WO2021045501A1 - Il-2 표면 발현 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 조성물 - Google Patents

Il-2 표면 발현 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2021045501A1
WO2021045501A1 PCT/KR2020/011774 KR2020011774W WO2021045501A1 WO 2021045501 A1 WO2021045501 A1 WO 2021045501A1 KR 2020011774 W KR2020011774 W KR 2020011774W WO 2021045501 A1 WO2021045501 A1 WO 2021045501A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
extracellular vesicles
cells
sev
receptor
Prior art date
Application number
PCT/KR2020/011774
Other languages
English (en)
French (fr)
Inventor
백문창
정도경
예경무
Original Assignee
경북대학교 산학협력단
재단법인대구경북과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020200094583A external-priority patent/KR102521664B1/ko
Application filed by 경북대학교 산학협력단, 재단법인대구경북과학기술원 filed Critical 경북대학교 산학협력단
Priority to CN202080052323.9A priority Critical patent/CN114173807B/zh
Priority to US17/621,234 priority patent/US20220409741A1/en
Priority to EP20861461.0A priority patent/EP3973969A4/en
Publication of WO2021045501A1 publication Critical patent/WO2021045501A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6911—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/475—Quinolines; Isoquinolines having an indole ring, e.g. yohimbine, reserpine, strychnine, vinblastine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/513—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim having oxo groups directly attached to the heterocyclic ring, e.g. cytosine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/24—Heavy metals; Compounds thereof
    • A61K33/243—Platinum; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/12—Cyclic peptides, e.g. bacitracins; Polymyxins; Gramicidins S, C; Tyrocidins A, B or C
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A61K38/2013—IL-2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/46—Ingredients of undetermined constitution or reaction products thereof, e.g. skin, bone, milk, cotton fibre, eggshell, oxgall or plant extracts
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/642—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a cytokine, e.g. IL2, chemokine, growth factors or interferons being the inactive part of the conjugate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/6425—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a receptor, e.g. CD4, a cell surface antigen, i.e. not a peptide ligand targeting the antigen, or a cell surface determinant, i.e. a part of the surface of a cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/65—Peptidic linkers, binders or spacers, e.g. peptidic enzyme-labile linkers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6901—Conjugates being cells, cell fragments, viruses, ghosts, red blood cells or viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/5005—Wall or coating material
    • A61K9/5063—Compounds of unknown constitution, e.g. material from plants or animals
    • A61K9/5068—Cell membranes or bacterial membranes enclosing drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/55—IL-2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment

Definitions

  • the present invention relates to a composition for preventing or treating cancer diseases comprising the extracellular vesicles on which IL-2 is surface-expressed as an active ingredient.
  • Small extracellular vesicles are small vesicles with a membrane structure secreted by most cells.
  • the diameter of sEV is approximately 30-100 nm, and various kinds of proteins, genetic materials (DNA, RNA, miRNA), and lipids derived from the cell are contained in the sEV.
  • sEV does not come off directly from the plasma membrane, but originates in specific compartments within the cell called multivesicular bodies (MVBs), and is released and secreted out of the cell. In other words, when the fusion of the polycystic body and the plasma membrane occurs, the vesicles are released into the extracellular environment, which is called sEV.
  • MVBs multivesicular bodies
  • cancer is a product of uncontrolled and disordered cell proliferation caused by an excess of abnormal cells, and from a molecular biology point of view, it can be said to be a disease caused by mutations in genes.
  • the types of cancer ranged to dozens of cancers as they have been discovered so far, and they are mainly classified according to the location of the affected tissue. Cancer is classified into benign tumors and malignant tumors. Benign tumors have a relatively slow growth rate and do not undergo metastasis moving from the original site of the tumor to other tissues, whereas malignant tumors leave the primary part and infiltrate into other tissues rapidly. It has a growing trait and is life-threatening. Most cancers initially have no symptoms, and even if there are symptoms, they are mild, so most people tend to overlook them, which is the cause of increasing cancer mortality.
  • the development of a multi-functional immune sEV in which useful cytokines are expressed from immune cells using cytokines specific for cancer treatment has the advantage of maximizing cancer prevention and treatment efficacy.
  • An object of the present invention is to provide an extracellular vesicle in which cytokines are expressed on the surface.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer diseases comprising the extracellular vesicles as an active ingredient.
  • Another object of the present invention is to provide a pharmaceutical composition for combined administration of an anticancer agent comprising the extracellular vesicles as an active ingredient.
  • Another object of the present invention is to provide a composition for delivery of drugs or physiologically active substances.
  • the present invention is a cytokine; Linker; And a transmembrane protein; it provides an extracellular vesicle fused thereto.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer diseases comprising the extracellular vesicles as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer diseases comprising the extracellular vesicles and anticancer agents as active ingredients.
  • the present invention includes at least one of a drug or a physiologically active substance, and a cytokine; Linker; And a transmembrane protein; comprising the fused extracellular vesicle, wherein the drug or physiologically active material is encapsulated in the extracellular vesicle lipid layer.
  • a lentiviral vector containing a cytokine-linker-PDGF receptor transmembrane domain an immune cell expressing a useful cytokine on the cell surface, and a cell derived from the immune cell and expressing a useful cytokine on the surface
  • Extracellular vesicles preferably small extracellular vesicles (sEV)
  • sEV extracellular vesicles
  • the extracellular endoplasmic reticulum having the same effect can be usefully used as a pharmaceutical composition for preventing or treating cancer diseases, a pharmaceutical composition for concurrent administration of an anticancer agent, a composition for delivering a drug or a physiologically active substance, and the like.
  • FIG. 1 is a diagram showing the construction of a lentiviral vector consisting of a cytokine-linker-PDGF receptor transmembrane domain and a method for preparing multi-functional immune small extracellular vesicles (sEV).
  • sEV IL-2 sEV IL-2
  • FIG. 4 shows an image obtained by using a transmission electron microscope of sEV IL-2 using an immunogold labeling method.
  • 11 is a result of confirming apoptosis of melanoma in co-culture of cytotoxic T cells and melanoma cells treated with sEV IL-2.
  • the MBC (membrane bound cytokine) platform consists of "the transmembrane domain of the cytokine-linker-PDGF (platelet-derived growth factor) receptor".
  • the cytokine is linked to the transmembrane domain of the PDGF receptor through a flexible linker, and is expressed in a form attached to the cell membrane without being secreted outside the cell upon expression.
  • the MBC platform is applied to the immune cells to produce immune cells expressing specific cytokines on the surface of cell membranes, and at the same time, sEV derived from immune cells expressing specific cytokines on the surface, referred to as an avatar thereof ( small extracellular vesicles)" was produced and its efficacy was evaluated.
  • the present invention is a cytokine; Linker; And a transmembrane protein; it provides extracellular vesicles fused thereto.
  • the cytokine is exposed to the surface of the extracellular vesicle by binding to a linker connected to a transmembrane protein penetrating the lipid layer of the extracellular vesicle.
  • the extracellular vesicles are cytokines; Linker; And a transmembrane domain; can be secreted from cells transfected with a viral vector.
  • cytokine may be IL-2, but is not limited thereto.
  • the linker is of the general formula (GGGGS)n, (SGGGG)n, (SRSSG)n, (SGSSC)n, (GKSSGSGSESKS)n, (RPPPPC)n, (SSPPPPC)n, (GSTSGSGKSSEGKG)n, (GSTSGSGKSSEGSGSTKG)n, It consists of an amino acid sequence represented by (GSTSGSGKPGSGEGSTKG)n, or (EGKSSGSGSESKEF)n, wherein n may be an integer of 1 to 20.
  • the transmembrane domain is epidermal growth factor receptor, insulin receptor, platelet-derived growth factor (PDGF) receptor, vascular endothelial growth factor receptor, fibroblast growth factor receptor, cholecystokinin (CCK) receptor, neurotrophic factor (Neurotrophic factor; NGF) receptor, hepatocyte growth factor (HGF) receptor, ephrin (Eph) receptor, angiopoietin receptor, and RTK (Related to receptor tyrosine kinase) receptor. It should be noted that it may be a transmembrane domain of one or more receptors, but is not limited thereto.
  • the cell is a T cell, and more specifically, may be a helper T cell, but is not limited thereto.
  • the extracellular endoplasmic reticulum can increase the anticancer effect by increasing the proliferation and activity of cytotoxic T cells.
  • the extracellular vesicles are small extracellular vesicles (sEV) having a diameter of 30 to 100 nm, and may include exosomes, microvesicles, etc., but are not limited thereto. do.
  • sEV small extracellular vesicles
  • the present invention provides a pharmaceutical composition for preventing or treating cancer diseases comprising the extracellular vesicles as an active ingredient.
  • the cancer diseases include melanoma, colon cancer, lung cancer, skin cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, head or neck cancer, uterine cancer, ovarian cancer, rectal cancer, gastric cancer, muscle cancer of the anus, breast cancer, fallopian tube carcinoma, endometrial carcinoma.
  • Cervical carcinoma vaginal carcinoma, vulvar carcinoma, Hawkins' disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, It may be selected from the group consisting of bladder cancer, kidney or ureter cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma and pituitary adenoma, but is not limited thereto. do.
  • composition may be administered in combination with an anticancer agent or an antibody, but is not limited thereto.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer diseases comprising the extracellular vesicles and an anticancer agent as an active ingredient, that is, a pharmaceutical composition for administration in combination with an anticancer agent for preventing or treating cancer diseases.
  • the anticancer agents cisplain, vinblastine, vincristine, actinomycin-D, 5-fluouracil, docetaxel, cabazitaxel (cabazitaxel), paclitaxel (paclitaxel), and pembrolizumab may be one or more selected from the group consisting of, but is not limited thereto.
  • the pharmaceutical composition may be administered in combination with the anticancer agent to increase the therapeutic effect on cancer diseases.
  • the pharmaceutical composition of the present invention may contain a pharmaceutically acceptable carrier, excipient, or diluent in addition to the above-described active ingredients.
  • a pharmaceutically acceptable carrier examples include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oils.
  • compositions of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injectable solutions according to a conventional method .
  • oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc.
  • external preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc.
  • external preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc.
  • external preparations such as fillers, weight agents, binders, wetting agents, disintegrants, and surfactants that are commonly used.
  • Solid preparations for oral administration include, but are not limited to, tablets, pills, powders,
  • Such a solid preparation may be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc. in addition to the active ingredient.
  • excipients for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc.
  • lubricants such as magnesium stearate and talc may also be used.
  • It can be prepared by adding various excipients, such as wetting agents, sweetening agents, fragrances, preservatives, and the like, in addition to liquids and liquid paraffins for oral use.
  • Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, and tasks.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like may be used.
  • a base for suppositories witepsol, macrosol, Tween 61, cacao butter, laurin paper, glycerogelatin, and the like can be used.
  • a suitable dosage of the pharmaceutical composition of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the form of the drug, and the time, but may be appropriately selected by a person skilled in the art.
  • the daily dosage of the composition is preferably It is 0.001 mg/kg to 50 mg/kg, and it can be administered once to several times a day, if necessary.
  • the present invention includes at least one of a drug or a physiologically active substance, and a cytokine; Linker; And a transmembrane protein; comprising the fused extracellular vesicle, wherein the drug or physiologically active material is encapsulated in the extracellular vesicle lipid layer.
  • cytokine may be IL-2, but is not limited thereto.
  • the linker is of the general formula (GGGGS)n, (SGGGG)n, (SRSSG)n, (SGSSC)n, (GKSSGSGSESKS)n, (RPPPPC)n, (SSPPPPC)n, (GSTSGSGKSSEGKG)n, (GSTSGSGKSSEGSGSTKG)n, It consists of an amino acid sequence represented by (GSTSGSGKPGSGEGSTKG)n, or (EGKSSGSGSESKEF)n, wherein n may be an integer of 1 to 20.
  • the transmembrane domain is epidermal growth factor receptor, insulin receptor, platelet-derived growth factor (PDGF) receptor, vascular endothelial growth factor receptor, fibroblast growth factor receptor, cholecystokinin (CCK) receptor, neurotrophic factor (Neurotrophic factor; NGF) receptor, hepatocyte growth factor (HGF) receptor, ephrin (Eph) receptor, angiopoietin receptor, and RTK (Related to receptor tyrosine kinase) receptor. It should be noted that it may be a transmembrane domain of one or more receptors, but is not limited thereto.
  • the drug is selected from the group consisting of anticancer agents, anti-inflammatory analgesics, antibiotics, antibacterial agents, and vaccines, and the physiologically active material may be selected from the group consisting of peptides, proteins, hormones, and genes, but is not limited thereto. .
  • HEK-293FT cells human embryonic kidney
  • B16F10 mouse melanoma
  • B16F10-luc-g5 mouse melanoma
  • DMEM medium Hyclone
  • Jurkat cells human T lymphocytes
  • RPMI 1640 medium Hyclone
  • SK-MEL-28 human melanoma
  • CTLL-2 cells (mouse cytotoxic T lymphocytes) were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum, 1% penicillin and streptomycin, and 20-100 IU/mL of recombinant IL-2 (R&D systems). .
  • a lentiviral vector containing the transmembrane domain of the antibody-linker-PDGF receptor was constructed with reference to the paper (Proc Natl Acad Sci US A. 2013 May 14;110(20):8099-104), which is IL-2- Linker (GSTSGSGKPGSGEGSTKG)-Reconstituted with a lentiviral vector containing the transmembrane domain of the PDGF receptor and cloned.
  • HEK-293FT cells were seeded in 6 well plates at a density of about 1 X 10 6 cells/well, and Lipofectamine® 2000 Reagent (ref. 11668-) in Opti-MEM (ref.31985-070; Gibco) medium. 027; Thermo fisher scientific), a lentiviral vector expressing the IL-2, pCMVD (# PS100001; Origene), and pVSVg (# 1733; Addgene) virus packaging vector in a ratio of 1:1: 1 after treatment Incubated overnight at 37°C. The next day, the supernatant was removed and replaced with a fresh medium to which 10% fetal calf serum was added.
  • the titer of the lentivirus was measured using the Lenti-X p24 rapid titer kit (# 632200; Takara). The lentivirus was aliquoted and frozen at -80°C.
  • Example 3 Transduction into Jurkat cells using lentivirus
  • a lentivirus expressing 10 ⁇ g/mL of polybrene and 500 ⁇ g/mL of IL-2 was added to 0.3 mL RPMI medium and treated with Jurkat cells (1 X 10 6 cells/ml).
  • the lentivirus and cell mixture was centrifuged at 30° C. at 1,200 xg for 90 minutes to perform spinoculation. Thereafter, the cells were cultured overnight at 37° C. with the lentivirus. Excess virus was removed, and fresh medium containing 10% fetal calf serum was added the next day.
  • Example 4 Analysis of IL-2 expression in Jurkat cells using real-time polymerase chain reaction
  • mRNA extraction kit # 9767; TaKaRa
  • concentration of mRNA was measured using a nanodrop (DS-11 Series Spectrophotometer; DeNovix).
  • synthesizing cDNA SuperScript III First-Strand Synthesis System, Ref. 18080-051; invitrogen
  • real-time polymerase chain reaction was performed to obtain IL-2 (Forward: agacccagggacttaatcag, Reverse: acaatggttgctgtctcatc).
  • IL-2 Formal: agacccagggacttaatcag, Reverse: acaatggttgctgtctcatc.
  • Example 5 Analysis of IL-2 expression in Jurkat cells using flow cytometry
  • Jurkat cells transfected with lentivirus were washed once with phosphate buffered saline (PBS) and then fixed with 4% formaldehyde. Thereafter, 1% bovine serum albumin (BSA) and 5% goat serum were added to PBS for 1 hour blocking at 4°C. Next, reacted with anti-Flag antibody (# 8146; CST) for 1 hour at 4°C, washed 3 times with PBS, reacted with FITC-conjugated secondary antibody at 4°C for 1 hour, washed 3 times with PBS, and flow cytometry The analysis was carried out.
  • PBS phosphate buffered saline
  • BSA bovine serum albumin
  • CST anti-Flag antibody
  • Jurkat cells transfected with lentivirus were isolated using a flow cytometer.
  • Control Jukat cells or Jukat cells expressing IL-2 were inoculated at a density of about 2 X 10 6 cells/well, and cultured in RPMI medium to which fetal calf serum was not added for 24 hours. Subsequently, in order to separate sEV or sEV IL-2 , each supernatant obtained from each cell was continuously centrifuged at 300 xg, 2500 xg, and 10,000 xg. Then, the supernatant was filtered through a 0.2 ⁇ m syringe filter and centrifuged at 120,000 xg. The sEV pellet was resuspended in PBS and centrifuged again at 120,000 xg. The purified sEV pellet was resuspended in PBS or 1X cell lysis buffer for the next experiment.
  • Example 7 Analysis of IL-2 expression of sEV using ELISA assay
  • an enzyme-linked immunosorbent assay was performed to determine whether IL-2 was expressed on the sEV surface.
  • an ELISA kit (#550534; BD OptEIATM Reagent Set B) was used to confirm the expression of Flag on the surface of sEV IL-2 isolated from cells. The plate was reacted with an anti-CD63 antibody (ab68418; Abcam) overnight at 4° C. to coat the plate, followed by washing 5 times using a wash buffer.
  • sEV IL-2 fixed with 4% formaldehyde control: sEV derived from Naive Jurkat cells
  • Assay Diluent After reacting with anti-Flag antibody (# 8146; CST) for 1 hour at room temperature, washing was performed 5 times using a wash buffer, and reacted with HRP-conjugated secondary antibody at room temperature for 1 hour, followed by washing 5 times with wash buffer. . Finally, after 10 minutes of color development using TMB, the color development was stopped using a stop solution. Then, the absorbance was measured at 450 nm using a microplate reader.
  • a purified sEV suspended in PBS is placed on a formba carbon-coated nickel grid, blocked using PBS added with 0.5% bovine serum albumin, and then a mouse anti-human that recognizes the Flag. Incubated with monoclonal antibody. Then, the protein A-gold particles (10 nm) were incubated with the conjugated anti-mouse secondary antibody. Then, it was washed 5 times with PBS, 10 times with ddH 2 O, and then counter-stained with 2% uranyl acetate.
  • Example 9 Analysis of sEV derived from melanoma cells using nanoparticle tracking
  • sEV IL-2 purified to melanoma cells (B16F10: 5 X 10 4 cells/ml, SK-MEL-28: 1 X 10 5 cells/ml) at a concentration of 10 ⁇ g/ml and incubating for 72 hours .
  • the size and concentration of sEV derived from the culture supernatant were measured using a Nanosight LM10 (Malvern Instruments) equipped with fast video capture and particle tracking software.
  • Example 10 Melanoma cell-derived sEV analysis using Western blot
  • the expression level of Rab protein involved in sEV secretion and expression was measured by Western blot.
  • the cytoplasm or sEV protein was separated by SDS-PAGE and transferred to a nitrocellulose membrane. Thereafter, incubation with each of the primary antibodies (ab18211; abcam/Rab5, ab50533; abcam/Rab7, ab55667; abcam/Rab 27a, # 4970; Cell signaling/ ⁇ -actin, ab10931; abcam/PD-L1), and HRP Incubated with the conjugated secondary antibody. Images were visualized using Enhanced chemiluminescence (ECL) detection reagent (# 34095; Thermo Scientific, # RPN2209; GE Healthcare) and quantified using ECL Hyper Film (AGFA, Morstel).
  • ECL Enhanced chemiluminescence
  • PD-L1 programmed death ligand 1
  • FIG. 6(A) it was confirmed that the protein expression of PD-L1 was significantly reduced in the two types of melanoma cells treated with sEV IL-2 compared to the control group. This was re-verified through immunostaining as shown in Fig. 6(B).
  • Example 11 Analysis of proliferation of cytotoxic T cells by sEV IL-2
  • IL-2 is known to be the most important factor for proliferation and activity of cytotoxic T cells. Accordingly, in the present invention, in order to analyze the effect of sEV IL-2 on cytotoxic T cells, cell proliferation analysis was performed using the MTS assay (# G3582; Promega).
  • CTLL-2 cells were inoculated into 96 well plates at a density of 5 X 10 3 cells/well and cultured for 24 hours. Thereafter, the culture medium was replaced with a new medium containing 10% FBS and rIL-2 (100 IU/ml), control sEV or sEV IL-2 (10 ⁇ g/ml), and further cultured for 24 hours. Thereafter, MTS reagent was added to each well and incubated at 37° C. for 2 hours, and MTS containing the supernatant of each well was removed, and absorbance was measured at 490 nm using a microplate reader.
  • FBS and rIL-2 100 IU/ml
  • control sEV or sEV IL-2 10 ⁇ g/ml
  • sEV IL-2 increases the number of cytotoxic T cells, which are important for cancer cell death, to increase the immune anticancer efficacy.
  • Example 12 Analysis of cytotoxic T cell activity by sEV IL-2
  • Fig. 9(B) As shown in Fig. 9(B), it was re-verified using a flow cytometer.
  • the expression of the immune checkpoint PD-1 (programmed cell death-1, Forward: agaatcctggagacctcaac, Reverse: atacccactagggcactcat) in cytotoxic T cells treated with sEV IL-2 was confirmed by the same method as above.
  • sEV IL-2 melanoma cells of PD-L1 decreases due to in order to show the anti-cancer effect due to the increased activity of cytotoxic T cells, as shown in FIG. 11 (A), sEV IL- 2 and melanoma cells (B16F10 ) And after co-culturing the cytotoxic T cells together, the survival rate of melanoma cells was confirmed.
  • Melanoma cells (B16F10-luc-g5) having a cell luminescence gene were used, and analyzed using an IVIS spectrum (PerkinElmer).
  • Melanoma cells were inoculated into a 96-well plate at a density of about 5 ⁇ 10 3 cells/well and pretreated with control sEV or sEV IL-2 (5 ⁇ g/mL). After 24 hours of incubation, the cells were cultured with different ratios of CTLL-2 cells (1:1 to 1:10). At the end of the culture, MTS reagent was added to each well and incubated at 37°C for 2 hours. After removing the MTS containing the supernatant of each well, the absorbance was measured at 490 nm using a microplate reader.
  • CTLL-2 cells were inoculated at a density of about 1 ⁇ 10 6 cells/well and pretreated with control sEV or sEV IL-2 (5 ⁇ g/mL). After 24 hours of incubation, the cells were cultured with different ratios of melanoma cells (1:1 to 1:10). At the end of the culture, MTS reagent was added to each well and incubated at 37°C for 2 hours. After removing the MTS containing the supernatant of each well, the absorbance was measured at 490 nm using a microplate reader.
  • Example 14 Cancer Growth Inhibition Analysis of sEV IL-2 in a Melanoma Transplantation Mouse Model
  • B16F10 mouse melanoma cells 5 X 10 5 were injected subcutaneously into the right flank of C57BL/6 mice. After 5 days from the start of the experiment, PBS, rhIL-2 (50,000 IU/mouse), control sEV or sEV IL-2 (20 ⁇ g/mouse) were injected directly into cancer tissues three times a week. Thereafter, cancer tissues (long axis * short axis * 0.52) of mice were measured and compared once every two days using an engineering digital caliper.
  • Example 15 Analysis of the regulation of exosomal PD-L1 expression in blood of sEV IL-2 in a melanoma transplanted mouse model
  • Blood was collected from the mice of the experiment and centrifuged at 550 x g to obtain serum. Thereafter, the supernatant was continuously centrifuged at 300 x g, 2,500 x g, and 10,000 x g. Then, the supernatant was filtered through a 0.2 ⁇ m syringe filter and centrifuged at 120,000 x g. The sEV pellet was resuspended in PBS and centrifuged again at 120,000 x g.
  • Purified sEV pellet was incubated with anti-PD-L1 (ab10931; abcam/PD-L1) antibody overnight, and FITC-conjugated secondary antibody (a11001; invitrogen/goat anti-mouse igg (h+l) cross-adsorbed secondary antibody) alexa fluor 488) and analyzed using an sEV flow cytometer (CytoFlEX/Beckman Coulter).
  • mice B16F10 mouse melanoma cells 5 X 10 5 were injected subcutaneously into the right flank of C57BL/6 mice. 7 days after the start of the experiment twice a week PBS, control sEV (20 ⁇ g / animal), sEV IL-2 (20 ⁇ g / animal), cisplatin (Cisplatin, p4394; Sigma-Aldrich / cis-Diammineplatinum (II) dichloride crystalline), control IgG (be0252; bioxcell/anti-rat IgG2b) and anti-PD-L1 antibody (be0101; bioxcell/anti PD-L1) were injected into mice (sEV IL-2 or control sEV; intratumoal injection, Cisplatin or PBS; intraperitoneal injection) , Anti-PD-L1 or control IgG; intravenous injection). Thereafter, cancer tissues (long axis * short axis * 0.52) of mice were measured and compared once every two days using an engineering digital

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Botany (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Dispersion Chemistry (AREA)
  • Inorganic Chemistry (AREA)
  • Endocrinology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 IL-2 표면 발현 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 조성물에 관한 것으로, 본 발명에서는 사이토카인-링커-PDGF 수용체 막관통 도메인을 포함하는 렌티바이러스 벡터를 이용하여 세포 표면에 유용 사이토카인이 발현된 면역세포, 및 상기 면역세포로부터 유래되며 표면에 유용 사이토카인이 발현된 세포외 소포체, 바람직하게는 작은 세포외 소포체(small extracellular vesicles; sEV)를 제조하였으며, 상기 세포외 소포체가 세포독성 T 세포의 증식 및 활성을 증가시켜 면역 항암 효능을 증대시키는 것을 확인한 바, 상기와 같은 효능을 가지는 세포외 소포체는 암 질환 예방 또는 치료용 약학 조성물, 항암제 병용투여용 약학 조성물, 약물 또는 생리활성물질 전달용 조성물 등으로 유용하게 활용될 수 있다.

Description

IL-2 표면 발현 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 조성물
본 발명은 IL-2가 표면 발현된 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 조성물에 관한 것이다.
작은 세포외 소포체(Small extracellular vesicles; sEV)는 대부분의 세포에서 분비되는 막 구조의 작은 소낭이다. sEV의 직경은 대략 30-100㎚로, sEV 안에는 그 세포에서 유래된 다양한 종류의 단백질, 유전물질(DNA, RNA, miRNA), 지질 등이 포함되어 있다. sEV는 원형질막(plasma membrane)으로부터 직접 떨어져 나가는 것이 아니라 다낭체(multivesicular bodies; MVBs)라고 불리는 세포 내 특정 구획에서 기원하여 세포 밖으로 방출 및 분비된다. 즉, 다낭체와 원형질막의 융합이 일어나면 소낭들은 세포 밖 환경으로 방출되는데 이것을 sEV라고 부른다. sEV가 어떤 기작에 의해 만들어지는지 정확하게 밝혀진 바가 없으나, 정상 상태 및 병적 상태 모두에서 다수의 세포 유형으로부터 분리되어 방출되는 것으로 알려져 있다.
한편, 암은 비정상적인 세포의 과잉으로 인하여 발생하는 비제어적이고 무질서한 세포 증식의 산물로서, 분자생물학적인 관점에서 볼 때 유전자의 변이에 의하여 발생하는 질환이라고 할 수 있다. 암의 종류는 현재까지 밝혀진 것만 해도 수십 종에 이르며 주로 발병 조직의 위치에 따라 구분된다. 암은 양성종양과 악성종양으로 구분되는데, 양성종양은 비교적 성장 속도가 느리고 종양의 원발생 부위에서 다른 조직으로 이동되는 전이가 발생하지 않는 반면, 악성종양은 원발부를 떠나 다른 조직으로 침윤되어 빠르게 성장하는 특성을 가져 생명을 위협한다. 대부분의 암은 초기에 증상이 없으며, 증상이 있다고 하더라도 경미하여 대부분의 사람들이 이를 간과하기 쉽고, 이는 암의 사망률을 높이는 원인이 되고 있다.
암의 치료를 위해서 수술 요법, 화학 요법, 방사선 요법 등이 사용되고 있으나 많은 연구에도 불구하고 암 환자 전체의 50% 이상이 결국 치유되지 못하고 사망하는 것으로 보고된다. 그 이유는 외과적으로 절제를 하였다 하더라도 미세하게 전이된 암세포를 제거하지 못하여 암이 재발하거나, 항암제에 대한 암세포의 사멸이 유도되지 않거나 초기에는 반응을 보여 종양이 줄어드는 듯 보이지만 치료 도중이나 치료가 끝난 후 항암제에 대한 내성이 생긴 암세포들이 급격히 증가하기 때문이다. 오늘날에는 약 60여 종의 다양한 항암제가 사용되고 있으며, 암 발생 및 암세포의 특성에 관한 지식이 많이 알려짐에 따라 새로운 항암제 개발에 관한 연구가 활발하게 진행되고 있다. 그러나 대부분의 항암제는 오심과 구토, 탈모, 피부 및 손톱의 변색, 신경계 부작용 등의 심각한 부작용을 일으키며, 반복적으로 장기간 투여되거나 암이 재발된 경우에는 암세포가 항암제에 대한 내성을 획득함으로써 치료 효과를 상실하는 단점이 있다. 또한, 방사선 요법은 고에너지의 방사선을 암 조직에 조사하여 암세포의 사멸을 유도하나, 암 조직 주변에 있는 정상 조직에게도 손상을 주어 부작용을 발생시키는 단점이 있다.
이에, 암 치료에 특이적인 사이토카인을 이용하여 면역세포로부터 유용 사이토카인이 발현된 다중 기능 면역 sEV의 개발은 암 예방 및 치료 효능을 극대화시킬 수 있는 이점이 있다.
본 발명의 목적은 표면에 사이토카인이 발현된 세포외 소포체를 제공하는 데에 있다.
본 발명의 다른 목적은 상기의 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 약학 조성물을 제공하는 데에 있다.
본 발명의 또 다른 목적은 상기의 세포외 소포체를 유효성분으로 포함하는 항암제 병용 투여용 약학 조성물을 제공하는 데에 있다.
본 발명의 또 다른 목적은 약물 또는 생리활성물질 전달용 조성물을 제공하는 데에 있다.
상기 목적을 달성하기 위하여, 본 발명은 사이토카인; 링커; 및 막관통 단백질;이 융합된 세포외 소포체를 제공한다.
또한, 본 발명은 상기 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 상기 세포외 소포체 및 항암제를 유효성분으로 포함하는 암 질환 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 약물 또는 생리활성물질 중 하나 이상과, 사이토카인; 링커; 및 막관통 단백질;이 융합된 세포외 소포체를 포함하며, 상기 약물 또는 생리활성물질은 상기 세포외 소포체 지질층 내에 봉입된 것을 특징으로 하는 약물 또는 생리활성물질 전달용 조성물을 제공한다.
본 발명에서는 사이토카인-링커-PDGF 수용체 막관통 도메인을 포함하는 렌티바이러스 벡터를 이용하여 세포 표면에 유용 사이토카인이 발현된 면역세포, 및 상기 면역세포로부터 유래되며 표면에 유용 사이토카인이 발현된 세포외 소포체, 바람직하게는 작은 크기의 세포외 소포체(Small extracellular vesicles; sEV)를 제조하였으며, 상기 세포외 소포체가 세포독성 T 세포의 증식 및 활성을 증가시켜 면역 항암 효능을 증대시키는 것을 확인한 바, 상기와 같은 효능을 가지는 세포외 소포체는 암 질환 예방 또는 치료용 약학 조성물, 항암제 병용투여용 약학 조성물, 약물 또는 생리활성물질 전달용 조성물 등으로 유용하게 활용될 수 있다.
도 1은 사이토카인-링커-PDGF 수용체 막관통 도메인으로 이루어진 렌티바이러스 벡터의 구성 및 다중 기능 면역 sEV(small extracellular vesicles)의 제조방법을 도시하여 나타낸 것이다.
도 2는 IL-2가 표면 발현된 Jurkat 세포에서 실시간 중합효소 연쇄반응 및 유세포 분석을 수행하여 IL-2의 발현 수준을 확인한 결과이다.
도 3은 IL-2가 표면 발현된 Jurkat 세포 유래 sEV(sEVIL-2)에서 웨스턴 블랏 및 ELISA 분석을 수행하여 IL-2의 발현 수준을 확인한 결과이다.
도 4는 sEVIL-2를 면역금표지법을 이용하여 투과 전자현미경으로 획득한 이미지를 나타낸 것이다.
도 5는 흑색종 세포에서 sEVIL-2에 의한 sEV 수 및 Rab 27a의 발현 감소를 확인한 결과이다.
도 6은 흑색종 세포에서 sEVIL-2에 의한 PD-L1의 발현 감소를 확인한 결과이다.
도 7은 흑색종 세포에서 sEVIL-2에 의한 exosomal PD-L1의 발현 감소를 확인한 결과이다.
도 8은 세포독성 T 세포에서 sEVIL-2에 의한 세포 증식을 확인한 결과이다.
도 9는 세포독성 T 세포에서 sEVIL-2에 의한 T 세포 활성을 확인한 결과이다.
도 10은 세포독성 T 세포에서 sEVIL-2에 의한 PD-1 발현 감소를 확인한 결과이다.
도 11은 세포독성 T 세포와 sEVIL-2로 처리된 흑색종 세포의 공동 배양에서 흑색종의 세포사멸을 확인한 결과이다.
도 12는 흑색종 이식 마우스 모델에서 sEVIL-2의 항암 효과를 확인한 결과이다.
도 13은 흑색종 이식 마우스에서 sEVIL-2에 의한 암세포 유래 exosomal PD-L1의 억제 효과를 확인한 결과이다.
도 14은 흑색종 이식 마우스 모델에서 sEVIL-2와 시스플라틴(cisplatin) 또는 항 PD-L1 항체와 병용 요법을 이용한 항암 효과를 확인한 결과이다.
도 15는 흑색종 이식 마우스 모델에서 sEVIL-2와 시스플라틴(cisplatin) 또는 항 PD-L1 항체와 병용 요법을 이용한 항암 효과를 웨스턴 블랏으로 확인한 결과이다.
MBC(membrane bound cytokine) 플랫폼은 "사이토카인-링커-PDGF(platelet-derived growth factor) 수용체의 막관통 도메인"으로 구성된다. 상기 사이토카인은 가요성 링커를 통해 PDGF 수용체의 막관통 도메인과 연결되어, 발현 시 세포 외부로 분비되지 않고 세포막에 부착된 형태로 발현한다.
본 발명에서는 도 1과 같이, 면역세포에 MBC 플랫폼을 적용하여 세포막 표면에 특정 사이토카인이 발현된 면역세포를 제작함과 동시에 이의 아바타로 불리는 "표면에 특정 사이토카인이 발현된 면역세포 유래 sEV(small extracellular vesicles)"를 제작하고, 이의 효능을 평가하였다.
이에, 본 발명은 사이토카인; 링커; 및 막관통 단백질;이 융합된 세포외 소포체(extracellular vesicles)를 제공한다.
상기 사이토카인은 상기 세포외 소포체의 지질층을 관통하는 막관통 단백질에 연결된 링커와 결합되어 세포외 소포체 표면에 노출된다.
상기 세포외 소포체는 사이토카인; 링커; 및 막관통 도메인;을 포함하는 바이러스 벡터로 형질감염된 세포에서 분비될 수 있다.
상기 사이토카인은 IL-2일 수 있으나, 이에 제한되는 것은 아님을 명시한다.
상기 링커는 일반식 (GGGGS)n, (SGGGG)n, (SRSSG)n, (SGSSC)n, (GKSSGSGSESKS)n, (RPPPPC)n, (SSPPPPC)n,　(GSTSGSGKSSEGKG)n, (GSTSGSGKSSEGSGSTKG)n,　(GSTSGSGKPGSGEGSTKG)n, 또는 (EGKSSGSGSESKEF)n로 표시되는 아미노산 서열로 이루어지며, 상기 n은 1 내지 20의 정수일 수 있다.
상기 막관통 도메인은 표피 성장인자 수용체, 인슐린 수용체, 혈소판 유래 성장인자(Platelet-derived growth factor; PDGF) 수용체, 혈관내피 성장인자 수용체, 섬유아세포 성장인자 수용체, 콜레시스토키닌(Cholecystokinin; CCK) 수용체, 신경영양인자(Neurotrophic factor; NGF) 수용체, 간세포 성장인자(Hepatocyte growth factor; HGF) 수용체, 에프린(Ephrin; Eph) 수용체, 안지오포이에틴 수용체 및 RTK(Related to receptor tyrosine kinase) 수용체로 이루어진 군에서 선택된 어느 하나 이상의 수용체의 막관통 도메인일 수 있으나, 이에 제한되는 것은 아님을 명시한다.
상기 세포는 T 세포이며, 보다 상세하게는 보조 T 세포일 수 있으나, 이에 제한되는 것은 아님을 명시한다.
상기 세포외 소포체는 세포독성 T 세포의 증식 및 활성을 증가시켜 항암 효과를 증대시킬 수 있다.
상기 세포외 소포체는 직경이 30 내지 100㎚인 작은 세포외 소포체(Small extracellular vesicles; sEV)로, 엑소좀(exosome), 미세소포(microvesicle) 등을 포함할 수 있으나, 이에 제한되는 것은 아님을 명시한다.
또한, 본 발명은 상기 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 약학 조성물을 제공한다.
상기 암 질환은 흑색종, 결장암, 폐암, 피부암, 비소세포성 폐암, 결장암, 골암, 췌장암, 두부 또는 경부 암, 자궁암, 난소암, 직장암, 위암, 항문부근암, 유방암, 나팔관암종, 자궁내막암종, 자궁경부암종, 질암종, 음문암종, 호킨스씨병, 식도암, 소장암, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직 육종, 요도암, 음경암, 전립선암, 만성 또는 급성 백혈병, 림프구 림프종, 방광암, 신장 또는 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계 종양, 1차 중추신경계 림프종, 척수 종양, 뇌간신경교종 및 뇌하수체 선종으로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아님을 명시한다.
상기 약학 조성물은 항암제 또는 항체와 병용 투여될 수 있으나, 이에 제한되는 것은 아님을 명시한다.
또한, 본 발명은 상기 세포외 소포체 및 항암제를 유효성분으로 포함하는 암 질환 예방 또는 치료용 약학 조성물, 즉 암 질환 예방 또는 치료를 위한 항암제 병용 투여용 약학 조성물을 제공한다.
상기 항암제는 시스플라틴(cisplain), 빈블라스틴(vinblastine), 빈크리스틴(vincristine), 액티노마이신-D(actinomycin-D), 5-플로오우라실(5-fluouracil), 도세탁셀(docetaxel), 카바지탁셀(cabazitaxel), 파클리탁셀(paclitaxel) 및 펨브롤리주맙(Pembrolizumab)으로 이루어진 군에서 선택되는 하나 이상일 수 있으나, 이에 제한되는 것은 아님을 명시한다.
상기 약학 조성물은 상기 항암제와 병용 투여함으로써 암 질환에 대한 치료 효과를 증대시킬 수 있다.
본 발명의 약학 조성물은 투여를 위하여, 상기 기재한 유효성분 이외에 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 포함할 수 있다. 상기 담체, 부형제 및 희석제로는 락토오스, 덱스트로오스, 수크로오스, 소르비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로오스, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
본 발명의 약학 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 또는 멸균 주사용액의 형태로 제형화하여 사용할 수 있다. 상세하게는 제형화할 경우 통상 사용하는 충진제, 중량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구투여를 위한 고형 제제로는 정제, 환제, 산제, 과립제, 캡슐제 등을 포함하나, 이에 한정되는 것은 아니다. 이러한 고형 제제는 상기 유효성분 외에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘 카보네이트, 수크로오스, 락토오스, 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있다. 경구를 위한 액상물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등을 첨가하여 조제될 수 있다. 비경구 투여를 위한 제제는 멸균된 수용액, 비수성 용제, 현탁제, 유제, 동결건조 제제 및 과제를 포함한다. 비수성 용제 및 현탁제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 오일, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔, 마크로솔, 트윈 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
본 발명의 약학 조성물의 적합한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 시간에 따라 다르지만, 당 업자에 의해 적절하게 선택될 수 있는 바, 상기 조성물의 일일 투여량은 바람직하게는 0.001 mg/kg 내지 50 mg/kg이며, 필요에 따라 일일 1회 내지 수회로 나누어 투여할 수 있다.
또한, 본 발명은 약물 또는 생리활성물질 중 하나 이상과, 사이토카인; 링커; 및 막관통 단백질;이 융합된 세포외 소포체를 포함하며, 상기 약물 또는 생리활성물질은 상기 세포외 소포체 지질층 내에 봉입된 것을 특징으로 하는 약물 또는 생리활성물질 전달용 조성물을 제공한다.
상기 사이토카인은 IL-2일 수 있으나, 이에 제한되는 것은 아님을 명시한다.
상기 링커는 일반식 (GGGGS)n, (SGGGG)n, (SRSSG)n, (SGSSC)n, (GKSSGSGSESKS)n, (RPPPPC)n, (SSPPPPC)n,　(GSTSGSGKSSEGKG)n, (GSTSGSGKSSEGSGSTKG)n,　(GSTSGSGKPGSGEGSTKG)n, 또는 (EGKSSGSGSESKEF)n로 표시되는 아미노산 서열로 이루어지며, 상기 n은 1 내지 20의 정수일 수 있다.
상기 막관통 도메인은 표피 성장인자 수용체, 인슐린 수용체, 혈소판 유래 성장인자(Platelet-derived growth factor; PDGF) 수용체, 혈관내피 성장인자 수용체, 섬유아세포 성장인자 수용체, 콜레시스토키닌(Cholecystokinin; CCK) 수용체, 신경영양인자(Neurotrophic factor; NGF) 수용체, 간세포 성장인자(Hepatocyte growth factor; HGF) 수용체, 에프린(Ephrin; Eph) 수용체, 안지오포이에틴 수용체 및 RTK(Related to receptor tyrosine kinase) 수용체로 이루어진 군에서 선택된 어느 하나 이상의 수용체의 막관통 도메인일 수 있으나, 이에 제한되는 것은 아님을 명시한다.
상기 약물은 항암제, 소염진통제, 항생제, 항균제 및 백신으로 이루어진 군에서 선택되며, 상기 생리활성물질은 펩타이드, 단백질, 호르몬제 및 유전자로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아님을 명시한다.
이하에서는 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1: 세포 배양
HEK-293FT 세포(인간 배아 신장), B16F10(마우스 흑색종), B16F10-luc-g5(마우스 흑색종)는 10% 우태아혈청, 1% 페니실린 및 스트렙토마이신이 첨가된 DMEM 배지(Hyclone)에서 배양하고, Jurkat 세포(인간 T 림프구)는 10% 우태아혈청, 1% 페니실린 및 스트렙토마이신이 첨가된 RPMI 1640 배지(Hyclone)에서 배양하였으며, SK-MEL-28(인간 흑색종)은 10% 우태아혈청, 1% 페니실린 및 스트렙토마이신이 첨가된 EMEM 배지(Hyclone)에서 배양하였다. CTLL-2 세포(마우스 세포독성 T 림프구)는 10% 우태아혈청, 1% 페니실린 및 스트렙토마이신, 20-100 IU/mL의 재조합 IL-2(R&D systems)가 첨가된 RPMI-1640 배지에서 배양하였다.
실시예 2: 렌티바이러스 제조
항체-링커-PDGF 수용체의 막관통 도메인을 포함하는 렌티바이러스 벡터는 논문(Proc Natl Acad Sci U S A. 2013 May 14;110(20):8099-104)을 참조하여 제작하였고, 이를 IL-2-링커(GSTSGSGKPGSGEGSTKG)-PDGF 수용체의 막관통 도메인을 포함하는 렌티바이러스 벡터로 재구성하여 클로닝하였다.
형질감염을 위해, HEK-293FT 세포를 6 웰 플레이트에 약 1 X 106 세포/웰 밀도로 접종하고, Opti-MEM(ref.31985-070; Gibco) 배지 하에 Lipofectamine® 2000 Reagent(ref.11668-027; Thermo fisher scientific), 상기 IL-2를 발현하는 렌티바이러스 벡터, pCMVD(# PS100001; Origene) 및 pVSVg(# 1733; Addgene) 바이러스 패키징 벡터를 1:1:1의 비율로 혼합하여 처리한 후 37℃에서 밤새 배양하였다. 다음날 상등액을 제거하고 10% 우태아혈청이 첨가된 신선한 배지로 교체하였다. 이후 48시간째에 바이러스를 함유하는 상등액을 수거하고, 원심분리 및 계면활성제가 없는 셀룰로오스 아세테이트(Surfactant-free cellulose acetate; SFCA) 막 여과 장치(0.22 μm; Corning)를 이용하여 세포 파편들을 제거하였다. 렌티바이러스의 역가는 Lenti-X p24 신속 역가 키트(# 632200; Takara)를 사용하여 측정하였다. 렌티바이러스는 분주하여 -80℃에서 동결시켰다.
실시예 3: 렌티바이러스를 이용한 Jurkat 세포로의 형질도입
10 μg/mL의 폴리브렌(polybrene) 및 500 μg/mL의 IL-2를 발현하는 렌티바이러스를 0.3 mL RPMI 배지에 첨가하고 Jurkat 세포(1 X 106 세포/ml)에 처리하였다. 렌티바이러스와 세포 혼합물을 30℃에서 1,200 x g로 90분 동안 원심분리하여 회전접종(spinoculation)을 수행하였다. 이후 세포를 렌티바이러스와 함께 37℃에서 밤새 배양하였다. 초과 바이러스를 제거하고 다음날 10% 우태아혈청이 첨가된 신선한 배지를 첨가하였다.
실시예 4: 실시간 중합효소 연쇄반응을 이용한 Jurkat 세포의 IL-2 발현 분석
렌티바이러스 벡터로 형질감염된 Jurkat 세포로부터 mRNA(mRNA extraction kit, # 9767; TaKaRa)를 추출한 뒤, nanodrop(DS-11 Series Spectrophotometer; DeNovix)을 이용하여 mRNA의 농도를 측정하였다. 이후 100 ng의 mRNA로 cDNA(SuperScript III First-Strand Synthesis System, Ref. 18080-051; invitrogen)를 합성한 후, 실시간 중합효소 연쇄반응을 수행하여 IL-2(Forward: agacccagggacttaatcag, Reverse: acaatggttgctgtctcatc)의 유전자 발현 수준을 분석하였다.
그 결과, 도 2(A)와 같이, 대조군 대비 렌티바이러스로 형질감염된 Jurkat 세포에서 IL-2의 유전자 발현이 약 1,600배 증가하는 것을 확인하였다.
실시예 5: 유세포 분석을 이용한 Jurkat 세포의 IL-2 발현 분석
세포 표면에서 IL-2의 발현 여부를 확인하기 위해, 렌티바이러스로 형질감염된 Jurkat 세포를 인산완충식염수(PBS)로 1회 세척한 뒤 4% 포름알데하이드로 고정시켰다. 이후 1% 우혈청알부민(bovine serum albumin; BSA)과 5% 염소 혈청이 첨가된 PBS를 이용하여 4℃에서 1시간 동안 블로킹시켰다. 다음으로 항 Flag 항체(# 8146; CST)와 4℃에서 1시간 반응시킨 후 PBS로 3회 세척하고, FITC가 접합된 2차 항체와 4℃에서 1시간 반응시킨 후 PBS로 3회 세척하여 유세포 분석을 수행하였다.
그 결과, 도 2(B)와 같이, 대조군 대비 렌티바이러스로 형질감염된 Jurkat 세포의 표면에서 IL-2의 단백질 발현이 약 46% 증가하는 것을 확인하였다.
도 2(C)와 같이, 유세포 분류기를 이용하여 렌티바이러스로 형질감염된 Jurkat 세포를 분리하였다.
실시예 6: sEV 정제
대조군 Jukat 세포 또는 IL-2를 발현하는 Jukat 세포를 약 2 X 106 세포/웰 밀도로 접종하고, 우태아혈청이 첨가되지 않은 RPMI 배지에서 24시간 배양하였다. 이후 sEV 또는 sEVIL-2를 분리하기 위해, 각 세포에서 얻은 각 상등액을 300 x g, 2500 x g, 10,000 x g로 연속 원심분리하였다. 이어서, 상등액을 0.2 μm 주사기 필터로 여과하고, 120,000 x g에서 원심분리하였다. sEV 펠릿을 PBS에 재현탁하고 다시 120,000 x g에서 원심분리하였다. 정제된 sEV 펠릿은 다음 실험을 위해 PBS 또는 1X 세포 용해 완충액에 재현탁하였다.
실시예 7: ELISA 분석을 이용한 sEV의 IL-2 발현 분석
렌티바이러스로 형질감염된 Jurkat 세포로부터 sEVIL-2를 분리 및 정제한 후, 상기 sEV 표면에서 IL-2 발현 여부를 확인하기 위해, 효소결합 면역흡착 분석법(ELISA)을 수행하였다. 먼저 세포에서 분리한 sEVIL-2 표면에서 Flag의 발현을 확인하기 위해 ELISA kit(#550534; BD OptEIA™ Reagent Set B)를 이용하였다. 플레이트를 항 CD63 항체(ab68418; Abcam)와 4℃에서 밤새 반응시켜 플레이트를 코팅한 뒤 wash buffer를 이용하여 5회 세척하였다. 이후 4% 포름알데하이드로 고정된 sEVIL-2 5 μg (대조군: Naive Jurkat 세포 유래 sEV)을 플레이트에 처리하여 상온에서 1시간 부착시킨 뒤 Assay Diluent를 이용하여 상온에서 1시간 블로킹시켰다. 이후 항 Flag 항체(# 8146; CST)와 상온에서 1시간 반응시킨 후 wash buffer를 이용하여 5회 세척하고, HRP가 접합된 2차 항체와 상온에서 1시간 반응시킨 후 wash buffer로 5회 세척하였다. 마지막으로 TMB를 이용하여 10분간 발색시킨 후 정지 용액(stop solution)을 이용하여 발색을 정지시켰다. 이후 마이크로플레이트 리더기를 이용하여 450 nm에서 흡광도를 측정하였다.
다른 방법으로 렌티바이러스로 형질감염된 Jurkat 세포에서 분리한 sEV 표면의 IL-2 발현을 확인하기 위해, Human IL-2 Immunoassay(D2050; R&D) kit를 이용하여 재현 실험을 수행하였다.
그 결과, 도 3과 같이, 대조군 대비 렌티바이러스로 감염된 Jurkat 세포로부터 유래된 sEV 표면에서 IL-2의 발현이 증가하는 것을 확인하였다.
실시예 8: 정제된 sEVIL-2 의 특성 분석
전자현미경을 사용하여 정제된 sEVIL-2의 특성을 확인하기 위해, PBS에 현탁한 정제된 sEVIL-2를 포름바 탄소 코팅 니켈 그리드(formvar carbon-coated nickel grids) 위에 떨어뜨렸다. 2% 우라닐 아세테이트(uranyl acetate)로 염색한 후, 그리드를 공기 건조시키고 HF-3300(Hitachi) 투과 전자현미경을 사용하여 직경 구조를 가시화하였다.
면역금표지법(immunogold labelling)을 위해, PBS에 현탁한 정제된 sEV를 포름바 탄소 코팅 니켈 그리드 위에 놓고, 0.5% 우혈청알부민이 첨가된 PBS를 이용하여 블로킹한 후 Flag를 인식하는 마우스 항-인간 단클론 항체와 함께 배양하였다. 이후 단백질 A-금 입자(10 nm)가 접합된 항-마우스 이차 항체와 배양하였다. 이어서, PBS로 5회 세척하고 ddH2O로 10회 세척한 다음 2% 우라닐 아세테이트로 대조 염색하였다.
그 결과, 도 4와 같이, sEVIL-2의 경우 Flag을 인식하는 항체에 의해 단백질 A-금 입자(10 nm)가 표지된 것을 확인할 수 있었다.
실시예 9: 나노입자 추적을 이용한 흑색종 세포 유래 sEV 분석
흑색종 세포(B16F10: 5 X 104 세포/ml, SK-MEL-28: 1 X 105 세포/ml)에 정제된 sEVIL-2를 10 μg/ml 농도로 처리하고 72시간 동안 배양한 후, 배양 상층액으로부터 유래되는 sEV의 크기 및 농도를 fast video capture 및 입자 추적 소프트웨어가 장착된 Nanosight LM10(Malvern Instruments)을 사용하여 측정하였다.
그 결과, 도 5(A)와 같이, 대조군 대비 sEVIL-2를 처리한 두 종류의 흑색종 세포에서 sEV의 수가 감소하는 것을 나노입자 추적 분석으로 확인하였다.
실시예 10: 웨스턴 블랏을 이용한 흑색종 세포 유래 sEV 분석
상기 흑색종 세포 유래 sEV 수의 감소를 재검증하기 위해, sEV 분비 및 발현에 관여하는 Rab 단백질의 발현 수준을 웨스턴 블랏으로 측정하였다. 세포질 또는 sEV 단백질을 SDS-PAGE로 분리하고, 니트로셀룰로오스 막으로 이동시켰다. 이후, 각각의 일차 항체(ab18211; abcam/Rab5, ab50533; abcam/Rab7, ab55667; abcam/Rab 27a, # 4970; Cell signaling/β-actin, ab10931; abcam/PD-L1)와 배양하고, HRP가 접합된 이차 항체로 배양하였다. Enhanced chemiluminescence(ECL) 검출 시약(# 34095; Thermo Scientific, # RPN2209; GE Healthcare)을 사용하여 이미지를 시각화하고 ECL 하이퍼 필름(AGFA, Morstel)을 사용하여 정량화하였다.
그 결과, 도 5(B)와 같이, 대조군 대비 sEVIL-2를 처리한 두 종류의 흑색종 세포에서 Rab 27a의 단백질 발현이 현저하게 감소하는 것을 확인하였다.
더불어, 흑색종에서 sEVIL-2의 효능을 평가하기 위해, 암세포의 면역회피에 가장 중요하다고 알려져 있는 PD-L1(programmed death ligand 1) 단백질의 발현을 측정하였다.
그 결과, 도 6(A)와 같이, 대조군 대비 sEVIL-2를 처리한 두 종류의 흑색종 세포에서 PD-L1의 단백질 발현이 현저하게 감소하는 것을 확인하였다. 이는 도 6(B)와 같이 면역염색법을 통해 재검증하였다.
다음으로 sEVIL-2에 의한 흑색종 유래 exosomal PD-L1 발현 조절 여부를 평가하기 위하여 웨스턴 블랏과 효소결합 면역흡착 분석법을 수행하였다.
그 결과, 도 7과 같이, 대조군 대비 sEVIL-2를 처리한 흑색종에서 exosomal PD-L1의 발현이 현저하게 감소하는 것을 확인하였으며(A), 효소결합 면역흡착 분석법을 이용하여 재검증하여 확인하였다(B).
실시예 11: sEVIL-2 에 의한 세포독성 T 세포의 증식 분석
IL-2는 세포독성 T 세포의 증식 및 활성에 가장 중요한 인자로 알려져 있다. 이에, 본 발명에서는 sEVIL-2가 세포독성 T 세포에 미치는 영향을 분석하기 위해, MTS 분석법(# G3582; Promega)을 이용하여 세포 증식 분석을 수행하였다.
CTLL-2 세포를 5 X 103 세포/웰의 밀도로 96 웰 플레이트에 접종하고 24시간 동안 배양하였다. 이후, 배양 배지를 10% FBS 및 rIL-2(100 IU/ml), 대조군 sEV 또는 sEVIL-2(10 μg/ml)가 포함된 새로운 배지로 교체하여 24시간 동안 추가 배양하였다. 이후, 각 웰에 MTS 시약을 첨가하고 37℃에서 2시간 동안 배양한 다음 각 웰의 상층액을 포함하는 MTS를 제거한 후, 마이크로플레이트 리더기를 사용하여 490 nm에서 흡광도를 측정하였다.
그 결과, 도 8과 같이, 대조군 대비 sEVIL-2를 처리한 CTLL-2 세포에서 세포 증식이 약 7배 증가하는 것을 확인하였고, 상기 반응은 항 IL-2 항체에 의해 유의하게 감소하는 것을 확인하였다.
즉, 상기 결과로부터 sEVIL-2가 암세포 사멸에 중요한 세포독성 T 세포 수를 증가시켜 면역 항암 효능을 증대시키는 것을 확인하였다.
실시예 12: sEVIL-2 에 의한 세포독성 T 세포의 활성 분석
다음으로 세포독성 T 세포의 활성에 관여하는 것으로 보고된 퍼포린(Perforin), 그랜자임-B(GrzmB), 인터페론-γ(IFN-γ)의 발현을 확인하기 위하여, 대조군 또는 sEVIL-2를 처리한 세포독성 T 세포로부터 mRNA를 추출하였다(mRNA extraction kit, #9767;TaKaRa). 추출된 mRNA는 nanodrop(DS-11 Series Spectrophotometer;DeNovix)을 이용하여 농도를 측정한 후 100 ng의 mRNA로 cDNA를 합성하였다(SuperScript III First-Strand Synthesis System, Ref. 18080-051;invitrogen). 합성된 cDNA를 이용하여 퍼포린(Forward:cgcctacctcaggcttatctc, Reverse:cctcgacagtcaggcagtc), 그랜자임-B(Forward:tgggggacccagagattaaaa, Reverse:tttcgtccataggagacaatgc), INF-γ(Forward:tgaccagagcatccaaaaga, Reverse:ctcttcgacctcgaaacagc)의 유전자 발현을 실시간 중합효소 연쇄반응으로 확인하였다.
그 결과, 도 9(A)와 같이, sEVIL-2를 처리한 세포독성 T 세포에서 상기 세 유전자의 발현이 모두 유의하게 증가하는 것을 확인하였다. 특히, 인터페론-γ의 경우 대조군 대비 약 9배 정도 유전자 발현이 증가하는 것을 확인할 수 있었다.
즉, 상기 결과로부터 sEVIL-2가 암세포 사멸에 중요한 세포독성 T 세포의 활성을 강하게 증가시키는 것을 확인할 수 있었다.
도 9(B)와 같이 유세포분석기를 이용하여 재검증하였다. 더불어, sEVIL-2를 처리한 세포독성 T 세포에서 면역관문점인 PD-1(programmed cell death-1, Forward:agaatcctggagacctcaac, Reverse:atacccactagggcactcat)의 발현을 상기와 동일한 방법으로 확인하였다.
그 결과, 도 10과 같이, 대조군 대비 sEVIL-2를 처리한 세포독성 T 세포의 경우 PD-1 유전자 및 단백질 발현이 현저하게 감소하는 것을 확인하였다. 이는 세포독성 T 세포의 PD-1 감소로 인하여 암세포의 PD-L1과의 결합으로 인한 면역회피를 감소시킴으로써 항암 효과가 증가될 수 있음을 시시한다.
실시예 13: 공동 배양 분석
sEVIL-2에 의한 흑색종 세포의 PD-L1 감소와 더불어 세포독성 T 세포의 활성 증가에 의한 항암 효과를 증명하기 위해, 도 11(A)와 같이, sEVIL-2와 흑색종 세포(B16F10) 그리고 세포독성 T 세포를 함께 공동 배양한 뒤 흑색종 세포의 생존율을 확인하였다. 세포 발광 유전자를 가진 흑색종 세포(B16F10-luc-g5)를 사용하였으며, IVIS spectrum(PerkinElmer)을 이용하여 분석하였다.
13-1. sEV IL-2 전처리된 흑색종 세포의 공동 배양 분석
96 웰 플레이트에 흑색종 세포를 약 5 X 103 세포/웰 밀도로 접종하고 대조군 sEV 또는 sEVIL-2(5 μg/mL)로 전처리하였다. 배양 24시간 후, 세포를 상이한 비율의 CTLL-2 세포(1:1 내지 1:10)와 함께 배양하였다. 배양 종료 시, MTS 시약을 각 웰에 첨가하고 37℃에서 2시간 동안 배양하였다. 각 웰의 상층액을 포함하는 MTS를 제거한 후, 마이크로플레이트 리더기를 사용하여 490 nm에서 흡광도를 측정하였다.
13-2. sEV IL-2 전처리된 T 세포의 공동 배양 분석
96 웰 플레이트에 CTLL-2 세포를 약 1 X 106 세포/웰 밀도로 접종하고 대조군 sEV 또는 sEVIL-2(5 μg/mL)로 전처리하였다. 배양 24시간 후, 세포를 상이한 비율의 흑색종 세포(1:1 내지 1:10)와 함께 배양하였다. 배양 종료 시, MTS 시약을 각 웰에 첨가하고 37℃에서 2시간 동안 배양하였다. 각 웰의 상층액을 포함하는 MTS를 제거한 후, 마이크로플레이트 리더기를 사용하여 490 nm에서 흡광도를 측정하였다.
그 결과, 도 11(B) 및 (C)와 같이, 세포독성 T 세포와 sEVIL-2를 처리한 흑색종 세포의 공동 배양군에서 흑색종 세포의 생존율이 현저하게 감소하는 것을 확인하였다.
실시예 14: 흑색종 이식 마우스 모델에서 sEVIL-2 의 암 성장 억제분석
B16F10 마우스 흑색종 세포 5 X 105을 C57BL/6 마우스 우측 옆구리에 피하주사하였다. 실험 시작일로부터 5일 후 주 3회 PBS, rhIL-2(50,000IU/마리), 대조군 sEV 또는 sEVIL-2를(20μg/마리) 암 조직에 직접 주사 하였다. 이후 공학용 디지털 캘리퍼를 이용하여 2일에 한 번씩 마우스의 암 조직(장축*단축*0.52)을 측정하여 비교하였다.
그 결과, 도 12(A)와 같이, sEVIL-2를 주입한 마우스의 암 성장이 PBS 대조군보다 현저하게 암의 성장을 억제시켰다. 이후 마우스에서 적출되어진 암 조직의 무게 분석과 같은 결과를 보였다(도 12(B)).
실시예 15: 흑색종 이식 마우스 모델에서 sEVIL-2 의 혈중 exosomal PD-L1 발현 조절에 대한 분석
상기 실험의 마우스에서 채혈한 뒤 550 x g에서 원심분리하여 혈청을 얻었다. 이후 상등액을 300 x g, 2,500 x g, 10,000 x g로 연속 원심분리하였다. 이어서, 상등액을 0.2 μm 주사기 필터로 여과하고, 120,000 x g에서 원심분리하였다. sEV 펠릿을 PBS에 재현탁하고 다시 120,000 x g에서 원심분리하였다. 정제된 sEV 펠릿은 항 PD-L1(ab10931; abcam/PD-L1)항체와 밤새 배양하고, FITC가 접합된 이차 항체(a11001; invitrogen/goat anti-mouse igg (h+l) cross-adsorbed secondary antibody alexa fluor 488)로 배양한 뒤 sEV 유세포 분석기(CytoFlEX/Beckman Coulter)를 이용하여 분석하였다.
그 결과 도 13(A, B)와 같이, sEVIL-2를 주입한 마우스의 exosomal PD-L1 발현양이 대조군에 비해 유의 있게 감소됨을 확인하였다.
실시예 16: 항암제 병용 처리에 따른 흑색종 이식 마우스의 암 성장 분석
B16F10 마우스 흑색종 세포 5 X 105을 C57BL/6 마우스 우측 옆구리에 피하주사하였다. 실험 시작일로부터 7일 후 주 2회 PBS, 대조군 sEV(20μg/마리), sEVIL-2(20μg/마리), 시스플라틴(Cisplatin, p4394; Sigma-Aldrich/cis-Diammineplatinum(II) dichloride crystalline), 대조군 IgG(be0252; bioxcell/anti-rat IgG2b), 항 PD-L1 항체(be0101; bioxcell/anti PD-L1)를 마우스에 주사하였다(sEVIL-2 또는 대조군 sEV; intratumoal injection, Cisplatin 또는 PBS; intraperitoneal injection, 항 PD-L1 또는 대조군 IgG; intravenous injection). 이후 공학용 디지털 캘리퍼를 이용하여 2일에 한 번씩 마우스의 암 조직(장축*단축*0.52)을 측정하여 비교하였다.
그 결과 도 14(A, B, C)와 같이, sEVIL-2와 함께 항암제를 주입한 마우스의 암 성장이 대조군보다 현저하게 암의 성장을 억제시켰다. 이후 마우스에서 적출되어진 암 조직의 무게 분석도 같은 결과를 보였다(도 14(D)).
또한, 항암제 병용 처리에 따른 흑색종 이식 마우스의 암 조직에서의 PD-L1과 더불어 Rab27a의 발현을 웨스턴블랏으로 확인한 결과, 도 15와 같이, sEVIL-2를 주입한 마우스의 암 조직에서 PD-L1과 Rab27a 모두 극적으로 감소된 발현을 확인하였다.
이상으로 본 발명의 특정한 부분을 상세히 기술한 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
본 발명의 범위는 후술하는 특허청구범위에 의하여 나타내어지며, 특허청구범위의 의미 및 범위 그리고 그 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (17)

  1. 사이토카인; 링커; 및 막관통 단백질;이 융합된 세포외 소포체(extracellular vesicles).
  2. 제 1 항에 있어서,
    상기 사이토카인은,
    상기 세포외 소포체의 지질층을 관통하는 막관통 단백질에 연결된 링커와 결합되는 것을 특징으로 하는 세포외 소포체.
  3. 제 1 항에 있어서,
    상기 세포외 소포체는,
    사이토카인; 링커; 및 막관통 도메인;을 포함하는 바이러스 벡터로 형질감염된 세포에서 분비되는 것을 특징으로 하는 세포외 소포체.
  4. 제 3 항에 있어서,
    상기 사이토카인은, IL-2인 것을 특징으로 하는 세포외 소포체.
  5. 제 3 항에 있어서,
    상기 링커는,
    일반식 (GGGGS)n, (SGGGG)n, (SRSSG)n, (SGSSC)n, (GKSSGSGSESKS)n, (RPPPPC)n, (SSPPPPC)n,　(GSTSGSGKSSEGKG)n, (GSTSGSGKSSEGSGSTKG)n,　(GSTSGSGKPGSGEGSTKG)n, 또는 (EGKSSGSGSESKEF)n로 표시되는 아미노산 서열로 이루어지며, 상기 n은 1 내지 20의 정수인 것을 특징으로 하는 세포외 소포체.
  6. 제 3 항에 있어서,
    상기 막관통 도메인은,
    표피 성장인자 수용체, 인슐린 수용체, 혈소판 유래 성장인자(Platelet-derived growth factor; PDGF) 수용체, 혈관내피 성장인자 수용체, 섬유아세포 성장인자 수용체, 콜레시스토키닌(Cholecystokinin; CCK) 수용체, 신경영양인자(Neurotrophic factor; NGF) 수용체, 간세포 성장인자(Hepatocyte growth factor; HGF) 수용체, 에프린(Ephrin; Eph) 수용체, 안지오포이에틴 수용체 및 RTK(Related to receptor tyrosine kinase) 수용체로 이루어진 군에서 선택된 어느 하나 이상의 수용체의 막관통 도메인인 것을 특징으로 하는 세포외 소포체.
  7. 제 3 항에 있어서,
    상기 세포는, 보조 T 세포인 것을 특징으로 하는 세포외 소포체.
  8. 제 1 항에 있어서,
    상기 세포외 소포체는,
    세포독성 T 세포의 증식 및 활성을 증가시켜 항암 효과를 증대시키는 것을 특징으로 하는 세포외 소포체.
  9. 제 1 항에 있어서,
    상기 세포외 소포체는,
    직경이 30 내지 100㎚인 작은 세포외 소포체(Small extracellular vesicles; sEV)인 것을 특징으로 하는 세포외 소포체.
  10. 제 1 항 내지 제 9 항 중 어느 한 항에 따른 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 약학 조성물.
  11. 제 10 항에 있어서,
    상기 암 질환은,
    흑색종, 결장암, 폐암, 피부암, 비소세포성 폐암, 결장암, 골암, 췌장암, 두부 또는 경부 암, 자궁암, 난소암, 직장암, 위암, 항문부근암, 유방암, 나팔관암종, 자궁내막암종, 자궁경부암종, 질암종, 음문암종, 호킨스씨병, 식도암, 소장암, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직 육종, 요도암, 음경암, 전립선암, 만성 또는 급성 백혈병, 림프구 림프종, 방광암, 신장 또는 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계 종양, 1차 중추신경계 림프종, 척수 종양, 뇌간신경교종 및 뇌하수체 선종으로 이루어진 군에서 선택된 것을 특징으로 하는 암 질환 예방 또는 치료용 약학 조성물.
  12. 제 10 항에 있어서,
    상기 조성물은,
    항암제와 병용 투여되는 것을 특징으로 하는 암 질환 예방 또는 치료용 약학 조성물.
  13. 제 1 항 내지 제 9 항 중 어느 한 항에 따른 세포외 소포체 및 항암제를 유효성분으로 포함하는 암 질환 예방 또는 치료용 약학 조성물.
  14. 제 13 항에 있어서,
    상기 항암제는,
    시스플라틴(cisplain), 빈블라스틴(vinblastine), 빈크리스틴(vincristine), 액티노마이신-D(actinomycin-D), 5-플로오우라실(5-fluouracil), 도세탁셀(docetaxel), 카바지탁셀(cabazitaxel), 파클리탁셀(paclitaxel) 및 펨브롤리주맙(Pembrolizumab)으로 이루어진 군에서 선택되는 하나 이상인 것을 특징으로 하는 암 질환 예방 또는 치료용 약학 조성물.
  15. 약물 또는 생리활성물질 중 하나 이상과, 사이토카인; 링커; 및 막관통 단백질;이 융합된 세포외 소포체를 포함하며, 상기 약물 또는 생리활성물질은 상기 세포외 소포체 지질층 내에 봉입된 것을 특징으로 하는 약물 또는 생리활성물질 전달용 조성물.
  16. 제 15 항에 있어서,
    상기 사이토카인은, IL-2인 것을 특징으로 하는 약물 또는 생리활성물질 전달용 조성물.
  17. 제 15 항에 있어서,
    상기 약물은 항암제, 소염진통제, 항생제, 항균제 및 백신으로 이루어진 군에서 선택되며, 상기 생리활성물질은 펩타이드, 단백질, 호르몬제 및 유전자로 이루어진 군에서 선택된 것을 특징으로 하는 약물 또는 생리활성물질 전달용 조성물.
PCT/KR2020/011774 2019-09-02 2020-09-02 Il-2 표면 발현 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 조성물 WO2021045501A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN202080052323.9A CN114173807B (zh) 2019-09-02 2020-09-02 包含il-2表面表达-细胞外囊泡作为活性成分的用于预防或治疗癌症的组合物
US17/621,234 US20220409741A1 (en) 2019-09-02 2020-09-02 Composition for preventing or treating cancer, containing il-2 surface expression-extracellular vesicles as active ingredient
EP20861461.0A EP3973969A4 (en) 2019-09-02 2020-09-02 COMPOSITION FOR THE PREVENTION OR TREATMENT OF CANCER USING IL-2 EXTRACELLULAR SURFACE EXPRESSION VESICLES AS AN ACTIVE AGENT

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20190108284 2019-09-02
KR10-2019-0108284 2019-09-02
KR10-2020-0094583 2020-07-29
KR1020200094583A KR102521664B1 (ko) 2019-09-02 2020-07-29 Il-2 표면 발현 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 조성물

Publications (1)

Publication Number Publication Date
WO2021045501A1 true WO2021045501A1 (ko) 2021-03-11

Family

ID=74852538

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/011774 WO2021045501A1 (ko) 2019-09-02 2020-09-02 Il-2 표면 발현 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 조성물

Country Status (4)

Country Link
US (1) US20220409741A1 (ko)
EP (1) EP3973969A4 (ko)
CN (1) CN114173807B (ko)
WO (1) WO2021045501A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160130949A (ko) * 2015-05-04 2016-11-15 한국과학기술원 목적 단백질을 포함하는 엑소솜의 제조 방법 및 상기 제조 방법에 의해 제조된 엑소솜을 이용하여 목적 단백질을 세포질로 전달시키는 방법
KR20180017119A (ko) * 2015-06-10 2018-02-20 보드 오브 리전츠, 더 유니버시티 오브 텍사스 시스템 질환의 치료를 위한 엑소좀의 용도
KR20180078173A (ko) * 2016-12-29 2018-07-09 한국과학기술연구원 신규 엑소좀 계열 항암제
WO2019027847A1 (en) * 2017-07-29 2019-02-07 University Of Southern California SYNTHETIC EXTRACELLULAR VESICLES FOR NEW THERAPIES
KR20190019872A (ko) * 2017-08-17 2019-02-27 주식회사 셀렉스라이프사이언스 표적특이적으로 물질을 전달하는 엑소좀의 제조방법 및 상기 방법으로 제조된 엑소좀

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4662708B2 (ja) * 2001-08-17 2011-03-30 エクソセラ・エルエルシー エクソゾームにタンパク質を標的化する方法および組成物
US7914792B2 (en) * 2003-02-14 2011-03-29 Exothera L.L.C. Methods and compounds for raising antibodies and for screening antibody repertoires
AU2015203111B2 (en) * 2008-02-01 2017-09-28 The General Hospital Corporation Use of microvesicles in diagnosis, prognosis and treatment of medical diseases and conditions
FR2950350B1 (fr) * 2009-09-24 2013-12-13 Centre Nat Rech Scient Nouveaux polynucleotides et polypeptides chimeriques permettant la secretion d'un polypeptide d'interet en association avec des exosomes et leurs utilisations
WO2014142235A1 (ja) * 2013-03-13 2014-09-18 Li Zhong 微小胞及びその製造方法
US20170112773A1 (en) * 2015-10-23 2017-04-27 Board Of Regents, The University Of Texas System Plasma membrane vesicles comprising functional transmembrane proteins
EP3202783A1 (en) * 2016-02-02 2017-08-09 Ecole Polytechnique Federale de Lausanne (EPFL) Engineered antigen presenting cells and uses thereof
WO2017147719A1 (en) * 2016-03-04 2017-09-08 Exerkine Corporation Method for treating neuropathy
WO2017173367A2 (en) * 2016-03-31 2017-10-05 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Extracellular vesicles, methods of making them, and methods of reducing liver uptake of extracellular vesicles
WO2017205559A1 (en) * 2016-05-25 2017-11-30 The Johns Hopkins University Engineered anucleate cellular and extracellular vesicles as a novel biologics delivery platform
GB2552473A (en) * 2016-07-21 2018-01-31 Evox Therapeutics Ltd Surface decoration of extracellular vesicles
MX2019012398A (es) * 2017-04-18 2020-09-25 Broad Inst Inc Composiciones para detectar secreciones y metodos de uso.
JP6620129B2 (ja) * 2017-08-04 2019-12-11 タンデム カンパニー，リミテッド 新規な組換えエキソソーム及びその用途
CN108315305B (zh) * 2017-12-26 2020-11-06 沣潮医药科技（上海）有限公司 携带嵌合抗原受体的免疫细胞外泌体的制备方法及其应用

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160130949A (ko) * 2015-05-04 2016-11-15 한국과학기술원 목적 단백질을 포함하는 엑소솜의 제조 방법 및 상기 제조 방법에 의해 제조된 엑소솜을 이용하여 목적 단백질을 세포질로 전달시키는 방법
KR20180017119A (ko) * 2015-06-10 2018-02-20 보드 오브 리전츠, 더 유니버시티 오브 텍사스 시스템 질환의 치료를 위한 엑소좀의 용도
KR20180078173A (ko) * 2016-12-29 2018-07-09 한국과학기술연구원 신규 엑소좀 계열 항암제
WO2019027847A1 (en) * 2017-07-29 2019-02-07 University Of Southern California SYNTHETIC EXTRACELLULAR VESICLES FOR NEW THERAPIES
KR20190019872A (ko) * 2017-08-17 2019-02-27 주식회사 셀렉스라이프사이언스 표적특이적으로 물질을 전달하는 엑소좀의 제조방법 및 상기 방법으로 제조된 엑소좀

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
FITZGERALD WENDY, FREEMAN MICHAEL L., LEDERMAN MICHAEL M., VASILIEVA ELENA, ROMERO ROBERTO, MARGOLIS LEONID: "A System of Cytokines Encapsulated in ExtraCellular Vesicles", SCIENTIFIC REPORTS, vol. 8, no. 1, 1 December 2018 (2018-12-01), XP055787507, DOI: 10.1038/s41598-018-27190-x *
PROC NATL ACAD SCI USA., vol. 110, no. 20, 14 May 2013 (2013-05-14), pages 8099 - 104
See also references of EP3973969A4
YUNSHAN YANG ; FANGMING XIU ; ZHIJIAN CAI ; JIANLI WANG ; QINGQING WANG ; YANGXIN FU ; XUETAO CAO: "Increased induction of antitumor response by exosomes derived from interleukin-2 gene-modified tumor cells", JOURNAL OF CANCER RESEARCH AND CLINICAL ONCOLOGY, SPRINGER, BERLIN, DE, vol. 133, no. 6, 12 January 2007 (2007-01-12), Berlin, DE, pages 389 - 399, XP019517726, ISSN: 1432-1335, DOI: 10.1007/s00432-006-0184-7 *

Also Published As

Publication number Publication date
EP3973969A4 (en) 2023-07-12
EP3973969A1 (en) 2022-03-30
US20220409741A1 (en) 2022-12-29
CN114173807A (zh) 2022-03-11
CN114173807B (zh) 2024-03-19

Similar Documents

Publication Publication Date Title
KR102521664B1 (ko) Il-2 표면 발현 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 조성물
WO2018044105A1 (ko) 항체 중쇄불변부위 이종이중체 (heterodimeric Fc)에 융합된 IL-21 (heterodimeric Fc-fused IL-21) 및 이를 포함하는 약제학적 조성물
WO2019198995A1 (ko) 엑소좀 기반의 면역세포의 교차분화 방법
AU2019339870A1 (en) Pharmaceutical combinations for treating tumor comprising anti-CD19 antibody and natural killer cell
WO2021066420A1 (ko) Cd138에 특이적으로 결합하는 키메릭 항원 수용체, 이를 발현하는 면역세포 및 이의 항암 용도
WO2022240081A1 (ko) 엽산 접합 아미노클레이를 기반으로 하는 표적 선택적 나노복합체, 이의 제조 방법 및 이의 용도
WO2018199593A1 (ko) Her3 및 cd3에 결합하는 이중특이적 항체
WO2021045501A1 (ko) Il-2 표면 발현 세포외 소포체를 유효성분으로 포함하는 암 질환 예방 또는 치료용 조성물
RU2335294C2 (ru) Аплидин для лечения множественной миеломы
KR20210043433A (ko) 엑소좀 pd-l1의 발현에 대한 억제제를 유효성분으로 포함하는 항암 효과 증진용 조성물
WO2015076430A1 (ko) 메트포민을 유효성분으로 포함하는 면역질환의 예방 또는 치료용 조성물
KR20220031505A (ko) 사이토카인 및 항체를 발현하는 세포외 소포체, 이를 제조하는 방법 및 이의 용도
WO2022203226A1 (ko) 키메릭 항원 수용체(car)를 포함하는 형질전환된 항원 특이적 전문적 항원표출세포 및 이의 용도
WO2022050720A1 (ko) 사이토카인 및 항체를 발현하는 세포외 소포체, 이를 제조하는 방법 및 이의 용도
WO2021107726A1 (ko) Cd300c 항원 또는 그의 수용체에 특이적으로 결합하는 키메라 항원 수용체
WO2020153800A9 (ko) 종양침윤림프구를 유효성분으로 포함하는 삼중음성 유방암 예방 또는 치료용 조성물
WO2023013955A1 (ko) T 세포의 세포외 소포체 및 항암제를 유효성분으로 포함하는 병용 투여용 약학적 조성물
WO2022215920A1 (ko) 키메릭 항원 수용체(car)를 포함하는 형질전환된 항원 특이적 전문적 항원표출세포 및 이의 용도
WO2022234976A1 (ko) 키메릭 항원 수용체(car)를 포함하는 형질전환된 항원 특이적 전문적 항원표출세포 및 이의 용도
WO2023229441A1 (ko) Nk 세포를 포함한 면역 세포의 활성을 우수하게 증진시키는 녹용 효소분해 추출물 및 면역 항암제를 유효성분으로 포함하는 암 예방 또는 치료를 위한 병용 투여용 약학 조성물
WO2023038479A1 (ko) 생체분자의 안정적 발현 및 전달을 위한 플라스미드 플랫폼
WO2024071544A1 (ko) 신규한 재조합 fc 수용체 및 이를 포함하는 세포
WO2023113293A1 (ko) 키메릭 항원 수용체(car)를 포함하는 형질전환된 항원 특이적 전문적 항원표출세포 및 이의 용도
WO2022211376A1 (ko) 키메릭 항원 수용체(car)를 포함하는 형질전환된 항원 특이적 전문적 항원표출세포 및 이의 용도
WO2021049920A1 (ko) 표면개질된 세포외 소포체 및 이를 포함하는 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20861461

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2020861461

Country of ref document: EP

Effective date: 20211222

NENP Non-entry into the national phase

Ref country code: DE