WO2021037978A1 - Procédés pour le diagnostic et le traitement du cancer - Google Patents

Procédés pour le diagnostic et le traitement du cancer Download PDF

Info

Publication number
WO2021037978A1
WO2021037978A1 PCT/EP2020/073971 EP2020073971W WO2021037978A1 WO 2021037978 A1 WO2021037978 A1 WO 2021037978A1 EP 2020073971 W EP2020073971 W EP 2020073971W WO 2021037978 A1 WO2021037978 A1 WO 2021037978A1
Authority
WO
WIPO (PCT)
Prior art keywords
glyphosate
cancer
subject
cells
dna
Prior art date
Application number
PCT/EP2020/073971
Other languages
English (en)
Inventor
Pierre-François CARTRON
Gwenola BOUGRAS-CARTRON
Manon DUFORESTEL
Original Assignee
INSERM (Institut National de la Santé et de la Recherche Médicale)
Université de Nantes
Institut De Cancérologie De L'ouest
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by INSERM (Institut National de la Santé et de la Recherche Médicale), Université de Nantes, Institut De Cancérologie De L'ouest filed Critical INSERM (Institut National de la Santé et de la Recherche Médicale)
Publication of WO2021037978A1 publication Critical patent/WO2021037978A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • A61K31/22—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin
    • A61K31/223—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin of alpha-aminoacids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/142—Toxicological screening, e.g. expression profiles which identify toxicity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers

Definitions

  • the present invention also relates to methods and compositions for the treatment of cancer.
  • the present invention relates to use of a signature of 5 genes as biomarkers of glyphosate exposure.
  • Epigenetic modifications govern heritable changes in phenotypes regulated at the chromatin level without requiring DNA sequence alteration. They are strongly modulated by environmental and lifestyle factors. For instance, epigenetic differences between monozygotic twins have been shown to arise over their life-course 1 . In honeybees, fertile queens and sterile workers are alternative forms of the adult female that develop from genetically identical larvae following differential feeding with royal jelly. This specific nutrition is responsible for triggering modifications in the epigenome via a DNA Methyl Transferase (DNMT) 3A- dependent mechanism 2 and histone post-translational modifications 3 .
  • DNMT DNA Methyl Transferase
  • herbicides have been increasingly recognized as epigenetic modifiers. Exposure to diuron was recently reported to affect the methylome of Pacific oysters 5 . In 2015, the International Agency for Research on Cancer (IARC) announced that the hazard of the herbicide glyphosate could be ranked as "probably carcinogenic to humans (Group 2A)”. Glyphosate was reported to induce the proliferation of human breast cancer cells via an impact on estrogen receptors 6 . This observation is supported by several other studies demonstrating that glyphosate can affect the activity of estrogen receptor alpha (ERa) and by ricochet, certain phenotypes of ERa positive cells within breast cancer cell populations 7 8 9
  • ERa estrogen receptor alpha
  • ricochet certain phenotypes of ERa positive cells within breast cancer cell populations 7 8 9
  • the data also uncover a specific DNA hypomethylation signature of genes (i.e., local DNA hypomethylation) related to TET3 pathway that might be used as epimark of glyphosate exposure.
  • the present invention also relates to methods and compositions for the treatment of cancer.
  • the present invention relates to use of a signature of 5 genes as biomarkers of glyphosate exposure.
  • Glyphosate triggered a significant reduction in DNA methylation as shown by the level of 5-methylcytosine DNA; however, in contrast to strong demethylating agent and cancer promoter UP peptide, glyphosate-treated cells did not lead to tumor development. While UP acts through a DNMT1/PCNA/UHRF1 pathway, glyphosate triggered increased activity of TET3. Combining glyphosate with enhanced expression of microRNA (miR) 182-5p associated with breast cancer induced tumor development in 50% of mice.
  • miR microRNA
  • the first object of the present invention relates to a method of determining whether a subject exposed to glyphosate has or is at a risk of developing a cancer comprising the steps of: i) determining the methylation level of at least one gene selected from MTRNR2L2, COL23A1, MSH3, DHFR and DUX4 genes in a sample obtained from the subject, and ii) comparing the methylation level determined at step i) with a predetermined reference value wherein detecting differential between the methylation level determined at step i) and the predetermined reference value is indicative of whether a subject exposed to glyphosate has or is at a risk of developing a cancer.
  • glyphosate also known as “N-(phosphonomethyl)glycine)
  • N-(phosphonomethyl)glycine has its general meaning in the art and refers to a broad-spectrum systemic herbicide and crop desiccant. It is an organophosphorus compound, specifically a phosphonate, which acts by inhibiting the plant enzyme 5 -enolpyruvylshikimate-3 -phosphate synthase.
  • the glyphosate has the following structure:
  • the terms “exposed to glyphosate” or “glyphosate exposure” relate to the first exposition of the subject to glyphosate, without limitation of the time of exposition.
  • the subject is exposed to glyphosate one time, two times, three times, four times, five times.
  • the subject is exposed to glyphosate few seconds to hours.
  • the subject is exposed to glyphosate during days or weeks or years.
  • the subject was exposed or is having a risk to be exposed.
  • the term “subject” denotes a mammal, such as a rodent, a feline, a canine, and a primate. Particularly, the subject according to the invention is a human. As used herein, the term “subject” encompasses “patient”.
  • the subject has or is at a risk of having cancer.
  • cancer has its general meaning in the art and refers to a group of diseases involving abnormal cell growth with the potential to invade or spread to other parts of the body.
  • cancer further encompasses both primary and metastatic cancers.
  • Examples of cancers that may treated by methods and compositions of the invention include, but are not limited to, cancer cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus.
  • the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acid
  • the subject has or is at a risk of having breast cancer.
  • breast cancer refers to any neoplastic pathology of the breast tissue, and includes all histological and molecular subtypes of breast neoplasia.
  • breast cancer tumor designates the abnormal mass of breast tissue composed of cancer, malignant cells.
  • risk in the context of the present invention, relates to the probability that an event will occur over a specific time period and can mean a subject's "absolute” risk or “relative” risk.
  • Absolute risk can be measured with reference to either actual observation post-measurement for the relevant time cohort, or with reference to index values developed from statistically valid historical cohorts that have been followed for the relevant time period.
  • Relative risk refers to the ratio of absolute risks of a subject compared either to the absolute risks of low risk cohorts or an average population risk, which can vary by how clinical risk factors are assessed.
  • Odds ratios the proportion of positive events to negative events for a given test result, are also commonly used (odds are according to the formula p/(l-p) where p is the probability of event and (1- p) is the probability of no event) to no- conversion.
  • "Risk evaluation,” or “evaluation of risk” in the context of the present invention encompasses making a prediction of the probability, odds, or likelihood that an event or disease state may occur, the rate of occurrence of the event or conversion from one disease state to another. Risk evaluation can also comprise prediction of future clinical parameters, traditional laboratory risk factor values, or other indices of relapse, either in absolute or relative terms in reference to a previously measured population.
  • the methods of the present invention may be used to make continuous or categorical measurements of the risk of conversion, thus diagnosing and defining the risk spectrum of a category of subjects defined as being at risk of conversion.
  • the invention can be used to discriminate between normal and other subject cohorts at higher risk.
  • the present invention may be used so as to discriminate those at risk from normal.
  • sample refers to any sample obtained from a subject, such as a serum sample, a plasma sample, a urine sample, a blood sample, a lymph sample, or a tissue sample.
  • sample is a tissue sample.
  • tissue when used in reference to a part of a body or of an organ, generally refers to an aggregation or collection of morphologically similar cells and associated accessory and support cells and intercellular matter, including extracellular matrix material, vascular supply, and fluids, acting together to perform specific functions in the body.
  • tissue There are generally four basic types of tissue in animals and humans including muscle, nerve, epithelial, and connective tissues.
  • the tissue sample when the subject suffers from a cancer, is a tumor tissue sample.
  • tumor tissue sample means any tissue tumor sample derived from the subject. Said tissue sample is obtained for the purpose of the in vitro evaluation.
  • the tumor sample may result from the tumor resected from the subject.
  • the tumor sample may result from a biopsy performed in the primary tumour of the subject or performed in metastatic sample distant from the primary tumor of the subject.
  • the tumor tissue sample encompasses a global primary tumor (as a whole), a tissue sample from the center of the tumor, a tumor tissue sample collected prior surgery (for follow-up of subjects after treatment for example), and a distant metastasis.
  • the tumor tissue sample can, of course, be subjected to a variety of well-known post-collection preparative and storage techniques (e.g., fixation, storage, freezing, etc.).
  • the sample can be fresh, frozen, fixed (e.g., formalin fixed), or embedded (e.g., paraffin embedded).
  • the inventors have showed that glyphosate exposure results to a TET3 overexpression which induces a global DNA hypomethylation.
  • the glyphosate-induced DNA hypomethylation can be detected via the methylation level of the MTRNR2L2 gene, COL23A1 gene, MSH3 gene, DHFR gene, DUX4.gene.
  • the term "gene” has its general meaning in the art and refers a DNA sequence that codes for or corresponds to a particular sequence of amino acids which comprise all or part of one or more proteins or enzymes, and may or may not include regulatory DNA sequences, such as promoter sequences, which determine for example the conditions under which the gene is expressed.
  • the name of each of the genes of interest refers to the internationally recognised name of the corresponding gene, as found in internationally recognised gene sequences and protein sequences databases, in particular in the database from the HUGO Gene Nomenclature Committee, that is available notably at the following Internet address: https://www.genenames.org/.
  • the name of each of the various biological markers of interest may also refer to the internationally recognised name of the corresponding gene, as found in the internationally recognised gene sequences and protein sequences databases ENTREZ ID, Genbank, TrEMBL or ENSEMBL.
  • the nucleic acid sequences corresponding to each of the gene of interest described herein may be retrieved by the one skilled in the art. (see Table A).
  • the methylation level of 1, 2, 3, 4 and/or 5, genes is determined.
  • the method of the present invention further comprises determining the methylation level of at least one gene selected from the group consisting of MTRNR2L2, COL23A1, MSH3, DHFR, DUX4.
  • the predetermined references values are determined from reference samples wherein the methylation level of the gene(s) was (were) determined and adjusted.
  • a set of reference samples characterized using both gene methylation level and another measurement technique such as immunohistochemistry, flow cytometry, or RNA can be used for defining the panel of the predetermined reference value.
  • Mixtures of known cellular proportions also can be suitable for determining the predetermined reference values.
  • control sample refers to a breast tissue or cells from a healthy subject, or to a healthy tissue of the subject.
  • the control sample may also refer to: i. a positive control sample indicative of the amount and/or methylation level of said at least one gene in a subject suffering from breast cancer with poor prognosis; ii. a negative control sample indicative of the amount and/or methylation level of said at least one gene in a healthy individual or in a healthy tissue of the subject
  • the methylation level of MTRNR2L2 gene is determined.
  • the methylation level of COL23 A1 gene is determined.
  • the methylation level of MSH3 gene is determined.
  • the methylation level of DHFR gene is determined.
  • the methylation level of DUX4 gene is determined.
  • methylation level of the MTRNR2L2 gene and the DUX4 gene is determined.
  • the level of methylation is determined. In a particular embodiment, the level of methylation of MTRNR2L2 gene, COL23A1 gene, MSH3 gene, DHFR gene, DUX4.gene is determined.
  • methylation has its general meaning in this art and refers to the addition of a methyl group on a substrate, or the substitution of an atom (or group) by a methyl group. Methylation is a form of alkylation, with a methyl group, rather than a larger carbon chain, replacing a hydrogen atom. Methylation is accomplished by enzymes; methylation can modify heavy metals, regulate gene expression, RNA processing and protein function. It has been recognized as a key process underlying epigenetics. As used herein, the term “methylation level” refers to the methylation level of MTRNR2L2 gene, COL23 A1 gene, MSH3 gene, DHFR gene, DUX4.gene.
  • the methylation level of the MTRNR2L2 gene, COL23 A1 gene, MSH3 gene, DHFR gene, DUX4.gene may be determined by any technology known by a person skilled in the art.
  • each gene methylation level may be measured at the genomic and/or nucleic and/or protein level.
  • the methylation level of gene is determined by measuring the amount of nucleic acid transcripts of each gene.
  • the methylation level is determined by measuring the amount of each gene corresponding protein. The amount of nucleic acid transcripts can be measured by any technology known by a man skilled in the art.
  • the measure may be carried out directly on an extracted messenger RNA (mRNA) sample, or on retrotranscribed complementary DNA (cDNA) prepared from extracted mRNA by technologies well-known in the art.
  • mRNA messenger RNA
  • cDNA retrotranscribed complementary DNA
  • the methylation level of a gene is determined by determining the quantity of mRNA.
  • the nucleic acid contained in the samples e.g., cell or tissue prepared from the subject
  • the extracted mRNA is then detected by hybridization (e. g., Northern blot analysis, in situ hybridization) and/or amplification (e.g., RT-PCR).
  • Other methods of Amplification include ligase chain reaction (LCR), transcription- mediated amplification (TMA), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA).
  • Nucleic acids having at least 10 nucleotides and exhibiting sequence complementarity or homology to the mRNA of interest herein find utility as hybridization probes or amplification primers. It is understood that such nucleic acids need not be identical, but are typically at least about 80% identical to the homologous region of comparable size, more preferably 85% identical and even more preferably 90-95% identical. In some embodiments, it will be advantageous to use nucleic acids in combination with appropriate means, such as a detectable label, for detecting hybridization.
  • Methylation level of a gene may be expressed as absolute level or normalized level.
  • levels are normalized by correcting the absolute level of a gene by comparing its methylation level to the methylation level of a gene that is not a relevant for determining the cancer stage of the subject, e.g., a housekeeping gene that is constitutively expressed.
  • Suitable genes for normalization include housekeeping genes such as the actin gene ACTB, ribosomal 18S gene, GUSB, PGK1 and TFRC. This normalization allows the comparison of the level in one sample, e.g., a subject sample, to another sample, or between samples from different sources.
  • the expression of TET3 is determined.
  • TET has its general meaning in the art and refers to the Ten-eleven translocation (TET).
  • TET family includes TET1, TET2 and TET3 and catalyzes the stepwise oxidation of 5-methylcytosine in DNA to 5 -hydroxy methyl cytosine and further oxidation products.
  • the inventors also show that two epigenetic events (global DNA hypomethylation and overexpression of a miR) cooperate to promote breast cancer.
  • the DNA hypomethylation level is determined.
  • DNA hypomethylation has its general meaning in this art and refers to the loss of the methyl group in the 5-methylcytosine nucleotide.
  • the miR-182-5p is determined.
  • miR-182-5p refers to a microRNA that is a small noncoding
  • the level of TET3 and/or the level of DNA hypomethylation and/or the level of miR-182-5p are determined.
  • the present invention relates to a method of determining whether a subject exposed to glyphosate has or is at a risk of developing a cancer comprising the steps of: i) determining the methylation level of at least one gene selected from MTRNR2L2, COL23A1, MSH3, DHFR and DUX4 genes and/or the level of TET3 and/or the level of miR-182-5p in a sample obtained from the subject, and ii) comparing the levels determined at step i) with the predetermined references values wherein detecting differential between the levels determined at step i) and the predetermined references value is indicative of whether a subject exposed to glyphosate has or is at a risk of developing a cancer.
  • the method of the present invention is also suitable for determining whether a subject exposed to glyphosate has or is at a risk of developing a cancer is eligible to a treatment.
  • the therapeutic agent of the invention includes TET-specific inhibitor DMOG or limit the intake of ascorbic acid or anti-miR182-5p.
  • the invention relates to a method for treating cancer in a subject exposed to glyphosate in need thereof comprising a step of administering said subject with a therapeutically effective amount of DMOG.
  • the present invention relates to DMOG for use in a method for treating cancer in a subject exposed to glyphosate in need thereof.
  • DMOG also known as “Dimethyloxaloylglycine” has its general meaning in the art and refers to a cell permeable prolyl-4-hydroxylase inhibitor, which upregulates HIF (hypoxia-inducible factor).
  • the invention relates to a method for treating cancer in a subject exposed to glyphosate in need thereof comprising a step of administering said subject with a therapeutically effective amount of an anti-miR182-5p.
  • the present invention relates to an anti-miR182-5p for use in a method for treating cancer in a subject exposed to glyphosate in need thereof.
  • anti-miR182-5p relates to an inhibitor of miR182-5p.
  • the invention relates to a method for treating cancer in a subject exposed to glyphosate in need thereof comprising a step of limiting intake of acid ascorbic.
  • the present invention relates to limiting intake of acid ascorbic for use in a method for treating cancer in a subject exposed to glyphosate in need thereof.
  • ascorbic acid has its general meaning in the art and refers to an organic compound with formula O ⁇ EEO ⁇ , originally called hexuronic acid.
  • the ascorbic acid has the following structure:
  • limiting intake refers to a consumption limited in ascorbic acid and to a limitation of products containing ascorbic acid.
  • examples of products containing ascorbic product include but are not limited to acerola Cherries, chili peppers, blackcurrants thyme, parsley, kiwis, broccoli.
  • the invention relates to a method for treating cancer in a subject exposed to glyphosate in need thereof comprising a step of administering said subject with a therapeutically effective amount of DMOG and/or a therapeutically effective amount of anti- miR182-5p and/or limiting intake of acid ascorbic.
  • the invention relates to a method for treating cancer in a subject exposed to glyphosate in need thereof comprising a step of i) determining the methylation level of at least one gene selected from MTRNR2L2, COL23A1, MSH3, DHFR and DUX4 genes in a sample obtained from the subject, and ii) comparing the methylation level determined at step i) with a predetermined reference value wherein detecting differential between the methylation level determined at step i) and a predetermined reference value is indicative of whether a subject exposed to glyphosate has or is at a risk of developing a cancer and iii) administering said subject with a therapeutically effective amount of DMOG and/or a therapeutically effective amount of anti-miR182-5p and/or limiting intake of acid ascorbic.
  • the invention relates to a method of treating cancer in a subject exposed to glyphosate has or is at a risk of developing a cancer comprising the steps of: i) determining the methylation level of at least one gene selected from MTRNR2L2, COL23A1, MSH3, DHFR and DUX4 genes and/or the level of TET3 and/or the level of miR-182-5p in a sample obtained from the subject, and ii) comparing the levels determined at step i) with the predetermined references values wherein detecting differential between the levels determined at step i) and the predetermined references value is indicative of whether a subject exposed to glyphosate has or is at a risk of developing a cancer and iii) administering said subject with a therapeutically effective amount of DMOG and/or a therapeutically effective amount of anti- miR182-5p and/or limiting intake of acid ascorbic.
  • the subject of the invention determined by the method of the present invention will be treated by a therapeutically effective amount of DMOG and/or a therapeutically effective amount of anti-miR182-5p and/or limiting intake of acid ascorbic.
  • treating refers to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subject at risk of contracting the disease or suspected to have contracted the disease as well as subject who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse.
  • the treatment may be administered to a subject having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment.
  • therapeutic regimen is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy.
  • a therapeutic regimen may include an induction regimen and a maintenance regimen.
  • the phrase “induction regimen” or “induction period” refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease.
  • the general goal of an induction regimen is to provide a high level of drug to a subject during the initial period of a treatment regimen.
  • An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both.
  • maintenance regimen refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years).
  • a maintenance regimen may employ continuous therapy (e.g., administering a drug at a regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., pain, disease manifestation, etc.]).
  • Any therapeutic agent of the invention may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form pharmaceutical compositions.
  • “Pharmaceutically” or “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate.
  • a pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • compositions for example, the route of administration, the dosage and the regimen naturally depend upon the condition to be treated, the severity of the illness, the age, weight, and sex of the patient, etc.
  • compositions of the invention can be formulated for a topical, oral, intranasal, parenteral, intraocular, intravenous, intramuscular or subcutaneous administration and the like.
  • compositions of the present invention may comprise a further therapeutic active agent.
  • anti-cancer agents may be added to the pharmaceutical composition as described below.
  • Anti-cancer agents denote all compounds use in chemotherapy and immunotherapy.
  • chemotherapeutic agent refers to chemical compounds that are effective in inhibiting tumor growth.
  • examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethylenethiophosphaorarnide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a carnptothecin (including the synthetic analogue topotecan); bryostatin; cally statin; CC-1065 (including its adozelesin, carzeles
  • calicheamicin especially calicheamicin (11 and calicheamicin 211, see, e.g., Agnew Chem Inti. Ed. Engl. 33:183-186 (1994); dynemicin, including dynemicin A; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromomophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, canninomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin, 6- diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino- doxorubicin, 2-pyrrolino
  • paclitaxel (TAXOL®, Bristol-Myers Squibb Oncology, Princeton, N.].) and doxetaxel (TAXOTERE®, Rhone-Poulenc Rorer, Antony, France); chlorambucil; gemcitabine; 6- thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP- 16); ifosfamide; mitomycin C; mitoxantrone; vincristine; vinorelbine; navelbine; novantrone; teniposide; daunomycin; aminopterin; xeloda; ibandronate; CPT-1 1 ; topoisomerase inhibitor RFS 2000; difluoromethylomithine (DMFO); retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
  • anti-estrogens including for example tamoxifen, raloxifene, aromatase inhibiting 4(5)-imidazoles, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and toremifene (Fareston); and anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; and phannaceutically acceptable salts, acids or derivatives of any of the above.
  • radiotherapy denotes all treatment with a radiotherapeutic agent.
  • radiotherapeutic agent as used herein, is intended to refer to any radiotherapeutic agent known to one of skill in the art to be effective to treat or ameliorate cancer, without limitation.
  • the radiotherapeutic agent can be an agent such as those administered in brachytherapy or radionuclide therapy.
  • Such methods can optionally further comprise the administration of one or more additional cancer therapies, such as, but not limited to, chemotherapies, and/or another radiotherapy.
  • immunotherapy denotes all treatment with an immunotherapeutic agent.
  • immunotherapeutic agent refers to a compound, composition or treatment that indirectly or directly enhances, stimulates or increases the body's immune response against cancer cells and/or that decreases the side effects of other anticancer therapies. Immunotherapy is thus a therapy that directly or indirectly stimulates or enhances the immune system's responses to cancer cells and/or lessens the side effects that may have been caused by other anti-cancer agents. Immunotherapy is also referred to in the art as immunologic therapy, biological therapy biological response modifier therapy and biotherapy.
  • immunotherapeutic agents examples include, but are not limited to, cytokines, cancer vaccines, monoclonal antibodies and non-cytokine adjuvants.
  • the immunotherapeutic treatment may consist of administering the subject with an amount of immune cells (T cells, NK, cells, dendritic cells, B cells).
  • Immunotherapeutic agents can be non-specific, i.e. boost the immune system generally so that the human body becomes more effective in fighting the growth and/or spread of cancer cells, or they can be specific, i.e. targeted to the cancer cells themselves immunotherapy regimens may combine the use of non specific and specific immunotherapeutic agents.
  • Non-specific immunotherapeutic agents are substances that stimulate or indirectly improve the immune system.
  • Non-specific immunotherapeutic agents have been used alone as a main therapy for the treatment of cancer, as well as in addition to a main therapy, in which case the non-specific immunotherapeutic agent functions as an adjuvant to enhance the effectiveness of other therapies (e.g. cancer vaccines).
  • Non-specific immunotherapeutic agents can also function in this latter context to reduce the side effects of other therapies, for example, bone marrow suppression induced by certain chemotherapeutic agents.
  • Non-specific immunotherapeutic agents can act on key immune system cells and cause secondary responses, such as increased production of cytokines and immunoglobulins. Alternatively, the agents can themselves comprise cytokines.
  • Non specific immunotherapeutic agents are generally classified as cytokines or non-cytokine adjuvants.
  • cytokines have found application in the treatment of cancer either as general non-specific immunotherapies designed to boost the immune system, or as adjuvants provided with other therapies.
  • Suitable cytokines include, but are not limited to, interferons, interleukins and colony- stimulating factors.
  • Interferons (IFNs) contemplated by the present invention include the common types of IFNs, IFN-alpha (IFN-a), IFN-beta (IFN-b) and IFN- gamma (IFN-g).
  • IFNs can act directly on cancer cells, for example, by slowing their growth, promoting their development into cells with more normal behaviour and/or increasing their production of antigens thus making the cancer cells easier for the immune system to recognise and destroy.
  • IFNs can also act indirectly on cancer cells, for example, by slowing down angiogenesis, boosting the immune system and/or stimulating natural killer (NK) cells, T cells and macrophages.
  • Recombinant IFN-alpha is available commercially as Roferon (Roche Pharmaceuticals) and Intron A (Schering Corporation).
  • Interleukins contemplated by the present invention include IL-2, IL-4, IL-11 and IL-12. Examples of commercially available recombinant interleukins include Proleukin® (IL-2; Chiron Corporation) and Neumega® (IL- 12; Wyeth Pharmaceuticals). Zymogenetics, Inc.
  • Colony-stimulating factors contemplated by the present invention include granulocyte colony stimulating factor (G-CSF or filgrastim), granulocyte-macrophage colony stimulating factor (GM-CSF or sargramostim) and erythropoietin (epoetin alfa, darbepoietin). Treatment with one or more growth factors can help to stimulate the generation of new blood cells in subjects undergoing traditional chemotherapy.
  • CSFs can be helpful in decreasing the side effects associated with chemotherapy and can allow for higher doses of chemotherapeutic agents to be used.
  • Various-recombinant colony stimulating factors are available commercially, for example, Neupogen® (G-CSF; Amgen), Neulasta (pelfilgrastim; Amgen), Leukine (GM-CSF; Berlex), Procrit (erythropoietin; Ortho Biotech), Epogen (erythropoietin; Amgen), Arnesp (erytropoietin).
  • immunotherapeutic agents can be active, i.e. stimulate the body's own immune response, or they can be passive, i.e.
  • Passive specific immunotherapy typically involves the use of one or more monoclonal antibodies that are specific for a particular antigen found on the surface of a cancer cell or that are specific for a particular cell growth factor.
  • Monoclonal antibodies may be used in the treatment of cancer in a number of ways, for example, to enhance a subject's immune response to a specific type of cancer, to interfere with the growth of cancer cells by targeting specific cell growth factors, such as those involved in angiogenesis, or by enhancing the delivery of other anticancer agents to cancer cells when linked or conjugated to agents such as chemotherapeutic agents, radioactive particles or toxins.
  • Monoclonal antibodies currently used as cancer immunotherapeutic agents that are suitable for inclusion in the combinations of the present invention include, but are not limited to, rituximab (Rituxan®), trastuzumab (Herceptin®), ibritumomab tiuxetan (Zevalin®), tositumomab (Bexxar®), cetuximab (C-225, Erbitux®), bevacizumab (Avastin®), gemtuzumab ozogamicin (Mylotarg®), alemtuzumab (Campath®), and BL22.
  • Other examples include anti-CTLA4 antibodies (e.g.
  • antibodies include B cell depleting antibodies.
  • Typical B cell depleting antibodies include but are not limited to anti-CD20 monoclonal antibodies [e.g.
  • the immunotherapeutic treatment may consist of allografting, in particular, allograft with hematopoietic stem cell HSC.
  • the immunotherapeutic treatment may also consist in an adoptive immunotherapy as described by Nicholas P. Restifo, Mark E.
  • circulating lymphocytes NK cells
  • the activated lymphocytes or NK cells are most preferably be the subject’s own cells that were earlier isolated from a blood or tumor sample and activated (or “expanded”) in vitro.
  • a “therapeutically effective amount” of the inhibitor of the present invention as above described is meant a sufficient amount of the inhibitor for treating GISTs at a reasonable benefit/risk ratio applicable to any medical treatment. It will be understood, however, that the total daily usage of the inhibitors and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment.
  • the specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific inhibitor employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific inhibitor employed; the duration of the treatment; drugs used in combination or coincidental with the specific inhibitor employed; and like factors well known in the medical arts.
  • the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day.
  • the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the inhibitor of the present invention for the symptomatic adjustment of the dosage to the subject to be treated.
  • a medicament typically contains from about 0.01 mg to about 500 mg of the inhibitor of the present invention, preferably from 1 mg to about 100 mg of the inhibitor of the present invention.
  • An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day.
  • i) DMOG and ii) anti-miR182-5p inhibitor as a combined preparation according to the invention for simultaneous, separate or sequential use in the method for treating a cancer in a subject according to the invention.
  • the term “combination” is intended to refer to all forms of administration that provide a first drug together with a further (second, third%) drug.
  • the drugs may be administered simultaneous, separate or sequential and in any order.
  • the drug is administered to the subject using any suitable method that enables the drug to reach the lungs.
  • the drug administered to the subject systemically (i.e. via systemic administration).
  • the drug is administered to the subject such that it enters the circulatory system and is distributed throughout the body.
  • the drug is administered to the subject by local administration, for example by local administration to the lungs.
  • the terms “combined treatment”, “combined therapy” or “therapy combination” refer to a treatment that uses more than one medication.
  • the combined therapy may be dual therapy or bi-therapy.
  • administration simultaneously refers to administration of 2 active ingredients by the same route and at the same time or at substantially the same time.
  • administration separately refers to an administration of 2 active ingredients at the same time or at substantially the same time by different routes.
  • administration sequentially refers to an administration of 2 active ingredients at different times, the administration route being identical or different.
  • FIGURES are a diagrammatic representation of FIGURES.
  • FIG. 1 Glyphosate exposure promotes a TET3-mediated global DNA hypomethylation.
  • MCF10A cells were treated according to a timetable shown in (A) and analyzed on day 21 of culture (UP peptide promotes DNMT1/PCNA/UHRF1 disruption).
  • B In-Cell ELISA was used to quantify TET proteins.
  • C MCF10A cells were transfected either with siRNA for TET3 or with control siRNA (siRNA-A) and treated with glyphosate [Glyphosate] or vehicle DMSO [MCF10A] according to a timetable shown in figure (1A).
  • FIG. 1 Glyphosate-induced TET3-mediated demethylations affects MTRNR2L2 and DUX4 genes.
  • A The timetable illustrates the experiment design. Explanations for color coded days are located in corresponding color rectangles underneath the timeline.
  • B MCF10A cells were treated with glyphosate for 21 days as in the schedule shown on figure 2A. The graphs illustrate TET3 -enrichment (top), following chromatin immunoprecipitation (ChIP) and the methylation level measured by qMSRE (bottom), of five genes defined by the ChIP atlas as being TET3-targeted genes.
  • ChIP chromatin immunoprecipitation
  • qMSRE bottom
  • (C) MCF10A cells were treated with glyphosate for 21 days (according to the timetable of figure 2A), with siRNA added concomitantly to glyphosate.
  • MCF10A cells were cultured in DMEM/F12 supplemented with 5% horse serum (Invitrogen, Cergy Pontoise, France), 500 ng/ml hydrocortisone (Sigma- Aldrich, France), 100 ng/ml cholera toxin (Sigma- Aldrich, France), 10 pg/ml insulin (Therm oFisher, France) and 20 ng/ml epidermal growth factor (EGF, Sigma-Aldrich, France), penicillin (100 U/mL), and 2 mmol/L Lglutamine.
  • horse serum Invitrogen, Cergy Pontoise, France
  • 500 ng/ml hydrocortisone Sigma- Aldrich, France
  • 100 ng/ml cholera toxin Sigma- Aldrich, France
  • 10 pg/ml insulin Therm oFisher, France
  • EGF epidermal growth factor
  • penicillin 100 U/mL
  • MCF7 and MDA-MB-231 cells were cultured in DMEM medium (Invitrogen) all supplemented with 5 % FCS and 2 mM 1-glutamine.
  • Glyphosate (CAS 1071- 83-6, sc-211568) was purchased from Santa-Cruz (France) and a 10 8 M stock solution was prepared in DMSO every week. Glyphosate was diluted directly in fresh cell culture medium and was fed to the cells at the timepoints indicated in the results section.
  • miRCury LNA miRNA mimics for the has-miR-146a, has-miR-182-5p, has- miR-27a, has-miR-500a-5p, has-miR-30a, and has-miR-495 (Qiagen, France), siRNA for siRNA-TET3 (sc94636) and control siRNA-A (sc94636) and HIPerfect Transfection Reagent (Qiagen).
  • a QIAcube automate and QIAmp DNA Mini QiaCube kit were used to isolate DNA.
  • the quantification of 5-mC was performed using the 5-mC DNA ELISA Kit (Zymo Research-Euromodex, France) according to the manufacturer’s instructions.
  • the 5mC DNA ELISA Kit estimates the number of 5mC on DNA without distinction of localization; therefore, we used the term of global DNA methylation level when referring to results obtained via this mode of quantification.
  • DNA methylation was quantified by qMSRE. Digestions were performed with adequate restriction enzymes, Hpall and Acil (NEB, France). Typically, 1 ng of genomic DNA were digested with 40 U of enzymes at 37°C for 2h in 50 pi of reaction. Control samples were treated in the same way but without addition of the enzyme. Five pi of digestion mixture were used for qPCR.
  • MSH3 TTTCTCCAGGGCTGGGACTTTG (SEQ ID NO: 1)
  • DHFR AAACCTCAGCGCTTCACCCAAT (SEQ ID NO: 3)
  • MTRNR2L2 ACCCCACCTGTTTACCAA (SEQ ID NO: 9) and
  • mice The experimental procedures with animals were in accordance with the guidelines of Institutional Animal Care and the French National Committee of Ethics. In addition, all experiments were conducted according to the Regulations for Animal Experimentation at the “Plateforme Animalerie” in the “Institut deInstitut en Sante de l'Universite de France (IRS- UN)” and approved by the French National Committee of Ethics. The number of mice was restricted to four per condition to limit the number of animals to the necessary minimum as in previous studies (Hervouet et al, 2010) (Pacaud et al, 2014) based on th fact that we anticipated to detect a highly frequent tumorigenic event (frequency superior to 1 to 4 for tumorigenesis).
  • PCTCdX xenografts
  • PCTCdX (here named Glypho-iBPCTC) were obtained after mechanical dissociation. Briefly, resected tumor tissue from mice was cut into pieces of 1-5 mm 3 and plated in a 60 mm 2 tissue culture dish with DMEM containing 10% FBS and antibiotics. Minced pieces of tumor were incubated with 200 U/ml collagenase I (Sigma) and 500 U/ml DNase I (Sigma) in PBS for lh at 37oC with vigorous constant agitation. The single-cell suspension was filtered through a 70 mm cell strainer (BD Falcon), washed with PBS, and then placed in DMEM-10% FBS. Cell cultures were split 1:5 when confluent.
  • Cells (3xl0 5 ) were seeded in six-well plates, cultured until they reached 80-90% confluence and treated with 10 pg/ml of mitomycin C (Sigma, France) for 2h (in order to prevent cell proliferation).
  • the monolayer of cells was scratched using a 2 Well silicone insert (Ibidi, Germany).
  • Cell migration was monitored by microscopy (Incellis Cell Imager, Bertin, France). The images acquired at different time points (0, 4, 8, 24, 28, 32 and 48h) for each sample were analyzed quantitatively. For each image, distances between one side of the wound and the other side were measured with ImageJ software; the mean value of 10 measurements all along the wound was recorded. The average migration speed was obtained by calculating the ratio distance/time along the time-course.
  • a cell suspension containing 10 5 cells was prepared and 100 pi were distributed in sixplicates in a 96-well plate. After 24h of incubation at 37°C and 5% C02 cells were exposed to tamoxifen for 48h. Tamoxifen was firstly diluted 10 times in Dimethyl sulfoxide (DMSO) and then, further diluted in DMEM containing 4.5 g/L glucose, 1% SVF, 1% Glutamine, 1%
  • DMSO Dimethyl sulfoxide
  • Penicillin-Streptomycin at the desired concentrations. Following treatment, 10 m ⁇ of MTT (10 pg/mL) were added in each well and the cells were incubated during 3h. Finally, the medium containing MTT was removed and 200 m ⁇ /well of DMSO were added to measure the optical density at 570 nm using a spectrophotometer.
  • XTT Assay Kit (ab232856, Abeam, France) according to the manufacturer’s instructions. Briefly, 105 cells were seeded in 100 m ⁇ of culture medium in each well of a 96-well plate. After 24h of incubation at 37°C and 5% C02, cells were treated with adequate drugs. Then, 10 m ⁇ /well of XTT mixture was added for an incubation of 2h at 37°C and 5% C02. Finally, absorbance was measured at 450 nm.
  • mMTase Maintenance methyltransferase
  • TET activity was determined using the Epigenase 5mC -Hydroxylase TET Activity/Inhibition Assay Kit (Colorimetric) (Epigentek/Euromedex, France) according to the manufacturer’s instructions. Dnmts-magnetic beads (DMB) assays were performed to estimate mMTase, such as initially described43.
  • DMB Dnmts-magnetic beads
  • a typical methylation reaction required 50 pg of nuclear extract (Nuclear extract kit, Active Motif, France), 125 nM DNA oligonucleotides (probes), and 900 nM tritium-labeled AdoMet (1 mCi/mL; #NET155V001MC; PerkinElmer, France), in reaction buffer (50 mM Tris, pH 8.0, 5 mM EDTA, 10% glycerol, 0.5 mM phenylmethylsulfonyl fluoride). After incubation at 37°C for lh, reactions were quenched with an equal volume of magnetic beads suspension and incubated for 15 min at room temperature. Next, the beads were magnetically isolated from the reaction mix, and tritium incorporation was measured by scintillation counting.
  • Antibodies used were anti-TETl (scl63446, Santa Cruz, France), anti-TET2 (sc398535, Santa Cruz), anti-TET3 (scl39186, Santa Cruz), anti-ERa (sc8002, Santa Cruz), anti-PR (scl30071, Santa Cruz) and anti-HER2 (sc-393712, Santa Cruz).
  • ChIP were performed using the ChIP-IT Express kit (Active Motif, France) according to the manufacturer’s instructions.
  • the cross-linking step was performed by treating the cells with 37% formaldehyde solution for 15 min at room temperature. Sonication was performed with the Bioruptor Plus (8 cycles 30sec ON/90sec OFF) (Diagenode, France).
  • the QuantiFast SYBR Green PCR Kit and Rotor-Gene Q were used to perform the qPCR.
  • Antibodies used were: Anti-IgG (Abeam, AB2410) and anti-TET3 (scl39186, Santa Cruz).
  • Exposure to glyphosate promotes TET3-mediated global DNA hypomethylation in MCF10A cells.
  • DNA hypomethylation has been shown to play a determining role in cancer development 12 13 14 .
  • non-neoplastic breast epithelial MCF10A cells were treated with a low dose (10- 11M) of this herbicide every three to four days over 21 days, covering three passage numbers whereas control cultures were treated with vehicle DMSO ( Figure 1A).
  • Figure 1A Several articles analyzing the effect of glyphosate on human cells have reported using 10-11 M (Thongprakaisang et al., 2013) (Mesnage et al., 2017) (Sritana et al., 2018).
  • MCF10A cells were viable as measured by XTT (2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)- 2H-tetrazolium-5-carboxanilide) assay at this concentration (Data not shown).
  • glyphosate 10-11 M is below the concentration detected in biological fluids (milk, serum, urine) (Yoshioka et al., 201 l)(Acquavella et al., 2004)(Steinbom et al., 2016).
  • Glyphosate exposure is tumorigenic for MCF10A cells in a “two-factor hit” model.
  • Pan-cancer RNA-seq data available from the KM plotter database revealed that although TET3 overexpression is associated with a favorable overall survival in head & neck squamous cell carcinoma, thymoma, and thyroid carcinoma; in contrast, it is associated with an unfavorable overall survival in breast cancer, as well as cervical squamous cell carcinoma, kidney renal papillary cell carcinoma, liver hepatocellular carcinoma, pheochromocytoma and paraganglioma and uterine corpus endometrial carcinoma (Data not shown).
  • PCTC tumor cells
  • Glypho-iBPCTC glyphosate-induced breast tumors
  • MCF-7 luminal A
  • MDA-MB-231 triple negative breast cancer cells
  • MCF7 and MDA-MB-231 cells were ERa+/PR+/HER2- (luminal A) and ERa-/PR-/HER2- (triple negative), respectively, and revealed that Glypho-iBPCTC were ERa+/PR-/HER2-, hence corresponding to a luminal B type of breast cancer with poorer outcome compared to ER+/PR+/HER2- subtype 21 (Data not shown).
  • MCF10A cells were transfected with miR-182-5p and exposed to 10 11 M of glyphosate (MCF10A glyphosate/miR 182 5p ) every three to four days over a 21 -day period.
  • MCF10A glyphosate/miR 182 5p cells were also treated in a similar manner with two therapeutic agents, an anti-miR-182-5p (50 nM) and dimethyloxallyl glycine (DMOG, 1 mM), a compound that blocks TET enzymatic activity26 (Data not shown).
  • Glyphosate exposure induces sustained TET3-mediated gene demethylation.
  • the hypomethylation induced by glyphosate treatment is sufficient for tumor onset when using a “two-factor hit” model with induced overexpression of miR-182-5p. Therefore, we investigated the possibility that an epimark of hypomethylation might be imprinted in the DNA.
  • the putative epimark induced by glyphosate might be the hypomethylation of TET3 -targeted genes, since TET3 mediates glyphosate-induced DNA hypomethylation.
  • the chromatin immunoprecipitation (ChIP) atlas database identifies MTRNR2L2, COL23A1, MSH3, DHFR and DUX4 as the most frequently present in TET3- ChlP hits.
  • ChIP experiments using anti-TET3 antibody were performed for chromatin obtained from MCF10A cells treated or not with glyphosate for 21 days such as described in Figure 1A.
  • MTRNRL2 and DUX4 genes were immunoprecipitated by TET3 in MCF10A cells treated with glyphosate.
  • COL23A1, MSH3, and DHFR genes were not immunoprecipitated in both untreated and treated MCF10A cells.
  • the prediction made by the ChIP atlas database was validated for MTRNRL2 and DUX4 genes and not for the COL23A1, MSH3, and DHFR genes, suggesting a context dependent accessibility for this set of TET3-controled genes.
  • TET3 might act by inhibiting epithelial-to- mesenchymal transition in ovarian and melanoma cancers 32 33 .
  • our analysis with KM plotter database revealed a potentially unfavorable outcome for breast cancers when TET3 is overexpressed (Data not shown).
  • miR- 10b delays oncogene-induced mammary tumorigenesis 37
  • overexpression of miR- 489 inhibits HER2/neu-induced mammary tumorigenesis 38 .
  • the expression of miR depends on epigenetic control, it seems that either an extensive global hypomethylation of DNA (like with UP peptide) or a less extensive global hypomethylation associated with local epigenetic alteration affecting a miR might lead to tumor onset. The mechanisms associated with specific targeting of miR expression remain to be understood.
  • glyphosate-induced DNA hypomethylation can be detected via the methylation level of only two of the five genes predicted to be controlled by TET3, MTRNR2L2 and DUX4 genes. Even if several other factors than glyphosate-induced TET3- mediated DNA hypomethylation (such as chromatin structure, other epimark,...) can govern the methylation status of the five genes, MTRNR2L2, DUX4 COL23A1, MSH3 and DHFR, our preliminary data with human samples support the idea that the study of the methylation status of these five genes might be important to obtain a marker of risk based on a MethylGlypho score.
  • DUX4 and MTRNR2L2 may appear as players in this process instead of only be considered potential biomarkers.
  • Results with KM plotter and BC- GenExMiner indicate that DUX4 level is negatively associated with breast cancer prognosis. No data seem available on MTRN2L2 in these databases.
  • DUX4 could act as an oncogene in various sarcomas and hematological malignancies (Dib et al, 2019), while we could not find information in the literature revealing a putative oncogenic role for MTRNR2L2.
  • TET3 -controlled genes are worth further investigation to establish their causal effect in mammary tumorigenesis in future work. Furthermore, knowing the epigenetic pathway involved in glyphosate-mediated risk increase might lead to prevention strategies to follow detection of the epigenetic risk. Our findings suggest that TET-specific inhibitor DMOG might be a plausible “therapeutic intervention” since it gave a satisfactory response on both DNA methylation and tumor incidence. It would act by limiting TET3-mediated global DNA hypomethylation. In contrast, global re-methylation of DNA by folate that has been considered for possible preventive effect 42 is insufficient to prevent tumor incidence in the case of glyphosate exposure (Hervouet et al., 2009) (Cartron et al., 2012). Another interesting direction would be to limit the intake of ascorbic acid since it not only further reduced DNA methylation but also increased tumor incidence in mice. The epigenetic pathway leading to DNA hypomethylation is an important aspect to consider for further translational work on breast cancer risk.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pathology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Oncology (AREA)
  • Emergency Medicine (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Cette invention concerne des méthodes et des compositions pour le traitement du cancer. En particulier, la présente invention concerne un procédé pour déterminer si un sujet exposé au glyphosate souffre d'un cancer ou est susceptible d'en développer un, et comprend les étapes suivantes : i) détermination du niveau de méthylation d'au moins un gène choisi parmi MTRNR2L2, COL23A1, MSH3, DHFR et DUX4 dans un échantillon prélevé chez le sujet, et ii) comparaison du niveau de méthylation déterminé à l'étape i) avec une valeur de référence prédéterminée, la détection différentielle entre le niveau de méthylation déterminé à l'étape i) et la valeur de référence prédéterminée indiquant si un sujet exposé au glyphosate souffre d'un cancer ou est susceptible d'en développer un. La présente invention concerne également une méthode de traitement du cancer chez un sujet exposé au glyphosate en ayant besoin, comprenant une étape d'administration audit sujet d'une quantité thérapeutiquement efficace de DMOG et/ou d'une quantité thérapeutiquement efficace d'anti-miR182-5p et/ou de limitation de l'absorption d'acide ascorbique.
PCT/EP2020/073971 2019-08-28 2020-08-27 Procédés pour le diagnostic et le traitement du cancer WO2021037978A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP19306040.7 2019-08-28
EP19306040 2019-08-28

Publications (1)

Publication Number Publication Date
WO2021037978A1 true WO2021037978A1 (fr) 2021-03-04

Family

ID=67956665

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2020/073971 WO2021037978A1 (fr) 2019-08-28 2020-08-27 Procédés pour le diagnostic et le traitement du cancer

Country Status (1)

Country Link
WO (1) WO2021037978A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7109304B2 (en) 2003-07-31 2006-09-19 Immunomedics, Inc. Humanized anti-CD19 antibodies
US20120207856A1 (en) * 2011-02-12 2012-08-16 Baylor Research Institute MSH3 Expression Status Determines the Responsiveness of Cancer Cells to the Chemotherapeutic Treatment with PARP Inhibitors and Platinum Drugs

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7109304B2 (en) 2003-07-31 2006-09-19 Immunomedics, Inc. Humanized anti-CD19 antibodies
US20120207856A1 (en) * 2011-02-12 2012-08-16 Baylor Research Institute MSH3 Expression Status Determines the Responsiveness of Cancer Cells to the Chemotherapeutic Treatment with PARP Inhibitors and Platinum Drugs

Non-Patent Citations (53)

* Cited by examiner, † Cited by third party
Title
"Agnew Chem Intl. Ed. Engl.", vol. 33, 1994, pages: 183 - 186
AMBATIPUDI, S. ET AL.: "DNA methylome analysis identifies accelerated epigenetic ageing associated with postmenopausal breast cancer susceptibility", EUR. J. CANCER, vol. 75, 2017, pages 299 - 307, XP029959215, DOI: 10.1016/j.ejca.2017.01.014
ANAND, P. ET AL.: "Cancer is a preventable disease that requires major lifestyle changes", PHARM. RES., vol. 25, 2008, pages 2097 - 2116, XP019613206
BASSI, S.TRIPATHI, T.MONZIANI, A.DI LEVA, F.BIAGIOLI, M.: "Epigenetics of Huntington's Disease", ADV. EXP. MED. BIOL., vol. 978, 2017, pages 277 - 299
CAO, M. ET AL.: "MicroRNA-495 induces breast cancer cell migration by targeting JAM-A", PROTEIN CELL, vol. 5, 2014, pages 862 - 872, XP035734376, DOI: 10.1007/s13238-014-0088-2
CARLA DIB ET AL: "DUX4 Pathological Expression: Causes and Consequences in Cancer", TRENDS IN CANCER, vol. 5, no. 5, 1 May 2019 (2019-05-01), US, pages 268 - 271, XP055670899, ISSN: 2405-8033, DOI: 10.1016/j.trecan.2019.03.001 *
CARTRON, P.-F. ET AL.: "Folate supplementation limits the tumourigenesis in rodent models of gliomagenesis", EUR. J. CANCER, vol. 48, 2012, pages 2431 - 2441
CHEN, P. ET AL.: "Higher dietary folate intake reduces the breast cancer risk: a systematic review and meta-analysis", BR. J. CANCER, vol. 110, 2014, pages 2327 - 2338
CHRISTINA GILLEZEAU ET AL: "The evidence of human exposure to glyphosate: a review", ENVIRONMENTAL HEALTH, vol. 18, no. 1, 7 January 2019 (2019-01-07), XP055670881, DOI: 10.1186/s12940-018-0435-5 *
DAVIES, A. H. ET AL.: "YB-1 transforms human mammary epithelial cells through chromatin remodeling leading to the development of basal-like breast cancer", STEM CELLS, vol. 32, 2014, pages 1437 - 1450
DE ALMEIDA, L. K. S.PLETSCHKE, B. I.FROST, C. L.: "Moderate levels of glyphosate and its formulations vary in their cytotoxicity and genotoxicity in a whole blood model and in human cell lines with different estrogen receptor status", BIOTECH, vol. 3, no. 8, 2018, pages 438
DE BENEDETTI ET AL., J IMMUNOL, vol. 166, 2001, pages 4334 - 4340
DEGLI ESPOSTI, D. ET AL.: "miR-500a-5p regulates oxidative stress response genes in breast cancer and predicts cancer survival", SCI REP, vol. 7, 2017, pages 15966
DI GENNARO, A. ET AL.: "A p53/miR-30a/ZEB2 axis controls triple negative breast cancer aggressiveness", CELL DEATH DIFFER., vol. 25, 2018, pages 2165 - 2180, XP036861311, DOI: 10.1038/s41418-018-0103-x
FRAGA, M. F. ET AL.: "Epigenetic differences arise during the lifetime of monozygotic twins", PROC. NATL. ACAD. SCI. U.S.A., vol. 102, 2005, pages 10604 - 10609
GAUDET, F. ET AL.: "Induction of tumors in mice by genomic hypomethylation", SCIENCE, vol. 300, 2003, pages 489 - 492
GOKSU, S. S. ET AL.: "Clinicopathologic features and molecular subtypes of breast cancer in young women (age <35", ASIAN PAC. J. CANCER PREV., vol. 15, 2014, pages 6665 - 6668
GONG, F. ET AL.: "Epigenetic silencing of TET2 and TET3 induces an EMT-like process in melanoma", ONCOTARGET, vol. 8, 2017, pages 315 - 328
GOOD, C. R. ET AL.: "TETl-Mediated Hypomethylation Activates Oncogenic Signaling in Triple-Negative Breast Cancer", CANCER RES., vol. 78, 2018, pages 4126 - 4137
HERVOUET, E. ET AL.: "Disruption of Dnmtl/PCNA/UHRFl interactions promotes tumorigenesis from human and mice glial cells", PLOS ONE, vol. 5, 2010, pages el 1333
HERVOUET, E. ET AL.: "Folate supplementation limits the aggressiveness of glioma via the remethylation of DNA repeats element and genes governing apoptosis and proliferation", CLIN.CANCER RES., vol. 15, 2009, pages 3519 - 3529
INIC, Z. ET AL.: "Difference between Luminal A and Luminal B Subtypes According to Ki-67, Tumor Size, and Progesterone Receptor Negativity Providing Prognostic Information", CLIN MED INSIGHTS ONCOL, vol. 8, 2014, pages 107 - 111
JIANG, G.SHI, W.FANG, H.ZHANG, X.: "miR-27a promotes human breast cancer cell migration by inducing EMT in a FBXW7-dependent manner", MOL MED REP, vol. 18, 2018, pages 5417 - 5426
JUDES, G. ET AL.: "TIP60: an actor in acetylation of H3K4 and tumor development in breast cancer", EPIGENOMICS, 2018
KIM, G. ET AL.: "Herbicide injury induces DNA methylome alterations in Arabidopsis", PEERJ, vol. 5, 2017, pages e3560
KIM, J. ET AL.: "Ablation of miR-lOb Suppresses Oncogene-Induced Mammary Tumorigenesis and Metastasis and Reactivates Tumor-Suppressive Pathways", CANCER RES., vol. 76, 2016, pages 6424 - 6435
KUCHARSKI, R.MALESZKA, J.FORET, S.MALESZKA, R.: "Nutritional control of reproductive status in honeybees via DNA methylation", SCIENCE, vol. 319, 2008, pages 1827 - 1830, XP002557465, DOI: 10.1126/science.1153069
KWIATKOWSKA, M. ET AL.: "DNA damage and methylation induced by glyphosate in human peripheral blood mononuclear cells (in vitro study", FOOD CHEM. TOXICOL., vol. 105, 2017, pages 93 - 98
LEONARD ET AL., CLINICAL CANCER RESEARCH (Z004, vol. 10, pages 53Z7 - 5334
MESNAGE ROBIN ET AL: "Evaluation of estrogen receptor alpha activation by glyphosate-based herbicide constituents", FOOD AND CHEMICAL TOXICOLOGY, PERGAMON, GB, vol. 108, 12 July 2017 (2017-07-12), pages 30 - 42, XP085164279, ISSN: 0278-6915, DOI: 10.1016/J.FCT.2017.07.025 *
MESNAGE, R. ET AL.: "Evaluation of estrogen receptor alpha activation by glyphosatebased herbicide constituents", FOOD CHEM. TOXICOL., vol. 108, 2017, pages 30 - 42, XP085164279, DOI: 10.1016/j.fct.2017.07.025
MICHEL, S. ET AL.: "Farm exposure and time trends in early childhood may influence DNA methylation in genes related to asthma and allergy", ALLERGY, vol. 68, 2013, pages 355 - 364
MINOR, E. A.COURT, B. L.YOUNG, J. I.WANG, G.: "Ascorbate induces ten-eleven translocation (Tet) methylcytosine dioxygenase-mediated generation of 5-hydroxymethylcytosine", J. BIOL. CHEM., vol. 288, 2013, pages 13669 - 13674
NICHOLAS P. RESTIFOMARK E. DUDLEYSTEVEN A. ROSENBERG: "Adoptive immunotherapy for cancer: harnessing the T cell response", NATURE REVIEWS IMMUNOLOGY, vol. 12, April 2012 (2012-04-01), XP055034896, DOI: 10.1038/nri3191
PACAUD, R. ET AL.: "The DNMT 1 /PCNA/UHRF 1 disruption induces tumorigenesis characterized by similar genetic and epigenetic signatures", SCI REP, vol. 4, 2014, pages 4230
PATEL, Y. ET AL.: "Overexpression of miR-489 derails mammary hierarchy structure and inhibits HER2/neu-induced tumorigenesis", ONCOGENE, 2018
PERERA, F. P.: "Environment and cancer: who are susceptible?", SCIENCE, vol. 278, 1997, pages 1068 - 1073
RONDON, R. ET AL.: "Effects of a parental exposure to diuron on Pacific oyster spat methylome", ENVIRON EPIGENET, vol. 3, no. dvx004, 2017
SPANNHOFF, A. ET AL.: "Histone deacetylase inhibitor activity in royal jelly might facilitate caste switching in bees", EMBO REP., vol. 12, 2011, pages 238 - 243
SRITANA, N. ET AL.: "Glyphosate induces growth of estrogen receptor alpha positive cholangiocarcinoma cells via non-genomic estrogen receptor/ERKl/2 signaling pathway", FOOD CHEM. TOXICOL., vol. 118, 2018, pages 595 - 607, XP085440758, DOI: 10.1016/j.fct.2018.06.014
SUN, M. ET AL.: "HMGA2/TET1/HOXA9 signaling pathway regulates breast cancer growth and metastasis", PROC. NATL. ACAD. SCI. U.S.A., vol. 110, 2013, pages 9920 - 9925, XP055217879, DOI: 10.1073/pnas.1305172110
SUZUKI ET AL., EUROP J OF IMMUNOL, vol. 22, no. 8, 1992, pages 1989 - 1993
TAYLOR LEE CHONG ET AL: "Reprogramming the Epigenome With Vitamin C", FRONTIERS IN CELL AND DEVELOPMENTAL BIOLOGY, vol. 7, 16 July 2019 (2019-07-16), XP055673397, DOI: 10.3389/fcell.2019.00128 *
TERRY, M. B.MCDONALD, J. A.WU, H. C.ENG, S.SANTELLA, R. M.: "Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum", ADV. EXP. MED. BIOL., vol. 882, 2016, pages 33 - 68
THONGPRAKAISANG, S.THIANTANAWAT, A.RANGKADILOK, N.SURIYO, T.SATAYAVIVAD, J.: "Glyphosate induces human breast cancer cells growth via estrogen receptors", FOOD CHEM. TOXICOL., vol. 59, 2013, pages 129 - 136
VIRGINIA LORENZ ET AL: "Epigenetic disruption of estrogen receptor alpha is induced by a glyphosate-based herbicide in the preimplantation uterus of rats", MOLECULAR AND CELLULAR ENDOCRINOLOGY., vol. 480, 1 January 2019 (2019-01-01), IE, pages 133 - 141, XP055671806, ISSN: 0303-7207, DOI: 10.1016/j.mce.2018.10.022 *
WANGQINGWANGCHUANXINGUOJINGBINZHNAGZHIJE: "Expression of miR-146a in triple negative breast cancer and its clinical significance", INT J CLIN EXP PATHOL, vol. 9, 2016, pages 11832 - 11837
YANG, L.YU, S.-J.HONG, Q.YANG, Y.SHAO, Z.-M.: "Reduced Expression of TET1, TET2, TET3 and TDG mRNAs Are Associated with Poor Prognosis of Patients with Early Breast Cancer", PLOS ONE, vol. 10, 2015, pages e0133896
YE, Z. ET AL.: "TET3 inhibits TGF-01-induced epithelial-mesenchymal transition by demethylating miR-30d precursor gene in ovarian cancer cells", J. EXP. CLIN. CANCER RES., vol. 35, 2016, pages 72
YIN, R. ET AL.: "Ascorbic acid enhances Tet-mediated 5-methylcytosine oxidation and promotes DNA demethylation in mammals", J. AM. CHEM. SOC., vol. 135, 2013, pages 10396 - 10403, XP055655125, DOI: 10.1021/ja4028346
YOKOCHI, T.ROBERTSON, K. D.: "Preferential methylation of unmethylated DNA by Mammalian de novo DNA methyltransferase Dnmt3a", J. BIOL. CHEM., vol. 277, 2002, pages 11735 - 11745
YU, J. ET AL.: "MicroRNA-182 targets FOXF2 to promote the development of triplenegative breast cancer", NEOPLASMA, vol. 64, 2017, pages 209 - 215
ZHANG, J. ET AL.: "Effect of TET inhibitor on bovine parthenogenetic embryo development", PLOS ONE, vol. 12, 2017, pages e0189542

Similar Documents

Publication Publication Date Title
US20230034473A1 (en) Methods of treating fibroblast growth factor 19-mediated cancers and tumors
Mao et al. Combination of PI3K/Akt pathway inhibition and Plk1 depletion can enhance chemosensitivity to gemcitabine in pancreatic carcinoma
EP3571212B1 (fr) Méthodes se rapportant au cancer du poumon
CN112522394B (zh) 新型外泌体释放相关靶点及其在监测和抑制肿瘤中的应用
US20240068047A1 (en) Use of sdha as a prognostic marker and therapeutic target in uveal melanoma
US20200330467A1 (en) Method and pharmaceutical compositions for the treatment of multiple myeloma
US20190367915A1 (en) Method for Assaying MicroRNA, Cancer Therapeutic Agent, and Medical Composition Containing Same for Cancer Therapy
CN107249692A (zh) 作为用于癌症治疗和诊断之靶标的磷酸甘油酸激酶1的蛋白激酶活性
US20170363629A1 (en) Biomarkers and targets for cancer immunotherapy
Dai et al. LINC00665 functions as a competitive endogenous RNA to regulate AGTR1 expression by sponging miR‑34a‑5p in glioma
US20200299783A1 (en) Molecular signature for selecting lymphoma patients for treatment with ibrutinib
JPWO2014126233A6 (ja) マイクロｒｎａの測定方法、並びに、がん治療剤及びこれを含有するがん治療のための医薬組成物
WO2017070660A1 (fr) Ciblage de récepteurs purinergiques p2 pour traiter un carcinome hépatocellulaire (hcc)
US20200009177A1 (en) Methods of inhibiting cancer stem cells with hmga1 inhibitors
WO2021037978A1 (fr) Procédés pour le diagnostic et le traitement du cancer
Zhang et al. Anti‑silencing function 1B promotes the progression of pancreatic cancer by activating c‑Myc
US20140275201A1 (en) Identification of cancer stem cell markers and use of inhibitors thereof to treat cancer
US20230220480A1 (en) Iron-score and in vitro method for identifying high risk dlbcl subjects and therapeutic uses and methods
US20220220565A1 (en) Methods and compositions for treating melanoma
Duan et al. ULK1 Depletion Protects Mice from Diethylnitrosamine-Induced Hepatocarcinogenesis by Promoting Apoptosis and Inhibiting Autophagy
US20210047696A1 (en) Methods and pharmaceutical compositions for treating cancer
CN117205198B (zh) 丹参酚酸c(sac)作为新型抗衰老药物原料在细胞衰老、肿瘤治疗与延长寿命中的应用
WO2023183164A1 (fr) Procédé de traitement du cancer du pancréas
CN117205193A (zh) 丹参酚酸a(saa)作为新型抗衰老药物原料在细胞衰老、肿瘤治疗与延长寿命中的应用
CN117205197A (zh) 丹参酚酸b(sab)作为新型抗衰老药物原料在细胞衰老、肿瘤治疗与延长寿命中的应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20760485

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20760485

Country of ref document: EP

Kind code of ref document: A1