WO2021055467A1 - Nano-médicament administrable par voie orale pour maladies virales - Google Patents

Nano-médicament administrable par voie orale pour maladies virales Download PDF

Info

Publication number
WO2021055467A1
WO2021055467A1 PCT/US2020/051061 US2020051061W WO2021055467A1 WO 2021055467 A1 WO2021055467 A1 WO 2021055467A1 US 2020051061 W US2020051061 W US 2020051061W WO 2021055467 A1 WO2021055467 A1 WO 2021055467A1
Authority
WO
WIPO (PCT)
Prior art keywords
ivm
nanoparticle
cells
nps
ivermectin
Prior art date
Application number
PCT/US2020/051061
Other languages
English (en)
Inventor
Shanta Dhar
Bapurao SURNAR
Dushyanth JAYAWEERA
Sylvia Daunert
Sapna DEO
Original Assignee
University Of Miami
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Miami filed Critical University Of Miami
Publication of WO2021055467A1 publication Critical patent/WO2021055467A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K17/00—Carrier-bound or immobilised peptides; Preparation thereof
    • C07K17/02—Peptides being immobilised on, or in, an organic carrier
    • C07K17/08—Peptides being immobilised on, or in, an organic carrier the carrier being a synthetic polymer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • A61K47/6931—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer
    • A61K47/6935—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer the polymer being obtained otherwise than by reactions involving carbon to carbon unsaturated bonds, e.g. polyesters, polyamides or polyglycerol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • A61K47/6931—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer
    • A61K47/6935—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer the polymer being obtained otherwise than by reactions involving carbon to carbon unsaturated bonds, e.g. polyesters, polyamides or polyglycerol
    • A61K47/6937—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer the polymer being obtained otherwise than by reactions involving carbon to carbon unsaturated bonds, e.g. polyesters, polyamides or polyglycerol the polymer being PLGA, PLA or polyglycolic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/19—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles lyophilised, i.e. freeze-dried, solutions or dispersions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5123—Organic compounds, e.g. fats, sugars
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/513—Organic macromolecular compounds; Dendrimers
    • A61K9/5146—Organic macromolecular compounds; Dendrimers obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyethylene glycol, polyamines, polyanhydrides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This disclosure relates generally to orally administrable nanoparticle for treating and preventing viral infection, specifically ZIKA and coronavirus infections, in particular humans with COVID 19.
  • the disclosure provides for a controlled release polymeric nanoparticle comprising a maleimide functional group on the nanoparticle surface, and a hydrophobic drug inside the nanoparticle.
  • Methods for using the orally administrable nanoparticle are also provided for treating and preventing viral disease.
  • ZIKV Zika virus
  • SARS-CoV-2 severe acute respiratory syndrome coronavirus 2
  • SARS-CoV-2 viral strain is highly transmittable and infects respiratory tissue via the SARS-CoV-2 spike protein targeting the angiotensin-converting enzyme. SARS-CoV-2 infection causes flu-like symptoms as well as more severe respiratory issues and death by respiratory failure.
  • biodegradable nanoparticles provide a steady delivery of ivermectin, in order to maintain an appropriate level in the body and following oral administration can cross the intestinal epithelial barrier and enter the blood stream.
  • IVM delivery via the and because IVM is delivered in a synthetic nanoparticle IVM accumulates at safe levels in the blood has the ability to target non-structural 1 protein of ZIKV.
  • the disclosed ivermectin-loaded, orally administrable, biodegradable nanoparticle can also be used to treat coronavirus, acting through the inhibition of the SARS-CoV-2 spike protein and targeting of the angiotensin-converting enzyme.
  • the nanoparticle delivered ivermectin inhibits nuclear transport activities mediated through proteins such as the importin a/b1 heterodimer.
  • the disclosed ivermectin packaged nanoparticle serves as a less toxic, more potent oral therapeutic, that decreases viral entry into cells and reduce overall viral load, both of which are keys to lowering disease transmission rates.
  • This invention provides reagents, pharmaceutical formulations, and methods for treating or preventing coronavirus infection in humans, and particularly COVID-19 infection.
  • a controlled release polymeric nanoparticle comprising a maleimide functional group on the nanoparticle surface, and a hydrophobic drug such as ivermectin inside the nanoparticle is disclosed.
  • a controlled release targeted polymeric nanoparticle comprising a FcRn binding domain that binds to a target cell or tissue; a hydrophobic drug encapsulated in the nanoparticle; and a targeting ligand with -SH functionality which can react at the nanoparticle surface with the maleimide functional group.
  • the nanoparticle described herein is a dry formulation comprising trehalose and/or sucrose. Further, the nanoparticle is a frozen formulation of nanoparticles comprising trehalose and/or sucrose. In the preferred embodiment the nanoparticle contains the hydrophobic drug ivermectin.
  • the polymeric nanoparticle comprises poly(lactide-co- glycolide)-b-polyethyleneglycol (PLGA-b-PEG) block copolymer that further comprises a poly(lactic-co-glycolic acid) (PLGA) core.
  • the FcRn binding domain targets tissue of the gastrointestinal tract.
  • RNA virus is Zika virus that is targeted with a nanoparticle that encapsulates ivermectin.
  • the nanoparticle comprises poly(lactide- co-glycolide)-b-polyethyleneglycol (PLGA-b-PEG) block copolymer.
  • the FcRn binding domain targets tissue of the gastrointestinal tract following oral administration of the nanoparticle.
  • the ivermectin is released at a therapeutic dose over a sustained period of time.
  • the method can be used to treat an individual who is or has been infected with a MERS virus, a Dengue virus, a hepatitis virus, a West nile fever virus, or an Ebolavirus.
  • RNA virus comprising administering the ivermectin containing nanoparticle to an individual is or has been infected with the SARS- COV-2 virus that results in a COVID-19 infection.
  • the FcRn binding domain targets tissue of the respiratory epithelia and the nanoparticle targets ACE2-expressing cells in the lungs.
  • Figure 1 (A) FcRn binds to Fc-lvermectin-NPs in an acidic environment, NPs transcytose across the epithelial-cell barrier and gets released at physiological pH of blood. (B) Synthetic strategy of PLGA-b-PEG-Mal. (C) GPC traces of the polymers. (D) Synthesis of IVM loaded NPs using nanoprecipitation. (E) Incorporation of targeting antibody Fc on the NPs. [00018]
  • Figure 2 (A) Characterization of IVM-loaded NPs by DLS and percent loading and encapsulation efficiency by HPLC.
  • B Characterization of targeted Fc-conjugated NPs by DLS and determination of Fc conjugation efficiency by the bicinchoninic acid assay (BCA).
  • Figure 3 (A) A cartoon of transcytosis of Fc-NP across the trans-epithelial barrier derived from Caco-2 cells. (B) Formation of tight junction was confirmed by measuring the trans- epithelial electrical resistance (TEER) with a Millicell-ERS (Millipore) and intact TEER after addition of NPs. (C) Expression of tight junction protein zonula occludens-1 (ZO-1). Quantification of NPs in the apical, basolateral sides of the barrier (D) in the absence and (E) in the presence of external Fc.
  • TEER trans- epithelial electrical resistance
  • Millicell-ERS Millicell-ERS
  • ZO-1 tight junction protein zonula occludens-1
  • Figure 5 (A) Biodistribution of IVM, NT-OH-IVM-NP, and T-Fc-IVM-NP in intestine and blood of Balb/c female mice after 24 h of post administration by oral gavage. (B) FcRn expression level in mice intestinal tissue by western blotting. (C) Cytokine expression in the blood plasma of the IVM or its NP-treated mice. (D) H & E staining of major tissue after treatment with saline or T-Fc-IVM-NP.
  • FIG. 1 A) Release of IVM from NT-Mal-IVM-NPs at pH 7.4 and 6.5 at 37 °C.
  • B Cellular toxicity of ivermectin and ivermectin-loaded NPs by performing mitochondrial respiration profiles of Caco-2 cells in presence targeted and non-targeted NPs by using Seahorse analyzer and MitoStress assay. Oligomycin, ATP synthase inhibitor; FCCP-carbonyl cyanide-p- trifluoromethoxyphenylhydrazone, an ionophore; Rotenone, an inhibitor of mitochondrial complex I; and Antimycin A, an inhibitor of mitochondrial complex III.
  • C Comparison of maximal respiration, basal respiration, ATP production, and coupling efficiency from the Mitostress assay mentioned in B.
  • Figure 7 NS1 expression level in HEK293T cells after treatment with NPs by (A) Western blotting and (B) immunofluorescence. Scale bar: 10 pm.
  • Figure 8 Temperature-dependent stability of (A) NT-Mal-NP and (B) NT-Mal-IVM- NP by analyzing the diameter and zeta potential over the course of 1 month.
  • C Stability of NT- Mal-IVM-NP alone and with cryoprotectants over the course of three 1 h freeze-thaw cycles (freezing at -80 °C).
  • D Stability of NT-Mal-IVM-NP stored at -80 °C both alone and with cryoprotectants, measured at 15 timepoints over the course of 180 days.
  • E Stability of NT-Mal- IVM-NP after freeze drying at -50 °C and 2 Pa and reconstitution in nanopure water.
  • F Comparison of inhibition of NS1 expression in HEK293T cells after treatment with freshly prepared NPs, dried powder, and the NPs stored at -80 °C for 180 days.
  • Figure 9 (A) Formation of placental barrier-like tight junction in JEG-3 cells as confirmed by measuring the TEER and intact TEER after addition of NPs. (B) Quantification of NPs in the apical side, inside the cells, and the basolateral sides of the barrier. (C) Expression of ZO-1by immunofluorescence. (D) Cellular toxicity of ivermectin and the NPs by performing mitochondrial respiration profiles of JEG-3 cells using MitoStress assay.
  • Oligomycin ATP synthase inhibitor
  • FCCP-carbonyl cyanide-pthfluoromethoxyphenylhydrazone an ionophore
  • Rotenone an inhibitor of mitochondrial complex I
  • Antimycin A an inhibitor of mitochondrial complex III.
  • the cells were treated with the articles for 24 h at a concentration of 10 mM with respect to ivermectin.
  • Figure 10 (A) 1 H NMR and (B) 13C NMR of MAL-NHS in CDCI3.
  • Figure 11 LC-MS-ESI of MAL-NHS.
  • Figure 12 (A) 1 H NMR and (B) 13C NMR of PLGA-b-PEG-NH2 in CDCI 3 .
  • Figure 13 (A) 1 H NMR and (B) 13C NMR of PLGA-b-PEG-MAL in CDCI 3 .
  • Figure 14 DLS histograms of (A) Mal-NP, (B) Mal-IVM10-NP, (C) Mal-IVM20-NP, (D) Mal-IVM30-NP, (E) Mal-IVM40-NP and (F) Mal-IVM50-NP in nanopure water at 37° C.
  • Figure 15 Zeta potential (mV) of (A) Mal-NP, (B) Mal-IVM10-NP, (C) Mal-IVM20- NP, (D) Mal-IVM30-NP, (E) Mal-IVM40-NP and (F) Mal-IVM50-NP in nanopure water at 37° C.
  • Figure 16 TEM images of (A) NT-Mal-NP and (B) NT-Mal-IVM-NP stained with 4% of uranyl acetate.
  • Figure 17 (A) DLS histograms of (A) NT-Mal-NP, (B) T-Fc-NP, (C) NT-Mal-IVM-NP, and (D) T-Fc-IVM-NP in nanopure water at 37° C.
  • Figure 18 Zeta potential (mV) of (A) NT-Mal-NP, (B) T-Fc-NP, (C) NT-Mal-IVM-NP, and (D) T-Fc-IVM-NP in nanopure water at 37° C.
  • Figure 19 (A) Diameters, (B) Zeta potentials of NT-Mal-QD-NP and T-Fc-QD-NP. (C) Fc conjugation efficiency of targeted NPs by the bicinchoninic acid assay (BCA). (D) TEM images of T-Fc-QD-NP (unstained).
  • Figure 20 Quantification of QD (Cd) loaded NPs in the (A) apical and (B) basolateral sides of the endothelial cell barrier.
  • ALT Alanine aminotransferase
  • AST Aspartate Aminotransferase
  • Figure 23 In vitro efficacy of (A) ivermectin, (B) NT-OH-IVM-NP, (C) NT-Mal-IVM- NP, and (D) T-Fc-IVM-NP in Caco-2 cells by the MTT assay. (E) IC50 values of the articles in the Caco-2 cells after treatment for 72 h.
  • Figure 24 Comparison of FcRn expression level in Caco-2, HEK293, and JEG-3 cells by western blotting.
  • Figure 25 Morphological comparison of NT-Mal-IVM-NP and NT-Mal-IVM-NP with sucrose after 180 days by TEM.
  • Figure 26 A) Targeted Fc-lvermectin-NPs in the acidic gut lumen bind to FcRn receptors, allowing NPs to transcytose across the epithelial cell barrier and release at the physiological pH of blood.
  • IVM delivered via T-Fc-IVM-NPs shows the ability to (1) decrease ACE2 receptor levels, (2) decrease SARS-CoV-2 spike protein levels, and (3) decrease levels of the nuclear transport proteins Importin a and b1 , which leads to (4) an increase in the antiviral activity of infected cells.
  • Figure 27 (A) Western blot showing expression of ACE2 and spike protein in HEK293T cells transfected with plasmid expressing spike protein with and without treatment of IVM, NT-IVM-NPs, or T-Fc-IVM-NPs. Cells were treated with the articles for 2 h or 4 h at a concentration of 10 mM with respect to ivermectin, the media was changed, and further incubated for 22 h or 20 h.
  • Immunofluorescence staining showing expression of (B) ACE2 and spike (C) in HEK293T cells transfected with plasmid expressing spike protein with and without treatment of IVM, NT-IVM-NPs, or T-Fc-IVM-NPs. Cells were treated with the articles for 4 h at a concentration of 10 pM with respect to IVM.
  • Figure 28 (A) Western blot showing expression of ACE2 in A549 adenocarcinomic alveolar basal epithelial cells transfected with plasmid expressing spike protein with and without treatment of IVM, NT-IVM-NPs, or T-Fc-IVM-NPs. Cells were treated with the articles for 24 h at a concentration of 10 pM with respect to IVM. (B) Western blot showing dose-dependent decrease in ACE2 expression after treatment with varying concentrations of T-Fc-IVM-NPs with respect to IVM in A549 cells.
  • FIG. 29 (A) Schematic representation of ACE2 expression and pseudovirus infection in HEK293T cells. Efficacy of T-Fc-IVM-NP showing inhibition of both ACE2 and pseudovirus uptake under (B) therapeutic and (C) preventative settings as measured by plate reader. Confocal microscopy images revealing the changes in the expression of red-tagged ACE2 receptor on the cell membrane and mNeonGreen pseudovirus accumulation in the nucleus following the treatment of T-Fc-IVM-NP under (D) therapeutic and (E) preventative settings.
  • Figure 30 Confocal microscopy images revealing the changes in the expression of red-tagged ACE2 receptor on the cell membrane and mNeonGreen pseudovirus accumulation in the nucleus following the treatment of T-Fc-IVM-NP under (A) therapeutic and (B) preventative settings in primary small airway epithelial human HSAEC cells.
  • FIG. 31 (A) Schematic representation of the how IVM delivered through T-Fc- IVM-NP inhibits IMP a and b1.
  • Figure 32 (A) Cellular toxicity of IVM and IVM-loaded NPs as measured by mitochondrial respiration profiles in spike protein-expressing HEK293T cells using the Sea horse analyzer and MitoStress assay: oligomycin, ATP synthase inhibitor; FCCP-carbonyl cyanide-p-trifluoromethoxyphenylhydrazone, an ionophore; rotenone, an inhibitor of mitochondrial complex I; and antimycin A, an inhibitor of mitochondrial complex III.
  • B Basal respiration and ATP production from the MitoStress assay.
  • C Expression of cytokines IL-6, IL- 1b, and TNFa in the media of spike protein-expressing HEK293T cells treated with IVM, NT- IVM-NP, or T-Fc-IVM-NP.
  • Figure 33 Characterization of IVM NPs (A) for diameter by DLS, (B) zeta potential, (C) percent loading and %EE of IVM in NT-NPs, and (D) percent loading, %EE of IVM and %Fc conjugation in T-Fc-NPs.
  • Figure 34 Uptake kinetics of IVM, NT-IVM-NPs, or T-FC-IVM-NPs in HEK293T cells.
  • Figure 35 Cytotoxicity of IVM, NT-IVM-NPs, or T-Fc-IVM-NPs in HEK293T cells as determined by the MTT assay.
  • Figure 36 Densitometric analyses of Western blots showing expression of ACE2 and spike protein in HEK293T cells transfected with plasmid expressing spike protein with and without treatment of IVM, NT-IVM-NPs, or T-Fc-IVM-NPs.
  • Cells were treated with the articles for 2 h or 4h at a concentration of 10 mM with respect to ivermectin, the media was changed, and further incubated for 22 h or 20 h. Analyses were performed by ImageJ.
  • Figure 37 (A) Western blot showing expression of ACE2 and spike protein in HEK293T cells transfected with plasmid expressing spike protein with and without treatment of IV, NT-IVM-NPs, or T-Fc-IVM-NPs. Cells were treated with the articles for 24h at a concentration of 10 pm with respect to ivermectin. (B) Densitometric analyses of Western blots showing expression of ACE2 and spike protein in HEK293T cells transfected with plasmid expression spike protein with and without treatment of IVM, NT-IVM-NPs, or T-Fc-IVM-NPs.
  • Figure 38 Western blot showing increased expression of ACE2 HEK293T cells upon treatment with Ang II at a varied concentration.
  • Figure 39 (A) Western blot showing expression in A549 adenocarcinomic alveolar basal epithelial cells transfected with plasmid expressing spike protein with and without treatment of IV, NT-IVM-NPs, or T-Fc-IVM-NPs. Cells were treated with the articles for 4h at a concentration of 10 pm with respect to IVM. (B) Densitometric analyses of Western blots showing dose-dependent decrease in ACE2 expression after treatment with varying concentrations of T-Fc-IVM-NPs with respect to IVM in A549 cells.
  • Figure 40 Effects of IVM and IVM-loaded NPs on mitochondrial complex IV and complex V activity in spike protein expressing HEK293T cells.
  • Figure 41 (A) Variation of hydrodynamic diameter of nano-ivermectin and (B) TEMs of nano-ivermectin obtained using the ultrasound-assisted reprecipitation method (aqueous medium) and (C) (acidic conditions of acetate buffer pH 5).
  • Figure 42 Change of (A) diameter and (B) zeta potential with volume of ethanolic ivermectin during the time growth of nanomaterials. Change of (C) diameter and (D) zeta potential with the pH of the suspension before and after the addition of a buffer.
  • Figure 43 (A) Absorbance spectra of bulk ivermectin and two nano-ivermectin suspensions aged for 24 hours, and (B) bulk ivermectin and nano-ivermectin suspensions aged for 24, 48, and 72 hours. [00060] Figure 44: Release profile of nano-ivermectin in PBS buffer pH 7.4.
  • Figure 45 Schematic of oral delivery of nanoparticles.
  • Figure 46 Schematic of orally deliverable clinically approved anti-viral drug loaded nanoparticles.
  • This disclosure relates generally to orally administrable nanoparticle for treating and preventing viral infection, specifically ZIKA and coronavirus infections, in particular humans with COVID 19. Methods for using the orally administrable nanoparticle are also provided for treating and preventing viral disease
  • the term "about” is understood as within a range of normal tolerance in the art, for example, within two standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%,
  • Ranges provided herein are understood to be shorthand for all of the values within the range.
  • a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40,
  • nanoparticle refers to a particle of matter that is between 1 and 100 nanometers (nm) in diameter.
  • nanoparticle refers to a particle of matter that is between 1 and 100 nanometers (nm) in diameter.
  • Nanoparticles occur widely in nature and are objects of study in many sciences such as chemistry, physics, geology and biology. Nanoparticles can also be synthesized and the production of nanoparticles with specific properties is an important branch of nanotechnology.
  • Nanoparticles can be part of nanotechnology-based delivery systems and are capable of transporting their contents across cellular membranes to deliver a specific message for the execution of a biological activity or function. Further, nanovesicles possess unique flow properties that endow them with an amended bioavailability. Nanovesicles have gained a particular importance due to their ability to enhance permeation rates of cargos such as drugs, through resistant biological membranes, mainly the skin barrier.
  • vesicle/cargo nanoscale system contributes to a major improvement of several pharmacokinetic properties of the cargo, including and not limited to, the solubility properties, controlled release, and milieu sensitivity (pH and type of medium).
  • solubility properties including and not limited to, the solubility properties, controlled release, and milieu sensitivity (pH and type of medium).
  • milieu sensitivity pH and type of medium.
  • maleimide-mediated methodologies are widely used in bioconjugation.
  • the name is a contraction of maleic acid and imide, the - C(0)NHC(0)- functional group.
  • Maleimides functional groups can be used in the preparation of targeted therapeutics, assemblies for studying proteins in their biological context, protein-based microarrays, or proteins immobilization.
  • Maleimides can be used in targeted drug therapies to bind and help deliver compounds in the body.
  • maleimides also describes a class of derivatives of the parent maleimide where the NH group is replaced with alkyl or aryl groups and that the substituent can comprise a wide number of molecules.
  • a controlled release targeted polymeric nanoparticle comprising: a FcRn binding domain that binds to a target cell or tissue; a hydrophobic drug encapsulated in the nanoparticle; and a targeting ligand with -SH functionality which can react at the nanoparticle surface with the maleimide functional group.
  • nanovesicle is synonymous with nanoparticle.
  • nanovesicles with the surprising technical effect of being composed solely of drug molecules, as nanodrugs, in a novel configuration where the drug molecules are self-carriers. This system introduces a novel area different from the norm wherein the nanovesicles are typically composed of phospholipid molecules.
  • the nanoparticles, serving as nanovesicles, are assemblies of drugs, thus, allow the delivery of an enhanced number of drug therapeutics without the need of a carrier or vehicle avoiding the problems related to the low loading capacity and unknown metabolism or degradation of the carrier in the body.
  • the nanodrugs disclosed herein can be efficiently implemented in aqueous medium in absence of any toxic organic solvent, which is highly significant for biological applications.
  • the nanovesicles, as described herein are composed of a potent antiviral drug in a nanoscale platform that can be widely applied to target various flaviviruses, and treat life-threatening viral infections.
  • the nanovesicles are composed of antiviral drug molecules with amphiphilic structures and cumulative hydrophobic property.
  • amphiphilic property of the drug is beneficial for topical deliveries, and eliminates the need for the use of penetration enhancers such as surfactants that are added to the nanovesicles suspensions.
  • the nanoparticle is a dry formulation comprising trehalose or sucrose.
  • the nanoparticle is a frozen formulation of nanoparticles comprising trehalose or a frozen formulation of nanoparticles comprising sucrose.
  • the polymeric nanoparticle comprises poly(lactide-co-glycolide)-b- polyethyleneglycol (PLGA-b-PEG) block copolymer that can further comprise a poly(lactic-co- glycolic acid) (PLGA) core.
  • PLGA poly(lactic-co- glycolic acid)
  • nanoparticles are advantageous as they can target specific tissue.
  • the FcRn binding domain targets tissue of the gastrointestinal tract.
  • the cargo of nanoparticles can have unknown effects on developing fetuses it is critical that some drug or antiviral containing nanoparticles not cross the placental barrier. Consistent with this, in one aspect of the current disclosure the nanoparticle described herein does not cross the placental barrier.
  • nanovesicles described herein are prepared from ivermectin drug for its highly efficient antiviral activity against flaviviruses, including but not limited to Yellow Fever, Dengue, and Zika Viruses. Also, disclosed is the use of nanovesicles containing ivermectin for use in treating COVD-19.
  • ivermectin for use in treating COVD-19.
  • One of skill in the art will further understand that the disclosed nanovesicles can be adapted or even used as disclosed for virus with similar origins.
  • the nanovesicle disclosed herein includes ivermectin within the nanoparticle.
  • Ivermectin inhibits viral protein replication, more specifically in relation to the inhibition of importin a/b that is included in several nuclear transport processes. Ivermectin use, historically has been limited as the potent action of the drug is only observed at high concentrations of micromolar range, resulting in toxic effects (i.e., cell toxicity).
  • ivermectin is part of a nanodrug overcomes this limitation and has the surprising technical effect lowering the effective dosage of ivermectin drug required to be effective, consequently avoiding toxicity and manifestation of side effects.
  • the innovative nanoivermectin-based formulation described herein drastically increases the therapeutic window, and can eventually eliminate the necessity for a frequent dosing of the drug.
  • the formulation of self-assembled nano ivermectin addresses the issue ivermectin solubility. Overcoming the "solubilizing" ivermectin issue is a significant technical effect, allowing use of the drug to treat viral infections.
  • RNA virus Zika virus (ZIKV).
  • the ZIKV causes microcephaly as well as a spectrum of neurologic problems including seizures in newborn babies and Guillain-Barre syndrome in adults.
  • the ultimate scale and impact of ZIKV remain to be determined as the severe abnormalities recognized at birth only represent the tip of the iceberg.
  • FDA Food and Drug Administration
  • This work identified more than 20 agents that decreased ZIKV infection in HuH-7 cells.
  • the most potent were ivermectin (IVM), mycophenolic acid (MPA), and daptomycin.
  • the current disclosure describes a new formulation of ivermectin as well as use of the nanoparticle for treating ZIKV.
  • the disclosed nanoparticle may also be used to treat related diseases in which ivermectin is effective, but its use may be limited by toxicity issues when administered in a non-nanoparticle formulation.
  • Targeted nanoparticles such as those disclosed herein can differentially deliver drugs to the site of interest in the body to improve the therapeutic index of drugs.
  • the Polymeric NPs of poly(lactide-co-glycolide)-b-polyethyleneglycol (PLGA-b-PEG) block copolymers designed and described herein are especially promising as drug delivery vehicles.
  • the core shell structure of polymeric NPs allows them to encapsulate and carry poorly water-soluble drugs such as IVM resulting long circulation half-life for the drug, release drugs at a sustained rate, and be functionalized with targeting ligands to modulate delivery method to target specific regions.
  • IVM poorly water-soluble drugs
  • the nanoparticles encapsulate ivermectin. And can comprise a poly(lactide-co-glycolide)-b-polyethyleneglycol (PLGA-b-PEG) block copolymer.
  • the FcRn binding domain targets tissue of the gastrointestinal tract.
  • the nanoparticles described herein can be are administered orally although one of skill in the art will understand the nanoparticles can be administered in alternative routes, including but not limited to intravenous.
  • the disclosed nanoparticle is further advantageous as the ivermectin payload is released at a therapeutic dose over a sustained period of time. Consistent with this, the nanoparticle can be loaded with alternative drugs, allowing for sustained release of alternative drugs, compounds, or therapeutics.
  • RNA virus in a further aspect of the disclosure is a method of treating an RNA virus, comprising administering the nanoparticle of any one of claims 1-11 to an individual infected with a single strand RNA virus.
  • the individual is or has been infected with the SARS- COV-2 virus that has presently or previously resulted in a COVID-19 infection.
  • the method disclosed herein can also be used as a prophylactic measure.
  • the FcRn binding domain targets tissue of the respiratory epithelia and can the nanoparticle can target ACE2- expressing cells.
  • COVID-19 a disease caused by a novel coronavirus strain SARS-CoV-2 is highly transmittable and infects respiratory tissue, and can cause flu-like symptoms as well as more severe respiratory issues and death by respiratory failure.
  • SARS-CoV-2 virus surface spike protein interacts with angiotensin-converting enzyme 2 (ACE2) receptors in the lung and facilitates the entry of virus into host cells, and much of the tissue damage done is actually a product of the immune response and resulting inflammation.
  • ACE2 angiotensin-converting enzyme 2
  • the disclosed IVM nanoformulation allows the therapeutic to be gradually released into the blood-stream, which maintains its level in the blood about the minimum effective therapeutic dose while keeping it below the maximum tolerated dose.
  • the NP was constructed using poly(lactide-co-glycolide)-b-poly(ethylene glycol)-maleimide (PLGA-b-PEG-MAL) polymer, and was targeted to the gut epithelial barrier for crossover into the bloodstream by covalent attachment of an Fc immunoglobulin fragment, which binds to receptors on epithelial cells in the gut lumen (Figure 26).
  • ACE2 which is present in high quantities in respiratory epithelia, allows for viral entry and infection of the lung and alveolar cells.
  • ACE2-expressing cells in the lung are involved in key processes such as blood pressure regulation and interferon production, and SARS-CoV-2 binding to this receptor can impede on those processes, making it an important target to reduce viral infection.
  • nanoparticle delivered IVM effectively decreases levels of viral spike protein as well as cellular levels of ACE2.
  • the disclosed IVM-loaded nanoparticles are engineered to contain a bound Fc immunoglobulin anti-body fragment to target FcRn receptors on gut epithelial cells, which will allow for transcytosis of orally delivered nanoparticles into the bloodstream and potential accumulation at respiratory epithelial cells, which are particularly affected by SARS-CoV-2 ( Figure 26).
  • the disclosed nanoparticle can be loaded with alternative therapeutics, including but not limited to, alternative drugs, chemicals, or antibodies.
  • the NPs disclosed herein can be further used to treat a wide range of viral infections.
  • the ivermectin nanoparticle can be used to treat an individual is or has been infected with a MERS virus.
  • the ivermectin nanoparticle can be used to treat an individual who is or has been infected with a Dengue virus.
  • the ivermectin nanoparticle can be used to treat an individual who is or has been infected with a hepatitis virus.
  • the ivermectin nanoparticle can be used to treat individual who is or has been infected with a West nile fever virus or an Ebolavirus.
  • the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims is introduced into another claim.
  • any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim.
  • elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements and/or features, certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements and/or features.
  • Polyethylene glycol (H2N-PEG2000-NH2) was procured from JenKem Technology, Bachem. Deuterated solvents, CDCI3 and DMSO-d6 were purchased from Cambridge Isotope Laboratories Inc. Regenerative cellulose membrane Amicon Ultra centrifugal 100 kDa filters were purchased from Merck Millipore Ltd. Strata C18-T columns (catalog number 8B-S004- EAK) were purchased from Phenomenex. Copper grids for transmission electron microscopy (TEM) were purchased from Electron Microscopy Sciences. Qdot. 705 ITKTM Amino (PEG) Quantum Dots (catalog number Q21561MP) and ProLong.
  • Gold anti-fade reagent with 4', 6- diamidino-2-phenylindole (DAPI) were purchased from Life Technologies.
  • Trans-well system polycarbonate (0.4-pm pore size, 12-well plates) were purchased from Corning, Lowell, MA.
  • the tight junction antibody ZO-1 (catalog number ab59720) was purchased from Abeam.
  • Alexa Fluor 488 goat anti-rabbit IgG secondary antibody (catalog number A11008) was procured from Invitrogen, ThermoFisher Scientific.
  • Phosphate buffered saline (1X PBS) was purchased from Gibco (reference number 10010-023).
  • Goat serum was obtained from Sigma Aldrich (catalog number G9023).
  • Glutamine, penicillin/streptomycin trypsin-EDTA solution, HEPES buffer (1 M in water), and sodium pyruvate were procured from Sigma Life Sciences.
  • Dulbecco's Modified Eagle's medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco Life Technologies.
  • Mouse monoclonal IgG, Fc-Rn (A-6) (Catalog number SC-393064) was purchased from Santa Cruz Biotechnology.
  • Zika virus NS1 antibody (EA88) catalog number. MA5-24583) was purchased from Invitrogen.
  • Flag-tagged Zika NS1 plasmid (Catalog number 79641) was procured from Addgene.
  • Native human IgG FC fragment protein (catalog number Ab90285) was procured from Abeam.
  • Ammonium persulfate (Catalog number 161-0180), tris/glycine/SDS buffer (Catalog number 161-0732), SDS-PAGE gel preparation kit TGX stain- freeTM fast castTM acrylamine 10% (Catalog number 161-0182), and ClarityTM western ECL substrate (Catalog number 170-5060) were purchased from Bio-Rad Inc.
  • Beta-actin antibody (Catalog number ab8226), nitrocellulose membrane (catalog number 88018), and tween-20 was purchased from Fisher Bioreagents.
  • High-performance liquid chromatography (HPLC) analyses were made on an Agilent 1200 series instrument equipped with a multi-wavelength UV-visible and a fluorescence detector. Cells were counted using Countess Automated Cell Counter procured from Invitrogen. TEM images were acquired using a JEOL JEM-1400 equipped with a Gatan Orius SC 200D CCD digital camera with a magnification of 80K. Inductively coupled plasma mass spectrometry (ICP-MS) studies were performed on an Agilent 7900 ICP-MS instrument. Mitochondrial bioenergetics assays were performed on XFe96 Extracellular Flux Analyzer (Agilent Seahorse Biosciences).
  • TEER measurements were performed on a Millicell.
  • ERS-2 Voltohmmeter Instrument (Catalog number MERS00002) purchased from Millipore. Confocal microscopy images were obtained using an Olympus FluoView FV3000. Mouse organ images were captured using a Zeiss Stemi 2000-CS stereoscope fitted with a CL-1500 ECO SteREO light source.
  • Human epithelial colorectal adenocarcinoma cells (Caco-2) cells were procured from ATCC. These cells were grown in Eagle's Minimum Essential Medium (DMEM) along with 20% fetal bovine serum. Cell cultures were maintained in a humidified cell culture incubator at 37°C and with 5% CO2. Transfectable derivative of human embryonic kidney 293 (HEK293T) cells were procured from ATCC. Cells were grown in Eagle's Minimum Essential Medium (DMEM) along with 10% fetal bovine serum. Cell cultures were maintained in a humidified cell culture incubator at 37°C and with 5% CO2. Human placental choriocarcinoma (JEG-3) cells were procured from ATCC. Cells were grown in Dulbecco Modified Eagle Medium (DMEM) along with 10% fetal bovine serum. Cell cultures were maintained in a humidified cell culture incubator at 37°C and with 5% C02.
  • DMEM Eagle's Minimum Essential Medium
  • JEG-3 Human placental chorio
  • 6-amino hexanoic acid (1 g, 7.62 mmol) and maleic anhydride (0.78 g, 80 mmol) were dissolved in 7.5 mL of acetic acid.
  • the reaction mixture was stirred for 1 h at room temperature until a white color product precipitated.
  • Formed Mal- acid (0.8 g, 3.8 mmol) and Nhydroxysuccinimide (0.48 g, 4.1 mmol) were dissolved in 5 mL of dry DMF. The reaction mixture was cooled to 0°C with stirring.
  • NH2-PEG-NH2 (1.0 g, 0.5 mmol), PLGA-COOH (0.825 g, 0.16 mmol), and DMAP (0.022 g, 0.2 mmol) were dissolved in dry CH2CI2 (12mL). This reaction mixture was cooled to 0 °C along with stirring. DCC (0.036 g, 0.17 mmol) was dissolved in CH2CI2 (1 mL) and added drop wise to the reaction vessel. The mixture was then warmed to room temperature and stirred overnight. Later on, precipitated DCU was filtered out and the resulting mixture was in a 1:1 mixture of cold diethyl ether: methanol (50 mL). This was repeated 5 times.
  • PLGA-b-PEG-Mal 5 mg mL-1 and ivermectin (1 mg mL-1) was made in 1 mL of DMF. The solution was added dropwise to 10 mL of Dl water with constant stirring (900 RPM) at room temperature and stirred for 2h. Nanoparticles (NPs) were washed 3 times with nanopure water with amicon ultracentrifugation filtration membranes with a molecular weight cutoff of 100 kDa (2800 rpm, 4°C). Formed NPs were suspended in water and stored at 4°C.
  • NP size (diameter, nm), PDI, and surface charge (zeta potential, mV) were obtained from three independent measurements.
  • NP solution was diluted with water, and 4% uranyl acetate added into the solution to stain the NPs.
  • the NP mixture was vortexed and dropped into a copper grid and dried overnight at room temperature using a JEOL JEM-1400 equipped with a Gatan Orius SC 200D CCD digital camera.
  • Nanoparticles (5 mg/mL with respect to total polymer) were diluted 100 times using nanopure water.
  • the NP solution (1 mL) was mixed with a 4% solution of uranyl acetate solution (5 pL) and vortexed.
  • the solution was filtered with a 0.45-micron filter and ⁇ 20 pL was dropped on a dark side of the copper grid and allowed to dry for 24 hours in desiccator at room temperature.
  • TEM images were recorded using JEOL JEM-1400 instrument.
  • cytotoxicity of ivermectin, NT-OH-IVM-NP, and T-Fc-IVMNP was tested in Caco- 2 cells using an MTT assay.
  • Cells were plated (3000 cells/well) in a 96-well plate and allowed to grow overnight. Media was changed and increasing concentrations of each article was added. Media was aspirated and fresh media added, and cells further incubated for an additional 48 h, after which 20 pL/well MTT was added (5 mg/mL Stock in PBS) and incubated for 5 h in order for MTT to be reduced to purple formazan. Media was removed and cells lysed with 100 pL of DMSO.
  • IC50 is the concentration of agent that reduces cell growth by 50% under experimental conditions and is the average from at least three independent measurements that were reproducible and statistically significant.
  • oligomycin (10 mM), FCCP (10 mM) and antimycin-A/rotenone mixture (10 mM each) were made in seahorse media.
  • Port A was filled with 20 mI_ of oligomycin, port B with 22 mI_ of FCCP and port C with 25 mI_ of antimycin A/rotenone to a final concentration of 0.1 mM in each well.
  • the cartridge was calibrated for pH and 02. After calibration, the experiment plate was run where 3 measurements were recorded for basal OCR and after addition of each reagent. The media was aspirated and 20 mI_ of RIPA buffer was added to each well and incubated for 10 mins at 37°C. Further BCA assays were performed to obtain protein normalized OCR values.
  • Caco-2 cells were plated in trans-well plate with a density of 50,000 cells/well on the apical side in 500 mI_ of DMEM (with 20% FBS) media. On the basal side, 1 mL of fresh media was added, and cells were grown up to 9 days. Before the addition of compounds, the integrity of the monolayer was monitored by TEER (transepithelial electrical resistance) using Epithelial Volt-ohmmeter. Media was replenished every two days. On the ninth day, 2 pg/mL of IgG-Fc (Fc) fragment was added in order to find out the targeting ability of the Fc-targeting nanoparticles.
  • TEER epithelial electrical resistance
  • ivermectin, NT-OH-IVM-NP, and T-Fc-IVM-NP were added to the cells with a concentration of 20 pg/mL, with respect to ivermectin, and were incubated for 12 h.
  • Apical and basal media were collected in eppendorf tubes and dissolved in 2 mL of acetonitrile.
  • 10 pg/mL of ivermectin was added to the collected media. This mixture was sonicated for 20 mins followed by centrifugation at 5000 rpm for 10 mins. From the precipitated debris, supernatant was gently collected.
  • Strata C18-T columns were activated by passing 1 mL of methanol and water through the filter in sequence.
  • the collected supernatant was passed through the activated column in order to get rid of remaining debris and impurities.
  • the column was washed with 1-2 mL of 5% methanol in order to remove the impurities.
  • NT-OH-IVM-NP and T-Fc-IVM-NP added with concentration of 20 pg/mL with respect to ivermectin and incubated for 12 h.
  • the cells were washed with PBS (1X) 3 times and fixed with 4% paraformaldehyde for 1 hour at 37 °C. After performing 3 washings, cells were permeabilized using 0.1% Triton-X100 for 10 min at 37 °C. The cells were washed with 1X PBS 3 times and blocked with 1% goat serum in 1X PBS for 12 h.
  • mice Female balb/c albino mice were used to understand the ivermectin and T-Fc-IVM- NPs distribution and toxicity after oral administration in vivo.
  • NT-OH-IVM-NP served as a non- targeted control.
  • Animals were divided into four groups, of three animals: Group 1- Saline, Group 2- Ivermectin, Group 3- NT-OH-IVM-NP, and Group 4- T-Fc-IVM-NP. Before oral dosage, animals were fasted for 8 h. Animals in each group received saline treatment, ivermectin, targeted NPs, or nontargeted NPs via oral gavage.
  • the dose of nanoparticle was 40 mg/kg with respect to ivermectin weight. Animals were sacrificed after 24 h and organs harvested. Blood (-200 pl_) was collected in heparinized tubes via cardiac puncture. Perfusion was performed with 1X PBS for 10 min with a flow rate of 7 mL/min. Collected blood was centrifuged to collect blood plasma. Organs were weighed and homogenized using a dounce homogenizer and collected in 2 mL of acetonitrile.
  • ivermectin peak 20 pg/mL was added to the crushed tissues and to the blood plasma and the mixture sonicated for 20 mins followed by centrifugation at 5000 rpm for 10 mins and supernatant collected.
  • Strata C18-T columns were activated by passing 1 mL of methanol and water through the filter in sequence. Supernatant was passed through the activated column for purification and the column washed with 1-2 mL of 5% methanol in order to remove the impurities.
  • the membrane was incubated at 4 °C overnight for primary antibody (FcRn and b-actin) and washed 5 times with TBST buffer and incubated with appropriate secondary antibodies at room temperature for 1 h. Membranes were washed five times with TBST buffer and developed using ECL. Images were taken using a BioRad ChemiDocTM imaging system and bands quantified using ImageJ software.
  • Enzyme-linked immunosorbent assay (ELISA) to determine immunogenic effect
  • the levels of pro-inflammatory cytokines IL-1 b, IL-6, and TNF-a in plasma were determined using ELISA kits following the manufacturer’s protocol. Briefly, 100 pL/well of coating buffer with capture antibody was added to the 96-well ELISA plate and the plate sealed overnight at 4°C. Buffer was aspirated from the wells and cells washed 3 times with 300 pL/well of wash buffer. After the last wash, the plate was inverted and blotted on absorbent paper to remove any residual buffer. Wells were blocked with 200 pL/well of assay diluent and incubated at room temperature for 1 h. The diluent was aspirated from the wells and the wells washed.
  • the reagent was aspirated from wells, and substrate solution (100 mI_) was added to each well and the plate sealed and incubated for 30 minutes at room temperature in the dark. Stop solution was added to each well and the absorbance was recorded at 450 nm.
  • master reaction mix 80 mI_ of AST Assay Buffer, 2 mI_ of AST Enzyme Mix, 8 mI_ of AST Developer and 10 mI_ of AST Substrate
  • T i nitial Absorbance at initial time, T i nitial , was (A450)i nitiai , and at the end the final time point, T finai , was at (A450) finai .
  • the absorbance was measured at 450 nm at the initial time.
  • the AST activity of a sample was determined by the following equation:
  • ALT Assay Plasma was used to determine ALT activity. Using Cayman’s ALT Assay Kit Measurement of the ALT activity was carried out by monitoring NADH oxidation rate in a coupled reaction system employing lactate dehydrogenase (LDH). The oxidation of NADH to NAD+ is accompanied by a decrease in absorbance at 340 nm. Under circumstances in which the ALT activity is rate limiting, the rate decrease is directly proportional to the ALT activity in the sample. Substrate (150 pL), 20 pL of Cofactor, and 20 pL of sample were added to each well of a 96 well plate and incubated at 37°C for 15 min. The reaction was initiated by the addition of 20 pL of ALT initiator and absorbance recorded immediately at 340 nm once every minute for five minutes. The change in absorbance (DA340) per minute was determined using the following equation.
  • DA /min A340 (Time 2) - A340 (Time 1 )/ Time 2 (min) - Time 1 (min)
  • the reaction rate at 340 nm was determined using the NADH extinction coefficient of 4.11 mM 1 .
  • ALT and H aspartate aminotransferase
  • Agar plates (1.5%) containing 100 pg/mL ampicillin were prepared and streaked with Flag-tagged Zika NS1 and control plasmid. Plates with NS1 and control plasmid were incubated at 37°C and 30°C respectively for 16 h. Single colonies were inoculated in 5 mL of LB broth media containing 100 pg/mL ampicillin for primary culture and incubated at 37°C with shaking for 16 hours. Plasmid isolation using Midiprep kit
  • NS1 and control plasmids were isolated using Qiagen Midiprep plasmid isolation kit. Overnight grown bacterial culture was harvested by centrifuging at 4500 rpm for 20 minutes at 4°C. Supernatant was discarded and the bacterial pellet dissolved in 4 mL of buffer P1 and mixed. Buffer P2 (4 mL) was added and mixed thoroughly by vigorously inverting the tube 4-6 times followed by incubation at room temperature for 5 minutes. Bbuffer P3 (4 mL) was mixed thoroughly by vigorously inverting the tube 4-6 times and incubated on ice for 15 minutes. Tubes were centrifuged at 4500 rpm for 30 minutes at 4°C.
  • HEK293T cells (0.3 x 106) were seeded overnight in 6-well plates with 10% FBS containing DMEM medium. Cells were transfected with 2 pg of Flag-tagged Zika NS1 plasmid and an empty vector using turbofectin (turbofectin: DNA-3:1) in Opti-MEM medium. Six hours post-transfection, medium was removed and replaced with fresh medium and incubated for additional 6 h. Cells were treated with 10 mM concentration of ivermectin (IVM), T-Fc-IVM-NP and NT-OH-IVM-NP for 6 h, cells lysed and total cell lysates (60 pg) resolved on a 4-20% gradient gel.
  • IVM ivermectin
  • Proteins were transferred to PVDF membrane and probed with Anti-flag (1:1000) and b-actin (1:1000) antibody overnight at 4°C, washed with TBST and probed with HRP- conjugated anti-mouse secondary antibody (1:2000) for 1 h at room temperature.
  • Membranes were developed using SuperSignal west pico chemiluminescence substrate (Thermo Scientific).
  • HEK293T cells were plated on coverslips in a 12 well plate at a density of 20,000 cells/well in 1 mL of DMEM (with 10% FBS) media.
  • Cells were transfected with 2 pg of Flag- tagged Zika NS1 plasmid (addgene# 79641) and an empty vector using turbofectin (turbofectin: DNA-3:1) in Opti-MEM medium. After 6 h post transfection, medium was removed and replaced with fresh medium and incubated for additional 6 hours.
  • Cells were treated with ivermectin (IVM), T-Fc-IVM-NP, or NT-OH-IVM-NP at a concentration of 10 pM IVM for 6 h.
  • Cells were washed with PBS and fixed with 4% paraformaldehyde for 1 h at 37°C. Cells were permeabilized using 0.1% Triton-X100 for 10 min at 37°C, washed with 1X PBS 3 times and blocked with 1% goat serum in 1X PBS for 12 h. Cells were treated with the respective primary antibody (Anti-flag (1 :1000) in 1% goat serum containing 1X PBS for 12 h at 4°C in humidified chambers. Cells were washed three more times with 1 % goat serum containing 1X PBS, appropriate secondary antibodies (Alexa 488 conjugated anti-mouse antibody) added along with DAPI and incubated for 1 hour at room temperature.
  • Primary antibody Anti-flag (1 :1000
  • NPs were prepared for the temperature dependent stability using 5 mg/mL PLGA- PEG-Mal alone (for Mal-NP) or using 5 mg/mL PLGA-PEG-Mal polymer and 1 mg/mL ivermectin (for Mal-IVM-NP). Solutions were stirred for 2 hours, then filtered using Amicon filtration (100 MWCO) at 2800 RPM. Three 1 mL solutions of both Mal-NP and Mal-IVMNP were prepared, and after initial DLS measurements of size and zeta potential were taken, the solutions were stored at 4°C, room temperature, and 37°C.
  • Mal-IVM-NPs were prepared in a similar fashion as described above, but with starting concentrations as 10 mg/mL PLGA-PEG-Mal polymer and 2 mg/mL ivermectin.
  • NPs were mixed with the cryoprotectants sucrose and trehalose in NP:cryoprotectant ratios of 1:0.1 , 1 :0.5, 1 :1, and 1 :2.
  • Final volumes of each sample were 400 pL, and each contained the same amounts of nanoparticles.
  • DLS measurements (size and zeta potential) of the samples were taken prior to placing samples -80 °C and measurements of size and zeta potential captured every hour. This was repeated for 3 cycles, each of which had the NPs at -80°C for one hour.
  • NPs must be dried and made into powdered form in order to eventually be packed into capsules to serve as a viable antiviral treatment.
  • Mal-IVM-NPs were produced as described above, with 10 mg/mL PLGA-PEG-Mal polymer and 2 mg/mL ivermectin. NPs were dried, with and without the cryoprotectants, using low pressure and temperature. Sucrose and trehalose were added in 1:2 NP:cryoprotectant ratios, and a third sample contained NPs alone. NPs were dried at approximately -50 °C and 2 Pa using a VirTis Benchtop K Freeze Dryer. Powdered NPs were reconstituted in 1 mL nanopure water. Size and zeta potential measurements were taken, and data suggested that NPs dried in the presence of sucrose displayed the best results with slightly increased size.
  • JEG-3 cells were plated in transwell plate at a density of 50,000 cells/well on the apical side in 500 pL of DMEM (with 10% FBS) media. On the basal side, 1 mL of fresh media was added and cells grown for up to 9 days. Prior to the addition of compounds, the integrity of the monolayer was monitored by TEER (transepithelial electrical resistance) using Epithelial Volt-ohmmeter.
  • TEER epithelial electrical resistance
  • ivermectin, NT- OH-IVM-NP, or T-Fc-IVMNP were added to the cells at a concentration of 20 pg/mL with respect to ivermectin, and were incubated for 12 h.
  • Apical and basal media were collected in eppendorf tubes and dissolved in 2 mL of acetonitrile.
  • 10 pg/mL of ivermectin was added to the collected media, the mixture sonicated for 20 min followed by centrifugation at 5000 rpm for 10 min and the supernatant gently collected.
  • ZO-1 tight junction protein
  • Bacterial agar plates (1.5%) containing 100 pg/mL ampicillin were prepared and streaked with SARS-CoV-2 spike protein plasmid and incubated at 37 °C for 16 h. A single colony from the plate was inoculated in 5 mL of LB broth media containing 100 pg/mL ampicillin for primary culture. The culture was incubated at 37°C in an incubator shaker for 16 h. Spike protein plasmid was isolated using Qiagen Midiprep plasmid isolation kit. Bacterial culture grown overnight was harvested by centrifuging at 1900g for 20 min at 4 °C.
  • the supernatant was discarded and the bacterial pellet was dissolved in 4 mL of buffer P1 and mixed properly, buffer P2 added and tubes mixed thoroughly incubated at room temperature for 5 min.
  • Buffer P3 (4 mL) was mixed thoroughly by vigorously inverting the tube four to six times and incubated on ice for 15 min followed by centrifugation at 1900g for 30 min at 4 °C.
  • the Qiagen midi column was equilibrated with 4 mL of buffer QBT and bacterial supernatant was loaded onto the column, and the column allowed to empty by gravity flow.
  • the plasmid was eluted from the column by using QF buffer and isopropanol used to precipitate the plasmid.
  • the plasmid was dissolved in water and the purity and quantification of plasmid measured using Nanodrop.
  • HEK293T cells, HeLa cells, and A549 cells (1 A ⁇ 105) were seeded in 6-well plates in 10% FBS-containing DMEM medium and were incubated overnight.
  • Cells were transfected with 2 pg of SARS-CoV-2 spike protein plasmid using turbofectin (turbofectin: DNA-3:1) in Opti- MEM medium.
  • turbofectin turbofectin: DNA-3:1
  • Cells were treated with 10 mM concentration of IVM, NT-IVM-NP, and T-Fc-IVM-NP for 24 hours.
  • the articles in the same concentration were added to cells for 2, 4, and 6 h, followed by incubation of cells in normal media for up to 24 hours.
  • HEK293T cells (1 A ⁇ 105) were seeded in 6-well plates in 10% FBS-containing DMEM medium and incubated overnight. Cells were transfected with 2 pg of SARS-CoV-2 spike protein plasmid using the transfection reagent turbofectin (turbofectin: DNA-3:1) in Opti- MEM medium. Six hours post-transfection, media was removed and replaced with fresh media and incubated for additional 6 hours. IVM and its nanoformulations were added to cells at 10 pM concentrations with respect to IVM to cells for 2, 4, and 6 h, followed by incubation of cells in normal media up to 24 hours total.
  • turbofectin turbofectin: DNA-3:1
  • HEK293T cells, HeLa cells, and A549 cells were each plated on coverslips in separate 12-well plates at a density of 20,000 cells/well in 1 mL of DMEM (with 10% FBS) media.
  • Cells were transfected with 2 pg of SARS-CoV-2 spike protein plasmid and an empty vector using turbofectin (turbofectin: DNA-3:1) in Opti-MEM medium.
  • turbofectin turbofectin: DNA-3:1
  • Opti-MEM medium Six hours post transfection, medium was removed and replaced with fresh medium and incubated for additional 6 hours.
  • Cells were treated with IVM, NT-IVM-NP, or T-Fc-IVM-NP at a concentration of 10 pM with respect to IVM for 6 h.
  • HEK293T cells were seeded in 6 well plate and transfected with 2pg of plasmid using turbofectin.
  • Cell were treated with ivermectin, NT-IVM-NP and T-Fc-IVMNP for 4 h at a concentration of 10 mM, medium was removed, and cells were kept for additional 20 hours.
  • RNA was extracted by harvesting cells with trypsin and lysed with buffer RLT. Ethanol (70%,) was added to the cell lysate , lysates transferred to RNeasy mini spin columns and centrifuged for 1 minute at 8000 rpm.
  • Reverse transcription from each sample was carried out using 1 pg of RNA using iScript Reverse Transcription Supermix.
  • Real time PCR reaction was performed using SsoAdvanced Universal SYBR® Green Supermix in a 20 pL reaction.
  • Beta-actin was used as an internal control and data analyzed using the comparative Ct value and expressed as fold change 2 DD0T .
  • the forward and reverse primer sequence was
  • 5OCAGTACGCCATGTAACGGA3’ (SEQ ID NO: 1) and 5’CGTGGAGGAGCTCAAAGGAC 3’ (SEQ ID NO: 2) respectively for spike gene.
  • the primer for human ACE2 gene was purchased from Sino Biological Inc (catalogue number: HP100185).
  • the primer sequence for b-actin gene was: Forward 5’ GCATCCTCACCCTGAAGTAC 3’ (SEQ ID NO: 3) and reverse 5’GATAGCACAGCCTGGATAGC 3’ (SEQ ID NO: 4).
  • ACE2-Red reporter assay The Angiotensin Converting Enzyme 2 (ACE2)-Red reporter assay and Pseudo SARS-CoV-2 Green Reporter assay were performed with the goal of increasing ACE2 expression in HEK293T cells and A549 cells and observing the effects of IVM-loaded nanoparticle treatment on ACE2 expression and SARS-CoV-2 virus cell entry. These effects were measured through fluorescence imaging using two different methods of treatment: a preventive method, in which IVM and IVM nanoformulation treatment preceded pseudovirus infection in the cells, and a therapeutic method, in which IVM and IVM nanoformulation treatment followed pseudovirus infection in the cells.
  • the preventive method’s aim was to decrease ACE2 levels initially through IVM treatment so that the rate at which pseudoviruses entered cells would decrease.
  • the therapeutic method aimed to interrupt ACE2 and pseudovirus binding and show a lowering in pseudovirus infection presence after the treatment.
  • HEK293T cells were detached using a standard trypsinization protocol and then counted. Cells were prepared for plating in an 8-well live cell imaging chamber at 20,000 cells per well, using 100 pl_ of media for each well. These cells were maintained in a single test tube at 500,000 cells per ml_, ready to be mixed with the viral transduction reaction.
  • an ideal NP system for oral delivery of IVM needs to have pH stability, intestinal absorption, and epithelium crossing ability, and should also demonstrate high IVM loading capacity and controlled release of the drug. It is also critical that orally delivered NP transports the payload efficiently from the intestine to the blood stream.
  • the neonatal Fc receptor (FcRn) mediates immunoglobulin G (IgG) transport across the polarized epithelial barriers.
  • FcRn is expressed at a level that is closely similar to fetal expression in the apical region of epithelial cells in the small intestine and diffuse throughout the colon in adulthood.
  • FcRn binds to the Fc portion of IgG following a pH-driven pathway; acidic pH of ⁇ 6.5 promotes binding of Fc to FcRn and physiological pH of ⁇ 7.4 releases the Fc from the FcRn binding pocket (Figure 1 A).
  • Figure 1B a biodegradable PLGA polymer based platform
  • the linkers on the polymer are comparatively acid resistant to provide stability to the NPs under acidic pH in the stomach when administered via oral route (Figure 1B). All monomers and polymers were characterized by NMR spectroscopy ( Figures 10-13).
  • the polymers were also analyzed by gel permeation chromatography (GPC) demonstrating purity and monodisperse distribution (Figure 1C).
  • GPC gel permeation chromatography
  • Figure 1C monodisperse distribution
  • the morphology of IVM loaded NPs was determined by transmission electron microscopy (TEM) confirming spherical, homogeneous particle population ( Figure 16). Ivermectin concentrations in the NPs were quantified using high performance liquid chromatography (HPLC). As IVM feed was increased from 10% to 50%, the NP size increased from ⁇ 60 nm to 140 nm. The NPs gave a very stable surface charge of nearly around -25.0 mV. The NPs with feed of 10% to 30% showed PDI -0.21 which suggested the formation of monodisperse particles. The 40% and 50% showed higher PDI of -0.45 indicating formation of higher aggregates.
  • the NPs with NH2 upon interaction with Fc showed similar size (-60 nm) and zeta potential ( ⁇ -12 mV) as NTMal-NPs.
  • the Fc-SH attached NPs showed increased in size ( ⁇ 88 nm) and ( ⁇ 22 mV). This increase is due to the covalent attachment of the Fc-SH on the NT Mal-NPs.
  • NP transport ability across the Caco-2 monolayer were determined by quantifying IVM in the apical (AP) and basolateral (BL) side media using HPLC (Figure 3A). Caco-2 cells were plated in a transwell plate on the apical side. On the basolateral side, 1 mL of media was added and the cells were grown up to 9 days. Before the addition of NPs, the monolayer integrity was checked by measuring the trans-epithelial resistance (TEER) indicating TEER values of >800 W/cm2 on day 9 ( Figure 3B, top). Media was replenished once every two days.
  • TEER trans-epithelial resistance
  • T-Fc-IVM-NP or NT-OH-IVM-NP was added to the apical side of the barrier and incubated for 12 h.
  • NT-OH-NP constructed using PLGA-b-PEG-OH polymer was used as a non-targeted control since -Mai containing NPs can interact with biological thiols or other reactive groups.
  • Addition of NPs did not change the tight junction function of the epithelial barrier as evident from intact TEER ( Figure 3B, bottom) and the expression of tight junction protein zonula occludens-1 (ZO-1) ( Figure 3C). Media from apical and basolateral sites were collected and stored at room temperature.
  • T-Fc-IVM- NPs were found at a much higher concentration in the basolateral side compared to the non- targeted NT-OH-IVM-NPs ( Figure 3D).
  • mice were used to evaluate the distribution properties of T-Fc-NP after oral administration.
  • NT-OH-NP was used as a non-targeted control. Animals were divided in three groups, each group containing three animals. Group assignments were: Group 1-Saline, Group 2-NT-OH-QD-NP, and Group 3-T-Fc-QD-NP. Animals in each group received saline, targeted, or non-targeted NPs via oral gavage. The dose of NP was 50 mg/kg with respect to total polymer. After 24 h, around 300 pL of blood was collected in heparinized tubes via cardiac puncture. Collected blood was centrifuged to collect blood plasma.
  • T-Fc-IVM-NP The percentage IVM accumulation for T-Fc-IVM-NP was found to be around 12%, 9%, 5%, 5%, and 60% in duodenum, jejunum, ileum, colon, and blood, respectively ( Figures 5A, and 21) 24 h post administration via oral gavage. Analyses of the intestinal tissue samples by Western Blot indicated significant expression of FcRn thus confirming that the targeted NPs utilize these receptors to get associated with the intestinal tissue (Figure 5B). T-Fc-IVM-NPs did not have any effect on serum proinflammatory markers IL1 -b, IL-6, and TNF-a suggesting that these NPs do not induce immunogenicity (Figure 5C).
  • T- Fc-IVM-NP has the potential to cross the intestine epithelial barrier to reach the blood to attack Zika virus, whereas free ivermectin might be disrupting the barrier due to its toxicity on the epithelial cells at the barrier.
  • the toxicity data was further confirmed by performing conventional MTT assay.
  • T-Fc-IVM-NP inhibits NS1 expression.
  • ZIKV is a single stranded RNA virus which encodes for three structural proteins (C, PrM or M, and E) and seven non-structural (NS) proteins NS1 , NS2A, NS2B, NS3, NS4A,
  • NS4B The NS1 protein is involved in viral replication, immune evasion, and pathogenesis of the host cells. NS1 is also a major antigenic marker for viral infection and is regarded as a potential therapeutic target for antiviral drug discovery. Earlier studies have suggested that ivermectin inhibits ZIKV infection. The current study evaluated whether T-Fc- IVM- NP inhibits the expression of NS1 protein. NS1 protein was expressed in HEK293T cells and demonstrated that T-Fc-IVM-NPeffectively inhibited NS1 expression, 0.08 relative to 1.05 for NS1 plasmid alone (Figure 7A). These results were further confirmed using immunofluorescence (Figure 7B). Under the in vitro settings using HEK293 cells, no significant differences were observed between free ivermectin and when delivered with targeted NP due the fact that HEK293 cells do not have significant FcRn expression (Figure 24).
  • Example 7 Dry Formulation of IVM-Loaded NPs (ZIKA)
  • the IVM-loaded TFc IVM-NPs must be made into powder form to be able to be packed into a capsule and to serve as a viable treatment option for ZIKV.
  • Formulation optimization studies were performed using NT-Mal-IVM-NP. Our studies involved freeze-drying the NPs in the presence of cryoprotectants to ensure their size and stability are maintained in powder form. Sucrose and trehalose were identified as potential cryoprotectants. These optimization studies were carried out under different conditions as discussed below.
  • NP ratios were set as 0.1 :1 , 0.5:1 , 1:1 , and 2:1 , as well as control samples with only NP (0:1 ). Size and zeta potential of mixtures of NP and cryoprotectant were tested both after initial mixture and after 1 , 2, and 3 freeze-thaw cycles from -80 °C to room temperature. Each cycle lasted approximately an hour. The tests revealed that both sucrose and trehalose in ratios of 1:1 or 2:1 offered the best protection to NP size and zeta potential, and so these two concentrations of both cryoprotectants were chosen for the long-term storage of NPs at -80 °C.
  • NPs with cryoprotactants maintain size better, and overall, the cryoprotectants in higher concentrations (2:1 cryoprotectant: NP ratio) were chosen for testing of the drying process (Figure 8C). IVM levels in the NPs were assessed using HPLC; it was found the levels did not show significant change after 180 days of long term storage.
  • cryoprotectant NP ratio of 1 :1 and 2:1 ratios are the best for dry formulation. These NPs maintained the size ⁇ 65 nm and a negative zeta potential.
  • Example 8 Transport of IVM loaded NPs across an in vitro Placental Barrier.
  • the placental barrier is built from various types of cell layers which allows for diffusion of different substances between the maternal and fetal circulatory systems. For this reason, the placental barrier is known as the leakiest barrier allowing small molecules to pass through between the mother and the fetus. This leaky nature of the placental barrier is a major reason for doctors’ reluctance towards prescribing medicines for chronic diseases such as hyperlipidemia and ZIKV infection to pregnant patients.
  • the fate of IVM and IVM loaded NPs were studied. NP transport ability across the placental carcinoma JEG-3 monolayer was assessed by quantifying IVM in the apical and basolateral side media using HPLC.
  • JEG-3 cells were plated in a trans-well plate on the apical side. On the basolateral side, media was added and the cells were grown up to 9 days. Before the addition of IVM or NPs, the monolayer integrity was checked by measuring the TEER indicating a value of >900 W/cm2 on day 9 ( Figure 9A). Media was replenished once every two days. On the ninth day, IVM, NT-OH-IVM- NP, or T-Fc-IVM-NP was added to the apical side of the barrier and incubated for 12 h. The TEER values and tight junction protein, ZO-1 expression confirmed that the addition of the articles did not damage the placental barrier ( Figures 9A and 9C).
  • IVM alone was able to cross the membrane significantly compared to the T-Fc-IVM-NPs and the NT-OH-IVMNPs ( Figure 9C).
  • NPs can be useful for the treatment pregnant patient without affecting the infant.
  • Cellular toxicity of IVM was compared with T-Fc-IVMNP in JEG-3 cells by studying basal respiration, maximal respiration, ATP production, extra cellular acidification. These studies indicated that at the same concentration, IVM completely disrupts cellular respiration of the cells which form the placental barrier while when ivermectin is loaded into T-Fc-NPs, it doesn’t show such toxicity (Figure 9D).
  • Example 9 Ivermectin Nanoformulation Has the Ability to Reduce ACE2 and Spike Protein Expression.
  • IVM-loaded PLGA-b-PEG-MAL nanoparticles were synthesized by following a nanoprecipitation method.
  • the nanoparticles were characterized using dynamic light scattering (DLS), and were found to have sizes around 60-70 nm and zeta potential around -30 mV for nanoparticles with 20% feed of IVM ( Figure 33).
  • IVM loading was quantified using HPLC ( Figure 33).
  • Fc immunoglobulin fragment targeting moiety was attached using thiolene chemistry, creating the targeted T-Fc-IVM-NPs. Conjugation of the Fc fragment was confirmed and quantified through a bicinchoninic acid (BCA) assay.
  • BCA bicinchoninic acid
  • SARS-CoV-2 is a positive sense single-stranded RNA virus and one of the most crucial components of its structure is the surface spike protein that al-lows it to enter and infect cells.
  • a logical method to model the conditions of viral infection in vitro and study the expression of the spike protein is to transfect cells using a plasmid expressing spike protein. This would mimic infectious conditions and allow for measurements of NP-delivered IVM’s ability to inhibit viral spike protein without requiring the construction of pseudoviruses or other technologies.
  • Spike protein of SARS-CoV- 2 interacts with ACE2 receptors on human cells, thereby infecting the host.
  • HEK293T human embryonic kidney epithelial cells were transfected with a plasmid containing the SARS-CoV-2 viral spike protein. These cells were subsequently treated with IVM, a non- targeted IVM-loaded nanoparticle, NT-IVM-NP, made from an PLGA-b-PEG-OH polymer, and the T-Fc-IVM-NPs. Treatments were with 10 mM of free IVM or the nanoformulations with respect to IVM for a period of 4 h followed by incubation for 20 h.
  • IVM nanoformulations showed significantly higher accumulation in the blood. These studies together suggest the superior ability of IVM nanoparticle to reduce spike and ACE2 compared to free IVM. Our studies also revealed that the HEK293T cells have low basal ACE2 expression.
  • NT-IVM-NP also decreased ACE2 mRNA expression, but this decrease was less as compare to T-IVM-NP.
  • SARS-CoV-2 spike protein binds to the ACE2 receptor on host cells and initiates a cascade of steps for cell fusion and viral uptake into the host cells.
  • Our results indicate that the T-IVM-NP might inhibit viral uptake or entry to the host cells by inhibiting spike and ACE2 expression.
  • EK1C4 a lipopeptide, targeting spike protein inhibited SARS-CoV-2 membrane fusion and viral entry into the host cells.
  • T-Fc-IVM-NP T-Fc-IVM-NP in two other ACE2-expressing epithelial cell lines, A549 adenocarcinomic alveolar basal epithelial cells and HeLa malignant epithelial cells, was also assessed to study the potential impact of the therapeutic on ACE2 and spike protein expression in lung cells and other epithelia that may be infected by SARS-CoV-2.
  • ACE2 expression was found to decrease after treatment with IVM and the IVM nanoformulations, and the largest decrease in expression was seen after treatment with the IVM-loaded nanoparticles (Figure 28A, Figure 39A for quantification).
  • the A549 cells were treated with increasing doses of T-Fc-IVM-NPs, and the western blot revealed a dose-dependent effect of the nanoformulation on ACE2 expression (Figure 28B, Figure 39B for quantification).
  • treatment with T-Fc-IVM-NP showed a de-crease in the expression of both spike protein and ACE2, and the more evident decrease appeared to be in cells treated with the nanoparticles rather than free IVM ( Figure 28C and Figure 39C for quantification).
  • immunofluorescence staining in A549 cells revealed a drop in expression of ACE2 following treatment with IVM, NT-IVM-NPs, and T-Fc-IVM-NPs ( Figure 28D).
  • Example 10 Pseudo-virus Inhibition Study.
  • Fluorescent green surface ACE2-expressing HEK293T cells were treated using two different approaches, a therapeutic approach and a preventative approach, which varied in terms of the order of T-Fc-IVM-NP treatments and the Pseudo SARS-CoV-2 exposure (Figure 29A).
  • the therapeutic approach in which cells were exposed to pseudo SARS-CoV-2 followed by T-Fc-IVM-NP treatment, resulted in significant decreases in the levels of both ACE2 and pseudovirus ( Figure 29B).
  • the preventative approach in which T-Fc-IVM-NP treatment preceded pseudovirus exposure with the goal of preventing uptake, there were decreases in both ACE2 express expression and pseudovirus uptake (Figure 29C).
  • Example 11 A Potential Mechanism of Action of T-Fc-IVM-NP [000162] Though the specific mechanism by which the re-leased IVM could inhibit the replication of the SARS-CoV-2 virus and expression of spike protein is yet to be determined, a possibility could be through the inhibition of the nuclear transport activities mediated through proteins such as importin (IMP) a/b1 heterodimer, as IVM was previously shown to inhibit a similar interaction between IMRa/b1 ( Figure 31 A) and the human immunodeficiency virus-1 (HIV-1) integrase protein.
  • IMP a/b1 heterodimer is a key nuclear transport protein and is believed to play a role in transporting viral proteins to the nucleus of infected cells.
  • IMP a and b1 work through the recognition of nuclear localization signals on proteins, and IMP a and b1 have previously been associated with the nuclear transport of other viral proteins such as HIV-1 integrase and dengue virus non-structural protein 5 (NS5).
  • IMP a and b1 transport of viral proteins to the nucleus allows proteins such as dengue virus’ NS5 protein to diminish cells’ antiviral responses by impacting mRNA splicing and immune signaling. Therefore, investigating the IVM-loaded nanoparticle’s potential inhibitory effect on IMP a and b1 is key to fully characterizing the therapeutic’s antiviral properties.
  • Example 12 Mitochondrial Functions and Inflammation of Spike-infected Cells and Effects of T-Fc-IVM-NP
  • SARS-CoV-2 has been found to impact host mitochondrial functions through ACE2 regulation and open-reading frames that can allow for increased viral replication and evasion of host cell immunity.23
  • the mitochondrial effects of spike protein expression and the mitochondrial toxicity of treatment using IVM and its nanoformulations was tested using a Mitostress assay in HEK293T cells transfect-ed with spike plasmid. Initially, spike protein ex pression within the HEK293T cells was found to slightly impact mitochondrial bioenergetics through the decrease of basal and maximum respiration as well as ATP production (Figure 33). This effect was further compounded by treatment with free IVM, which more significantly decreased these three metrics and led to further mitochondrial dysfunction.
  • the T-Fc-IVM-NPs serve as a far more helpful treatment compared to free IVM by not impeding mitochondrial respiration or causing inflammation, and the IVM-loaded nanoparticles in fact allow for treated cells to regain some respiration and ATP production capacity that was initially lowered by spike protein expression and the infection in general.
  • Solubility was achieved by preparing nano-ivermectin vesicles following an optimized reprecipitation method, wherein the drug was dissolved in a good solvent (ethanol) at millimolar concentration and its ethanolic solution (in small increments) was added to a poor solvent (water) to allow the precipitation of the nanovesicles.
  • the synthesis was assisted with ultrasound (ultrasonication bath) for a better size-control of the nanomaterials, that was achieved by the action of acoustic cavitations to promote intermolecular interactions.
  • the disclosed nanovesicles were analyzed using materials characterization techniques, optical properties, in addition to the release studies at the physiological pH.
  • nanovesicles are based on a spontaneous self-assembly mechanism that is governed in this case by hydrophobic and hydrogen bonding interactions.
  • the formation of nanovesicles is represented in Figure 41 C; the self-assembly of ivermectin amphiphilic molecules into nanovesicles is demonstrated under aqueous conditions, to overcome the undesirable hydrophobe-water interactions.
  • the self-assembly mechanism has been applied to produce various nanodrugs, only restricted in majority to the domain of anticancer application.
  • the procedure is different and unique, where the mechanism relates to the organization of a double-tailed surfactant under aqueous conditions contributing to the formation of nanovesicles-based drugs.
  • the disclosed nanoparticle has a hydrophilic head of the structure that faces the aqueous medium while the hydrophobic part is directed towards the interior of the vesicle, where a small volume of water/ethanol is contained.
  • the thickness of the shell is mainly determined by the interfacial tension, showing the following dimensions: total size of the shell, 133 nm; the dark interior shell, 27 nm ( Figure 41 C).
  • Zeta potential measurements were conducted to determine the electrostatic surface potential and evaluate the stability of the nanosuspensions.
  • Zeta potential (CE5) value was -24 mV (average zeta potential values of duplicate syntheses, 3 records per synthesis) with pH of the medium being 7.35.
  • the synthesized nanovesicles present an acceptable stability and exhibit minimal level of agglomeration considering that the zeta potential value is close to the limit value (-30 mV) that is globally accepted as the normal value reflecting the stability of nanosuspensions.
  • the presence of this high surface charge contributes to an electrostatic repulsion among the vesicles and causes a decrease in the level of agglomeration.
  • Ivermectin vesicles might have redistributed and stabilized after a sufficient time of growth or aging. Zeta potential measurements studies were also performed on ivermectin nanosuspensions prepared using different volumes of ethanolic solutions ( Figure 42B). The nanosuspensions formulated with 50 mI_ and 100 mI_ (zeta potential magnitude higher or equal to 30 mV) were more stable than the nanosuspension formulated with 150 mI_ volume. In fact, the nanosuspensions generated with 100 mI_ had the most constant response during the growth of nanoparticles, which indicates that the use of this volume is optimal for the formulation of long term-stored suspensions.
  • the evaluation of the surface charge of these nanovesicles reflects the optimal interaction of nanomaterials with the biological target, as well as the bioavailability of these materials.
  • the pH stability of these nanoformulations was also performed by resuspending the aqueous suspension of nanovesicles in different pH buffers ( Figures 42C and 42D).
  • the effect of pH on the nanoformulations in terms of size and stability is dictated by two factors: the first is the pKa of ivermectin molecule (pka value is around 6.5) and the second is the presence of ions that originate from the buffers.
  • the pka of ivermectin had its heavy effect on the size of nanomaterials that showed a tremendous increase in size after adding phosphate buffers of pH 7 and 7.8.
  • the presence of ions caused a drop in zeta potential values by almost 15 mV magnitude, especially when using buffers of pHs 5 and 7.
  • the distinctive effect of those two buffers is that pH 5 buffer is an acetate buffer where the acetate ions might have some hydrogen bonding interactions with ivermectin molecules, leading to an increase in size and decrease of zeta potential magnitude.
  • the pH 7 phosphate buffer which caused the noticeable changes in size and zeta potential values, has a pH that is slightly higher than the pka value of ivermectin.
  • the ivermectin molecule exists in its ionic form and its solubility in aqueous system increases.
  • an uncontrolled precipitation and unstable formulation were observed as a result of the pH increase during the suspension of the nanomaterials in the buffer.
  • the long-term storage of the nanovesicles was also assessed after two months at 25°C from their preparation in aqueous medium, which is important for the potential use of this compound as a pharmaceutical product.
  • the fabricated nanovesicles have shown a long-shelf life (at least 2 months, (84 nm size)) and a high colloidal stability (-32 mV), an advantage that was observed in difference to what conventional liposomes present.
  • Nanomaterials usually exhibit optical properties that lie between atomic and bulk properties.31 Their properties different from their bulk counterpart as a result of the inter- and intra-molecular interactions that contribute to the formation of the nanomaterials. It is informative to understand the changes of optical properties for nano-ivermectin and the type of molecular arrangement that controlled the formation of nanovesicles. For this purpose, nano ivermectin suspensions were synthesized in duplicate under aqueous conditions using the reprecipitation method, then left to age for 24 hours (Figure 43A).
  • the bulk of ivermectin was prepared following a similar procedure in ethanol, and both bulk and nano-ivermectin were compared at the same concentration.
  • the conjugated-diene chromophore of ivermectin has an absorbance maximum at 245 nm.32
  • Both nanosuspensions were consistent in terms of optical properties, with absorbance ranging between 220 and 260 nm.
  • the nanosuspensions showed a decrease in the molar absorptivity in comparison to the bulk material, as a result of the presence of intermolecular electronic interactions upon aggregation.
  • the decrease of the cross-section of nano-ivermectin exposed to the light can also contribute to the decrease in absorbance value.
  • nanosuspensions presented more defined shoulders in the absorbance spectra, suggesting the presence of multiple excited states.
  • Our previous studies have shown size stability of nano-ivermectin suspensions (for 100 -, pL ethanolic ivermectin formulations) at various aging periods (or growth time) ( Figures 42A and 42B).
  • the optical measurements confirmed the stability as well of the nanosuspensions, that were synthesized and left to age for 24, 48, and 72 hours (Figure 43B).
  • the properties of the nanosuspensions were similar indicating consistency in the synthesis method (same average size of 80 nm) and stability of the suspensions over time.
  • the nanosuspensions were synthesized in duplicate using the optimized reprecipitation method, with an amount of 100 -, pL of 1 mM ivermectin drug. After 24 hours, the nanomaterials were suspended in PBS and dialyzed against PBS buffer pH 7.4. Nano-ivermectin showed first a burst release of 20% of its molecules or entities, suggesting that those molecules were not strongly bound to the assembled nanoscale aggregates.
  • the nanovesicles kept then a slower and sustainable release for a long period of time, about 220 hours.
  • the general profile of the release/degradation rate implies a maintained efficacy of nano-ivermectin for several days. This is advantageous because it reflects a controlled release of the therapeutic agents under physiological conditions.
  • the examples herein demonstrate that a synthetic nanoparticle can cross the intestinal epithelial barrier when administered via oral route and distribute in the blood at a considerable concentration. It is further disclosed that the plasma concentration of ivermectin can be increased significantly when delivered with this synthetic nanoparticle. Further, the toxicity of ivermectin on epithelial cells can be lowered by entrapment inside the polymeric nanoparticles. The examples demonstrate that Ivermectin-loaded NPs demonstrated stability over time, particularly at 4°C and even at room temperature.
  • NT-Mal-IVMNP when combined with cryoprotectant such as sucrose or trehalose in higher concentrations, showed maintenance of both size and zeta potential across multiple freeze-thaw cycles and over several months at -80°C.
  • cryoprotectant such as sucrose or trehalose in higher concentrations

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nanotechnology (AREA)
  • Epidemiology (AREA)
  • Optics & Photonics (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)

Abstract

La présente invention concerne de manière générale des nanoparticules administrables par voie orale pour le traitement et la prévention d'une infection virale, en particulier des infections par ZIKA et les coronavirus. L'invention concerne également des procédés d'utilisation des nanoparticules pouvant être administrées par voie orale pour traiter et prévenir une maladie virale.
PCT/US2020/051061 2019-09-16 2020-09-16 Nano-médicament administrable par voie orale pour maladies virales WO2021055467A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962901077P 2019-09-16 2019-09-16
US62/901,077 2019-09-16

Publications (1)

Publication Number Publication Date
WO2021055467A1 true WO2021055467A1 (fr) 2021-03-25

Family

ID=74884330

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/051061 WO2021055467A1 (fr) 2019-09-16 2020-09-16 Nano-médicament administrable par voie orale pour maladies virales

Country Status (1)

Country Link
WO (1) WO2021055467A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022129417A1 (fr) * 2020-12-16 2022-06-23 Medincell Méthodes et compositions pour le traitement prophylactique du virus sars-cov-2 (covid-19)
WO2022217966A1 (fr) * 2021-04-15 2022-10-20 苏州大学 Agent de nano-piégeage inhibant le sars-cov -2
WO2023283106A1 (fr) * 2021-07-07 2023-01-12 Codagenix Inc. Variants du sars-cov-2 désoptimisés et leurs méthodes d'utilisation
EP3989981A4 (fr) * 2020-02-07 2023-12-27 Topelia Australia Pty Ltd Produits manufacturés et méthodes de traitement, d'amélioration ou de prévention d'une infection à coronavirus

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100303723A1 (en) * 2006-11-20 2010-12-02 Massachusetts Institute Of Technology Drug delivery systems using fc fragments
WO2017075369A1 (fr) * 2015-10-30 2017-05-04 Pfizer Inc. Nanoparticules thérapeutiques comprenant un agent thérapeutique, et leurs méthodes de production et d'utilisation

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100303723A1 (en) * 2006-11-20 2010-12-02 Massachusetts Institute Of Technology Drug delivery systems using fc fragments
WO2017075369A1 (fr) * 2015-10-30 2017-05-04 Pfizer Inc. Nanoparticules thérapeutiques comprenant un agent thérapeutique, et leurs méthodes de production et d'utilisation

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3989981A4 (fr) * 2020-02-07 2023-12-27 Topelia Australia Pty Ltd Produits manufacturés et méthodes de traitement, d'amélioration ou de prévention d'une infection à coronavirus
WO2022129417A1 (fr) * 2020-12-16 2022-06-23 Medincell Méthodes et compositions pour le traitement prophylactique du virus sars-cov-2 (covid-19)
WO2022217966A1 (fr) * 2021-04-15 2022-10-20 苏州大学 Agent de nano-piégeage inhibant le sars-cov -2
WO2023283106A1 (fr) * 2021-07-07 2023-01-12 Codagenix Inc. Variants du sars-cov-2 désoptimisés et leurs méthodes d'utilisation

Similar Documents

Publication Publication Date Title
Verma et al. Vitamin B12 functionalized layer by layer calcium phosphate nanoparticles: A mucoadhesive and pH responsive carrier for improved oral delivery of insulin
Yang et al. Recent advances in the application of vitamin E TPGS for drug delivery
WO2021055467A1 (fr) Nano-médicament administrable par voie orale pour maladies virales
Wang et al. Low-molecular-weight protamine-modified PLGA nanoparticles for overcoming drug-resistant breast cancer
Yuan et al. Stearic acid-g-chitosan polymeric micelle for oral drug delivery: in vitro transport and in vivo absorption
JP5539993B2 (ja) 薬物送達のためのナノ担体
Li et al. Bioinspired peptosomes with programmed stimuli-responses for sequential drug release and high-performance anticancer therapy
Zhou et al. Redox-triggered activation of nanocarriers for mitochondria-targeting cancer chemotherapy
Wang et al. Surface-modified nanoerythrocyte loading DOX for targeted liver cancer chemotherapy
Ding et al. Dual-functional bio-derived nanoparticulates for apoptotic antitumor therapy
Bian et al. Awakening p53 in vivo by D-peptides-functionalized ultra-small nanoparticles: Overcoming biological barriers to D-peptide drug delivery
Zayed et al. Combining hydrophilic chemotherapy and hydrophobic phytotherapy via tumor-targeted albumin–QDs nano-hybrids: covalent coupling and phospholipid complexation approaches
Liu et al. Hierarchically stimuli-responsive nanovectors for improved tumor penetration and programed tumor therapy
BRPI0715299A2 (pt) mÉtodo para preparar nanoparticulas polimÉricas, mÉtodod para preparar uma coposiÇço micelar, micelas polimÉricas reconstituÍveis, composiÇço polimÉrica bioativa de nanopartÍculas, mÉtodo para proporcionar um medicamento a um paciente e processo para preparar composiÇÕes de nanoparticulas polimÉricas
Shukla et al. Multifunctional hybrid nanoconstructs facilitate intracellular localization of doxorubicin and genistein to enhance apoptotic and anti-angiogenic efficacy in breast adenocarcinoma
Yim et al. A self-assembled polymeric micellar immunomodulator for cancer treatment based on cationic amphiphilic polymers
Duan et al. Vincristine-loaded and sgc8-modified liposome as a potential targeted drug delivery system for treating acute lymphoblastic leukemia
Wang et al. Glutathione detonated and pH responsive nano-clusters of Au nanorods with a high dose of DOX for treatment of multidrug resistant cancer
Xu et al. Active-targeting and acid-sensitive pluronic prodrug micelles for efficiently overcoming MDR in breast cancer
JP7164205B2 (ja) キナ酸修飾ナノ粒子およびその使用
KR20180120220A (ko) 난소암을 특이적으로 표적하는 생분해성 양친성 폴리머, 이로부터 제조된 폴리머 배시클 및 용도
Zhang et al. Dual-responsive doxorubicin-loaded nanomicelles for enhanced cancer therapy
Sun et al. High loading of hydrophobic and hydrophilic agents via small immunostimulatory carrier for enhanced tumor penetration and combinational therapy
Zhou et al. Alternative and injectable preformed albumin-bound anticancer drug delivery system for anticancer and antimetastasis treatment
Song et al. Erythrocyte-biomimetic nanosystems to improve antitumor effects of paclitaxel on epithelial cancers

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20866532

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20866532

Country of ref document: EP

Kind code of ref document: A1