WO2020245611A1 - Leader sequence - Google Patents

Leader sequence Download PDF

Info

Publication number
WO2020245611A1
WO2020245611A1 PCT/GB2020/051380 GB2020051380W WO2020245611A1 WO 2020245611 A1 WO2020245611 A1 WO 2020245611A1 GB 2020051380 W GB2020051380 W GB 2020051380W WO 2020245611 A1 WO2020245611 A1 WO 2020245611A1
Authority
WO
WIPO (PCT)
Prior art keywords
pvc
effector
seq
payload
leader sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2020/051380
Other languages
English (en)
French (fr)
Inventor
Nicholas R. Waterfield
Joseph HEALEY
Alexia HAPESHI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Warwick
Original Assignee
University of Warwick
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP20732657.0A priority Critical patent/EP3980545A1/en
Priority to CA3142462A priority patent/CA3142462A1/en
Priority to SG11202113297RA priority patent/SG11202113297RA/en
Priority to JP2021572387A priority patent/JP7748288B2/ja
Priority to MX2021015121A priority patent/MX2021015121A/es
Priority to CN202080042046.3A priority patent/CN114008205A/zh
Priority to KR1020217042571A priority patent/KR20220133757A/ko
Priority to AU2020288380A priority patent/AU2020288380A1/en
Application filed by University of Warwick filed Critical University of Warwick
Priority to US17/613,911 priority patent/US20230076614A1/en
Priority to BR112021024592A priority patent/BR112021024592A2/pt
Publication of WO2020245611A1 publication Critical patent/WO2020245611A1/en
Anticipated expiration legal-status Critical
Priority to JP2025064761A priority patent/JP2025114573A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/89Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/035Fusion polypeptide containing a localisation/targetting motif containing a signal for targeting to the external surface of a cell, e.g. to the outer membrane of Gram negative bacteria, GPI- anchored eukaryote proteins

Definitions

  • the present invention relates to a leader sequence, and use of a leader sequence for packaging molecules into protein complexes.
  • Biological molecules e.g. peptides, proteins and nucleic acids
  • Biological molecules have great potential as broadly applicable therapeutics. Indeed, there has been a trend in recent years for the pharmaceutical industry to move away from‘small molecule’ drugs, toward more complex macromolecular therapeutics (aka. “biologies”). Such biologies include protein-based therapeutics (notably antibodies, hormones, growth factors and cytokines) and nucleic acid- based treatments (such as short-interfering RNAs, DNA/RNA vaccines and gene therapies).
  • protein-based therapeutics notably antibodies, hormones, growth factors and cytokines
  • nucleic acid- based treatments such as short-interfering RNAs, DNA/RNA vaccines and gene therapies.
  • protein-based pesticides are typically toxins which must target an extracellular component of a cell of a pest.
  • Bacillus thuringiensis toxins are commonly used natural pesticides which must bind membrane receptors to exert their toxic effects.
  • T3SS Type III secretion system
  • a significant drawback of these systems is that they remain associated with the bacterial membrane at all times, requiring use of actual bacterial cells (comprising the secretion system) as the delivery system. As such, it is difficult to fully control what molecules are transferred from the bacteria to the target cell (even when the biologic of interest is overexpressed), as these secretion systems function by providing a connection (e.g.
  • the present invention solves one or more of the above-mentioned problems.
  • the present invention is predicated on the surprising finding that toxigenic Photorhabdus Virulence Cassettes (PVC) effector proteins of Photorhabdus bacteria comprise a previously unknown“leader sequence” (or“leader peptide”), which functions to package (or“load”) PVC effectors into a so called PVC Needle Complex(e.g. “nanosyringe”), which subsequently delivers the PVC effector to a target cell where it exerts its toxigenic effect(s) (the PVC effectors representing a payload of such nanosyringes).
  • PVC Photorhabdus Virulence Cassettes
  • leader sequences can be practically utilized to direct a payload linked thereto to be packaged into a PVC Needle Complex (and related/ homologous complexes), a well characterized molecular delivery system of Photorhabdus.
  • the newly discovered leader sequence surprisingly functions to load the PVC Needle Complex with a molecular payload (or“warhead”).
  • the invention provides use of a Photorhabdus Virulence Cassettes (PVC) effector leader sequence, for packaging a payload into a PVC Needle Complex;
  • PVC Photorhabdus Virulence Cassettes
  • the payload is one or more selected from a polypeptide, a nucleic acid, or a combination thereof (preferably a polypeptide);
  • leader sequence and the payload form an effector fusion that is distinct from a wild-type PVC effector protein.
  • an aspect of the invention provides use of a PVC effector leader sequence, for packaging a payload into a PVC Needle Complex;
  • the payload is one or more selected from a polypeptide, a nucleic acid, or a combination thereof (preferably a polypeptide);
  • leader sequence and the payload form a fusion that is distinct from a PVC effector protein (e.g. wild-type PVC effector protein).
  • a PVC effector protein e.g. wild-type PVC effector protein
  • the invention provides in one aspect a method for packaging a payload into a PVC Needle Complex with a PVC effector leader sequence, comprising contacting an (effector) fusion with a PVC Needle Complex, wherein the payload is one or more selected from a polypeptide, a nucleic acid, or a combination thereof (preferably a polypeptide); and wherein the leader sequence and the payload form the (effector) fusion, that is distinct from a PVC effector protein (e.g. wild-type PVC effector protein).
  • a PVC effector protein e.g. wild-type PVC effector protein
  • fusion and“effector fusion”, in the context of a (effector) fusion formed by the leader sequence and the payload (and that is distinct from a wild-type PVC effector protein) are used interchangeably herein.
  • This use (of the leader sequence) was demonstrated, as outlined in the examples, by expressing an effector fusion (tagged with a detection label) and a PVC Needle Complex in a cell (e.g. host bacterial cell) wherein the effector fusion is packaged into the PVC Needle Complex (via the leader sequence), isolating the PVC Needle Complex, then detecting the presence or absence of the payload within the PVC Needle Complex (e.g. a disrupted version thereof) via Western blot detection of the detection label. The presence of the payload is detected when fused to a leader sequence only, but not when the payload lacks a leader sequence.
  • PVC effector leader sequence means the leader region (polypeptide region) from a PVC effector polypeptide which is capable of packaging a payload (e.g. effector) into a PVC Needle Complex, and is preferably amino acids 1-50 of a PVC effector, or amino acids 2-50 when omitting the initial methionine.
  • the inventors have demonstrated that the leader sequence is encompassed within (or may consist essentially of) amino acids 1-50 of a multitude of identified PVC effector polypeptide sequences. However, leader sequences having alternative lengths and positioning within a PVC effector are intended to be encompassed (e.g. with the proviso that said leader sequence is capable of packaging a payload into a PVC Needle Complex).
  • the remaining (non-leader sequence) portion of a PVC effector is referred to an“effector portion” (e.g. payload) herein.
  • the effector portion preferably comprises or consists essentially of amino acids 51-C terminus of a PVC effector protein.
  • a PVC effector leader sequence is encompassed within amino acids 1-50 or 2-50 (preferably 1-50) of a PVC effector polypeptide.
  • a PVC effector leader sequence comprises (or consists essentially of) amino acids 1-50 or 2-50 (preferably 1-50) of a PVC effector polypeptide.
  • wild-type PVC effector protein is used synonymously with the term“endogenous PVC effector protein”, or simply“PVC effector protein”, and refers to an (e.g. intact) PVC effector sequence having an endogenous leader sequence (i.e. endogenous to the given PVC effector, preferably amino acids 1-50 of the PVC effector) associated with the effector portion (e.g. the payload, preferably amino acids 51-C terminus of a PVC effector protein).
  • wild-type PVC effectors may comprise (or consist essentially of) an amino acid sequence of one or more sequence selected from SEQ ID NO.: 1 - SEQ ID NO.: 46.
  • the fusion/ effector fusion of the invention described herein is thus distinct from a PVC effector protein (e.g. wild-type PVC effector protein), as the leader sequence is not fused to an effector portion with which it may be fused in the case of a wild-type PVC effector protein.
  • the fusion/ effector fusion may comprise the leader sequence of the“Pnf” PVC effector protein (e.g. the leader of SEQ ID NO.: 78) fused to the effector portion of the hvnA (gene Plu1649) PVC effector protein (e.g.
  • the fusion/ effector fusion may comprise the leader sequence of, e.g., the “Pnf” PVC effector protein (e.g. the leader of SEQ ID NO.: 78) fused to a non-effector portion, for example a non- Photorhabdus protein such as Ore recombinase.
  • the leader sequence finds utility in packaging a range of e.g. heterologous (non-wild-type) agents into a PVC Needle Complex, opening the possibility to use the PVC Needle Complex as a modular, diverse delivery system for delivering not only natural effectors, but also‘unnatural’ payloads to a cell for the first time. As such, it is possible to manufacture a PVC Needle Complex having a payload of choice.
  • Another aspect of the invention provides a method for manufacturing a PVC Needle Complex comprising a payload (e.g. in other words, a method for manufacturing a packaged PVC Needle Complex), the method comprising:
  • the payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof (preferably a polypeptide);
  • effector fusion is distinct from a wild-type PVC effector protein.
  • An aspect of the invention provides a method for manufacturing a PVC Needle Complex comprising a payload (e.g. in other words, a method for manufacturing a packaged PVC Needle Complex), the method comprising:
  • the payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof (preferably a polypeptide).
  • said contacting may occur within a cell (e.g. bacterial host cell), in a cell lysate, or in a purified cell lysate (preferably within a cell). In one embodiment, said contacting may occur within a cell free expression system. Similar, a use described herein may comprise a contacting step (between the fusion/ effector fusion and PVC Needle Complex) occurring within a cell (e.g. bacterial host cell), in a cell lysate, cell free expression system, or in a purified cell lysate (preferably within a cell, more preferably a bacterial host cell).
  • a cassette (operon) encoding the PVC Needle Complex may be operably linked to a first promoter, and a gene encoding the fusion/ effector fusion (payload) may be operably linked to a second (preferably different) promoter.
  • said first and/or second promoter is an inducible promoter (e.g. an arabinose inducible promoter such a pBAD, and/or an IPTG inducible promoter).
  • the invention embraces an expression system wherein an operon encoding the PVC is present within a first vector/ plasmid (optionally operably linked to a first promoter), and the sequence encoding the effector fusion (leader sequence fused to payload) is present within a second (preferably different) plasmid (optionally linked to a second promoter).
  • the PVC Needle Complex and/or (preferably and) effector fusion may be expressed in one or more host selected from a bacterial cell, a yeast cell, an insect cell and/or a mammalian cell.
  • the PVC Needle Complex and effector fusion may be expressed together in a host cell selected from a bacterial cell, a yeast cell, an insect cell and a mammalian cell (preferably a bacterial cell).
  • a mammalian cell preferably a bacterial cell.
  • Suitable mammalian cells include a HEK293 cell and/or a CHO cell.
  • the PVC Needle Complex and/or (preferably and) the effector fusion (payload) may be expressed in a heterologous bacterial expression system (preferably E. coli).
  • the PVC Needle Complex and/or (preferably and) the PVC effector may be expressed in a Photorhabdus cell, optionally wherein the PVC operon of the Photorhabdus cell is endogenous to the cell (and optionally wherein the PVC operon is operably linked to an inducible promoter which may be incorporated into the genome to be operably linked to the PVC operon via genetic engineering).
  • an inducible promoter may be introduced into the genome of a Photorhabdus cell 5’ to a PVC (operon), preferably by recombineering as described in the examples (e.g. Example 3).
  • the payload may be, for example, a therapeutic payload, such that a PVC Needle Complex finds utility in medical treatment.
  • the invention provides a (packaged) PVC Needle Complex, for use in a method of treatment;
  • the PVC Needle Complex comprises (e.g. is packaged with) an effector fusion which comprises (or consists essentially of) a PVC effector leader sequence fused to a payload;
  • said payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof (preferably a polypeptide);
  • effector fusion is distinct from a wild-type PVC effector protein.
  • a further aspect of the invention provides a (packaged) PVC Needle Complex, for use in a method of treatment;
  • the PVC Needle Complex holds (e.g. is packaged with) a fusion which comprises (or consists essentially of) a PVC effector leader sequence fused to a payload;
  • said payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof (preferably a polypeptide);
  • fusion is distinct from a PVC effector protein (e.g. wild-type PVC effector protein).
  • the invention provides a method of treating a subject, the method comprising administering a (packaged) PVC Needle Complex to a subject (e.g. a patient);
  • the PVC Needle Complex comprises (e.g. is packaged with) an effector fusion which comprises (or consists essentially of) a PVC effector leader sequence fused to a payload;
  • said payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof (preferably a polypeptide);
  • an aspect of the invention provides a method of treating a subject, the method comprising administering a (packaged) PVC Needle Complex to a subject (e.g. a patient);
  • the PVC Needle Complex holds (e.g. is packaged with) a fusion which comprises (or consists essentially of) a PVC effector leader sequence fused to a payload;
  • said payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof (preferably a polypeptide);
  • fusion is distinct from a PVC effector protein (e.g. wild-type PVC effector protein).
  • the payload is a polypeptide.
  • the subject may be a mammalian subject, preferably a human subject.
  • PVC Needle Complex holds an effector fusion
  • PVC Needle Complex comprising an effector fusion means a PVC Needle Complex having a packaged effector fusion, or in other words, a PVC Needle Complex that is packaged with an effector fusion.
  • the term“packaged effector fusion”,“fusion” and“effector fusion” embraces a combination of a PVC effector leader sequence and a payload which remains in contact (e.g. fused) subsequent to packaging into PVC Needle Complex (e.g. the leader sequence has not been cleaved off the payload), as well as combination of a PVC effector leader sequence and a payload which are no longer in direct contact (e.g. no longer fused, such as following cleavage of the leader sequence from the payload).
  • “treat” or“treating” as used herein encompasses prophylactic treatment (e.g. to prevent onset of a disease) as well as corrective treatment (treatment of a subject already suffering from a disease).
  • Preferably“treat” or“treating” as used herein means corrective treatment.
  • the term “treat” or“treating” encompasses treating both the disease and a symptom thereof. In some embodiments “treat” or“treating” refers to a symptom of a disease.
  • a PVC Needle Complex may be administered to a subject in a therapeutically effective amount or a prophylactically effective amount.
  • A“therapeutically effective amount” is any amount of the (packaged/ laden) PVC Needle Complex, which when administered alone or in combination (e.g. with another therapeutic, administered parallel or in series and acting additively or synergistically) to a subject for treating a disease (or a symptom thereof) is sufficient to effect such treatment of the disease, or symptom thereof.
  • A“prophylactically effective amount” is any amount of the (packaged/ laden) PVC Needle Complex that, when administered alone or in combination (e.g. with another therapeutic, administered parallel or in series and acting additively or synergistically) to a subject inhibits or delays the onset or reoccurrence of a disease (or a symptom thereof).
  • the prophylactically effective amount prevents the onset or reoccurrence of a disease entirely. “Inhibiting” the onset means either lessening the likelihood of disease onset (or symptom thereof), or preventing the onset entirely.
  • a (packaged) PVC Needle Complex comprising (e.g. that holds/ that is packaged with) an effector fusion;
  • said effector fusion comprises (or consists essentially of) a PVC effector leader sequence fused to a payload (or in other words, wherein said effector fusion is formed by a PVC effector leader sequence and a payload);
  • said payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof;
  • effector fusion is distinct from a wild-type PVC effector protein.
  • one aspect of the invention provides a (packaged) PVC Needle Complex that holds (e.g. is packaged with) a fusion;
  • said fusion comprises (or consists essentially of) a PVC effector leader sequence fused to a payload (or in other words, wherein said fusion is formed by a PVC effector leader sequence and a payload);
  • said payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof (preferably a polypeptide);
  • fusion is distinct from a PVC effector protein (e.g. wild-type PVC effector protein).
  • the (packaged) PVC Needle Complex is an isolated (e.g. non natural) PVC Needle Complex.
  • the PVC Needle Complex typically functions in nature to deliver toxigenic PVC effectors to insect targets.
  • the invention concomitantly expands the number and variety of invertebrates (e.g. pests), such as amoeba, nematodes, helminths and insects, which may be targeted and killed.
  • a method for suppressing a pest comprising:
  • a. contacting a pest, or a target area comprising a pest, with a (packaged) PVC Needle Complex comprising (e.g. holding/ packaged with) an effector fusion;
  • the effector fusion comprises (or consists essentially of) a PVC effector leader sequence fused to a payload (or in other words, wherein said effector fusion is formed by a PVC effector leader sequence and a payload);
  • said payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof (preferably a polypeptide);
  • effector fusion is distinct from a wild-type PVC effector protein.
  • An aspect of the invention provides a method for suppressing a pest, the method comprising: a. contacting a pest, or a target area comprising a pest, with a (packaged) PVC Needle Complex holding (e.g. packaged with) a fusion; b. wherein the fusion comprises (or consists essentially of) a PVC effector leader sequence fused to a payload (or in other words, wherein said fusion is formed by a PVC effector leader sequence and a payload);
  • said payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof (preferably a polypeptide);
  • fusion is distinct from a PVC effector protein (e.g. wild-type PVC effector protein).
  • PVC Needle Complex holds an effector fusion
  • PVC Needle Complex comprising an effector fusion means a PVC Needle Complex having a packaged effector fusion.
  • target area refers to an area where a pest is present and/or where a pest may be (e.g. is expected to be, or suspected of being) present.
  • a target area may be contacted before, and/or when a pest is present.
  • the target area may be in the vicinity of (e.g. close proximity to) a pest.
  • the target area may be an area that a user wishes to protect from a pest.
  • a target area may comprise a plant and/or plant product.
  • the term“suppressing a pest” embraces“pest control”, “inhibiting the growth of a pest”, “inhibiting the proliferation of pest”, and/or“mortality of a pest”.
  • pests examples include one or more insect(s), mite(s), sowbug(s), pillbug(s), centipede(s), mollusk(s), millipede(s), protist(s), fungus (fungi), helminth(s) and/or bloodborne parasite(s).
  • the pest may be at any stage of development e.g. may be a larvae and/or adult pest (e.g. imago).
  • the invention may be used to target a variety of agricultural, commercial, home and garden pests.
  • the pest is an insect, a mite, a sowbug, a pillbug, a centipede, a mollusk and/or a millipede.
  • the pest may be an insect and/or a mite (preferably insect).
  • insects examples include, an insect of the order Lepidoptera, Coleoptera, Diptera, Blattodea, Hymenoptera, Isoptera, Orthoptera, Thysanura, and/or Dermaptera.
  • an insect of the order Lepidoptera may be one or more of a moth and/or a butterfly.
  • Suitable moths include Manduca Sexta and/or Galleria mellonella.
  • an insect of the order Coleoptera may be one or more of a European chafer grub, a northern masked chafer grub, a southern masked chafer grub, a Japanese beetle grub, a June beetle grub, a black vine weevil, a strawberry root weevil, a clay-colored weevil, a Colorado potato beetle, and/or a wireworm.
  • an insect of the order Diptera may be one or more of a leatherjacket (e.g. larvae of a crane fly), an onion maggot, a cabbage maggot, a carrot rust fly maggot, a fungus gnat, and/or a mosquito.
  • an insect of the order Blattodea may be a cockroach, suitably one or more cockroach selected from an American cockroach, and/or a German cockroach.
  • an insect of the order Hymenoptera may be an ant.
  • the ant may be one or more of a carpenter ant, an odorous house ant, a pavement ant, an Argentine ant, a Pharaoh ant, a tawny crazy ant, a harvester ant, a red imported fire ant, a Southern fire ant, a European fire ant, and/or a little fire ant.
  • an insect of the order Hymenoptera may be a yellowjacket.
  • an insect of the order Isoptera may be a termite.
  • the termite may be one or more of a damp wood termite, a dry wood termite, and/or a subterranean termite.
  • an insect of the order Orthoptera may be one or more of a cricket, a grasshopper, and/or a locust.
  • an insect of the order Thysanura may be a silverfish.
  • an insect of the order Dermaptera may be an earwig.
  • Suitable molluscs include a slug and/or a snail.
  • the pest is a protist.
  • said protist is one or more selected from Chaos carolinense, Amoeba proteus, Naegleria fowleri, Dictyostelium discoideum, Entamoeba histolytica, Trichomonas vaginalis, Blastocystis hominis, Leishmania Spp., and Giardia lamblia.
  • said protist is one or more selected from Fonticula alba, Dictyostelium discoideum, Chlamydomonas reinhardtii, Crytomonas paramedium, Paulinella chromatophora, Nannochloropsis gaditana, and/or Tetrahymena Spp.
  • the pest is a fungus.
  • said fungus is one or more fungus selected from Encephalitozoan cuniculi, Nasema apis, Namema ceranae, Vittaforma carneae, Enterocytosoan bieneusi, Spraguea lophii, Vavra culiculis, Edharzardia aedes, Nematocida parisii, Razeiia Spp., Parasitella parasitica, Lichteimia ramose, Sporisorium scitamineum, Trametes versicolor, and/or Punctularia strigosozonata.
  • said fungus is a Candida spp.
  • Said Candida spp. may be one or more selected from C. albicans, C. ascalaphidarum, C. amphixiae, C. Antarctica, C. argentea, C. atlantica, C. atmosphaerica, C. auris, C. blattae, C. bromeliacearum, C. carpophila, C. carvajaiis, C. cerambycidarum, C. chauliodes, C. corydalis, C. dosseyi, C. dubliniensis, C. ergatensis, C. fructus, C. glabrata, C. fermentati, C.
  • Candida spp. may be C. albicans.
  • the pest is a helminth.
  • Said helminth may be one or more selected from the phyla Annelida, Platyhelminthes, Nematoda and/or Acanthocephala.
  • said helminth is a parasitic flatworm.
  • Said parasitic flatworm may be one or more selected from a Cestoda, a Trematoda and/or a Monogenea.
  • said helminth is a parasitic nematode.
  • Said parasitic nematode may be one or more selected an ascarid ( Ascaris ), a filaria, a hookworm, a pinworm ( Enterobius ), and/or a whipworm ⁇ Trichuris trichiura).
  • the pest is a bloodborne parasite.
  • Said bloodborne parasite may be one or more selected from Trypanosoma Spp (e.g. Trypanosoma brucei and/or T cruzi), Babesia Spp (e.g. Babesia microti), Leishmania Spp, Plasmodium Spp (e.g. P. falciparum), and/or Toxoplasma Spp. (e.g. Toxoplasma gondii).
  • the PVC Needle Complex for pest control is suitably environmentally safe (e.g. an environmentally safe pesticidal composition).
  • a payload to a cell, for example, during laboratory research.
  • a cell may be part of an in vitro cell line, or may be a cell of an animal (e.g. a research animal model). Additionally or alternatively, the cell may be comprised within an ex vivo system, such as an organoid.
  • Another aspect of the invention provides an in vitro (and/or ex vivo) method for delivering a payload into a cell, the method comprising:
  • a. contacting a cell with a (packaged) PVC Needle Complex comprising (e.g. holding/ packaged with) an effector fusion;
  • the effector fusion comprises (or consists essentially of) a PVC effector leader sequence fused to a payload (or in other words, wherein said effector fusion is formed by a PVC effector leader sequence and a payload);
  • said payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof (preferably a polypeptide);
  • effector fusion is distinct from a wild-type PVC effector protein.
  • An aspect of the invention provides an in vitro (and/or ex vivo) method for delivering a payload into a cell, the method comprising:
  • the fusion comprises (or consists essentially of) a PVC effector leader sequence fused to a payload (or in other words, wherein said fusion is formed by a PVC effector leader sequence and a payload);
  • said payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof (preferably a polypeptide);
  • fusion is distinct from a PVC effector protein (e.g. wild-type PVC effector protein).
  • the invention provides an effector fusion comprising (or consisting essentially of) a PVC effector leader sequence fused to a payload (or in other words, an effector fusion formed by a PVC effector leader sequence and a payload);
  • said payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof;
  • an aspect of the invention provides a fusion comprising (or consisting essentially of) a PVC effector leader sequence fused to a payload (or in other words, a fusion formed by a PVC effector leader sequence and a payload);
  • said payload is one or more selected from a polypeptide, a nucleic acid or a combination thereof (preferably a polypeptide);
  • fusion is distinct from a PVC effector protein (e.g. wild-type PVC effector protein).
  • the fusion/ effector fusion is an isolated fusion/ effector fusion (e.g. an isolated, non-naturally occurring fusion/ effector fusion).
  • the present invention embraces a nucleic acid comprising a nucleotide sequence which encodes the fusion/ effector fusion, and/or an expression vector comprising said nucleic acid. Also embraced is a host cell comprising said nucleic acid and/or expression vector.
  • another aspect of the invention provides an isolated PVC effector leader sequence (e.g. wherein the isolated PVC effector leader sequence is capable of packaging a payload into a PVC Needle Complex).
  • an isolated nucleic acid comprising a nucleotide sequence which encodes a PVC effector leader sequence.
  • the isolated PVC effector leader sequence may be recombinant, synthetic, and/or purified.
  • the isolated nucleic encoding a PVC effector leader sequence may be recombinant, synthetic, and/or purified.
  • Photorhabdus is a bacterium of the genus Enterobacteriacae, represented by three formally recognized (to date) species - namely P. luminescens, P. asymbiotica, and P. temperata. Important strains include P. asymbiotica subsp. australis, and P. luminescens subsp laumondii.
  • GenBank Photorhabdus asymbiotica ATCC43949 complete genome - GenBank Accession Number: FM 162591.1 ; Photorhabdus laumondii subsp. laumondii strain TT01 chromosome, complete genome - GenBank Accession number: CP024901.1).
  • Each of these species comprise at least one operon known as a Photorhabdus Virulence Cassette (PVC) operon, encoding a PVC Needle Complex, which may be referred to as a “nanosyringe” herein.
  • PVC Photorhabdus Virulence Cassette
  • a PVC Needle Complex which may be referred to as a “nanosyringe” herein.
  • Photorhabdus is typically found in nature as an insecticidal bacterium following regurgitation from a (symbiont) entomopathogenic Heterorhabditis sp. nematode (e.g. in order to avoid competition for food and resources from insects), it is understood that the PVC Needle Complex functions in nature to suppress insects.
  • Photorhabdus Virulence Cassettes represent one of at least four well-characterised toxin delivery systems of Photorhabdus.
  • Other major classes of Photorhabdus protein insecticidal toxins include the “Toxin Complexes” (Tcs), the “binary PirAB toxins”, and the “makes caterpillars floppy” (Mcf) toxins.
  • PVC Photorhabdus Virulence Cassette
  • PVC operon means a discrete operon of a Photorhabdus genome comprising genes encoding for polypeptide subunits which, when expressed, assemble to provide the macromolecular PVC Needle Complex.
  • the molecular architecture of these cassettes have been well characterized and described, for example in The Molecular Biology of Photorhabdus Bacteria (Springer International Publishing AG 2017, ISBN: 978-3-319-52714- 7, Chapter 10, pages 159-177), incorporated herein by reference.
  • a PVC typically comprises around sixteen genes ( pvd-pvc16 ) encoding structural proteins which assemble to provide a“PVC Needle Complex”, which are typically followed by one or more genes at the 3’ end which encode PVC effector genes, having toxic activity (and typically being homologues of typical T3SS-like effectors).
  • a Photorhabdus genome typically comprises a plurality of such cassettes (e.g. at least four), which are often associated with different effector payloads, or even a plurality of effector payloads.
  • Class I PVCs which may be referred to as a“prototypical PVC” herein
  • Class II lack pvc13 host cell binding fibres and pvc3, which (without wishing to be bound by theory) the inventors believe may be a minor specialised sheath subunit that attaches pvc13 fibre proteins onto the PVC Needle Complex (nanosyringe).
  • Class III is similar to Class I, but has an additional PvcO gene at the start of the operon (of unknown function) and two additional genes encoded between pvc13 and pvc14 that resemble“invasion” type protein genes.
  • This class is typically seen in the human clinical isolate strains of Photorhabdus - the inventors have shown that optimal transcription of PVC Class III may occur when the strain (harboring the PVC operon encoding a PVC Class III operon) is grown at 37°C and exposed to human serum, suggesting this class may be a mammalian adapted version of a PVC Needle Complex.
  • FIG. 1 (D) An example cassette (PVC) is shown in Figure 1 (D), which shows a map of the model“Class I” PVC operon of Photorhabdus asymbiotica ATCC43949 (obtainable from the ATCC, accession number: ATCC 43949), said operon being associated with the downstream effector gene“PAU_03332” (encoding a Pnf protein effector, e.g. SEQ ID NO.: 32).
  • This model operon is referred to as Pa AT cc 43949 p ⁇ /C pnf.
  • This operon comprises sixteen structural genes ( pvd-16 ), and two genes (3’ end) encoding effectors (in this case the pvc17 / Rhs- like, encoding an Rhs-like effector, and pvc21, encoding a Pnf effector).
  • Said genes pvd-16 correspond to genes PAU_03353 to PAU_03338 of the sequence of GenBank accession no. FM 162591.1 , and are represented by the sequence of SEQ ID NO.: 93.
  • PVC operon e.g. encoding the structural genes, but not a/the PVC effector
  • SEQ ID NO: 93 which is encodes the operon shown schematically in Figure1(D)
  • SEQ ID NO: 94 and in SEQ ID NO: 95.
  • a PVC Needle Complex from any one of Classes l-lll may be used for a variety of applications.
  • PVC Needle Complexes of a certain class may be particularly suitable for delivery to a defined cell type.
  • a PVC Needle Complex for delivery of a payload to a mammalian cell may suitably be a member of Class III.
  • a PVC Needle Complex for delivery of a payload to an insect cell may suitably be a member of Class I (such as P. asymbiotica PVC pnf, encoded by SEQ ID NO.: 93, e.g. as expressed in E. coli from a cosmid clone).
  • the term“PVC Needle Complex” (used synonymously with the terms“PVC Needle Complex delivery system” and“nanosyringe” herein) means a macromolecular protein complex comprising polypeptide subunits encoded by a PVC (operon) of a Photorhabdus bacterium.
  • a PVC Needle Complex is assembled in a nanosyringe structure, having a physical structure (superficially) similar to the antibacterial R- type pyocins (see Figure 3).
  • Functional and molecular studies have shown that a PVC Needle Complex becomes packaged (loaded) with a PVC effector protein(s) (i.e. the PVC effector proteins are packaged therein, or thereon), the packaged PVC Needle Complex is released from the bacterium, and then injects the PVC effector into a target cell such that the PVC effector protein may exert toxicity.
  • PVC Needle Complex preferably encompasses PVC Needle Complex-like structures/complexes, encoded by operon(s) comprising genes which are homologous to genes of a Photorhabdus PVC operon.
  • PVC-like elements are not restricted to Photorhabdus, and a well characterized homologous operon (to a PVC operon) is present on the pADAP plasmid of the insect pathogenic bacteria Serratia entomophila.
  • an analogous, and (at least partially) homologous, PVC-like ‘injectosome’ Needle Complex system is employed by the bacterium Pseudoaiteromonas luteoviolacea (e.g.
  • a PVC Needle Complex is a“nanosyringe” complex, with the polypeptide encoded by the effector gene being packaged (loaded) within, or at the end (tip) of, the PVC Needle Complex, thus representing a“payload” or“warhead” of the PVC Needle Complex.
  • the PVC Needle Complex itself (with the payload still loaded) is freely released (e.g. secreted) from Photorhabdus cells, before interacting with the membrane of a target cell and injecting the payload into the cell’s cytosol.
  • the inventors have successfully expressed and loaded PVC Needle Complexes in heterologous expression systems, before isolating/ purifying the PVC Needle Complexes and using them to suppress (e.g. kill) insect larvae (see Example 2).
  • the PVC Needle Complexes act as long-range protein delivery systems.
  • the PVC Needle Complex is encoded by a sequence having at least 75% sequence identity (preferably at least 85% sequence identify; more preferably at least 95% sequence identity) to a sequence selected from SEQ ID NO.: 93, SEQ ID NO.: 94, and SEQ ID NO.: 95 (for example, SEQ ID NO.: 93).
  • the PVC Needle Complex is encoded by a sequence selected from SEQ ID NO.: 93, SEQ ID NO.: 94, and SEQ ID NO.: 95 (for example, SEQ ID NO.: 93).
  • Leader/ signal sequences are typically peptides, often of 10-30 amino acids long present at the N-terminus of the majority of (newly) expressed proteins that are destined towards the secretory pathway (e.g. for directing said proteins to a protein-conducting channel on the cell membrane). Many proteins require a signal sequence for Golgi or endoplasmic reticulum entry.
  • leader sequence (used interchangeably with the terms“leader peptide”,“signal sequence”, “targeting signal”, “localization signal”, “localization sequence”, and “transit peptide” herein), used in the context of a“PVC effector leader sequence” herein, means a polypeptide sequence which functions to direct the PVC effector into the interior, or the end (tip), of a PVC Needle Complex - as such, the leader sequence functions to package a PVC effector into a PVC Needle Complex.
  • the PVC Needle Complex can subsequently deliver (e.g. inject) the PVC effector into a target cell.
  • the PVC Needle Complex may be an assembled PVC Needle Complex.
  • the term“PVC Needle Complex” may refer to a fragment of a PVC Needle Complex (e.g. wherein the leader sequence contacts said fragment, and optionally the PVC Needle Complex assembles around the leader sequence-payload ‘effector fusion’).
  • a PVC leader sequence is typically present in the N-terminus (characterized by or encompassed within the first 50 amino acids) of a PVC effector or homologue thereof.
  • the invention embraces leader sequences of PVC effectors and PVC effector homologues, which may be found in regions other than the N-terminal region of such PVC effectors/ homologues (e.g. in the C-terminal region).
  • the leader sequence comprises (or consists essentially of) amino acid residues 1-50 of a PVC effector (e.g. PVC effector protein).
  • a PVC effector e.g. PVC effector protein
  • Reference to“amino acid residues 1-50” embraces“amino acid residues 2-50”, wherein the N-terminal methionine is omitted e.g. has been cleaved.
  • the leader sequence may be a fragment of the N-terminal 50 amino acids of a PVC effector (e.g. a fragment comprising or consisting essentially of £ 45, £ 35, £ 25, or £ 15 amino acids), with the proviso that the fragment is capable of packaging a payload into a PVC Needle Complex.
  • a leader sequence (e.g. isolated leader sequence) of the invention comprises (or consists essentially of) an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% sequence identity to one or more sequence selected from SEQ ID NO.: 47 - SEQ ID NO.: 92 (preferably SEQ ID NO.: 50, SEQ ID NO.: 68, SEQ ID NO.: 71 , SEQ ID NO.: 76, SEQ ID NO.: 78, or SEQ ID NO.: 92) - e.g. with the proviso that the leader sequence is capable of packaging a payload into a PVC Needle Complex.
  • SEQ ID NO.: 47 - SEQ ID NO.: 92 preferably SEQ ID NO.: 50, SEQ ID NO.: 68, SEQ ID NO.: 71 , SEQ ID NO.: 76, SEQ ID NO.: 78, or SEQ ID NO.: 92
  • a leader sequence comprises (or consists essentially of) an amino acid sequence having at least 60% sequence identity to one or more sequence selected from SEQ ID NO.: 47 - SEQ ID NO.: 92 (preferably SEQ ID NO.: 50, SEQ ID NO.: 68, SEQ ID NO.: 71 , SEQ ID NO.: 76, SEQ ID NO.: 78, or SEQ ID NO.: 92) - e.g. with the proviso that the leader sequence is capable of packaging a payload into a PVC Needle Complex.
  • a leader sequence comprises (or consists essentially of) an amino acid sequence of one or more selected from SEQ ID NO.: 47 - SEQ ID NO.: 92 (preferably SEQ ID NO.: 50, SEQ ID NO.: 68, SEQ ID NO.: 71 , SEQ ID NO.: 76, SEQ ID NO.: 78, or SEQ ID NO.: 92).
  • a leader sequence comprises (or consists essentially of) an amino acid sequence selected from SEQ ID NO.: 47 - SEQ ID NO.: 92 (preferably SEQ ID NO.: 50, SEQ ID NO.: 68, SEQ ID NO.: 71 , SEQ ID NO.: 76, SEQ ID NO.: 78, or SEQ ID NO.: 92).
  • a leader sequence comprises (or consists essentially of) an amino acid sequence selected from SEQ ID NO.: 50, SEQ ID NO.: 68, SEQ ID NO.: 71 , SEQ ID NO.: 76, SEQ ID NO.: 78, and SEQ ID NO.: 92.
  • the leader sequence comprises (or consists essentially of) an amino acid sequence of SEQ ID NO.: 50. In one embodiment, the leader sequence comprises (or consists essentially of) an amino acid sequence of SEQ ID NO.: 68. In one embodiment, the leader sequence comprises (or consists essentially of) an amino acid sequence of SEQ ID NO.: 71. In one embodiment, the leader sequence comprises (or consists essentially of) an amino acid sequence of SEQ ID NO.: 76. In one embodiment, the leader sequence comprises (or consists essentially of) an amino acid sequence of SEQ ID NO.: 78. In one embodiment, the leader sequence comprises (or consists essentially of) an amino acid sequence of SEQ ID NO.: 92.
  • leader sequences share a “chemical composition consensus”, based on amino acid properties. More particularly, the leader sequences comprise similar charge patterns, the pattern comprising 2x negatively charged regions, each followed by a positively charged region (e.g. [-ve] [+ve] [-ve] [+ve]) - see Figure 9. This is consistent with leader sequences of toxins of the type 2 secretion system, which comprise a charge / property pattern of [+ve] [Hydrophobic] [+ve] [C]. A further theory posits that the leader sequences share a typical“helix-turn-helix” structure. Another theory is that the leader sequences form a structure recognised by an ATPase enzyme (e.g.
  • PVC effector (used synonymously with the term“PVC operon-encoded effector”, and“PVC effector protein”) means an effector polypeptide encoded by a Photorhabdus PVC operon, more particularly (and typically) found shortly downstream (3’) of the structural genes of said operon (preferably shortly or immediately downstream of pvc16 , and typically within 5kb).
  • PVC effector preferably embraces homologues thereof.
  • the leader sequence may also be from a polypeptide encoded by a gene which is a homologue of gene encoding a PVC effector - see Table 1 for examples of such homologues.
  • identification of PVC effectors is aided by detecting homology of a gene downstream of pvd 6 with a known toxin polypeptide (e.g. a gene which encodes said toxin polypeptide).
  • the term“homologue” preferably means a gene that descended from the same ancestral gene, and shares similar function - such gene (or polypeptide encoded thereby) is homologous to a gene encoding the PVC effector.
  • a homologue may be from the genome of a Photorhabdus species or from a species other than a Photorhabdus species. Examples of suitable homologues are outlined in Table 1.
  • the present inventors have elucidated and characterised, in detail, genes that encode PVC effectors of these PVC Needle Complexes in the three most common (best characterised) strains of Photorhabdus, as well as the P. asymbiotica Thai strain PB68.1. This was conducted based on analysing proximity of genetic linkage to the 3’ end of the PVC structural genes of the operons, and predicted function of the protein sequence of the effector (e.g. a homologue of a known effector/ toxin protein).
  • the PVC effectors e.g. genes encoding the PVC effectors
  • ORF open reading frames
  • homologues as outlined in Table 1), and being typically present within a distance of 1 kilobase to 5 kilobase (kb) (e.g. within 1 kb) downstream of the final structural gene of a PVC operon (e.g. pvc16) (typically with few or no intervening genes).
  • a PVC operon e.g. pvc16
  • these other genes are not assigned as PVC effectors (due to lack of homology to a known effector/ toxin gene, as described above).
  • Putative PVC effector gene e.g. ORF within a distance of 5kb, for example within 1 kb downstream of the final structural gene of a PVC operon
  • BlastP and HHPRED https://toolkit.tuebingen.mpg. de/#/tools/hhpred.
  • Putative PVC effector genes were assigned as PVC effector genes based on direct homology to known toxin encoding genes, similarity to a toxin protein family, proximity to the PVC operon (e.g. within 1-5kb downstream of the final structural gene of a PVC operon, pvc16) and/or based on domain similarities of predicted secondary structures to that of known toxins.
  • a PVC effector may be identified (within a Photorhabdus genome) by (i) identifying pvc16 (e.g. via sequence homology to a known pvc16), (ii) identifying an ORF 3’ to pvc16, preferably £5kb downstream of pvc16), and (iii) confirming said ORF encodes a PVC effector through identification of sequence homology to a known gene encoding a toxin polypeptide (for example, a toxin protein described in the column of Table 1 labelled “Homologue(s)”).
  • a toxin polypeptide for example, a toxin protein described in the column of Table 1 labelled “Homologue(s)”.
  • the PVC effector gene PAU_03337 (referred to herein as“sepC” due to homology to virulent sep genes) is positioned 325 base pairs (bp) downstream of pvc16 (PAU_03338) of the PVC operon referred to herein as PVCpnf (e.g. of SEQ ID NO. 93), which is found in P. asymbiotica ATCC43949. That is, the start codon of PAU_03337 begins 325 bp downstream of the end of the stop codon of PAU_03338.
  • effector gene PAU_03337 is annotated as being positioned in the genome as follows: complement (3913237..3914247) - that is, at nucleotide positions 3913237..3914247; and PAU_03338 is annotated as being positioned in the genome as follows: complement (3914573..3915454). No other ORF (encoding an effector or otherwise) is found between these two genes.
  • PVCpnf e.g. of SEQ ID NO. 93
  • PAU_03332 referred to herein as “pnf’
  • the PVC effector gene PAU_02095 (referred to herein as“Rhs-iike toxin effector” due to homology to virulent Rhs toxin genes) is positioned 3961 bp downstream of pvc16 (PAU_02099) of a PVC operon referred to herein as PVC lopT (e.g. of SEQ ID NO. 94), which is found in P. asymbiotica ATCC43949. That is, the start codon of PAU_02095 begins 3961 bp downstream of the end of the stop codon of PAU_02099.
  • the PVC effector of gene PAU_02009 (referred to as“cif” herein due to predicted function as a cell cycle inhibiting factor/ ATP/GTP binding protein) is positioned 157bp downstream of pvc16 (PAU_02008) of the associated PVC operon, referred to herein as PVC c/7, found in P. asymbiotica ATCC43949.
  • PVC effector gene “pvc17” (e.g.“plu165T’) is positioned 104bp downstream of pvc16 (gene“piu1655’) ⁇ and with regard to a PVC operon of Photorhabdus temperata subsp. temperata Meg1 referred to as a PVCc/7 operon herein, PVC effector gene “CIF toxin effector” (e.g. MEG1 DRAFT_03529) is positioned 4216bp downstream of the relevant pvc16 gene.
  • CEF toxin effector e.g. MEG1 DRAFT_03529
  • a gene encoding a PVC effector is typically positioned within a distance of £ 5 kb downstream of the final gene of a PVC operon (e.g. of pvc16), more typically within a distance of £ 1 kb downstream of the final gene of a PVC operon.
  • a PVC operon e.g. of pvc16
  • a PVC effector (as translated) comprises at least two principle domains: the leader sequence (amino acids 1 to 50) and the actual effector polypeptide (amino acids 51 to C-terminal amino acid) - the latter of which may be referred to as the“effector” (e.g.“effector portion”) or “payload” herein.
  • accession numbers provided in Table 1 are provided for exemplary purposes, providing example amino acid sequences of (or having high similarity to) PVC effectors described herein.
  • the sequences of said accession numbers may be accessed through GenBank (https://www.ncbi.nlm.nih.gov/genbank/).
  • the locus tag (beginning with“PAU” or“Plu”) corresponds to the locus tag assigned to the effector in genome sequences available through GenBank above. Locus tags beginning with “PAT” (referring to strain P. asymbiotica Thai strain PB68.1) and“PAK” (referring to strain P. asymbiotica Kingscliff) have been assigned by the present inventors upon identification of the PVC effector genes within the genomes of said strains (in a consistent manner with the locus tags of publicly available sequences). This locus tags may be used herein to refer to the corresponding PVC effector polypeptide.
  • the PVC effector is encoded by one or more gene (with the SEQ ID NO. of the encoded PVC effector protein in parentheses) selected from PAK_1985 (SEQ ID NO: 1), PAK_1987 (SEQ ID NO: 2), PAK_1988 (SEQ ID NO: 3), PAK_2075 (SEQ ID NO: 4), PAK_2077 (SEQ ID NO: 5), PAK_2892 (SEQ ID NO: 6), PAK_2893 (SEQ ID NO: 7), PAK_2894 (SEQ ID NO: 8), PAK_3525 (SEQ ID NO: 9), PAT_00148 (SEQ ID NO: 10), PAT_00149 (SEQ ID NO: 11), PAT_00150 (SEQ ID NO: 12), PAT_00152 (SEQ ID NO: 13),
  • PAT_02308 (SEQ ID NO: 14), PAT_02309 (SEQ ID NO: 15), PAT_02310 (SEQ ID NO: 16),
  • PAT_02956 (SEQ ID NO: 17), PAT_02957 (SEQ ID NO: 18), PAT_03171 (SEQ ID NO: 19),
  • PAT_03172 SEQ ID NO: 20
  • PAT_03177 SEQ ID NO: 21
  • PAU_02009 SEQ ID NO: 22
  • PAU_02010 SEQ ID NO: 23
  • PAU_02095 SEQ ID NO: 24
  • PAU_02096 SEQ ID NO: 25
  • PAU_02097 (SEQ ID NO: 26), PAU_02098 (SEQ ID NO: 27), PAU_02230 (SEQ ID NO: 28),
  • PAU_02805 (SEQ ID NO: 29), PAU_02806 (SEQ ID NO: 30), PAU_02807 (SEQ ID NO: 31),
  • PAU_03332 (SEQ ID NO: 32), PAU_03337 (SEQ ID NO: 33), Plu1651 (SEQ ID NO: 34), Plu1671 (SEQ ID NO: 35), Plu1672 (SEQ ID NO: 36), Plu1690 (SEQ ID NO: 37), Plu1691 (SEQ ID NO: 38), Plu1712 (SEQ ID NO: 39), Plu1713 (SEQ ID NO: 40), Plu1714 (SEQ ID NO: 41), Plu2400 (SEQ ID NO: 42), Plu2401 (SEQ ID NO: 43), Plu2514 (SEQ ID NO: 44), Plu2515 (SEQ ID NO: 45), Plu1649 (SEQ ID NO: 46), or a combination thereof.
  • the PVC effector is encoded by one or more gene (with the SEQ ID NO. of the encoded PVC effector protein in parentheses) selected from PAU_02009 (SEQ ID NO: 22), PAU_02010 (SEQ ID NO: 23), PAU_02095 (SEQ ID NO: 24), PAU_02096 (SEQ ID NO:
  • PAU_02805 SEQ ID NO: 29
  • PAU_02806 SEQ ID NO: 30
  • PAU_02807 SEQ ID NO:
  • the PVC effector may be encoded by one or more gene listed above.
  • the PVC effector is encoded by one or more gene (with the SEQ ID NO. of the encoded PVC effector in parentheses) selected from PAK_02075 (SEQ ID NO: 4), PAU_02009 (SEQ ID NO: 22), PAU_02096 (SEQ ID NO: 25), PAU_02806 (SEQ ID NO: 30), PAU_03332 (SEQ ID NO: 32), Plu1651 (SEQ ID NO: 34), Plu1649 (SEQ ID NO: 46), or a combination thereof.
  • one or more gene selected from PAK_02075 (SEQ ID NO: 4), PAU_02009 (SEQ ID NO: 22), PAU_02096 (SEQ ID NO: 25), PAU_02806 (SEQ ID NO: 30), PAU_03332 (SEQ ID NO: 32), Plu1651 (SEQ ID NO: 34), Plu1649 (SEQ ID NO: 46), or a combination thereof.
  • the PVC effector is encoded by one or more gene (with the SEQ ID NO. of the encoded PVC effector in parentheses) selected from PAU_02806 (SEQ ID NO: 30), PAU_03332 (SEQ ID NO: 32), Plu1651 (SEQ ID NO: 34), Plu1649 (SEQ ID NO: 46), or a combination thereof.
  • the PVC effector may have a sequence having at least 80% sequence identity (preferably at least 90% sequence identity; more preferably 100% sequence identity) to an amino acid sequence selected from SEQ ID NO: 1 - SEQ ID NO: 46.
  • the PVC effector may have a sequence having at least 80% sequence identity (preferably at least 90% sequence identity; more preferably 100% sequence identity) to an amino acid sequence selected from SEQ ID NO: 22 - SEQ ID NO: 46.
  • the present inventors have identified the leader sequences of the gogB1 (PAU_02806) and Pnf (PAU_03332) PVC effectors as being particularly efficient at packaging a (fused) payload into a PVC Needle Complex.
  • the PVC effector is encoded by PAU_02806 (e.g. has an amino acid sequence of SEQ ID NO: 30).
  • the PVC effector is encoded by PAU_03332 (e.g. has an amino acid sequence of SEQ ID NO: 32).
  • the PVC effector comprises (or consists essentially of) an amino acid sequence of one or more selected from SEQ ID NO: 1 - SEQ ID NO: 46 (for example SEQ ID NO: 22 - SEQ ID NO: 46), or a combination thereof.
  • the PVC effector may comprise (or consist essentially of) a sequence selected from SEQ ID NO: 4, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 46.
  • the PVC effector comprises (or consists essentially of) an amino acid sequence of SEQ ID NO.: 4. In one embodiment, the PVC effector comprises (or consists essentially of) an amino acid sequence of SEQ ID NO. 22. In one embodiment, the PVC effector comprises (or consists essentially of) an amino acid sequence of SEQ ID NO. 25. In one embodiment, the PVC effector comprises (or consists essentially of) an amino acid sequence of SEQ ID NO: 30. In one embodiment, the PVC effector comprises (or consists essentially of) an amino acid sequence of SEQ ID NO: 32. In one embodiment, the PVC effector comprises (or consists essentially of) an amino acid sequence of SEQ ID NO. 46.
  • the term“packaging” means the directing of a payload, by a leader sequence of the invention (to which the payload is linked/ fused), into the interior, or end (tip), of an assembled PVC Needle Complex, such that the PVC Needle Complex is subsequently configured for delivering (e.g. injecting) the payload into a target cell.
  • the payload may be packaged within a PVC Needle Complex, or may be packaged at the end (or tip) of the PVC Needle Complex (e.g. at least a portion of the payload may be external to the PVC Needle Complex).
  • payload means a molecule which is packaged into the interior, or end (tip), of an assembled PVC Needle Complex, and subsequently delivered (e.g. injected) into a (target) cell.
  • the payload is a PVC effector (more particularly, the effector portion of said PVC effector), encoded (as described above) by a gene that is downstream to (3’ to) the structural genes of a PVC operon.
  • PVC effector more particularly, the effector portion of said PVC effector
  • PAU_03337 listed as PVCpnf 17
  • an adenylate cyclase effector e.g.
  • PAU_03332 (listed as PVCpnf 21), encoding a Pnf effector (e.g. SEQ ID NO.: 32).
  • a leader sequence and a payload of the present invention form an“effector fusion” (or simply “fusion”) that is“distinct from a (e.g. wild-type) PVC effector” (e.g. a polypeptide encoded by one of the genes outlined in Table 1).
  • the effector fusion may be a chimaera, formed of a leader sequence from a first PVC effector fused to (an/the effector portion of) a second (different) PVC effector (preferably amino acids 51 to the C-terminal amino acid of said second PVC effector), wherein said first PVC effector and said second PVC effector are different.
  • the effector fusion may be a chimaera, comprising (or consisting essentially of) a leader sequence described herein fused to a non-PVC effector polypeptide.
  • the effector fusion may be a chimaera, comprising (or consisting essentially of) a leader sequence described herein fused to a non -Photorhabdus polypeptide.
  • the effector fusion may be a leader sequence-nucleic acid fusion (preferably conjugate), comprising a leader sequence described herein fused to a nucleic acid.
  • effector fusion is not limited to a fusion complex comprising a leader sequence fused to a toxic payload (e.g. the leader could be fused to a therapeutic payload).
  • effector as used in the context of “effector fusion” means the payload which is packaged into the PVC Needle Complex (which could provide a variety of effects, including toxigenic and/or therapeutic effects).
  • effector fusion may be used interchangeably with the term“fusion” herein.
  • effector fusion may be used synonymously with the term “leader sequence- payload fusion”, and/or“leader sequence-payload complex”.
  • the payload may be distinct from a PVC effector protein (e.g. distinct from amino acids 51 to the C-terminal amino acid of a PVC effector).
  • the payload may be a polypeptide or nucleic acid that is not found in a wild-type Photorhabdus bacterium.
  • the payload may be one or more selected from a polypeptide (e.g. a polypeptide payload), a nucleic acid (e.g. a nucleic acid payload), or a combination thereof.
  • a polypeptide e.g. a polypeptide payload
  • a nucleic acid e.g. a nucleic acid payload
  • the payload is a polypeptide.
  • polypeptide payloads examples include an antibody (e.g. an anti-MDM antibody), a nanobody, a peptide vaccine (e.g. a tyrosinase-related protein 2 (TRP2) peptide vaccine), a nuclear factor-kB inhibitor, a T3SS payload (e.g. a T3SS payload which inhibits the NF-kB and/or MAPK pathways), an anti-apoptotic peptide (e.g.
  • an antibody e.g. an anti-MDM antibody
  • a nanobody e vaccine
  • a peptide vaccine e.g. a tyrosinase-related protein 2 (TRP2) peptide vaccine
  • TRP2 tyrosinase-related protein 2
  • T3SS payload e.g. a T3SS payload which inhibits the NF-kB and/or MAPK pathways
  • an anti-apoptotic peptide e.g.
  • nucleic acid-modifying enzymes include a recombinase (e.g. Cre recombinase), a transposase, a Cas enzyme (e.g. Cas9), and/or a Mad7 (preferably Mad7, more preferably Cre recombinase).
  • the payload may be, for example, tBid (SEQ ID NO.: 109) and/or BaxBH3 peptide (aa59-73) (SEQ ID NO.: 111).
  • Any polypeptide having enzymatic activity may be a payload.
  • a nucleic acid payload may be conjugated/ crosslinked to a leader sequence of the invention.
  • copper-free click chemistry e.g. strain-promoted alkyne azide cycloaddition (SPAAC)
  • SPAAC strain-promoted alkyne azide cycloaddition
  • nucleic acid payloads include a primer, an mRNA, a nucleic acid analogue, an aptamer, a small interfering RNA (siRNA), a microRNA therapeutic inhibitor (antimiR), a microRNA therapeutic mimic (promiR), a long non-coding RNA modulator, a single guide RNA (sgRNA), or a combination thereof.
  • the leader sequence may be fused directly or indirectly (e.g. by means of a spacer) to the payload.
  • the leader sequence may be fused covalently or non-covalently to the payload.
  • the leader sequence is covalently fused to the payload.
  • the fusion/ effector fusion may be a (recombinant) fusion protein comprising (or consisting essentially of) a PVC effector leader sequence fused to a (polypeptide) payload.
  • Another aspect of the invention provides an isolated nucleic acid comprising a nucleotide sequence which encodes a PVC effector leader sequence of the invention.
  • Another aspect of the invention provides an isolated nucleic acid comprising a nucleotide sequence which encodes an effector fusion (e.g. fusion) of the invention, and optionally a nucleotide sequence which encodes a PVC Needle Complex.
  • Another aspect of the invention provides an expression vector comprising: a nucleic acid (preferably an isolated nucleic acid) comprising a nucleotide sequence which encodes a PVC effector leader sequence of the invention.
  • a nucleic acid preferably an isolated nucleic acid
  • a nucleotide sequence which encodes an effector fusion e.g. fusion
  • optionally a nucleotide sequence which encodes a PVC Needle Complex optionally a nucleotide sequence which encodes a PVC Needle Complex.
  • Another aspect of the invention provides a host cell comprising an isolated nucleic acid, the isolated nucleic acid comprising a nucleotide sequence which encodes a PVC effector leader sequence of the invention.
  • Another aspect of the invention provides a host cell comprising an isolated nucleic acid, the isolated nucleic acid comprising a nucleotide sequence which encodes an effector fusion (e.g. fusion) of the invention, and optionally a nucleotide sequence which encodes a PVC Needle Complex.
  • nucleic acid may be used synonymously with the term“polynucleotide”.
  • Another aspect of the invention provides a host cell comprising an expression vector, the expression vector comprising a nucleotide sequence which encodes a PVC effector leader sequence of the invention.
  • Another aspect of the invention provides a host cell comprising an expression vector, the expression vector comprising a nucleotide sequence which encodes an effector fusion (e.g. fusion) of the invention, and optionally a nucleotide sequence which encodes a PVC Needle Complex.
  • Said host cell may be a mammalian cell, an insect cell, a yeast cell, a bacterial cell (e.g. E. coli), or a plant cell.
  • the host cell is a bacterial cell (preferably E. coli).
  • the host cell is a Photorhabdus cell, optionally wherein the Photorhabdus cell comprises a PVC operon operably linked to an inducible promoter (e.g. see Example 3).
  • the PVC operon may be endogenous to the Photorhabdus cell (e.g. the PVC operon may be PVCu4).
  • the Photorhabdus cell may be obtainable from the ATCC under accession no. ATCC 29999.
  • sequences e.g. leader sequence and/or nucleic acid sequence
  • sequences include sequences that have been removed from their naturally occurring environment, recombinant or cloned (e.g. DNA) isolates, and chemically synthesized analogues or analogues biologically synthesized by heterologous systems.
  • the leader sequence(s) and/or polynucleotide(s) of the present invention may be prepared by any means known in the art.
  • large amounts of the leader sequence(s) and/or polynucleotide(s) may be produced by replication and/or expression in a suitable host cell.
  • the natural or synthetic DNA fragments coding for a desired fragment will typically be incorporated into recombinant nucleic acid constructs, typically DNA constructs, capable of introduction into and replication in a prokaryotic or eukaryotic cell.
  • DNA constructs will be suitable for autonomous replication in a unicellular host, such as yeast or bacteria, but may also be intended for introduction to and integration within the genome of a cultured bacterial, insect, mammalian, plant or other eukaryotic cell lines.
  • the leader sequence(s) and/or polynucleotide(s) of the present invention may also be produced by chemical synthesis, e.g. a polynucleotide by the phosphoramidite method or the tri-ester method, and may be performed on commercial automated oligonucleotide synthesizers.
  • a double-stranded (e.g. DNA) fragment may be obtained from the single stranded product of chemical synthesis either by synthesizing the complementary strand and annealing the strand together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.
  • the term“isolated” in the context of the present invention denotes that the leader sequence and/or polynucleotide sequence has been removed from its natural genetic milieu and is thus free of other extraneous or unwanted coding sequences (but may include naturally occurring 5' and 3' untranslated regions such as promoters and terminators), and is in a form suitable for use within genetically engineered protein production systems.
  • isolated molecules are those that are separated from their natural environment.
  • sequence alignment methods can be used to determine percent identity, including, without limitation, global methods, local methods and hybrid methods, such as, e.g., segment approach methods. Protocols to determine percent identity are routine procedures within the scope of one skilled in the art. Global methods align sequences from the beginning to the end of the molecule and determine the best alignment by adding up scores of individual residue pairs and by imposing gap penalties. Non-limiting methods include, e.g., CLUSTAL W, see, e.g., Julie D.
  • Non-limiting methods include, e.g., Match-box, see, e.g., Eric Depiereux and Ernest Feytmans, Match-Box: A Fundamentally New Algorithm for the Simultaneous Alignment of Several Protein Sequences, 8(5) CABIOS 501 -509 (1992); Gibbs sampling, see, e.g., C. E.
  • percent sequence identity is determined by conventional methods. See, for example, Altschul et al., Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-19, 1992. Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1 , and the "blosum 62" scoring matrix of Henikoff and Henikoff (ibid.) as shown below (amino acids are indicated by the standard one-letter codes).
  • the "percent sequence identity" between two or more nucleic acid or amino acid sequences is a function of the number of identical positions shared by the sequences. Thus, % identity may be calculated as the number of identical nucleotides / amino acids divided by the total number of nucleotides / amino acids, multiplied by 100. Calculations of % sequence identity may also take into account the number of gaps, and the length of each gap that needs to be introduced to optimize alignment of two or more sequences. Sequence comparisons and the determination of percent identity between two or more sequences can be carried out using specific mathematical algorithms, such as BLAST, which will be familiar to a skilled person. ALIGNMENT SCORES FOR DETERMINING SEQUENCE IDENTITY
  • Substantially homologous polypeptides are characterized as having one or more amino acid substitutions, deletions or additions. These changes are preferably of a minor nature, that is conservative amino acid substitutions (see below) and other substitutions that do not significantly affect the folding or activity of the polypeptide; small deletions, typically of one to about 30 amino acids; and small amino- or carboxyl-terminal extensions, such as an amino- terminal methionine residue, a small linker peptide of up to about 20-25 residues, or an affinity tag.
  • Acidic glutamic acid, aspartic acid
  • Aromatic phenylalanine, tryptophan, tyrosine
  • non-standard amino acids such as 4- hydroxyproline, 6-N-methyl lysine, 2-aminoisobutyric acid, isovaline and a -methyl serine
  • a limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, and unnatural amino acids may be substituted for polypeptide amino acid residues.
  • the polypeptides of the present invention can also comprise non-naturally occurring amino acid residues.
  • Non-naturally occurring amino acids include, without limitation, trans-3-methylproline, 2,4- methano-proline, cis-4-hydroxyproline, trans-4-hydroxy-proline, N-methylglycine, allo- threonine, methyl-threonine, hydroxy-ethylcysteine, hydroxyethylhomo-cysteine, nitro- glutamine, homoglutamine, pipecolic acid, tert-leucine, norvaline, 2-azaphenylalanine, 3- azaphenyl-alanine, 4-azaphenyl-alanine, and 4-fluorophenylalanine.
  • Several methods are known in the art for incorporating non-naturally occurring amino acid residues into proteins.
  • an in vitro system can be employed wherein nonsense mutations are suppressed using chemically aminoacylated suppressor tRNAs.
  • Methods for synthesizing amino acids and aminoacylating tRNA are known in the art. Transcription and translation of plasmids containing nonsense mutations is carried out in a cell free system comprising an E. coli S30 extract and commercially available enzymes and other reagents. Proteins are purified by chromatography. See, for example, Robertson et al. , J. Am. Chem. Soc. 113:2722, 1991 ; Ellman et al., Methods Enzymol.
  • coli cells are cultured in the absence of a natural amino acid that is to be replaced (e.g., phenylalanine) and in the presence of the desired non-naturally occurring amino acid(s) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine).
  • the non-naturally occurring amino acid is incorporated into the polypeptide in place of its natural counterpart. See, Koide et al., Biochem. 33:7470-6, 1994.
  • Naturally occurring amino acid residues can be converted to non-naturally occurring species by in vitro chemical modification. Chemical modification can be combined with site-directed mutagenesis to further expand the range of substitutions (Wynn and Richards, Protein Sci. 2:395-403, 1993).
  • a limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, non-naturally occurring amino acids, and unnatural amino acids may be substituted for amino acid residues of polypeptides of the present invention.
  • Essential amino acids in the polypeptides of the present invention can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-5, 1989). Sites of biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., Science 255:306-12, 1992; Smith et al., J. Mol. Biol. 224:899-904, 1992; Wlodaver et al., FEBS Lett. 309:59-64, 1992. The identities of essential amino acids can also be inferred from analysis of homologies with related components (e.g. the translocation or protease components) of the polypeptides of the present invention.
  • related components e.g. the translocation or protea
  • amino acids are referred to herein using the name of the amino acid, the three letter abbreviation or the single letter abbreviation.
  • the term“protein”, as used herein, includes proteins, polypeptides, and peptides.
  • the term“amino acid sequence” is synonymous with the term“polypeptide” and/or the term“protein”.
  • the term“amino acid sequence” is synonymous with the term“peptide”.
  • the term“amino acid sequence” is synonymous with the term“enzyme”.
  • the terms "protein” and "polypeptide” are used interchangeably herein. In the present disclosure and claims, the conventional one-letter and three-letter codes for amino acid residues may be used.
  • JCBN Joint Commission on Biochemical Nomenclature
  • Figure 1 shows (A) a schematic representation of one PVC operon layout (gene clusters present in varying regions of the originating genome) encoding a PVC Needle Complex.
  • B A schematic representation of Class I, II and III PVC operon layouts. Homologous subunit types amongst the classes are show as having similar shading (in grey scale).
  • C An illustration of an assembled PVC Needle Complex. The numbering shown is used to correlate a gene cluster in (A) with the position of the encoded proteins in the structure in (C) (e.g. the cap ⁇ 6’ cluster in A is shown as ⁇ 6’ in the left-most cap region of (B)).
  • FIG. 2 A map of the model Class I PaATCC 43949 PVCpnf operon (e.g. encoded by SEQ ID NO.: 93), showing two effector genes in the payload region (Rhs-like adenylate cyclase, and PAU_03332).
  • Figure 2 shows an overview of a cloning procedure for preparation of PVC Needle Complex expressing plasmids, based on overlapping PCR. PCR fragments (having overlapping regions) are provided from template gDNA of P. asymP/of/ca ATCC43949 (available from the ATCC under accession no. ATCC 43949) with relevant primers targeting the PVC operon.
  • Figure 3 shows a transmission electron micrograph of an (in vitro) sample of PVC Needle Complexes (e.g. prepared from cells having the expression vector described above).
  • the PVC Needle Complexes assemble in a distinct‘nanosyringe’ structure, consistent with its role as a contractile structure.
  • a 3D rendered model of a PVC Needle Complex as derived from high resolution single particle cryo-EM tomography structure is shown in (B).
  • FIG. 4 shows (A) a transmission electron micrograph of a PVC Needle Complex comprising a Pnf payload following immuno-gold staining with an anti-Pnf (immunogold) antibody, confirming the Pnf-payload toxin is associated with the PVC Needle Complex (referred to as PVC pnf).
  • PVCpnf Needle Complexes were prepared from supernatants of an E. coli cosmid clone, which encodes the PVCpnf operon.
  • Anti-peptide antibodies against the Pnf (TGQKPGNNEWKTGR, SEQ ID NO: 96) epitope were used to localise the payload toxin protein.
  • FIG. 5 shows cryo-SEM image of ex vivo hemocytes (insect macrophage/neutrophil equivalents) from 5th instar Manduca sexta that had been injected with a native (A) or heat inactivated (B) enriched preparation of PaATcc43949 pvc pnf Needle Complexes (nanosyringes) heterologously produced by an E. coli cosmid clone.
  • Scale bar 50pm. 25kV; magnification 40 K (A) and 50K (B).
  • Figure 6 shows experimental results demonstrating the (toxic) cellular phenotype following contact with a PVC Needle Complex is due to intracellular toxin delivery.
  • a Pnf loaded PVC Needle Complex was injected into insects ( Galleria mellonella insect larvae), showing potent activity within 15 minutes for the given dose (explained in the examples) - note mortality/morbidity is typically associated with the“melanisation” immune response in these dead/dying insects.
  • a control, denatured (via boiling) Pnf loaded PVC Needle Complex injected into animals showed no activity.
  • C Purified Pnf (payload), absent the PVC Needle Complex (i.e.
  • Pnf not packaged into the complex showed no activity against either animals (left) or a HeLa cell line (right).
  • D Pnf (payload) delivered into the cytosol of HeLa cells - via ‘BioPorter’ liposomal preparations containing the protein, or by intracellular expression following transfection with an appropriate plasmid
  • E showed potent activity/toxicity, as evidenced by multi-nucleation in the cells.
  • F The effect of PVCpnf+Pnf on the respiration rate of THP1 derived human macrophages as measured by Resazurin plate reader assay. Note the heat denatured and empty PVCpnf nanosyringes showed no strong adverse effect. These same samples were tested by injection into Galleria larvae. The PVCpnZ+Pnf samples showed over around 50% mortality within minutes (darkened larvae in the bottom two panels) while the heat denatured and empty PVCpnf injected insects all remained healthy (no darkened larvae in the top two panels).
  • Figure 7 shows (in silico ) predicted secondary structures of a range of the endogenous payload (toxin) associated with various PVC operons, demonstrating the large variety of structure types.
  • B The amino acid length of various payloads (toxins) plotted against predicted isoelectric point.
  • Figure 8 shows confirmation that leader sequences (e.g. having 50 amino acids) of the invention are necessary and sufficient for (trans-)packaging payload proteins/peptides into PVC Needle Complexes (nanosyringes) expressed in Photorhabdus.
  • A 1-6: Schematic maps of chimeric effector protein expression constructs (trans-expressed in the arabinose- inducible pBAD30 vector), including those expressing Pnf and non-native cre-recombinase and Myc-tags. C-terminal Myc-tag epitopes are shown as black arrows.
  • B Western blots using anti-Myc mouse antibody.
  • Samples are from purified PVC(u4) Needle Complexes (nanosyringes) overexpressed from chromosomally engineered P. luminescens TT01 which harbour the trans-packaging expression constructs 1-6 shown in (A).
  • a blank pBAD30 plasmid was used as a negative control and showed no signal. Arrows show correct band sizes for expected products.
  • Figure 9 shows an alignment of the leader sequences, demonstrating the presence of a chemical composition consensus amongst the leader sequences, based on amino acid properties. More particularly, the leader sequences comprise similar charge patterns, of 2x negatively charged regions, each followed by a positively charged region [-ve] [+ve] [-ve] [+ve].
  • Figure 10 shows (A) western blot analysis of PVC Needle Complexes and payloads from particulate preparations (Cesium Chloride gradient and Monolith FPLC preparations, as described in Materials and Methods).
  • pBADPVCpnf in which PVC16 of the nanosyringe is FLAG-tagged providing PVC16::FLAG detectable with AntiFLAG Ab
  • a signal from the tagged cap protein of“PVCPnf” PVC Needle Complex with a Pnf payload
  • (C) provides further proof via Western blot analysis of (trans-)packaging of the Cre recombinase into purified PVC pnf expressed in E. coli.
  • the Western blot demonstrates that for a given amount of Anti-FLAG antibody Western signal (a specific probe for the nanosyringe due the incorporation of PVC16::FLAG), a much higher amount of the Cre payload is detected (using the Anti-Myc tag antibody).
  • the numbers denote 2-fold dilutions. Note, upon dilution, the anti- FLAG signal from the nanosyringe is lost, while the payload remains intense in most lanes.
  • CsCI denotes purification by Caesium Chloride density gradient centrifugation.
  • FIG. 11 shows western blot analysis of PVC Needle Complexes expressed without (1) and with (2) concomitant expression of (Myc-tagged) Pnf from a separate plasmid, probed simultaneously with an anti-FLAG and anti-Myc antibody.
  • the PVC Needle Complex (nanosyringe) was expressed and purified without the presence of a ‘payload plasmid’ (an expression plasmid encoding a payload protein linked to a leader sequence) within E. coli.
  • Figure 12 shows western blot analysis of trans-packing experiments in P. luminescens TT01 PVCu4 over-expression strain. Results demonstrate the trans-packaging of a myc-tagged Pvc17 (Plu1651whole::Myc).
  • Figure 13 shows further western blot analysis of trans-packaging experiments in P. luminescens TT01 PVCunit4 over-expression strain (as explained in the Examples). Results demonstrate trans-packing of Myc-tagged Pvc17 (Plu 1651 :: Myc) and a Myc tag alone using the leader of Pnf (PAU_03332 leader), and that the leader is necessary.
  • Lane 1 shows packaging of the leader of fused to a Myc-tag (PAU_03332::Myc); Lane 3 shows a lack of packaging when the leader sequence is absent (Myc only is not packaged); lane 4 shows lack of packaging of HvnA (a natural effector) when the leader sequence is absent; lane 6 shows packaging of Myc-tagged PAU_03332:: Plu 1649, i.e. a chimaera of the leader from PAU_03332 (i.e. amino acids 1-50 of PAU_03332) and the effector (i.e. amino acids 51-C- terminus) from Plu1649.
  • Lane 1 shows packaging of Plu1651 with a C-terminal Myc tag using an anti-Myc antibody Western blot.
  • Figure 14 shows further Western blot analysis demonstrating the very high level of trans packaging of Myc-tagged Pnf (PAU_03332::Myc) using the PAU_02806 (GogB) leader (second lane, not including the ladder lane).
  • the first lane demonstrates use of the Plu1649 leader for packaging the PAU_03332 effector (Myc-tagged Plu1649::PAU_03332).
  • the band appears weak due to the relative intensity of the band in the second lane.
  • the experiment involved filter sterilisation of 50 mL culture, 8 M final concentration of urea added to break down PVCs. Samples collected from 10 mL supernatant.
  • Figure 15 shows further western blot analysis demonstrating trans-packaging of Plu 1651 (pvc17) with a C-terminal Myc tag as described in Figure 13 into PVCunit4 expressed from Photorhabdus .
  • Raw represents particulate preps from supernatants, Be, Be2 and IP represent different“cuts” from a Caesium chloride gradient purification.
  • Figure 16 (A) provides a diagrammatic explanation of the mechanism of action of Cre in the mouse organoid experiment (of Example 6), and how the positive control (TAM) facilitates Cre activation.
  • White arrows show the location of cells expressing the tdTom fluorescent reporter gene.
  • B Demonstration of delivery of active trans-packaged Cre-recombinase into murine bile duct organoids by PVC pnf expressed and purified from E. coli.
  • White circles show the location of groups of cells expressing the fluorescent reporter gene.
  • the upper images show a direct grey scale conversion of an images obtained via light microscopy.
  • the lower image shows a corresponding image with false-colour enhancement of positive cells, which is provided simply to aid identification of the difference between effected cells and surrounding unaffected ones within the former grey scale conversion.
  • Figure 17 shows a dot-blot analysis of nanosyringe expression both with a payload (the Cas9-like protein MAD7) and without.
  • Some leaky expression of the IPTG inducible MAD7 is seen before induction (T1) as is common with this expression system.
  • T1 the IPTG inducible MAD7
  • FLAG signal is robust in the MAD7 sample, and occurs as expected post-induction and persists post-purification, as this promoter system has reduced leaky expression. It is concluded that the nanosyringes and MAD7 are compatible with one another in terms of expression, and that MAD7, the largest protein tested to date, can be packaged in to the nanosyringe system.
  • Figure 18 shows western dot-blot analysis confirming trans-packaging of the pro-apoptotic tBid protein domain and BaxBH3 (both having the leader sequence of SEQ ID NO.: 78 fused to the N-term) peptide into purified PVCpnf expressed from E. coli ⁇ 7 & 8).
  • the nanosyringe with its cognate toxin“Pnf” is shown, as purified by 2 different methods (5 & 6) as a positive control.
  • the blots at the bottom of the panel represent the same examples as in 7 & 8 in the panels above. These blots were made from another purification of the same constructs, demonstrating reproducibility of purification.
  • This experiment demonstrated that“tBid protein domain and BaxBH3 peptide” packed samples (nanosyringes) can be successfully prepared, e.g. for used in the apoptosis delivery assays in Example 9.
  • Figure 19 shows TUNEL-stain microscopic analysis from cells exposed to the packaged nanosyringes for 20 minutes only.
  • First (left) bar DNase I treated cells (+ control);
  • Second bar no DNAse I or nanosyringe treatment (- control);
  • Third bar cells were exposed to nanosyringes packaged with tBid (via leader sequence of SEQ ID NO.: 78 fused to the N- term);
  • fourth (right) bar cells were exposed to nanosyringes packaged with Bax_BH3 domain (via leader sequence of SEQ ID NO.: 78 fused to the N-term).
  • PBMCs were treated with tBID, Bax loaded nanosyringes, and the positive (DNase I treated cells) and negative (no DNase I treatment) controls for 20 minutes at room temperature before performing TUNEL staining to determine an apoptotic response.
  • Cells negative for apoptotic response show blue or light brown staining. Blue staining (Methyl green) or light brown staining indicates healthy cells with absence of apoptotic signal. Dark brown staining indicates cells undergoing apoptosis.
  • Plasmids encoding PVC Needle Complexes were prepared using standard molecular techniques known in the art. Briefly, genomic DNA from P. asymb/of/ca ATCC43949 (obtainable from the ATCC under accession no. ATCC 43949) was used in PCR (with appropriate primers) to amplify multiple (e.g. four) overlapping regions of the PVC operon. Overlap/extension PCR was employed to prepare a whole operon, and fused (again using overlapping PCR) into an appropriate expression vector as detailed in Figure 1 (using the primers of SEQ ID NO: 101 - SEQ ID NO: 106).
  • the operons are typically operably linked to an inducible promoter (e.g. arabinose inducible, and/or IPTG inducible) as is known in the art.
  • an inducible promoter e.g. arabinose inducible, and/or IPTG inducible
  • This is generally achieved by cloning into pBAD family plasmids (inducible via arabinose) (Invitrogen, catalog number: V43001) and pVTRa (inducible via IPTG) (Biomedal, S.L.) vectors (although any combination of compatible expression vector systems should suffice).
  • a PVC Needle Complex can be expressed independently of the payload (toxin), and vice versa.
  • Separate expression vectors e.g. having differing inducible promoters
  • An overnight culture of the bacteria (transformed with PVC Needle Complex expression vector) is prepared by picking a colony from a plate and inoculating 100 mL of LB media. The culture is grown at 37°C with shaking.
  • the media may be routinely supplemented with 0.2% d-Glucose to aid repression of the genetic constructs for optimal cell health.
  • the media is also supplemented with the relevant antibiotics for maintenance of the expression (PVC Needle Complex) vector. If a payload vector is also being used, the relevant antibiotic for that vector is also supplied.
  • the media for the 1 L flask is identical to the overnight media but typically does not contain glucose.
  • 3- Cultures are grown to approximately mid-to-late exponential (an OD600nm of -0.8) at which point the plasmids are induced.
  • IPTG concentrations may typically be optimised on a per- protein basis, and a typical starting figure of 0.1 mM is preferable.
  • DNAse, and protease inhibitors can be added to the lysate.
  • 8- Cell debris is removed by centrifugation at 50,000xg, 4°C, for 20 minutes in a high speed centrifuge.
  • a subsequent process for purification via Caesium Chloride density gradient is as follows:
  • Balanced tubes are then subjected to ultracentrifugation at 35,000 RPM in an SW40Ti swinging bucket rotor, equivalent to 155,000 xg, for 2 hours, 4°C.
  • the correct gradient fraction will be the region just above a‘blue-ish-white’ halo that appears. Fractions are extracted via puncturing the tube with a syringe and needle.
  • PVC Needle Complexes of good purity can be obtained in this manner, and stored in buffer at 4°C. Suitably, dialyse back in to TM buffer to remote the CsCI.
  • PVCs can be extracted via Monolith anion exchange chromatography, as follows (note all steps can be performed manually with a peristaltic pump or syringe apparatus, or via F/HPLC):
  • PVC Needle Complexes are present in the elution fractions. If a fraction collector is used, subsequent SDS-PAGE or similar may be needed to identify the correct fraction.
  • the column (of e.g. step 2) was of the CIMmultus(TM) Quaternary Amine anion exchange columns (BIA Separations d.o.o.).
  • the CIMmultusTM QA-1 which is a monolithic column with 1.3 pm channel size and a column volume of 1 ml_.
  • DEAE a weak anion exchanger
  • PVC Needle Complexes can be purified from supernatants as well as/instead of cell pellets, with the following
  • DNAse (0.25U/ml_) and protease inhibitors can optionally be added.
  • NaCI is added to a final concentration of 0.5M, and 80 g/L of PEG6000 is also added.
  • the solution is mixed at 4°C overnight.
  • the solution is centrifuged to pellet the PEG6000 at 8000xg, 4°C for 30 mins.
  • the pellet is resuspended in a small volume ( ⁇ 5 ml_) of TM buffer (or similar) and
  • PVCunit4 (chassis encoded by genes plu1667 - plu1652)
  • Photorhabdus strains overexpressing a PVC Needle Complex were prepared using chromosomal recombineering to place a PVC (operon) of choice (operon encoding PVCunit4 Needle Complex was used here, as an example) under the control of an arabinose inducible transcription promoter.
  • the recombineered strains are then genetically transformed with effector expression plasmids (e.g. based on the arabinose inducible expression vector pBAD30) to facilitate PVC Needle Complex over-expression, PVC effector expression, PVC effector trans-packaging, and secretion of the whole complex simply through the addition of the arabinose sugar.
  • the promoter region of PVCunit4 was amplified using primers PVCpromF (5’- T AT CAT AT GT CT ACAACTCCAGAACAAATTGCT G-3’ , SEQ ID NO: 97) and PVCpromR (5’- ATCTCTAGAACAGATATTCCAGCCAGC-3’, SEQ ID NO: 98) using genomic DNA from P. luminescens strain DJC (aka strain TT01) as a template.
  • a suitable P. luminescens strain is obtainable from the ATCC under accession no. ATCC 29999.
  • the PCR product was digested with Ndel and Xbal and introduced by ligation into the suicide vector pCEP (ThermoFisher, catalog number: V04450), using E.
  • luminescens DJC RifR were mixed with 20 mI of the donor bacteria (resulting in a recipient to donor ratio of 4:1) and placed in the centre of an LB agar plate supplemented with 0.1 % pyruvate and 10 mM MgSCL. The plate was incubated overnight at 30°C and the resulting growth was harvested in 1.5 ml LB. Aliquots were plated on plates containing rifampicin (50 pg/ml) and chloramphenicol (25 pg/ml) to select for trans-conjugants and the plates were incubated at 30°C for 3 days.
  • the supernatants were incubated overnight at 4°C, stirring.
  • the precipitated proteins were then collected by centrifugation at 8000 g for 30 min at 4°C.
  • the pellets were re-suspended in 8 ml TM buffer (20 mM TrisHCI, 20 mM MgCI2, pH7.4) and incubated at room temperature for 2h with gentle shaking. Any remaining debris was removed by centrifugation at 13000g for 10 min and the supernatant containing PVC Needle Complexes was applied to a CsCI density gradient and centrifuged at 35000 rpm for 2h in a Beckman coulter Optima L-90K or XPN-80K ultracentrifuge.
  • the fraction containing PVC Needle Complexes was collected and UltraceMOOK devices (Amicon) were used to remove the CsCI and exchange the buffer for TMS (20 mM TrisHCI, 8 mM MgS04, pH7.4).
  • the PVC Needle Complexes were further purified using a CIMmultusTM quarternary amine 2 pm pore anion exchange column (BIAseparations).
  • the column was washed with TMS buffer containing 200 mM NaCI and the PVC Needle Complexes were eluted in TMS containing 1 M NaCI.
  • the NaCI was removed by buffer exchange using an UltraceMOOK device and the sample was applied to a CIMmultusTM DEAE 2 pm pore column (BIA separations) for a final purification.
  • the column was washed in TMS containing 200 mM NaCI and the sample was eluted in TMS containing 500 mM NaCI. It is possible to perform this with and without lysis (e.g. because the PVC Needle Complexes appear to be secreted from live cell, and can be collected in supernatant) of the cells (to release the PVC Needle Complexes).
  • TEM transmission electron microscopy
  • 300-mesh copper grids that were coated with a fine layer of carbon were used as substrates for the protein fractions.
  • a preferred aqueous negative stain is 3% methylamine tungstate.
  • the coated grids were exposed to UV light for 16 h immediately prior to use to ensure adequate wetting of the substrate.
  • a 10 pi drop was applied to the TEM grid, and the protein was allowed to settle for 5 min. Liquid was absorbed with filter paper from the edge of the grid and replaced immediately with 10 mI of filtered negative stain. The drop was partially removed with filter paper, and the grids were allowed to air dry thoroughly before they were viewed with a JEOL 1200EX transmission electron microscope (JEOL, Tokyo, Japan) operating at 80 kV.
  • JEOL 1200EX transmission electron microscope JEOL, Tokyo, Japan
  • BioPORTER assays For BioPORTER assays (Genlantis), 80 mI of purified wild-type and mutant Pnf proteins (500 pg ml-1), or PBS as a negative control, were added to one BioPORTER tube (Genlantis) and re-suspended in 920 mI of DMEM. The samples were added to HeLa cells grown in 6- well plates and incubated for 4h. BioPORTER/protein or PBS mixes were replaced by fresh complete medium and the cells were incubated for 20-48 h.
  • the inventors have successfully excised (cloned) the required expression genes from the host bacterium, Photorhabdus (e.g. which are comprised within SEQ ID NO: 93, SEQ ID NO.:94 and/or SEQ ID NO:.95), and have devised a reliable, scalable expression system in laboratory E. coli as explained above. It has been demonstrated that trans-expression on separate plasmids enables incorporation of payloads (e.g. Pnf) into the syringes, creating a multi-plasmid (modular) platform.
  • payloads e.g. Pnf
  • the polypeptide Pnf was identified as a PVC effector as follows. This was identified within the Photorhabdus asymbiotica ATCC43949 complete genome - GenBank Accession Number: FM 162591.1.
  • the final gene of the PVC operon (P. asymbiotica ATCC43949 PVCpnf operon, which has a sequence of SEQ ID NO: 93) was identified, namely pvc16 (e.g. PAU_03338).
  • pvc16 e.g. PAU_03338
  • the position of the pvc16 genes of a PVC locus is illustrated in Figures 1(A), (B) and (D).
  • ORFs shortly 3’ of pvc16 (e.g. within about 5kb downstream of pvc16) were identified - one such ORF (PAU_03332) being 3535bp downstream of pvc16.
  • the predicted function of the polypeptide (having a sequence of SEQ ID NO.: 32) encoded by this putative effector ORF was obtained by a combination of BlastP and HHPRED (https://toolkit.tuebingen.mpg. de/#/tools/hhpred).
  • This ORF could then be assigned as a PVC effector based on direct homology to a known bacterial toxin (e.g. of the CNF1 family from E. coli).
  • PVC Needle Complexes exert cellular effects consistent with the provenance of the cargoes they carry.
  • cells and whole insect animals exposed to PVC Needle Complexes loaded with the cytoskeleton toxin Pnf undergo cell death in a manner consistent with cytoskeleton toxicity.
  • Injection experiments were performed by injection of 10mI of supernatant, provided following centrifugation (pelleting) of an overnight culture (typically 1 L) of a culture of E. coli harbouring a cosmid clone encoding the PVC Needle Complex with Pnf (PVCPnf) - e.g. a PVC encoded by SEQ ID NO.: 93, packaged with a PVC effector of SEQ ID NO.: 32.
  • PVCPnf PVC Needle Complex with Pnf
  • Resazurin assays The blue compound resazurin was explored for use in assays to determine the activity of PVCs on macrophages (M0). Resazurin is metabolically reduced in cell mitochondria, producing a pink and highly fluorescent compound, resorufin. The effect of PVCs on macrophage metabolism can be determined by introducing resazurin into the culture media. The number of macrophages affected by PVCs can be inferred by comparing the fluorescence measured to that of the cell density optimisation curve (see Czekanska, Methods in Molecular Biology, 2011 , 740, 27-32, incorporated herein by reference).
  • Optimisation of use of Resazurin for THP1 derived macrophages The metabolism of macrophages over 18 h was assessed at different seed densities to determine the optimum cell density for use of this assay with PVCs.
  • a 30 ml_ culture of THP-1 cells was pelleted at 1000 rpm for 4 min, before resuspension in 2 ml_ of RPMI media (also containing 10 % FBS (v/v) and 2 mM L-glutamine). Cells were counted using a cell haemocytometer, then diluted in media to a density of 2x10 6 cells mL ⁇ 1 .
  • THP-1 cells were then activated with phorbol 12- myristate- 13-acetate (PMA) immediately before plating.
  • PMA phorbol 12- myristate- 13-acetate
  • 200 pl_ of the cells were plated in quadruplicate in a 96-well plate, and a 2-fold serial dilution was performed until reaching a final cell density of 1.5625x10 3 cell mL ⁇ 1 .
  • 125 mI_ of the starting cell dilution was also plated in quadruplicate on the same plate, for a 5-fold serial dilution, until reaching a cell density of 0.32x10 3 cells mL ⁇ 1 .
  • Four blank wells were also prepared, containing RPMI and PMA. The plate was incubated at 37 °C with 5 % CO2 for 48 h.
  • THP-1 cells diluted to 1.25x10 5 mL ⁇ 1 , were activated and seeded in a 96-well plate, where wells contained 100 mI_ of cells at a final well density of 1.25x10 4 cells mL ⁇ 1 . Blank wells were also prepared in quadruplicate, containing cells without PVC samples, as well as wells containing media and PMA only. The plate was incubated for 48 h at 37 °C with 5 % CO2. The media was then replaced with fresh RPMI, before addition of 10 pL of each PVC sample.
  • the plate was incubated for a further 24 h, before the addition of 10 mI_ resazurin (12.5 mg/ml_) to each well, and the fluorescence was measured every 30 min for 18 h (excitation: 530-570 nm, emission: 580-620 nm, maintained at 37 °C and 5 % C0 2 ).
  • a‘leader’ peptide sequence preferably on the N-terminus of a payload (toxin) protein, can direct the payload to the PVC complex and allow for (e.g. trigger) the packaging of the payload into the PVC Needle Complex.
  • the inventors have demonstrated that amino acid residues 1-50 of a PVC effector protein is/ comprises a leader sequence.
  • hvnA having a leader sequence from a different (non-hvnA) PVC effector i.e. corresponding to the N-terminal amino acid residues 1-50 from the PAU_03332 effector
  • Figure 8A, construct 3 was correctly packaged into the complex and remained associated with the PVC Needle Complex upon isolation/ purification, as demonstrated by Western blot detection of the Myc-tagged hvnA (see Figure 8B, lane 3).
  • the inventors have demonstrated the surprising ability of the ‘PAU_03332’ leader sequence (which is associated with a different payload, Pnf) for packaging of a hvnA payload (i.e. a different payload to that of PAU_03332). This demonstrates the ability to swap the leader sequences of the PVC effector, allowing use of an optimal leader sequence (having optimal packaging activity) for packaging.
  • the inventors have found that fusing a leader sequence described herein to exogenous (non -Photorhabdus) polypeptides (preferably at the N-terminus) allows for packaging of said exogenous polypeptides into a PVC Needle Complex, with the exogenous polypeptides remaining associated with the PVC Needle Complex upon isolation/ purification.
  • the inventors performed in-depth analysis of the size (e.g. polypeptide length) and structure of the various natural PVC effector payloads encoded by Photorhabdus (see Figure 7), which show a wide variety of different lengths and structure, demonstrating that the applicability of the PVC Needle Complex (nanosyringe) delivery system of the present invention is not limited by the size or properties of the payload protein of interest.
  • the PVC Needle Complex (nanosyringe) chassis can be utilised as a versatile multifunctional delivery vehicle.
  • payload proteins are supplied in‘trans’ on separate genetic constructs.
  • the leader sequences are surprisingly sufficient to target these separately synthesised proteins for packaging into the PVC Needle Complex vehicle (see Figure 11).
  • FIG. 10(C) Further exemplification of trans-packaging of high levels of the Cre site specific recombinase into the PVCpnf nanosyringe expressed in E. coli is provided in Figure 10(C).
  • the inventors constructed a laboratory E. coli expression strain harbouring (i) the arabinose inducible expression plasmid for the P. asymbiotica ATCC43949 PVCpnf operon e.g. of SEQ ID NO.: 93 (with a C-terminal FLAG tag on Pvc16, e.g.
  • leader sequences showing greater sequence diversity for (trans-)packaging a payload.
  • the inventors performed a CLUSTALW sequence comparison of a panel of leader sequences to determine diversity.
  • PVC effectors are identified as proteins encoding recognisable toxin-like domains that are encoded immediately downstream of the pvc16 structural gene. Each PVC operon can encode just a single effector, or several different effector genes in tandem array.
  • a phylogenetic tree is shown in Figure 10E, with the identities of leader sequences exemplified herein for packaging payload proteins into the nanosyringe complexes being elaborated by either the P. asymbiotica ATCC43949 PVC pnf operon (solid arrows) or the P. luminescens TT01 PVC unit4 operons (dashed arrows) or both.
  • the exemplified leader sequences are well distributed throughout and are therefore at or close to maximally sequentially diverse.
  • PVC Needle Complexes are known to comprise tail fibres (see the 3D rendered PVC structure, left most asterix of the rightmost image) which are believed to allow for cell-type specific targeting of the PVC complexes.
  • the inventors have successfully demonstrated that modification of a tail fibre region to incorporate non-natural amino acids (e.g. a substitution of an amino acid in the wild-type sequence for an alternative amino acid of the 20 standard amino acids) does not affect expression of tail fibres.
  • the Bile Duct organoid preparation murine primary bile ducts were isolated and expanded as organoids in matrigel using“BD expansion media” for 12 passages following Huch et al (Regen Med. 2013 Jul;8(4):385-7. PMID: 23826690; DOI :10.2217/rme.13.39) protocol. Cells were then plated in 2D and cultured in BD expansion media.
  • Mouse Genotype LSL-Tom reporter in Rosa26 locus + Axin2CreRT (inducible upon 40HT treatment). Cells were cultured in uncoated polystyrene plates at a seeding density: of 10,000 cells/well.
  • Nanosyringes were prepared as 30% volume syringe preparation in PBS + 70% culture media. Total volume of 100 pi per well.
  • the positive control represented 500nM 40HT (in ethanol) at 1 :1000 (v/v) as positive control for the recombination.
  • the negative control represents 1 :1000 (v/v) ethanol dilution only.
  • Cells were seeded and grown for 48h, nanosyringes added and then cultured for another 24h before fixing (4% PFA fixation 15min RT) and staining for microscopic examination. Staining: Primary antibody Anti-RFP (1 :1000) from Rockland. Secondary Anti-Rabbit 568 (used at 1 :500 v/v). Samples were visualized on a laser-confocal microscope.
  • Figure 16B includes representative micrographs from these experiments demonstrating signal for the RFP protein could be detected in a number of cells when treated with the Cre loaded PVCpnf nanosyringe.
  • organoids rather than simple cell monolayers, some stochasticity in the number of cells that are dosed is expected, and this is even observed in the positive control, which is a small molecule inducer (rather than a large protein complex). It is anticipated that, as these are organoids, there will be some level of cellular differentiation present which may alter the binding characteristics of the nanosyringes.
  • this“nanosyringe + Cre” experiment is a promising proof of concept for a biotechnology tool/aide, by demonstrating the ability to provide a DNA change leading to a transformed cell.
  • This experiment therefore demonstrates the use of exogenous payloads (a protein of viruses rather than bacteria), and nucleic acid modifying enzymes in particular. It is evident that the Cre enzyme is delivered in a functional manner and is capable of traversing the cellular interior to the nucleus to affect its DNA modifying changes.
  • the purification method described herein can be employed to select for (e.g. exceedingly) high molecular weight protein complexes/ biological matter, enabling recovery of the nanosyringes and any cargo (payload) they carry.
  • ‘Loose’/ unpackaged payload remains in solution and is not subject to sufficient centrifugal force and as such is lost during purification, unless contained within the much larger nanosyringe‘shell’ (that is, when successfully packaged).
  • Successful packaging of MAD7 is demonstrated by Figure 17.
  • PVC pnf leader SEQ ID NO.: 78
  • the Pnf effector protein leader sequence e.g. SEQ ID NO.: 78
  • SEQ ID NO.: 78 was fused to the N-terminus
  • Myc epitope tag was fused to the C-terminus.
  • Western dot blot analysis confirmed the presence of these human derived proteins in purified nanosyringes ( Figure 18).
  • a preliminary test has confirmed the ability to use the PVC pnf nanosyringe, produced in E. coli, to deliver trans-packaged human protein sequences (e.g. packaged according to Example 8) and induce apoptosis in ex vivo circulating PBMC cells from human donors.
  • the assay is a TUNEL-stain microscopic analysis from cells exposed to the packaged nanosyringes for 20 minutes only. Results are shown in Figure 19A, demonstrating (via successful induction of apoptosis) delivery of tBid p15 fragment and BaxBH3 domain.
  • tBid p15 fragment (SEQ ID NO: 109) is part of the normal human apoptosis regulation pathway.
  • Cellular effects a pro-apoptotic member of the Bcl-2 family.
  • the C-terminal part of Bid (tBid) translocates to the mitochondria, where it induces the release of cytochrome c.
  • Bid is normally cleaved by caspase 8 from its latent cytosolic full-length pro-Bid form.
  • BaxBH3 (aa59-73) (SEQ ID NO: 111) is a minimal BH3 domain synthetic peptide, comprising critical 15 residues of the defined Bax BH3 domain. Cellular effects: these 15 residues contain sufficient information to bind to, and functionally antagonize, Bcl- xL and to induce specifically Bax/Bak. Appears to abrogate Bak/Bcl-2 interactions - freeing up pro-apoptosis factors.
  • PBMCs Peripheral Blood Mononuclear Cells
  • Trypan blue is a Diazo dye commonly used to selectively colour dead tissue or cells, hence, dead cells are shown as a distinctive blue colour under a microscope while live cells or tissues with intact cell membranes remain uncoloured. Since live cells are excluded from staining, this staining method is also described as a Dye Exclusion Method. Trypan blue is commonly used for assessment of tissue or cell viability. A suitable number of cells (2 X 10 5 ) were exposed to the nanosyringes and empty nanosyringe for 20 minutes. A suitable volume of cells (30mI_) were added to an equal volume of 0.4% Trypan blue and the number of viable (unstained) and dead (stained) cells counted using a hemocytometer. Each compound was tested at 3 concentrations. Blood cells from two independent human donors was tested for each compound at each concentration and each sample was tested in duplicate.
  • PBMCs Peripheral Blood Mononuclear Cells
  • Results of PBMC cell viability assay The Trypan blue viability assays confirmed that the PVC preparations were not immediately toxic in themselves to PBMCs taken from healthy human donors (Table 2). Nanosyringe treatment showed > 60% viability indicating low toxicity at maximum dose concentration (Table 2). The inventors then moved on to test the ability of the chimeric nanosyringes to induce apoptosis.
  • PBMCs Peripheral Blood Mononuclear Cells
  • TUNEL assay was then used to identify apoptotic nuclei in single cell suspensions fixed on slides.
  • Terminal deoxynucleotidyl Transferase (TdT) binds to the exposed 3’-OH ends of DNA fragments which are generated in response to apoptotic signal factors.
  • TdT Terminal deoxynucleotidyl Transferase
  • HRP streptavidin-horseradish peroxide
  • DAB Diamineobenzidine
  • Methyl green counterstaining enables the visualisation of normal and apoptotic cells.
  • TUNEL assay kit (Abeam) was used for detection of apoptotic cells. The assay was performed following the manufacturer’s instructions. Briefly, slides were covered with 100pL proteinase K solution or 5 minutes, slides were rinsed with 1x TRIS buffer saline (TBS). The treatment of nanosyringes or the DNase I positive kit control was performed for 20 minutes at room temperature. Slides were rinsed with TBS. Slides were then incubated with TdT equilibrium buffer for 30 minutes before the addition of TdT labelling reaction mix. Slides were incubated at 37° for 19 minutes.
  • TRIS buffer saline TRIS buffer saline
  • slides were treated with 1 pg/mI DNase I (the kit positive control) for 20 minutes at room temperature following the proteinase K treatment step detailed below.
  • the DNase I treatment fragments DNA in normal cells to generate free 3 ⁇ H groups identical to those generated during apoptosis.
  • a negative control was generated by substituting DNase I with dH 2 0 in the reaction mix during the treatment stage.
  • results of PMBC apoptosis assays TUNEL staining using PBMCs was performed following treatment with the intact tBID and Bax loaded nanosyringes, with appropriate positive and negative kit controls. Treatment was performed for 20 mins to determine if the nanosyringes elicited an apoptotic signal. A positive control (DNase I treatment) and negative control (no DNase I treatment) was included. Results showed both nanosyringes, containing either tBID or Bax, showed strong apoptotic signals (89% and 78% positive, respectively) on the PBMCs. The positive control showed a strong apoptotic signal (79%), whereas the negative control showed no apoptotic signal (100% negative).
  • An anti-MDM (p53 inhibitor) antibody is linked to a leader sequence described herein, and expressed together with a PVC Needle Complex for packaging therein.
  • Isolated PVC Needle Complex (comprising the antibody payload) is contacted with a tumour for intracellular delivery of the antibody (said tumour cells being characterised by having high MDM- suppression of p53 activity for MDM inhibition).
  • the tumour is suppressed by the activity of the anti-MDM antibody.
  • a PVC Needle Complex is used to (intracellularly) deliver anti-tumour peptide vaccine to activate the MHC-I dependent cytotoxic T-cell lymphocyte (CTL) response.
  • CTL MHC-I dependent cytotoxic T-cell lymphocyte
  • a tyrosinase-related protein 2 (TRP2) peptide vaccine is delivered for enhancing cross-presentation to CTLs occurs and antitumor effects against TRP2-expressing tumours. The tumour is suppressed by the activity of the peptide vaccine.
  • a PVC Needle Complex is used to (intracellularly) deliver a nuclear factor-kB inhibitors (which are used for the control of inflammatory disorders, such as rheumatoid arthritis) to a cell.
  • the cell subsequently demonstrates a reduced expression of pro-inflammatory cytokines.
  • a PVC Needle Complex is used to (intracellularly) deliver a T3SS payload (which inhibits NF-kB and MAPK pathways). This is completed with an isolated (purified) PVC Needle Complex, without any need for the PVC Needle Complex to remain associated with the bacterial cell from which it derives.
  • a PVC Needle Complex is used to (intracellularly) deliver, to a cell, anti-apoptotic peptides including BH4, the Bcl-xL-protein, and/or a peptide inhibitor of c-Jun N-terminal kinase (which can protect the heart and brain against ischemic injuries (a restriction in blood supply to tissues, causing a shortage of oxygen and glucose needed for cellular metabolism)).
  • anti-apoptotic peptides including BH4, the Bcl-xL-protein, and/or a peptide inhibitor of c-Jun N-terminal kinase (which can protect the heart and brain against ischemic injuries (a restriction in blood supply to tissues, causing a shortage of oxygen and glucose needed for cellular metabolism)).
  • ischemic injuries a restriction in blood supply to tissues, causing a shortage of oxygen and glucose needed for cellular metabolism
  • a PVC Needle Complex is used to (intracellularly) deliver nicotinamide adenine dinucleotide quinone internal oxidoreductase (Ndi1), the single-subunit yeast analog of complex I (which provides significant cardioprotective effects) to complex l-deficient mutant cells.
  • the Ndi1 protein is correctly targeted to the matrix side of the inner mitochondrial membranes, and restores the NADH oxidase activity to the complex l-deficient cells.
  • a PVC Needle Complex is used to deliver one of two of the essential subunits of the PHOX complex (which are used in enzyme replacement therapy to restore production of ROS in chronic granulomatous disease) to a chronic granulomatous disease cell. A restoration in production of ROS is observed.
  • a PVC Needle Complex is used to (intracellularly) deliver (e.g. intramuscularly) a myotubularin (which is used for improving local and distant muscle performance in X-linked myotubular myopathy patients).
  • Myotubularin- dephosphorylation of phosphatidylinositol 3- phosphate and phosphatidylinositol (3,5)-bi-phosphate is observed.
  • a PVC Needle Complex is used to (intracellularly) deliver a recombinase“Cre” (which is capable of excising defined genetic cassettes) into a mouse cell line, in which the genome has loxP recombination sites flanking a stop signal upstream of an mCherry gene.
  • the Cre payload excises the recombination sites, and removes the stop signal, allowing for expression of the mCherry gene in the cell.
  • a PVC Needle Complex is used to (intracellularly) deliver a ⁇ 15kDa nanobody (antibody fragment) with affinity for an intracellular component. A nanobody-intracellular complex is detected.
  • a PVC Needle Complex is used to intracellularly deliver (e.g. into insect cells) an atypical (non -Photorhabdus) polypeptide toxin for insect crop pests and animal parasites. Suppression of the pests is observed.
  • a PVC Needle Complex is used to (intracellularly) deliver a nuclease (e.g. Cas9 and/or Mad7) into a target cell comprising a guide RNA.
  • a nuclease e.g. Cas9 and/or Mad7
  • the nuclease performs site-directed gene inactivation
  • residue/codon may be optional.
  • SEQ ID NO: 93 Photorhabdus asvmbiotica strain ATCC43949 PVCPnf operon, pyd - DVC16; e.g. corresponding to genes PAU 03353 to PAU 03338 of the sequence of GenBank accession no. FM 162591.1)
  • AAAAAGT ACGATGAACGATTATTACACACCCGTGGTATCCCATCGTTTTATGGCGAGTTTTATTTTTAACCGCA
  • GAAATTCCT AAACCGGAT GAAAAAGTTATTGC ACGCAT AACAACT GAACTT AAT AAT AATGGTTTGCTT AAT AC

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nanotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medical Informatics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Dermatology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
PCT/GB2020/051380 2019-06-07 2020-06-05 Leader sequence Ceased WO2020245611A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
KR1020217042571A KR20220133757A (ko) 2019-06-07 2020-06-05 리더 서열
SG11202113297RA SG11202113297RA (en) 2019-06-07 2020-06-05 Leader sequence
JP2021572387A JP7748288B2 (ja) 2019-06-07 2020-06-05 リーダー配列
MX2021015121A MX2021015121A (es) 2019-06-07 2020-06-05 Secuencias lider.
CN202080042046.3A CN114008205A (zh) 2019-06-07 2020-06-05 前导序列
EP20732657.0A EP3980545A1 (en) 2019-06-07 2020-06-05 Leader sequence
BR112021024592A BR112021024592A2 (pt) 2019-06-07 2020-06-05 Sequência líder
AU2020288380A AU2020288380A1 (en) 2019-06-07 2020-06-05 Leader sequence
US17/613,911 US20230076614A1 (en) 2019-06-07 2020-06-05 Leader sequence
CA3142462A CA3142462A1 (en) 2019-06-07 2020-06-05 Leader sequence
JP2025064761A JP2025114573A (ja) 2019-06-07 2025-04-10 リーダー配列

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1908155.3 2019-06-07
GBGB1908155.3A GB201908155D0 (en) 2019-06-07 2019-06-07 Leader sequence

Publications (1)

Publication Number Publication Date
WO2020245611A1 true WO2020245611A1 (en) 2020-12-10

Family

ID=67386182

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2020/051380 Ceased WO2020245611A1 (en) 2019-06-07 2020-06-05 Leader sequence

Country Status (12)

Country Link
US (1) US20230076614A1 (https=)
EP (1) EP3980545A1 (https=)
JP (2) JP7748288B2 (https=)
KR (1) KR20220133757A (https=)
CN (1) CN114008205A (https=)
AU (1) AU2020288380A1 (https=)
BR (1) BR112021024592A2 (https=)
CA (1) CA3142462A1 (https=)
GB (1) GB201908155D0 (https=)
MX (1) MX2021015121A (https=)
SG (1) SG11202113297RA (https=)
WO (1) WO2020245611A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023158486A3 (en) * 2022-02-15 2023-10-19 The Broad Institute, Inc. Cell-type specific targeting contractile injection system
WO2024003387A1 (en) 2022-06-30 2024-01-04 Københavns Universitet Contractile injection system and use thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN119735656A (zh) * 2023-09-22 2025-04-01 北京朝赛蕴生物科技有限公司 一种蛋白复合物的制备纯化及应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992006204A1 (en) 1990-09-28 1992-04-16 Ixsys, Inc. Surface expression libraries of heteromeric receptors
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
WO2014138324A1 (en) * 2013-03-07 2014-09-12 The General Hospital Corporation Compositions and methods for bacterial delivery of polypeptides

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017066479A1 (en) * 2015-10-14 2017-04-20 Bayer Cropscience Lp Axmi554 delta-endotoxin gene and methods for its use

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
WO1992006204A1 (en) 1990-09-28 1992-04-16 Ixsys, Inc. Surface expression libraries of heteromeric receptors
WO2014138324A1 (en) * 2013-03-07 2014-09-12 The General Hospital Corporation Compositions and methods for bacterial delivery of polypeptides

Non-Patent Citations (38)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. FM 162591.1
"The Molecular Biology of Photorhabdus Bacteria", 2017, SPRINGER INTERNATIONAL PUBLISHING AG, pages: 159 - 177
ABE A ET AL: "Type-III effectors: Sophisticated bacterial virulence factors", COMPTES RENDUS - BIOLOGIES, ELSEVIER, PARIS, FR, vol. 328, no. 5, 1 May 2005 (2005-05-01), pages 413 - 428, XP027629480, ISSN: 1631-0691, [retrieved on 20050501] *
ALTSCHUL ET AL., BULL. MATH. BIO., vol. 48, 1986, pages 603 - 16
BOWIESAUER, PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 2152 - 6
C. E. LAWRENCE ET AL.: "Detecting Subtle Sequence Signals: A Gibbs Sampling Strategy for Multiple Alignment", SCIENCE, vol. 262, no. 5131, 1993, pages 208 - 214, XP001152872, DOI: 10.1126/science.8211139
CHUNG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 10145 - 9
CHUNG ET AL., SCIENCE, vol. 259, 1993, pages 806 - 9
CUNNINGHAMWELLS, SCIENCE, vol. 244, 1989, pages 1081 - 5
CZEKANSKA, METHODS IN MOLECULAR BIOLOGY, vol. 740, 2011, pages 27 - 32
DERBYSHIRE ET AL., GENE, vol. 46, 1986, pages 145
ELLMAN ET AL., METHODS ENZYMOL., vol. 202, 1991, pages 301
ERIC DEPIEREUXERNEST FEYTMANS: "Match-Box: A Fundamentally New Algorithm for the Simultaneous Alignment of Several Protein Sequences", CABIOS, vol. 8, no. 5, 1992, pages 501 - 509
G. BRIONES ET AL: "Cre Reporter System To Monitor the Translocation of Type III Secreted Proteins into Host Cells", INFECTION AND IMMUNITY, vol. 74, no. 2, 20 January 2006 (2006-01-20), pages 1084 - 1090, XP055151152, ISSN: 0019-9567, DOI: 10.1128/IAI.74.2.1084-1090.2006 *
HALEMARHAM: "THE HARPER COLLINS DICTIONARY OF BIOLOGY", 1991, HARPER PERENNIAL
HENIKOFFHENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 10915 - 19
HUCH ET AL., REGEN MED., vol. 8, no. 4, July 2013 (2013-07-01), pages 385 - 7
ISABELLA VLISIDOU ET AL: "PHOTORHABDUS VIRULENCE CASSETTES: EXTRACELLULAR MULTI-PROTEIN NEEDLE COMPLEXES FOR DELIVERY OF SMALL PROTEIN EFFECTORS INTO HOST CELLS.", BIORXIV, 15 February 2019 (2019-02-15), XP055716354, Retrieved from the Internet <URL:https://www.biorxiv.org/content/10.1101/549964v1.full.pdf> [retrieved on 20200720], DOI: 10.1101/549964 *
IVO VAN WALLE ET AL.: "Align-M - A New Algorithm for Multiple Alignment of Highly Divergent Sequences", BIOINFORMATICS, vol. 20, no. 9, 2004, pages 1428 - 1435
JIANG FENG ET AL: "Cryo-EM Structure and Assembly of an Extracellular Contractile Injection System", CELL, vol. 177, no. 2, 4 April 2019 (2019-04-04), pages 370, XP085654989, ISSN: 0092-8674, DOI: 10.1016/J.CELL.2019.02.020 *
JULIE D. THOMPSON ET AL.: "CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment Through Sequence Weighting, Position- Specific Gap Penalties and Weight Matrix Choice", NUCLEIC ACIDS RESEARCH, vol. 22, no. 22, 1994, pages 4673 - 4680, XP002956304
KIM DOHLICH ET AL: "A Substrate-Fusion Protein Is Trapped inside the Type III Secretion System Channel in Shigella flexneri", PLOS PATHOGENS, vol. 10, no. 1, 16 January 2014 (2014-01-16), pages e1003881, XP055151154, DOI: 10.1371/journal.ppat.1003881 *
KOIDE ET AL., BIOCHEM., vol. 33, 1994, pages 7470 - 6
LOWMAN ET AL., BIOCHEM., vol. 30, 1991, pages 10832 - 7
NER ET AL., DNA, vol. 7, 1988, pages 127
OSAMU GOTOH: "Significant Improvement in Accuracy of Multiple Protein. Sequence Alignments by Iterative Refinement as Assessed by Reference to Structural Alignments", J. MOL. BIOL., vol. 264, no. 4, 1996, pages 823 - 838
REIDHAAR-OLSONSAUER, SCIENCE, vol. 241, 1988, pages 53 - 7
ROBERTSON ET AL., J. AM. CHEM. SOC., vol. 113, 1991, pages 2722
SINGLETON ET AL.: "DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY", 1994, JOHN WILEY AND SONS
SMITH ET AL., J. MOL. BIOL., vol. 224, 1992, pages 899 - 904
SORY M-P ET AL: "IDENTIFICATION OF THE YOPE AND YOPH DOMAINS REQUIRED FOR SECRETION AND INTERNALIZATION INTO THE CYTOSOL OF MACROPHAGES USING THE CYAA GENE FUSION APPROACH", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, vol. 92, 1 December 1995 (1995-12-01), pages 11998 - 12002, XP002921387, ISSN: 0027-8424, DOI: 10.1073/PNAS.92.26.11998 *
TURCATTI ET AL., J. BIOL. CHEM., vol. 271, 1996, pages 19991 - 8
VOS ET AL., SCIENCE, vol. 255, 1992, pages 306 - 12
WILKINSON ET AL., BMC GENOMICS, vol. 10, 2009
WILKINSON, FEMS MICROBIOLOGY LETTERS, vol. 309, no. 2, August 2010 (2010-08-01), pages 136 - 143
WLODAVER ET AL., FEBS LETT., vol. 309, 1992, pages 59 - 64
WYNNRICHARDS, PROTEIN SCI., vol. 2, 1993, pages 395 - 403
YANG ET AL., J BACTERIOL., vol. 188, no. 6, March 2006 (2006-03-01), pages 2254 - 2261

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023158486A3 (en) * 2022-02-15 2023-10-19 The Broad Institute, Inc. Cell-type specific targeting contractile injection system
WO2024003387A1 (en) 2022-06-30 2024-01-04 Københavns Universitet Contractile injection system and use thereof

Also Published As

Publication number Publication date
BR112021024592A2 (pt) 2022-01-18
US20230076614A1 (en) 2023-03-09
JP2025114573A (ja) 2025-08-05
JP2022535283A (ja) 2022-08-05
GB201908155D0 (en) 2019-07-24
AU2020288380A1 (en) 2022-01-06
CN114008205A (zh) 2022-02-01
EP3980545A1 (en) 2022-04-13
MX2021015121A (es) 2022-03-17
KR20220133757A (ko) 2022-10-05
JP7748288B2 (ja) 2025-10-02
SG11202113297RA (en) 2021-12-30
CA3142462A1 (en) 2020-12-10

Similar Documents

Publication Publication Date Title
US12031167B2 (en) Generation of acyl amino acids
US10131888B2 (en) Intracellular protein delivery
Simmonds et al. Cloning and sequence analysis of zooA, a Streptococcus zooepidemicus gene encoding a bacteriocin-like inhibitory substance having a domain structure similar to that of lysostaphin
González-Magaña et al. The P. aeruginosa effector Tse5 forms membrane pores disrupting the membrane potential of intoxicated bacteria
JP2025114573A (ja) リーダー配列
KR20130069632A (ko) 캡핑-용이한 rna 폴리머라제 효소 및 이들의 용도
CN107022001A (zh) 一种分离的母乳内源性抗菌多肽及其应用
US20240254169A1 (en) Protein and peptide delivery systems and methods for making and using them
KR20230003511A (ko) 안면견갑상완 근이영양증에 대한 crispr-억제
CN114908077A (zh) 噬菌体裂解酶、其嵌合物及应用
US20220290114A1 (en) Antimicrobial endolysin polypeptides, compositions and formulations
KR101595976B1 (ko) 황색포도알균에 특이적 항균 활성을 가지는 리신 융합 단백질 및 이의 용도
Tak Toxin Secretion by Mycobacterium tuberculosis
Ramirez Mechanism and Function of Membrane Homeostasis of Sortase Modulated by an Evolutionarily Conserved Protein Involved in Pilus Assembly in Actinobacteria
Portieles et al. Novel Bacillus altitudinis endolysin (ArtE2) targeting both Gram-positive and Gram-negative bacteria
Blair et al. HELICOBACTER PYLORI CSD5 LINKS A CELL SHAPE PROMOTING PROTEIN COMPLEX TO THE CELL WALL AND ATP SYNTHASE TO PROMOTE HELICAL SHAPE
US20080026999A1 (en) Two-component bacillus lantibiotic and methods for producing and using the same
CN107056924A (zh) 一种母乳内源性抗菌多肽及其应用
CN106995485A (zh) 一种分离的内源性抗菌多肽及其应用
US7985837B2 (en) Two component Bacillus lantibiotic and methods for producing and using the same
JP2025172596A (ja) イチュリン含有組成物
Chuang et al. Comparison of Tir from enterohemorrahgic and enteropathogenic Escherichia coli strains: two homologues with distinct intracellular properties
WO2024052546A1 (en) Materials and methods to produce insecticidal toxins
Wu Peptidoglycan-targeting lytic enzymes for antimicrobial applications
JP2009118759A (ja) ヒト癌細胞選択的な細胞障害能を有する新規タンパク質

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20732657

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3142462

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021572387

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021024592

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2020288380

Country of ref document: AU

Date of ref document: 20200605

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112021024592

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20211206

ENP Entry into the national phase

Ref document number: 2020732657

Country of ref document: EP

Effective date: 20220107