WO2021015437A1 - 활성산소 생성억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물 - Google Patents
활성산소 생성억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물 Download PDFInfo
- Publication number
- WO2021015437A1 WO2021015437A1 PCT/KR2020/008466 KR2020008466W WO2021015437A1 WO 2021015437 A1 WO2021015437 A1 WO 2021015437A1 KR 2020008466 W KR2020008466 W KR 2020008466W WO 2021015437 A1 WO2021015437 A1 WO 2021015437A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ros
- sod1
- composition
- virus
- production inhibitor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
- A61K31/575—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of three or more carbon atoms, e.g. cholane, cholestane, ergosterol, sitosterol
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/111—Aromatic compounds
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/142—Amino acids; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/045—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
- A61K31/05—Phenols
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/075—Ethers or acetals
- A61K31/085—Ethers or acetals having an ether linkage to aromatic ring nuclear carbon
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/192—Carboxylic acids, e.g. valproic acid having aromatic groups, e.g. sulindac, 2-aryl-propionic acids, ethacrynic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
- A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
- A61K31/198—Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
- A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline
- A61K31/353—3,4-Dihydrobenzopyrans, e.g. chroman, catechin
- A61K31/355—Tocopherols, e.g. vitamin E
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/365—Lactones
- A61K31/375—Ascorbic acid, i.e. vitamin C; Salts thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
- A61K31/4706—4-Aminoquinolines; 8-Aminoquinolines, e.g. chloroquine, primaquine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/44—Oxidoreductases (1)
- A61K38/446—Superoxide dismutase (1.15)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0043—Nose
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y115/00—Oxidoreductases acting on superoxide as acceptor (1.15)
- C12Y115/01—Oxidoreductases acting on superoxide as acceptor (1.15) with NAD or NADP as acceptor (1.15.1)
- C12Y115/01001—Superoxide dismutase (1.15.1.1)
Definitions
- the present invention relates to a pharmaceutical composition for the prevention or treatment of viral infections, including an active oxygen production inhibitor and an active oxygen scavenger complex as an active ingredient.
- ROS reactive oxygen species
- NOXs cell membrane NADPH oxidases
- PDI protein disulfide isomerase
- ROS at an appropriate concentration in vivo is useful for cell differentiation, cell signaling, and homeostasis, etc., but the production of high concentration ROS by UV irradiation and infection has a fatal adverse effect on lipids, proteins, and DNA. Therefore, in vivo, it has its own ROS catabolism to regulate ROS concentration, but excessive ROS production causes oxidative stress.
- Enzymatic antioxidants include superoxide dismutases (SODs) and catalases. ROSs that have not been eliminated by SODs and catalase are converted to hydroxyl radicals (OH) that have a short half-life and are highly reactive. Unlike superoxide and hydrogen peroxide, which can be detoxified by SODs and catalases, hydroxy groups ( ⁇ OH) are also produced in vivo as by-products of immune reactions such as macrophages, and generated ⁇ OH can be removed by enzymes and reactions. It cannot be so harmful to the organism.
- SODs superoxide dismutases
- catalases hydroxyl radicals
- SOD1 mainly in the cytoplasm
- SOD2 in the mitochondria
- SOD3 in the extracellular.
- SOD1 and SOD3 contain copper and zinc ions
- SOD2 contains manganese ions.
- Influenza A Virus which is known to cause flu, is one of the representative causes of acute respiratory disease. IAV is highly contagious, with a worldwide pandemic of large and small every year, and can infect 10-20% of the normal population within 2-3 weeks. Increased ROS during IAV infection causes apoptosis and causes severe cellular stress.
- ROS-mutation theory was established by oxidative DNA damage, and when ROS is excessively produced in cells, not only short-term consequences such as inflammatory reaction and apoptosis, but also endoplasmic reticulum stress worsens when exposed to ROS continuously. It was found that it has serious effects such as inducing various degenerative diseases related to aging.
- the present inventors have confirmed for the first time that ROS induced by IAV in vitro and in animal experiments increases the viral replication rate and infection rate.
- the exact mechanism of production of ROS caused by IAV and its cause to date are still unclear, but as a result of the present inventors' research, it was found that the increase in ROS due to endoplasmic reticulum stress has many effects on host cell damage after viral infection.
- the technical task to be achieved by the present invention is to achieve more effective prevention, treatment, or improvement of viral infectious diseases by simultaneously achieving inhibition and elimination of ROS production, and the present invention includes an ROS production inhibitor and an ROS scavenging agent as active ingredients.
- an ROS production inhibitor and an ROS scavenging agent as active ingredients.
- the present invention provides a pharmaceutical composition for preventing or treating viral infections, comprising an ROS production inhibitor and an ROS scavenging agent as active ingredients.
- the present invention provides a food composition for preventing or improving viral infectious diseases, comprising an ROS production inhibitor and an ROS scavenging agent as active ingredients.
- the present invention provides a feed additive for preventing or improving viral infectious diseases, including an ROS production inhibitor and an ROS scavenging agent as active ingredients.
- the present invention provides a composition for quarantine against viral infectious diseases, comprising an ROS production inhibitor and an ROS scavenging agent as active ingredients.
- the present invention provides a cosmetic composition comprising a ROS production inhibitor and a ROS scavenging agent as active ingredients.
- the ROS production inhibitor may be to reduce the amount of ROS production through preventing or inhibiting the activation of endoplasmic reticulum stress, and specifically, the ROS production inhibitor is 4-phenylbutyrate (4-PBA) , Taurine-conjugated ursodeoxycholic acid (TUDCA), 3-MA (3-Methyladenine) and chloroquine (chloroquine diphosphate) may be one or more selected from the group consisting of, preferably 4-PBA Can be
- the ROS scavenging agent may be superoxide dismutase 1: SOD1, and N-acetyl cysteine (NAC), glutathione, catalase ), butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ascorbic acid, and at least one selected from the group consisting of tocopherol.
- SOD1 superoxide dismutase 1
- NAC N-acetyl cysteine
- BHA butylated hydroxyanisole
- BHT butylated hydroxytoluene
- ascorbic acid and at least one selected from the group consisting of tocopherol.
- it may be a combination of SOD1 and NAC and/or BHA, more preferably SOD1 and NAC.
- the composition may be for nasal, oral, or inhaled administration, but preferably may be for inhalation administration administered into the bronchi of an individual using breathing.
- the virus may be a virus having RNA as a genome, and non-limiting examples of the virus include influenza A virus, human immunodeficiency virus, and coronavirus.
- the virus is In consideration of the formulation and administration method of the pharmaceutical composition of the present invention, it may be a respiratory disease-causing virus including influenza A virus and coronavirus.
- the present invention provides a method for preventing or treating a viral infection disease comprising administering a combined preparation of an ROS production inhibitor and an ROS scavenging agent to an individual.
- the ROS production inhibitor and the ROS scavenging agent may be administered simultaneously or sequentially, but preferably, they may be mixed in one composition and administered simultaneously.
- the ROS production inhibitor and ROS scavenger combination formulation may be administered through the mouth or nose of an individual, and when administered through the nose, the combination formulation is sprayed and administered.
- the administration is not limited as long as it is an administration method capable of delivering the complex formulation into the bronchi of an individual, but may preferably be administered through the individual's breath.
- the administration may be performed once or more times a day.
- the present invention provides a use of a combination formulation of an ROS production inhibitor and an ROS scavenging agent for the manufacture of a drug for preventing or treating viral infections.
- the present invention relates to a composition capable of preventing, treating, and improving viral infectious diseases, and the safety of an active oxygen production inhibitor and an active oxygen scavenging agent has already been verified, so that the composition of the present invention is also safe for human application.
- the present invention reversely utilizes the mechanism by which the virus causes oxidative damage to host cells and activates virus replication and infection under that condition, and there is no direct specificity for a specific virus like a conventional vaccine, but the virus It has the advantage of being able to efficiently inhibit the proliferation of all viruses that cause oxidative stress regardless of the type or mutation.
- composition of the present invention is capable of inhibiting viral proliferation irrespective of mutation, and thus can be applied as a global infection inhibitor and therapeutic agent as a limited alternative to a vaccine that must be newly developed every year due to viral mutation. Or it can be used as an adjuvant.
- composition of the present invention has the advantage of suppressing virus proliferation and minimizing damage to cells and tissues caused by oxidative stress.
- FIG. 1 is a diagram showing a correlation in which the expression of the viral protein, PB1, increases when the amount of ROS increases and the amount of SOD1 enzyme decreases according to influenza A virus (IAV) infection in vitro .
- IAV influenza A virus
- Figure 2 shows that the treatment of the Tat protein or external H 2 O 2 of HIV, which plays a major role in infection with Human Immunodeficiency Virus (HIV), which causes AIDS, increases ROS production. At this time, it is a view confirming that the HIV replication activity is decreased due to the increase in ROS when the ROS scavenging agent NAC is treated.
- HIV Human Immunodeficiency Virus
- FIG. 3 shows that activation of an autophagy reaction that degrades protein in vitro following IAV infection is one of the causes of SOD1 protein reduction and viral titer increase.
- treatment with RNA interference of the LC3 gene which plays an important role in the process of autophagy activation, or treatment with the autophagy inhibitor 3-MA (3-Methyladenine) or chloroquine diphosphate, suppressed the reduction of SOD1 and eventually the virus It has been shown that the replication capacity is reduced. That is, since it reduces ROS by inhibiting the decrease of SOD1 protein, it means that the autophagy inhibitor 3-MA or chloroquine partially acts as an inhibitor of ROS production.
- FIG. 4 shows that the relationship between ROS generation and SOD1 enzyme amount reduction, which increases according to IAV infection in vitro , is affected by endoplasmic reticulum stress-reactive activity.
- FIG. 4 is a diagram confirming that activation of endoplasmic reticulum stress, which induces such a causal relationship, helps to proliferate the virus, and suppression of endoplasmic reticulum stress creates an unfavorable environment for the virus. Although it may vary depending on the degree of viral infection, it has been found that inhibition of endoplasmic reticulum stress has more influence on viral replication than inhibition of autophagy.
- FIG. 5 shows that the amount of SOD1 enzyme in the lung tissue was decreased as the amount of SOD1 in the lung tissue increased as the titer was increased during IAV infection in vivo , and it was confirmed that the accumulated amount of ROS in the bronchoalveolar lavage fluid (BALF) increased. It is a diagram confirming that the accumulation of ROS in BALF is reduced as the amount of SOD1 enzyme is recovered.
- BALF bronchoalveolar lavage fluid
- 6A and B are views comparing and confirming the effect of inhibiting virus proliferation and infection by measuring the change in weight of mice after nasal administration of ROS production inhibitors and scavengers alone or in combination in vivo .
- the treatment of SOD1 alone could obtain similar effects to those of the treatment of ROS production inhibitor (4-PBA) and scavenging agent (NAC).
- 4-PBA and NAC were treated in combination, there was a significant synergistic effect compared to the treatment alone.
- Figure 6C is a Vero E6 cell that induces COVID-19 Antiviral drug that decreases the genome copy value of the virus when treated with NAC and 4-PBA after infection with type 2 severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2, Severe acute respiratory syndrome coronavirus 2) at 0.05 MOI. It is showing effect.
- SARS-CoV-2 severe acute respiratory syndrome coronavirus 2
- FIG. 7 is a view confirming the effect of inhibiting the proliferation and infection of the virus through the weight change of rats and the decrease in the titer of the virus through the combined administration of SOD1 and various ROS production inhibitors and scavengers in vivo .
- ROS accumulation in bronchial alveolar lavage fluid decreased according to IAV infection when combined treatment.
- FIG. 8 is a diagram showing a comparison and confirmation of the infection prevention effect of 4-PBA, NAC, and SOD1 treatment in vitro and in vivo .
- tissue culture apoptosis was reduced when SOD1 and NAC were treated before IAV infection, and 4-PBA twice a day for 2 days before infection in order to test the preventive effect against general transmission pathways (airborne infections such as droplets) in rat experiments.
- 4-PBA twice a day for 2 days before infection in order to test the preventive effect against general transmission pathways (airborne infections such as droplets) in rat experiments.
- As a result of spraying the mixture of NAC and NAC it was observed that it showed a preventive effect in case of mild initial infection.
- Figure 10 is for the preparation and expression of the expression vector (expression vector) pET-SOD1 for bacteria for the overproduction of SOD1 used as a ROS scavenging agent.
- the present invention minimizes tissue damage through effective ROS production inhibition and scavenging action in respiratory infections and related diseases that cause overproduction and inflammation of ROS, and is applied to a complex antioxidant and antiviral composition applied to the prevention and treatment of viral infections. For.
- the present inventors studied the relationship between oxidative stress occurring in host cells during infection with influenza virus and infection and proliferation of the virus. As a result, it was confirmed that the expression of SOD1 decreased and the production of ROS increased according to the virus infection. It was confirmed that infection and ROS accumulation are sufficient conditions. In addition, the decrease in SOD1 and the increase in ROS are due to activation of the endoplasmic reticulum stress reaction mechanism, and when the ROS generated by using this viral infection mechanism in reverse is observed, the titer of the virus is observed to decrease. It was confirmed that the infection and ROS accumulation were not a simple sufficient condition but a necessary and sufficient condition.
- ROS accumulation affects the replication capacity of retrovirus HIV and coronavirus in addition to influenza virus (IAV). That is, it was re-verified that virus replication and infection and ROS accumulation were sufficient conditions (see Examples 2 and 6).
- the present inventors tried to further confirm the effect of activation of the endoplasmic reticulum stress response mechanism on viral proliferation, and specifically, IRE1, which is an intermediate factor of the endoplasmic reticulum stress signal pathway, through Examples After infecting a cell line lacking a gene with a virus, a change in the expression level of a viral protein was confirmed to see a change in the virus replication rate. As a result, when the endoplasmic reticulum stress response mechanism is blocked, the expression level of the viral protein is significantly reduced, and from this, it can be seen that activation of endoplasmic reticulum stress is not a phenomenon caused by viral infection, but an essential environmental condition necessary for viral infection and its proliferation. Yes (see Example 4).
- activation of the endoplasmic reticulum stress response mechanism is an essential condition for viral infection and its proliferation
- the present inventors have searched for a composition for inhibiting viral infection and/or its proliferation that is actually applicable.
- the amount of ROS remaining in the bronchial alveolar lavage fluid increased and the amount of SOD1 expressed in the lung tissue decreased according to the virus infection in vivo , and the alveolar alveoli according to the administration of external SOD1 in the infected animal model.
- the cumulative ROS amount of the washing solution decreased and the amount of SOD1 in the lung tissue recovered to a level similar to that before infection (see Example 5).
- the present inventors have identified an optimal combination of ROS production inhibitors and ROS scavengers capable of inhibiting viral proliferation by simultaneously blocking ROS generation and accumulation pathways essential for viral proliferation in an animal model.
- the combined treatment with SOD1 (50 unit/mouse) and other ROS production inhibitors and/or ROS scavengers has a remarkably superior synergistic effect on ROS production reduction and virus titer reduction than SOD1 alone treatment. Shown (see Example 7).
- the combination formulation was treated before IAV infection in tissue culture, or 2 days before animal infection, followed by infection.
- a certain amount of infection solution was sprayed into the cage for a certain time.
- the pretreatment of the composite composition has the effect of preventing infection during the initial administration by continuously confirming that the death of host cells in the tissue culture is reduced and the weight loss of the experimental animals in the early stage of infection is gradually suppressed compared to the untreated group. (See Example 8).
- the present invention can provide a composition for preventing, treating, or improving viral infectious diseases comprising an ROS production inhibitor and an ROS scavenging agent as active ingredients.
- GSH glutathione
- NAC N-acetyl cysteine
- butylated hydroxyanisole (BHA) is fat-soluble and has a property of stabilizing and erasing ROS, so it is widely used as a food preservative.
- SOD1 superoxide dismutase 1
- catalase ROS scavengers made in vivo.
- SOD1 is an intracellular molecule, unlike SOD3, which is exocytosis outside the cell, and is placed in the cell within an individual, and when applied to an animal model, there were questions about the efficient delivery of the active ingredient and maintenance of its activity, but a specific embodiment of the present invention Through this, it was confirmed that even in the animal model, the route of administration of SOD1 was effective to eliminate ROS in cells regardless of whether the route of administration was oral or nasal.
- 4-phenylbutyrate (4-PBA) inhibits the production of ROS through inhibition of endoplasmic reticulum stress and has a function of stabilizing SOD1 at the same time.
- ER stress refers to a state in which impaired endoplasmic reticulum function occurs when immature proteins with more than the ability to process the endoplasmic reticulum are introduced into the endoplasmic reticulum due to a physiological or pathological environment or calcium in the endoplasmic reticulum is depleted.
- endoplasmic reticulum stress occurs, the ER stress response occurs as a defense mechanism.
- the ER stress response is translation from mRNA to protein by phosphorylation of eIF2 ⁇ (eukaryotic translation initiation factor 2 alpha subunit).
- the term "vesicle stress inhibitor” in the present invention is not limited as long as it delays or blocks the activation of a defense mechanism against endoplasmic reticulum stress or reduces the degree of the endoplasmic reticulum stress response, and the "reactive oxygen production inhibitor” in the present invention It is not limited as long as it inhibits the production of reactive oxygen species, which is a product of various mechanisms, but preferably blocks the defense mechanism against endoplasmic reticulum stress that causes viral infection or decreases the degree of activation of the mechanism. It may be to reduce oxygen production and/or accumulation.
- the present invention not only suppresses ROS generation but also suppresses ROS production by treating a combination of ROS production inhibitors and ROS scavengers including SOD1 to significantly increase the efficiency of inhibition of viral proliferation and infection, as well as inhibition of ROS production. Since it is performed through activation blocking to suppress apoptosis, damage to cells, tissues, etc. in an individual can be prevented or minimized.
- prevention refers to any action that delays viral infection by administration of the composition according to the present invention or inhibits the replication of the virus to delay the onset of disease caused by infection
- treatment is according to the present invention. It refers to any action in which symptoms of a viral infection disease are improved or advantageously changed by administration of a pharmaceutical composition, and "improvement” refers to parameters related to a viral infection disease, for example, the degree of symptoms by administration of the composition according to the present invention. It means all actions that reduce.
- the virus infection disease that is the object of prevention, treatment, or improvement is controlled by the virus regardless of whether symptoms appear, and the virus is replicated through the replication of the viral genetic material, so that the infected cells function normally. It is not limited as long as it is not possible, and it does not matter whether the genome is DNA or RNA as long as the virus, which is the causative factor of the disease, increases ROS production by inducing endoplasmic reticulum stress in infected cells.
- the term "individual” means a vertebrate animal such as mammals and birds, including humans and livestock, and preferably refers to humans and livestock.
- the active oxygen generation inhibitor and the active oxygen scavenging agent may be used in the form of a pharmaceutically acceptable salt, and an acid addition salt formed by a pharmaceutically acceptable free acid is useful.
- salt is an acid addition salt formed by a pharmaceutically acceptable free acid.
- Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous or phosphorous acid, and aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes. It is obtained from non-toxic organic acids such as dioates, aromatic acids, aliphatic and aromatic sulfonic acids.
- Such pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, ioda Id, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suberate , Sebacate, fumarate, maleate, butin-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, me Toxibenzoate, phthalate, terephthalate, benzenesulfonate, toluenesulfonate
- the acid addition salt according to the present invention is prepared in a conventional manner, for example, an active oxygen generation inhibitor and/or an active oxygen scavenger are dissolved in an excess of an aqueous acid solution, and the salt is dissolved in a water-miscible organic solvent such as methanol, ethanol. , Acetone or acetonitrile can be used to precipitate.
- the mixture may be prepared by evaporating a solvent or an excess of acid and drying it or by suction filtration of the precipitated salt.
- a pharmaceutically acceptable metal salt may be prepared using a base.
- the alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating and drying the filtrate. At this time, it is pharmaceutically suitable to prepare sodium, potassium or calcium salt as the metal salt.
- the corresponding silver salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable negative salt (eg, silver nitrate).
- composition of the present invention includes not only pharmaceutically acceptable salts, but also all salts, isomers, hydrates and solvates that can be prepared by conventional methods.
- the pharmaceutical composition may further include a suitable carrier, excipient, and diluent commonly used in the preparation of the pharmaceutical composition.
- carrier is also called a vehicle, and refers to a compound that facilitates the addition of a compound into cells or tissues.
- DMSO dimethyl sulfoxide
- carrier is also called a vehicle, and refers to a compound that facilitates the addition of a compound into cells or tissues.
- DMSO dimethyl sulfoxide
- It is a commonly used carrier that facilitates the introduction of many organic compounds into tissues.
- diot is defined as a compound that is diluted in water to dissolve the compound as well as stabilize the biologically active form of the target compound.
- Salts dissolved in buffer solutions are used as diluents in the art.
- the commonly used buffer solution is phosphate buffered saline, because it mimics the salt state of human solutions. Because buffer salts can control the pH of a solution at low concentrations, buffer diluents rarely alter the biological activity of a compound.
- the compounds containing azelaic acid as used herein may be administered to a human patient as such, or as a pharmaceutical composition mixed with other ingredients, such as in combination therapy, or with a suitable carrier or excipient.
- the pharmaceutical composition for preventing or treating fatty liver comprising azelaic acid is a powder, granule, tablet, capsule, suspension, emulsion, syrup, aerosol, etc.
- a carrier, excipient, and diluent that can be formulated and used in the composition containing azelaic acid, lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, Starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and Mineral oils are mentioned.
- Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations contain at least one excipient, such as starch, calcium carbonate, and sucrose. ) Or lactose (lactose), gelatin, etc. are mixed to prepare. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.
- Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc.
- Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories.
- non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used.
- injectable ester such as ethyl oleate
- a base for suppositories witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like can be used.
- the therapeutically effective amount for a composition comprising an active oxygen production inhibitor and an active oxygen scavenging agent of the present invention can be determined initially from cell culture assays.
- the dose can be calculated in an animal model to obtain a range of circulating concentrations including the half maximal inhibitory concentration (IC 50 ) or half maximal effective concentration (C 50 ) determined in the cell culture. Such information can be used to more accurately determine useful doses in humans.
- the dosage of the composition of the present invention may vary within the above range depending on the dosage form employed and the route of administration employed.
- the preferred dosage of the pharmaceutical composition of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the drug form, the route and duration of administration, but may be appropriately selected by those skilled in the art.
- the pharmaceutical composition of the present invention is preferably administered at 0.0001 to 1000 mg/kg per day, preferably 0.5 to 200 mg/kg, and more preferably 0.5 to 100 mg/kg. Administration may be administered once a day, or may be divided several times. The above dosage does not in any way limit the scope of the present invention.
- the pharmaceutical composition according to the present invention can be administered to mammals such as mice, rats, livestock, humans, etc. by various routes such as parenteral and oral, and all modes of administration can be expected, for example, rectal, Intravenous, intramuscular, subcutaneous, intrauterine dura mater, or cerebrovascular injection; oral; It can be administered by nasal passage, but is preferably administered by inhalation into the subject's nose or mouth.
- the combined formulation consisting of the active oxygen production inhibitor and the active oxygen scavenging agent of the present invention may be provided as an inhalant formulated in an inhalable form, and in this case, the combined formulation may be included in the inhalant in the form of an aqueous solution or dry powder,
- the inhalant may be in the form of an aerosol including a mixture of one or more pharmaceutically acceptable propellants and carriers.
- the oral dosage form may be administered once to several times a day depending on the age, sex, and weight of the patient.
- each dosage may be increased or decreased according to the route of administration, the degree of disease, sex, weight, age, and the like. Therefore, the dosage of the present invention does not limit the scope of the present invention in any way.
- the composition when provided as a mixture in which other ingredients are added in addition to the active oxygen generation inhibitor and the active oxygen scavenger, contains 0.001% to 99.9% by weight of the vesicle stress inhibitor and the active oxygen scavenger, based on the total weight of the composition, Preferably, 0.1% to 99% by weight, more preferably from 0.1% to 50% by weight may be included.
- the present invention provides a food composition for preventing or improving viral infectious diseases, comprising an active oxygen production inhibitor and an active oxygen scavenger as active ingredients.
- an active oxygen production inhibitor and an active oxygen scavenging agent may be added to food for the purpose of suppressing viral infections or preventing disease transmission.
- the active oxygen production inhibitor and the active oxygen scavenger of the present invention are used as food additives, the active oxygen production inhibitor and the active oxygen scavenger may be added as it is or may be used together with other foods or food ingredients, and it is appropriate according to a conventional method. Can be used.
- the mixing amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment).
- the azelaic acid of the present invention is added in an amount of 15% by weight or less, preferably 10% by weight or less based on the raw material.
- the amount may be below the above range, and there is no problem in terms of safety, so the active ingredient may be used in an amount above the above range.
- food includes functional foods and health functional foods
- the term'functional food' means a food in which the functionality of a general food is improved by adding an active oxygen production inhibitor and an active oxygen scavenger of the present invention to the general food.
- Functionality can be broadly divided into physical properties and physiological functions.
- the active oxygen production inhibitor and the active oxygen scavenging agent of the present invention are added to a general food, the physical properties and physiological functions of the general food will be improved.
- 'Functional food' is defined as'functional food'.
- the functional food of the present invention can be used in various ways such as drugs, foods and beverages for the prevention or improvement of viral infectious diseases since the replication of the virus is suppressed by reducing the synthesis of viral proteins.
- types of food There is no particular limitation on the type of food.
- foods to which the above substances can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, Alcoholic beverages and vitamin complexes, and all foods in the usual sense are included.
- the health beverage composition according to the present invention may contain various flavoring agents or natural carbohydrates as an additional component, like a conventional beverage.
- the natural carbohydrates described above are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol.
- natural sweeteners such as taumatin and stevia extract, and synthetic sweeteners such as saccharin and aspartame can be used.
- the proportion of the natural carbohydrate is generally about 0.01-20 g, preferably about 5-12 g per 100 mL of the composition of the present invention.
- the composition of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, colorants, pectic acids and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, Carbonating agents used in carbonated beverages may be contained.
- the composition of the present invention may contain flesh for the production of natural fruit juice, fruit juice beverage and vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not very important, but it is generally selected in the range of 0.01-0.20 parts by weight per 100 parts by weight of the composition of the present invention.
- Recombinant IAV (A/WSN/1933) is R.G.
- lipofectamine 2000 was used as a transfection agent, and transfection was performed for 24 hours.
- 293T cells were transfected by culturing them in a medium containing 10% FBS in DMEM, and the next day, they were replaced with Opti-MEM medium containing 0.3% BSA and cultured. After 48 hours of medium replacement, only the cell culture was collected, centrifuged at 13,000 rpm for 1-2 minutes, and the virus was obtained from the supernatant.
- IAV infected with Madin-Darby canine kidney (MDCK) cells, and a virus to be used after 24 to 48 hours was obtained.
- MDCK Madin-Darby canine kidney
- the MDCK line was used as cells for the Plaque assay. Dispense 1.0 ⁇ 10 6 MDCK cells per well of a 6-well plate, and add 500 ⁇ l of diluted virus to each well by serial dilution at 100% confluency for 1 hour. Performed. At this time, the medium was Opti-MEM, 0.3% BSA, 1 ⁇ g/ml TPCK-trypsin, and agar media (2x L-15 medium, 0.8% agar, 0.075% NaHCO 3 , 1 ⁇ g/ml TPCK- trypsin, 0.3% BSA, 1x glutamate/antibiotics). After replacing the medium, it was maintained at room temperature until it solidified, and then incubated for 2 to 3 days under conditions of 37°C and 5 atm CO 2 .
- tissue culture infection most of the virus whose titer was measured was infected with human alveolar epithelial cells A549 at 0.01 MOI. After 1 hour of infection, the cells were washed with PBS (phosphate-buered saline) and incubated with RPMI 1640 or DMEM containing 2% FBS for 24 hours.
- PBS phosphate-buered saline
- Animal infection experiments were carried out using 3-week-old rats (BALB/c or C57BL/6N), and after infection through the intranasal of the rats, body weight was measured during the breeding period. After breeding according to experimental conditions for a certain period of time, anesthesia was performed, and rat lung tissue was collected, and virus titer was measured through plaque assay, and ROS analysis such as BALF (Bronchoalveolar lavage fluid) was performed.
- BALF Bronchoalveolar lavage fluid
- the obtained cDNA was used as a template, and the Chop primer (sense, 5'-GACTCTTCATACACCACCACACCTGA-3'; anti-sense, 5'- GCCGCTCGTTCTCTTCAGCTAGCT -3) ') was used to compare Chop mRNA expression by polymerase chain reaction.
- Vero E6 cells were aliquoted and cultured in each well of a 24-well plate, and the cells were infected with SARS-CoV-2 at 0.05 MOI for 1 hr, and then cultured for 48 hours with or without antiviral treatment (control). .
- Viral RNA was separated using a viral RNA isolation kit and stored at -80°C.
- the target gene for genome copy quantitative analysis is the E gene encoding the SARS-CoV-2 envelope protein, and qRT-PCR analysis was performed using the Power SYBR Green RNA-to-C T 1-Step Kit (Applied Biosystems).
- cells were aliquoted at 1 ⁇ 10 5 cells/well in a 12-well plate, treated with HIV-Tat protein or H 2 O 2 , or cultured for 24 hours after infection with IAV.
- the negative control with only medium added the control with only infection (MOI 0.01 or 0.03), and cell lines using XBP1 siRNA, prepare a single cell suspension in PBS (Phosphate-buffered saline) and add a fluorescent dye at a ratio of 1/5,000. It was dyed for 30 minutes at room temperature.
- PBS Phosphate-buffered saline
- Intracellular ROS (H 2 O 2 ) production was measured using 2'7'-dichlorofluorecein diacetate (DCFH-DA, Sigma), and after washing with PBS, flow cytometry (FACS-Calibur, Becton-Dikinson) was measured. The amount of superoxide anion was measured using a superoxide detection system (Enzo Life Sci.).
- pLTR-Luc a luciferase reporter
- the U3 and R portions (-453 ⁇ +82) of the promoter 5'long terminal repeats of HIV1 were separated and inserted into pGL3-basic (Promega, Madison, WI).
- pGL3-basic Promega, Madison, WI.
- Promega luciferase assay kit was used according to the method suggested by the manufacturer.
- the SOD1 expression vector pET-SOD1 was constructed so that the human SOD1 gene can be mass-produced in bacterial culture.
- pET-26b(+) plasmid was used, and after cutting it with Nde I and Hind III, the human SOD1 gene (refer to the base sequence diagram) was used as a primer pair 5'-CCCAAGCTTT TATTGGGCGA TC-3' and 5 PCR amplification was performed using'- TTCCATATGA TGGCGACGAA GGCC-3', and then these products were cloned through heat-denaturation and recombination.
- the pET-SOD1 was introduced into bacteria and cultured to confirm the result of expression induced by 1 mM IPTG.
- A549 lung cell line was infected with MOI (multiplicity of infection) 0.01 or 0.03 for 24 hours. After treating the infected cell line with a substance that specifically binds to superoxide anion, it was confirmed by flow cytometry (see A in FIG. 1), it was confirmed that ROS increased with increasing virus MOI.
- MOI multiplicity of infection
- Example 1 and 2 Data supporting that virus replication and infectivity can be controlled by ROS accumulated by viral infection were confirmed (Examples 1 and 2).
- the mechanism of action of this phenomenon we investigated whether the virus decreases the SOD1 protein of the host and whether autophagy, which has a proteolytic function, is a fundamentally related regulatory pathway.
- the LC3 gene which plays a major role in autophagy activation, was silencing with siRNA and the degree of LC3 conversion and the amount of SOD1 protein were confirmed by Western blotting. .
- LC3 was significantly converted in virus-infected cells and the amount of SOD1 protein was also markedly decreased.
- a cell line lacking the IRE1 (Inositol-requiring enzyme 1) gene in endoplasmic reticulum stress activation signaling was infected with a virus and the expression level of the viral protein PB1 was confirmed. It was confirmed that the expression of PB1 in the cells lacking the IRE1 gene was significantly reduced compared to the cells lacking the IRE1 gene (see A in FIG. 4).
- the expression level of the endoplasmic reticulum stress activation marker gene Chop was confirmed by performing RT-PCR 24 hours after infection with the virus in the A549 cell line. As a result, it was confirmed that the expression of the Chop gene was increased in the cells infected with the influenza virus, and from the above results, it was found that the endoplasmic reticulum stress mechanism of the cells was activated by the influenza virus infection (see B in FIG. 4).
- siRNA was used for 18 hours immediately before viral infection to induce the inactivation of XBP1, a sub-stage gene of IRE1 in transduction of endoplasmic reticulum stress activation. .
- XBP1 a sub-stage gene of IRE1 in transduction of endoplasmic reticulum stress activation.
- the amount of ROS production decreased by about 30% or more compared to the control (Negative siRNA) (Fig. 4). C). From the above results, it was found that influenza virus infection activates endoplasmic reticulum stress, and there is a close correlation between the activation of endoplasmic reticulum stress and an increase in the production of ROS.
- influenza virus infection activates endoplasmic reticulum stress, and that activation of endoplasmic reticulum stress induces a decrease in SOD1 expression and an increase in ROS generation.
- Example 5 Effect of ROS increase and decrease and ROS production inhibitor or scavenging agent administration according to the degree of influenza virus infection in an animal model
- Examples 1 and 3 showed that endoplasmic reticulum stress was activated by influenza virus infection in vitro , and decreased SOD1 expression and increased ROS generation by activation of endoplasmic reticulum stress.
- mice C57BL/6N or BALB/c were infected with an influenza virus with 10 or 100 Plaque forming units (PFU), and then the amounts of SOD1 and ROS and viral titers in lung tissue were measured.
- PFU Plaque forming units
- SOD1 is an enzyme present in the cytoplasm and acts within the cell. Accordingly, in order to check whether SOD1 exhibits its function when administered nasal cavity, a certain amount of SOD1 was injected into the infected mice by intranasal spraying, and the amounts of SOD1 and ROS in the lung tissue were measured.
- mice administered 50 unit/mouse SOD1, 1 mg/mouse NAC, or 2.5 mg/mouse 4-PBA and 50 unit/mouse SOD1 and 50 unit/mouse catalase were administered intranasally. As a result of measuring the weight of the mice, a significant change in weight was observed (see FIG. 6A).
- ROS accumulation is a result of viral infection and is an essential condition for viral infection and proliferation.
- Example 7 Antiviral activity synergy analysis by combination of ROS production inhibitor and scavenging agent
- mice C57BL/6N were infected with 1,000 PFU influenza virus, and SOD1 and NAC, 4-PBA, or BHA were administered in combination at the beginning of infection, or NAC and 4-PBA were administered intranasally, and then the weight of the mice. And viral titer changes were compared with the control group.
- Example 8 Confirmation of the effect of preventing viral infection disease of the combination of ROS production inhibitor and scavenging agent
- the administration of the ROS production inhibitor and the scavenging agent was intended to confirm the effect on the prevention of viral infections. Accordingly, the A549 lung cell line was infected with IVA after treatment with SOD1 and NAC, and the degree of apoptosis was observed. As a result, it was confirmed that apoptosis caused by viral infection was significantly reduced when pretreatment with SOD1 and NAC (see A in FIG. 8).
- the present invention relates to a pharmaceutical composition for the prevention or treatment of viral infectious diseases comprising an active oxygen production inhibitor and an active oxygen scavenger complex as an active ingredient, and as a limited alternative to a vaccine that must be newly developed every year due to viral mutations ( global) It can be applied as an infection inhibitor and therapeutic agent, and can be used as a preventive or adjuvant for quarantine.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Polymers & Plastics (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Food Science & Technology (AREA)
- Pulmonology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Animal Husbandry (AREA)
- Otolaryngology (AREA)
- Mycology (AREA)
- Nutrition Science (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
본 발명은 바이러스 감염 질환을 예방, 치료, 및 개선할 수 있는 조성물에 관한 것으로서, 활성산소 생성억제제 및 활성산소 소거제는 안전성이 이미 검증되어 본 발명의 조성물도 인체 적용에 안전성이 보장되고, 본 발명은 바이러스가 숙주세포의 산화적 손상을 야기하여 그 조건에서 바이러스 복제 및 감염을 활성화시키는 기전을 역으로 이용한 것으로서, 기존의 백신과 같이 특정 바이러스에 대한 직접적인 특이성(specificity)은 없으나, 바이러스의 종류나 변이(mutation)와 무관하게 산화적 스트레스를 유발하는 모든 바이러스에 대한 증식을 효율적으로 억제할 수 있는 바, 신종바이러스의 출현이나 바이러스 변이에 의해 매년 새로 개발해야 하는 백신의 제한적 대체제로서 글로벌(global) 감염억제제 및 치료제로 적용될 수 있으며 방역 차원의 예방제 또는 보조제 등으로 활용될 것으로 기대된다.
Description
본 발명은 활성산소 생성억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방 또는 치료용 약학적 조성물 등에 관한 것이다.
일반적으로 활성산소(reactive oxygen species: ROS)는 정상적인 세포의 대사산물로서 산소분자의 환원작용으로 생성되는 기본적인 경로 이외에 감염이나 염증 등의 요인으로 세포 및 조직 종류에 따라 다양한 기전을 통해 생성된다. ROS 생성에는 세포막의 NADPH oxidases (NOXs), 미토콘드리아, 과산화소체(peroxisome)가 관여한다. 또한 최근에 단백질 folding, 분비 및 세포 내 칼슘조절에 관련하는 소포체(endoplasmic reticulum, ER)에서 endoplasmic reticulum oxidoreductin 1 (ERO1)과 protein disulfide isomerase (PDI) 효소 작용으로 단백질의 이황화 결합(disulfide bond) 형성시에 ROS가 생성될 수 있음이 알려졌다. 생체내에서 적절한 농도의 ROS는 세포분화, 세포 신호전달 및 항상성(homeostasis) 등 세포 생리학적으로 유용하게 작용하나, 자외선 조사 및 감염 등에 의한 고농도 ROS 생성은 지질, 단백질, DNA에 치명적인 악영향을 미친다. 따라서 생체 내에서 자체 ROS catabolism을 갖추어 ROS 농도를 조절하지만, 과도한 ROS 생성은 산화적 스트레스를 야기한다.
과도한 ROS 생산에 대응하기 위하여 생체 내에 효소적 또는 비효소적 항산화시스템이 있다. 효소적 항산화제로는 superoxide dismutases (SODs)와 catalase가 있다. SODs와 catalase에의하여 소거되지 못한 ROS들은 반감기가 짧으며 반응성이 매우 높은 하이드록시기(hydroxyl radical: OH)로 전환된다. SODs와 catalase에 의해 해독될 수 있는 superoxide 및 과산화수소와 달리, 하이드록시기(ㆍOH)는 생체 내에서 대식세포 등의 면역반응의 부산물로도 생성되며, 생성된 ㆍOH은 효소 반응에 의해 제거될 수 없으므로 유기체에 매우 유해하다. 또한, 생체에는 3 가지 형태의 SOD가 존재하는데, SOD1은 주로 세포질, SOD2는 미토콘드리아, SOD3는 세포 외에서 작용한다. SOD1과 SOD3는 구리와 아연 이온을 함유하고 SOD2는 망간 이온이 관여한다.
생체 내에서 산화적 스트레스가 발생되는 여러 경우가 있는데, 이 중에 하나인 바이러스 감염에 의한 ROS 과다생성에 대한 연구가 최근 집중되고 있다. 흔히 독감을 유발하는 것으로 알려져 있는 인플루엔자 A 바이러스(Influenza A Virus, IAV)는 급성 호흡기 질환을 일으키는 대표적인 원인 중의 하나이다. IAV는 매년 전 세계적으로 크고 작은 유행을 일으키며, 2~3주 내로 통상 인구의 10~20%가 감염될 수 있을 정도로 전염성이 매우 크다. IAV 감염 중에 나타나는 ROS 증가는 세포사멸을 일으키며, 심각한 세포 스트레스를 일으킨다. 이러한 산화적 스트레스의 결과로서 oxidative DNA damage에 의하여 ROS-mutation theory 개념이 성립되었으며, 세포 내에서 ROS가 과량 생산되면 염증반응, 세포사멸 등 단기적 결과뿐 아니라, 나아가 ROS에 지속적으로 노출 시 소포체스트레스 악화로 노화 관련 각종 퇴행성 질병 유발 등의 심각한 영향을 미치는 것이 밝혀졌다.
본 발명자들은 in vitro 및 동물실험에서의 IAV가 유도하는 ROS가 바이러스 복제율과 감염율을 증가시킨다는 것을 최초로 확인하였다. 또한 현재까지 IAV가 일으키는 ROS의 정확한 생성기전과 그의 원인은 아직도 불명확하나, 본 발명자들의 연구 결과 바이러스 감염 후 숙주세포 손상에 소포체스트레스로 인한 ROS 증가가 많은 영향을 끼치는 것을 알 수 있었다.
본 발명이 이루고자 하는 기술적 과제는 ROS 생성억제와 소거를 동시에 달성하여 바이러스 감염 질환을 보다 효과적으로 예방, 치료, 또는 개선할 수 있도록 하는 것으로서, 본 발명은 ROS 생성억제제와 ROS 소거제를 유효성분으로 포함하는 조성물을 바이러스 감염 질환의 예방, 치료, 또는 개선을 위한 약학적 조성물, 식품 조성물, 사료 첨가물, 및 방역용 조성물로서 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당해 기술분야의 통상의 기술자에게 명확하게 이해될 수 있을 것이다.
상기 과제를 해결하기 위하여, 본 발명은 ROS 생성억제제 및 ROS 소거제를 유효성분으로 포함하는, 바이러스 감염 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 ROS 생성억제제 및 ROS 소거제를 유효성분으로 포함하는, 바이러스 감염 질환의 예방 또는 개선용 식품 조성물을 제공한다.
또한, 본 발명은 ROS 생성억제제 및 ROS 소거제를 유효성분으로 포함하는, 바이러스 감염 질환의 예방 또는 개선용 사료 첨가제를 제공한다.
또한, 본 발명은 ROS 생성억제제 및 ROS 소거제를 유효성분으로 포함하는, 바이러스 감염 질환의 방역용 조성물을 제공한다.
또한, 본 발명은 ROS 생성억제제 및 ROS 소거제를 유효성분으로 포함하는, 향장 조성물을 제공한다.
본 발명의 일 구현예로서, 상기 ROS 생성억제제는 소포체스트레스 활성화 방지또는 억제를 통해 ROS 생성량을 감소시키는 것일 수 있으며, 구체적으로 상기 ROS 생성억제제는 4-페닐부티레이트(4-phenylbutyrate: 4-PBA), 타우린 컨쥬게이티드 우르소데옥시콜산(taurine-conjugated ursodeoxycholic acid: TUDCA), 3-MA(3-Methyladenine) 및 클로로퀸(chloroquine diphosphate)으로 으로 이루어진 군으로부터 선택된 하나 이상일 수 있으며, 바람직하게는 4-PBA일 수 있다.
본 발명의 다른 구현예로서, 상기 ROS 소거제는 초과산화물 불균등화효소 (superoxide dismutase 1: SOD1)일 수 있으며, N-아세틸 시스테인(N-acetyl cysteine: NAC), 글루타치온(glutathione), 카탈라아제(catalase), 부틸하이드록시아니솔(butylated hydroxyanisole: BHA), 부틸하이드록시톨루엔(butylated hydroxytoluene: BHT), 아스코르부산(ascorbic acid), 및 토코페롤(tocopherol)으로 이루어진 군으로부터 선택된 하나 이상을 추가로 포함할 수 있으나, 바람직하게는 SOD1과 NAC 및/또는 BHA의 복합일 수 있으며, 더욱 바람직하게는 SOD1 및 NAC일 수 있다.
본 발명의 또 다른 구현예로서, 상기 조성물은 비강, 구강, 또는 흡입 투여용일 수 있으나, 바람직하게는 호흡을 이용하여 개체의 기관지 내부로 투여하는 흡입 투여용일 수 있다.
본 발명의 또 다른 구현예로서, 상기 바이러스는 RNA를 유전체로 갖는 바이러스일 수 있으며, 상기 바이러스의 비제한적인 예로 인플루엔자 A 바이러스, 인간면역결핍바이러스 및코로나바이러스 등이 있으며, 본 발명에서 상기 바이러스는 본 발명의 약학적 조성물의 제형과 투여방법을 고려하여 인플루엔자 A 바이러스 및 코로나바이러스를 포함하는 호흡기 질환 유발 바이러스일 수 있다.
또한, 본 발명은 ROS 생성억제제 및 ROS 소거제 복합제제를 개체에 투여하는 단계를 포함하는 바이러스 감염 질환의 예방 또는 치료 방법을 제공한다.
본 발명의 일 구현예로서, 상기 ROS 생성 억제제 및 ROS 소거제는 동시에 또는 순차로 투여되는 것일 수 있으나, 바람직하게는 하나의 조성물안에 혼합되어 동시에 투여하는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 ROS 생성 억제제 및 ROS 소거제 복합제제는 개체의 입 또는 코를 통해 투여되는 것일 수 있으며, 코를 통해 투여되는 경우 상기 복합제제를 분사(spray)하여 투여할 수 있다. 즉, 상기 투여는 개체의 기관지 내부로 상기 복합제제가 전달될 수 있는 투여방법이라면 제한되지 아니하나, 바람직하게는 개체의 호흡을 통해 투여하는 것일 수 있다. 본 발명의 또 다른 구현예로서, 상기 투여는 1일 1회 이상 수행되는 것일 수 있다.
또한, 본 발명은 바이러스 감염 질환의 예방 또는 치료용 약제의 제조를 위한 ROS 생성억제제 및 ROS 소거제의 복합제제의 용도를 제공한다.
본 발명은 바이러스 감염 질환을 예방, 치료, 및 개선할 수 있는 조성물에 관한 것으로서, 활성산소 생성억제제 및 활성산소 소거제는 안전성이 이미 검증되어 본 발명의 조성물도 인체 적용에 안전성이 보장된다. 또한, 본 발명은 바이러스가 숙주세포의 산화적 손상을 야기하여 그 조건에서 바이러스 복제 및 감염을 활성화시키는 기전을 역으로 이용한 것으로서, 기존의 백신과 같이 특정 바이러스에 대한 직접적인 특이성(specificity)은 없으나, 바이러스의 종류나 변이(mutation)와 무관하게 산화적 스트레스를 유발하는 모든 바이러스에 대한 증식을 효율적으로 억제할 수 있는 장점이 있다. 또한, 본 발명의 조성물은 변이에 무관하게 바이러스 증식을 억제할 수 있는 바, 바이러스 변이에 의해 매년 새로 개발해야 하는 백신의 제한적 대체제로서 글로벌(global) 감염억제제 및 치료제로 적용될 수 있으며 방역 차원의 예방제 또는 보조제 등으로 활용될 수 있다. 아울러, 본 발명의 조성물은 바이러스 증식 억제와 동시에 산화적 스트레스에 의한 세포 및 조직의 손상을 최소화할 수 있다는 장점이 있다.
도 1은 in vitro에서 인플루엔자 A 바이러스(IAV) 감염에 따라 ROS의 생성이 증가하고, SOD1 효소량이 감소될 때 바이러스 단백질인 PB1의 발현이 증가하는 상호관계를 보여주는 도면이다.
도 2는 후천성면역겹핍증(AIDS)을 유발하는 인간면역결핍바이러스(Human Immunodeficiency Virus, HIV) 감염시 주요 역할을 하는 HIV의 Tat 단백질 혹은 외부 H2O2를 처리하면 ROS 생성이 증가됨을 보여준다. 이때, ROS 소거제인 NAC의 처리시 ROS 증가로 인한 HIV 복제 활성이 감소됨을 확인한 도면이다.
도 3은 in vitro에서 IAV 감염에 따라 단백질 분해를 하는 자가포식(Autophagy)반응이 활성화되는 것이 SOD1 단백질 감소와 바이러스 역가(titer) 증가의 원인 중의 하나인 것을 나타내 주고 있다. 이를 입증하기 위하여 자가포식 활성화 과정에서 중요한 역할을 하는 LC3 유전자의 RNA 간섭(interference) 처리 혹은 자가포식 억제제 3-MA(3-Methyladenine)나 클로로퀸(chloroquine diphosphate) 처리시 SOD1 감소가 억제되면서 결국 바이러스의 복제능력이 감소됨을 보여주었다. 즉 SOD1 단백질의 감소를 억제하여 ROS를 감소시키므로 자가포식 억제제 3-MA 혹은 클로로퀸은 부분적으로 ROS 생성 억제제로 작용함을 의미한다.
도 4는 in vitro에서 IAV 감염에 따라 증가하는 ROS 발생과 SOD1 효소량 감소관계는 소포체스트레스 반응기작 활성에 영향을 받는 것을 보이고 있다. 또한 이러한 인과관계를 불러오는 소포체스트레스 활성화는 바이러스 증식에 도움을 주고 소포체스트레스 억제는 바이러스에 불리한 환경을 조성함을 확인한 도면이다. 바이러스 감염 정도에 따라 다를 수도 있지만 자가포식 억제보다 소포체스트레스 억제가 바이러스 복제에 좀더 많은 영향을 주는 것으로 확인되었다.
도 5는 in vivo에서 IAV 감염시 역가를 높일수록 폐 조직에서 SOD1 효소량이 감소되면서 기관지 폐포세척액(BALF)에 ROS양의 누적량이 증가하였음이 확인되고, 외부에서 SOD1을 비강투여함에 따라 폐 조직의 SOD1 효소량이 회복되면서 BALF에 ROS의 누적이 감소됨을 확인한 도면이다.
도 6A와 B는 in vivo에서 ROS 생성억제제 및 소거제의 단독 혹은 복합으로 비강투여 후 쥐의 체중 변화 측정을 통해 바이러스의 증식 및 감염 억제 효과를 비교 확인한 도면이다. Catalase와 복합 처리의 상승효과 시험시 SOD1 단독 처리로도 ROS 생성억제제(4-PBA) 및 소거제(NAC)의 처리 경우와 유사한 효과를 얻을 수 있음을 확인했다. 그러나 4-PBA와 NAC를 복합 처리하였을 시 각각 단독처리에 비하여 큰폭의 상승효과가 있음을 보였다. 특히 도 6C는 Vero E6 cell에 COVID-19을 유발하는 제2형 중증급성호흡기증후군 코로나바이러스 2(SARS-CoV-2, Severe acute respiratory syndrome coronavirus 2)를 0.05 MOI로 감염 후, NAC와 4-PBA 병용처리시 바이러스의 genome copy 값이 감소하는 항바이러스의 효과를 보이고 있다.
도 7은 in vivo에서 SOD1과 다양한 ROS 생성억제제 및 소거제를 복합 투여하여 쥐의 체중변화를 통한 바이러스의 증식 및 감염 억제 효과와 바이러스의 역가 감소를 확인한 도면이다. 또한 병용처리시 IAV 감염에 따라 기관지 폐포세척액에 ROS 누적량이 감소되는 것을 보여주었다.
도 8은 in vitro 및 in vivo에서 4-PBA, NAC 및 SOD1 처리의 감염 예방 효과를 비교 확인한 도면이다. 조직배양에서 SOD1과 NAC를 IAV 감염전 처리시 세포사멸이 줄었으며, 쥐실험에서 일반적 전염경로(비말 등 airborne infection)에 대한 예방 효과를 시험하기 위하여 감염전 1일 2회 2일동안 4-PBA와 NAC 혼합액을 분무한 결과 경미한 초기 감염시 예방 효과를 보이는 것을 관찰하였다.
도 9는 in vivo에서 감염초기에 4-PBA와 NAC 및 SOD1의 복합처리시 바이러스 감염 억제와 더불어 숙주세포의 치료 효과에 대한 상승효과를 확인하였다. 상기 복합 제제는 구강(Oral administration, OA)보다 비강 투여(Nasal spray, NS) 시 보다 후수한 효과가 있음을 확인한 도면이다.
도 10은 ROS 소거제로 사용되는 SOD1의 과량생산을 위한 박테리아용 발현벡터(expression vector) pET-SOD1 제조와 발현 확인에 대한 것이다.
본 발명은 ROS의 과다생성과 염증을 유발하는 호흡기 감염 및 관련 질환에서 효율적인 ROS의 생성억제 및 소거작용을 통하여 조직 손상을 최소화하고 바이러스 감염 질환의 예방 및 치료에 적용되는 복합 항산화 및 항바이러스제 조성물에 대한 것이다.
본 발명자들은 인플루엔자바이러스의 감염시 숙주세포에서 발생하는 산화적 스트레스와 바이러스의 감염 및 증식간의 관계에 대해 연구한 결과, 바이러스 감염에 따라 SOD1의 발현이 감소되며 ROS의 생성이 증가됨을 확인하여 바이러스 증식에 따른 감염과 ROS 누적이 충분조건임을 확인하였다. 또한, 상기 SOD1 감소와 ROS 증가는 소포체스트레스 반응기작의 활성화에 의한 것으로서, 이러한 바이러스 감염 기작을 역으로 이용하여 생성되는 ROS를 소거하는 경우 바이러스의 역가(titer)가 감소함을 관찰하고 바이러스 증식에 따른 감염과 ROS 누적이 단순 충분조건이 아닌 필요충분조건임을 확인하였다. 이에, SOD1과 ROS 소거제의 복합 투여 및 ROS 생성억제제와 소거제의 복합 투여가 세포사멸을 효과적으로 억제하고 바이러스 감염 질환의 예방 효과가 있음을 확인하였으며, 나아가 생성된 ROS 소거와 동시에 소포체 스트레스반응 기전을 차단하여 생성되는 ROS를 감소시키는 경우 ROS 소거제를 단독으로 처리하는 경우보다 현저하게 우수한 바이러스 감염 및/또는 증식을 차단할 수 있음을 실험적으로 확인하고 본 발명을 완성하였다.
보다 구체적으로, 인간 폐포상피 세포주(alveolar epithelial cell line) A549를 이용한 in vitro 실험에서 감염시킨 바이러스의 MOI에 비례하여 발생하는 ROS가 증가함을 확인하고, 바이러스 감염에 의한 ROS의 증가 원인을 보다 세부적으로 확인하기 위하여 세포 내에서 ROS 소거제로 작용하는 SOD1의 발현 수준의 변화를 관찰한 결과 바이러스 유전체의 복제가 진행됨에 따라 SOD1의 발현이 감소됨을 확인할 수 있었다. 동시에 바이러스 감염에 의한 SOD1 감소 또는 ROS 증가는 바이러스의 증식을 높여주는 결과를 보여주고 있다(실시예 1 참조).
본 발명의 구체적인 실시예에서는 ROS 누적이 인플루엔자바이러스(IAV) 이외에도 레트로바이러스 HIV와 코로나바이러스의 복제능에도 영향을 나타냄을 확인하였다. 즉, 바이러스의 복제 및 감염과 ROS 누적은 충분조건임을 재검증하였다(실시예 2 및 6 참조).
또한, 바이러스 감염에 의해 증가하는 ROS 발생이 구체적으로 어떤 machanism에 의한 것인지 확인하고자 하였으며, 이를 위하여 바이러스에 감염된 A549 세포주에서 자가포식과 소포체스트레스의 활성화 마커 유전자의 발현 수준을 각각 확인하여 바이러스 감염에 따라 자가포식과 소포체스트레스 기전이 활성화됨을 확인하였으며, 각 활성 기전 신호전달 경로(signal pathway)의 중간 인자인 LC3 및 XBP1 유전자에 대한 siRNA를 이용하여 불활성화시킨 경우, 바이러스 감염에 의한 ROS 생성량이 약 30% 이상씩 감소됨을 확인하여, 바이러스 감염에 따라 증가하는 ROS 발생이 자가포식이나 소포체스트레스 반응기작에 의한 산물임을 검증하였다(실시예 3 및 4 참조).
따라서, 자가포식 및 소포체스트레스 반응과 SOD1 단백질양과의 상관관계에 근거하여 각각 반응의 특이적 억제제 처리가 항바이러스 효과가 있는지 확인하기 위하여, 먼저 A549 세포주 in vitro system에서 각각의 억제제 3-MA 혹은 클로로퀸 및 4-PBA를 처리하고 SOD1 단백질 수준 변화를 확인한 결과 바이러스 감염시 자가포식이나 소포체스트레스 반응 기전이 차단되는 경우 SOD1 단백질양 감소의 정도가 크게 줄어듬을 확인할 수 있었는 바, 자가포식과 소포체스트레스 반응의 활성화가 SOD1의 발현 감소에 크게 영향을 줌을 알 수 있었다(실시예 3 및 5 참조). 그러나 감염 기간과 바이러스 투여량에 따라 이들 효과는 달라지기도 한다. 또한, 자가포식과 소포체스트레스 반응의 발생 원인 등을 고려해 보면 소포체스트레스 억제제 처리가 바이러스 감염 억제에 대한 좀 더 안정적인 효과를 나타내는 데에 대한 설명이 된다.
이에 본 발명자들은 소포체 스트레스반응 기작의 활성화가 바이러스 증식에 미치는 영향을 좀 더 확인하고자 하였으며, 구체적으로 실시예를 통하여 소포체스트레스 signal pathway의 중간 인자인 IRE1 유전자가 결여된 세포주를 바이러스에 감염시킨 후 바이러스 복제율 변화를 보기 위하여 바이러스 단백질(viral protein)의 발현 수준의 변화를 확인하였다. 그 결과, 소포체스트레스 반응 기작이 차단된 경우 바이러스 단백질의 발현 수준이 현저하게 감소되며, 이로부터 소포체스트레스 활성화는 바이러스 감염에 의한 일 현상이 아니라 바이러스 감염과 그 증식을 위해 필요한 필수적인 환경조건임을 알 수 있었다(실시예 4 참조).
소포체 스트레스반응 기전의 활성화가 바이러스 감염과 그 증식에 필수적인 조건임을 확인하고, 나아가 본 발명자들은 실제로 적용 가능한 바이러스 감염 및/또는 그 증식의 억제 조성물을 탐색하였다. 구체적인 실시예를 통하여 in vivo에서 바이러스 감염에 따라 기관지 폐포세척액에 잔존하는 ROS양이 증가하고 폐조직에서 발현하는 SOD1의 양이 감소함을 확인하고, 감염된 동물모델에서 외부 SOD1의 투여에 따라 상기 폐포세척액의 누적 ROS양이 감소하고 폐조직에서의 SOD1의 양이 감염 전과 유사한 수준으로 회복됨을 확인하였다(실시예 5 참조).
또한, 동물모델에서 ROS 소거제의 투여시 ROS 생성 감소와 SOD1 양의 회복이 바이러스 증식에 미치는 영향을 급성 감염 동물모델의 생존도(체중 측정)을 분석하여 확인하였으며, 그 결과, ROS 소거효소 SOD1의 단독투여로도 바이러스 감염에 의해 감소된 체중이 유의하게 회복되었음을 확인하여, 활발한 바이러스 증식을 위햐여 소포체스트레스 반응기작의 활성화로 기인한 ROS 과다누적 환경이 필수 조건임을 알 수 있었다. 따라서 ROS 생성억제제 4-PBA의 투여로 바이러스 감염에 의해 감소된 체중이 회복됨을 확인하였는 바, ROS 생성의 억제 및/또는 ROS 소거를 함으로써 각각 유사한 수준의 항바이러스 효과를 나타내었다, 동시에 이들의 상승효과 여부를 확인한 결과, ROS 생성 억제제(4-PBA) 및 ROS 소거제(NAC)의 복합 처리 시의 단독 처리시 보다 큰폭의 상승효과를 나타내었다. 또한 이에 근거 하여 상기 복합 처리시 코로나바이러스의 복제율도 감소시킴을 확인하였다. 따라서 본 발명의 조성물이 바이러스 감염질환 증상의 정도를 호전시키거나 치료할 수 있음을 확인하였다(실시예 6 참조).
한편, 본 발명자들은 바이러스 증식을 위해 필수적인 ROS 생성과 누적 경로를 동시에 차단하여 바이러스 증식을 억제시킬 수 있는 최적 조합의 ROS 생성억제제 및 ROS 소거제를 동물모델에서 확인하였다. 구체적으로, IAV 감염 동물모델에서 SOD1(50 unit/mouse)와 다른 ROS 생성 억제제 및/또는 ROS 소거제와 복합 처리는 SOD1의 단독 처리보다 ROS 생성량 감소 및 바이러스 역가 감소에 대하여 현저하게 우수한 상승효과를 나타내었다(실시예 7 참조).
동시에 상기 복합 제제의 바이러스 감염 질환의 예방적 효과를 확인하기 위하여, 조직배양에서 IAV 감염전에 상기 복합제제를 처리하거나 동물 감염 전 2일간 처리한 후 감염을 시켰다. 이때 동물 감염시 공기매개로 인한 감염(airborne infection)과 유사한 상황을 유도하기 위하여 일정량의 감염액을 케이지 안에 일정 시간 분무하였다. 그 결과, 상기 복합 조성물의 사전 처리시 비처리군 대비 조직배양내 숙주세포의 사멸 감소하고 감염초기 실험동물의 체중 감소가 조금씩 억제됨을 지속적으로 확인함으로써 초기 투약시 감염 예방의 효과가 있음을 확인하였다(실시예 8 참조).
최종적으로 본 발명의 조성물의 항바이러스제로서의 치료효과를 위한 동물시험을 하였다. 그 결과, SOD1 단독처리시 체중 감소를 약하게 억제하나 ROS 생성 억제제와 소거제와의 병용 투여시 현저하게 높은 수치로 체중 감소를 억제하였다. 특히, 12 dpi에서 SOD1, 4-PBA, 및 NAC의 복합제제를 비강 투여한 생쥐는 감염 전과 비교하여 96%까지 체중을 회복하였는 바, 본 발명의 복합제제가 바이러스 감염질환에 치료 효과를 나타냄을 알 수 있었다. 한편, 각각의 복합제제는 구강 투여(OA)보다 비강 투여(NS)가 보다 효율적인 것이 확인되었다(실시예 9 참조). 따라서 본 발명은 ROS 생성억제제 및 ROS 소거제를 유효성분으로 포함하는 바이러스 감염질환의 예방, 치료, 또는 개선을 위한 조성물을 제공할 수 있다.
본 발명에서 “글루타치온(glutathione: GSH)”은 생체내 가장 풍부하고 여러 효소를 보조하는 대표적인 항산화제로서, 세포 내의 산화적 스트레스가 유발되면 GSH 감소되거나 결핍되는 현상이 나타나는 것이 알려져 있다.
또한, 본 발명에서 “N-아세틸 시스테인(N-acetyl cysteine: NAC)”은 직접 항산화제로 작용하기도 하며 GSH의 전구물질로도 작용하여 간접적인 항산화 효과를 나타내기도 하나, 생체내 처리시 여러 부작용을 유발하는 것이 알려져 있다. 따라서, 본 발명의 조성물에서 NAC이 포함되는 경우 NAC은 투여되는 동물 개체의 단위 체중(20g) 당 1 mg 이하로 투여되도록 조절되는 것이 바람직하다. 또한, 본 발명에서 NAC은 SOD1과 함께 처리되는 경우에 적은 용량으로도 효과적으로 감염에 의한 개체의 체중 회복, 기관지에서의 ROS 누적 감소 및 바이러스 역가 감소를 달성할 수 있다.
또한, 본 발명에서 “부틸하이드록시아니솔(butylated hydroxyanisole: BHA)”는 지용성이고 ROS를 안정화하여 소거하는 성질을 가져 식품 보존제로 많이 사용된다.
또한, 본 발명에서 “초과산화물 불균등화효소 (superoxide dismutase 1: SOD1)”와 “카탈라아제(catalase)”는 생체 내에서 만들어지는 ROS 소거제이다. 한편, SOD1은 세포 밖으로 exocytosis되는 SOD3과 달리 intracellular molecule로서 개체 내에서 세포 내에 위치하여 동물모델에 적용하는 경우 유효성분의 효율적인 전달(delivery) 및 그 활성 유지에 의문이 있었으나, 본 발명의 구체적인 실시예를 통하여, 동물모델에서도 SOD1의 투여의 경로가 구강인지 비강인지를 불문하고 세포 내에서 ROS를 효과적으로 소거함을 확인하였다.
한편, 본 발명에서 “4-페닐부티레이트(4-phenylbutyrate: 4-PBA)”는 소포체스트레스 억제를 통해 ROS의 생성을 억제하는 것으로서 SOD1을 안정화시키는 기능을 동시에 갖는다.
본 발명에서 "소포체스트레스(ER stress)"란 생리적 또는 병리적 환경에 의해 소포체가 처리할 수 있는 능력 이상의 미성숙 단백질이 소포체 내로 유입되거나 소포체 내의 칼슘이 고갈되면서 소포체기능에 장애가 발생하는 상태를 의미하는 것으로서, 소포체스트레스가 발생하면 이에 대한 방어기작으로서 소포체 스트레스반응(ER stress response)이 발생하는데, 소포체 스트레스반응으로는 eIF2α (eukaryotic translation initiation factor 2 alpha subunit) 인산화에 의한 mRNA에서 단백질로의 번역(translation)의 감소, IRE1/XBP-1 및 ATF6(Activating Transcription Factor 6)의 인산화에 의한 샤페론의 발현 증가와 그로 인한 소포체의 단백질접힘(protein folding) 능력 향상, CHOP(C/EBP homologus protein), caspase-12, 및/또는 JNK(c-JUN NH2-terminal kinase) 유전자의 활성에 의한 세포자연사(apoptosis) 증가 등이 있다.
따라서, 본 발명에서 "소포체스트레스 억제제"란 소포체 스트레스에 대한 방어기작 발동을 지연 또는 차단시키거나 소포체 스트레스 반응의 정도를 감소시키는 것이라면 제한되지 아니하고, 본 발명에서 “활성산소 생성억제제”는 세포 내에서 다양한 기작의 산물인 활성산소의 생성을 억제하는 것이라면 제한되지 아니하나, 바람직하게는 바이러스 감염 유발 소포체스트레스에 대한 방어기작을 차단하거나 그 기작의 활성화 정도를 감소시키는 것으로서 여러 소포체스트레스반응 산물 중의 하나인 활성산소 생성 및/또는 누적을 감소시키는 것일 수 있다.
본 발명은 ROS 생성억제제와 SOD1을 포함한 ROS 소거제 복합제제를 처리하여 ROS 소거뿐만 아니라 원천적으로 ROS 생성을 억제하여 바이러스 증식 및 감염의 억제 효율을 현저하게 증가시킬 뿐만 아니라, ROS 생성억제가 소포체스트레스 활성화 차단을 통해 수행되어 세포사멸을 억제시킬 수 있는 바, 개체에 있어 세포, 조직 등의 손상을 방지하거나 최소화할 수 있다.
본 발명에서 “예방”이란 본 발명에 따른 조성물의 투여에 의해 바이러스 감염을 지연시키거나 바이러스의 복제를 억제하여 감염에 의한 질환 발병을 지연시키는 모든 행위를 의미하고, “치료”란 본 발명에 따른 약학적 조성물의 투여에 의해 바이러스 감염 질환 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, “개선”이란 본 발명에 따른 조성물의 투여에 의해 바이러스 감염 질환과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다.
본 발명에서 예방, 치료, 또는 개선의 대상이 되는 바이러스 감염 질환이란 증상이 나타나는지 여부와 무관하게 바이러스에 의해 세포가 제어 당하여 바이러스 유전 물질 등의 복제를 통해 바이러스를 복제하게 되어 감염된 세포가 정상 기능을 하지 못하게 되는 것이라면 제한되지 아니하며, 상기 질환의 원인 인자인 바이러스는 감염된 세포 내의 소포체스트레스를 유발하여 ROS 생성을 증가시키는 것이라면 그 유전체가 DNA인지 RNA인지 가리지 아니한다.
본 발명에서 “개체”란 인간 및 가축을 포함하는 포유류, 조류 등의 척추동물을 의미하고, 바람직하게는 인간 및 가축을 의미한다.
본 발명에서 활성산소 생성억제제 및 활성산소 소거제는 약학적으로 허용 가능한 염의 형태로 사용될 수 있으며, 염으로는 약학적으로 허용가능한 유리산(free acid)에 의해 형성된 산부가염이 유용하다.
본 발명에서 사용되는 용어 "염"은 약학적으로 허용 가능한 유리산(free acid)에 의해 형성된 산 부가염이 유용하다. 산 부가염은 염산, 질산, 인산, 황산, 브롬화수소산, 요드화수소산, 아질산 또는 아인산과 같은 무기산류와 지방족 모노 및 디카르복실레이트, 페닐-치환된 알카노에이트, 하이드록시 알카노에이트 및 알칸디오에이트, 방향족 산류, 지방족 및 방향족 설폰산류와 같은 무독성 유기산으로부터 얻는다. 이러한 약학적으로 무독한 염류로는 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 디하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 아세테이트, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피올레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴-1,4-디오에이트, 헥산-1,6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트, 프탈레이트, 테레프탈레이트, 벤젠설포네이트, 톨루엔설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, β-하이드록시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트 또는 만델레이트를 포함한다.
본 발명에 따른 산 부가염은 통상의 방법, 예를 들면, 활성산소 생성 억제제 및/또는 활성산소 소거제를 과량의 산 수용액 중에 용해시키고, 이 염을 수혼화성 유기 용매, 예를 들면 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜서 제조할 수 있다. 또한 이 혼합물에서 용매나 과량의 산을 증발시킨 후 건조시키거나 또는 석출된 염을 흡입 여과시켜 제조할 수도 있다.
또한, 염기를 사용하여 약학적으로 허용 가능한 금속염을 만들 수도 있다. 알칼리 금속 또는 알칼리 토금속 염은 예를 들면, 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해하고, 비용해 화합물 염을 여과하고, 여액을 증발, 건조시켜 얻는다. 이때, 금속염으로는 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하다. 이에 대응하는 은염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 음염 (예, 질산은)과 반응시켜 얻는다.
또한, 본 발명의 조성물은 약학적으로 허용되는 염뿐만 아니라, 통상의 방법에 의해 제조될 수 있는 모든 염, 이성질체, 수화물 및 용매화물을 모두 포함한다.
본 발명에서 약학적 조성물 (pharmaceutical composition)은 약학적 조성물의 제조에 통상적으로 사용되는 적절한 담체, 부형제, 및 희석제를 더 포함할 수 있다.
본 발명에서 "담체 (carrier)"란 비이클 (vehicle)이라고도 불리우며, 세포 또는 조직 내로의 화합물의 부가를 용이하게 하는 화합물을 의미하는 것으로서, 예를 들어, 디메틸술폭사이드 (DMSO)는 생물체의 세포 또는 조직 내로의 많은 유기 화합물들의 투입을 용이하게 하는 통상 사용되는 담체이다.
본 발명에서 "희석제 (diluent)"란 대상 화합물의 생물학적 활성 형태를 안정화시킬 뿐만 아니라, 화합물을 용해시키게 되는 물에서 희석되는 화합물로 정의된다. 버퍼 용액에 용해되어 있는 염은 당해 분야에서 희석제로 사용된다. 통상 사용되는 버퍼 용액은 포스페이트 버퍼 식염수이며, 이는 인간 용액의 염 상태를 모방하고 있기 때문이다. 버퍼 염은 낮은 농도에서 용액의 pH를 제어할 수 있기 때문에, 버퍼 희석제가 화합물의 생물학적 활성을 변형하는 일은 드물다. 여기에 사용된 아젤라산을 함유하는 화합물들은 인간 환자에게 그 자체로서, 또는 결합 요법에서와 같이 다른 성분들과 함께 또는 적당한 담체나 부형제와 함께 혼합된 약제학적 조성물로서, 투여될 수 있다.
또한, 본 발명에 따른 아젤라산을 포함하는 지방간 예방 또는 치료용 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 외용제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있으며, 상기 아젤라산을 포함하는 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈 (tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 활성산소 생성억제제 및 활성산소 소거제를 포함하는 조성물에 대한 치료적 유효량은 세포 배양 분석으로부터 초기에 측정될 수 있다. 예를 들어, 선량 (dose)은 세포 배양에서 결정된 IC50 (half maximal inhibitory concentration) 또는 C50 (half maximal effective concentration)를 포함하는 순환 농도 범위를 얻기 위하여 동물 모델에서 계산될 수 있다. 그러한 정보는 인간에서의 유용한 선량을 더욱 정확히 결정하는데 사용될 수 있다. 본 발명의 조성물의 투여량은 채용된 투여 형태와 이용된 투여 루트에 따라 상기 범위에서 변화될 수 있다.
본 발명의 약학적 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나 바람직한 효과를 위해서, 본 발명의 약학적 조성물은 1일 0.0001 내지 1000 ㎎/㎏으로, 바람직하게는 0.5 내지 200 ㎎/㎏으로, 더욱 바람직하게는 0.5 내지 100 ㎎/㎏ 투여하는 것이 좋다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명에 따른 약학적 조성물은 생쥐, 쥐, 가축, 인간 등의 포유동물에 비경구, 경구 등의 다양한 경로로 투여될 수 있으며, 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 직장, 정맥, 근육, 피하, 자궁내 경막, 또는 뇌혈관내 주사; 경구; 비강에 의해 투여될 수 있으나, 개체의 코 또는 입으로 흡입 투여하는 것이 바람직하다.
따라서 본 발명의 활성산소 생성억제제 및 활성산소 소거제로 이루어진 복합제제는 흡입 가능한 형태로 제형화된 흡입제로 제공될 수도 있고, 이 경우 상기 복합제제는 수성용액 또는 건조분말 형태로 흡입제에 포함될 수 있고, 또한 상기 흡입제는 하나 이상의 약제학적으로 허용가능한 추진제 및 담체의 혼합물을 포함한 에어로졸 형태일 수 있다.
또한 경구형 제형의 경우도 환자의 나이, 성별, 체중에 따라 1일 1회 내지 수회 투여할 수 있다. 또한 각 투여량(실시예 참조)은 투여경로, 질병의 정도, 성별, 체중, 나이 등에 따라서 증감될 수 있다. 따라서, 상기 본 발명의 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명에서 활성산소 생성억제제 및 활성산소 소거제 외에 다른 성분이 첨가된 혼합물로 제공되는 경우, 상기 조성물은 조성물 총 중량에 대하여 상기 소포체스트레스 억제제 및 활성산소 소거제를 0.001 중량% 내지 99.9 중량%, 바람직하게는 0.1 중량 % 내지 99 중량 %, 더욱 바람직하게는 중량% 내지 50 중량%로 포함할 수 있다.
아울러 본 발명은 활성산소 생성억제제 및 활성산소 소거제를 유효성분으로 포함하는, 바이러스 감염 질환 예방 또는 개선용 식품 조성물을 제공한다. 또한, 활성산소 생성억제제 및 활성산소 소거제는 바이러스 감염 질환 억제 또는 질환의 전이 방지를 목적으로 식품에 첨가될 수 있다. 본 발명의 활성산소 생성억제제 및 활성산소 소거제를 식품 첨가물로 사용할 경우, 상기 활성산소 생성억제제 및 활성산소 소거제를 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효성분의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시 본 발명의 아젤라산은 원료에 대하여 15 중량% 이하, 바람직하게는 10 중량% 이하의 양으로 첨가된다. 그러나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.
본 발명에서 식품은 기능성 식품 및 건강기능식품을 포함하고, '기능성 식품'이란, 일반 식품에 본 발명의 활성산소 생성억제제 및 활성산소 소거제를 첨가함으로써 일반 식품의 기능성을 향상시킨 식품을 의미한다. 기능성은 물성 및 생리기능성으로 대별될 수 있는데, 본 발명의 활성산소 생성억제제 및 활성산소 소거제를 일반 식품에 첨가할 경우, 일반 식품의 물성 및 생리기능성이 향상될 것이고, 본 발명은 이러한 향상된 기능의 식품을 포괄적으로 '기능성 식품'이라 정의한다.
본 발명의 기능성 식품은 바이러스 단백질 합성을 감소시켜 바이러스의 복제가 억제되는 바 바이러스 감염 질환의 예방 또는 개선을 위한 약제, 식품 및 음료 등에 다양하게 이용될 수 있다. 상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 식품을 모두 포함한다.
본 발명에 따른 건강음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물은 포도당 및 과당과 같은 모노사카라이드, 말토오스 및 수크로오스와 같은 디사카라이드, 덱스트린 및 시클로덱스트린과 같은 폴리사카라이드, 및 자일리톨, 소르비톨 및 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 mL당 일반적으로 약 0.01-20g, 바람직하게는 약 5-12 g 이다.
상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 조성물은 천연 과일쥬스, 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.01-0.20 중량부의 범위에서 선택되는 것이 일반적이다.
본 발명은 다양한 변환을 가할 수 있고 여러 가지 실시예를 가질 수 있는 바, 이하 특정 실시예들을 도면에 예시하고 상세한 설명에 상세하게 설명하고자 한다. 그러나, 이는 본 발명을 특정한 실시 형태에 대해 한정하려는 것이 아니며, 본 발명의 사상 및 기술 범위에 포함되는 모든 변환, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다. 본 발명을 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 본 발명의 요지를 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.
[재료 및 방법]
1. 인플루엔자 바이러스 생산 및 배양
재조합 IAV (A/WSN/1933)는 R.G. Webster (University of Tennessee, TN, USA)가 제공한 8개의 바이러스 RNA에 대한 cDNA(서열번호 1 내지 8)가 들어있는 플라스미드를 293T 세포에 co-transfection하고, 세포 배양액을 채취하여 원심분리한 후 그 상등액을 획득하였다.
구체적으로, transfection agent는 lipofectamine 2000을 사용하였으며, transfection은 24시간 동안 수행되었다. 293T 세포는 DMEM에 10% FBS이 포함된 배지에서 배양하여 transfection시켰으며, 다음날 BSA 0.3%을 포함한 Opti-MEM 배지로 교체하여 배양하였다. 배지 교체 48시간 이후에 세포 배양액만을 채취하여 13,000 rpm으로 1~2 분 동안 원심분리 후 상등액에서 바이러스를 획득하였다.
이어서, 상기 획득된 IAV를 Madin-Darby canine kidney (MDCK) 세포에 감염시키고 24 내지 48시간 이후에 사용할 바이러스를 획득하였다.
2. 바이러스역가 분석(Plaque assay)
Plaque assay를 위한 세포로는 MDCK line을 사용하였다. 6-웰 플레이트의 각 웰(well)당 MDCK 세포를 1.0×106개씩 분주하고 100% confluency에서 연속희석법(serial dilution)을 통해 희석된 바이러스를 각 웰당 500 μl씩 투입하여 감염 과정을 1시간 동안 수행하였다. 이때 배지는 Opti-MEM, 0.3% BSA, 1 μg/ml TPCK-trypsin을 사용하였으며, 감염 과정 이후에 agar media(2x L-15 medium, 0.8% agar, 0.075% NaHCO3, 1 μg/ml TPCK-trypsin, 0.3% BSA, 1x glutamate/antibiotics)로 교체하였다. 배지 교체 후 굳을 때까지 상온에서 유지한 후 37℃, 5기압 CO2 조건에서 2~3일 동안 배양하였다.
3. 바이러스 감염 및 동물실험
조직배양의 감염은 역가(titer)가 측정된 바이러스를 인간 폐상피 세포 (Human alveolar epithelial cells) A549에 대부분 0.01 MOI로 감염시켰다. 1시간 감염 후, 세포들을 PBS (phosphate-buered saline)으로 세척하고 2% FBS가 포함된 RPMI 1640 혹은 DMEM과 함께 24시간 동안 배양하였다.
동물 감염 실험은 3주령의 쥐(BALB/c 혹은 C57BL/6N)를 이용하였고 쥐의 비강(intranasal)을 통하여 감염시킨 후, 사육하는 기간 동안 체중을 측정하였다. 일정 기간 실험 조건 별 사육한 뒤, 마취를 하고 쥐 폐조직을 채취한 뒤 plaque assay를 통하여 바이러스 역가를 측정하였으며 BALF (Bronchoalveolar lavage fluid) 등의 ROS 분석을 실행하였다.
4. 웨스턴 블럿 (Western blot)
세포주 실험에서는 12-well 플레이트에서 1.5×105 cells/well 씩 감염 후 24시간 동안 배양하였다. 음성대조군으로는 배지만 첨가된 것, 감염만 시킨 대조군(MOI 0.01 또는 0.03), XBP1 (X-box binding protein 1)의 siRNA를 사용한 세포주들을 Nonidet-P40 (150mM NaCl, 1% NP-40, 50 mM Tris pH 8.0, 2mg/ml aprotinan, 1 mM lupeptin, 0.1 mM PMSF)으로 ice 에서 15분 분해시킨 후 13,000 rpm으로 15분 동안 원심분리하고 그 상층액을 12.5% PAGE로 분리하였다. PVDF membrane에 transfer 후 SOD1, NP 그리고 actin 항체를 사용하여 분석하였다.
5. RT-PCR
12-웰 플레이트의 각 웰에 1.5×105 개의 세포를 분주하여 배양하고 상기 세포를 IAV로 감염시킨 후 24시간 동안 배양하였다. 배지만 첨가된 음성대조군과 감염만 시킨 대조군(MOI 0.01) 세포주에서 RNA를 분리하여 역전사 반응으로 cDNA를 획득하였다. Chop (C/EBP homologous protein)의 발현 정도를 측정하기 위해 획득된 cDNA를 형판(template)으로 사용하고, Chop 프라이머(sense, 5′-GACTCTTCATACACCACCACACCTGA-3′; anti-sense, 5′- GCCGCTCGTTCTCTTCAGCTAGCT -3′)를 이용해 중합효소연쇄반응으로 Chop mRNA 발현을 비교하였다.
6. Genome copy 정량분석
24-웰 플레이트의 각 웰에 Vero E6 세포를 분주하여 배양하고 상기 세포를 0.05 MOI의 SARS-CoV-2로 1 hr 감염시킨 후 항바이러스제를 처리하거나 혹은 처리하지(대조구) 않고 48시간 동안 배양하였다. 바이러스 RNA는 viral RNA isolation kit를 사용하여 분리 후 -80℃에 보관하였다. Genome copy 정량분석의 대상유전자는 SARS-CoV-2 envelope 단백질을 코딩하는 E 유전자이며, qRT-PCR 분석은 Power SYBR Green RNA-to-CT 1-Step Kit (Applied Biosystems)을 사용하였다.
7. 세포내 ROS 측정 분석
세포주 실험에서는 12-웰 플레이트에서 1×105 cells/well 씩 세포를 분주하고 HIV-Tat 단백질 또는 H2O2로 처리, 혹은 IAV로 감염 후 24시간 동안 배양하였다. 배지만 첨가된 음성대조군, 감염만 시킨 대조군(MOI 0.01 또는 0.03), XBP1 siRNA를 사용한 세포주들은 각각 PBS (Phosphate-buffered saline)에 단일세포 혼탁액을 준비하고 형광 염색액을 1/5,000 비율로 첨가해 상온에서 30분 동안 염색하였다.
동물실험에서 BALF (Bronchoalveolar lavage fluid)에 대한 ROS 분석은 폐조직을 PBS로 헹군 후 세포들을 분리하여 단일세포 혼탁액으로 준비하고 형광 염색액을 1/5000 비율로 첨가하여 상온에서 30분 동안 염색하였다. 유세포분석은 FACSCalibur (BD Bioscience)으로 수행하였다.
세포내 ROS (H2O2) 생성량 측정은 2'7'-dichlorofluorecein diacetate (DCFH-DA, Sigma)을 사용하였고 PBS로 세척후 Flow cytometry (FACS-Calibur, Becton-Dikinson) 로 측정하였다. 초과산화물(Superoxide anion) 생성량은 superoxide detection system (Enzo Life Sci.)을 사용하여 측정하였다.
8. 리포터 유전자 분석 (Reporter gene assay)
루시퍼레이즈(luciferase) 리포터인 pLTR-Luc를 제조하기 위하여 HIV1의 promoter 5'long terminal repeats의 U3 및 R 부분(-453 ~ +82)을 분리하여 pGL3-basic (Promega, Madison, WI)에 삽입하였다. pLTR-Luc을 transfection시킨 후, Promega luciferase assay kit을 제조사에서 제시한 방법대로 사용하였다.
9. SOD1 발현 벡터 제조
인간 SOD1 유전자를 세균배양으로 대량 생산할 수 있도록 SOD1 발현 벡터 pET-SOD1을 제작하였다. Backbone (transfer vector)으로는 pET-26b(+) 플라스미드을 사용하였고, 이를 NdeI 및 HindIII로 자른 후, 인간 SOD1 유전자(염기서열 도식 참조)을 프라이머쌍 5'- CCCAAGCTTT TATTGGGCGA TC-3' 및 5'- TTCCATATGA TGGCGACGAA GGCC-3'을 이용하여 PCR 증폭하였고, 다음 이들 산물을 열-변성(denaturation)과 재결합(renaturation)을 거쳐 클로닝 하였다. 상기 pET-SOD1를 박테리아에 도입 배양하면서 1 mM IPTG로 유도되는 발현 결과를 확인하였다.
10. 통계적 분석
대조군과 실험군의 차이는 paired Student's t-test에 의해서 평가되었으며, P-values<0.05 인 경우 유의한 차이로 고려되었다.
[실험 결과]
실시예 1. 인플루엔자 바이러스 감염으로 인한 ROS 증가와 SOD1 감소 확인
인플루엔자 바이러스 감염 시 발생되는 ROS를 측정하기 위하여 A549 폐세포주에 MOI (multiplicity of infection) 0.01 또는 0.03으로 24시간 동안 감염시켰다. 감염시킨 세포주에 초과산화물(superoxide anion)에 특이적으로 결합하는 물질을 처리한 후 유세포 분석으로 확인한 결과(도 1에 A 참조), 바이러스 MOI 증가에 따라 ROS가 증가함을 확인할 수 있었다.
바이러스 감염이 유도하는 ROS 발생 증가의 원인을 알아보기 위하여 MOI 0.01로 감염시킨 A549 세포주를 Western blot을 수행하여 ROS (superoxide anion) 소거제로 작용하는 효소 SOD1의 발현 수준 증감을 비교하였다. 그 결과, 감염된 세포주에서 바이러스 유전자 polymerase인 PB1발현이 증가될 때 SOD1 단백질 양은 크게 감소됨을 확인하였다 (도 1에 B 참조). 상기 결과로부터 인플루엔자 바이러스 감염이 SOD1 단백질 발현의 감소를 유발하며, 결국 ROS를 증가시키는데 밀접한 상관관계가 있음을 확인하였다.
실시예 2. HIV 유전자 발현에 의한 ROS 생성량 및 바이러스 복제율에 미치는 영향
후천성면역겹핍증(AIDS)를 유발하는 HIV (human immunodeficiency virus) 감염시에 주요 역할을 하는 HIV의 Tat 단백질을 처리하면 외부 H2O2를 처리한 것과 비등한 수준의 ROS 생성이 증가됨을 확인했다(도 2에 A 참조). 이때 대표적 ROS 소거제 NAC로 처리할 때 ROS로 인하여 증가되는 HIV 복제율(HIV long terminal repeat-luciferase reporter 활성)이 억제되는 결과로부터 HIV 감염시 생성되는 ROS는 바이러스 복제 및 감염에 주요한 역할을 함을 확인하였다(도 2에 B 참조).
실시예 3. 인플루엔자 바이러스 감염 후 오토파지의 활성화에 의한 SOD1 감소와 오토파지 억제제의 ROS 생성억제제로서의 효과
바이러스 복제(replication)와 감염율(infectivity)이 바이러스 감염에 의하여 누적되는 ROS에 의하여 조절될 수 있음을 지지하는 data를 확인하였다(실시예 1과 2). 이러한 현상의 작용기전으로 바이러스가 숙주의 SOD1 단백질를 감소시키는 지 여부와 단백질 분해 기능이 있는 자가포식(Autophagy)이 원천적으로 관련된 조절기전 경로인지를 탐색하였다. 자가포식 활성화의 상관관계를 확인하기 위하여 A549 세포주에 바이러스를 감염시킨 후 24시간 뒤 자가포식 활성화에 주요하게 작용하는 LC3의 유전자를 siRNA로 silencing하고 LC3 전환 정도와 SOD1 단백질 양을 Western blotting으로 확인하였다. 그 결과, 바이러스에 감염된 세포에서 LC3가 크게 전환되었고 SOD1 단백질 양도 뚜렷이 감소하는 현상을 보였다. 반면, LC3 siRNA 처리구에서는 SOD1 단백질 양이 회복되는 현상을 보였으며, 이러한 경향은 곧 ROS 생성의 감소, 바이러스 역가(titer)의 감소 결과을 낳았다(도 3에 A, B 및 C 참조). 상기 결과로부터 인플루엔자 바이러스 감염에 의해 세포의 자가포식 기전이 활성화되면서 SOD1 효소단백질을 감소시키고 ROS이 과다축적되면서 바이러스의 증식을 촉진하는데 기여한다고 본다.
따라서 이러한 바이러스의 자가포식 활성화를 이용하여 SOD1 단백질을 제거하면서 바이러스 복제를 촉진하는 작용기전을 효과적으로 제어하기 위하여 자가포식 억제제 3-MA 혹은 클로로퀸 처리를 실시하였다. 바이러스 감염구에 3-MA 처리시 LC3 전환이 약화되는 것으로 자가포식이 효과적으로 억제됨을 확인하였고, 동시에 SOD1 단백질 양의 증가 및 바이러스 단백질 PB1의 발현이 감소하는 것을 볼 수 있었다. 또한 클로로퀸에 대한 SOD에 대한 효과는 3-MA 경우보다 좀 더 뚜렷하였다(도 3에 D와 E 참조). 이러한 실험을 근거로 하여 자가포식 억제제 3-MA와 클로로퀸이 항바이러스제로서 가능성을 제시할 수 있다.
실시예 4. 인플루엔자 바이러스 감염시 SOD1 감소/ROS 증가와 소포체스트레스 활성화의 상관관계 확인
인플루엔자 바이러스 감염과 소포체스트레스 활성화의 상관관계를 확인하기 위하여, 소포체스트레스 활성화 신호전달에서 IRE1 (Inositol-requiring enzyme 1) 유전자가 결여된 세포주를 바이러스에 감염시키고, 바이러스 단백질인 PB1의 발현량을 확인한 결과 IRE1 유전자가 결여된 세포에서 PB1의 발현이 IRE1 유전자가 결여되지 않은 세포와 비교하여 현저하게 감소함을 확인할 수 있었다(도 4에 A 참조).
바이러스 감염에 의해 증가하는 ROS 발생이 소포체스트레스에서 유래하는지 재확인하기 위하여, A549 세포주에 바이러스를 감염시킨 후 24시간 뒤 소포체스트레스 활성화 마커 유전자인 Chop의 발현 수준을 RT-PCR을 수행하여 확인하였다. 그 결과, 인플루엔자 바이러스에 감염된 세포에서 Chop 유전자의 발현이 증가됨을 확인할 수 있었는바, 상기 결과로부터 인플루엔자 바이러스 감염에 의해 세포의 소포체스트레스 기작이 활성화됨을 알 수 있었다(도 4에 B 참조).
또한, 바이러스 감염에 의해 증가하는 ROS 발생이 소포체스트레스에서 유래하는지 확인하기 위하여, 바이러스 감염 직전 18시간 동안 siRNA를 이용하여 소포체스트레스 활성화 신호전달에 있어서 IRE1의 하위 단계 유전자인 XBP1의 불활성화를 유도하였다. XBP1 siRNA에 의해 소포체스트레스 활성화 기작이 차단된 세포주에 바이러스를 감염시키고 24시간 후에 ROS를 측정한 결과 대조군(Negative siRNA)과 비교하여 ROS 생성량이 약 30% 이상 감소함을 확인할 수 있었다(도 4에 C 참조). 상기 결과로부터, 인플루엔자 바이러스 감염이 소포체스트레스를 활성화시키며, 이 소포체스트레스 활성화와 ROS의 생성 증가가 밀접한 상관관계가 있음을 알 수 있었다.
이어서, 바이러스 감염에 의한 소포체스트레스 활성화와 ROS 발생간의 관계에 있어서 SOD1 발현 수준 변화를 확인하기 위하여, 상기 실험과 동일하게 siRNA에 의해 소포체스트레스 활성화 기작을 차단한 세포주와 대조군(Negative control)과의 SOD1 발현량을 비교확인한 결과, 소포체스트레스 활성화가 결여된 조건에서 바이러스 감염된 세포에서 SOD1 발현의 감소 폭이 대조군과 비교하여 현저하게 적음을 확인할 수 있었다(도 4에 D참조).
상기 결과로부터, 인플루엔자 바이러스 감염은 소포체스트레스를 활성화시키며, 소포체스트레스 활성화는 SOD1 발현의 감소와 ROS 발생의 증가를 유도한다는 결론을 얻을 수 있다.
실시예 5. 동물모델에서 인플루엔자 바이러스 감염 정도에 따른 ROS 증감과 ROS 생성억제제 또는 소거제 투여 효과
실시예 1과 3은 in vitro에서 인플루엔자 바이러스 감염에 의해 소포체스트레스가 활성화되고, 소포체스트레스 활성화에 의해 SOD1 발현 감소 및 ROS 발생 증가를 보여주었다. 이를 in vivo에서 확인하기 위하여 생쥐(C57BL/6N 혹은 BALB/c)에 인플루엔자 바이러스를 10 또는 100 PFU (Plaque forming unit)로 감염시킨 후 폐조직에서의 SOD1 및 ROS 양 그리고 바이러스 역가를 측정하였다.
한편, SOD1은 세포질에 존재하는 효소로 세포 내에서 작용한다. 이에, 비강 투여시 SOD1이 그 기능을 나타내는지 확인하고자 상기 감염 생쥐에 SOD1을 비강 분사(intranasal spray) 방법으로 일정량씩 주입하고 폐조직에서의 SOD1 및 ROS의 양을 측정하였다.
그 결과, 바이러스 PFU가 높아질수록 기관지 폐포세척액(BALF)에 ROS 누적이 증가하고 폐 조직의 SOD1 발현량이 감소하나, SOD1 (50 unit/mouse) 비강 투여에 따라 폐포세척액에서 ROS 양이 감소하고 폐조직에서 SOD1의 양이 감염 전에 가까운 수준으로 회복됨을 확인할 수 있었다(도 5에 A 및 B 참조)
또한, 감염된 쥐에 4-PBA(2.5 mg/mouse)가 쥐의 비강 안으로 주입되도록 투여한 결과, 투여구들은 비투여구와 비교하여 현저하게 보다 적은 양의 ROS가 발생되는 것을 확인하였다(도 5에 C 참조).
실시예 6. 바이러스 증식에 영향주는 ROS 생성억제제와 소거제 분석
ROS 생성억제제와 소거제들에 의하여 기대되는 ROS 누적 감소가 인플루엔자 바이러스 증식에 어떠한 영향을 미치는지를 마우스의 생존도(체중 측정)로 분석하였다. 우선 1,000 PFU로 감염시킨 acute test에서 50 unit/mouse SOD1, 1 mg/mouse NAC, 또는 2.5 mg/mouse 4-PBA 투여한 쥐와 50 unit/mouse SOD1과 50 unit/mouse catalase를 병용하여 비강 투여한 쥐들의 체중을 측정한 결과, 유의한 체중 변화가 관찰되었다(도 6A 참조).
또한, 구강으로 투여할 수 있는 ROS 생성 억제제(4-PBA) 및 ROS 소거제(NAC)의 복합 투여에 따른 상승효과 여부를 확인한 결과, 200 PFU로 감염시킨 쥐에 상기 dose의 각각 1/3을 병용 처리 시 단독 처리시 보다 큰폭의 상승효과를 나타냄을 확인하였다(도 6에 B 참조).
이러한 복합 투여제제가 인플루엔자외에 다른 호흡기 질환 유발 바이러스에도 영향을 주는 지 알기 위하여 제2형 중증급성호흡기증후군 코로나바이러스 2(SARS-CoV-2, Severe acute respiratory syndrome coronavirus 2)를 0.05 MOI로 감염 후, NAC와 4-PBA 복합 처리시 바이러스의 genome copy 값이 감소하는 항바이러스의 효과를 보임을 확인하였다(도 6에 C 참조).
상기 결과로부터, ROS 누적은 바이러스 감염의 결과이면서 동시에 바이러스 감염과 증식에 필수적인 조건임을 알 수 있다.
실시예 7. ROS 생성억제제와 소거제 조합에 의한 항바이러스 활성 상승작용 분석
항바이러스제로서 SOD1와 다른 항산화제의 병용투여가 ROS 감소 및 바이러스 감염율에 미치는 영향의 정도를 확인하였다. 구체적으로, 생쥐(C57BL/6N)를 1,000 PFU 인플루엔자 바이러스로 감염시키고 감염 초기에 SOD1과 NAC, 4-PBA, 또는 BHA를 복합 투여하거나 또는 NAC와 4-PBA를 비강으로 복합 투여한 후 생쥐의 체중과 바이러스 역가 변화를 대조 투여군과 비교하였다.
그 결과, 감염 7일 후 유의한 체중 변화의 차이를 확인하였으며, 체중 변화와 폐 조직 내 바이러스 역가의 역비례적인 관계를 확인할 수 있었다. 또한, SOD1의 단독투여보다 SOD1과 NAC 또는 4-PBA의 병용투여시 감염된 쥐의 체중 회복률이 우수하였으며, 바이러스 역가도 3.7~4.4배 정도 현저히 감소됨을 확인할 수 있었다.
실시예 8. ROS 생성억제제와 소거제 조합의 바이러스 감염 질환 예방 효과 확인
본 실시예에서는 ROS 생성억제제와 소거제의 투여가 바이러스 감염 질환 예방에 대한 효과를 확인하고자 하였다. 이에, A549 폐 세포주에 SOD1과 NAC을 처리한 이후에 IVA로 감염시키고 세포사멸의 정도를 관찰하였다. 그 결과, SOD1과 NAC을 전처리한 경우 바이러스 감염에 의한 세포사멸이 현저하게 감소됨을 확인할 수 있었다(도 8에 A 참조).
이어서, 동물실험에서 일반적 전염경로(비말 등 airborne infection)에 대한 예방 효과를 확인하기 위하여 감염전 1일 2회 2일동안 4-PBA와 NAC 혼합액을 분무한 결과, 상기 조성물과 처리조건이 감염초기에 바이러스 증식을 억제하는 예방 효과를 보이는 것이 확인되었다(도 8에 B 참조).
실시예 9. ROS 생성억제제와 소거제 조합의 상승 효과 및 바이러스 감염 질환의 치료 효과 확인
보통 200 PFU 이상의 IAV로 감염시, 초기부터 ROS 생성이 급증하며 이로 인한 바이러스 복제와 감염율에 큰 영향을 준다, 따라서 본 실시예에서는 200 PFU 대신 60 PFU IAV로 생쥐를 감염시켜 일반 비말에 의한 감염과 유사한 조건에서 복합제제 처리에 따른 바이러스 감염 질환의 예방 및 치료 효과를 확인하였다. SOD1 유무에 따라 ROS 생성 억제제 4-PBA와 ROS 소거제 NAC를 병용 처리시 바이러스 감염 예방 및 증식 억제 여부를 확인하였다. 결과적으로 SOD1은 ROS 생성 억제제와 소거제와의 병용 투여시 SOD1을 사용하지 않은 것에 비하여 현저한 시너지 효과를 보였다. 또한 ROS 생성 억제와 소거의 복합 제제는 구강 투여(OA)보다 비강 투여(NS)시 보다 효과적으로 바이러스 감염 질환을 예방 또는치료할 수 있음을 확인하였다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
본 발명은 활성산소 생성억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방 또는 치료용 약학적 조성물 등에 관한 것으로서, 바이러스 변이에 의해 매년 새로 개발해야 하는 백신의 제한적 대체제로서 글로벌(global) 감염억제제 및 치료제로 적용될 수 있으며 방역 차원의 예방제 또는 보조제 등으로 활용될 수 있다.
Claims (19)
- 활성산소(reactive oxygen species: ROS) 생성억제제 및 ROS 소거제 복합물을 유효성분으로 포함하는, 바이러스 감염 질환의 예방 또는 치료용 약학적 조성물로서,상기 ROS 생성억제제는 소포체스트레스 활성화 억제를 통해 ROS 생성을 억제하는 것이고,상기 ROS 소거제는 기존 생성된 ROS를 제거하는 것을 특징으로 하는, 약학적 조성물.
- 제1항에 있어서,상기 ROS 생성억제제는 4-페닐부티레이트(4-phenylbutyrate: 4-PBA), 타우린 컨쥬게이티드 우르소데옥시콜산(taurine-conjugated ursodeoxycholic acid: TUDCA), 3-MA(3-Methyladenine) 및 클로로퀸(chloroquine diphosphate)으로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 약학적 조성물.
- 제1항에 있어서,상기 ROS 소거제는 N-아세틸 시스테인(N-acetyl cysteine: NAC), 글루타치온(glutathione), 초과산화물 불균등화효소 (superoxide dismutase 1: SOD1), 카탈라아제(catalase), 부틸하이드록시아니솔(butylated hydroxyanisole: BHA), 부틸하이드록시톨루엔(butylated hydroxytoluene: BHT), 아스코르부산(ascorbic acid), 및 토코페롤(tocopherol)으로 이루어진 군으로부터 선택된 하나 이상을 추가로 포함하는 것을 특징으로 하는, 약학적 조성물.
- 제1항에 있어서,상기 ROS 소거제는 초과산화물 불균등화효소 (superoxide dismutase 1: SOD1)을 포함하고,N-아세틸 시스테인(N-acetyl cysteine: NAC), 글루타치온(glutathione), 카탈라아제(catalase), 부틸하이드록시아니솔(butylated hydroxyanisole: BHA), 부틸하이드록시톨루엔(butylated hydroxytoluene: BHT), 아스코르부산(ascorbic acid), 및 토코페롤(tocopherol)으로 이루어진 군으로부터 선택된 하나 이상을 추가로 포함하는 것을 특징으로 하는, 약학적 조성물.
- 제1항에 있어서,상기 바이러스는 인플루엔자 바이러스, 인간면역결핍바이러스 및 코로나바이러스로 이루어진 군으로부터 선택되는 하나 이상의 바이러스인 것을 특징으로 하는, 약학적 조성물.
- 제1항에 있어서,상기 조성물은 흡입에 의한 비강 또는 구강 투여용인 것을 특징으로 하는, 약학적 조성물.
- 활성산소(reactive oxygen species: ROS) 생성억제제 및 ROS 소거제를 유효성분으로 포함하는, 바이러스 감염 질환의 예방 또는 개선용 식품 조성물로서,상기 ROS 생성억제제는 소포체스트레스 활성화 억제를 통해 ROS 생성을 억제하는 것을 특징으로 하는, 식품 조성물.
- 제7항에 있어서,상기 ROS 생성억제제는 4-페닐부티레이트(4-phenylbutyrate: 4-PBA), 타우린 컨쥬게이티드 우르소데옥시콜산(taurine-conjugated ursodeoxycholic acid: TUDCA), 3-MA(3-Methyladenine) 및 클로로퀸(chloroquine diphosphate)으로 이루어진 군으로부터 선택된 하나 이상인 것을 특징으로 하는, 식품 조성물.
- 제7항에 있어서,상기 ROS 소거제는 N-아세틸 시스테인(N-acetyl cysteine: NAC), 글루타치온(glutathione: GSH), 초과산화물 불균등화효소 (superoxide dismutase 1: SOD1), 카탈라아제(catalase), 부틸하이드록시아니솔(butylated hydroxyanisole: BHA), 부틸하이드록시톨루엔(butylated hydroxytoluene: BHT), 아스코르부산(ascorbic acid), 및 토코페롤(tocopherol)으로 이루어진 군으로부터 선택된 하나 이상을 추가로 포함하는 것을 특징으로 하는, 식품 조성물.
- 제7항에 있어서,상기 ROS 소거제는 초과산화물 불균등화효소 (superoxide dismutase 1: SOD1)을 포함하고,N-아세틸 시스테인(N-acetyl cysteine: NAC), 글루타치온(glutathione), 카탈라아제(catalase), 부틸하이드록시아니솔(butylated hydroxyanisole: BHA), 부틸하이드록시톨루엔(butylated hydroxytoluene: BHT), 아스코르부산(ascorbic acid), 및 토코페롤(tocopherol)으로 이루어진 군으로부터 선택된 하나 이상을 추가로 포함하는 것을 특징으로 하는, 식품 조성물.
- 제7항에 있어서,상기 바이러스는 인플루엔자 바이러스, 인간면역결핍바이러스 및 코로나바이러스로 이루어진 군으로부터 선택되는 하나 이상의 바이러스인 것을 특징으로 하는, 식품 조성물.
- 활성산소(reactive oxygen species: ROS) 생성억제제 및 ROS 소거제를 유효성분으로 포함하는, 바이러스 감염 질환의 예방 또는 개선용 사료 첨가제로서,상기 ROS 생성억제제는 소포체스트레스 활성화 억제를 통해 ROS 생성을 억제하는 것이고,상기 ROS 소거제는 기존 생성된 ROS를 제거하는 것을 특징으로 하는, 사료 첨가제.
- 제12항에 있어서,상기 ROS 생성억제제는 4-페닐부티레이트(4-phenylbutyrate: 4-PBA), 타우린 컨쥬게이티드 우르소데옥시콜산(taurine-conjugated ursodeoxycholic acid: TUDCA), 3-MA(3-Methyladenine) 및 클로로퀸(chloroquine diphosphate)으로 이루어진 군으로부터 선택된 하나 이상이고,상기 ROS 소거제는 N-아세틸 시스테인(N-acetyl cysteine: NAC), 글루타치온(glutathione), 초과산화물 불균등화효소 (superoxide dismutase 1: SOD1), 카탈라아제(catalase), 부틸하이드록시아니솔(butylated hydroxyanisole: BHA), 부틸하이드록시톨루엔(butylated hydroxytoluene: BHT), 아스코르부산(ascorbic acid), 및 토코페롤(tocopherol)으로 이루어진 군으로부터 선택된 하나 이상을 추가로 포함하는 것을 특징으로 하는, 사료 첨가제.
- 활성산소(reactive oxygen species: ROS) 생성억제제 및 ROS 소거제를 유효성분으로 포함하는, 바이러스 감염 질환 방역용 조성물로서,상기 ROS 생성억제제는 소포체스트레스 활성화 억제를 통해 ROS 생성을 억제하는 것이고,상기 ROS 소거제는 기존 생성된 ROS를 제거하는 것을 특징으로 하는, 방역용 조성물.
- 제14항에 있어서,상기 ROS 생성억제제는 4-페닐부티레이트(4-phenylbutyrate: 4-PBA), 타우린 컨쥬게이티드 우르소데옥시콜산(taurine-conjugated ursodeoxycholic acid: TUDCA), 3-MA(3-Methyladenine) 및 클로로퀸(chloroquine diphosphate)으로 이루어진 군으로부터 선택된 하나 이상이고,상기 ROS 소거제는 N-아세틸 시스테인(N-acetyl cysteine: NAC), 글루타치온(glutathione), 초과산화물 불균등화효소 (superoxide dismutase 1: SOD1), 카탈라아제(catalase), 부틸하이드록시아니솔(butylated hydroxyanisole: BHA), 부틸하이드록시톨루엔(butylated hydroxytoluene: BHT), 아스코르부산(ascorbic acid), 및 토코페롤(tocopherol)으로 이루어진 군으로부터 선택된 하나 이상을 추가로 포함하는 것을 특징으로 하는, 방역용 조성물.
- 활성산소(reactive oxygen species: ROS) 생성억제제 및 ROS 소거제를 유효성분으로 포함하는, 바이러스 감염 질환 예방 또는 개선용 향장 조성물로서,상기 ROS 생성억제제는 소포체스트레스 활성화 억제를 통해 ROS 생성을 억제하는 것이고,상기 ROS 소거제는 기존 생성된 ROS를 제거하는 것을 특징으로 하는, 향장 조성물.
- 활성산소(reactive oxygen species: ROS) 생성억제제 및 ROS 소거제를 개체에 투여하는 단계를 포함하는 바이러스 감염 질환 예방 또는 치료 방법으로서,상기 ROS 생성억제제는 소포체스트레스 활성화 억제를 통해 ROS 생성을 억제하는 것이고,상기 ROS 소거제는 기존 생성된 ROS를 제거하는 것을 특징으로 하는, 방법.
- 제17항에 있어서,상기 ROS 생성억제제는 4-페닐부티레이트(4-phenylbutyrate: 4-PBA)이고,상기 ROS 소거제는 초과산화물 불균등화효소 (superoxide dismutase 1: SOD1) 및 N-아세틸 시스테인(N-acetyl cysteine: NAC)이고,상기 NAC은 개체의 단위 체중(1kg) 당 0.1 내지 5 mg 투여하는 것을 특징으로 하는, 방법.
- 바이러스 감염 질환의 예방 또는 치료용 약제의 제조를 위한 활성산소(reactive oxygen species: ROS) 생성억제제 및 ROS 소거제의 복합제제의 용도.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17/628,811 US12496332B2 (en) | 2019-07-22 | 2020-06-29 | Composition for preventing, treating, or ameliorating viral infection disease, containing a complex of endoplasmic reticulum (ER) stress inhibitor and reactive oxygen species scavenger as active ingredients |
| KR1020200113915A KR102539642B1 (ko) | 2019-09-06 | 2020-09-07 | 활성산소 생성억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2019-0088151 | 2019-07-22 | ||
| KR20190088151 | 2019-07-22 | ||
| KR20190110873 | 2019-09-06 | ||
| KR10-2019-0110873 | 2019-09-06 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2021015437A1 true WO2021015437A1 (ko) | 2021-01-28 |
Family
ID=74193289
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2020/008466 Ceased WO2021015437A1 (ko) | 2019-07-22 | 2020-06-29 | 활성산소 생성억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물 |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US12496332B2 (ko) |
| WO (1) | WO2021015437A1 (ko) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021231936A1 (en) * | 2020-05-14 | 2021-11-18 | Steven Hoffman | Methods of using bile acids to treat viral infections |
| WO2022174768A1 (en) | 2021-02-17 | 2022-08-25 | Versitech Limited | Anti-viral peptides and compositions and methods of use thereof |
| US11534420B2 (en) | 2019-05-14 | 2022-12-27 | Tyme, Inc. | Compositions and methods for treating cancer |
| US12472231B2 (en) | 2020-03-18 | 2025-11-18 | The University Of Hong Kong | Compositions of anti-viral peptides and methods of use thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117085138B (zh) * | 2023-09-06 | 2026-03-10 | 暨南大学 | 一种提高免疫力和抗病原感染的组合物及其用途 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130052154A1 (en) * | 2011-05-24 | 2013-02-28 | Board Of Regents Of The University Of Nebraska | Compositions and Methods for the Treatment of Lung Inflammation |
| KR20140099749A (ko) * | 2013-02-04 | 2014-08-13 | 경희대학교 산학협력단 | 4-페닐부티르산을 포함하는 c형 간염의 치료 또는 예방용 약제학적 조성물 |
| KR20150085146A (ko) * | 2014-01-13 | 2015-07-23 | 한국원자력의학원 | 소포체 스트레스 저해제를 포함하는 방사선 방호용 조성물 |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE102006026464A1 (de) | 2006-06-01 | 2007-12-06 | Virologik Gmbh Innovationszentrum Medizintechnik Und Pharma | Pharmazeutische Zusammensetzung zur Behandlung von Virusinfektionen und / oder Tumorerkrankungen durch Inhibition der Proteinfaltung und des Proteinabbaus |
| KR101374241B1 (ko) | 2010-11-17 | 2014-03-14 | 전북대학교병원 | 페닐부틸산(4-phenylbutyric acid)또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는, 천식 치료용 약학적 조성물 |
| CN103561732A (zh) | 2011-04-11 | 2014-02-05 | 阿克西里亚药品公司 | 治疗化合物 |
-
2020
- 2020-06-29 WO PCT/KR2020/008466 patent/WO2021015437A1/ko not_active Ceased
- 2020-06-29 US US17/628,811 patent/US12496332B2/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130052154A1 (en) * | 2011-05-24 | 2013-02-28 | Board Of Regents Of The University Of Nebraska | Compositions and Methods for the Treatment of Lung Inflammation |
| KR20140099749A (ko) * | 2013-02-04 | 2014-08-13 | 경희대학교 산학협력단 | 4-페닐부티르산을 포함하는 c형 간염의 치료 또는 예방용 약제학적 조성물 |
| KR20150085146A (ko) * | 2014-01-13 | 2015-07-23 | 한국원자력의학원 | 소포체 스트레스 저해제를 포함하는 방사선 방호용 조성물 |
Non-Patent Citations (2)
| Title |
|---|
| JUNG KWANG IL, KO DONG-HYUN, SHIN NARY, PYO CHUL WOONG, CHOI SANG-YUN: "Endoplasmic reticulum-associated degradation potentiates the infectivity of influenza A virus by regulating the host redox state", FREE RADICAL BIOLOGY & MEDICINE, ELSEVIER INC, US, vol. 135, 1 May 2019 (2019-05-01), US, pages 293 - 305, XP055775420, ISSN: 0891-5849, DOI: 10.1016/j.freeradbiomed.2019.03.021 * |
| MA RONG; YANG LU; NIU FANG; BUCH SHILPA: "HIV Tat-Mediated Induction of Human Brain Microvascular Endothelial Cell Apoptosis Involves Endoplasmic Reticulum Stress and Mitochondrial Dysfunction", MOLECULAR NEUROBIOLOGY, HUMANA PRESS, US, vol. 53, no. 1, 20 November 2014 (2014-11-20), US, pages 132 - 142, XP036233653, ISSN: 0893-7648, DOI: 10.1007/s12035-014-8991-3 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11534420B2 (en) | 2019-05-14 | 2022-12-27 | Tyme, Inc. | Compositions and methods for treating cancer |
| US12472231B2 (en) | 2020-03-18 | 2025-11-18 | The University Of Hong Kong | Compositions of anti-viral peptides and methods of use thereof |
| WO2021231936A1 (en) * | 2020-05-14 | 2021-11-18 | Steven Hoffman | Methods of using bile acids to treat viral infections |
| US11607418B2 (en) | 2020-05-14 | 2023-03-21 | Tyme, Inc. | Methods of treating SARS-CoV-2 infections |
| WO2022174768A1 (en) | 2021-02-17 | 2022-08-25 | Versitech Limited | Anti-viral peptides and compositions and methods of use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US12496332B2 (en) | 2025-12-16 |
| US20220323551A1 (en) | 2022-10-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12496332B2 (en) | Composition for preventing, treating, or ameliorating viral infection disease, containing a complex of endoplasmic reticulum (ER) stress inhibitor and reactive oxygen species scavenger as active ingredients | |
| WO2017039365A1 (ko) | D-싸이코스를 이용한 지질 흡수 억제 및/또는 배출 촉진 방법 | |
| US20240131046A1 (en) | Anti-viral agent | |
| WO2018182329A1 (ko) | S1pr4를 타겟으로 하는 비알코올성 지방간염 예방 또는 치료용 조성물 | |
| KR102539642B1 (ko) | 활성산소 생성억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물 | |
| WO2019231150A1 (ko) | 해국 추출물을 포함하는 근육 질환 예방, 개선 또는 치료용, 또는 근 기능 개선용 조성물 | |
| WO2024090747A1 (ko) | 칸나비디올 및 타우린을 포함하는 치주염 예방 또는 치료용 조성물 | |
| WO2024029904A1 (ko) | Hapln1을 포함하는 항산화 조성물 및 이를 이용한 세포의 항산화 방법 | |
| KR20220136910A (ko) | 사이토카인 억제제와 활성산소 생성억제제 및 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물 | |
| WO2022031151A1 (ko) | 고사리 추출물 또는 이의 분획물을 포함하는 항바이러스용 조성물 | |
| KR101708833B1 (ko) | 커큐민을 포함하는 항바이러스 조성물 | |
| KR20210011894A (ko) | 활성산소 생성억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물 | |
| WO2023008981A1 (ko) | 항바이러스 조성물 및 이의 이용 | |
| WO2023027540A1 (ko) | 진세노사이드 rc를 포함하는 근육 질환의 예방, 개선 또는 치료용 조성물 | |
| WO2022211486A1 (ko) | 사이토카인 억제제와 활성산소 생성억제제 및 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물 | |
| WO2012173392A9 (ko) | 인플루엔자 바이러스 감염의 예방 또는 치료용 커큐미노이드계 화합물/스테비오사이드 함유 복합체 | |
| KR20230123906A (ko) | 선학초(Agrimonia pilosa) 추출물과 오배자(Galla rhois)추출물의 혼합물을 유효성분으로 포함하는 인플루엔자 바이러스 감염증 예방, 치료 또는 개선용 조성물 | |
| WO2022270760A1 (ko) | 커큐민 유도체와 tgf-β 수용체 억제제의 병용투여를 통한 비알코올성 지방간염 치료 방법 | |
| WO2023140505A1 (ko) | 할로푸지논을 유효성분으로 함유하는 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 조성물 | |
| WO2022124800A1 (ko) | 푸코실락토스를 유효성분으로 함유하는 항바이러스 조성물 | |
| WO2021241873A1 (ko) | 제2형 중증급성호흡기증후군 코로나바이러스 감염 질환의 예방 또는 치료용 조성물 | |
| WO2017105081A1 (ko) | 폐질환 치료용 또는 증상완화용 약학조성물 | |
| WO2017014545A1 (ko) | 멜라닌 응집 호르몬을 유효성분으로 포함하는 파킨슨병 치료 및 레보도파 부작용 억제용 약학 조성물 | |
| WO2020235900A1 (ko) | 골 손실 질환의 예방, 개선 또는 치료를 위한 chp(사이클로-히스프로) 및 부갑상선 호르몬을 포함하는 조성물의 용도 | |
| KR20160097014A (ko) | 방향성 정유를 함유하는 레몬그라스 추출물을 유효성분으로 포함하는 항바이러스용 조성물 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20844464 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 20844464 Country of ref document: EP Kind code of ref document: A1 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 17628811 Country of ref document: US |