WO2020249698A1 - Gènes et polypeptides biosynthétiques - Google Patents

Gènes et polypeptides biosynthétiques Download PDF

Info

Publication number
WO2020249698A1
WO2020249698A1 PCT/EP2020/066241 EP2020066241W WO2020249698A1 WO 2020249698 A1 WO2020249698 A1 WO 2020249698A1 EP 2020066241 W EP2020066241 W EP 2020066241W WO 2020249698 A1 WO2020249698 A1 WO 2020249698A1
Authority
WO
WIPO (PCT)
Prior art keywords
melianol
nucleic acid
plant
host
seq
Prior art date
Application number
PCT/EP2020/066241
Other languages
English (en)
Inventor
Anne Osbourn
Hannah HODGSON
Original Assignee
Plant Bioscience Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Plant Bioscience Limited filed Critical Plant Bioscience Limited
Publication of WO2020249698A1 publication Critical patent/WO2020249698A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
    • A01N43/90—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having two or more relevant hetero rings, condensed among themselves or with a common carbocyclic ring system
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N65/00—Biocides, pest repellants or attractants, or plant growth regulators containing material from algae, lichens, bryophyta, multi-cellular fungi or plants, or extracts thereof
    • A01N65/08—Magnoliopsida [dicotyledons]
    • A01N65/26—Meliaceae [Chinaberry or Mahogany family], e.g. mahogany, langsat or neem
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N65/00—Biocides, pest repellants or attractants, or plant growth regulators containing material from algae, lichens, bryophyta, multi-cellular fungi or plants, or extracts thereof
    • A01N65/08—Magnoliopsida [dicotyledons]
    • A01N65/36—Rutaceae [Rue family], e.g. lime, orange, lemon, corktree or pricklyash
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D303/00—Compounds containing three-membered rings having one oxygen atom as the only ring hetero atom
    • C07D303/02—Compounds containing oxirane rings
    • C07D303/12—Compounds containing oxirane rings with hydrocarbon radicals, substituted by singly or doubly bound oxygen atoms
    • C07D303/14—Compounds containing oxirane rings with hydrocarbon radicals, substituted by singly or doubly bound oxygen atoms by free hydroxyl radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D407/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00
    • C07D407/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00 containing two hetero rings
    • C07D407/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8249—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving ethylene biosynthesis, senescence or fruit development, e.g. modified tomato ripening, cut flower shelf-life
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07J—STEROIDS
    • C07J17/00—Normal steroids containing carbon, hydrogen, halogen or oxygen, having an oxygen-containing hetero ring not condensed with the cyclopenta(a)hydrophenanthrene skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07J—STEROIDS
    • C07J9/00—Normal steroids containing carbon, hydrogen, halogen or oxygen substituted in position 17 beta by a chain of more than two carbon atoms, e.g. cholane, cholestane, coprostane

Definitions

  • the present invention relates generally to genes and polypeptides which have utility in engineering or modifying limonoid or proto-limonoid production in host cells.
  • the invention further relates to systems, methods and products employing the same.
  • Limonoids are a diverse natural products made by plants belonging to the Meliaceae (Mahogany) and Rutaceae (Citrus) families.
  • limonoids have been heralded as bee-friendly degradable“natural” insecticides. Limonoids also contribute to bitterness in citrus fruits and have important pharmaceutical properties.
  • the best known limonoid insecticide is azadirachtin, produced by the Meliaceae family neem tree ( Azadirachta indica).
  • the basic limonoid scaffold has 26 carbon atoms (C26). Limonoids are classified as tetranor-triterpenes because their prototypical structure is a tetracyclic triterpene scaffold (C30) which has lost four carbons during furan ring formation (1) (Fig. 1).
  • limonoids The immediate precursors to limonoids (i.e. the C30 tetracyclic triterpenes preceding the loss of four carbons) are known as protolimonoids.
  • Limonoids are heavily oxygenated and can exist either as simple ring-intact structures or as highly modified seco-ring derivatives (2) (Fig. 1).
  • Limonoid production is largely confined to specific families within the Sapindales order (Meliaceae, Rutaceae, and to a lesser extent the Simaroubaceae) (3, 4).
  • Rutaceae limonoids have historically been studied because they are partially responsible for bitterness in citrus fruit. They have also been reported to have important medicinal activities (e.g. anti-cancer, anti-HIV) and so are of interest as potential pharmaceuticals. Around 50 limonoid aglycones have been reported from the Rutaceae, primarily with seco-A,D-ring structures (3-5) (Fig. 1).
  • Seco- Co- ring limonoids e.g. salannin and azadirachtin; Fig. 1
  • Fig. 1 Seco- Co- ring limonoids
  • Azadirachtin isolated from A. indica
  • A. indica is particularly renowned because of its potent insect antifeedant activity and other features that make it suitable for crop protection, such as systemic uptake, degradability, and low toxicity to mammals, birds, fish and beneficial insects (1).
  • Azadirachtin has a highly complex structure (Fig. 1). Although the total chemical synthesis of this limonoid was reported in 2007, this represented the culmination of a 22-year endeavour (6) involving 71 steps and with 0.00015% total yield. Chemical synthesis of azadirachtin is therefore not practical for production on an industrial scale.
  • Rutaceae limonoids such as limonin [achieved in 35 steps from geraniol (7)] is also unlikely to be commercially viable. Therefore, at present the use of seco-C-ring Meliaceae limonoids for crop protection relies on extraction of A. indica seeds (1). Similarly, the potential health benefits of Rutaceae limonoids remain restricted to dietary consumption (8).
  • MVA mevalonate
  • OSCs oxidosqualene cyclases
  • an OSC has been identified in Citrus grandis and implicated in limonoid biosynthesis by viral induced gene silencing (13).
  • the C. grandis OSC is a close homolog to characterised lanosterol synthases (11), which would make involvement in limonoid biosynthesis unlikely.
  • oxidosqualene cyclisation is commonly followed by oxidation, performed by cytochrome P450s (CYPs) (11).
  • CYPs cytochrome P450s
  • Several CYP sequences identified in A. indica and C. grandis have been implicated in limonoid biosynthesis based on expression profiling, in silico docking modelling, and phylogenetic analysis (12-17).
  • these CYPs have not been functionally characterised and predictions of their activity are problematic without an understanding of the nature of the triterpene scaffold that they would act on.
  • the only limonoid biosynthetic enzyme whose function has been confirmed by recombinant expression is a limonoid UDP-glucosyltransferase from Citrus unshiu, which produces limonin-17 ⁇ -D-glucopyranoside (18).
  • JP2005052009 reports the cloning of a tirucalla-7,24-dien-3b-ol synthase, apparently from tree of heaven (Ailanthus altissima, family Simaroubaceae).
  • A. altissima is known to produce quassinoids but are not known to produce true limonoids.
  • Multifunctional OSC genes are known from Arabidopsis thaliana ( AtLUP5 , At PEN 3).
  • the encoded enzymes may produce tirucalla-7,24-dien-3b-ol as part of their product profile (11 , 27, 28).
  • the present inventors have investigated three diverse limonoid-producing species ⁇ A. indica, Melia azedarach and Citrus sinensis) to elucidate the early steps in limonoid biosynthesis.
  • the presently characterised synthases are also clearly distinct from Atl_UP5, the multifunctional OSC from A.thaliana) although another previously characterised multifunctional OSC (AtPEN3) from A. thaliana is located in a neighbouring subclade to the presently characterised synthases.
  • the present inventors have further identified co-expressed cytochrome P450 enzymes from M. azedarach (MaCYP71CD2 and MaCYP71 BQ5), as well as orthologs or homologs of these from A. indica and C. sinensis (see Table S4), that are capable of three oxidations of tirucalla-7,24-dien-3b-ol, resulting in spontaneous hemiacetal ring formation and the production of the protolimonoid melianol.
  • Fig. 5 D The pathway shown in Fig. 5 D is the proposed pathway for melianol biosynthesis in M. azedarach, showing the synthesis of tirucalla-7,24-dien-3b-ol (1) and ultimately the protolimonoid melianol (4). This biosynthetic scheme appears to be conserved across the Meliaceae and Rutaceae families.
  • the present work is believed to represent the first characterisation of protolimonoid biosynthetic enzymes from any plant species.
  • the present inventors have successfully engineered the melianol biosynthetic pathway into heterologous organisms which are not otherwise melianol producers.
  • the present inventors have further identified limonoid biosynthetic genes for steps downstream of melianol.
  • Candidate genes were selected from a novel genome assembly, based on their annotation and shared expression with melianol biosynthetic genes. A subset of genes were assessed for activity by co-expression with melianol biosynthetic gene in N. benthamiana. This approach has led to the identification of four diverse melianol-modifying enzymes (see Figure 19).
  • MaCYP88A108 is a homolog of AiCYP88A108, which was co-expressed with
  • MalSOMI was identified as a potential sterol isomerase, inferred to be important during limonoid scaffold rearrangement.
  • the present inventors have further identified“tailoring enzymes”: a short chain dehydrogenase/reductase (MaSDRI) and an acyltransferase (MaBAHDI). These are characterised as modifying melianol-type scaffolds by dehydrogenation and acetylation respectively.
  • miSDRI short chain dehydrogenase/reductase
  • MaBAHDI acyltransferase
  • the methods and materials described herein can be used, inter alia, to produce recombinant host organisms (for example plants or microorganisms) which can produce limonoids or proto-limonoids even if they are not naturally produced by the wild-type host.
  • recombinant host organisms for example plants or microorganisms
  • the disclosure herein provides the means to engineer plants with enhanced insect resistance and produce high value limonoids for pharmaceutical and other applications by expression in heterologous hosts.
  • which method comprises the step of expressing a heterologous nucleic acid within the host or one or more cells thereof, following an earlier step of introducing the nucleic acid into the host or an ancestor of either,
  • heterologous nucleic acid comprises a plurality of nucleotide sequences each of which encodes a polypeptide which in combination have said melianol biosynthesis activity.
  • one or more of the recited activities may be provided by enzymes or other polypeptides native to the host, provided at least one (e.g. one, two or three) are provided by heterologous nucleic acid of the invention.
  • Hosts of the invention are therefore“non-naturally occurring” in nature.
  • these polypeptides could comprise any one or more of the following:
  • TDS a specific or multifunctional tirucalla-7,24-dien-3b-ol synthase
  • Enzyme (ii) may be an enzyme capable of oxidising tirucalla-7,24-dien-3b-ol to dihydroniloticin
  • Enzyme (iii) may be an enzyme capable of oxidising dihydroniloticin to tirucalla-7- ene-24,25-epoxy ⁇ ,21 ,23-triol or 21-oxotirucalla-7-ene-24,25-epoxy ⁇ ,23-diol.
  • the heterologous nucleic acid comprises all of (i) to (iii), but if one or more of those activities is present natively in the host, then that activity need not be provided heterologously.
  • At least enzymes (ii) and (iii) are provided as part of the method.
  • melianol suggests that the oxidation at C21 may produce an aldehyde at this position, since this would allow the formation of the melianol hemiacetal ring. Indeed melianol exists as an epimeric mixture in solution (37), with the hemiacetal ring opening and reforming with two different stereochemistries at C21.
  • the C-23 oxidase/C23-C24 epoxidase and C-21 oxidase are CYP450 enzymes, which are optionally CYP71 enzymes.
  • TDS TDS, C-23 oxidase/C23-C24 epoxidase, and C-21 oxidase
  • Tables 1 or 2 herein or the Sequence Annex
  • TDS activity may be provided by any of OSC1 sequences in Table 1 , or the A. altissima tirucalla-7,24-dien-3b-ol synthase of JP2005052009
  • Atl_UP5 or AtPEN3 sequences of Table 2 A. thaliana Atl_UP5 or AtPEN3 sequences of Table 2, or substantially homologous variants or fragments of these, having the requisite biological activity.
  • the one, two, or three of the respective polypeptides are selected from the sequences listed in Table 1.
  • the invention also provides a method of converting a host to a phenotype whereby the host is able to carry out said synthesis of a melianol-derivative, wherein the heterologous nucleic acid comprises a plurality of nucleotide sequences each of which encodes a polypeptide, wherein the polypeptides in combination have said melianol-derivative biosynthesis activity.
  • melianol-derivatives include “true” limonoids; 7,8-epoxymelianol; melianol B; dehydrogenated melianol B, which is optionally melianone B; and acetylated melianol B, which is optionally acetoxy- melianol B.
  • these polypeptides could comprise any one, two, three or all four of the following:
  • the nucleic acid encodes at least the C7-C8 epoxidase and C7-C8 isomerase, and the melianol-derivative is a limonoid.
  • Preferred genes or polypeptides for use in the practice of the invention are shown in Table 1 (or in the Sequence Annex) or are substantially homologous variants or fragments of these, having the requisite biological activity described in Table 1 or in the corresponding Figures or Examples.
  • nucleotide sequences of any of Tables 1 and 2 may be referred to herein as“melianol-biosynthesis (modifying) sequences” or“M-B sequences” e.g. M-B genes and M-B polypeptides.
  • the invention encompasses use of variants of these genes (and polypeptides).
  • A“variant” M-B nucleic acid or M-B polypeptide molecule shares homology with, or is identical to, all or part of the M-B genes or polypeptides discussed herein.
  • a variant polypeptide shares the relevant biological activity of the native M-B polypeptide.
  • a variant nucleic acid encodes the relevant variant polypeptide.
  • the“biological activity” of the M-B polypeptide is the ability to catalyse the respective reaction shown in Fig. 5D or 19, and described above (e.g. the cyclase or oxidase or epoxidase or isomerase or dehydrogenase or acetyl transferase activity) and/or the activity set out in the respective Table e.g. Table 1 , 2 or 3.
  • the relevant biological activities may be assayed based on the reactions shown in Fig.
  • 5D in vitro they can be assayed by activity in vivo as described in the Examples i.e. by introduction of a plurality of heterologous constructs to generate melianol, which can be assayed by LC-MS or the like.
  • Table 4 shows pairwise comparisons of some of the enzymes described herein, obtained using Clustal Omega (version 1.2.4 - accessed through
  • Variants of the sequences disclosed herein preferably share at least 50%, 55%, 56%, 57%, 58%, 59%, 60%, 65%, or 70%, or 80% identity, most preferably at least about 90%, 95%, 96%, 97%, 98% or 99% identity. Such variants may be referred to herein as“substantially homologous”.
  • Preferred variants may be:
  • Naturally occurring nucleic acids such as alleles (which will include polymorphisms or mutations at one or more bases) or pseudoalleles (which may occur at closely linked loci to the M-B genes of the invention).
  • paralogues are also included.
  • isogenes or other homologous genes belonging to the same families as the M-B genes of the invention.
  • orthologues or homologues from other plant species are also included.
  • Homology may be at the nucleotide sequence and/or amino acid sequence level, as discussed below.
  • Artificial nucleic acids which can be prepared by the skilled person in the light of the present disclosure. Such derivatives may be prepared, for instance, by site directed or random mutagenesis, or by direct synthesis. Preferably the variant nucleic acid is generated either directly or indirectly (e.g. via one or more amplification or replication steps) from an original nucleic acid having all or part of the sequence of a M-B gene of the invention.
  • nucleic acids corresponding to those above, but which have been extended at the 3' or 5' terminus.
  • M-B variant nucleic acid as used herein encompasses all of these possibilities. When used in the context of polypeptides or proteins it indicates the encoded expression product of the variant nucleic acid.
  • the preferred melianol-biosynthesis modifying nucleic acids are any of SEQ I D Nos 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 33, 35, 36, 38 or 40 or substantially homologous variants thereof.
  • the preferred melianol-biosynthesis modifying polypeptides are any of SEQ ID Nos 2, 4, 6, 8, 10, 12, 14, 16, 18, 34, 37, 39 or 41 or substantially homologous variants thereof.
  • Other preferred melianol-biosynthesis modifying nucleic acids for use in the invention are SEQ ID No 19, or substantially homologous variants or fragments thereof.
  • Other preferred melianol-biosynthesis modifying polypeptides are polypeptides encoded by any of these sequences or variants or fragments.
  • MVA is an important intermediate in triterpenoid synthesis. Therefore it may be desirable to expression of rate-limiting MVA pathway genes into the host, to maximise yields of downstream products.
  • HMG-CoA reductase is believed to be a rate-limiting enzyme in the MVA pathway.
  • tHMGR recombinant feedback-insensitive truncated form of HMGR
  • one embodiment of the invention comprises the use of a heterologous HMGR (e.g. a feedback-insensitive HMGR) along with the M-B genes described herein.
  • HMGR e.g. a feedback-insensitive HMGR
  • HMGR encoding or polypeptide sequences include SEQ ID Nos 21 to 24, or variants or fragments of these.
  • Variants may be homologues, alleles, or artificial derivatives etc. as discussed in relation to M-B genes or polypeptides as described above.
  • an HMGR native to the host being utilised may be preferred - for example a yeast HMGR in a yeast host, and so on.
  • HMGR genes are known in the art and may be selected, as appropriate in the light of the present disclosure.
  • one embodiment of the invention comprises the use of a heterologous SQS along with the M-B genes and optionally HMGR described herein.
  • SQS encoding or polypeptide sequences include SEQ ID Nos 25 to 26, or variants or fragments of these. Variants may be homologues, alleles, or artificial derivatives etc. as discussed in relation to M-B genes or polypeptides as described above.
  • an SQS native to the host being utilised may be preferred - for example a yeast SQS in a yeast host, and so on.
  • SQS genes are known in the art and may be selected, as appropriate in the light of the present disclosure.
  • one embodiment of the invention comprises the use of a heterologous cytochrome P450 reductase such as AtATR2 (Arabidopsis thaliana cytochrome P450 reductase 2) along with the M-B genes described herein.
  • a heterologous cytochrome P450 reductase such as AtATR2 (Arabidopsis thaliana cytochrome P450 reductase 2) along with the M-B genes described herein.
  • HAtATR2 encoding or polypeptide sequences include SEQ ID Nos 27 to 28, or variants or fragments of these. Variants may be homologues, alleles, or artificial derivatives etc. as discussed in relation to M-B genes or polypeptides as described above.
  • HMGR HMG-CoA reductase
  • HMGR or SQS are optionally selected from the respective polypeptides in Table 3 or substantially homologous variants or fragments of any of said polypeptides, or are encoded by the respective polynucleotides in Table 3, or substantially homologous variants or fragments of any of said polynucleotides.
  • genes may be utilised in the practice of the invention, to provide additional activities and ⁇ or improve expression or activity. These include those expressing co-factor or helper proteins, or other factors.
  • any of these nucleic acid sequences may be referred to herein as“M-B nucleic acid” or“melianol-biosynthesis modifying nucleic acid”.
  • encoded polypeptides may be referred to herein as“M-B polypeptides” or“melianol-biosynthesis modifying polypeptides”.
  • At least 2 or 3 different Agrobacterium tumefaciens strains are co- infiltrated e.g. each carrying a M-B nucleic acid.
  • the genes may be present from transient expression vectors.
  • a preferred expression system utilises the called“'Hyper-Translatable' Cowpea Mosaic Virus ('CPMV-HT') system, described in W02009/087391 the disclosure of which is specifically incorporated herein in support of the embodiments using the CPMV-HT system - for example vectors based on pEAQ-HT expression plasmids.
  • 'CPMV-HT' called“'Hyper-Translatable' Cowpea Mosaic Virus
  • vectors for use in the present invention will typically comprise an expression cassette comprising:
  • a host may be converted from a phenotype whereby the host is unable to carry out effective melianol biosynthesis from OS to a phenotype whereby the host is able to carry out said melianol-biosynthesis, such that melianol can be recovered therefrom or utilised in vivo to synthesize downstream products.
  • the present invention has wide applicability in plant hosts. As discussed herein, additional activities may be employed when practising the invention in microorganisms.
  • Examples hosts includes plants such as Nicotiana benthamiana and microorganisms such as yeast. These are discussed in more detail below.
  • the invention may comprise transforming the host with heterologous nucleic acid as described above by introducing the M-B nucleic acid into the host cell via a vector and causing or allowing recombination between the vector and the host cell genome to introduce a nucleic acid according to the present invention into the genome.
  • a host cell transformed with a heterologous nucleic acid which comprises a plurality of nucleotide sequences each of which encodes a polypeptide which in combination have said melianol- biosynthesis activity
  • nucleic acid wherein expression of said nucleic acid imparts on the transformed host the ability to carry out melianol-biosynthesis from OS, or improves said ability in the host.
  • one or more of the recited activities may be provided by enzymes or other polypeptides native to the host, provided at least one (e.g. one, two or three) nucleotide sequences are provided by heterologous M-B nucleic acid of the invention. Hosts of the invention are therefore non-naturally occurring in nature.
  • the invention further encompasses a host cell transformed with nucleic acid or a vector as described above (e.g. comprising the melianol-biosynthesis modifying nucleotide sequences) especially a plant or a microbial cell.
  • a host cell transformed with nucleic acid or a vector as described above (e.g. comprising the melianol-biosynthesis modifying nucleotide sequences) especially a plant or a microbial cell.
  • the transgene may be on an extra-genomic vector or incorporated, preferably stably, into the genome. There may be more than one heterologous nucleotide sequence per haploid genome.
  • the methods and materials described herein can be used, inter alia, to generate stable crop-plants that accumulate melianol.
  • plants include row crops such as sunflower, potato, canola, dry bean, field pea, flax, safflower, buckwheat, cotton, maize, soybeans, and sugar beets.
  • Major crop-plants such as corn, wheat, oilseed rape and rice may also be preferred hosts.
  • Plants which include a plant cell according to the invention are also provided. Production of products
  • the methods described above may be used to generate melianol in a heterologous host.
  • the melianol will generally be non-naturally occurring in the species into which they are introduced.
  • ⁇ monoids from the plants or methods of the invention may be isolated and commercially exploited.
  • the methods above may form a part of, possibly one step in, a method of producing downstream limonoids such as azadirachtin in a host.
  • the method may comprise the steps of culturing the host (where it is a microorganism) or growing the host (where it is a plant) and then harvesting it and purifying the melianol or a downstream product or derivative (e.g. azadirachtin) product therefrom.
  • the product thus produced forms a further aspect of the present invention.
  • the utility of limonoids is described above.
  • melianol may be recovered to allow for further chemical synthesis of limonoids or limonoids-based compounds such as pharmaceuticals.
  • the present inventors have newly characterised or identified sequences from Meliaceae or Rutaceae families which are believed to be involved in the synthesis of limonoids (see SEQ. ID: Nos 1-18; 33-41)
  • the methods of the present invention will include the use of one or more of these newly characterised M-B nucleic acids of the invention (e.g. one, two, or three such M-B nucleic acids) optionally in conjunction with the manipulation of other genes affecting melianol biosynthesis known in the art.
  • M-B nucleic acids of the invention e.g. one, two, or three such M-B nucleic acids
  • SEQ. ID: Nos 1-18; 33-411 form aspects of the invention in their own right, as do derived variants and materials of these sequences, and methods of using them.
  • the present inventors utilised a variety of genome and transcriptome approaches with Meliaceae and Rutaceae species to begin to elucidate the biosynthetic pathway to structurally complex and important limonoids such as azadirachtin.
  • Phylogenetic analysis, gene expression analysis and metabolite profiling have been used to identify OSCs from M. azedarach and C. sinensis and CYPs from Melia azedarach.
  • Functional characterisation of candidate genes by heterologous expression in Saccharomyces cerevisiae or transient expression in Nicotiana benthamiana has led to the identification of three enzymes from M. azedarach that together are capable of biosynthesis of the 30C protolimonoid, melianol. Identification of the corresponding three C. sinensis homologs supports the notion of conserved initial biosynthesis for limonoids in Meliaceae and Rutaceae species.
  • the present invention provides means for manipulation of total levels of limonoids or protolimonoids such as melianol in host cells such as microorganisms or plants.
  • the M-B modifying nucleic acid described above is in the form of a recombinant and preferably replicable vector.
  • Vector is defined to include, inter alia, any plasmid, cosmid, phage or
  • Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self-transmissible or mobilizable, and which can transform a prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication).
  • a“binary vector” system includes (a) border sequences which permit the transfer of a desired nucleotide sequence into a plant cell genome; (b) desired nucleotide sequence itself, which will generally comprise an expression cassette of (i) a plant active promoter, operably linked to (ii) the target sequence and ⁇ or enhancer as appropriate.
  • the desired nucleotide sequence is situated between the border sequences and is capable of being inserted into a plant genome under appropriate conditions.
  • the binary vector system will generally require other sequence (derived from A. tumefaciens ) to effect the integration. Generally this may be achieved by use of so called "agro-infiltration" which uses Agrobacterium-mediated transient transformation.
  • T-DNA Agrobacterium tumefaciens to transfer a portion of its DNA
  • the T-DNA is defined by left and right border sequences which are around 21-23 nucleotides in length.
  • the infiltration may be achieved e.g. by syringe (in leaves) or vacuum (whole plants).
  • the border sequences will generally be included around the desired nucleotide sequence (the T-DNA) with the one or more vectors being introduced into the plant material by agro-infiltration.
  • Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
  • appropriate regulatory sequences including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
  • shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eucaryotic (e.g. higher plant, mosses, yeast or fungal cells).
  • a vector including nucleic acid according to the present invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the genome.
  • the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, e.g. yeast and bacterial, or plant cell.
  • a host cell such as a microbial, e.g. yeast and bacterial, or plant cell.
  • the vector may be a bi-functional expression vector which functions in multiple hosts. In the case of genomic DNA, this may contain its own promoter or other regulatory elements (optionally in combination with a heterologous enhancer, such as the 35S enhancer discussed in the Examples below). The advantage of using a native promoter is that this may avoid pleiotropic responses. In the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell
  • promoter is meant a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA).
  • operably linked means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter.
  • DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter.
  • the promoter is an inducible promoter.
  • inducible as applied to a promoter is well understood by those skilled in the art. In essence, expression under the control of an inducible promoter is
  • “switched on” or increased in response to an applied stimulus The nature of the stimulus varies between promoters. Some inducible promoters cause little or undetectable levels of expression (or no expression) in the absence of the appropriate stimulus. Other inducible promoters cause detectable constitutive expression in the absence of the stimulus. Whatever the level of expression is in the absence of the stimulus, expression from any inducible promoter is increased in the presence of the correct stimulus.
  • nucleic acid according to the invention may be placed under the control of an externally inducible gene promoter to place expression under the control of the user.
  • An advantage of introduction of a heterologous gene into a plant cell, particularly when the cell is comprised in a plant, is the ability to place expression of the gene under the control of a promoter of choice, in order to be able to influence gene expression, and therefore melianol biosynthesis, according to preference.
  • mutants and derivatives of the wild-type gene may be used in place of the endogenous gene.
  • this aspect of the invention provides a gene construct, preferably a replicable vector, comprising a promoter (optionally inducible) operably linked to a nucleotide sequence provided by the present invention, such as the melianol-biosynthesis modifying gene, most preferably one of the M-B nucleic acids which are described herein, or a derivative thereof.
  • nucleic acid constructs which operate as plant vectors.
  • Specific procedures and vectors previously used with wide success upon plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Cray RRD ed.) Oxford, BIOS Scientific Publishers, pp 121-148).
  • Suitable vectors may include plant viral-derived vectors (see e.g. EP-A-194809).
  • the vectors of the present invention which are for use in plants comprise border sequences which permit the transfer and integration of the expression cassette into the plant genome.
  • the construct is a plant binary vector.
  • the binary transformation vector is based on pPZP (Hajdukiewicz, et al. 1994).
  • Other example constructs include pBin19 (see Frisch, D. A., L. W. Harris- Haller, et al. (1995).“Complete Sequence of the binary vector Bin 19.” Plant Molecular Biology 27: 405-409).
  • Suitable promoters which operate in plants include the Cauliflower Mosaic Virus 35S (CaMV 35S). Other examples are disclosed at mg. 120 of Lindsey & Jones (1989) “Plant Biotechnology in Agriculture” Pub. OU Press, Milton Keynes, UK.
  • the promoter may be selected to include one or more sequence motifs or elements conferring developmental and/or tissue-specific regulatory control of expression.
  • Inducible plant promoters include the ethanol induced promoter of Caddick et al (1998) Nature Biotechnology 16: 177-180.
  • selectable genetic markers may be included in the construct, such as those that confer selectable phenotypes such as resistance to antibiotics or herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron,
  • methotrexate methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate.
  • Positive selection system such as that described by Haldrup et al. 1998 Plant molecular Biology 37, 287-296, may be used to make constructs that do not rely on antibiotics.
  • a preferred vector is a 'CPMV-HT' vector as described in W02009/087391.
  • the Examples below demonstrate the use of these pEAQ-HT expression plasmids.
  • vectors for use in the present invention will typically comprise an expression cassette comprising:
  • Enhancer sequences are sequences derived from (or sharing homology with) the RNA-2 genome segment of a bipartite RNA virus, such as a comovirus, in which a target initiation site has been mutated. Such sequences can enhance downstream expression of a heterologous ORF to which they are attached. Without limitation, it is believed that such sequences when present in transcribed RNA, can enhance translation of a heterologous ORF to which they are attached.
  • A“target initiation site” as referred to herein, is the initiation site (start codon) in a wild-type RNA-2 genome segment of a bipartite virus (e.g. a comovirus) from which the enhancer sequence in question is derived, which serves as the initiation site for the production (translation) of the longer of two carboxy coterminal proteins encoded by the wild-type RNA-2 genome segment.
  • a bipartite virus e.g. a comovirus
  • RNA virus will be a comovirus as described hereinbefore.
  • Most preferred vectors are the pEAQ vectors of W02009/087391 which permit direct cloning version by use of a polylinker between the 5’ leader and 3’ UTRs of an expression cassette including a translational enhancer of the invention, positioned on a T-DNA which also contains a suppressor of gene silencing and an NPTII cassettes.
  • suppressors of gene silencing are known in the art and described in WO/2007/135480. They include HcPro from Potato virus Y, He-Pro from TEV, P19 from TBSV, rgsCam, B2 protein from FHV, the small coat protein of CPMV, and coat protein from TCV.
  • a preferred suppressor when producing stable transgenic plants is the P19 suppressor incorporating a R43W mutation.
  • the present invention also provides methods comprising introduction of such a construct into a plant cell or a microbial (e.g. bacterial, yeast or fungal) cell and/or induction of expression of a construct within a plant cell, by application of a suitable stimulus e.g. an effective exogenous inducer.
  • a suitable stimulus e.g. an effective exogenous inducer.
  • cell suspension cultures of engineered limonoid -producing plant species may be cultured in fermentation tanks (see e.g. Grotewold et al. (Engineering Secondary Metabolites in Maize Cells by Ectopic Expression of Transcription Factors, Plant Cell, 10, 721-740, 1998).
  • a host cell containing a heterologous construct according to the present invention especially a plant or a microbial cell.
  • a further aspect of the present invention provides a method of transforming a plant cell involving introduction of a construct as described above into a plant cell and causing or allowing recombination between the vector and the plant cell genome to introduce a nucleic acid according to the present invention into the genome.
  • the invention further encompasses a host cell transformed with nucleic acid or a vector according to the present invention (e.g. comprising the melianol -biosynthesis modifying nucleotide sequence) especially a plant or a microbial cell.
  • a host cell transformed with nucleic acid or a vector according to the present invention e.g. comprising the melianol -biosynthesis modifying nucleotide sequence
  • the transgene may be on an extra-genomic vector or incorporated, preferably stably, into the genome. There may be more than one heterologous nucleotide sequence per haploid genome.
  • Yeast has seen extensive employment as a triterpene-producing host and is therefore potentially well adapted for melianol biosynthesis.
  • the host is a yeast.
  • Examples may include one or more plant cytochrome P450 reductases (CPRs) to serve as the redox partner to the introduced P450s, as well as an HMGR.
  • CPRs plant cytochrome P450 reductases
  • Plants which include a plant cell transformed as described above, form a further aspect of the invention. If desired, following transformation of a plant cell, a plant may be regenerated, e.g. from single cells, callus tissue or leaf discs, as is standard in the art. Almost any plant can be entirely regenerated from cells, tissues and organs of the plant.
  • the present invention embraces all of the following: a clone of such a plant, seed, selfed or hybrid progeny and descendants (e.g. F1 and F2 descendants).
  • the invention also provides a plant propagule from such plants, that is any part which may be used in reproduction or propagation, sexual or asexual, including cuttings, seed and so on. It also provides any part of these plants (e.g. leaf, stem, dried or ground product, edible portion etc.), which in all cases include the plant cell or heterologous melianol-biosynthesis modifying DNA described above.
  • the present invention also encompasses the expression product of any of the coding melianol -biosynthesis modifying nucleic acid sequences disclosed and methods of making the expression product by expression from encoding nucleic acid therefore under suitable conditions, which may be in suitable host cells.
  • plant backgrounds such as those above may be natural or transgenic e.g. for one or more other genes relating to melianol biosynthesis, or otherwise affecting that phenotype or trait.
  • the M-B nucleic acids described herein may be used in combination with any other gene, such as transgenes affecting the rate or yield of melianol, or its modification, or any other phenotypic trait or desirable property.
  • plants or microorganisms e.g. bacteria, yeasts or fungi
  • plants or microorganisms can be tailored to enhance production of desirable precursors, or reduce undesirable metabolism.
  • down-regulation of genes in the host may be desired e.g. to reduce undesirable metabolism or fluxes which might impact on M-B yield.
  • Such down regulation may be achieved by methods known in the art, for example using anti-sense technology.
  • a nucleotide sequence is placed under the control of a promoter in a "reverse orientation" such that transcription yields RNA which is complementary to normal mRNA transcribed from the "sense" strand of the target gene.
  • Antisense technology is also reviewed in Bourque, (1995), Plant Science 105, 125-149, and Flavell, (1994) PNAS USA 91 , 3490-3496.
  • An alternative to anti-sense is to use a copy of all or part of the target gene inserted in sense, that is the same, orientation as the target gene, to achieve reduction in expression of the target gene by co-suppression.
  • van der Krol et aI (1990) The Plant Cell 2, 291-299; Napoli et al., (1990) The Plant Cell 2, 279-289; Zhang et al., (1992) The Plant Cell 4, 1575-1588, and US-A-5,231 ,020.
  • Further refinements of the gene silencing or co-suppression technology may be found in W095/34668 (Biosource); Angell & Baulcombe (1997) The EMBO Journal
  • dsRNA Double stranded RNA
  • RNAi RNA interference
  • RNA interference is a two-step process.
  • dsRNA is cleaved within the cell to yield short interfering RNAs (siRNAs) of about 21-23nt length with 5' terminal phosphate and 3' short overhangs ( ⁇ 2nt)
  • siRNAs target the corresponding mRNA sequence specifically for destruction (Zamore P.D. Nature Structural Biology, 8, 9, 746-750, (2001)
  • miRNA miRNA
  • stem loop precursors incorporating suitable oligonucleotide sequences, which sequences can be generated using well defined rules in the light of the disclosure herein.
  • the invention provides a method for influencing or affecting limonoid or protolimonoid biosynthesis in a host, which method comprises any of the following steps of:
  • mismatches of a M-B nucleotide sequence such as to reduce the respective encoded polypeptide activity by an miRNA mechanism
  • polypeptides may be employed in fermentation via expression in microorganisms such as e.g. E.coli, yeast and filamentous fungi and so on.
  • microorganisms such as e.g. E.coli, yeast and filamentous fungi and so on.
  • one or more newly characterised M-B sequences of the present invention may be used in these organisms in conjunction with one or more other biosynthetic genes.
  • In vivo methods are describe extensively above, and generally involve the step of causing or allowing the transcription of, and then translation from, a recombinant nucleic acid molecule encoding the M-B polypeptides.
  • the M-B polypeptides may be used in vitro, for example in isolated, purified, or semi-purified form.
  • they may be the product of expression of a recombinant nucleic acid molecule.
  • polypeptides which affect melianol biosynthesis see SEQ. ID: Nos 1-18; 33-41 in Table 1).
  • the M-B nucleic acid is derived from Meliaceae or Rutaceae families (SEQ. ID: Nos 1-18; 33-41).
  • nucleic acids which are variants of the M-B nucleic acid derived from Meliaceae or Rutaceae families discussed above.
  • variants may be used to alter the limonoid (e.g. melianol or melianol derivative) content of a plant, as assessed by the methods disclosed herein.
  • a variant nucleic acid may include a sequence encoding a variant M-B polypeptide sharing the relevant biological activity of the native M-B polypeptide, as discussed above. Examples include variants of any of SEQ ID Nos 2, 4, 6, 8, 10, 12, 14, 16 or 18.
  • Described herein are methods of producing a derivative nucleic acid comprising the step of modifying any of the M-B genes of the present invention disclosed above, particularly the M-B sequences from Meliaceae or Rutaceae families such as A. indica, M. azedarach or C. sinensis. Changes may be desirable for a number of reasons. For instance they may introduce or remove restriction endonuclease sites or alter codon usage. This may be particularly desirable where the M-B genes are to be expressed in alternative hosts e.g. microbial hosts such as yeast. Methods of codon optimizing genes for this purpose are known in the art (see e.g. Maria, Stephan, et al. "Expression of codon optimized genes in microbial systems: current industrial applications and perspectives.” Frontiers in microbiology 5 (2014)). Thus sequences described herein including codon modifications to maximise yeast expression represent specific embodiments of the invention.
  • changes to a sequence may produce a derivative by way of one or more (e.g. several) of addition, insertion, deletion or substitution of one or more nucleotides in the nucleic acid, leading to the addition, insertion, deletion or substitution of one or more (e.g. several) amino acids in the encoded polypeptide.
  • Such changes may modify sites which are required for post translation modification such as cleavage sites in the encoded polypeptide; motifs in the encoded polypeptide for phosphorylation etc.
  • Leader or other targeting sequences e.g. membrane or golgi locating sequences
  • Other desirable mutations may be random or site directed mutagenesis in order to alter the activity (e.g. specificity) or stability of the encoded polypeptide. Changes may be by way of conservative variation, i.e. substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine.
  • altering the primary structure of a polypeptide by a conservative substitution may not significantly alter the activity of that peptide because the side-chain of the amino acid which is inserted into the sequence may be able to form similar bonds and contacts as the side chain of the amino acid which has been substituted out. This is so even when the substitution is in a region which is critical in determining the peptides
  • the present invention may utilise fragments of the polypeptides encoding the M-B genes of the present invention disclosed above, particularly the M-B sequences from Meliaceae or Rutaceae families such as A. indica, M. azedarach or C. sinensis.
  • the present invention provides for the production and use of fragments of the full-length M-B polypeptides of the invention disclosed herein, especially active portions thereof.
  • An“active portion” of a polypeptide means a peptide which is less than said full length polypeptide, but which retains its essential biological activity.
  • A“fragment” of a polypeptide means a stretch of amino acid residues of at least about five to seven contiguous amino acids, often at least about seven to nine contiguous amino acids, typically at least about nine to 13 contiguous amino acids and, most preferably, at least about 20 to 30 or more contiguous amino acids.
  • Fragments of the polypeptides may include one or more epitopes useful for raising antibodies to a portion of any of the amino acid sequences disclosed herein.
  • Preferred epitopes are those to which antibodies are able to bind specifically, which may be taken to be binding a polypeptide or fragment thereof of the invention with an affinity which is at least about 1000x that of other polypeptides.
  • M. azedarach or C. sinensis or variants (e.g. derivatives such as fragments thereof) may be referred to as“MR M-B sequences (or nucleic acid, or polypeptide)”.
  • MR M-B sequences or nucleic acid, or polypeptide
  • nucleic acid encoding any of these polypeptides (2, 4, 6, 8, 10, 12, 14, 16, 18, 34, 37, 39 or 41).
  • nucleic acids of the invention include those which are degeneratively equivalent to these, or homologous variants (e.g. derivatives) of these.
  • aspects of the invention further embrace isolated nucleic acid comprising a sequence which is complementary to any of those discussed hereinafter.
  • MRM-B sequence to catalyse its respective biological activity (e.g. as described in Fig. 5D or Fig. 19) forms another aspect of the invention.
  • the invention further provides a method of influencing or affecting limonoid e.g. melianol biosynthesis in a host such as a plant, the method including causing or allowing transcription of a heterologous MRM-B nucleic acid as discussed above within the cells of the plant.
  • the step may be preceded by the earlier step of introduction of the MRM-B nucleic acid into a cell of the plant or an ancestor thereof.
  • Such methods will usually form a part of, possibly one step in, a method of producing a limonoid or protolimonoid e.g. melianol in a host such as a plant.
  • the method will employ a M-B modifying polypeptide of the present invention (e.g. in Table 1) or derivative thereof, as described above, or nucleic acid encoding either.
  • a M-B modifying polypeptide of the present invention e.g. in Table 1
  • nucleic acid encoding e.g. in Table 1
  • Nucleic acid may include cDNA, RNA, genomic DNA and modified nucleic acids or nucleic acid analogs (e.g. peptide nucleic acid). Where a DNA sequence is specified, e.g. with reference to a figure, unless context requires otherwise the RNA equivalent, with U substituted for T where it occurs, is encompassed. Nucleic acid molecules according to the present invention may be provided isolated and/or purified from their natural environment, in substantially pure or homogeneous form, or free or substantially free of other nucleic acids of the species of origin, and double or single stranded. Where used herein, the term “isolated” encompasses all of these possibilities. The nucleic acid molecules may be wholly or partially synthetic.
  • nucleic acids may comprise, consist, or consist essentially of, any of the sequences discussed hereinafter.
  • heterologous is used broadly herein to indicate that the gene/sequence of nucleotides in question (e.g. encoding melianol -biosynthesis modifying polypeptides) have been introduced into said cells of the host or an ancestor thereof, using genetic engineering, i.e. by human intervention.
  • Nucleic acid heterologous to a host cell will be non-naturally occurring in cells of that type, variety or species.
  • the heterologous nucleic acid may comprise a coding sequence of or derived from a particular type of plant cell or species or variety of plant, placed within the context of a plant cell of a different type or species or variety of plant.
  • nucleic acid sequence to be placed within a cell in which it or a homologue is found naturally, but wherein the nucleic acid sequence is linked and/or adjacent to nucleic acid which does not occur naturally within the cell, or cells of that type or species or variety of plant, such as operably linked to one or more regulatory sequences, such as a promoter sequence, for control of expression.
  • heterologous nucleic acid alter one or more of the cell’s characteristics and hence phenotype e.g. with respect to limonoid or protolimonoid e.g. melianol or melianol derivative biosynthesis. Such transformation may be transient or stable.
  • protolimonoid refers to immediate precursors to limonoids, achieved by oxidations of tirucallla-7,24-dien-3b-ol scaffold by suitable Cyp enzymes (see Figure 1).
  • “Unable to carry out melianol biosynthesis” means that the host, prior to the conversion, does not, or is not believed to, naturally produce detectable or recoverable levels of melianol under normal metabolic circumstances of that host.
  • the nucleotide sequence information provided herein may be used to design probes and primers for probing or amplification.
  • An oligonucleotide for use in probing or PCR may be about 30 or fewer nucleotides in length (e.g. 18, 21 or 24). Generally specific primers are upwards of 14 nucleotides in length. For optimum specificity and cost effectiveness, primers of 16-24 nucleotides in length may be preferred. Those skilled in the art are well versed in the design of primers for use in processes such as PCR.
  • probing can be done with entire restriction fragments of the gene disclosed herein which may be 100's or even 1000's of nucleotides in length. Small variations may be introduced into the sequence to produce‘consensus’ or ‘degenerate’ primers if required.
  • Probing may employ the standard Southern blotting technique. For instance DNA may be extracted from cells and digested with different restriction enzymes.
  • Restriction fragments may then be separated by electrophoresis on an agarose gel, before denaturation and transfer to a nitrocellulose filter.
  • Labelled probe may be hybridised to the single stranded DNA fragments on the filter and binding determined.
  • DNA for probing may be prepared from RNA preparations from cells. Probing may optionally be done by means of so-called‘nucleic acid chips’ (see Marshall &
  • polypeptide in accordance with the present invention is obtainable by means of a method which includes:
  • test nucleic acid may be provided from a cell as genomic DNA, cDNA or RNA, or a mixture of any of these, preferably as a library in a suitable vector. If genomic DNA is used the probe may be used to identify untranscribed regions of the gene (e.g. promoters etc.), such as are described hereinafter,
  • probes may be radioactively, fluorescently or enzymatically labelled.
  • Other methods not employing labelling of probe include amplification using PCR (see below), RN’ase cleavage and allele specific oligonucleotide probing.
  • the identification of successful hybridisation is followed by isolation of the nucleic acid which has hybridised, which may involve one or more steps of PCR or amplification of a vector in a suitable host.
  • Preliminary experiments may be performed by hybridising under low stringency conditions.
  • preferred conditions are those which are stringent enough for there to be a simple pattern with a small number of hybridisations identified as positive which can be investigated further.
  • hybridizations may be performed, according to the method of
  • Hybridization is carried out at 37-42°C for at least six hours. Following hybridization, filters are washed as follows: (1) 5 minutes at room temperature in 2X SSC and 1 % SDS; (2) 15 minutes at room temperature in 2X SSC and 0.1% SDS; (3) 30 minutes - 1 hour at 37°C in 1X SSC and 1 % SDS; (4) 2 hours at 42-65°C in 1X SSC and 1% SDS, changing the solution every 30 minutes.
  • T m 81.5°C + 16.6Log [Na+] + 0.41 (% G+C) - 0.63 (% formamide) - 600/#bp in duplex
  • T m of a DNA duplex decreases by 1 - 1.5°C with every 1% decrease in homology.
  • targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42°C.
  • Such a sequence would be considered substantially homologous to the nucleic acid sequence of the present invention.
  • suitable conditions include, e.g. for detection of sequences that are about 80-90% identical, hybridization overnight at 42°C in 0.25M Na 2 HP0 4 , pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 55°C in 0.1X SSC, 0.1% SDS.
  • suitable conditions include hybridization overnight at 65°C in 0.25M
  • hybridization of a nucleic acid molecule to a variant may be determined or identified indirectly, e.g. using a nucleic acid amplification reaction, particularly the polymerase chain reaction (PCR).
  • PCR requires the use of two primers to specifically amplify target nucleic acid, so preferably two nucleic acid molecules with sequences characteristic of a M-B gene of the present invention are employed.
  • RACE PCR only one such primer may be needed (see "PCR protocols; A Guide to Methods and Applications", Eds. Innis et al, Academic Press, New York, (1990)).
  • a method involving use of PCR in obtaining nucleic acid according to the present invention may include:
  • clones or fragments identified in the search can be extended. For instance if it is suspected that they are incomplete, the original DNA source (e.g. a clone library, mRNA preparation etc.) can be revisited to isolate missing portions e.g. using sequences, probes or primers based on that portion which has already been obtained to identify other clones containing overlapping sequence.
  • the original DNA source e.g. a clone library, mRNA preparation etc.
  • Purified protein (polypeptide, enzyme), or a fragment, mutant, derivative or variant thereof, e.g. produced recombinantly by expression from encoding nucleic acid therefor, forms one aspect of the invention.
  • Such purified polypeptides may be used to raise antibodies employing techniques which are standard in the art.
  • Antibodies and polypeptides comprising antigen binding fragments of antibodies may be used in identifying homologues from other species as discussed further below.
  • Methods of producing antibodies include immunising a mammal (e.g. human, mouse, rat, rabbit, horse, goat, sheep or monkey) with the protein or a fragment thereof.
  • Antibodies may be obtained from immunised animals using any of a variety of techniques known in the art, and might be screened, preferably using binding of antibody to antigen of interest. For instance, Western blotting techniques or immunoprecipitation may be used (Armitage et al, 1992, Nature 357: 80-82).
  • Antibodies may be polyclonal or monoclonal.
  • binding specificity may be obtained from a recombinantly produced library of expressed immunoglobulin variable domains, e.g. using lambda
  • bacteriophage or filamentous bacteriophage which display functional immunoglobulin binding domains on their surfaces; for instance see W092/01047.
  • Antibodies raised to a polypeptide or peptide can be used in the identification and/or isolation of homologous polypeptides, and then the encoding genes.
  • Antibodies may be modified in a number of ways. Indeed the term“antibody” should be construed as covering any specific binding substance having a binding domain with the required specificity. Thus, this term covers antibody fragments, derivatives, functional equivalents and homologues of antibodies, including any polypeptide comprising an immunoglobulin binding domain, whether natural or synthetic.
  • a number of patents and publications are cited herein in order to more fully describe and disclose the invention and the state of the art to which the invention pertains. Each of these references is incorporated herein by reference in its entirety into the present disclosure, to the same extent as if each individual reference was specifically and individually indicated to be incorporated by reference.
  • Ranges are often expressed herein as from“about” one particular value, and/or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent“about,” it will be understood that the particular value forms another embodiment.
  • the triterpene precursor 2,3-oxidosqualene is proposed to be cyclised to an unconfirmed tetracyclic triterpene scaffold.
  • the structure of ring-intact limonoids implicates a tetracyclic triterpene precursor of either the euphane (20R) or tirucallane (20S) type. Retrosynthetic discrimination between these two side chains is impossible based on limonoid structures, because the formation of the furan ring eradicates any remnants of the precursor’s C20 stereochemistry. However predictions can be made based on the immediate precursors of limonoids
  • protolimonoids suggests the most likely triterpene precursor is in fact tirucalla-7,24- dien-3b-ol (1), as indicated by the retrosynthetic arrow (*), rather than tirucallol itself.
  • Biosynthesis of limonoids from triterpene scaffolds is predicted to occur through protolimonoid structures such as melianol (4) and requires two major biosynthetic steps: scaffold rearrangements, and furan ring formation accompanied by loss of four carbons. Scaffold rearrangement is proposed to be initiated by epoxidation of the C7 double bond (C7-8 epoxide) and furan ring formation could feasibly be initiated through oxidation and cyclisation of the C20 tail (melianol (4)).
  • A Phylogenetic tree of candidate OSCs from Azadirachta indica (blue), Melia azedarach (green) and Citrus sinensis (orange). Functionally characterised OSCs from other plant species (11) are included, with the two previously characterised tirucalla-7,24-dien-3b-ol synthases from Arabidopsis thaliana ( AtLUP5 , At PEN 3) highlighted (yellow). Human and prokaryotic OSCs sequences used as an outgroup are represented by the grey triangle.
  • Candidate OSCs chosen for further analysis are indicated (circles).
  • the phylogenetic tree was constructed by FastTree V2.1.7 (59) and formatted using iTOL (60).
  • AtLUP5 characterised AtLUP5 (yellow) are shown.
  • C GC-MS mass spectra of TMS-tirucalla- 7,24-dien-3b-ol (1).
  • D Confirmation of the structure of the cyclization product generated by AiOSCI as tirucalla-7,24-dien-3b-ol (1) by NMR (Table S3).
  • Figure 3 Expression patterns of AiOSC1 and other co-expressed genes in A. indica.
  • a heatmap of a subset of differentially expressed (p ⁇ 0.05) genes with similar expression patterns to AiOSC1 (blue circle) across flower, root, fruit and leaf tissues of A. indica are shown.
  • Raw RNAseq reads (19, 22) were aligned to a Trinity- assembled transcriptome of the same dataset. Read counts were normalised to library size and logR 2 R-transformed. Values depicted are scaled by row (gene) to emphasise differences across tissues. The Pfam identifier for relevant predicted gene is included next to the contig number. Genes with no structural (Augustus) or functional (Pfam) annotations have been excluded.
  • Cytochrome P450 (CYP) candidates AiCYP71BQ5, AiCYP72A721 and AiCYP88A108 (blue triangles) are indicated with the latter two being considered gene fragments ( ⁇ 300 amino acids).
  • Figure 4 Accumulation of melianol and salannin and expression of MaOSCI, MaCYP71CD2 and MaCYP71BQ5 in Melia azedarach.
  • A A subset of a larger phylogenetic tree showing the CYP71 family.
  • Candidate CYPs selected for cloning were identified by homology to A. indica candidate CYPs identified as co-expressed with AiOSC1 (triangle) or occurrence in a unique CYP71 subclade lacking close homologs from A. thaliana or C. sativus (squares).
  • the phylogenetic tree was constructed by FastTree V2.1.7 (59) and formatted using iTOL (60). Local support values from FastTree Shimodaira- Hasegawa (SH) test (between 0.6 and 1.0) are indicated at nodes and scale bar depicts estimated number of amino acid substitutions per site.
  • Fig. 10 Expression patterns of differentially expressed candidate genes from M. azedarach (Elv1).
  • Genes were selected based on annotation, from a larger subset of differentially expressed genes identified as co-expressed based on hierarchical clustering. Genes are labelled with Elv1 identifier and given name (based on human readable annotation).
  • the melianol biosynthetic genes MaOSCI , MaCYP71CD2 and
  • MaCYP71BQ5 are included for comparison (bold). Read counts used for hierarchical clustering were normalised by library size and log2 transformed. The heatmap was constructed by Heatmap3 V1.1.1 (99) with scaling performed by row (gene) to emphasise pattern of expression.
  • Fig. 13 Expression of MalSOMI in N. benthamiana.
  • Mass spectra corresponding to UHPLC-IT-TOF analysis of N. benthamiana leaves expressing candidate genes in pEAQ-HT-DEST1.
  • Fig. 15 Combinatorial transient expression of MalSOMI in N. benthamiana.
  • Fig. 16 Expression of MaSDRI and MaBAHDI in N. benthamiana.
  • UHPLC-IT-TOF EICs of extracts from N. benthamiana leaves expressing melianol B biosynthetic genes ( AiOSC1 , MaCYP71CD2, MaCYP71BQ5, MaCYP88A 108 and MalSOMI) with and without MaSDRI (A) and with and without MaBAHDI (B).
  • the UHPLC-IT-TOF limonoid’ gradient was used.
  • Peaks are labelled as follows: melianol B (10); dehydrogenated oxidised melianol B (12-13); oxidised melianol B acetate (14-16).
  • the mass spectra for newly identified peaks is provided in Figure 14.
  • C Predictions of structures, exact masses and mechanisms of formation of the new peaks (9-16).
  • Fig. 17. Combinatorial transient expression of MaSDRI and MaBAHDI in N. benthamiana.
  • Fig. 18 Transient expression of melianol B biosynthetic genes in combination with MaBAHDI and MaSDRI in N. benthamiana.
  • A UHPLC-IT-TOF generated EICs of methanol extracts from agroinfiltrated N. benthamiana leaves expressing melianol B biosynthetic genes ( AiOSC1 , MaCYP71CD2, MaCYP71BQ5,
  • Example 1 Characterisation of OSCs catalysing the formation of tirucall-7.24- dien-38-ol from three limonoid-producinq species.
  • OSCs are therefore deemed likely to have functions in sterol biosynthesis rather than in limonoid biosynthesis (11).
  • the remaining candidates fell into other more diverse triterpene OSC clades and so were deemed more likely to have roles in specialized metabolism. Three of these were from C. sinensis, one from A. indica and another from M. azedarach.
  • CsOSC3, indicated in Fig. 2 A) were also expressed in yeast and found to make different products, which were identified as b-amyrin and lupeol based on
  • AiOSC1 showed highest expression in the fruit (Fig. 3), consistent with a previous report of high levels of the ring-intact limonoids azadiradione and epoxyazadiradione (Fig. 6) in A. indica in this organ (12).
  • AiOSC1 Unlike A. indica , the spatial occurrence of limonoids within other Meliaceae species has not been investigated. M. azedarach, a close relative of A. indica (30), is the second most prolific limonoid-producing species with 109 limonoid structures reported, including seco-C-ring limonoids of the azadirachtin and meliacarpin class (2,4). We therefore investigated the levels of melianol and salannin in extracts from the leaves, roots and petioles of young ( ⁇ 12 months) M. azedarach plants.
  • Example 3 Identification of two cytochrome P450 enzymes from Melia azedarach that together convert tirucall-7.24-dien-3b-ol to melianol.
  • azedarach CYPs (SH local support value of 1) was phylogenetically distinct from all A. thaliana and C. sativus candidates (Fig.5A). This subclade sits within the largest CYP family in plants (CYP71), which is known for taxa-specific subfamily blooms and includes CYPs with characterised roles in secondary metabolism (33). Further the subclade includes a candidate CYP ( MaCYP71BQ5) which is an ortholog of
  • AiCYP71BQ5 is co-expressed with AiOSC1 in A. indica (Fig. 3).
  • Two of the candidates, MaCYP71CD2 and MaCYP71BQ5 share a similar expression pattern to MaOSCI (Fig. 4B)10T.
  • AiOSC1 in Nicotiana benthamiana 34, 35.
  • Expression of AiOSC1 gave the expected product, tirucalla-7,24-dien-3b-ol (Fig. 5B), consistent with previous expression in yeast (Fig. 2B, C).
  • Co-expression of AiOSC1 and MaCYP71CD2 resulted in consumption of tirucall-7,24-dien-3b-ol (1) and generation of a new product with a derivatised mass of 602.6 determined by GC-MS and an adduct of 481.365 determined by LC-MS (2) (Fig. 5 B, C, Fig. 7-8).
  • MaCYP71CD2 may act first due to greater efficiency of consumption of tirucalla-7,24-dien-3b-ol (1) than observed for MaCYP71 BQ5 (Fig.
  • MaCYP71 BQ5 introduces a primary alcohol at C21 of (1) to form the previously isolated compound tirucalla-7,24-dien-21 ,3b-diol (3), another postulated protolimonoid.
  • Tirucalla-7,24-dien-21 ,3b-diol (3) has been isolated only once from an obscure member of the Simaroubaceae family (36), whilst a related structure with an aldehyde at C21 , 3-oxotirucalla-7,24-dien-21-al, has been isolated a total of four times from members of Meliaceae, Rutaceae and Simaroubaceae families.
  • the mass adduct of the product of co-expression of AiOSCI , MaCYP71CD2 and MaCYP71 BQ5 (4) does not correspond to the predicted product of
  • MaCYP71CD2 and MaCYP71 BQ5 acting together (tirucalla-7-ene-24,25-epoxy- 3b,21 ,23-triol).
  • Melianol exists as an epimeric mixture in solution (37), with the hemiacetal ring opening and reforming with two different stereochemistries at C21. Similar epimeric mixtures have been reported in other protolimonoids containing a hemiacetal ring structure such as turraeanthin (38) and melianone (39).
  • melianol (4) has only been isolated eight times, its C3 ketone melianone has been isolated from a total of 18 species across the Meliaceae, Rutaceae and
  • MaCYP71 BQ5 from members of all three limonoid-producing families of plants suggests that the biosynthesis of melianol could represent the initial stage of limonoid biosynthesis across the Sapindales order. Consistent with this, close homologs of MaCYP71CD2 and MaCYP71BQ5 are present in A. indica and C. sinensis (Table 4).
  • Fig. 5 D The pathway shown in Fig. 5 D is the proposed pathway for melianol biosynthesis in M. azedarach and C. sinensis, based on the evidence presented here.
  • Our work provides the first example of the functional characterisation of biosynthetic enzymes involved in protolimonoid biosynthesis.
  • MaCYP71CD2 and MaCYP71 BQ5 are capable of catalysing the three oxygenations of tirucalla-7,24-dien-3b-ol required to induce hemiacetal ring formation, so affording the protolimonoid melianol.
  • the identification of enzymes capable of initial ring formation on the sidechain of tirucalla- 7,24-dien-3b-ol are feasibly the starting process of furan ring formation (Fig. 1). Thus, the identification of these enzymes could imply that the order of chemical
  • the candidate genes selected based on differential expression analysis were cloned into pEAQ-HT-DEST 1 vectors to allow their functional characterisation by transient expression in N. benthamiana. Expression of different combinations of these genes in combination with melianol biosynthetic genes revealed that four candidate genes had activity on melianol-type scaffolds and therefore likely limonoid biosynthetic genes. The activities observed included modification of the internal scaffold of melianol from a protolimonoid-type to a limonoid-type internal scaffold (by
  • MaCYP88A108 and MalSOMI to form‘melianol B’ and the further decoration of melianol-type scaffolds by tailoring enzymes (MaSDRI and MaBAHDI).
  • MaCYP88A108 was originally identified as a homolog of AiCYP88A 108, which was co-expressed with AiOSC1 in A. indica ( Figure 3, Table S4). It was reselected as a candidate here because the newly generated M. azedarach genome revealed an extended 5’ sequence (141 bp) within the coding sequence of this gene.
  • MaCYP88A108 may introduce a hydroxyl group to multiple positions on the melianol scaffold this is unlikely given that no peaks with multiple oxidations were identified and when considering previously characterised triterpene biosynthetic CYPs that are capable of multiple oxidations, such as MaCYP71CD2 and AsCYP51 H10 from A. strigosa (80), oxidise both positions simultaneously as opposed to oxidising positions individually.
  • MalSOMI is annotated in Elv1 as sterol-8, 7-isomerase (IPR007905, IPR033118) and was selected as a candidate based on the structural similarity of protolimonoids to sterols and the potential requirement of isomerase function during limonoid scaffold rearrangement.
  • the sequence amplified using MalSOMI primers was not identical to the predicted sequence as it is containing an un-spliced intron, which is assumed to be spliced out when expressed in heterologous expression systems such as N.
  • MalSOMI may protonate a novel substrate for this class of enzyme as other plant sterol-8, 7-isomerases (characterised from A. thaliana and Zea mays) do not require prior oxygenation in order to perform their isomerisations and utilise an alkene as a substrate (81 ,82).
  • 7-isomerases characterised from A. thaliana and Zea mays
  • melianol is not consumed and no new products are detected (Figure 15), which confirms that MalSOMI does not function in the absence of oxidation by MaCYP88A108 and requires the epoxide rather than the alkene as a substrate.
  • MaSDRI is annotated as an SDR (IPR002347) and was selected based on its potential ability to convert the C3 hydroxy group of protolimonoids to a C3 ketone commonly seen in true limonoids.
  • SDR SDR
  • MaSDRI melianol B biosynthetic genes
  • MaSDRI thaliana
  • MaBAHDI was selected based on it being preliminarily identified as a possible ‘vinorine synthase’.
  • Vinorine synthases are a specific enzyme-type within the Benzylalcohol acetyl-, anthocyanin-O-hydroxy-cinnamoyl-, anthranilateW-hydroxy- cinnamoyl/benzoyl-, deacetylvindoline acetyltransferase (BAHD) superfamily, which transfer acetyl groups in monoterpenoid indole alkaloid biosynthetic pathways (84).
  • BAHD deacetylvindoline acetyltransferase
  • Triterpenes have previously been produced using engineered transgenic plant lines (e.g. Arabidopsis, Wheat).
  • a series of Golden Gate 23. Engler, C., et al. , A golden gate modular cloning toolbox for plants. ACS Synth Biol, 2014. 3(11): p. 839-43.) vectors which allow for construction of multigene vectors and allow integration of an entire pathway into a single locus have been reported. These can be applied analogously to the present invention, in the light of the disclosure herein.
  • a young ( ⁇ 1 year) Melia azedarach plant was purchased from Crug Farm Plants (UK) in summer 2016 and maintained in a John Innes Centre greenhouse (24 °C, 16 h light, grown in John Innes Cereal mix). The individual’s provenance is
  • RNAseq reads from two studies of Azadirachta indica (12, 19, 22) and one study of Melia azedarach (23) were downloaded from NCBI-SRA (Table S1). Within each dataset, tissues were pooled and a reference transcriptome was assembled using Trinity de novo assembler V.r0140717 (42) following a standard protocol (43) (Table S1). For protein annotation Augustus V3.2.2 (44) was used in intron-less mode with an Arabidopsis thaliana training model and untranslated region (UTR) identification turned off.
  • Melia azedarach limonoid and protolimonoid quantification Freeze-dried Melia azedarach material was weighed ( ⁇ 10 mg) and homogenised using Tungsten Carbide Beads (3 mm; Qiagen) with the a TissueLyser (1000 rpm, 1 min). Samples were extracted in 550 ml 100% methanol (10 mg/ml podophyllotoxin internal standard (Sigma-Aldrich)) and agitated at 18°C for 20 min. Supernatant (400 mI) was transferred and mixed with 140 mI ddh ⁇ O.
  • De-fatting was performed by addition of hexane (400 mI) and removal of the upper phase (300 mI) in duplicate. Remaining solvent was evaporated to dryness and extracts re-suspended in 100 mI of methanol.
  • Spin-X® Centrifuge Filter Centrifuge Tubes (pore size 0.22pm, Corning® Costar®) were used to filter extracts by centrifugation.
  • Eluate 50 pi
  • LCMSsolutions V3 (Shimadzu) was utilised to analyse chromatograms and for peak identification.
  • the internal standard (podophyllotoxin) was used to calculate an estimated concentration of target compound in starting material.
  • Azadirachtin Sigma-Aldrich
  • salannin Greyhound Chromatography
  • melianol (4) see below
  • Candidate cytochrome P450s were identified in M. azedarach transcriptome data by a BLAST+ V2.7.1 (32) search using Arabidopsis thaliana CYP protein sequences (http://www.p450.kvl.dk) as a query. A total of 1672 hits were identified with 103 representing unique, full-length (300-700 amino acids) protein coding (Augustus V3.2.2 (44)) sequences with‘cytochrome P450’ pFAM annotations (HMMSCAN (EMBL-EBI)). Protein sequences of candidates were aligned with MUSCLE V3.8.31 (45) to CYP protein sequences from A. thaliana
  • CYP clades were determined based on previous phylogenetic studies (33). Protein sequences of the 103 CYP candidates from M. azedarach were used as a BLAST+ V2.7.1 (32) query to identify homologs in A. indica and C. sinensis. CYPs were named following convention by the Cytochrome P450 Nomenclature Committee (29)
  • intron spanning PCR primers were designed for MaA-Acf/n, MaOSCI, MaCYP71CD2 and MaCYP71BQ5 (Table S10) by assuming similar intron patterning to the closely related A. indica species and subsequent alignment to the closest homologs in the A. indica draft genome (PRJNA176672; AMWY00000000.1) (21)).
  • Lightcycler® 480 SYBR Green I Mastemix (Roche) was used for quantitative real time PCR (qRT-PCR) performed on CFX96 real-time system and C1000 touch thermal cycler (BioRad). R was used to calculate relative expression compared to MaA-acf/n using the AACq method (47).
  • Candidate genes from M. azedarach were expressed in N. benthamiana by agroinfiltration of Agrobacteria tumefaciens LLBA4404 strains transformed with pEAQ-HT-DEST 1 constructs (48) (pEAQ-HT-DEST 1 was kindly provided by Lomonossoff laboratory). Different combinations of strains were co-infiltrated to test combinations of genes.
  • a feedback insensitive HMG CoA-reductase ( AstHMGR ) was included in addition to the candidates due to its proven ability to boost triterpene yield in this system (35). Agro-infiltration and harvest of leaf discs was performed as described previously for combinatorial triterpene biosynthesis (35).
  • RNA extraction and cDNA synthesis from Melia azedarach Melia azedarach tissues were flash-frozen in liquid nitrogen and ground using a pestle and mortar. RNA was extracted from leaf tissues using the modified protocol for RNeasy Plant Mini Kit (Qiagen) developed for extraction from woody plants (1). DNAase treatment was performed‘on-column’ using DNAse (Promega). Following the manufacturer’s instructions, first-strand cDNA synthesis was performed using the GoScriptTM
  • Saccharomyces cerevisiae heterologous recombination and transformation Saccharomyces cerevisiae heterologous recombination and transformation.
  • Fragment 2 was amplified using a forward primer with the 5’ end complementary to the 3’ of fragment 1 and a pYES2-specific reverse primer as described above. Coding sequences of oxidosqualene cyclase (OSC) candidates from M. azedarach were amplified from cDNA by PCR with pYES2-specific primers. All PCR reactions were performed using Phusion polymerase (Promega) following the manufacturer’s instructions, and all primers (Table S10) were ordered from Sigma-Aldrich. The PCR fragments were co-transformed into GIL77 with linearized pYES2 vector following a standard protocol (YeastMakerTM, Yeast transformation system 2, Clontech laboratories).
  • OSC oxidosqualene cyclase
  • plasmids were extracted using ZymoprepTM Yeast Plasmid Miniprep (Zymo Research), transformed into Escherichia coli for propagation and extracted for sequencing. All plasmid purifications from E. coli were performed using QIAprep Spin Miniprep Kit (Qiagen).
  • S. cerevisiae strains GIL77 (2) and Y21900 MATa/a ura3A0 leu2A0 his3A 1 met15A 0/ME T15 LYS2/lys2A0 ERG 7/ERG 7::kanMX4) (EuroScarf) were used for expression of candidate OSCs and CYP genes. Both strains have either partial (Y21900) or full (GIL77) loss of function of ERG7.
  • GIL77 strain All media used for GIL77 strain were supplemented with 20 mg/mL ergosterol (Fluka), 13 mg/mL hemin (Sigma-Aldrich) and 5 mg/ml_ Tween 80 (Sigma-Aldrich). Selection media are listed in Table S12. Strains were grown in liquid culture at 30°C with shaking at 200 rpm. For expression of candidate genes, strains were first pre-cultured to saturation ( ⁇ 48 h) in SD +glucose (2% wt/vol) +[supplements].
  • Cells were saponified by resuspending in 250 pi of saponification reagent (20% (wt/vol) KOH in 50% (vol/vol) EtOH) and incubating for 2 h at 65°C. Triterpenes were then extracted in an equal volume of hexane and the hexane extracts were pooled and dried down.
  • Gateway® cloning of OSCs and genes from M. azedarach. The coding sequence of candidate genes were amplified by PCR with a forward primer containing 5’ AttB1 site and a reverse containing 5’ AttB2. Gel electrophoresis was used to confirm the sizes of PCR fragments. These were then purified using QIAquick Gel Extraction Kit or QIAquick PCR Purification Kit (Qiagen). Gateway® technology (Invitrogen) was used following the manufacturer’s instructions. Briefly, purified PCR fragments were transferred into donor vector pDNR207 by performing a BP recombination reaction followed by transformation into E. coli (DH5aTM (ThermoFisher Scientific)).
  • Plasmids were sequenced to check for successful recombination and correct coding sequence. Finally, an LR recombination reaction was performed to transfer the coding sequence of candidate genes from pDNR207 to the desired expression vector following the manufacturer’s instructions.
  • PYES2-DEST52 Thermo- Fisher Scientific
  • pAG423GAL and pAG425GAL Additional genes
  • Lomonossoff laboratory was used as an expression vector for Agrobacteria tumefaciens mediated transient expression in Nicotiana benthamiana.
  • GC-MS analysis of triterpene extracts Dried samples were resuspended in 200 mL of extraction solvent and 50 mL aliquots were dried down under N2 gas. Dried aliquots were then derivatized in 50mL 1-(trimethylsilyl)imidazole - pyridine mixture (Sigma- Aldrich) and heated at 65°C for 30 min, before being transferred to glass inserts in glass autosampler vials.
  • GC-MS analysis was performed using a 7890B GC (Agilent) and an electron-impact (El) 5977AMSD (Agilent) fitted with a Zebron ZB5-HT Inferno column (Phenomenex) following a previously described method (4).
  • DGE analysis was performed using Trinity-assembled A. indica transcriptome (Ai 1) (Table S1) as reference sequence with corresponding raw RNAseq reads from fruit, root, leaf, stem and flower tissues (5, 6).
  • Transcript abundance estimation was performed using a script provided within the Trinity de novo assembler package“align and estimate abundance” (7). Briefly, raw RNAseq reads for each tissue were aligned to the transcriptome (BowTie V1.0.1 (8)) and abundance per gene was estimated (RSEM V1.3.0 (9)) using Trinity transcripts as a proxy for genes.
  • the resultant estimated counts per gene were converted to integers and genes scoring less than one count per million in two or more tissues were excluded from the analysis. Data were normalized to account for differences in library size by using a trimmed mean of M-values (TMM) method (EdgeR V3.22.5 (10)). Due to a lack of replicates in the published dataset, a dispersion value could not be calculated and was therefore manually estimated at 0.05.
  • TMM M-values
  • Correlation matrices for tissues and genes were calculated using the Spearman (12) and Person (13) methods, respectively. Conversion of correlation matrices to distance matrices was performed based on complete linkages. The dendrogram of clustered genes was cut at 0.08422892 (max height of tree/4.85) and visualized using Heatmap3 V1.1.1 (14).
  • LC-MS was carried out based on a previously described method (15) using positive mode electrospray LC-MS on a Nexera/Prominence UHPLC equipped with an ion-trap ToF mass spectrometer (Shimadzu).
  • Spray chamber conditions were 300°C heat block, 250°C curved desorbation line, 1.5 L/min nebuliser gas, and drying gas‘on’.
  • the instrument was calibrated using sodium trifluoroacetate cluster ions according to the manufacturer’s instructions.
  • benthamiana plants were agroinfiltrated with equal volumes of A. tumefaciens strains containing pEAQ-/-/T-DEST1 expression construct for AstHMGR, AiOSC1 and MaCYP71CD2.
  • Initial extraction was performed on dried leaf material (68.64 g) following the large-scale triterpene extraction protocol previously described (16).
  • Successive rounds of fractionation were performed using IsoleraTM Prime (Biotage) as described in Table S11. To achieve final purification, the sample was dissolved in a minimal amount of ethanol and agitated (15 min) with activated charcoal (Sigma- Aldrich). This yielded 86 mg of dihydroniloticin, enabling structural confirmation by NMR.
  • featureCounts tool of subread V1.6.0 (95) was used to generate raw read counts by counting the number of reads overlapping with Elv1 genes in each alignment.
  • Raw read counts were analysed in R using DEseq2 v1.22.1 (96). Genes with zero counts were removed from the analysis, normalisation was performed based on library size and subsequent counts were log2 transformed with a pseudo count of one. The resultant library-normalised log2 read counts were used for downstream analyses.
  • edgeR V3.22.5 97 was used to select genes from the newly generated Melia azedarach genome Elv1 (unpublished), which were differentially expressed (P-value ⁇ 0.05). Briefly, raw read counts were imported into an EdgeR object and genes with low coverage (less than one count per million in more than four samples) were discarded. Normalisation (by library size) was performed using the‘trimmed mean of M-values’ method. To identify differentially expressed genes, a genewise negative binomial generalized linear model (glmQLFit) was used with pairwise comparisons between all sample types.
  • glmQLFit genewise negative binomial generalized linear model
  • DEseq2 V1.22.1 (96) was used to produce read counts for hierarchical clustering, by removing read counts of zero, normalising by library size and performing log2 transformation with a pseudo count of one.
  • the log2-library-normalised read counts were used for hierarchical clustering and plotting as described for the A. indica analysis. A number of methods were used to capture the widest possible pool of co-expressed genes.
  • genes clustering with melianol biosynthetic genes MaOSCI , MaCYP71CD2 and MaCYP71BQ5 when using read counts from all 28 RNA-Seq tissues or using a mean value for each of the seven tissues
  • genes clustering with the latest melianol biosynthetic gene at time of analysis MaCYP71BQ5 based on read counts from all 28 RNA-Seq tissues or using a mean value for each of the seven tissues. From this pool of co-expressed genes, candidates were manual selected based on their annotation.
  • the fraction collector was programmed to collect fractions between 22-25 minutes (with a maximum peak duration of 2 min) and to be triggered by detection of a peak from either the DAD or ELSD detector (with criteria of up slope 2, down slope 4, threshold 2.5 and upper threshold 5000).
  • the DAD was set to collect signals with a wavelength of 205nm and bandwidth of 4nm, and the ELSD to acquire signals with the following parameters, temperature 40°C, gas flow rate of 1.6 SLM, data rate of 80Hz and LED intensity 100%.
  • N. benthamiana leaf disc based M. sexta feeding assay was based on a published assay (98).
  • A. tumefaciens liquid cultures were inoculated with strains harbouring genes of interest.
  • Infiltration of N. benthamiana leaves with A. tumefaciens and NeemAZAL T/S solution was performed the following day.
  • three days post-lay M. sexta eggs were transferred onto uninfiltrated N. benthamiana leaves in petri-dishes containing moistened blue roll.
  • Remaining leaf material was freeze-dried and quantitative metabolite analysis was performed as described.
  • a paintbrush was used to transfer an acclimatised five day post-lay (one day posthatch) M. sexta larvae into each well, ensuring no contact between paintbrush and leaf. Plates were sealed and incubated for 32-48. Images of plates were taken before and after the assay. Post-assay images were aligned to pre-assay images using the landmark correspondence plug-in in Fiji to generate comparable post-assay images. Python was used to run the‘find green area differences’ script to calculate the percentage of green area remaining after the assay.
  • transcriptome has been assigned an ID based on species and original data set: Azadirachta indica (Ai1 and Ai2) and Melia azedarach (Ma1). Details of RNAseq data used to assemble transcriptomes include: BioSample, SRA identifiers and the tissue of origin. Basic statistics from Trinity de novo (7) generated assemblies are also included: total number of transcripts, N50 and total number of bases assembled.
  • NMR spectra were recorded using CDCIR3R and referenced to TMS. Coupling constants are reported as observed and not corrected for second order effects. Assignments were made via a combination of 1 H, 13C, DEPT-edited HSQC, HMBC and 2D NOESY experiments. Where signals overlap 1 H d is reported as the centre of the respective HSQC crosspeak. Assignments were consistent with previous literature assignments for tirucalla-7,24-dien-3 ⁇ -ol (23). Table S4. Candidate CYPs from M. azedarach, orthologs from A. indica and closest C. sinensis homologs.
  • Candidate CYPs from M. azedarach transcriptome (Ma1) are listed with their orthologs or closet homologs from A. indica
  • CYP nomenclature is listed (black) along with identifiers in datasets (grey).
  • CYPs and fragments from A. indica and M. azedarach were named and assigned to clans by the Cytochrome P450 Nomenclature Committee following established convention (24).
  • CYPs from C. sinensis had previously been identified from an alternative C. sinensis genome (25) and later assigned names by the Cytochrome P450 Nomenclature Committee (24).
  • NMR spectra were recorded using CDCIR3R and referenced to TMS. Coupling constants are reported as observed and not corrected for second order effects. Assignments were made via a combination of P 1 PH, P 13 PC, DEPT-edited HSQC, HMBC and 2D NOESY experiments. Where signals overlap P 1 PH d is reported as the centre of the respective HSQC crosspeak. Assignments were consistent with previous literature assignments for dihydroniloticin (26). Table S6. 13 C & 1 H d assignments for tirucalla-7,24-dien-3b,21-diol.
  • NMR spectra were recorded using CDCIR3R and referenced to TMS. Coupling constants are reported as observed and not corrected for second order effects. Assignments were made via a combination of P 1 PH, P 13 PC, DEPT-edited HSQC, HMBC and 2D NOESY experiments. Where signals overlap P 1 PH d is reported as the centre of the respective HSQC crosspeak. Table S7. 13C d comparison to the literature for tirucalla-7-ene- 23,21,24,25-diepoxy-3b,21-diol (melianol) C21 epimeric mixture.
  • AttB1-F GGGGACAAGTTT GTACAAAAAAGCAGGCTTCAT GTGGAAGCT GAAGATT G
  • nucleotide sequences of all primers used and their target genes are listed including, those used for cloning, sequencing and qRT-PCR.
  • Supplement drop-out (SD) media used to select for each S. cerevisiae plasmid. Selection amino are include uracil (URA), histidine (HIS) and leucine (LEU).
  • HMKYNRSSKDMSKIAC SEQ ID 25 - AsSQS coding sequence (nucleotide)

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Dentistry (AREA)
  • Environmental Sciences (AREA)
  • Agronomy & Crop Science (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Pest Control & Pesticides (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nutrition Science (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne des gènes et des polypeptides de plantes nouvellement caractérisés qui ont une utilité dans l'ingénierie ou la modification de la production de limonoïdes ou proto-limonoïdes dans des cellules hôtes. L'invention concerne en outre des systèmes, des procédés et des produits les utilisant.
PCT/EP2020/066241 2019-06-12 2020-06-11 Gènes et polypeptides biosynthétiques WO2020249698A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1908431.8A GB201908431D0 (en) 2019-06-12 2019-06-12 Biosynthetic genes and polypeptides
GB1908431.8 2019-06-12

Publications (1)

Publication Number Publication Date
WO2020249698A1 true WO2020249698A1 (fr) 2020-12-17

Family

ID=67386307

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2020/066241 WO2020249698A1 (fr) 2019-06-12 2020-06-11 Gènes et polypeptides biosynthétiques

Country Status (2)

Country Link
GB (1) GB201908431D0 (fr)
WO (1) WO2020249698A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114350702A (zh) * 2022-01-27 2022-04-15 浙江农林大学 一种柑橘的病毒接种方法
WO2024109131A1 (fr) * 2022-11-21 2024-05-30 东北林业大学 Procédé de synthèse de cholestérol et de ses dérivés à l'aide d'une installation de châssis, et composition

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0194809A1 (fr) 1985-03-07 1986-09-17 Lubrizol Genetics Inc. Vecteur de transformation d'ARN
WO1992001047A1 (fr) 1990-07-10 1992-01-23 Cambridge Antibody Technology Limited Procede de production de chainon de paires a liaison specifique
US5231020A (en) 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
WO1995034668A2 (fr) 1994-06-16 1995-12-21 Biosource Technologies, Inc. Inhibition cytoplasmique de l'expression genique
JP2005052009A (ja) 2003-08-04 2005-03-03 Mitsui Chemicals Inc チルカラ−７，２４−ジエン−３β−オールシンターゼおよび該酵素遺伝子
WO2007135480A1 (fr) 2006-05-22 2007-11-29 Plant Bioscience Limited Système bipartite, procédé et composition permettant l'expression constitutive et inductible de niveaux élevés de protéines étrangères dans des plantes
WO2009087391A1 (fr) 2008-01-08 2009-07-16 Plant Bioscience Limited Systèmes d'expression de protéines

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0194809A1 (fr) 1985-03-07 1986-09-17 Lubrizol Genetics Inc. Vecteur de transformation d'ARN
US5231020A (en) 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
WO1992001047A1 (fr) 1990-07-10 1992-01-23 Cambridge Antibody Technology Limited Procede de production de chainon de paires a liaison specifique
WO1995034668A2 (fr) 1994-06-16 1995-12-21 Biosource Technologies, Inc. Inhibition cytoplasmique de l'expression genique
JP2005052009A (ja) 2003-08-04 2005-03-03 Mitsui Chemicals Inc チルカラ−７，２４−ジエン−３β−オールシンターゼおよび該酵素遺伝子
WO2007135480A1 (fr) 2006-05-22 2007-11-29 Plant Bioscience Limited Système bipartite, procédé et composition permettant l'expression constitutive et inductible de niveaux élevés de protéines étrangères dans des plantes
WO2009087391A1 (fr) 2008-01-08 2009-07-16 Plant Bioscience Limited Systèmes d'expression de protéines

Non-Patent Citations (173)

* Cited by examiner, † Cited by third party
Title
A. BAYERX. MAJ. STOCKIGT: "Acetyltransfer in natural product biosynthesis functional cloning andmolecular analysis of vinorine synthase", BIOORGANIC &MEDICINAL CHEMISTRY, vol. 12, no. 10, 2004, pages 2787 - 2795
A. C. HUANGT. JIANGY.-X. LIUY.-C. BAIJ. REEDB. QUA. GOOSSENSH.-W. NUTZMANNY. BAIA. OSBOURN: "A specialized metabolic network selectively modulates Arabidopsis root microbiota", SCIENCE, vol. 364, no. 6440, 2019, pages eaau6389
A. HALLAB: "PhD thesis", 2015, UNIVERSITATS-UND LANDESBIBLIOTHEK BONN, article "Protein Function Prediction Using Phylogenomics, Domain Architecture Analysis, Data Integration, and Lexical Scoring"
A. RAHIERS. PIERREG. RIVEILLF. KARST: "Identification of essential amino acid residues in a sterol 8, 7-isomerase from zea mays reveals functional homology and diversity with the isomerases of animal and fungal origin", BIOCHEMICAL JOURNAL, vol. 414, no. 2, 2008, pages 247 - 259
AARTHY T ET AL.: "Tracing the biosynthetic origin of limonoids and their functional groups through stable isotope labelling and inhibition in neem tree (Azadirachta indica) cell suspension", BMC PLANT BIOLOGY, vol. 18, no. 1, 2018, pages 230
AHSAN MARMSTRONG JAGRAY ALWATERMAN PG: "Boronialatenolide: a novel pentanortriterpene from the aerial parts of Boronia alata (Rutaceae", AUSTRALIAN JOURNAL OF CHEMISTRY, vol. 47, no. 9, 1994, pages 1783 - 1787
AHSAN MARMSTRONG JAGRAY ALWATERMAN PG: "Terpenoids, alkaloids and coumarins from Boronia inornata and Boronia gracilipes", PHYTOCHEMISTRY, vol. 38, no. 5, 1995, pages 1275 - 1278
AKHILA ASRIVASTAVA MRANI K: "Production of radioactive azadirachtin in the seed kernels of Azadirachta indica (the Indian neem tree", NATURAL PRODUCT LETTERS, vol. 11, no. 1, 1996, pages 107 - 110
ANGELLBAULCOMBE, THE EMBO JOURNAL, vol. 16, no. 12, 1997, pages 3675 - 3684
ARMITAGE ET AL., NATURE, vol. 357, 1992, pages 80 - 82
AVINASH PANDREKA ET AL: "De novo Sequencing and Analysis of Transcriptome from Azadirachta indica to Characterize the Genes Involved in Limonoid Biosynthesis", PHD THESIS, 1 May 2018 (2018-05-01), pages 217 - 219 , 227-, XP055718318, Retrieved from the Internet <URL:https://dspace.ncl.res.in/xmlui/handle/20.500.12252/5846> [retrieved on 20200727] *
AYAFOR JFSONDENGAM BLCONNOLLY JDRYCROFT DSOKOGUN JI: "Tetranortriterpenoids and related compounds, part 26. tecleanin, a possible precursor of limonin, and other new tetranortriterpenoids from Teclea grandifolia Engl.(Rutaceae", JOURNAL OF THE CHEMICAL SOCIETY, PERKIN TRANSACTION, vol. 1, no. 1, 1981, pages 1750 - 1753
BAK S ET AL.: "Cytochromes P450", THE ARABIDOPSIS BOOK, vol. 9, no. 1, 2011, pages e0144 - e0144
BAK S ET AL.: "The Arabidopsis Book", vol. 9, 2011, article "Cytochromes p450", pages: e0144 - e0144
BASAK SISLAM A: "DP Melianone from Swietenia mahagoni. J", INDIAN CHEM. SOC., vol. 47, no. 5, 1970, pages 501 - 503
BENOSMAN A: "Tirucallane triterpenes from the stem bark of Aglaia leucophylla", PHYTOCHEMISTRY, vol. 40, no. 5, 1995, pages 1485 - 1487
BEVAN CEKONG DHALSALL TTOFT P: "West African timbers. Part XX. The structure of turraeanthin, an oxygenated tetracyclic triterpene monoacetate", JOURNAL OF THE CHEMICAL SOCIETY C: 1967(ORGANIC, 1967, pages 820 - 828
BEVAN CEKONG DHALSALL TTOFT P: "West African timbers. Part XX. The structure of turraeanthin, an oxygenated tetracyclic triterpene monoacetate", JOURNAL OF THE CHEMICAL SOCIETY C: ORGANIC, 1967, pages 820 - 828
BHAMBHANI S ET AL.: "Genes encoding members of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene family from Azadirachta indica and correlation with azadirachtin biosynthesis", ACTA PHYSIOL. PLANT., vol. 39, no. 1, 2017, pages 65
BHAMBHANI S ET AL.: "Transcriptome and metabolite analyses in Azadirachta indica: identification of genes involved in biosynthesis of bioactive triterpenoids", SCIENTIFIC REPORTS, vol. 7, no. 1, 2017, pages 5043
BIAVATTI MW: "Chemistry and bioactivity of Raulinoa echinata Cowan, an endemic Brazilian Rutaceae species", PHYTOMEDICINE, vol. 8, no. 2, 2001, pages 121 - 124, XP004957212, DOI: 10.1078/0944-7113-00016
BOURQUE, PLANT SCIENCE, vol. 105, 1995, pages 125 - 149
CAMACHO C ET AL.: "BLAST+: architecture and applications", BMC BIOINFORMATICS, vol. 10, no. 1, 2009, pages 421, XP055111342, DOI: 10.1186/1471-2105-10-421
CHEN J: "Cytotoxic triterpenoids from Azadirachta indica", PLANTA MEDICA, vol. 77, no. 16, 2011, pages 1844 - 1847
COOMBES PHMULHOLLAND DARANDRIANARIVELOJOSIA M: "Mexicanolide limonoids from the Madagascan Meliaceae Quivisia papinae", PHYTOCHEMISTRY, vol. 66, no. 10, 2005, pages 1100 - 1107, XP004967657, DOI: 10.1016/j.phytochem.2005.03.002
DATABASE NCBI [online] ANONYMOUS: "Premnaspirodiene oxygenase-like [Citrus sinensis]", XP055719411, Database accession no. XP_006469495 *
DATABASE UniProt [online] 28 February 2018 (2018-02-28), "SubName: Full=Uncharacterized protein {ECO:0000313|EMBL:GAY33000.1};", XP055726774, retrieved from EBI accession no. UNIPROT:A0A2H5MYA2 Database accession no. A0A2H5MYA2 *
DATABASE UniProt [online] 3 April 2013 (2013-04-03), "RecName: Full=Terpene cyclase/mutase family member {ECO:0000256|RuleBase:RU362003}; EC=5.4.99.- {ECO:0000256|RuleBase:RU362003};", XP055726771, retrieved from EBI accession no. UNIPROT:L7WI23 Database accession no. L7WI23 *
DATABASE UniProt [online] 3 September 2014 (2014-09-03), "SubName: Full=Uncharacterized protein {ECO:0000313|EMBL:KDO44741.1};", XP055726773, retrieved from EBI accession no. UNIPROT:A0A067E1K2 Database accession no. A0A067E1K2 *
DATABASE UniProt [online] 3 September 2014 (2014-09-03), "SubName: Full=Uncharacterized protein {ECO:0000313|EMBL:KDO78504.1};", XP055726772, retrieved from EBI accession no. UNIPROT:A0A067GFT7 Database accession no. A0A067GFT7 *
EBIZUKA YKATSUBE YTSUTSUMI TKUSHIRO TSHIBUYA M: "Functional genomics approach to the study of triterpene biosynthesis", PURE AND APPLIED CHEMISTRY, vol. 75, no. 2-3, 2003, pages 369 - 374
EDGAR R: "MUSCLE: multiple sequence alignment with high accuracy and high throughput", NUCLEIC ACIDS RESEARCH, vol. 32, no. 5, 2004, pages 1792 - 1797, XP008137003, DOI: 10.1093/nar/gkh340
EKONG DEUIBIYEMI SAOLAGBEMI EO: "The meliacins (limonoids). biosynthesis of nimbolide in the leaves of Azadirachta indica", JOURNAL OF THE CHEMICAL SOCIETY D: CHEMICAL COMMUNICATIONS, vol. 18, 1971, pages 1117 - 1118
ELENA, CLAUDIA ET AL.: "Expression of codon optimized genes in microbial systems: current industrial applications and perspectives", FRONTIERS IN MICROBIOLOGY, vol. 5, 2014, XP002765948, DOI: 10.3389/fmicb.2014.00021
ENGLER, C. ET AL.: "A golden gate modular cloning toolbox for plants", ACS SYNTH BIOL, vol. 3, no. 11, 2014, pages 839 - 43
ENGLISH ET AL., THE PLANT CELL, vol. 8, 1996, pages 179 - 188
ESIMONE CO ET AL.: "Potential anti-respiratory syncytial virus lead compounds from Aglaia species", DIE PHARMAZIE - AN INTERNATIONAL JOURNAL OF PHARMACEUTICAL SCIENCES, vol. 63, no. 10, 2008, pages 768 - 773
FIRE A. ET AL., NATURE, vol. 391, 1998
FIRE, TRENDS GENET., vol. 15, 1999, pages 358 - 363
FLAVELL, PNAS USA, vol. 91, 1994, pages 3490 - 3496
FO ERFERNANDES JBVIEIRA PCDA SILVA MFDGF: "Isolation of secoisolariciresinol diesters from stems of Simaba cuneata", PHYTOCHEMISTRY, vol. 31, no. 6, 1992, pages 2115 - 2116, XP026633436, DOI: 10.1016/0031-9422(92)80374-N
FRISCH, D. A.L. W. HARRIS-HALLER ET AL.: "Complete Sequence of the binary vector Bin 19", PLANT MOLECULAR BIOLOGY, vol. 27, 1995, pages 405 - 409, XP000654452, DOI: 10.1007/BF00020193
GRABHERR MG ET AL.: "Full-length transcriptome assembly from RNA-Seq data without a reference genome", NATURE BIOTECHNOLOGY, vol. 29, no. 7, 2011, pages 644 - U 130, XP055689113, DOI: 10.1038/nbt.1883
GRAY ALBHANDARI PWATERMAN PG: "New protolimonoids from the fruits of Phellodendron chinense", PHYTOCHEMISTRY, vol. 27, no. 6, 1988, pages 1805 - 1808, XP026631050, DOI: 10.1016/0031-9422(88)80448-5
GRIECO PAHADDAD JPINEIRO-NUNEZ MMHUFFMAN JC: "Quassinoids from the twigs and thorns of Castela polyandra", PHYTOCHEMISTRY, vol. 50, no. 4, 1999, pages 637 - 645, XP004290852, DOI: 10.1016/S0031-9422(98)00589-5
GROSVENOR SNJMASCOLL KMCLEAN SREYNOLDS WFTINTO WF: "Tirucallane, apotirucallane, and octanorapotirucallane triterpenes of Simarouba amara.", JOURNAL OF NATURAL PRODUCTS, vol. 69, no. 9, 2006, pages 1315 - 1318
GROTEWOLD ET AL.: "Engineering Secondary Metabolites in Maize Cells by Ectopic Expression of Transcription Factors", PLANT CELL, vol. 10, 1998, pages 721 - 740, XP002145082, DOI: 10.1105/tpc.10.5.721
GU J: "Chemical components of Dysoxylum densiflorum", NATURAL PRODUCTS AND BIOPROSPECTING, vol. 3, no. 2, 2013, pages 66 - 69
GUALDANI RCAVALLUZZI MMLENTINI GHABTEMARIAM S: "The chemistry and pharmacology of citrus limonoids", MOLECULES, vol. 21, no. 11, 2016, pages 1530
GUERINEAUMULLINEAUX: "Plant Molecular Biology Labfa", 1993, SCIENTIFIC PUBLISHERS, article "Plant transformation and expression vectors", pages: 121 - 148
H. LIB. HANDSAKERA. WYSOKERT. FENNELLJ. RUANN. HOMERG. MARTHG. ABECASISR. DURBIN: "The sequence alignment/map format and SAMtools", BIOINFORMATICS, vol. 25, no. 16, 2009, pages 2078 - 2079, XP055229864, DOI: 10.1093/bioinformatics/btp352
HAAS BJ ET AL.: "De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis", NATURE PROTOCOLS, vol. 8, no. 8, 2013, pages 1494 - 1512, XP055454988, DOI: 10.1038/nprot.2013.084
HALDRUP ET AL., PLANT MOLECULAR BIOLOGY, vol. 37, 1998, pages 287 - 296
HAMMOND ET AL., NATURE REV. GENES, vol. 2, 2001, pages 1110 - 1119
HAN JLIN WXU RWANG WZHAO S: "Studies on the chemical constituents of Melia azedarach L", ACTA PHARMACEUTICA SINICA, vol. 26, no. 6, 1991, pages 426 - 429
HARDING WWJACOBS HLEWIS PAMCLEAN SREYNOLDS WF: "Cycloartanes, protolimonoids, a pregnane and a new ergostane from Trichilia reticulata", NATURAL PRODUCT LETTERS, vol. 15, no. 4, 2001, pages 253 - 260
HASEGAWA SHERMAN Z: "Biosynthesis of obacunone from nomilin in Citrus limon", PHYTOCHEMISTRY, vol. 24, no. 9, 1985, pages 1973 - 1974, XP026617030, DOI: 10.1016/S0031-9422(00)83102-7
HASEGAWA SHERMAN ZORME EOU P: "Biosynthesis of limonoids in citrus: sites and translocation", PHYTOCHEMISTRY, vol. 25, no. 12, 1986, pages 2783 - 2785
HASEGAWA SMIYAKE M: "Biochemistry and biological functions of citrus limonoids", FOOD REVIEWS INTERNATIONAL, vol. 12, no. 4, 1996, pages 413 - 435
HAYASIDA WOLIVEIRA LFERREIRA ALIMA M: "Ergostane steroids, tirucallane and apotirucallane triterpenes from Guarea convergens", CHEMISTRY OF NATURAL COMPOUNDS, vol. 53, no. 2, 2017, pages 312 - 317, XP036221474, DOI: 10.1007/s10600-017-1977-4
HODGSON, HANNAH ET AL.: "Identification of key enzymes responsible for protolimonoid biosynthesis in plants: Opening the door to azadirachtin production", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 116.34, 2019, pages 17096 - 17104
HONG Z-L ET AL.: "Tetracyclic triterpenoids and terpenylated coumarins from the bark of Ailanthus altissima (''tree of heaven", PHYTOCHEMISTRY, vol. 86, no. 1, 2013, pages 159 - 167
HUANG HL ET AL.: "Tirucallane-type triterpenoids from Dysoxylum lenticellatum", JOURNAL OF NATURAL PRODUCTS, vol. 74, no. 10, 2011, pages 2235 - 2242
INADA AKONISHI MMURATA HNAKANISHI T: "Structures of a new limonoid and a new triterpenoid derivative from pericarps of Trichilia connaroides", JOURNAL OF NATURAL PRODUCTS, vol. 57, no. 10, 1994, pages 1446 - 1449
IRUNGU BN: "Antiplasmodial and cytotoxic activities of the constituents of Turraea robusta and Turraea nilotica", JOURNAL OF ETHNOPHARMACOLOGY, vol. 174, 2015, pages 419 - 425
ITOKAWA HKISHI EMORITA HTAKEYA K: "Cytotoxic quassinoids and tirucallane-type triterpenes from the woods of Eurycoma longifolia", CHEMICAL & PHARMACEUTICAL BULLETIN, vol. 40, no. 4, 1992, pages 1053 - 1055
JAYAKUMAR GAJITHA BAI MDFUJIMOTO Y: "Beddomeilactone: a new triterpene from Dysoxylum Beddomei", NATURAL PRODUCT RESEARCH, vol. 18, no. 4, 2004, pages 329 - 334
JIMENEZ A: "Limonoids from Swietenia humilis and Guarea grandiflora (Meliaceae) Taken in part from the PhD and MS theses of C. Villarreal and M. A. Jimenez, respectively", PHYTOCHEMISTRY, vol. 49, no. 7, 1998, pages 1981 - 1988
K. GEISLERR. K. HUGHESF. SAINSBURYG. P. LOMONOSSOFFM. REJZEKS. FAIRHURSTC.-E. OLSENM. S. MOTAWIAR. E. MELTONA. M. HEMMINGS ET AL.: "Biochemical analysis of a multifunctional cytochrome P450 (CYP51) enzyme required for synthesis of antimicrobial triterpenes in plants", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 110, no. 35, 2013, pages E3360 - E3367
KAUR RARORA S: "Chemical constituents and biological activities of Chukrasia tabularis A. Juss.-A review", JOURNAL OF MEDICINAL PLANTS RESEARCH, vol. 3, no. 4, 2009, pages 196 - 216
KETWARU PKLASS JTINTO WFMCLEAN SREYNOLDS WF: "Pregnane steroids from Trichilia schomburgkii", JOURNAL OF NATURAL PRODUCTS, vol. 56, no. 3, 1993, pages 430 - 431
KIPLIMO JISLAM SKOORBANALLY N: "Ring A, D-SECO limonoids and flavonoid from the Kenyan Vepris uguenensis Engl. and their antioxidant activity", PLANTA MEDICA, vol. 78, no. 11, 2012, pages PI111
KISHI KYOSHIKAWA KARIHARA S: "Limonoids and protolimonoids from the fruits of Phellodendron amurense", PHYTOCHEMISTRY, vol. 31, no. 4, 1992, pages 1335 - 1338, XP028087504, DOI: 10.1016/0031-9422(92)80285-M
KITA M ET AL.: "Molecular cloning and characterization of a novel gene encoding limonoid UDP-glucosyltransferase in Citrus", FEBS LETTERS, vol. 469, no. 2-3, 2000, pages 173 - 178, XP004261071, DOI: 10.1016/S0014-5793(00)01275-8
KNORR L: "Synthese von furfuranderivaten aus dem diacetbernsteinsaureester", BERICHTE DER DEUTSCHEN CHEMISCHEN GESELLSCHAFT, vol. 17, no. 2, pages 2863 - 2870
KOENEN EJCLARKSON JJPENNINGTON TDCHATROU LW: "Recently evolved diversity and convergent radiations of rainforest mahoganies (Meliaceae) shed new light on the origins of rainforest hyperdiversity", NEW PHYTOLOGIST, vol. 207, no. 2, 2015, pages 327 - 39
KRISHNAN NM ET AL.: "A draft of the genome and four transcriptomes of a medicinal and pesticidal angiosperm Azadirachta indica", BMC GENOMICS, vol. 13, no. 1, 2012, pages 464, XP021120003, DOI: 10.1186/1471-2164-13-464
KRISHNAN NM ET AL.: "De novo sequencing and assembly of Azadirachta indica fruit transcriptome", CURRENT SCIENCE, vol. 101, no. 12, 2011, pages 1553 - 1561
KRISHNAN NMJAIN PGUPTA SHARIHARAN AKPANDA B: "An improved genome assembly of Azadirachta indica A. Juss", G3: GENES, GENOMES, GENETICS, vol. 6, no. 7, 2016, pages 1835 - 1840
KUMAR VNIYAZ NMMWICKRAMARATNE DBMBALASUBRAMANIAM S: "Tirucallane derivatives from Paramignya monophylla fruits", PHYTOCHEMISTRY, vol. 30, no. 4, 1991, pages 1231 - 1233, XP027190981
KURAVADI NA ET AL.: "Comprehensive analyses of genomes, transcriptomes and metabolites of neem tree", PEERJ, vol. 3, 2015, pages e1066
KUSHIRO TSHIBUYA MMASUDA KEBIZUKA Y: "Mutational studies on triterpene synthases: engineering lupeol synthase into 3-amyrin synthase", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 122, no. 29, 2000, pages 6816 - 6824
LANGMEAD BTRAPNELL CPOP MSALZBERG SL: "Ultrafast and memory-efficient alignment of short DNA sequences to the human genome", GENOME BIOL, vol. 10, no. 1, 2009, pages R25, XP021053573, DOI: 10.1186/gb-2009-10-3-r25
LAVIE DJAIN MKSHPAN-GABRIELITH SR: "A locust phagorepellent from two melia species", CHEMICAL COMMUNICATIONS (LONDON), vol. 1967, no. 18, 1967, pages 910 - 911
LETUNIC IBORK P: "Interactive tree of life (iTOL) v3: an online tool for the display and annotation of phylogenetic and other trees", NUCLEIC ACIDS RESEARCH, vol. 44, no. W1, 2016, pages W242 - W245
LI BDEWEY CN: "RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome", BMC BIOINFORMATICS, vol. 12, no. 1, 2011, pages 323, XP021104619, DOI: 10.1186/1471-2105-12-323
LIEN TPKAMPERDICK CSCHMIDT JADAM GSUNG T: "Apotirucallane triterpenoids from Luvunga sarmentosa (Rutaceae", PHYTOCHEMISTRY, vol. 60, no. 7, 2002, pages 747 - 754, XP004371695, DOI: 10.1016/S0031-9422(02)00156-5
LIU HHEILMANN JRALI TSTICHER O: "New tirucallane-type triterpenes from Dysoxylum variabile", JOURNAL OF NATURAL PRODUCTS, vol. 64, no. 2, 2001, pages 159 - 163
LIU J-Q ET AL.: "Limonoids from the leaves of Toona ciliata var. yunnanensis", PHYTOCHEMISTRY, vol. 76, no. 1, 2012, pages 141 - 149
LIVAK KJSCHMITTGEN TD: "analysis of relative gene expression data using real-time quantitative PCR and the 2-AACT method", METHODS, vol. 25, no. 4, 2001, pages 402 - 408
LOVE MHUBER WANDERS S: "Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2", GENOME BIOLOGY, vol. 15, no. 12, 2014, pages 550, XP021210395, DOI: 10.1186/s13059-014-0550-8
LUO X-DWU S-HMA Y-BWU D-G: "Tirucallane triterpenoids from Dysoxylum hainanense", PHYTOCHEMISTRY, vol. 54, no. 8, 2000, pages 801 - 805, XP004291578, DOI: 10.1016/S0031-9422(00)00172-2
M. D. ROBINSOND. J. MCCARTHYG. K. SMYTH: "edgeR: a bioconductor package for differential expression analysis of digital gene expression data", BIOINFORMATICS, vol. 26, no. 1, 2010, pages 139 - 140
M. GIOLAIP. PAAJANENW. VERWEIJL. PERCIVAL-ALWYND. BAKERK. WITEKF. JUPEG. BRYANI. HEINJ. D. JONES ET AL.: "Targeted capture and sequencing of gene-sized DNA molecules", BIOTECHNIQUES, vol. 61, no. 6, 2016, pages 315 - 322
M. I. LOVEW. HUBERS. ANDERS: "Moderated estimation of fold change and dispersion for RNA-Seq data with DESeq2", GENOME BIOLOGY, vol. 15, no. 12, 2014, pages 550
MACKENZIE DJMCLEAN MAMUKERJI SGREEN M: "Improved RNA extraction from woody plants for the detection of viral pathogens by reverse transcription-polymerase chain reaction", PLANT DISEASE, vol. 81, no. 2, 1997, pages 222 - 226, XP001100054
MARSHALLHODGSON, NATURE BIOTECHNOLOGY, vol. 16, 1998, pages 177 - 180
MIGUITA CH ET AL.: "313-0-tigloylmelianol from Guarea kunthiana: a new potential agent to control rhipicephalus (boophilus) microplus, a cattle tick of veterinary significance", MOLECULES, vol. 20, no. 1, 2015, pages 111
MITTAPELLI SRMARYADA SKKHAREEDU VRVUDEM DR: "Structural organization, classification and phylogenetic relationship of cytochrome P450 genes in Citrus lementina and Citrus sinensis", TREE GENETICS & GENOMES, vol. 10, no. 2, 2014, pages 399 - 409
MOHAMAD K: "Tirucallane triterpenes from Dysoxylum macranthum", PHYTOCHEMISTRY, vol. 52, no. 8, 1999, pages 1461 - 1468, XP004291153, DOI: 10.1016/S0031-9422(99)00455-0
MORGAN ED: "Azadirachtin, a scientific gold mine", BIOORGANIC & MEDICINAL CHEMISTRY, vol. 17, no. 12, 2009, pages 4096 - 4105, XP026152224, DOI: 10.1016/j.bmc.2008.11.081
MORLACCHI P ET AL.: "Product profile of PEN3: the last unexamined oxidosqualene cyclase in Arabidopsis thaliana", ORGANIC LETTERS, vol. 11, no. 12, 2009, pages 2627 - 2630
MULHOLLAND DAKOTSOS MMAHOMED HATAYLOR DAH: "Triterpenoids from Owenia cepiodora", PHYTOCHEMISTRY, vol. 49, no. 8, 1998, pages 2457 - 2460, XP004290460, DOI: 10.1016/S0031-9422(98)00307-0
NAKANISHI TINADA ALAVIE D: "A new tirucallane-type triterpenoid derivative, lipomelianol from fruits of Melia toosendan Sieb. et Zucc", CHEMICAL AND PHARMACEUTICAL BULLETIN, vol. 34, no. 1, 1986, pages 100 - 104
NAKANISHI TINADA ALAVIE D: "A new tirucallane-type triterpenoid derivative, lipomelianol from fruits of Melia toosendan. Sieb. et Zucc", CHEMICAL AND PHARMACEUTICAL BULLETIN, vol. 34, no. 1, 1986, pages 100 - 104
NARNOLIYA LKRAJAKANI RSANGWAN NSGUPTA VSANGWAN RS: "Comparative transcripts profiling of fruit mesocarp and endocarp relevant to secondary metabolism by suppression subtractive hybridization in Azadirachta indica (neem", MOLECULAR BIOLOGY REPORTS, vol. 41, no. 5, 2014, pages 3147 - 3162
NELSON DR: "Cytochrome P450 Protocols", 2004, HUMANA PRESS, article "Cytochrome P450 nomenclature", pages: 1 - 10
NTALLI NG: "Cytotoxic tirucallane triterpenoids from Melia azedarach fruits", MOLECULES, vol. 15, no. 9, 2010, pages 5866 - 5877
ORISADIPE ATADESOMOJU AAD'AMBROSIO MGUERRIERO AOKOGUN JI: "Tirucallane triterpenes from the leaf extract of Entandrophragma angolense", PHYTOCHEMISTRY, vol. 66, no. 19, 2005, pages 2324 - 2328, XP005096140, DOI: 10.1016/j.phytochem.2005.07.017
OU PHASEGAWA SHERMAN ZFONG CH: "Limonoid biosynthesis in the stem of Citrus limon", PHYTOCHEMISTRY, vol. 27, no. 1, 1988, pages 115 - 118
P. JONESD. BINNSH.-Y. CHANGM. FRASERW. LIC. MCANULLAH. MCWILLIAMJ. MASLENA.MITCHELLG.NUKA ET AL.: "Interproscan 5: genome-scale protein function classification", BIOINFORMATICS, vol. 30, no. 9, 2014, pages 1236 - 1240
PAAL C: "Ueber die derivate des acetophenonacetessigesters und des acetonylacetessigesters", BERICHTE DER DEUTSCHEN CHEMISCHEN GESELLSCHAFT, vol. 17, no. 2, pages 2756 - 2767
PANDREKA A ET AL.: "Triterpenoid profiling and functional characterization of the initial genes involved in isoprenoid biosynthesis in neem (Azadirachta indica)", BMC PLANT BIOLOGY, vol. 15, no. 1, 2015, pages 214
PEARSON K: "Notes on regression and inheritance in the case of two parents", PROCEEDINGS OF THE ROYAL SOCIETY OF LONDON, vol. 58, no. 1, 1895, pages 240 - 242
POLONSKY JBASKEVITCH-VARON ZDAS BC: "Triterpenes tetracycliques du Simarouba amara", PHYTOCHEMISTRY, vol. 15, no. 2, 1976, pages 337 - 339
POLONSKY JVARON ZRABANAL RMJACQUEMIN H: "21, 20-anhydromelianone and melianone from Simarouba amara (Simaroubaceae); carbon-13 NMR spectral analysis of A7-tirucallol-type triterpenes", ISRAEL JOURNAL OF CHEMISTRY, vol. 16, no. 1, 1977, pages 16 - 19
PRICE MDEHAL PARKIN A: "FastTree 2-approximately maximum-likelihood trees for large alignments", PLOS ONE, vol. 5, no. 3, 2010, pages e9490
PURUSHOTHAMAN KKDURAISWAMY KCONNOLLY JDRYCROFT DS: "Triterpenoids from Walsura piscidia", PHYTOCHEMISTRY, vol. 24, no. 10, 1985, pages 2349 - 2355, XP026647169, DOI: 10.1016/S0031-9422(00)83040-X
Q. LIUB. KHAKIMOVP. D. CARDENASF. COZZIC. E. OLSENK. R. JENSENT. P. HAUSERS. BAK: "The cytochrome P450 CYP72A552 is key to production of hederagenin-based saponins that mediate plant defense against herbivores", NEW PHYTOLOGIST, vol. 222, no. 3, 2019, pages 1599 - 1609
R. J. GREBENOKT. E. OHNMEISSA. YAMAMOTOE. D. HUNTLEYD. W. GALBRAITHD. DELIA PENNA: "Isolation and characterization of an Arabidopsis thaliana C-8,7 sterol isomerase: functional and structural similarities to mammalian C-8, 7 sterol isomerase/emopamil-binding protein", PLANT MOLECULAR BIOLOGY, vol. 38, no. 5, 1998, pages 807 - 815, XP002558802, DOI: 10.1023/A:1006028623875
RACOLTA SJUHL PBSIRIM DPLEISS J: "The triterpene cyclase protein family: a systematic analysis", PROTEINS: STRUCTURE, FUNCTION, AND BIOINFORMATICS, vol. 80, no. 8, 2012, pages 2009 - 2019
RAGASA CY: "Glabretal-type triterpenoids from Dysoxylum mollissimum", PHYTOCHEMISTRY LETTERS, vol. 6, no. 4, 2013, pages 514 - 518
RAJAKANI RNARNOLIYA LSANGWAN NSSANGWAN RSGUPTA V: "Subtractive transcriptomes of fruit and leaf reveal differential representation of transcripts in Azadirachta indica", TREE GENETICS & GENOMES, vol. 10, no. 5, 2014, pages 1331 - 1351, XP035392453, DOI: 10.1007/s11295-014-0764-7
REED J ET AL.: "A translational synthetic biology platform for rapid access to gram-scale quantities of novel drug-like molecules", METABOLIC ENGINEERING, vol. 42, no. 1, 2017, pages 185 - 193, XP085136198, DOI: 10.1016/j.ymben.2017.06.012
REEGAN ADGANDHI MRPAULRAJ MGBALAKRISHNA KIGNACIMUTHU S: "Effect of niloticin, a protolimonoid isolated from Limonia acidissima L. (Rutaceae) on the immature stages of dengue vector Aedes aegypti L. (Diptera: Culicidae", ACTA TROPICA, vol. 139, no. 1, 2014, pages 67 - 76
ROBINSON MMCCARTHY DSMYTH G: "edgeR: a Bioconductor package for differential expression analysis of digital gene expression data", BIOINFORMATICS, vol. 26, no. 1, 2010, pages 139 - 140
RODRIGUES VFCARMO HMBRAZ RFMATHIAS LVIEIRA I: "Two new terpenoids from Trichilia quadrijuga (Meliaceae", NATURAL PRODUCT COMMUNICATIONS, vol. 5, no. 2, 2010, pages 179 - 184
ROY ASARAF S: "Limonoids: Overview of significant bioactive triterpenes distributed in plants kingdom", BIOLOGICAL & PHARMACEUTICAL BULLETIN, vol. 29, no. 2, 2006, pages 191 - 201, XP008103058, DOI: 10.1248/bpb.29.191
S. ANDREWSF. KRUEGERA. SEGONDS-PICHONL. BIGGINSC. KRUEGERS. WINGETTFASTQC: "RNA-Seq analysis workshop course material", vol. 29, 2013, WEILL CORNELLMEDICAL COLLEGE, article "STAR: ultrafast universal RNA-Seq aligner", pages: 15 - 21
S. T. MUGFORDX. QIS. BAKHTL. HILLE. WEGELR. K. HUGHESK. PAPADOPOULOUR.MELTONM. PHILOF. SAINSBURY ET AL.: "A serine carboxypeptidase-like acyltransferase is required for synthesis of antimicrobial compounds and disease resistance in oats", THE PLANT CELL, vol. 21, no. 8, 2009, pages 2473 - 2484
S. ZHAOY. GUOQ. SHENGY. SHYR: "Heatmap3: an improved heatmap package withmore powerful and convenient features", BMC BIOINFORMATICS, vol. 15, no. S10, 2014, pages 16
SAINSBURY FTHUENEMANN ECLOMONOSSOFF GP: "pEAQ: versatile expression vectors for easy and quick transient expression of heterologous proteins in plants", PLANT BIOTECHNOLOGY JOURNAL, vol. 7, no. 7, 2009, pages 682 - 693
SARAIVA RDCGPINTO ACNUNOMURA SMPOHLIT AM: "Triterpenes and a canthinone alkaloid from the stems of Simaba polyphylla (Cavalcante) WW Thomas (Simaroubaceae", QUIMICA NOVA, vol. 29, no. 2, 2006, pages 264 - 268
SAXENA NKUMAR Y: "Chemistry of azadirachtin and other bioactive isoprenoids from neem", 2008, INTERNATIONAL PUBLISHING HOUSE PVT. LTD., article "Spearman rank correlation coefficient", pages: 502 - 505
SCHWAB ET AL., PLANT CELL, vol. 18, 2006, pages 1121 - 1133
SHARP, GENES DEV., vol. 15, 2001, pages 485 - 490
SIDDIQUI SMAHMOOD TSIDDIQUI BSFAIZI S: "Isolation of a triterpenoid from Azadirachta indica", PHYTOCHEMISTRY, vol. 25, no. 9, 1986, pages 2183 - 2185
SIEVERS F ET AL.: "Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega", MOLECULAR SYSTEMS BIOLOGY, vol. 7, no. 1, 2011, pages 539
SMITH ET AL., NATURE, vol. 334, 1988, pages 724 - 726
STANKE MMORGENSTERN B: "AUGUSTUS: a web server for gene prediction in eukaryotes that allows user-defined constraints", NUCLEIC ACIDS RESEARCH, vol. 33, 2005, pages W465 - W467
STEPHENSON MJREED JBROUWER BOSBOURN A: "Transient expression in nicotiana benthamiana leaves for triterpene production at a preparative scale", JOVE, vol. 138, 2018, pages e58169
STEPHENSON MJREED JBROUWER BOSBOURN A: "Transient expression in Nicotiana benthamiana leaves for triterpene production at a preparative scale", JOVE, vol. 138, no. 1, 2018, pages e58169
SU R: "Triterpenoids from the fruits of Phellodendron chinense: The stereostructure of niloticin", CHEMICAL AND PHARMACEUTICAL BULLETIN, vol. 38, no. 6, 1990, pages 1616 - 1619
T. Z. BERARDINIL. REISERD. LIY. MEZHERITSKYR. MULLERE. STRAITE. HUALA: "The Arabidopsis information resource: making and mining the 'gold standard' annotated reference plant genome", GENESIS, vol. 53, no. 8, 2015, pages 474 - 485
TAN Q-GLUO X-D: "Meliaceous limonoids: chemistry and biological activities", CHEMICAL REVIEWS, vol. 111, no. 11, 2011, pages 7437 - 7522
THIMMAPPA RGEISLER KLOUVEAU TO'MAILLE POSBOURN A: "Triterpene biosynthesis in plants", ANNUAL REVIEW OF PLANT BIOLOGY, vol. 29, no. 65, 2014, pages 225 - 57
TINTO WFJAGESSAR PKKETWARU PREYNOLDS WFMCLEAN S: "Constituents of Trichilia schomburgkii", JOURNAL OF NATURAL PRODUCTS, vol. 54, no. 4, 1991, pages 972 - 977
TUSCHL, CHEM. BIOCHEM., vol. 2, 2001, pages 239 - 245
U. CONSORTIUM: "UniProt: a hub for protein information", NUCLEIC ACIDS RESEARCH, vol. 43, no. D1, 2014, pages D204 - D212
VAN DER KROL ET AL., THE PLANT CELL, vol. 2, 1990, pages 279 - 289
VASIL ET AL.: "Laboratory Procedures and Their Applications", vol. I, II and III, 1984, ACADEMIC PRESS, article "Cell Culture and Somatic Cell Genetics of Plants"
VEITCH GE ET AL.: "Synthesis of azadirachtin: a long but successful journey", ANGEW CHEM INT ED ENGL, vol. 46, no. 40, 2007, pages 7629 - 32
VIEIRA JI ET AL.: "Hirtinone, a novel cycloartane-type triterpene and other compounds from Trichilia hirta L. (Meliaceae", MOLECULES, vol. 18, no. 3, 2013, pages 2589 - 2597
VOINNETBAULCOMBE, NATURE, vol. 389, 1997, pages 553
WANG FS ET AL.: "Identification of putative genes involved in limonoids biosynthesis in citrus by comparative transcriptomic analysis", FRONTIERS IN PLANT SCIENCE, vol. 8, no. 1, 2017, pages 782
WANG G-C ET AL.: "Limonoids and triterpenoids as 11 β-HSD1 inhibitors from Walsura robusta", JOURNAL OF NATURAL PRODUCTS, vol. 79, no. 4, 2016, pages 899 - 906
WANG J-R: "Protolimonoids and norlimonoids from the stem bark of Toona ciliata var. pubescens", ORGANIC & BIOMOLECULAR CHEMISTRY, vol. 9, no. 22, 2011, pages 7685 - 7696
WANG JZHANG YLUO JKONG L: "Complete 1 H and 13C NMR data assignment of protolimonoids from the stem barks of Aphanamixis grandifolia", MAGNETIC RESONANCE IN CHEMISTRY, vol. 49, no. 7, 2011, pages 450 - 457
WANG SZHANG HLI XZHANG J: "Gene expression profiling analysis reveals a crucial gene regulating metabolism in adventitious roots of neem (Azadirachta indica)", RSC ADVANCES, vol. 6, no. 115, 2016, pages 114889 - 114898
WANG Y ET AL.: "Comparative analysis of the terpenoid biosynthesis pathway in Azadirachta indica and Melia azedarach by RNA-seq", SPRINGERPLUS, vol. 5, no. 1, 2016, pages 1 - 9
WATTANAPIROMSAKUL CWATERMAN PG: "Flavanone, triterpene and chromene derivatives from the stems of Paramignya griffithii", PHYTOCHEMISTRY, vol. 55, no. 3, 2000, pages 269 - 273, XP004291643, DOI: 10.1016/S0031-9422(00)00311-3
WEISSBACHWEISSBACH: "Molecular Cloning: a Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
XU Q ET AL.: "The draft genome of sweet orange (Citrus sinensis)", NATURE GENETICS, vol. 45, no. 1, 2012, pages 59 - 66
Y. LIAOG. K. SMYTHW. SHI: "The Subread aligner: fast, accurate and scalable readmapping by seed-and-vote", NUCLEIC ACIDS RESEARCH, vol. 41, no. 10, 2013, pages e108 - e108
YAMASHITA S ET AL.: "Total synthesis of limonin", ANGEWANDTE CHEMIE INTERNATIONAL EDITION, vol. 54, no. 29, 2015, pages 8538 - 8541
YANG S-PNI GGU Y-CYUE J-M: "Triterpenoids from Aglaia odorata var. microphyllina AU - Liu, Jia", J. ASIAN NAT. PROD. RES., vol. 14, no. 10, 2012, pages 929 - 939
YUAN C-M ET AL.: "Bioactive limonoid and triterpenoid constituents of Turraea pubescens", JOURNAL OF NATURAL PRODUCTS, vol. 76, no. 6, 2013, pages 1166 - 1174
ZAMORE P.D., NATURE STRUCTURAL BIOLOGY, vol. 8, no. 9, 2001, pages 746 - 750
ZHANG ET AL., THE PLANT CELL, vol. 4, 1992, pages 1575 - 1588
ZHANG X-Y ET AL.: "Tirucallane-type alkaloids from the bark of Dysoxylum laxiracemosum", JOURNAL OF NATURAL PRODUCTS, vol. 73, no. 8, 2010, pages 1385 - 1388
ZHANG YYXU H: "Recent progress in the chemistry and biology of limonoids", RSC ADVANCES, vol. 7, no. 56, 2017, pages 35191 - 35220
ZHAO SGUO YSHENG QSHYR Y: "Heatmap3: an improved heatmap package with more powerful and convenient features", BMC BIOINFORMATICS, vol. 15, no. 10, 2014, pages 16
ZHAO W-Y ET AL.: "New tirucallane triterpenoids from Picrasma quassioides with their potential antiproliferative activities on hepatoma cells", BIOORGANIC CHEMISTRY, vol. 84, no. 1, 2019, pages 309 - 318

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114350702A (zh) * 2022-01-27 2022-04-15 浙江农林大学 一种柑橘的病毒接种方法
WO2024109131A1 (fr) * 2022-11-21 2024-05-30 东北林业大学 Procédé de synthèse de cholestérol et de ses dérivés à l'aide d'une installation de châssis, et composition

Also Published As

Publication number Publication date
GB201908431D0 (en) 2019-07-24

Similar Documents

Publication Publication Date Title
Singh et al. A WRKY transcription factor from Withania somnifera regulates triterpenoid withanolide accumulation and biotic stress tolerance through modulation of phytosterol and defense pathways
Sohrabi et al. In planta variation of volatile biosynthesis: an alternative biosynthetic route to the formation of the pathogen-induced volatile homoterpene DMNT via triterpene degradation in Arabidopsis roots
Hamberger et al. Evolution of diterpene metabolism: Sitka spruce CYP720B4 catalyzes multiple oxidations in resin acid biosynthesis of conifer defense against insects
Vaughan et al. Formation of the unusual semivolatile diterpene rhizathalene by the Arabidopsis class I terpene synthase TPS08 in the root stele is involved in defense against belowground herbivory
Ding et al. Multiple genes recruited from hormone pathways partition maize diterpenoid defences
Khakimov et al. Identification and genome organization of saponin pathway genes from a wild crucifer, and their use for transient production of saponins in Nicotiana benthamiana
Ginglinger et al. Gene coexpression analysis reveals complex metabolism of the monoterpene alcohol linalool in Arabidopsis flowers
Moses et al. Unraveling the triterpenoid saponin biosynthesis of the African shrub Maesa lanceolata
Sallaud et al. Characterization of two genes for the biosynthesis of the labdane diterpene Z‐abienol in tobacco (Nicotiana tabacum) glandular trichomes
US20230279444A1 (en) Metabolic engineering
Danner et al. Four terpene synthases produce major compounds of the gypsy moth feeding-induced volatile blend of Populus trichocarpa
US20230106588A1 (en) Transferase enzymes
US9096863B2 (en) Biosynthetic engineering of glucosinolates
Yang et al. The scarecrow‐like transcription factor SlSCL3 regulates volatile terpene biosynthesis and glandular trichome size in tomato (Solanum lycopersicum)
Zhao et al. Genetic transformation system for woody plant Tripterygium wilfordii and its application to product natural celastrol
Zhang et al. A (conditional) role for labdane‐related diterpenoid natural products in rice stomatal closure
WO2020249698A1 (fr) Gènes et polypeptides biosynthétiques
Kallam et al. Tunable control of insect pheromone biosynthesis in Nicotiana benthamiana
Perassolo et al. Biosynthesis of sesquiterpene lactones in plants and metabolic engineering for their biotechnological production
Almeida et al. Metabolic engineering of cucurbitacins in Cucurbita pepo hairy roots
Hay Investigation of the role of gene clusters in terpene biosynthesis in Sorghum bicolor
WO2024003012A1 (fr) Enzymes biosynthétiques de saponarioside
Firsov et al. Molecular Cloning of a cDNA for Chrysanthemum morifolium Ramat Squalene Synthase Gene and Impact of Its Silencing on Transgenic Chrysanthemum Plants
Mrakovčić Testing of candidate genes for compound biosynthesis in Arnica montana
Kershanskaya et al. Improving crops genome through genetic engineering of the key metabolic pathways

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20732578

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20732578

Country of ref document: EP

Kind code of ref document: A1