene-2-carboxamide).
- PAMP pathogen-associated molecular pattern
- the composition further comprises a nucleoside reverse transcriptase inhibitor (NRTI).
- NRTI nucleoside reverse transcriptase inhibitor
- the NRTI is selected from Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Tenofovir, Tenofovir alafenamide (TAF), Clevudine, Besivo, Zadaxin, Remdesivir, and the like.
- the vehicle is a liposome, nanocapsule, nanoparticle, exosome, microparticle, microsphere, lipid particle, vesicle, and the like, configured for the introduction of the RIG-I agonist into target host cells infected with HBV.
- the disclosure provides a method of treating a subject with a hepatitis B virus (HBV) infection, comprising administering to the subject a therapeutically effective amount of the compositions disclosed herein.
- HBV hepatitis B virus
- FIGURES 1A-1D illustrate that the F7 small molecule and poly-U/UC PAMP differentially induce innate immune genes.
- F7 and poly-U/UC induce IRF3 activation and innate immune gene expression.
- Sendai virus, F7, X-RNA and poly-U/UC PAMP were administered to HepG2-hNTCP and dHepaRG, as indicated for 24 and 48 hours.
- the cell lysates were resolved by SDS-PAGE and then subjected to immunoblotting.
- the levels of protein expression by the p-IRF3 (S386 phosphorylation active form of IRF3), IRF3 (total IRF3), and IFIT1 relative to the expression level of tubulin were determined using respective antibodies.
- ID Gene expression analysis. HepG2-hNTCP cells were administered with SenV, F7, X-RNA and poly-U/UC-RNA as described above for 24 and 72 hours, then total cellular RNA was purified from harvested cells.
- the levels of expression of innate immune genes IFIT1, CXCL10, IFITM1, RSAD2, RIG-I, MDA5, SAMHD1, APOBEC3A, APOBEC3G, IFN-a, IFN-b, and IFN-/.3 were measured by qRT-PCR and normalized to the level of GAPDH expression. Each are shown as the mean fold induction over that achieved with 2.5 % DMSO treatment from three independent experiments.
- FIGURES 2A-2E illustrate the therapeutic suppression of cccDNA formation.
- the scheme illustrates the schedule with HBV inoculum (1000 Geq/cell) and administration of Cyclosporin A (CsA), F7, X-RNA and poly-U/UC PAMP. 2.5% DMSO was added to the medium at 1 day post infection (Dpi).
- cccDNA and PF-RC DNA were harvested from HepG2-hNTCP cells using Flirt extraction method and analyzed by Southern blot analysis using an HBV-specific DNA probe.
- IC90, and IC50 values were calculated based on the decline of the cccDNA relative to DMSO treated controls. IC90, and IC50 values are the average of three experiments ⁇ one standard deviation. Cytotoxicity was determined by measuring cellular ATP content as a measure of cell viability using the CellTiter-GloTM reagent. CC50 values shown are the average of three experiments ⁇ one standard deviation. Positions of mass markers are indicated on each Southern blot.
- FIGURES 3A-3F illustrate that F7 and poly-U/UC PAMP suppress de novo HBV cccDNA synthesis.
- FIGURE 4A-4D illustrate subcellular compartment analysis of antiviral activity.
- HepG2-hNTCP cultures were inoculated with HBV at moi 1000 Geq/cell for 24 hr. On treatment day 0 the cultures received F7 (10 mM) or poly-U/UC PAMP (100 ng/ml). Cells were harvested for production of Hirt extracts at each time point shown through three days. Parallel cultures were harvested for Western blot analysis to monitor Lamin B1 and Calnexin as markers of whole cell lysate and cytosol respectively.
- (4B) and (4D) DNA was analyzed by Southern blot using HBV-specific DNA probe. Viral protein- free DNAs (protein-free Relaxed Circular DNA [PF-RC DNA] and cccDNA) are indicated. The positions of mass markers are indicated. Lower panels show Western blot of Lamin B1 and Calnexin abundance.
- FIGURE 5A-5F illustrate that F7 and poly-U/UC PAMP treatment directs HBV cccDNA decay.
- 5 A HBV infection and treatment schedule. On day 0 HepG2-hNTCP cells were infected with HBV at moi of 1000 Geq/cell, incubated for 24 hr, and media was replaced. On day three the cells were harvested or treated with DMSO, ETV (500 nM), F7 (10 pM), poly-U/UC (lOOng/ml), or with ETC combination with F7 or poly-U/UC PAMP. Cells were harvested at the indicated points over a 20-day time course. (5B), (5C) DNA was isolated by Hirt extract and subjected to Southern blot analysis using an HBV- specific DNA probe.
- Percentage values below each lane indicate the relative amount of cccDNA compared to day three control prior to each treatment. The positions of mass markers are indicated.
- (5D) cccDNA levels were measured by RT-qPCR. Relative cccDNA values to mitochondrial DNA (MT-C03) are shown. Statistical significance was determined using Student's t test. Data are presented as mean ⁇ standard deviation (SD), * P ⁇ 0.01, **P ⁇ 0.005, *** P ⁇ 0.001 and ns non-significant.
- E Half-life of cccDNA from RT-qPCR analyses was estimated from the simultaneous fitting of three replicates under each treatment strategy.
- C(t) is the % values of cccDNA at time 't' post-treatment
- C(0) is the % values of cccDNA at the start of the treatment.
- FIGURES 6A-6D illustrate that F7 and poly-U/UC PAMP specifically signal IRF3 activation through RIG-I to suppress HBV cccDNA.
- 6A F7 was administered for 24 hours to HepG2-hNTCP-NT (expressing non-targeting guide RNA), RKO (RIG-I knockout expressing RIG-I-targeting guide RNA), and MKO (MDA5-knock out expressing MDA5 -targeting guide RNA).
- Cells were harvested and analyzed by immunoblot.
- the levels of protein expression by p-IRF3 (S386 phosphorylated, active IRF3), IRF3 (total IRF), IFIT1, RIG-I, and MDA5 relative to the expression level of tubulin were determined using respective antibodies.
- (6B) HepG2-hNTCP-NT, RKO, and MKO cells were treated with lOOng/ml of X-RNA or lOOng/ml or 200ng/ml of poly- U/UC PAMP for 24 hr.
- Cells were harvested and analyzed by immunoblot as in (6A).
- (6C and 6D) Cells were infected with HBV at moi of 1000 Geq/cell. After 24 hour cultures were treated with DMSO (-; negative control), CsA (treatment control), (6C) 10 mM) or F7 or (6D) X RNA or poly-U/UC PAMP.
- Hirt extracts prepared and subjected to Southern blot analysis using as HBV-DNA probe. The positions of mass markers are indicated. Values beneath each lane show percent cccDNA remaining compared to -control treatment.
- FIGURES 7A-7C illustrate suppression of cccDNA in primary human hepatocytes.
- 7 A PHH were cultured alone or were treated with 100 ng/ml X-RNA (X100), or 50 ng/ml (P50), 100 ng/ml (P100) or 200 ng/ml (P200) poly-U/UC PAMP or were infected with SenV (control) and harvested 24 and 72 hours later.
- the cell lysates were analyzed by immunoblot for p-IRF3 (S386 phosphorylated, active IRF3), IRF3 (total IRF3), IFIT1, and Actin (control) using respective antibodies.
- (7B) PHH cultures were cultured alone or were treated with 100 ng/ml X-RNA (XI 00), or 100 ng/ml (PI 00) or 200 ng/ml (P200) poly-U/UC PAMP or were infected with SenV (control) and harvested 24 and 72 later. Cells were harvested, RNA extracted and analyzed by RT-qPCR to measure the expression levels of the indicated innate immune genes normalized to the level of GAPDH expression. Values are shown on the heat map as mean fold induction over nontreated cells from three independent experiments.
- (7C) PHH cultures were inoculated with HBV at moi of 200 Geq/cell.
- CsA treatment control; 10 mM
- XI 00 100 ng/ml X-RNA
- PI 00 100 ng/ml
- P200 poly-U/UC PAMP
- CsA treatment control; 10 mM
- XI 00 100 ng/ml X-RNA
- PI 00 100 ng/ml
- P200 200 ng/ml
- Viral protein-free DNAs protein-free Relaxed Circular DNA [PF-RC DNA] and cccDNA
- Values under each lane show the percent remaining cccDNA compared to nontreated -control. The positions of mass markers are shown at left.
- FIGURES 8A-8L are a series of graphs illustrating that F7 and poly-U/UC induce differential innate immune genes expression.
- HepG2-hNTCP cells were infected with SenV (positive control) or treated with F7 (5 or 10 uM as indicated), X-RNA (100 ng/ml; X-100 and 200 ng/ml; X-200) or poly-U/UC PAMP 100 ng/ml or 200ng/ml as indicated for 24 (black columns) and 72 hours (gray columns). Cells were harvested at each time point.
- Total cellular RNA was purified and subjected to RT-qPCR analysis to measure the expression level of a panel of innate immune genes including IFIT1, CXCL10, IFITM1, RSAD2, RIG-I, MDA5, SAMHD1, APOBEC3A, APOBEC3G, IFN-a, IFN-b, and IFN- l3.
- FIGURES 9A-9E illustrate kinetics of HBV replication in parallel cultures of cells during treatment with F7 or poly-U/UC PAMP.
- 9 A HepG2-hNTCP cells were infected with HBV at a moi of 1000 Geq/cell. After 24 hours the cells were treated with F7 (10 mM) (upper), or 100 ng/ml X RNA or lOOng/ml poly-U/UC PAMP (lower). Cells were harvested at each time point, Hirt supernatants prepared and subjected to Southern blot analysis.
- HBV pgRNA was analyzed by RT-qPCR. Values from 20 Dpi of HBV only' was set to 100% for RT-PCR analysis.
- HBV intracellular capsid-associated DNA from cells treated with 10 uM F7 (upper) or lOOng/ml XRNA or poly-U/UC PAMP (lower) was analyzed by Southern blot.
- 9D Secreted HBsAg from HBV-infected cells treated with F7 (upper) or poly-U/UC (lower) was detected by ELISA.
- FIGURES 10A-10E graphically illustrate CC50 analysis of F7 and poly-U/UC PAMP treatment.
- HepG2-NTCP Cells (10A and IOC), dHepaRG (10B and 10D), and PHH (10E) were treated with increasing doses of F7 or poly-U/UC PAMP for 72 hours.
- Cell viability was determined concurrently by measuring ATP content, with values normalized to mock-treated cells.
- FIGURE 11 illustrates the half-life of cccDNA.
- HepG2-NTCP cells were infected with HBV at an moi 1000 Geq/cell/ At 3 dpi the cultures were left nontreated or were treated with ETV (500nM) through the full 50 day time course by replacing the media each day with fresh media alone or containing ETV. Cells were harvested at the indicated time points, DNA was isolated by Flirt extraction and analyzed by Southern blot using a HBV-specific probe. Percentage values below each lane indicate the relative amount of cccDNA present compared to day 3 levels.
- FIGURE 12 illustrates immunoblot analysis of HepG2-hNTCP cells transduced with CRISPR/Cas9 guide RNA constructs to target RIG-I (RKO) or MDA5 (MKO) or nontargeting guide RNA (NT) control.
- RKO target RIG-I
- MDA5 MDA5
- NT nontargeting guide RNA
- HBV covalently-closed-circular DNA (cccDNA) is central to viral persistence such that its elimination is considered the cornerstone for HBV cure.
- PRRs pathogen recognition receptors
- IRF3 interferon regulatory factor 3
- F7 a small molecule compound
- PAMP pathogen-associated-molecular-pattem
- the disclosure provides a method for suppressing hepatitis B virus (HBV) covalently-closed-circular DNA (cccDNA) levels in an infected cell.
- the method comprises contacting the infected cell with an agent that induces interferon regulatory factor 3 (IRF3) activation in the infected cell.
- IRF3 interferon regulatory factor 3
- hepatitis B virus DNA is released from the viral nucleocapsid in the nucleus of the infected cell.
- This viral DNA is released from the viral capsid as relaxed circular DNA (RC DNA).
- the RC DNA is converted to covalently closed circular DNA (cccDNA) and serves as the main template for the synthesis of all HBV RNA transcripts including pregenomic (pg) RNA, pre-S, S, and X viral RNAs.
- cccDNA can be replicated within the cell through the intracellular amplification pathway.
- the cccDNA can be relatively long-lived and can be the basis for long-term, chronic infections, even after treatments.
- the term “suppressing cccDNA” comprises inhibiting formation of new cccDNA in the infected cell.
- the term “suppressing cccDNA” can also encompass reducing the stability of existing cccDNA in the infected cell prior to the contacting step. The reduction in stability can lead to a decreased half-life of the cccDNA. The reduced stability can be observed by a reduction in levels of cccDNA within the infected cell. In some embodiments, the reduction of levels of cccDNA is relative to an infected cell (e.g., of the same lineage or tissue type) that is also infected with HBV.
- the reduction can be any detectable reduction, such as about 5% reduction, about 10% reduction, about 15% reduction, about 20% reduction, about 25% reduction, about 30% reduction, about 35% reduction, about 40% reduction, about 45% reduction, about 50% reduction, about 55% reduction, about 60% reduction, about 65% reduction, about 70% reduction, about 75% reduction, about 80% reduction, about 85% reduction, about 90% reduction, about 95% reduction, about 97% reduction, about 99% reduction, and total eradication of cccDNA levels in the infected cell.
- the cell can be any cell that is infected with HBV.
- the infected cell is a hepatocyte.
- a key component of the innate immune response against viral infections is the activation of interferon regulatory factor 3 (IRF3).
- IRF3 induces the expression of antiviral genes and also induces IFN.
- the antiviral genes can suppress virus replication in the infected cell while IFN directs the suppression of virus replication both in the infected cell and neighboring bystander cells through the expression of hundreds of interferon stimulated genes (ISGs) that have antiviral and immune-modulatory activities.
- ISGs interferon stimulated genes
- programed death of virus -infected cells can serve to prevent virus spread.
- the combination of IRF3 actions impart a synergistic program of virus control for many viruses.
- the present disclosure is based in part on a demonstration that this pathway can be leveraged against HBC, which typically avoids inducing such IRF3 actions.
- the agent that induces IRF3 activation indirectly by inducing a retinoic acid-inducible gene I (RIG I) like receptor (RLR) signaling pathway.
- RLRs are cytoplasmic RNA helicases that function as PRRs for the recognition of RNA virus infection.
- the RLRs include RIG-I (retinoic acid-inducible gene I), MDA5 (melanoma differentiation-associated gene 5), and LGP2 (laboratory of genetics and physiology 2). Whereas RIG-I and MDA5 encode tandem amino-terminal caspase activation and recruitment domains (CARDs), LGP2 lacks CARDs and is thought to play a regulatory role in signaling initiated by RIG-I or MDA5.
- RIG-I signals through the adaptor protein mitochondrial antiviral signaling (MAVS, also known as IPS-l/VISA/Cardif). Downstream signaling by the RLRs induces the activation of latent transcription factors, including interferon regulatory factor (IRF)-3 and NF-KB, leading to the production of type-I interferons (IFN) from the infected cell.
- IRF interferon regulatory factor
- IFN type-I interferons
- RLR activation can be established by an increase in IRF-3 phosphorylation.
- the RLR signaling pathway comprises RIG I, melanoma differentiation associated gene 5 (MDA5), laboratory of genetics and physiology 2 (LGP2), and/or mitochondrial antiviral signaling (MAVS) protein.
- the agent inducing RIG-I signaling is or comprises a nucleic acid molecule comprising a pathogen-associated molecular pattern (PAMP).
- PAMPs and PAMP-containing nucleic acid molecules encompassed by the present disclosure are disclosed in U.S. Pub. Nos. 2015/0017207 and 2018/0104325, which address PAMP induction of innate immune response signaling and are incorporated herein by reference in their entireties. Elements and exemplary embodiments of the PAMP containing nucleic acid encompassed by the disclosure are addressed here.
- nucleic acid refers to a polymer of monomer units or "residues".
- the monomer subunits, or residues, of the nucleic acids each contain a nitrogenous base (i.e., nucleobase) a five-carbon sugar, and a phosphate group.
- the identity of each residue is typically indicated herein with reference to the identity of the nucleobase (or nitrogenous base) structure of each residue.
- Canonical nucleobases include adenine (A), guanine (G), thymine (T), uracil (U) (in RNA instead of thymine (T) residues) and cytosine (C).
- nucleic acids of the present disclosure can include any modified nucleobase, nucleobase analogs, and/or non- canonical nucleobase, as are well-known in the art.
- Modifications to the nucleic acid monomers, or residues encompass any chemical change in the structure of the nucleic acid monomer, or residue, that results in a noncanonical subunit structure. Such chemical changes can result from, for example, epigenetic modifications (such as to genomic DNA or RNA), or damage resulting from radiation, chemical, or other means.
- noncanonical subunits which can result from a modification, include uracil (for DNA), 5-methylcytosine, 5-hydroxymethylcytosine, 5- formethylcytosine, 5-carboxycytosine b-glucosyl-5-hydroxy-methylcytosine, 8- oxoguanine, 2-amino-adenosine, 2-amino-deoxyadenosine, 2-thiothymidine, pyrrolo- pyrimidine, 2-thiocytidine, or an abasic lesion.
- An abasic lesion is a location along the deoxyribose backbone but lacking a base.
- Known analogs of natural nucleotides hybridize to nucleic acids in a manner similar to naturally occurring nucleotides, such as peptide nucleic acids (PNAs) and phosphorothioate DNA.
- PNAs peptide nucleic acids
- the five-carbon sugar to which the nucleobases are attached can vary depending on the type of nucleic acid.
- the sugar is deoxyribose in DNA and is ribose in RNA.
- the nucleic acid residues can also be referred with respect to the nucleoside structure, such as adenosine, guanosine, 5-methyluridine, uridine, and cytidine.
- alternative nomenclature for the nucleoside also includes indicating a "ribo" or deoxyrobo" prefix before the nucleobase to infer the type of five- carbon sugar.
- ribocytosine as occasionally used herein is equivalent to a cytidine residue because it indicates the presence of a ribose sugar in the RNA molecule at that residue.
- the nucleic acid polymer can be or comprise a deoxyribonucleotide (DNA) polymer, a ribonucleotide (RNA) polymer, including mRNA.
- the nucleic acids can also be or comprise a PNA polymer, or a combination of any of the polymer types described herein (e.g., contain residues with different sugars).
- the PAMP-containing nucleic acid is synthetic.
- synthetic refers to non-natural character of the nucleic acid.
- nucleic acids can be synthesized de novo using standard synthesis techniques.
- the nucleic acid PAMPs can be generated or derived from naturally occurring pathogen sequences using recombinant technologies, which are well-known in the art.
- sequence of the synthetic nucleic acid PAMP construct is not naturally occurring.
- the PAMP-containing nucleic acid is an RNA construct.
- the PAMP-containing nucleic acid is derived from, or reflects the sequence of, the HCV poly-U/UC region and, in this context, may be generally referred to as the poly-U/UC PAMP RNA construct.
- the poly-U/UC PAMP RNA construct is synthetic.
- the PAMP-containing nucleic acid of this disclosure generally comprises (a) a 5'-arm region comprising a terminal triphosphate ("ppp" or "3 x p"); (b) a poly-uracil core (also referred to as a "poly-U core”); and (c) a 3'-arm region.
- the three regions (a, b, and c) are covalently linked in a single nucleic acid polymer macromolecule.
- the covalent linkage can be direct (without interspersed linker sequence(s)) or indirect (with interspersed linker(s) and/or sequences(s)).
- the 5'-arm region is covalently linked to the 5'-end of the poly-U core.
- the 3'-arm region is covalently linked to the 3'-arm region of the poly-U core.
- the polymer can be single or double stranded or can appear with a combination of single and double stranded portions.
- the poly-U core comprises at least 8 contiguous uracil residues. In further embodiments, the comprises between 8 and 60 contiguous uracil residues, such as 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
- the poly-U core comprises more than 8 contiguous uracil residues. In one embodiment, the poly-U core comprises 12 or more contiguous uracil residues. In some embodiments, the poly-U core consists of a plurality of contiguous uracil residues, such as 8, 9, 10, 11,
- the 3'-arm region comprises a 5'-most nucleic acid residue that is not a uracil residue.
- the 5'-most nucleic acid residue of the 3'-arm region can be an adenine, guanine, or cytosine residue, or any non-canonical residue.
- the 5'-most nucleic acid residue of the 3'-arm region is a cytosine residue, a guanine residue, or an adenine residue.
- the nucleotide composition of the 3 '-arm region is at least about 40% uracil residues. In some embodiments, the 3'-arm region is at least about 45%, is at least about 50%, is at least about 60%, is at least about 70%, is at least about 80%, is at least about 90%, or is at least about 95 uracil residues. In one embodiment, the 3'-arm region comprises a plurality of short stretches (for example, between about 2 and about 15 nucleotides in length) of contiguous uracil residues with one or more cytosine residues interspersed therebetween.
- the 3'-arm region comprises a plurality of short stretches (for example, between about 2 and about 15 nucleotides in length) of contiguous uracil residues with one or more guanine residues interspersed therebetween. In one embodiment, the 3 '-arm region comprises a plurality of short stretches (for example, between about 2 and about 15 nucleotides in length) of contiguous uracil residues with one or more adenine residues interspersed therebetween. In one embodiment, the 3'-arm region comprises a stretch of consecutive uracil residues that does not exceed the length of the poly-U core of the synthetic PAMP-containing nucleic acid molecule.
- the 3 '-arm region does not comprise a stretch of consecutive uracil residues that equals and/or exceeds the length of the poly-U core of the synthetic PAMP-containing nucleic acid molecule. In some embodiments, the 3'-arm region comprises at least 7 consecutive uracil residues, such as 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29, contiguous uracil residues.
- the 5'-arm region consists of a terminal tri-phosphate (ppp) moiety.
- the triphosphate is at the 5 '-terminus of the synthetic PAMP- containing nucleic acid molecule and can be represented as "5'-ppp".
- the terminal triphosphate is linked directly to the 5'-end of the poly-U core sequence.
- the 5'-arm region comprises the 5'-end terminal triphosphate and one or more additional nucleic acid residues, the sequence of which terminates with a 3'-end.
- the one or more additional nucleic acid residues in the 5'-arm region of this embodiment are disposed between the terminal triphosphate and the 5 '-most uracil residue of the poly-U core.
- the one or more additional nucleic acid residues in the 5 '-arm region can be any number of nucleic acid residues and can present any sequence without limitation.
- the sequence of the one or more additional nucleic acid residues in the 5'-arm region does not affect the functionality of the PAMP-containing nucleic acid molecule. For instance, as described in U.S. Pub. Nos.
- the addition of a poly-U core region to a non-stimulatory nucleic acid that contains a 5'-triphosphate confers stimulatory properties for innate immune system signaling.
- the sequence of the one or more additional nucleic acid residues in the 5 '-arm region does not consist of the entire 5 '-end portion of a naturally occurring HCV genome sequence that naturally occurs "upstream" or 5' to the poly-U core of the poly-U/UC region for that HCV strain.
- the entire synthetic PAMP-containing nucleic acid molecule is not a naturally occurring HCV genome, complete with the 5' triphosphate, the entire coding region, and the untranslated 3' poly-U/UC region.
- the 5'-arm region, the one or more nucleic acid residues of the 5'-arm region, and the poly-uracil core do not naturally occur together in an HCV genome.
- the one or more nucleic acid residues of the 5'-arm region can comprise or consist of a subfragment of the entire naturally occurring sequence that exists between the 5 '-arm region and the poly -uracil core.
- the one or more nucleic acid residues of the 5 '-arm region can comprise sequence in addition to a portion or the entire naturally occurring HCV genome sequence that exists between the 5'-end and the poly -uracil core.
- the nucleic acid molecule comprises a sequence of at least 16 nucleotides. In some embodiments, the nucleic acid molecule comprises a sequence of at least about 16 nucleotides to about 1000 nucleotides, such as between about 20 and about 1000 nucleotides, between about 30 and about 1000 nucleotides, between about 40 and about 1000 nucleotides, between about 50 and about 1000 nucleotides, between about 60 and about 1000 nucleotides, between about 70 and about 1000 nucleotides, between about 80 and about 1000 nucleotides, between about 90 and about 1000 nucleotides, between about 100 and about 1000 nucleotides, between about 150 and about 1000 nucleotides, between about 200 and about 1000 nucleotides, between about 250 and about 1000 nucleotides, between about 300 and about 1000 nucleotides, between about 350 and about 1000 nucleotides, between about 400 and about 1000 nucleotides, between about 450 and about 1000 nucleotides
- the nucleic acid contains between about 20 and about 100 nucleotides, between about 30 and about 100 nucleotides, between about 40 and about 100 nucleotides, between about 50 and about 100 nucleotides, between about 60 and about 100 nucleotides, between about 70 and about 100 nucleotides, as between about 80 and about 100 nucleotides, and between about 90 and about 100 nucleotides, and any number or range therein.
- the nucleic acid comprises between about 16 and 60 nucleotides, such as between about 16 and about 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, and 60 nucleotides.
- the nucleic acid has up to about 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, and 60 nucleotides and the 3'- arm comprises a plurality of short stretches between 2 and 15 contiguous uracil residues with one or more cytosine or guanine residues interspersed between the plurality of short stretches.
- the nucleic acid molecule has up to 53 nucleotides and the 3'-arm region is at least 60% uracil residues
- Non-limiting examples of nucleic acid sequences of PAMPs encompassed by the disclosed PAMP-containing nucleic acids containing are disclosed in U.S. Pub. Nos. 2015/0017207 and 2018/0104325 and Saito, T., et al. (2008). Innate immunity induced by composition-dependent RIG-I recognition of hepatitis C virus RNA. Nature 454, 523-527; and Schnell, G., et al. (2012). Uridine composition of the poly-U/UC tract of HCV RNA defines non-self recognition by RIG-I.
- PLoS pathogens 8, el002839 (each of which is incorporated herein by reference) and are set forth herein as SEQ ID NOS:34-123.
- the PAMP-containing nucleic acids contains poly-U core region and/or 3'-arm sequences independently selected from any of the poly-U core region and/or 3'-arm regions in any of the disclosed sequences of SEQ ID NOS:34-123. These exemplary, non-limiting sequences are also provided below in TABLE 1.
- the disclosed PAMP-containing nucleic acids can comprise any of the sequences listed therein. It will be understood that such exemplary PAMP containing nucleic acids would comply with the general structural parameters of the PAMP containing molecules, as described herein, including having a terminal tri-phosphate (ppp) moiety.
- the PAMP- containing molecule comprises the sequence: GGCCAUCCUGUUUUUUUCCCUUUUUUUUUUCUCCUUUUUUUUCCUCUUU UUUUCCUUUUCUUUCCUUU (SEQ ID NO: 124).
- the PAMP- containing nucleic acid comprises the sequence:
- nucleic acids with HCV-derived RNA PAMPs having poly-uracil core sequences can trigger retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) signaling.
- the PAMP-containing nucleic acid molecule is capable of inducing retinoic acid-inducible gene I (RIG-I)-bke receptor (RLR) activation.
- the RLR is RIG-I.
- RLR activation can be established by an increase in IFN-b or ISG54 expression.
- RLR activation can be established by an increase in IRF-3 phosphorylation.
- the PAMP-containing nucleic acid molecule is contacted to the cell at a concentration of about 80ng/mL or greater to result in induction of RLR activation. Accordingly, in some embodiments, the method comprises contacting the cell with the PAMP-containing nucleic acid molecule agent at a concentration of least about 80ng/mL to about 500ng/mL, such as between lOOng/mL and 250ng/mL.
- the method comprises contacting the cell with the PAMP-containing nucleic acid molecule at a concentration of least about 80ng/mL, about 90ng/mL, about lOOng/mL, about llOng/mL, about 120ng/mL, about 130ng/mL, about 140ng/mL, about
- the agent is or comprises a small molecule agent.
- small molecule agents that induce the RLR and/or IRF3 signaling pathways.
- Exemplary small molecule agonists that induce the RLR signaling pathway and/or IRF3 signaling pathway encompassed by the present disclosure are described in, e.g., Bedard, K.M., et al. (2012). Isoflavone agonists of IRF-3 dependent signaling have antiviral activity against RNA viruses. Journal of virology 86, 7334-7344; Pattabhi, S., et al. (2016). Targeting Innate Immunity for Antiviral Therapy through Small Molecule Agonists of the RLR Pathway.
- the small molecule agent is or comprises a benzothiazol-derivative molecule.
- Exemplary molecules are disclosed US 9884876.
- the small molecule agent has the chemical formula N-(6- benzamido-l,3-benzothiazol-2-yl)naphthalene-2-carboxamide. This small molecule is referred to herein as "F7", and has the structure:
- the method comprises contacting the infected cell with two or more agents that induce IRF3 activation in the infected cell.
- the two or more agents e.g., a first agent, a second agent, a third agent, etc.
- the two or more agents can be contacted to the cell together, such as when formulated in a single admixture, or in separate administrations coordinated such that the effects of each agent is exhibited in the cell in overlapping time-frames.
- the two or more agents can comprise, for example, a PAMP containing nucleic acid and a small molecule agent.
- Each of the PAMP containing nucleic acid and the small molecule agent can encompass the features and embodiments of each agent as described above in more detail.
- the two or more agents comprise a nucleic acid comprising a pathogen-associated molecular pattern (PAMP), wherein the PAMP comprises: a 5' arm region comprising a terminal triphosphate; a poly uracil core comprising at least 8 contiguous uracil residues; and a 3' arm region comprising at least 8 nucleic acid residues, wherein the 5' most nucleic acid residue of the 3' arm region is not a uracil and wherein the 3' arm region is at least 30% uracil residues.
- PAMP pathogen-associated molecular pattern
- the small molecule agent in this illustrative embodiment is or comprises a benzothiazol-derivative molecule, such as a small molecule comprising the chemical formula N-(6-benzamido- 1 ,3-benzothiazol-2-yl)naphthalene-2-carboxamide.
- the method further comprises contacting the cell with a reverse transcriptase inhibitor in addition to the at least one agent that induces IRF3 activation in the infected cell, as described above.
- exemplary reverse transcriptase inhibitors can include nucleotide or nucleoside reverse transcriptase inhibitors (NTRIs), which are analogs of naturally occurring nucleotides or nucleosides that are needed to synthesize viral DNA.
- NTRIs nucleotide or nucleoside reverse transcriptase inhibitors
- the NTRIs compete with the natural deoxynucleotides for incorporation into the growing viral DNA.
- due to structural differences e.g., a lack of a 3' hydroxyl group
- the chain extension is prevented because the next incoming nucleotide cannot form a phosphodiester bond needed to extend the chain.
- NTRIs encompassed by the disclosure include Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Tenofovir, Tenofovir alafenamide (TAF), Clevudine, Besivo, Zadaxin, Remdesivir, and the like. Persons of ordinary skill in the art can select other appropriate reverse transcriptase inhibitors for performance of the disclosed methods.
- the method comprises contacting the cell with two or more of the following:
- a nucleic acid molecule comprising a pathogen-associated molecular pattern (PAMP), wherein the PAMP comprises: a 5' arm region comprising a terminal triphosphate; a poly uracil core comprising at least 8 contiguous uracil residues; and a 3' arm region comprising at least 8 nucleic acid residues, wherein the 5' most nucleic acid residue of the 3' arm region is not a uracil and wherein the 3' arm region is at least 30% uracil residues, as described in more detail above;
- PAMP pathogen-associated molecular pattern
- a small molecule agent such as a benzothiazol-derivative molecule, such as N-(6-benzamido-l,3-benzothiazol-2-yl)naphthalene-2-carboxamide;
- an NRTI such as selected from Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Tenofovir, Tenofovir alafenamide (TAF), Clevudine, Besivo, Zadaxin, Remdesivir, and the like.
- the method comprises contacting the infected cell with a nucleic acid molecule comprising a pathogen-associated molecular pattern (PAMP), as described above, and an NRTI, such as selected from Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Tenofovir, Tenofovir alafenamide (TAF), Clevudine, Besivo, Zadaxin, Remdesivir, and the like.
- PAMP pathogen-associated molecular pattern
- NRTI such as selected from Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Tenofovir, Tenofovir alafenamide (TAF), Clevudine, Besivo, Zadaxin, Remdesivir, and the like.
- the plurality of agents can be formulated in a combination or admixture, or can be contacted separately but in a coordinated fashion such that each
- the method described above can be an in vitro method, applied to infected cell maintained in culture.
- the method can include screening potential anti-viral agents for additional contribution to suppressing cccDNA.
- the method can be an in vivo method performed with a subject with an HBC infection, or suspected of having an HBV infection, or is at risk of having an HBV infection.
- the disclosure provides a method of treating or preventing a hepatitis B virus (HBV) infection in a subject in need thereof.
- the method comprises administering to the subject a therapeutically effective amount of composition that induces interferon regulatory factor 3 (IRF3) activation in infected cells of the subject.
- IRF3 interferon regulatory factor 3
- the term “treat” refers to medical management of a disease, disorder, or condition (e.g., HBV infection, as described above) of a subject (e.g., a human or non-human mammal, such as another primate, horse, dog, mouse, rat, guinea pig, rabbit, and the like). Treatment can encompass any indicia of success in the treatment or amelioration of a disease or condition (e.g., HBV infection).
- the term “" refers to preventing or suppressing the infection of colonization of a pathogen (e.g., hepatitis B virus).
- treating refers to a therapeutic use, such as addressing an infection that has already started.
- the term “treating” refers to curing the infection to a point where no active pathogens (e.g., hepatitis B virus) remain in the host.
- the term “treating” also encompasses slowing or inhibiting the spread of the infection within the body, such as slowing or inhibiting the replication rate of the pathogen (e.g., hepatitis B virus).
- the term also encompasses reducing the pathogenic burden in a cell (or host tissue or body). In some embodiments, this encompasses reducing the cccDNA levels in cells of the body.
- the term also encompasses accelerating the rate of clearance of the pathogen relative to the time period required by the host's endogenous immune response to clear the pathogen without administration of the disclosed agents.
- the treatment or amelioration of symptoms can be based on objective or subjective parameters, including the results of an examination by a physician.
- the term “treating” includes the administration of the agents or compositions disclosed in the present disclosure to alleviate, or to arrest or inhibit development of the symptoms or conditions associated with disease or condition (e.g., HBV infection).
- therapeutic effect refers to the amelioration, reduction, or elimination of the disease or condition, symptoms of the disease or condition, or side effects of the disease or condition in the subject.
- therapeuticically effective refers to an amount of the composition that results in a therapeutic effect and can be readily determined.
- the composition is or comprises a nucleic acid molecule comprising a pathogen-associated molecular pattern (PAMP).
- PAMP can comprise: a 5' arm region comprising a terminal triphosphate; a poly uracil core comprising at least 8 contiguous uracil residues; and a 3' arm region comprising at least 8 nucleic acid residues, wherein the 5' most nucleic acid residue of the 3' arm region is not a uracil and wherein the 3' arm region is at least 30% uracil residues. Additional embodiments and features of the PAMP and/or nucleic acid comprising the PAMP that are encompassed in this aspect are described above in more detail and are not repeated here.
- the composition is or comprises a small molecule agent that induces RIG-I signaling.
- the small molecule agent is or comprises a benzothiazol-derivative molecule, such as N-(6-benzami do-1, 3-benzothiazol- 2-yl)naphthalene-2-carboxamide. Additional embodiments and features of the small molecule agent that are encompassed in this aspect are described above in more detail and are not repeated here.
- the composition is formulated as an admixture of two or more therapeutic agents (e.g., comprising a first agent, a second agent, etc.).
- the method can comprise administering to the subject separate compositions (e.g., independently comprising a first agent, a second agent, etc.).
- the separate administrations can be simultaneous or coordinated such that the effects of the respective compositions are realized in overlapping time-frames in the subject.
- a representative example of a combination embodiment is a method comprising administering to the subject therapeutically effective amounts of a first agent and a second agent (in the same or different compositions), wherein: the first agent is or comprises a nucleic acid molecule comprising: a 5' arm region comprising a terminal triphosphate; a poly uracil core comprising at least 8 contiguous uracil residues; and a 3' arm region comprising at least 8 nucleic acid residues, wherein the 5' most nucleic acid residue of the 3' arm region is not a uracil and wherein the 3' arm region is at least 30% uracil residues; and the second agent is or comprises a benzothiazol-derivative molecule, such as a small molecule comprising the chemical formula N-(6-benzamido-l,3-benzothiazol-2- yl)naphthalene-2-carboxamide.
- the first agent is or comprises a nucleic acid molecule comprising: a 5
- the method can also include administering to the subject other anti -viral therapies, e.g., known therapies to treat HBV infection.
- the treatment method further comprises administering to the subject a therapeutically effective amount of a with a reverse transcriptase inhibitor in addition to the at least one agent that induces IRF3 activation in the infected cell, as described above.
- the method can further comprise administering a therapeutic amount of an NRTI, such as an NRTI selected from Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Tenofovir, Tenofovir alafenamide (TAF), Clevudine, Besivo, Zadaxin, Remdesivir, and the like.
- an NRTI such as an NRTI selected from Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Tenofovir, Tenofovir alafenamide (TAF), Clevudine, Besivo, Zadaxin, Remdesivir, and the like.
- the method comprises administering to the subject therapeutically effective amounts of a first agent and a second agent (in a single composition or in separate compositions), wherein the first agent is or comprises a nucleic acid molecule comprising: a 5' arm region comprising a terminal triphosphate; a poly uracil core comprising at least 8 contiguous uracil residues; and a 3' arm region comprising at least 8 nucleic acid residues, wherein the 5' most nucleic acid residue of the 3' arm region is not a uracil and wherein the 3' arm region is at least 30% uracil residues; and wherein the second agent is or comprises an NRTI, such as Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Tenofovir, Tenofovir alafenamide (TAF), Clevudine, Besivo, Zadaxin, Remdesivir, and the like.
- the first agent is or comprises a
- the composition or compositions are administered only once.
- the composition or compositions are administered multiple times according to a schedule established by a medical professional. Factors influencing the schedule include observed cccDNA levels, tolerance to the therapy, and the like.
- the disclosure provides therapeutic compositions formulated for treating hepatitis B virus (HBV).
- HBV hepatitis B virus
- This aspect also encompasses methods of administering the disclosed therapeutic compositions for treating and/or preventing HBV infection in a subject.
- the therapeutic composition of this aspect comprises a RIG-I agonist, a vehicle for intracellular delivery, and a pharmaceutically acceptable carrier.
- the RIG-I agonist is a nucleic acid molecule comprising a pathogen-associated molecular pattern (PAMP). Specific exemplary embodiments of the nucleic acid molecule and the PAMP are described in more detail above and are encompassed in this aspect.
- the RIG-I agonist is or comprises a benzothiazol-derivative molecule. Exemplary embodiments are described in more detail above and are encompassed in this aspect.
- the RIG-I agonist comprises the chemical formula N-(6- benzamido-l,3-benzothiazol-2-yl)naphthalene-2-carboxamide.
- the active agent or agents can be incorporated into a vehicle to facilitate intracellular delivery.
- a variety of therapeutic delivery vehicles or systems are known and can be applied to the therapeutic composition.
- Delivery vehicles or systems can include particle formulations, such as emulsions, microparticles, immune-stimulating complexes (ISCOMs), nanoparticles, which can be, for example, particles and/or matrices, microspheres, liposomes, nanocapsules, and the like, which are advantageous for the delivery of antigens.
- the formulation and use of such delivery vehicles can be carried out using known and conventional techniques.
- the disclosed PAMP- containing nucleic acid and any optional additional therapeutic agent are formulated into a liposomal delivery vehicle.
- Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap solution including dissolved solutes within and/or between the lipid bilayers. Exemplary applications of liposomal formulations are described in Yallapu, U., et al, Liposomal Formulations in Clinical Use: An Updated Review, Pharmaceutics 9(2): 12 (2017), incorporated herein by reference in its entirety.
- the compositions or agents are appropriately formulated for the desired therapeutic administration according to known methods.
- the compositions can be appropriately formulated for preferred routes of administration according to known methods.
- the pharmaceutical composition can be formulated for delivery by any route of systemic administration (e.g., intramuscular, intradermal, subcutaneous, subdermal, transdermal, intravenous, intraperitoneal, intracranial, intranasal, mucosal, anal, vaginal, oral, or buccal route, or they can be inhaled).
- Certain routes of administration are particularly appropriate for pharmaceutical compositions intended to induce, at least, elements of an innate immune response.
- transdermal administration, intramuscular, subcutaneous, and intravenous administrations are particularly appropriate.
- formulations suitable for introduction of the therapeutic compositions vary according to route of administration.
- routes of administration such as, for example, by intraarticular (in the joints), intravenous, intramuscular, intradermal, intraperitoneal, intranasal, and subcutaneous routes, include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
- the formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials.
- Solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
- Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, such preparations can contain a preservative to prevent the growth of microorganisms.
- the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Pat. No.
- carrier includes any and all solvents, dispersion media, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, mannitol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
- polyol e.g., glycerol, propylene glycol, mannitol, and liquid polyethylene glycol, and the like
- suitable mixtures thereof e.g., glycerol, propylene glycol, mannitol, and liquid polyethylene glycol, and the like
- vegetable oils e.g., glycerol, propylene glycol, mannitol, and liquid polyethylene glycol, and the like
- Proper fluidity can be
- microorganisms can be facilitated by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
- various antibacterial and antifungal agents for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
- isotonic agents for example, sugars or sodium chloride.
- Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
- phrases “pharmaceutically-acceptable” refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a subject (e.g., human).
- the words “comprise,” “comprising,” and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense, which is to indicate, in the sense of “including, but not limited to.” Words using the singular or plural number also include the plural and singular number, respectively. Additionally, the words “herein,” “above,” and “below,” and words of similar import, when used in this application, shall refer to this application as a whole and not to any particular portions of the application.
- the word “about” indicates a number within range of minor variation above or below the stated reference number. For example, in some embodiments, the term “about” refers to a number within a range of 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% above and/or below the indicated reference number.
- polypeptide or "protein” refers to a polymer in which the monomers are amino acid residues that are joined together through amide bonds. When the amino acids are alpha-amino acids, either the L-optical isomer or the D-optical isomer can be used, the L-isomers being preferred.
- polypeptide or protein as used herein encompasses any amino acid sequence and includes modified sequences such as glycoproteins. The term polypeptide is specifically intended to cover naturally occurring proteins, as well as those that are recombinantly or synthetically produced. Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions.
- This example describes the demonstration that induction of RIG-I signaling pathway destabilizes cccDNA and prevents formation of new cccDNA in hepatocytes, providing a strategy to eradicate the cccDNA and corresponding hepatitis B viral infection.
- Acute virus infection typically triggers intracellular innate immune activation leading to induction of intracellular antiviral defenses. This process serves to control viral replication and spread from the site of infection, and to modulate the adaptive immune response for systemic virus control. Innate immune activation occurs via host cell sensing of viral pathogen associated molecular patterns (PAMP) embedded in viral replication products, including viral nucleic acid. PAMPs are sensed by cellular patern recognition receptors (PRRs).
- PAMP viral pathogen associated molecular patterns
- PRRs that sense virus infection include Toll-like receptors (TLR), NOD-bke receptors (NLR), intracellular DNA sensors cGAS, STING, IFI16, DAI and others, as well as the RIG-I-like receptors (RLRs) including retinoic-acid inducible gene-I (RIG-I) and melanoma differentiation antigen 5 (MDA5).
- TLR Toll-like receptors
- NLR NOD-bke receptors
- RIG-I-like receptors RIG-I-like receptors
- RLRs retinoic-acid inducible gene-I
- MDA5 melanoma differentiation antigen 5
- Induction of TLR, RLR, or STING signaling drives the downstream activation of latent transcription factors including interferon regulatory factor (IRF)3 and NF-kB to promote the expression of antiviral effector genes and immune regulatory genes including chemokines, IFNs, and other immune regulatory cytokines.
- IRF interferon regulatory factor
- HCV PAMP hepatitis C virus
- the HCV PAMP is a 100 nt poly uridine/cytosine (poly-U/UC) motif with the HCV genome 3' nontranslated region.
- poly-U/UC PAMP specifically activates RIG-I to drive IRF3 activation and antiviral innate immunity that suppresses HCV infection in vitro and activates hepatic innate immunity in vivo.
- RIG-I activation was evaluated in the treatment of HBV infection in vitro.
- RIG-I signaling triggered by poly-U/UC PAMP RNA or small molecule activator of RIG-I directed robust IRF3 activation and RIG-I-dependent antiviral actions to suppress cccDNA levels.
- hNTCP human sodium/taurocholate cotransporting polypeptide
- dHepaRG differentiated HepaRG
- PHs primary human hepatocytes
- RIG-I and IRF3 agonists trigger innate immune activation in hepatocytes
- Small-molecule agonists of IRF3 were previously identified that confer innate immune activation leading to induction of IRF3 -target genes and antiviral action against a range of RNA viruses (Bedard, K.M., et al. (2012). Isoflavone agonists of IRF-3 dependent signaling have antiviral activity against RNA viruses. Journal of virology 86, 7334-7344; Pattabhi, S., et al. (2016). Targeting Innate Immunity for Antiviral Therapy through Small Molecule Agonists of the RLR Pathway. Journal of virology 90, 2372- 2387; Probst, P., et al. (2017).
- a small-molecule IRF3 agonist functions as an influenza vaccine adjuvant by modulating the antiviral immune response. Vaccine 35, 1964-1971).
- F7 (N-(6-benzamido-l,3-benzothiazol-2- yl)naphthalene-2-carboxamide), referred here as F7, was produced for analyses of anti- HBV activity (FIGURE 1A).
- F7 N-(6-benzamido-l,3-benzothiazol-2- yl)naphthalene-2-carboxamide
- F7 was produced for analyses of anti- HBV activity (FIGURE 1A).
- a -100 nt PAMP motif was identified within the HCV genome comprising 5'ppp and the poly-U/UC region of viral RNA that is specifically recognized by RIG-I and confers RIG-I signaling of IRF3 activation leading to antiviral gene expression (Saito, T., et al.
- Control cells were treated with DMSO or infected with Sendai virus (SenV; a potent activator of RIG-I-dependent signaling), or transfected with 200 ng/ml of X-RNA in liposome, a non-P AMP/non- signaling 5'ppp-containing 100 nt RNA motif from the HCV genome with similar mass to the poly-U/UC PAMP (Saito et al. (2008), supra). Similar to SenV control, both F7 and poly-U/UC PAMP but neither DMSO nor X RNA treatment specifically induced innate immune activation as marked by IRF3 translocation into the nucleus (FIGURE IB).
- mRNA expression was also assessed across a panel of innate immune response genes, including IFNs, ISGs, and direct IRF3-target genes, for response to F7 or poly-U/UC PAMP (FIGURE ID; FIGURES 8A-8L). While poly-U/UC PAMP treatment also induced type I and type III IFN and ISG expression, F7 treatment induced only IRF3- target gene expression. This difference is consistent with the signaling properties of each molecule and the nature of IFN expression, as IFN expression relies on activation of both IRF3 and NF-kB, whereas F7 specifically activates IRF3 but not NF-kB (Bedard et al. (2012), supra).
- the poly-U/UC PAMP triggers RIG-I signaling of both transcription factors to induce IRF3-target genes, IFNs and hence ISGs (Saito, T., et al. (2008), supra ; Schnell, G, et al. (2012), supra).
- type I IFN, SAMHD1, APOBEC3A, and APOBEC3G which were induced by poly-U/UC PAMP treatment, have demonstrated antiviral activity against HBV infection (Bonvin, M., et al. (2006). Interferon-inducible expression of APOBEC3 editing enzymes in human hepatocytes and inhibition of hepatitis B virus replication.
- IRF3 activation suppresses HBV cccDNA formation
- Cyclosporin A (CsA) treatment was employed as an HBV entry inhibitor antiviral control (Watashi, K., et al. (2014). Cyclosporin A and its analogs inhibit hepatitis B virus entry into cultured hepatocytes through targeting a membrane transporter, sodium taurocholate cotransporting polypeptide (NTCP).
- NTCP sodium taurocholate cotransporting polypeptide
- PF-RC DNA was first detected by 1 dpi.
- cccDNA synthesis occurred by 2 dpi in control- treated cells, and PF-RC and cccDNA both accumulated over the 20 dpi time course.
- the production of cccDNA was markedly suppressed in cells treated with F7 or poly-U/UC PAMP within 2 dpi.
- IRF3 agonists partition to the nucleus to suppress cccDNA synthesis
- the IRF3 activation restricts the stability of HBV cccDNA alone and in combination with ETV
- ETV is a nucleoside analog that prevents the viral reverse transcription and replication of new synthesized HBV DNAs, thereby preventing the replenishment of cccDNA by de novo formation.
- ETV was applied to HBV-infected cultures at a 100-fold IC50 (Langley, D.R., et al. (2007). Inhibition of Hepatitis B Virus Polymerase by Entecavir. Journal of virology 81, 3992-4001) thereby allowing for the measurement of cccDNA half-life under conditions in which levels are sustained only from the initial cccDNA pool. Cells were then harvested over a treatment time course, and DNA extracts were analyzed by Southern blot and qPCR assay.
- cccDNA levels modestly increased over the infection time course in non-treatment control cells.
- Cells from ETV -treated cultures stably maintained cccDNA levels over the time course at levels similar to 3 dpi cultures, demonstrating sustained and stable cccDNA of over 20 dpi in our in vitro culture system, well in line with the reported cccDNA half-life(ti/2) of greater than 40 days (FIGURE 11, (Huang, Q., et al. (2020). Rapid Turnover of HBV cccDNA Indicated by Monitoring Emergence and Reversion of Signature-Mutation in Treated Chronic Hepatitis B Patients. Hepatology; Ko, C., et al. (2016).
- combination treatment of F7 and poly-U/UC PAMP with ETV impart additive antiviral actions to suppress cccDNA ti/2 and persistence from weeks (Huang, Q., el al. (2020), supra, ⁇ Ko, C., el al. (2016), supra) to less than 7 days.
- HepG2-hNTCP cells expressing non-targeting guide RNA HepG2-hNTCP-NT
- guide RNA for knockout (KO) of RIG-I expression HepG2-hNT CP -RKO
- MDA5 HepG2-hNTCP-MKO
- HepG2-hNTCP- MKO cells serve as an RLR KO control to reveal the specificity of F7 and poly-U/UC PAMP for triggering RIG-I-dependent IRF3 activation (Saito et al. (2008), supra).
- each cell population was infected with HBV followed by a single treatment with F7 or poly-U/UC PAMP at 1 dpi. Cells were harvested at 3 dpi for Southern blot analysis of cccDNA levels. Parallel cultures of each cell population were treated with DMSO or single dose X-RNA (negative control) or with CsA as a treatment control.
- F7 treatment reduced cccDNA levels in HepG2-hNTCP-NT and HepG2-hNTCP-MKO cells but not in HepG2-hNTCP-RKO cells (FIGURE 6C).
- poly-U/UC PAMP suppression of cccDNA was dependent of RIG-I, as cccDNA was suppressed by poly-U/UC PAMP treatment in HepG2-hNTCP-NT and HepG2-hNTCP-MKO cells but not in the HepG2- hNTCP-RKO cells (FIGURE 6D).
- HBV infection were assessed in non-immortalized and terminally differentiated primary human hepatocytes (PHH) that retain the expression of hepatocyte marker genes at a level comparable to that of human liver tissue.
- PHH cultures were treated over a poly-U/UC PAMP dose-response and assessed innate immune activation.
- F7 and poly-U/UC PAMP induces IRF3 activation and expression of IRF3-target genes (FIGURES 1A-1D).
- the underlying mechanisms of F7 and poly-U/UC PAMP to suppress cccDNA likely involve the actions of IRF3-target genes to block cccDNA synthesis and impart actions that facilitate the destabilization and degradation of cccDNA to deplete it from the infected cell.
- F7 treatment of cells does not induce expression of type I or III IFN, owing to the RIG-I-activation properties of this class of compounds that do not impart signaling to NF-kB but instead exclusively activate downstream IRF3 (Bedard et al. (2012), supra, ⁇ Probst, et al.
- IRF3 activation drives the expression and production of various immune modulatory cytokines and chemokines, including CXCL10, a chemoattractant for T cells (Sankar, S., et al. (2006). IKK-i signals through IRF3 and NFkappaB to mediate the production of inflammatory cytokines. Cell Signal 18, 982-993; Zhai, Y., et al. (2008). CXCL10 regulates liver innate immune response against ischemia and reperfusion injury.
- IRF3-target genes are proposed to include a variety of anti-cccDNA effectors in addition to the known actions of the APOBEC genes.
- effector genes then impart pleiotropic actions to i) suppress cccDNA amplification, and ii) destabilize cccDNA and/or enhance cccDNA degradation. Indeed, a marked reduction in the cccDNA ti/2 was observed when cells were treated with F7 or poly-U/UC PAMP, and this reduction was further enhanced when cells were cotreated with either of these plus entecavir.
- the antiviral actions against cccDNA could also include IFN-mediated actions directed by the low level IFN induction (Isorce, N., et al. (2016).
- Antiviral activity of various interferons and pro- inflammatory cytokines in non-transformed cultured hepatocytes infected with hepatitis B virus Antiviral research 130, 36-45; Lucifora, J., et al. (2014), supra, Phillips, S., et al. (2017). Peg-Interferon Lambda Treatment Induces Robust Innate and Adaptive Immunity in Chronic Hepatitis B Patients. Frontiers in Immunology 8; Robek, M.D., et al. (2005). Lambda Interferon Inhibits Hepatitis B and C Virus Replication. Journal of Virology 79, 3851-3854; Xu, F., et al. (2016).
- Type III interferon-induced CBF inhibits HBV replication by hijacking HBx. Cellular & Molecular Immunology). Interestingly, these actions of IFN and specific ISGs resulting from treatment with poly-U/UC PAMP could have contributed to a suppression of cccDNA resulting in a modestly shorter half-life compared to treatment with F7. Mechanistically, it is proposed that the antiviral action of F7 and poly-U/UC PAMP might also include alteration of the cellular DNA repair machinery that otherwise contribute to cccDNA biosynthesis.
- HBV takes advantage of host DNA repair factors to repair the discontinuity of RC-DNA and convert it into a transcription permissive cccDNA
- several cellular DNA repair proteins known to be involved in cccDNA metabolism including TDP2 (Koniger, C., et al. (2014). Involvement of the host DNA-repair enzyme TDP2 in formation of the covalently closed circular DNA persistence reservoir of hepatitis B viruses. Proceedings of the National Academy of Sciences of the United States of America 111, E4244-4253), DNA ligases (Long, Q., et al. (2017). The role of host DNA ligases in hepadnavirus covalently closed circular DNA formation.
- RIG-I and IRF3 can be specifically targeted to activate the RLR innate immune program for the control of HBV infection through suppression of cccDNA, reducing the ti/2 to days compared to weeks or months in the absence of treatment.
- Targeting innate immunity and the RLR pathway thus offers an effective strategy toward new antiviral therapies against HBV that can be offered alone or in combination with NA for HBV treatment. Determining the innate immune targets directed by RIG-I and IRF3 that impart depletion of cccDNA will bring insight into the mechanism of action and unique antiviral properties of these novel drug candidates toward an HBV cure.
- NTCP stably expressing human hepatoma cell line C3A, a subclone of HepG2 were maintained in Dulbecco modified Eagle medium (DMEM) supplemented with 10 % heat-inactivated FBS, 1 x Glutamax (GIBCO), 100 U/ml penicillin, and 100 pg/ml streptomycin and were selected/expanded with medium containing 1 pg/ml of puromycin as previously described (Guo, F., et al. (2017).
- DMEM Dulbecco modified Eagle medium
- FBS 1 x Glutamax
- streptomycin 100 U/ml
- streptomycin 100 pg/ml
- HBV core protein allosteric modulators differentially alter cccDNA biosynthesis from de novo infection and intracellular amplification pathways.
- DDX3 DEAD-Box RNA Helicase Is a Host Factor That Restricts Hepatitis B Virus Replication at the Transcriptional Level. Journal of virology 88, 13689-13698).
- HepAD38 cell line which support produce HBV in tetracycline (TET)-inducible manner, were maintained as previously described (Watashi, K., et al. (2013). Interleukin-1 and tumor necrosis factor-alpha trigger restriction of hepatitis B virus infection via a cytidine deaminase activation-induced cytidine deaminase (AID).
- the human liver progenitor HepaRG cell line was cultured in complete William's E medium supplemented with 10% FBS, 100 U/ml penicillin, 100 pg/ml streptomycin, Hydrocortisone 21-Hemisuccinate (Cayman), human insulin (Sigma), and 1 x Glutamax (GIBCO) (Gripon, P., et al. (2002). Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences of the United States of America 99, 15655-15660). Primary human hepatocytes were freshly isolated from chimeric mice that have humanized liver reconstituted with PHH.
- the recovered PHH were cultured in DMEM supplemented with 10% heat-inactivated FBS, 15pg/ml L- proline, 25ng/ml insulin, 50nM Dexamethasone, 5ng/ml EGF, and O.lmM L-ascorbic acid 2-phospate, as described previously (Ishida, Y., et al. (2015). Novel robust in vitro hepatitis B virus infection model using fresh human hepatocytes isolated from humanized mice. The American journal of pathology 185, 1275-1285).
- hNTCP human sodium taurocholate co-transporting polypeptide
- the gene coding sequence was amplified from a cDNA clone prepared from dHepaRG cells. A carboxyl-terminal C9 tag was added by PCR amplification. Transduced cells were selected with 20 pg/ml blasticidin and the best growing single cell clones were screened for their ability to support HBV infection.
- guide RNA (gRNA) sequences were designed with the CRISPR tool of Benchling (Biology Software, 2017, https://benchling.com).
- the gRNA target oligonucleotides were cloned into Cas9-t2a-pRRL lentiviral vector by using the In-Fusion cloning kit (Takara).
- gRNA sequences used for gene knockouts were gRIG-I: 5'- GGGTCTTCCGGATATAATCC-3' (SEQ ID NO: 28), and gMDA5: 5'- GTGGTTGGACTCGGGAATTCG-3' (SEQ ID NO: 29) (Esser-Nobis, K exclusively et al. (2019). Comparative Analysis of African and Asian Lineage-Derived Zika Virus Strains Reveals Differences in Activation of and Sensitivity to Antiviral Innate Immunity. Journal of virology 93). Upon transduction, cells were kept under continuous selection with 10 pg/ml puromycin and knockouts were confirmed by western blot.
- HBV infection HBV (Genotype D) was purified from the supernatant of HepAD38 cells by PEG concentration and subsequent sucrose gradient, as described previously (Ko, C., et al. (2014). DDX3 DEAD-Box RNA Helicase Is a Host Factor That Restricts Hepatitis B Virus Replication at the Transcriptional Level. Journal of Virology 88, 13689-13698; Watashi, K., et al. (2013), supra).
- HBV infection cells were seeded into collagen-coated plates. One day later, the cells were infected with HBV in DMEM containing 4% polyethylene glycol 8000 (PEG-8000).
- the multiplicities of infection are indicated in each Figure Legend.
- the inocula were removed 24 hours later, and the infected cultures were maintained in complete DMEM containing 2.5% DMSO until harvesting, as described previously (Ni, Y., et al. (2014). Hepatitis B and D viruses exploit sodium taurocholate co-transporting polypeptide for species-specific entry into hepatocytes. Gastroenterology 146, 1070- 1083).
- F7 is a small molecule based on a benzothiazol core structure identified in a high-throughput screen for IRF3 agonists (US 9884876; Probst, et al. (2017), supra).
- F7 N-(6-benzamido-l,3-benzothiazol-2-yl)naphthalene-2-carboxamide
- FIGURE 1A structure was obtained from US 9884876 and synthesized de novo by Medchem Source, Inc. for use in the present studies.
- Working stocks of Sendai virus (SenV) strain Cantell were generated as previously described (Loo, Y.M., et al. (2008).
- poly-U/UC PAMP-RNA and X-RNA were each synthesized from T7 promoter-linked complementary oligonucleotides for the poly-U/UC PAMP RNA (Forward: 5'-
- RNA products were generated by using T7 RNA polymerase and T7 MEGAshortscript kit (Ambion) according to the manufacturer's instructions. 10pg of oligonucleotide mixture were annealed using gradient PCR program (95°C 2min, with gradual temperature decrease by l°C/30sec to 50°C). After annealing, the reaction mixture was assembled in an RNase-Free micro-centrifuge tube with 7.5mM of each nucleotide, lOx Reaction buffer, 2pg of template DNA and T7 enzyme as described by manufacturer, and the reaction was incubated at 37°C for 4 hours to allow in vitro transcription.
- RNAs were precipitated by using ethanol and ammonium acetate as described by the manufacturer and resuspended in nuclease-free water. RNA concentrations were determined by absorbance using a Nanodrop spectrophotometer. RNA quality and purity were assessed on denaturing 2% formaldehyde agarose gels.
- RT-qPCR Reverse transcription quantitative real time qPCR analysis: Total cellular RNAs were extracted from cells using TRIZOL reagent and the manufacturers' protocol (Invitrogen). cDNA was synthesized from the purified RNA by both random and oligo (dT) priming using iScript select cDNA synthesis kit (Biorad, Inc.). For HBV cccDNA expression analysis, total DNA was extracted using the DNeasy kit (QIAGEN).
- Southern Blot analysis of HBV DNA Southern blot analysis was performed on DNA isolated from cytoplasmic viral capsids exactly as previously described (Ko, C., et al. (2014). DDX3 DEAD-Box RNA Helicase Is a Host Factor That Restricts Hepatitis B Virus Replication at the Transcriptional Level. Journal of Virology 88, 13689-13698; Ko, C., et al. (2014b). Residues Arg703, Asp777, and Arg781 of the RNase H Domain of Hepatitis B Virus Polymerase Are Critical for Viral DNA Synthesis. Journal of Virology 88, 154-163 ).
- HBV -DNA including cccDNA
- a modified Hirt extraction method was used, as previously described (Cai, D., et al. (2013).
- the Hirt extracted protein-free DNAs preparation was digested with plasmid-safe ATP-dependent DNase (Epicentre).
- the extracted Viral DNA forms were separated on 1.2 % agarose gel, transferred to positive charged nylon membrane (GE healthcare, Amersham) via upward capillary transfer, then hybridized with digoxigenin-labeled HBV-specific DNA probe. DNA signal was detected by DIG luminescent detection kit (Roche).
- Immunoblot analysis was performed essentially as described (Lee, S., et al. (2016). Hepatitis B virus X protein enhances Myc stability by inhibiting SCF(Skp2) ubiquitin E3 ligase-mediated Myc ubiquitination and contributes to oncogenesis. Oncogene 35, 1857-1867). Cells were lysed with RIPA buffer containing 0.1 % sodium dodecyl sulfate in the presence of protease and phosphatase inhibitor cocktail (Sigma Aldrich). Lysates were separated by SDS-PAGE followed by electrical transfer onto nitrocellulose membranes.
- the membranes were probed overnight at 4°C using the appropriate primary antibodies and followed by the corresponding HRP- conjugated secondary antibodies.
- the following primary antibodies were used for this study: Rabbit anti-IRF3 phosphoserine 386 (Cell Signaling), Rabbit anti-IRF3 (Cell Signaling), Rabbit anti-IFITl (antibody 972; raised in rabbit against as IFIT1 437-490 aa peptide sequence), Rabbit anti-RIG-I (antibody 969; raised in rabbit against RIG-I aa 1- 227 peptide sequence), Rabbit anti-MDA5 (Enzo Life Sciences), Rabbit anti-Lamin B1 (Abeam), Mouse anti-Calnexin (Abeam) and Mouse anti-a-Tububn (Cell signaling).
- Immunofluorescence analysis was performed essentially as described (Lee, S., et al. (2016), supra). Briefly, cells seeded on collagen coated 24-mm coversbps were fixed with 3% paraformaldehyde and permeabilized with 0.2% Triton-X 100 in PBS. Cells were then incubated with mouse monoclonal antibody AR1 specific to IRF3 (Rustagi, A., et al. (2013). Two new monoclonal antibodies for biochemical and flow cytometric analyses of human interferon regulatory factor-3 activation, turnover, and depletion.
- Cytotoxicity assays Cytotoxicity was evaluated from cultures of HepG2-C3A- hNTCP and dHepaRG cells using CellTiter-Glo as described (Edwards, T.C., et al. (2019). Inhibition of HBV replication by N-hydroxyisoquinolinedione and N- hydroxypyridinedinone ribonuclease H inhibitors. Antiviral research 164, 70-80). Cells were seeded in 96-well culture plates in DMEM medium and incubated in the presence or absence of serially diluted compound or poly-U/UC PAMP.
- HBV entry assay and cell fractionation Cells were inoculated with HBV in presence of 4% PEG for 6 hours at 4°C. To assess HBV entry, inoculum was removed by washing with PBS that included proteinase K and cells were shifted to 37°C post attachment. After incubation and treatment, the cells were lysed in a hypotonic buffer (100 mM HEPES, 15 mM MgCh, 100 mM KCL and Nonidet P-40), and homogenized with a dounce homogenizer. The cytoplasmic fraction was separated from nuclei pellet by centrifugation (6,000*g for 5 min at 4 °C).
- hypotonic buffer 100 mM HEPES, 15 mM MgCh, 100 mM KCL and Nonidet P-40
- Nuclei pellet was resuspended in extraction buffer (20 mM HEPES, 15 mM MgCh. 420mM NaCl, 0.2 mM EDTA and 25% (v/v) Glycerol including DTT and protease inhibitor cocktail). Each cellular fraction was mixed with 1% SDS (v/v) and protein-free DNA was extracted using the Hirt extraction method.
- ELISA For ELISA, supernatant from cells were collected, centrifuged at 10,000 x g for 5 minutes, and liquid fraction recovered for analysis. HBsAg ELISA were performed on the recovered supernatant using the Hepatitis B virus s Antigen (HBsAg) Detection Kit (AlphaLISA; PerkinElmer) following the manufacturer's instructions.
- HBsAg Hepatitis B virus s Antigen
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202080069643.5A CN114502194A (zh) | 2019-10-02 | 2020-09-30 | 用于治疗乙型肝炎病毒感染的组合物和方法 |
| JP2022520428A JP2022550454A (ja) | 2019-10-02 | 2020-09-30 | B型肝炎ウイルス感染の治療のための組成物及び方法 |
| EP20870757.0A EP4037706A4 (en) | 2019-10-02 | 2020-09-30 | Compositions and methods for treatment of hepatitis b virus infection |
| US17/710,783 US20220241314A1 (en) | 2019-10-02 | 2022-03-31 | Compositions and methods for treatment of hepatitis b virus infection |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962909321P | 2019-10-02 | 2019-10-02 | |
| US62/909,321 | 2019-10-02 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/710,783 Continuation US20220241314A1 (en) | 2019-10-02 | 2022-03-31 | Compositions and methods for treatment of hepatitis b virus infection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2021067480A1 true WO2021067480A1 (en) | 2021-04-08 |
Family
ID=75337516
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/053606 Ceased WO2021067480A1 (en) | 2019-10-02 | 2020-09-30 | Compositions and methods for treatment of hepatitis b virus infection |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US20220241314A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4037706A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2022550454A (cg-RX-API-DMAC7.html) |
| CN (1) | CN114502194A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2021067480A1 (cg-RX-API-DMAC7.html) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11318213B2 (en) | 2020-03-23 | 2022-05-03 | Hdt Bio Corp. | Compositions and methods for delivery of RNA |
| US11679163B2 (en) | 2019-09-20 | 2023-06-20 | Hdt Bio Corp. | Compositions and methods for delivery of RNA |
| US12233160B2 (en) | 2021-09-22 | 2025-02-25 | Hdt Bio Corp. | Dried nanoparticle compositions |
| WO2025040743A1 (en) | 2023-08-22 | 2025-02-27 | Univerza V Ljubljani | Conjugated tlr7 and rig-i agonists |
| US12257299B2 (en) | 2021-09-22 | 2025-03-25 | Hdt Bio Corp. | SARS-CoV-2 RNA vaccine compositions and methods of use |
| US12350329B2 (en) | 2021-09-22 | 2025-07-08 | Hdt Bio Corp. | RNA vaccines against infectious diseases |
| US12485163B2 (en) | 2021-09-22 | 2025-12-02 | Hdt Bio Corp. | Cancer therapy compositions and uses thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021226129A1 (en) * | 2020-05-04 | 2021-11-11 | Neuralexo, Inc. | Small molecule activators of interferon regulatory factor 3 and methods of use thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150291534A1 (en) * | 2012-11-08 | 2015-10-15 | University Of Pittsburgh-Of The Commonwealth System Of Higher Education | Compounds for treating hiv and methods for using the compounds |
| US9884876B2 (en) * | 2014-05-09 | 2018-02-06 | Kineta, Inc. | Anti-viral compounds, pharmaceutical compositions, and methods of use thereof |
| US20180104325A1 (en) * | 2013-07-09 | 2018-04-19 | University Of Washington Through Its Center For Commercialization | Methods and Compositions for Activation of Innate Immune Responses Through RIG-I Like Receptor Signaling |
| US20180369323A1 (en) * | 2012-06-01 | 2018-12-27 | Drexel University | Modulation of hepatitis b virus cccdna transcription |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016164619A2 (en) * | 2015-04-07 | 2016-10-13 | Spring Bank Pharmaceuticals, Inc. | Compositions and methods for the treatment of hbv infection |
| KR20190057277A (ko) * | 2016-06-24 | 2019-05-28 | 에모리 유니버시티 | B형 간염 바이러스 치료용 포스포아미데이트 |
| EP3634431A4 (en) * | 2017-05-31 | 2021-06-23 | Arbutus Biopharma Corporation | THERAPEUTIC COMPOSITIONS AND METHODS OF TREATMENT FOR HEPATITIS B |
| WO2019152884A1 (en) * | 2018-02-02 | 2019-08-08 | University Of Washington | Compositions and methods for inducing tripartite motif-containing protein 16 (trim16) signaling |
-
2020
- 2020-09-30 WO PCT/US2020/053606 patent/WO2021067480A1/en not_active Ceased
- 2020-09-30 JP JP2022520428A patent/JP2022550454A/ja active Pending
- 2020-09-30 EP EP20870757.0A patent/EP4037706A4/en active Pending
- 2020-09-30 CN CN202080069643.5A patent/CN114502194A/zh active Pending
-
2022
- 2022-03-31 US US17/710,783 patent/US20220241314A1/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180369323A1 (en) * | 2012-06-01 | 2018-12-27 | Drexel University | Modulation of hepatitis b virus cccdna transcription |
| US20150291534A1 (en) * | 2012-11-08 | 2015-10-15 | University Of Pittsburgh-Of The Commonwealth System Of Higher Education | Compounds for treating hiv and methods for using the compounds |
| US20180104325A1 (en) * | 2013-07-09 | 2018-04-19 | University Of Washington Through Its Center For Commercialization | Methods and Compositions for Activation of Innate Immune Responses Through RIG-I Like Receptor Signaling |
| US9884876B2 (en) * | 2014-05-09 | 2018-02-06 | Kineta, Inc. | Anti-viral compounds, pharmaceutical compositions, and methods of use thereof |
Non-Patent Citations (1)
| Title |
|---|
| CHEN ET AL.: "TLR3 Plays Significant Roles against HBV-Associated HCC", GASTROENTEROLOGY RESEARCH AND PRACTICE, vol. 2015, no. 572171, 23 April 2015 (2015-04-23), pages 1 - 9, XP055818193 * |
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11679163B2 (en) | 2019-09-20 | 2023-06-20 | Hdt Bio Corp. | Compositions and methods for delivery of RNA |
| US11654200B2 (en) | 2020-03-23 | 2023-05-23 | Hdt Bio Corp. | Compositions and methods for delivery of RNA |
| US11896677B2 (en) | 2020-03-23 | 2024-02-13 | Hdt Bio Corp. | Compositions and methods for delivery of RNA |
| US11458209B2 (en) | 2020-03-23 | 2022-10-04 | Hdt Bio Corp. | Compositions and methods for delivery of nucleic acid-lipid nanoparticle complexes encoding for viral RNA polymerase region and protein antigen |
| US11534497B2 (en) | 2020-03-23 | 2022-12-27 | Hdt Bio Corp. | Compositions and methods for delivery of RNA |
| US11559584B2 (en) | 2020-03-23 | 2023-01-24 | Hdt Bio Corp. | Compositions and methods for delivery of RNA |
| US11648321B2 (en) | 2020-03-23 | 2023-05-16 | Hdt Bio Corp. | Compositions and methods for delivery of RNA |
| US11648322B2 (en) | 2020-03-23 | 2023-05-16 | Hdt Bio Corp. | Compositions and methods for delivery of RNA |
| US11318213B2 (en) | 2020-03-23 | 2022-05-03 | Hdt Bio Corp. | Compositions and methods for delivery of RNA |
| US11433142B2 (en) | 2020-03-23 | 2022-09-06 | Hdt Bio Corp. | Compositions and methods for delivery of RNA-lipid nanoparticle complexes encoding for viral RNA polymerase region and protein antigen |
| US11376335B2 (en) | 2020-03-23 | 2022-07-05 | Hdt Bio Corp. | RNA-lipid nanoparticle complexes of viral RNA polymerase region and SARS-CoV-2 spike protein region |
| US11752218B2 (en) | 2020-03-23 | 2023-09-12 | Hdt Bio Corp. | Nucleic acid-small diameter and liquid core nanoparticle complexed compositions |
| US12133894B2 (en) | 2020-03-23 | 2024-11-05 | Hdt Bio Corp. | Compositions and methods for delivery of RNA |
| US12433957B2 (en) | 2020-03-23 | 2025-10-07 | Hdt Bio Corp. | Compositions and methods for delivery of RNA |
| US12257299B2 (en) | 2021-09-22 | 2025-03-25 | Hdt Bio Corp. | SARS-CoV-2 RNA vaccine compositions and methods of use |
| US12350329B2 (en) | 2021-09-22 | 2025-07-08 | Hdt Bio Corp. | RNA vaccines against infectious diseases |
| US12233160B2 (en) | 2021-09-22 | 2025-02-25 | Hdt Bio Corp. | Dried nanoparticle compositions |
| US12485163B2 (en) | 2021-09-22 | 2025-12-02 | Hdt Bio Corp. | Cancer therapy compositions and uses thereof |
| WO2025040743A1 (en) | 2023-08-22 | 2025-02-27 | Univerza V Ljubljani | Conjugated tlr7 and rig-i agonists |
Also Published As
| Publication number | Publication date |
|---|---|
| US20220241314A1 (en) | 2022-08-04 |
| EP4037706A4 (en) | 2023-09-13 |
| CN114502194A (zh) | 2022-05-13 |
| EP4037706A1 (en) | 2022-08-10 |
| JP2022550454A (ja) | 2022-12-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220241314A1 (en) | Compositions and methods for treatment of hepatitis b virus infection | |
| JP6922030B2 (ja) | B型肝炎およびd型肝炎ウイルス感染の治療のための方法 | |
| TWI620568B (zh) | 用於治療b型肝炎及d型肝炎感染之方法 | |
| US9775894B2 (en) | Methods and compositions for activation of innate immune responses through RIG-I like receptor signaling | |
| TW202045723A (zh) | 用於B型肝炎病毒感染之RNAi劑 | |
| US20140287023A1 (en) | 5'-triphosphate oligoribonucleotides | |
| Lee et al. | Suppression of hepatitis B virus through therapeutic activation of RIG-I and IRF3 signaling in hepatocytes | |
| CN108712905B (zh) | 抗肝肿瘤病毒剂 | |
| Lei et al. | Mechanisms underlying the compromised clinical efficacy of interferon in clearing HBV | |
| TW202342064A (zh) | 編碼抗融合多肽之環狀多核糖核苷酸 | |
| Bahojb Mahdavi et al. | A comprehensive overview on the crosstalk between microRNAs and viral pathogenesis and infection | |
| US20170233742A1 (en) | Compositions Comprising Small Interfering RNA Molecules for Prevention and Treatment of Ebola Virus Disease | |
| US9771590B2 (en) | Targeting hepatitis B virus (HBV) host factors | |
| Gaajetaan et al. | The type I interferon response during viral infections: a “SWOT” analysis | |
| Mustafin et al. | COVID-19, retroelements, and aging | |
| Qamar et al. | Therapeutic Modalities for Sar s-Cov-2 (Covid-19): Current Status and Role of Protease Inhibitors to Block Viral Entry Into Host Cells. | |
| Kaur et al. | A Comprehensive Update on the Recent Advancements in the Treatment of Chronic Hepatitis B: Is it Feasible to Attain a Complete Cure-Practical Hurdles | |
| US20250188469A1 (en) | Antiviral antisense oligomer | |
| WO2026084025A1 (ja) | Hiv感染症の治療用医薬 | |
| HK40065449A (en) | Methods for the treatment of hepatitis b and hepatitis d virus infections | |
| Yi | Translation Enhancement of In-Vitro-Transcribed Messenger Rna by Influenza a Virus Derived Non-Structural Protein 1 | |
| CN115177606A (zh) | 金精三羧酸在制备抗乙型肝炎病毒药物中的应用 | |
| Hellermann et al. | Respiratory Syncytial Virus | |
| Levrero | Dottorato di Ricerca in Tecnologie Biomediche in Medicina Clinica Ciclo XXIX “Regulation of viral expression by the HBV core protein and the characterization HBc as a potential therapeutic target for HBV cure” Candidato: Relatore |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20870757 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2022520428 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2020870757 Country of ref document: EP Effective date: 20220502 |