WO2021022140A1 - Surexpression de pho13 pour augmenter la production d'éthanol par la levure - Google Patents

Surexpression de pho13 pour augmenter la production d'éthanol par la levure Download PDF

Info

Publication number
WO2021022140A1
WO2021022140A1 PCT/US2020/044463 US2020044463W WO2021022140A1 WO 2021022140 A1 WO2021022140 A1 WO 2021022140A1 US 2020044463 W US2020044463 W US 2020044463W WO 2021022140 A1 WO2021022140 A1 WO 2021022140A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
yeast
modified
expression
parental
Prior art date
Application number
PCT/US2020/044463
Other languages
English (en)
Inventor
Courtney BEMENT
Quinn Qun Zhu
Original Assignee
Danisco Us Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Danisco Us Inc filed Critical Danisco Us Inc
Priority to BR112022001828A priority Critical patent/BR112022001828A2/pt
Publication of WO2021022140A1 publication Critical patent/WO2021022140A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03041—4-Nitrophenylphosphatase (3.1.3.41)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • the present compositions and methods relate to modified yeast cells that over expresses the protein PH013.
  • the yeast cells demonstrate increased ethanol production from glucose compared to parental cells. Such yeast cells are particularly useful for large-scale ethanol production from starch substrates.
  • First-generation yeast-based ethanol production converts sugars into fuel ethanol.
  • Ethanol production in engineered yeast cells with a heterologous phosphoketolase (PKL) pathway is higher than in a parental strain without a PKL pathway (see, e.g.,
  • the PKL pathway consists of phosphoketolase (PKL) and phosphotransacetylase (PTA) to channel carbon flux away from the glycerol pathway and toward the synthesis of acetyl-coA.
  • PTL phosphoketolase
  • PTA phosphotransacetylase
  • AADH acetaldehyde dehydrogenase
  • ACS acetyl-coA synthase
  • compositions and methods relate to modified yeast that over-expresses PH013. Aspects and embodiments of the compositions and methods are described in the following, independently-numbered, paragraphs.
  • modified yeast cells derived from parental yeast cells comprising a genetic alteration that causes the modified cells to produce an increased amount of PH013 polypeptides compared to the parental cells, wherein the modified cells produce during fermentation more ethanol from glucose compared to the amount of ethanol from glucose produced by otherwise identical parental yeast cells.
  • the genetic alteration comprises the introduction into the parental cells of a nucleic acid capable of directing the expression of a PH013 polypeptide to a level above that of the parental cell grown under equivalent conditions.
  • the genetic alteration comprises the introduction of an expression cassette for expressing a PH013 polypeptide.
  • the amount of increase in the expression of the PH013 polypeptide is at least about 300%, at least about 500%, at least about 1,000%, at least about 5,000%, or even at least about 10,000% compared to the level expression in the parental cells grown under equivalent conditions.
  • the cells further comprise an exogenous gene encoding a carbohydrate processing enzyme.
  • the modified cells of any of paragraphs 1-5 further comprise a PKL pathway.
  • the modified cells of any of paragraphs 1-6 further comprise an alteration in the glycerol pathway and/or the acetyl-CoA pathway.
  • the modified cells of any of paragraphs 1-7 further comprise an alternative pathway for making ethanol.
  • the cells are of a Saccharomyces spp.
  • a method for increased production of alcohol from yeast cells grown on a carbohydrate substrate comprising: introducing into parental yeast cells a genetic alteration that increases the production of PH013 polypeptides compared to the amount produced in the parental cells, wherein increased alcohol production results from increased glucose metabolism.
  • increased production of alcohol is not from the metabolism of C5 sugars.
  • the cells having the introduced genetic alteration are the modified cells are the cells of any of paragraphs 1-9.
  • the increased production of alcohol is at least 0.2%, at least 0.5%, at least 1.0% or at least 1.2%.
  • PH013 polypeptides are over-expressed by at least 3-fold, at least 5-fold, at least 10-fold, at least 50- fold, or even at least 100-fold.
  • alcohol refers to an organic compound in which a hydroxyl functional group (-OH) is bound to a saturated carbon atom.
  • yeast cells refer to organisms from the phyla Ascomycota and Basidiomycota.
  • Exemplary yeast is budding yeast from the order Saccharomycetales.
  • Particular examples of yeast are Saccharomyces spp., including but not limited to S. cerevisiae.
  • Yeast include organisms used for the production of fuel alcohol as well as organisms used for the production of potable alcohol, including specialty and proprietary yeast strains used to make distinctive-tasting beers, wines, and other fermented beverages.
  • the phrase“engineered yeast cells,”“variant yeast cells,”“modified yeast cells,” or similar phrases, refer to yeast that include genetic modifications and characteristics described herein. Variant/modified yeast do not include naturally occurring yeast.
  • polypeptide and“protein” are used interchangeably to refer to polymers of any length comprising amino acid residues linked by peptide bonds.
  • the conventional one-letter or three-letter codes for amino acid residues are used herein and all sequence are presented from an N-terminal to C-terminal direction.
  • the polymer can comprise modified amino acids, and it can be interrupted by non amino acids.
  • the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
  • polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids, etc.
  • proteins are considered to be “related proteins,” or“homologs.” Such proteins can be derived from organisms of different genera and/or species, or different classes of organisms (e.g., bacteria and fungi), or artificially designed. Related proteins also encompass homologs determined by primary sequence analysis, determined by secondary or tertiary structure analysis, or determined by immunological cross-reactivity, or determined by their functions.
  • homologous protein refers to a protein that has similar activity and/or structure to a reference protein. It is not intended that homologs necessarily be evolutionarily related. Thus, it is intended that the term encompass the same, similar, or corresponding enzyme(s) (i.e., in terms of structure and function) obtained from different organisms. In some embodiments, it is desirable to identify a homolog that has a quaternary, tertiary and/or primary structure similar to the reference protein. In some embodiments, homologous proteins induce similar immunological response(s) as a reference protein. In some embodiments, homologous proteins are engineered to produce enzymes with desired activity (ies).
  • the degree of homology between sequences can be determined using any suitable method known in the art (see, e.g., Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol., 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444; programs such as GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI); and Devereux et al. ( 1984) Nucleic Acids Res. 12:387-95).
  • PILEUP is a useful program to determine sequence homology levels.
  • PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pair-wise alignments. It can also plot a tree showing the clustering relationships used to create the alignment.
  • PILEUP uses a simplification of the progressive alignment method of Feng and Doolittle, (Feng and Doolittle (1987) J. Mol. Evol. 35:351-60). The method is similar to that described by Higgins and Sharp ((1989) CABIOS 5: 151-53).
  • Useful PILEUP parameters including a default gap weight of 3.00, a default gap length weight of 0.10, and weighted end gaps.
  • BLAST algorithm Another example of a useful algorithm is the BLAST algorithm, described by Altschul et al. ((1990) J. Mol. Biol. 215:403-10) and Karlin et al. ((1993) Proc. Natl. Acad. Sci. USA 90:5873-87).
  • One particularly useful BLAST program is the WU-BLAST-2 program (see, e.g., Altschul et al. (1996) Meth. Enzymol. 266:460-80). Parameters“W,”“T,” and“X” determine the sensitivity and speed of the alignment.
  • the BLAST program uses as defaults a word-length (W) of 11, the BLOSUM62 scoring matrix (see, e.g., Henikoff and Henikoff ( 1989) Proc. Natl. Acad. Sci. USA 89: 10915) alignments (B) of 50, expectation (E) of 10, M'5, N'-4, and a comparison of both strands.
  • the phrases“substantially similar” and“substantially identical,” in the context of at least two nucleic acids or polypeptides, typically means that a polynucleotide or polypeptide comprises a sequence that has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or even at least about 99% identity, or more, compared to the reference (i.e., wild-type) sequence.
  • Percent sequence identity is calculated using CLUSTAL W algorithm with default parameters. See Thompson et al. (1994) Nucleic Acids Res. 22:4673-4680. Default parameters for the CLUSTAL W algorithm are:
  • Gap extension penalty 0.05
  • polypeptides are substantially identical.
  • first polypeptide is immunologically cross-reactive with the second polypeptide.
  • polypeptides that differ by conservative amino acid substitutions are immunologically cross reactive.
  • a polypeptide is substantially identical to a second polypeptide, for example, where the two peptides differ only by a conservative substitution.
  • Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions (e.g., within a range of medium to high stringency).
  • the term“gene” is synonymous with the term“allele” in referring to a nucleic acid that encodes and directs the expression of a protein or RNA. Vegetative forms of filamentous fungi are generally haploid, therefore a single copy of a specified gene (i.e.. a single allele) is sufficient to confer a specified phenotype.
  • the term“allele” is generally preferred when an organism contains more than one similar genes, in which case each different similar gene is referred to as a distinct“allele.”
  • the term“expressing a polypeptide” and similar terms refers to the cellular process of producing a polypeptide using the translation machinery (e.g., ribosomes) of the cell.
  • “over-expressing a polypeptide,”“increasing the expression of a polypeptide,” and similar terms refer to expressing a polypeptide at higher-than-normal levels compared to those observed with parental or“wild-type cells that do not include a specified genetic modification.
  • an“expression cassette” refers to a DNA fragment that includes a promoter, and amino acid coding region and a terminator (i.e., promoter: : amino acid coding region: terminator) and other nucleic acid sequence needed to allow the encoded polypeptide to be produced in a cell.
  • Expression cassettes can be exogenous (i.e., introduced into a cell) or endogenous (i.e., extant in a cell).
  • wild-type and“native” are used interchangeably and refer to genes, proteins or strains found in nature, or that are not intentionally modified for the advantage of the presently described yeast.
  • the term“protein of interest” refers to a polypeptide that is desired to be expressed in modified yeast.
  • a protein can be an enzyme, a substrate-binding protein, a surface-active protein, a structural protein, a selectable marker, a signal transducer, a receptor, a transporter, a transcription factor, a translation factor, a co-factor, or the like, and can be expressed.
  • the protein of interest is encoded by an endogenous gene or a heterologous gene (i.e., gene of interest”) relative to the parental strain.
  • the protein of interest can be expressed intracellularly or as a secreted protein.
  • disruption of a gene refers broadly to any genetic or chemical manipulation, i.e., mutation, that substantially prevents a cell from producing a function gene product, e.g., a protein, in a host cell.
  • exemplary methods of disruption include complete or partial deletion of any portion of a gene, including a polypeptide-coding sequence, a promoter, an enhancer, or another regulatory element, or mutagenesis of the same, where mutagenesis encompasses substitutions, insertions, deletions, inversions, and combinations and variations, thereof, any of which mutations substantially prevent the production of a function gene product.
  • a gene can also be disrupted using CRISPR, RNAi, antisense, or any other method that abolishes gene expression.
  • a gene can be disrupted by deletion or genetic manipulation of non-adjacent control elements.
  • deletion of a gene refers to its removal from the genome of a host cell.
  • control elements e.g. , enhancer elements
  • deletion of a gene refers to the deletion of the coding sequence, and optionally adjacent enhancer elements, including but not limited to, for example, promoter and/or terminator sequences, but does not require the deletion of non-adjacent control elements.
  • Deletion of a gene also refers to the deletion a part of the coding sequence, or a part of promoter immediately or not immediately adjacent to the coding sequence, where there is no functional activity of the interested gene existed in the engineered cell.
  • the terms“genetic manipulation,”“genetic alteration,”“genetic engineering,” and similar terms are used interchangeably and refer to the alteration/change of a nucleic acid sequence.
  • the alteration can include but is not limited to a substitution, deletion, insertion or chemical modification of at least one nucleic acid in the nucleic acid sequence.
  • a“functional polypeptide/protein” is a protein that possesses an activity, such as an enzymatic activity, a binding activity, a surface-active property, a signal transducer, a receptor, a transporter, a transcription factor, a translation factor, a co-factor, or the like, and which has not been mutagenized, truncated, or otherwise modified to abolish or reduce that activity.
  • Functional polypeptides can be thermostable or thermolabile, as specified.
  • “a functional gene” is a gene capable of being used by cellular components to produce an active gene product, typically a protein. Functional genes are the antithesis of disrupted genes, which are modified such that they cannot be used by cellular components to produce an active gene product, or have a reduced ability to be used by cellular components to produce an active gene product.
  • “aerobic fermentation” refers to growth and production processes in the presence of oxygen.
  • anaerobic fermentation refers to growth and production processes in the absence of oxygen.
  • PH013 (YDL236W) is a conserved phosphatase (/ nitrophenyl phosphatase) that serves as a metabolic repair enzyme via the dephosphorylation of two side products of pyruvate kinase, 2-phosphoglycolate and 4-phosphoerythronate.
  • PH013 improves xylose fermentation efficiency and tolerance to fermentation stressors in industrial yeast (van Vleet et al. (2008) Metabolic Engineering 10:360-69).
  • PH013 deleted strains show upregulation of the pentose phosphate pathway as part of an oxidative stress response (Kim et al. (2015) Applied Environmental Microbiology 81 : 1601-9).
  • the pentose phosphate pathway is the primary metabolic pathway for xylose, which could explain the improved xylose fermentation described previously. Studies have also shown that PH013 deletion improves strain tolerance to acetic acids though the exact mechanism by which this is achieved is not known (Fujitomi et al. (2012) Bioresource Technology 111: 161-66).
  • the increase in the amount of PH013 polypeptides produced by modified cells is an increase of at least 300%, at least 500%, at least 1,000%, at least 5,000%, or at least 10,000%, or more, compared to the amount of PH013 polypeptides produced by parental cells grown under the same conditions.
  • the increase in the amount of PH013 polypeptides produced by the modified cells is at least 3-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100-fold, or more, compared to the amount of PH013 polypeptides produced by parental cells grown under the same conditions.
  • the increase in the strength of the promoter used to control expression of the PH013 polypeptides produced by the modified cells is at least 3-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100-fold, or more, compared to strength of the native promoter controlling PH013 expression.
  • the increase in ethanol production by the modified cells is an increase of at least 0.2%, at least 0.5%, at least 0.7%, at least 0.8%, at least 0.9%, at least 1.0%, at least 1.1%, at least 1.2%, at least 1.3%, at least 1.4%, at least 1.5%, or more, compared to the amount of ethanol produced by parental cells grown under the same conditions.
  • increased PH013 expression is achieved by genetic manipulation using sequence-specific molecular biology techniques, as opposed to chemical mutagenesis, which is generally not targeted to specific nucleic acid sequences.
  • chemical mutagenesis is not excluded as a method for making modified yeast cells.
  • the present compositions and methods involve introducing into yeast cells a nucleic acid capable of directing the over-expression, or increased expression, of a PH013 polypeptide.
  • Particular methods include but are not limited to (i) introducing an exogenous expression cassette for producing the polypeptide into a host cell, optionally in addition to an endogenous expression cassette, (ii) substituting an exogenous expression cassette with an endogenous cassette that allows the production of an increased amount of the polypeptide, (iii) modifying the promoter of an endogenous expression cassette to increase expression, (iv) increase copy number of the same or different cassettes for over-expression of PH013, and/or (v) modifying any aspect of the host cell to increase the half-life of the PH013 mRNA and/or polypeptide in the host cell.
  • the parental cell that is modified already includes a gene of interest, such as a gene encoding a selectable marker, carbohydrate-processing enzyme, or other polypeptide.
  • a gene of introduced is subsequently introduced into the modified cells.
  • the parental cell that is modified already includes an engineered pathway of interest, such as a PKL pathway to increases ethanol production, or any other pathway to increase alcohol production.
  • an engineered pathway of interest such as a PKL pathway to increases ethanol production, or any other pathway to increase alcohol production.
  • the amino acid sequence of the PH013 polypeptide that is over-expressed in modified yeast cells has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99% identity, to SEQ ID NO: 2.
  • the amino acid sequence of the PH013 polypeptide corresponds to, or has, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99% identity, to a functionally or structurally equivently molecule, or a homolog of the PH013 polypeptide.
  • Increased expression of PH013 can be combined with expression of genes in the PKL pathway to further increase ethanol production.
  • Engineered yeast cells having a heterologous PKL pathway have been previously described in WO2015148272 (Miasnikov et al). These cells express heterologous phosphoketolase (PKL), phosphotransacetylase (PTA) and acetylating acetyl dehydrogenase (AADH), optionally with other enzymes, to channel carbon flux away from the glycerol pathway and toward the synthesis of acetyl-CoA, which is then converted to ethanol.
  • PTL heterologous phosphoketolase
  • PTA phosphotransacetylase
  • AADH acetylating acetyl dehydrogenase
  • Such modified cells are capable of increased ethanol production in a fermentation process when compared to otherwise-identical parent yeast cells.
  • the present modified yeast cells include additional beneficial modifications.
  • the modified cells may further include mutations that result in attenuation of the native glycerol biosynthesis pathway and/or reuse glycerol pathway, which are known to increase alcohol production.
  • Methods for attenuation of the glycerol biosynthesis pathway in yeast are known and include reduction or elimination of endogenous NAD-dependent glycerol 3-phosphate dehydrogenase (GPD) or glycerol phosphate phosphatase activity (GPP), for example by disruption of one or more of the genes GP 1. GPD2, GPP 1 and/or GPP2. See, e.g., U.S. Patent Nos.
  • the modified yeast may further feature increased acetyl-CoA synthase (also referred to acetyl-CoA ligase) activity (EC 6.2.1.1) to scavenge (i.e.. capture) acetate produced by chemical or enzymatic hydrolysis of acetyl-phosphate (or present in the culture medium of the yeast for any other reason) and converts it to Ac-CoA.
  • acetyl-CoA synthase also referred to acetyl-CoA ligase activity
  • scavenge i.e.. capture
  • Increasing acetyl-CoA synthase activity may be accomplished by introducing a heterologous acetyl-CoA synthase gene into cells, increasing the expression of an endogenous acetyl-CoA synthase gene and the like.
  • the modified cells may further include a heterologous gene encoding a protein with NAD + -dependent acetylating acetaldehyde dehydrogenase activity and/or a heterologous gene encoding a pyruvate-formate lyase.
  • a heterologous gene encoding a protein with NAD + -dependent acetylating acetaldehyde dehydrogenase activity and/or a heterologous gene encoding a pyruvate-formate lyase.
  • the yeast expressly lacks a heterologous gene(s) encoding an acetylating acetaldehyde dehydrogenase, a pyruvate-formate lyase or both.
  • the present modified yeast cells may further over-express a sugar transporter-like (STL1) polypeptide to increase the uptake of glycerol (see, e.g., STL1) polypeptide to increase the uptake of glycerol (see, e.g., STL1)
  • the present modified yeast cells further include a butanol biosynthetic pathway.
  • the butanol biosynthetic pathway is an isobutanol biosynthetic pathway.
  • the isobutanol biosynthetic pathway comprises a polynucleotide encoding a polypeptide that catalyzes a substrate to product conversion selected from the group consisting of: (a) pyruvate to acetolactate; (b) acetolactate to 2,3-dihydroxyisovalerate; (c) 2,3-dihydroxyisovalerate to 2-ketoisovalerate; (d) 2- ketoisovalerate to isobutyraldehyde; and (e) isobutyraldehyde to isobutanol.
  • the isobutanol biosynthetic pathway comprises polynucleotides encoding polypeptides having acetolactate synthase, keto acid reductoisomerase, dihydroxy acid dehydratase, ketoisovalerate decarboxylase, and alcohol dehydrogenase activity.
  • the modified yeast cells comprising a butanol biosynthetic pathway further comprise a modification in a polynucleotide encoding a polypeptide having pyruvate decarboxylase activity.
  • the yeast cells comprise a deletion, mutation, and/or substitution in an endogenous polynucleotide encoding a polypeptide having pyruvate decarboxylase activity.
  • the polypeptide having pyruvate decarboxylase activity is selected from the group consisting of: PDC1, PDC5, PDC6, and combinations thereof.
  • the yeast cells further comprise a deletion, mutation and/or substitution in one or more endogenous polynucleotides encoding FRA2, ALD6, ADH1, GPD2, BDH1, DLS1, DPB3, CPR1, MAL23C, MNN4, PAB1, TMN2,
  • yeast cells over-express one or more of these polynucleotides.
  • the present modified yeast cells further include any number of additional genes of interest encoding proteins of interest. Additional genes of interest may be introduced before, during, or after genetic manipulations that result in the increased production of PH013 polypeptides.
  • Proteins of interest include selectable markers, carbohydrate-processing enzymes, and other commercially -relevant polypeptides, including but not limited to an enzyme selected from the group consisting of a dehydrogenase, a transketolase, a phosphoketolase, a transladolase, an epimerase, a phytase, a xylanase, a b- glucanase, a phosphatase, a protease, an a-amylase, a b-amylase, a glucoamylase, a pullulanase, an isoamylase, a cellulase, a trehalase, a lipase, a pectinase, a polyesterase, a cutinase, an oxidase, a transferase, a reductase, a hemicellulase, a mannan
  • the present compositions and methods include methods for increasing alcohol production and/or reducing glycerol production, in fermentation reactions. Such methods are not limited to a particular fermentation process.
  • the present engineered yeast is expected to be a“drop-in” replacement for convention yeast in any alcohol fermentation facility. While primarily intended for fuel alcohol production, the present yeast can also be used for the production of potable alcohol, including wine and beer.
  • Yeasts are unicellular eukaryotic microorganisms classified as members of the fungus kingdom and include organisms from the phyla Ascomycota and Basidiomycota. Yeast that can be used for alcohol production include, but are not limited to, Saccharomyces spp., including S. cerevisiae, as well as Kluyveromyces, Lachancea and Schizosaccharomyces spp. Numerous yeast strains are commercially available, many of which have been selected or genetically engineered for desired characteristics, such as high alcohol production, rapid growth rate, and the like. Some yeasts have been genetically engineered to produce heterologous enzymes, such as glucoamylase or a-amylase.
  • Alcohol production from a number of carbohydrate substrates including but not limited to com starch, sugar cane, cassava, and molasses, is well known, as are innumerable variations and improvements to enzymatic and chemical conditions and mechanical processes.
  • the present compositions and methods are believed to be fully compatible with such substrates and conditions.
  • Alcohol fermentation products include organic compound having a hydroxyl functional group (-OH) is bound to a carbon atom.
  • exemplary alcohols include but are not limited to methanol, ethanol, «-propanol, isopropanol, «-butanol, isobutanol, «-pentanol, 2- pentanol, isopentanol, and higher alcohols.
  • the most commonly made fuel alcohols are ethanol, and butanol.
  • Liquefact (com mash slurry) was prepared by adding 600 ppm of urea, 0.124 SAPU/g ds acid fungal protease, 0.33 GAU/g ds variant Trichoderma reesei glucoamylase and 1.46 SSCU/g ds Aspergillus kawachii a-amylase, adjusted to a pH of 4.8 with sulfuric acid.
  • RPKIOM reads per kilobase ten million transcripts
  • RNA-Seq analysis was performed on two strains of Saccharomyces cerevisiae, namely (i) FERMAXTM Gold (Martrex Inc., Minnesota, USA; herein abbreviated“FG”), a standard strain used for ethanol production and (ii) an FG strain engineered with the PKL pathway (herein abbreviated“FG-PKL”) described in as described in WO2015148272.
  • FG-PKL FG-PKL
  • Table 1 Expression levels are expressed as reads per kilobase ten million transcripts (RPK10M).
  • PH013 gene (YDL236W) of Saccharomyces cerevisiae was codon optimized and synthesized to generate PH013s (SEQ ID NO: 1) shown, below.
  • HTA1 promoter (YGL037C locus; SEQ ID NO: 3) and PAB1 promoter (YER165W locus; SEQ ID NO: 4) were separately linked with the PH013 coding sequence, along with the FBA1 terminator (YKL060C locus; SEQ ID NO: 5) to generate two expression cassettes, HTAl ::PH013s::FbalTer and PABl ::PH013s::FbalTer, respectively.
  • cassettes were introduced at position 350000 of Chromosome II of FG-PKL, an engineered yeast having a heterologous phosphoketolase (PKL) pathway involving the expression of phosphoketolase (PKL), phosphotransacetylase (PTA) and acetylating acetyl dehydrogenase (AADH) as described in WO2015148272 (Miasnikov et ah).
  • PTL heterologous phosphoketolase
  • PTA phosphotransacetylase
  • AADH acetylating acetyl dehydrogenase
  • nucleic acid sequence of the PAB1 promoter is shown, below, as SEQ ID NO: 4: ACACAATGAGTGCAATACGTACTTCTTTGAAGCGACTTAGAAGAGGCGGCAAAAGTCTTGAT CGTAAGGAATGGGCCAAAATTTTGAAGACCGAATTAACTACGATTGGTAATCATATCGAATC GCAAAAGGGCTCATCGAGAAAGGCAAGCCCAGAAAAATATCGCAAGCACCTTTGGTCTTACA GTGCCAACTTTTGGCCTGCCGACGTTAAGAGTACAAAGCTGATGGCAATGTACGACAAGATA ACAGAGTCTCAAAAGAAGTGAAACAATTTTTCTTCACCACATTTTCCATTGTTCCTTCCCCC CATAACTATAAACGTATTTATGTATATATATTTGCGTGTAAGTGTGTGTACTATAGGGCACC GTAAAGTAATAATGCTTAATTAGTTACTACTATGACCATATAAGAGGTCATACTGTATGAAG CCACAAAGCAGATAGATCAATCATGTTTAACGAAA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des compositions et des procédés se rapportant à une levure modifiée qui surexprime PHO13. La levure présente une production accrue d'éthanol à partir du glucose par rapport aux cellules parentales. Une telle levure est particulièrement utile pour la production d'éthanol à grande échelle à partir de substrats d'amidon.
PCT/US2020/044463 2019-08-01 2020-07-31 Surexpression de pho13 pour augmenter la production d'éthanol par la levure WO2021022140A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
BR112022001828A BR112022001828A2 (pt) 2019-08-01 2020-07-31 Superexpressão de pho13 para produção de etanol aumentada por levedura

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962881390P 2019-08-01 2019-08-01
US62/881,390 2019-08-01

Publications (1)

Publication Number Publication Date
WO2021022140A1 true WO2021022140A1 (fr) 2021-02-04

Family

ID=72145494

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/044463 WO2021022140A1 (fr) 2019-08-01 2020-07-31 Surexpression de pho13 pour augmenter la production d'éthanol par la levure

Country Status (2)

Country Link
BR (1) BR112022001828A2 (fr)
WO (1) WO2021022140A1 (fr)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS6131088A (ja) * 1984-07-25 1986-02-13 Takeda Chem Ind Ltd 新規ｄｎａおよびその用途
US8795998B2 (en) 2009-07-24 2014-08-05 Technische Universiteit Delft Fermentative glycerol-free ethanol production
US8956851B2 (en) 2011-04-05 2015-02-17 Lallemand Hungary Liquidity Management, LLC Methods for the improvement of product yield and production in a microorganism through the addition of alternate electron acceptors
WO2015023989A1 (fr) 2013-08-15 2015-02-19 Lallemand Hungary Liquidity Management Llc Procédés pour l'amélioration du rendement de production et de la production dans un micro-organisme par recyclage de glycérol
WO2015148272A1 (fr) 2014-03-28 2015-10-01 Danisco Us Inc. Voie de cellule hôte modifiée pour la production améliorée d'éthanol
US9175270B2 (en) 2007-10-29 2015-11-03 Danisco Us Inc. Method of modifying a yeast cell for the production of ethanol
WO2019161335A1 (fr) * 2018-02-19 2019-08-22 Lygos, Inc. Cellules hôtes recombinantes et procédés de production d'acide glycérique et de produits en aval

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS6131088A (ja) * 1984-07-25 1986-02-13 Takeda Chem Ind Ltd 新規ｄｎａおよびその用途
US9175270B2 (en) 2007-10-29 2015-11-03 Danisco Us Inc. Method of modifying a yeast cell for the production of ethanol
US8795998B2 (en) 2009-07-24 2014-08-05 Technische Universiteit Delft Fermentative glycerol-free ethanol production
US8956851B2 (en) 2011-04-05 2015-02-17 Lallemand Hungary Liquidity Management, LLC Methods for the improvement of product yield and production in a microorganism through the addition of alternate electron acceptors
WO2015023989A1 (fr) 2013-08-15 2015-02-19 Lallemand Hungary Liquidity Management Llc Procédés pour l'amélioration du rendement de production et de la production dans un micro-organisme par recyclage de glycérol
WO2015148272A1 (fr) 2014-03-28 2015-10-01 Danisco Us Inc. Voie de cellule hôte modifiée pour la production améliorée d'éthanol
WO2019161335A1 (fr) * 2018-02-19 2019-08-22 Lygos, Inc. Cellules hôtes recombinantes et procédés de production d'acide glycérique et de produits en aval

Non-Patent Citations (22)

* Cited by examiner, † Cited by third party
Title
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 10
ALTSCHUL ET AL., METH. ENZYMOL., vol. 266, 1996, pages 460 - 80
BAMBA ET AL., AMB EXPR, vol. 6, 2016, pages 4
DEVEREUX ET AL., NUCLEIC ACIDS RES., vol. 12, 1984, pages 387 - 95
DU§KOVD ET AL., MOL. MICROBIOL., vol. 97, 2015, pages 541 - 59
FENGDOOLITTLE, J. MOL. EVOL., vol. 35, 1987, pages 351 - 60
FERREIRA ET AL., MOL. BIOL. CELL, vol. 16, 2005, pages 2068 - 76
FRANÇOIS COLLARD ET AL: "A conserved phosphatase destroys toxic glycolytic side products in mammals and yeast", NATURE CHEMICAL BIOLOGY, vol. 12, no. 8, 1 August 2016 (2016-08-01), New York, pages 601 - 607, XP055753543, ISSN: 1552-4450, DOI: 10.1038/nchembio.2104 *
FUJITOMI ET AL., BIORESOURCE TECHNOLOGY, vol. 111, 2012, pages 161 - 66
GOMBERT, A.K.VAN MARIS. A.J., CURR. OPIN. BIOTECHNOL., vol. 33, 2015, pages 81 - 86
HENIKOFFHENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1989, pages 10915
HIGGINSSHARP, CABIOS, vol. 5, 1989, pages 151 - 53
KARLIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 87
KEISUKE FUJITOMI ET AL: "Deletion of the PHO13 gene improves ethanol production from lignocellulosic hydrolysate in the presence of acetic and formic acids, and furfural", BIORESOURCE TECHNOLOGY, ELSEVIER, AMSTERDAM, NL, vol. 111, 29 January 2012 (2012-01-29), pages 161 - 166, XP028474401, ISSN: 0960-8524, [retrieved on 20120206], DOI: 10.1016/J.BIORTECH.2012.01.161 *
KIM ET AL., APPLIED ENVIRONMENTAL MICROBIOLOGY, vol. 81, 2015, pages 1601 - 9
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
PEARSONLIPMAN, PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482
SOO RIN KIM ET AL: "Rational and Evolutionary Engineering Approaches Uncover a Small Set of Genetic Changes Efficient for Rapid Xylose Fermentation in Saccharomyces cerevisiae", PLOS ONE, vol. 8, no. 2, 26 February 2013 (2013-02-26), pages e57048, XP055104976, DOI: 10.1371/journal.pone.0057048 *
THOMPSON ET AL., NUCLEIC ACIDS RES., vol. 22, 1994, pages 4673 - 4680
VLEET ET AL., METABOLIC ENGINEERING, vol. 10, 2008, pages 360 - 69
ZHANG ET AL., J. IND. MICROBIOL. BIOTECHNOL., vol. 40, 2013, pages 1153 - 60

Also Published As

Publication number Publication date
BR112022001828A2 (pt) 2022-06-28

Similar Documents

Publication Publication Date Title
CN110741014B (zh) 具有改善的醇生产的酵母
EP3762499B1 (fr) Réduction de la production d'acétate par une levure surexprimant pab1
EP3802784B1 (fr) Surexpression de l'activateur/répresseur transcriptionnel gis1 dans la levure pour une production accrue d'éthanol
WO2021108464A1 (fr) Réduction de la production d'acétate par une levure surexprimant des polypeptides mig
WO2020069067A1 (fr) Surexpression de l'inhibiteur de la ribonucléotide réductase dans la levure pour une production accrue d'éthanol
WO2019173225A1 (fr) Levures présentant une production d'alcool améliorée dans des conditions à teneur élevée en solides dissous
WO2021022140A1 (fr) Surexpression de pho13 pour augmenter la production d'éthanol par la levure
CN112513261B (zh) 富马酸还原酶过表达导致酵母中增加的发酵速率
WO2021022097A1 (fr) Surexpression de l'adh5p pour augmenter la production d'éthanol par la levure
EP3938519A1 (fr) Surexpression du transporteur fumarate-succinate dans la levure pour augmenter la production d'éthanol et réduire la production d'acétate
EP3938381A1 (fr) Surexpression du cytochrome b2 dans la levure pour une production accrue d'éthanol
EP4355881A1 (fr) Production accrue d'éthanol par surexpression de kgd2 dans la levure
US20230116556A1 (en) Increased ethanol production by overexpression of jid1 in yeast
US20210032642A1 (en) Increased alcohol production from yeast producing an increased amount of active hac1 protein
US20210388397A1 (en) Selected phosphotransacetylase genes for increased ethanol production in engineered yeast
WO2023076323A1 (fr) Réduction de l'acétate produite par la levure avec une expression réduite de rsf2 ou de tda9
US20210147792A1 (en) Yeast over-expressing protein phosphatases associated with the hog pathway
US20230331789A1 (en) Over-expression of gds1 in yeast for increased ethanol and decreased acetate production
WO2024123691A1 (fr) Production accrue d'éthanol par levure dans des solides à haute dissolution
EP3571218A1 (fr) Cellules de levure modifiées qui surexpriment une sous-unité d'adn polymérase

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20758029

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022001828

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2020758029

Country of ref document: EP

Effective date: 20220301

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112022001828

Country of ref document: BR

122 Ep: pct application non-entry in european phase

Ref document number: 20758029

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 112022001828

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20220131