WO2020242250A1 - 조골세포 유래 미토콘드리아를 포함하는 골형성 촉진을 위한 약학적 조성물 - Google Patents

조골세포 유래 미토콘드리아를 포함하는 골형성 촉진을 위한 약학적 조성물 Download PDF

Info

Publication number
WO2020242250A1
WO2020242250A1 PCT/KR2020/007015 KR2020007015W WO2020242250A1 WO 2020242250 A1 WO2020242250 A1 WO 2020242250A1 KR 2020007015 W KR2020007015 W KR 2020007015W WO 2020242250 A1 WO2020242250 A1 WO 2020242250A1
Authority
WO
WIPO (PCT)
Prior art keywords
osteoblasts
mitochondria
derived
centrifugation
pharmaceutical composition
Prior art date
Application number
PCT/KR2020/007015
Other languages
English (en)
French (fr)
Inventor
이윤실
김나경
서준호
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to US17/614,635 priority Critical patent/US20220226387A1/en
Priority to KR1020217039080A priority patent/KR20220003058A/ko
Publication of WO2020242250A1 publication Critical patent/WO2020242250A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/32—Bones; Osteocytes; Osteoblasts; Tendons; Tenocytes; Teeth; Odontoblasts; Cartilage; Chondrocytes; Synovial membrane
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0654—Osteocytes, Osteoblasts, Odontocytes; Bones, Teeth
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/20—Animal model comprising regulated expression system
    • A01K2217/206—Animal model comprising tissue-specific expression system, e.g. tissue specific expression of transgene, of Cre recombinase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2509/00—Methods for the dissociation of cells, e.g. specific use of enzymes
    • C12N2509/10—Mechanical dissociation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Definitions

  • osteoblast-derived mitochondria as an active ingredient.
  • the osteoblast-derived mitochondria promote bone regeneration and/or bone formation, increase bone density, and may be usefully used in the prevention and/or treatment of bone diseases.
  • Mitochondria are essential organelles for the survival of eukaryotic cells involved in the synthesis and regulation of adenosine triphosphate (ATP) as an energy source. Mitochondria are associated with various metabolic pathways in vivo, such as cell signaling, cell differentiation, cell death, as well as the control of cell cycle and cell growth.
  • ATP adenosine triphosphate
  • mitochondrial functions may be altered by swelling due to an abnormal mitochondrial membrane potential, oxidative stress due to reactive oxygen species, or free radicals, and defects in oxidative phosphorylation for energy generation of mitochondria.
  • Mitochondria constantly communicate with surrounding organelles, and in this process, they secrete vesicles by themselves to exchange various substances. Mitochondria are also known to be able to secrete or fission vesicles outside the cell and move to surrounding cells in the form of small mitochondria.
  • osteoblasts which are cells that form bones, are responsible for the secretion of various substances to optimally maintain the state of these bones. do.
  • osteoblast-derived mitochondria contribute to bone formation, thereby promoting bone formation through mitochondrial activation, and inducing bone mineralization in bone disease lesions, thereby proposing that it can be usefully applied to the treatment of bone diseases.
  • One example provides a pharmaceutical composition comprising the mitochondria derived from osteoblasts as an active ingredient.
  • the mitochondria derived from osteoblasts The mitochondria derived from osteoblasts
  • the pharmaceutical composition may be one having an effect of promoting bone formation or bone formation and/or preventing and/or treating bone disease.
  • a pharmaceutical composition for bone formation or for promoting bone formation comprising as an active ingredient mitochondria derived from osteoblasts.
  • a pharmaceutical composition for preventing and/or treating bone diseases for bone formation comprising as an active ingredient mitochondria derived from osteoblasts.
  • Another example is the prevention of bone formation and/or bone disease comprising administering a pharmaceutically effective amount of osteoblast-derived mitochondria to a subject in need of osteogenesis or osteogenesis promotion and/or prevention and/or treatment of bone disease. And/or a method of treatment.
  • Another example is a pharmaceutical composition for the prevention and/or treatment of osteoblast-derived mitochondria and/or osteogenesis or promotion of bone formation and/or bone disease, or for the prevention and/or treatment of bone formation or bone formation and/or bone disease It provides a use for use in the manufacture of.
  • Another example provides a method of preparing a pharmaceutical composition for the prevention and/or treatment of bone formation and/or bone disease comprising mitochondria derived from osteoblasts, comprising the step of extracting mitochondria from osteoblast culture.
  • the present specification provides a use of osteoblast-derived mitochondria to promote bone formation or bone formation and/or to prevent and/or treat bone disease.
  • the mitochondria derived from osteoblasts used as an active ingredient herein may be obtained from osteoblasts of a mammal, such as a human.
  • the mitochondria may be isolated from a mammalian, for example, a human osteoblast or osteoblast culture medium.
  • the mitochondria derived from osteoblasts may be normal mitochondria obtained from osteoblasts having normal mitochondria biological activity.
  • the osteoblast-derived mitochondria may be isolated from osteoblasts isolated from a living body and/or osteoblasts isolated from a living body and cultured in vitro.
  • the mitochondria derived from osteoblasts may be isolated from osteoblasts through various known methods such as, for example, using a specific buffer solution, centrifugation, or using a magnetic field.
  • the mitochondria derived from osteoblasts refers to a structure in which the mitochondrial matrix is enclosed by the mitochondrial double membrane (inner membrane and outer membrane).
  • the mitochondria derived from osteoblasts may be present in osteoblasts or secreted from osteoblasts and present in a culture medium (or medium).
  • 'derived from osteoblasts' may mean that it is present in osteoblasts, or separated and/or secreted from osteoblasts, osteoblast cultures, osteoblast lysates, and/or osteoblast disruptions. .
  • the mitochondria derived from osteoblasts are mitochondria isolated and/or secreted from osteoblasts, osteoblast cultures, osteoblast lysates, and/or osteoblast lysates, the mitochondria-derived endoplasmic reticulum, the mitochondria and/or the mitochondria-derived It may include one or more selected from the group consisting of cells including endoplasmic reticulum (eg, osteoblasts with increased mitochondrial synthesis) or cultures of the cells.
  • osteoblasts are cells that make bone cells in vertebrates, and make bones by synthesizing and secreting bone matrix, and depositing minerals such as Ca ions and Mg ions necessary for bones to calcify bone tissue. It is a cell that is buried in the bone tissue that it has created and becomes a normal bone cell. Osteoblasts are located inside the periosteum that surrounds the bone.
  • the osteoblasts used herein may be osteoblasts extracted (or isolated) from bone or osteoblasts obtained by culturing the osteoblasts in a medium for bone differentiation (also referred to herein as activated osteoblasts).
  • mitochondria are intracellular organs including an inner membrane and an outer membrane consisting of a bilayer of phospholipids, a matrix inside the inner membrane, and an intermembrane space between the inner and outer membranes, and a part of the inner membrane is inner It protrudes and forms a'cristae' structure that is folded in several layers, and the average length of the longest part is about 10nm to about 50um, about 10nm to about 30um, about 10nm to about 10um, about 50nm to about 50um, It may be about 50nm to about 30um, or about 50nm to about 10um.
  • the mitochondria are internal mitochondria of osteoblasts, mitochondria secreted from osteoblasts, and mitochondria generated by dividing the mitochondria (the mitochondria have a crystal structure of the inner membrane in a form wrapped in a double membrane, and are generally spherical and relatively large Is small), or may include all of them.
  • mitochondrial-derived vesicle a part of the mitochondrial substrate is wrapped in a double membrane or a single membrane (eg, one of the outer membrane and the inner membrane of the double membrane) and separated, and the crystal structure of the inner membrane is observed. Not, and the average length may be smaller than the mitochondria.
  • the osteoblast-derived mitochondria may be obtained from an osteoblast, an osteoblast lysate, and/or an osteoblast lysate.
  • the osteoblast culture may be obtained by culturing osteoblasts in a conventional medium, for example, a medium for bone formation or a medium for bone differentiation that is commonly used for bone formation and/or bone differentiation.
  • the mitochondria derived from osteoblasts used as an active ingredient in the pharmaceutical composition or method provided herein is obtained by first centrifuging a culture of osteoblasts, osteoblast lysates, lysates, or lysates. It may be used in the form of a pellet obtained by secondary centrifugation of the supernatant or a suspension containing the pellet.
  • the first centrifugation is performed by sedimenting and removing cellular components other than mitochondria (mitochondria and/or mitochondrial-derived endoplasmic reticulum) (e.g., cellular components larger or heavier than the mitochondria).
  • the second centrifugation is a step for sedimenting and collecting mitochondria (mitochondria and/or mitochondrial-derived endoplasmic reticulum) in the supernatant obtained in the first centrifugation, and a higher speed than the first centrifugation and/or Can be performed for a long time.
  • the first centrifugation (low-speed centrifugation) and/or the second centrifugation (high-speed centrifugation) are each independently performed once. More than one (eg, 1 time, 2 times, 3 times, 4 times, or 5 times) can be performed.
  • a conventional purification step for using the collected mitochondria may be further included.
  • the first and second centrifugation may each independently be performed at a temperature of 0 to 10°C, 3 to 10°C, 0 to 5°C, or 3 to 5°C.
  • the first and second centrifugation may each independently be performed for 1 to 50 minutes, 1 to 30 minutes, 1 to 15 minutes, 5 to 50 minutes, 5 to 30 minutes, or 5 to 15 minutes.
  • it is not limited thereto, and may be appropriately adjusted according to the number of centrifugation and the content of the sample.
  • the first centrifugation is 100 to 2,000 ⁇ g, 100 to 1,500 ⁇ g, 100 to 1,000 ⁇ g, 100 to 800 ⁇ g, 200 to 2,000 ⁇ g, 200 to 1,500 ⁇ g, 200 to 1,000 ⁇ g, 200 to 800 ⁇ g, 300 to 2,000 ⁇ g, 300 to 1,500 ⁇ g, 300 to 1,000 ⁇ g, 300 to 800 ⁇ g, 400 to 2,000 ⁇ g, 400 to 1,500 ⁇ g, 400 to 1,000 ⁇ g, 400 to 800 ⁇ g, 500 to 2,000 ⁇ g, 500 to 1,500 ⁇ g, 500 to 1,000 ⁇ g, 500 to 800 ⁇ g, 600 to 800 ⁇ g, 200 to 450 ⁇ g, or 300 to 450 ⁇ g Can be done with
  • the second centrifugation may be performed at a faster rate than the first centrifugation, for example, 3,000 to 20,000 ⁇ g, 3,000 to 18,000 ⁇ g, 3,000
  • the osteoblast-derived mitochondria may be obtained in a culture medium obtained after culturing osteoblasts or may be in a form contained in an osteoblast culture medium.
  • the osteoblast culture medium may be a culture obtained by culturing osteoblasts in a conventional medium, for example, a medium commonly used for bone cell differentiation.
  • a culture medium may include cytokines, chemokines, exosomes, microvesicles, etc. secreted by cells, and mitochondria derived from osteoblasts.
  • the separation of the osteoblast-derived mitochondria is the step of culturing osteoblasts, and the obtained culture medium is first centrifuged to precipitate cellular components excluding mitochondria, and a supernatant is obtained, and the supernatant is second centrifuged. Separation can be carried out by a step of obtaining a fraction (pellet) containing a mitochondrial component.
  • the osteoblast-derived mitochondria may be used for osteogenesis or promoting bone formation and/or for preventing and/or treating bone diseases.
  • bone formation or promotion of bone formation is interchangeable in the same sense as each other, and collectively refers to all processes in which a new bone is made or the made bone is densified, differentiation from osteoblasts to bone cells, bone mineralization (bone mineralization) may mean an action that induces and/or promotes at least one selected from among all mechanisms involved in bone formation.
  • the bone disease to which the osteoblast-derived mitochondria can be effectively applied is bone generation/bone regeneration due to one or more selected from the group consisting of decreased osteoblast activity, increased osteoclast activity, external shock, aging, etc. It may mean any disease associated with reduction and/or destruction of the normal structure of bone tissue.
  • the bone diseases are fractures, bone destruction (e.g., secondary bone destruction, inflammatory bone destruction, etc.), osteoporosis, osteomalacia, osteoarthritis, rheumatoid arthritis, osteogenic disorders (e.g., decreased bone regeneration due to aging Etc.) It may be one or more selected from the group consisting of.
  • active ingredient refers to an ingredient that exhibits activity alone or together with an adjuvant (carrier) that is not active by itself.
  • adjuvant carrier
  • mitochondria derived from osteoblasts described above are used as the active ingredient.
  • the mitochondria derived from osteoblasts as an active ingredient may be contained or used in a pharmaceutically effective amount.
  • the pharmaceutically effective amount refers to the content or dosage of an active ingredient capable of obtaining a desired effect.
  • the content or dosage of the active ingredient (mitochondria derived from osteoblasts) in the pharmaceutical composition is the formulation method, administration method, age, weight, sex, pathological condition of the patient, food, administration time, administration interval, administration route, excretion rate. And response sensitivities.
  • one dose of the active ingredient is 0.001 to 1000 mg/kg, 0.01 to 100 mg/kg, 0.01 to 50 mg/kg, 0.01 to 20 mg/kg, 0.01 to 10 mg/kg, 0.01 to 5 mg/kg , 0.1 to 100 mg/kg, 0.1 to 50 mg/kg, 0.1 to 20 mg/kg, 0.1 to 10 mg/kg, 0.1 to 5 mg/kg, 1 to 100 mg/kg, 1 to 50 mg/kg, 1 to It may be in the range of 20 mg/kg, 1 to 10 mg/kg, or 1 to 5 mg/kg, but is not limited thereto.
  • the content of the active ingredient in the pharmaceutical composition is, based on the total weight of the pharmaceutical composition, 0.01% to 99.9% by weight, 0.01% to 90% by weight, 0.01% to 80% by weight, 0.01% to 70 wt%, 0.01 wt% to 60 wt%, 0.01 wt% to 50 wt%, 0.01 wt% to 40 wt%, 0.01 wt% to 30 wt%, 1 wt% to 99.9 wt%, 1 wt% to 90 wt% %, 1% to 80%, 1% to 70%, 1% to 60%, 1% to 50%, 1% to 40%, 1% to 30%, 5% to 99.9%, 5% to 90%, 5% to 80%, 5% to 70%, 5% to 60%, 5% to 50%, 5% % To 40%, 5% to 30%, 10% to 99.9%, 10% to 90%, 10% to 80%, 10% to 70%, 10% to It may be 60 wt%, 10 wt%, 10
  • the pharmaceutical composition provided herein may further include a pharmaceutically acceptable carrier in addition to the active ingredient.
  • the carrier is commonly used in the formulation of a drug containing proteins, nucleic acids, and/or cells, and lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, silicic acid Calcium, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water (e.g., water for injection, purified water, etc.), syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, minerals It may be one or more selected from the group consisting of oil, etc., but is not limited thereto.
  • the pharmaceutical composition may include a stabilizer or a solubility aid, for example, the stabilizer may be sodium pyrosulfite or ethylenediaminetetraacetic acid, and the solubility aid is hydrochloric acid. , Acetic acid, sodium hydroxide, sodium hydrogen carbonate, sodium carbonate or potassium hydroxide.
  • the pharmaceutical composition may further include one or more selected from the group consisting of diluents, excipients, lubricants, wetting agents, sweetening agents, flavoring agents, emulsifying agents, suspending agents, preservatives, etc. that are commonly used in the manufacture of pharmaceutical compositions. have.
  • the active ingredient provided herein or a pharmaceutical composition comprising the same may be administered to a mammal, including a primate including humans, monkeys, rodents including mice, rats, etc., or cells, tissues derived therefrom, It may be cell culture or tissue culture. More specifically, the target of administration of the active ingredient or pharmaceutical composition may be a mammal such as a human who needs bone formation, is at risk of developing bone disease, or is suffering from bone disease.
  • the active ingredient or pharmaceutical composition provided herein may be administered by parenteral administration, or may be administered by contacting cells, tissues, or body fluids in or isolated from a living body.
  • the active ingredient or pharmaceutical composition may be administered parenterally, for example, directly to a site requiring bone formation and/or a bone disease site (eg, injection).
  • the active ingredient or pharmaceutical composition may be formulated in the form of an injection that can be directly administered (eg, injected) to the affected area, that is, a site requiring bone formation and/or a bone disease site.
  • the injection can be prepared as a physically or chemically very stable injection by adjusting the pH using an acid aqueous solution or a buffer solution such as phosphate that can be used as an injection in order to secure product stability according to the prescription and distribution of injections. have.
  • the injection may include water for injection.
  • the water for injection is distilled water prepared for dissolving solid injections or diluting water-soluble injections, glucose injection, xylitol injection, D-mannitol injection, fructose injection, physiological saline, dextran 40 injection, dextran 70 injection, amino acid injection, Ringer's solution, lactic acid-Ringer's solution, or a phosphate buffer solution in a pH range of 3.5 to 7.5, or sodium dihydrogen phosphate-citric acid buffer solution.
  • the active ingredient or pharmaceutical composition provided herein may be in various forms (eg, hydrogel, patch, sheet paper for transplantation, etc.), that is, a site requiring bone formation (tissue) and/or It can be administered (attached, inserted, or implanted) directly to the site (tissue) of a bone disease.
  • the active ingredient or pharmaceutical composition may be included in a collagen sheet and applied to the affected area (attached, inserted, or implanted).
  • the method for isolating osteoblasts includes the following steps:
  • Transgenic animals (first transgenic animals) engineered to conditionally express fluorescent proteins only in cells expressing Cre recombinase or mitochondrial substrates within the cells, and osteoblasts engineered to specifically express Cre recombinase Crossing a transgenic animal (a second transgenic animal) to prepare a transgenic animal (third transgenic animal) expressing the fluorescent protein only in the osteoblasts or mitochondrial matrix of the osteoblasts, and
  • the first transgenic animal and the second transgenic animal are homogeneous animals capable of crossing, and may be selected from mammals other than humans, and may be, for example, mice, rats, rabbits, pigs, dogs, or cows. It is not limited.
  • a first transgenic animal (expressing a fluorescent protein conditionally expressing a Cre recombinase) is a female, and a second transgenic animal (expressing a fluorescent protein only in osteoblasts) may be crossed using a male.
  • a fluorescent signal is generated from a decomposition product obtained by treating a protease (eg, trypsin, collagenase, etc.) on a bone sample isolated from the third transgenic animal. It may include the step of extracting the cells that represent, and the step of extracting the cells that exhibit the fluorescent signal may be performed by a conventional cell separation technique such as FACS (Fluorescence-activated cell sorting).
  • a protease eg, trypsin, collagenase, etc.
  • Live osteoblasts can be separated by the method of separating osteoblasts as described above.
  • the osteoblast isolation method provided herein does not involve the use of an antibody that binds to osteoblasts, antigens that are specifically expressed on the outer cell membrane of living osteoblasts when the osteoblasts are separated by FACS using conventional antibodies And/or it is possible to overcome the problem that occurs because there is no antibody binding thereto.
  • the pharmaceutical composition comprising osteoblast-derived mitochondria (mitochondrial and/or mitochondrial-derived endoplasmic reticulum) disclosed in the present invention as an active ingredient induces osteoblast differentiation/osteogenesis in osteoblasts to enhance bone formation, thereby promoting various bone diseases. Excellent therapeutic effect can be obtained.
  • osteoblast-derived mitochondria mitochondrial and/or mitochondrial-derived endoplasmic reticulum
  • FIG. 1 shows the production process of conditionally genetically engineered mice (Col1a1-Cre; Igs1 CKI-mito-GFP/+ ) made to selectively express green fluorescent protein (GFP) only in the mitochondria of osteoblasts for selective osteoblast culture. It is a schematic diagram showing an example.
  • Lattice SIM structured illumination microscopy observing the fission of mitochondria after induction of bone formation of osteoblasts extracted from the skull of a transgenic mouse (Col1a1-Cre; Igs1 CKI - mito - GFP /+ ) ) Is an image.
  • Lattice SIM Elyra 7, which observed that mitochondrial endoplasmic reticulum was secreted after induction of osteoblast formation from the skull of a transgenic mouse (Col1a1-Cre;Igs1 CKI - mito - GFP /+ ). Zeiss) image.
  • FIGS. 4a to 4c are transmission electron microscopy images of observing cellular structures inside osteoblasts after inducing bone formation in osteoblasts extracted from the skull of a transgenic mouse (Col1a1-Cre;Igs1 CKI - mito - GFP /+ ),
  • Figure 4a is an image of the inside of the osteoblasts observed at 25,000 times (left) and 15,000 times (right), respectively (bar scale: 500nm)
  • Figure 4b is an image of the inside of the osteoblasts observed at 10,000 times (bar scale: 1 ⁇ m)
  • Figure 4c is an image obtained by observing the outside of the osteoblast cells 10,000 times (left) and 6000 times (right), respectively (left photo: up arrow-collagen fiber, down arrow-Extracellular mitochondria, bar scale-1 ⁇ m; right Photo (osteoid): Up arrow-mineral deposition, center-collagen fiber, down arrow-Extracellular mitochondria, bar scale-2 ⁇ m).
  • MDV mitochondria-derived vesicles
  • Figure 6a is a schematic diagram of a process of extracting osteoblasts from cells extracted from the skull of a transgenic mouse (Col1a1-Cre;Igs1 CKI - mito - GFP /+ ) using a fluorescence-activated cell sorting (FACS) Show as
  • 6B and 6C show the results of quantifying the FACS results of FIG. 6A.
  • FIG. 6D is a fluorescence image obtained as a result of the FACS of FIGS. 6A-C, showing osteoblasts in which green fluorescent protein (GFP) is expressed in the mitochondrial matrix (bar scale: 50 ⁇ m).
  • GFP green fluorescent protein
  • FIG. 7 is a schematic diagram showing a process of separating mitochondria and mitochondrial-derived endoplasmic reticulum (MDV) secreted from activated osteoblasts.
  • MDV mitochondrial-derived endoplasmic reticulum
  • FIG. 8A is a schematic diagram showing a process of applying the isolated mitochondria and mitochondrial-derived endoplasmic reticulum (MDV) to induce bone formation.
  • MDV mitochondrial-derived endoplasmic reticulum
  • Figure 8b shows the result of alkaline phosphatase (ALP) staining 3 days after adding the extracted mitochondria to the osteoblast differentiation culture solution. Compared to the control group, osteoblasts grown in the differentiated culture medium supplemented with mitochondria significantly promoted the osteogenic ability.
  • ALP alkaline phosphatase
  • Figure 8c shows the results of confirming the expression of representative genes (Alpl, Runx2, Sp7) related to osteoblast differentiation through real-time polymerase chain reaction (qRT-PCR) 3 days after adding the extracted mitochondria to the osteoblast differentiation culture solution. It is a graph showing.
  • a transgenic mouse was prepared to specifically express green fluorescent protein (GFP) only in the mitochondrial matrix of osteoblasts. More specifically, a transformed mouse (Igs1 CKI-mitoGFP/+ ) (purchased from Jackson Lab; Stock No. 018140) so that GFP is expressed only in the mitochondrial matrix of the cells expressing the Cre recombinase enzyme was used for osteoblast-specific Cre recombination.
  • GFP green fluorescent protein
  • Enzyme-expressing Col1a1 - Cre mice (mouse deposited with the Korea Research Institute of Bioscience and Biotechnology (freeze-preserved) were animalized with the consent of the donor) and crossed (female Igs1 CKI - mitoGFP / CKI -mitoGFP mice and male Col1a1 - Cre mice) Mating) Transgenic mice (Col1a1-Cre; Igs1 CKI - mito - GFP /+ ) that conditionally express GFP only in the mitochondria of osteoblasts were prepared. A description of the above transgenic mice is schematically shown in FIG. 1.
  • the skull of the transgenic mouse prepared as described above was treated with a 0.25% trypsin-EDTA (Gibco) solution for 10 minutes, then the solution was removed, and a 2 mg/mL type 2 collagenase (Worthington) solution After 30 minutes of treatment, the solution is removed. After removing impurities from the bone tissue first, the cells separated from the bone tissue are centrifuged at a speed of 1300 rpm for 3 minutes while treating the bone tissue for 60 minutes with a type 2 collagenase. Separately collected.
  • the osteoblast differentiation medium is 50 ⁇ g/mL of ascorbic acid (Amreasco), 5 mM of beta-glycerophosphate (Sigma), 10% (w/v) fetal bovine serum (Gibco), and 100 U/mL of penicillin-streptomycin. It is composed of alpha MEM (Minimum Essential Medium-Alpha Modification; HyClone) added with (Gibco), and the result of observation with ultra-high resolution fluorescence microscope Lattice SIM (structured illumination microscopy) 0.5 and 7 days after osteoblast differentiation. Is shown in Figure 2. As shown in FIG. 2, it can be seen that mitochondria are widely fissioned within osteoblasts as the differentiation time elapses.
  • Example 2 Confirmation of endoplasmic reticulum secretion from mitochondria after induction of osteoblast differentiation in skull-derived osteoblasts
  • the skull-derived osteoblasts extracted from the skull of a transgenic mouse (Col1a1-Cre; Igs1 CKI- mito-GFP/+ ) were cultured in a medium for osteoblast differentiation and induce bone formation for 7 days.
  • Real-time cell imaging was performed with ultra-high resolution Lattice SIM (structured illumination microscopy) fluorescence microscope (Elyra 7, Zeiss) for about 20 minutes.
  • FIG. 3 The resulting fluorescence image is shown in FIG. 3. As shown in Figure 3, it can be confirmed that small mitochondria or mitochondrial-derived vesicles (MDVs) (arrows in Figure 3) are actively secreted from the mitochondria in which green fluorescent protein (GFP) is expressed in the mitochondrial substrate. have.
  • MDVs mitochondrial-derived vesicles
  • GFP green fluorescent protein
  • Example 3 Identification of mitochondrial-derived endoplasmic reticulum inside and outside osteoblasts during osteoblast differentiation process
  • Example 1 after inducing bone formation in osteoblasts extracted from the skull of a transgenic mouse (Col1a1-Cre; Igs1 CKI - mito - GFP /+ ), cell structures inside and outside the osteoblasts were transmitted through electrons. Observation under a microscope, and the results are shown in Figs. 4A, 4B, and 4C.
  • FIG. 4A it can be seen that mitochondrial-derived endoplasmic reticulum and small mitochondria are separated from relatively large mitochondria inside osteoblasts.
  • Figure 4b it can be seen that a large number of small mitochondria that appear dark are generated due to high electron density inside the osteoblast cells.
  • FIG. 4C it can be confirmed that mitochondrial-derived endoplasmic reticulum and/or small mitochondria were secreted near collagen fibers at a site where bone formation outside osteoblasts is induced.
  • Example 4 Confirmation of bone formation promoting action of mitochondrial components secreted from activated osteoblasts
  • FIG. 5 shows mitochondria are widely divided in the process of differentiation of osteoblasts activated for bone formation, and calcium phosphate is accumulated inside the mitochondria, and then mitochondrial-derived endoplasmic reticulum and/or small mitochondria containing accumulated calcium phosphate are mitochondria.
  • MDV mitochondrial-derived endoplasmic reticulum
  • osteoblasts were harvested from cells obtained from the skull of a transgenic mouse (Col1a1-Cre; Igs1 CKI - mito - GFP /+ ) using a fluorescence-activated cell sorting (FACS). Extracted (see Fig. 6A). Specifically, among cells obtained from the skull, cells having a similar size and shape while being alive (P1 to P4 in FIG. 6C) are isolated, and among them, osteoblasts expressing green fluorescent protein (GFP positive Osteoblasts; Only P6) labeled with arrows 6b and 6c were isolated. The FACS process and flow cytometric analysis results obtained therefrom are shown in Figs. 6b, 6c, and 6d. 6b, 6c, and 6d, the isolated osteoblasts correspond to the P6 population indicated by arrows, and accounted for about 3.1% of the total cells.
  • FACS fluorescence-activated cell sorting
  • the extracted mitochondria in the osteoblast differentiation medium was added to evaluate bone formation. More specifically, after collecting the culture medium of the activated osteoblasts induced differentiation in the osteoblast differentiation medium, refrigerated centrifugation at 4° C. for 10 minutes at a rate of 700 ⁇ g to precipitate the cells (cell pellets in FIG.
  • alkaline phosphatase which is a bone formation marker
  • ALP alkaline phosphatase staining was performed on the third day after treating the mitochondrial pellet in the osteoblast differentiation culture medium as shown in FIG. 8A.
  • ALP staining 1 mg of Naphthol AS-MX phosphate (Sigma) was dissolved in 100 ⁇ L of N,N-dimethylformamide (Sigma), and then 2 mL of 0.1% Fast blue BB salt (Sigma) solution was added and then 37°C. It proceeded for 30 minutes.
  • osteogenesis activity of mitochondria and mitochondrial-derived endoplasmic reticulum isolated from osteoblasts was measured by expression levels of Alpl, Runx2, and Sp7, representative genetic markers related to osteoblast differentiation.
  • qRT-PCR real-time polymerase chain reaction
  • the primer sequences used for the qRT-PCR are as follows: Alpl F_primer: CCAACTCTTTTGTGCCAGAGA, Alpl R_primer: GGCTACATTGGTGTTGAGCTTTT, Runx2 F_primer: TTCTCCAACCCACGAATGCAC, Runx2 R_primer: CAGGTACGTGTGCGA_GCGAGT, GGCGT7GACAGT:GCGAGT, GGCGCGA_GCGAGT:
  • Fig. 8c The obtained results are shown in Fig. 8c. As shown in Figure 8c, compared to the control group, it can be seen that the expression of representative genes (Alpl, Runx2, Sp7) related to osteoblast differentiation in osteoblasts grown in the differentiation culture medium to which the mitochondrial pellet is added was significantly increased.
  • FIGS. 8b and 8c The results shown in FIGS. 8b and 8c were obtained only 3 days after adding the extracted mitochondrial pellet to the osteoblast differentiation culture solution, and thus the mitochondria and mitochondrial-derived endoplasmic reticulum extracted from osteoblasts proved to be very excellent in inducing bone formation, This suggests that it can be usefully used for preventing or treating bone diseases.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Rheumatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Genetics & Genomics (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Environmental Sciences (AREA)
  • Virology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

조골세포 유래의 미토콘드리아를 유효성분으로 포함하는 골형성 촉진용 약학조성물 및 골질환 치료용 약학적 조성물에 관한 것이다.

Description

조골세포 유래 미토콘드리아를 포함하는 골형성 촉진을 위한 약학적 조성물
조골세포 유래의 미토콘드리아를 유효성분으로 포함하는 골형성 촉진용 약학적 조성물 및 골질환 치료용 약학적 조성물이 제공된다. 상기 조골세포 유래의 미토콘드리아는 골재생 및/또는 골형성을 촉진시키며, 골 밀도를 증진시키고, 골질환의 예방 및/또는 치료에 유용하게 이용될 수 있다.
미토콘드리아는 에너지 공급원으로서 아데노신 트라이포스페이트(adenosine triphosphate: ATP) 합성 및 조절에 관여하는 진핵 세포의 생존에 필수적인 세포 소기관이다. 미토콘드리아는 생체 내 다양한 대사 경로, 예를 들어, 세포 신호처리, 세포 분화, 세포 사멸뿐만 아니라 세포 주기 및 세포 성장의 제어와 연관이 있다.
따라서, 미토콘드리아가 손상되면 다양한 질병이 유발될 수 있는데, 대부분의 공지된 미토콘드리아 장애는 미토콘드리아 DNA에서 발생하는 유전성 또는 후천성 돌연변이에 기인한다. 예를 들어, 미토콘드리아 막전위 이상으로 인한 팽윤, 활성산소종, 또는 자유라디칼 등에 의한 산화적 스트레스, 그리고 미토콘드리아의 에너지 생성을 위한 산화적 인산화 기능의 결함 등에 의해 미토콘드리아의 기능이 변형될 수 있다.
미토콘드리아는 주변 세포소기관들과도 끊임없이 소통하며 이 과정에서 다양한 물질들을 주고받기 위해 스스로 소포체(vesicle)를 분비하기도 한다. 미토콘드리아는 세포 밖으로도 스스로 소포체(vesicle)을 분비하거나 분열(fission)하여 작은 미토콘드리아 형태로 주변 세포로 이동할 수 있는 것으로도 알려져 있다.
　Hayakawa 등의 연구에 따르면, 건강한 성상세포(astrocyte)로부터 분비된 건강한 미토콘드리아 혹은 미토콘드리아 유래 소포체가 뇌졸중으로 인해 손상된 신경세포(neuron)로 전달될 수 있다고 밝혔다 (Nature. 2016 Jul 28;535(7613):551-5).
한편, 척추동물의 골격을 이루는 뼈의 형태와 기능을 적절히 유지하는 것은 생명유지에 필수적이며, 뼈를 형성하는 세포인 조골세포는 이러한 뼈의 상태를 최적으로 유지하기 위해 여러 가지 물질의 분비를 관장한다.
뼈의 광화(mineralization)에서 골조직 수산화인회석(hydroxyapatite, Ca10(PO4)6(OH)2)의 중요한 구성성분인 인산칼슘(calcium phosphate)을 비롯한 다양한 물질들이 조골세포 내부에서 만들어지고 세포외 기질(extracellular matrix, ECM)로 분비된 후 성숙한 골조직 형성에 기여하게 되는데, 이러한 물질들이 어떻게 세포 밖으로 운반되는지에 관한 확실한 기전은 아직까지 밝혀지지 않고 있다.
조골세포의 분화 및 골광화 과정을 관찰하는 대부분의 연구들은 골형성 유도를 시작하고 3주 정도가 지난 이후의 비교적 늦은 단계에서 조골세포의 상태를 관찰하고 있어서, 조골세포 내에서의 초기 분화 과정 및 인산칼슘 형성 초기 과정에 대한 연구가 미흡하여 초기 골 병변에서 치료를 유도할 수 있는 효과를 기대하기 어려웠다.
본 명세서에서는 조골세포 유래 미토콘드리아가 골형성에 기여함을 밝힘으로써, 미토콘드리아 활성화를 통해 골형성을 촉진하고, 골질환 병변에서 골광화를 유도하여 골질환 치료에 유용하게 적용될 수 있음을 제안한다.
일 예는 조골세포 유래의 미토콘드리아를 유효성분으로 포함하는 약학적 조성물을 제공한다.
상기 조골세포 유래의 미토콘드리아는,
(1) 조골세포, 조골세포 배양물, 또는 조골세포 파쇄물로부터 분리 또는 분비된 미토콘드리아,
(2) 상기 (1)의 미토콘드리아 유래 소포체 (mitochondria-derived vesicle; MDV), 또는
(3) 상기 (1) 및 (2)의 조합
을 포함하는 것일 수 있다.
상기 약학적 조성물은 골형성 또는 골형성 촉진 및/또는 골질환 예방 및/또는 치료 효과를 갖는 것일 수 있다. 따라서, 다른 예는 조골세포 유래의 미토콘드리아를 유효성분으로 포함하는 골형성용 또는 골형성 촉진용 약학적 조성물을 제공한다. 다른 예는 조골세포 유래의 미토콘드리아를 유효성분으로 포함하는 골형성용 골질환 예방 및/또는 치료용 약학적 조성물을 제공한다.
다른 예는 조골세포 유래의 미토콘드리아의 약학적 유효량을 골형성 또는 골형성 촉진 및/또는 골질환의 예방 및/또는 치료를 필요로 하는 대상에게 투여하는 단계를 포함하는 골형성 및/또는 골질환 예방 및/또는 치료 방법을 제공한다.
다른 예는 조골세포 유래의 미토콘드리아의 골형성 또는 골형성 촉진 및/또는 골질환의 예방 및/또는 치료, 또는 골형성 또는 골형성 촉진 및/또는 골질환의 예방 및/또는 치료를 위한 약학적 조성물의 제조에 사용하기 위한 용도를 제공한다.
다른 예는 조골세포 배양물로부터 미토콘드리아를 추출하는 단계를 포함하는, 조골세포 유래의 미토콘드리아를 포함하는 골형성 및/또는 골질환의 예방 및/또는 치료를 위한 약학적 조성물의 제조 방법을 제공한다.
본 명세서에서는 조골세포 유래의 미토콘드리아의 골형성 또는 골형성 촉진 및/또는 골질환 예방 및/또는 치료 용도를 제공한다.
이하, 본 발명을 보다 상세히 설명한다.
조골세포 유래의 미토콘드리아
본 명세서에서 유효성분으로 사용되는 조골세포 유래의 미토콘드리아는 포유동물, 예컨대 인간의 조골세포로부터 수득된 것일 수 있다. 일 예에서, 상기 미토콘드리아는 포유동물, 예컨대 인간의 조골세포 또는 조골세포 배양액으로부터 분리된 것일 수 있다. 또한, 상기 조골세포 유래의 미토콘드리아는 미토콘드리아의 생물학적 활성이 정상인 조골세포로부터 수득된 정상적인 미토콘드리아일 수 있다. 또한, 상기 조골세포 유래의 미토콘드리아는 생체로부터 분리된 조골세포 및/또는 생체로부터 분리되어 체외에서 배양된 조골세포로부터 분리된 것일 수 있다.
상기 조골세포 유래의 미토콘드리아는, 예를 들어, 특정 버퍼 용액을 사용하거나 원심분리 및 자기장을 이용하는 등 공지된 다양한 방법을 통해 조골세포로부터 분리된 것일 수 있다.
본 명세서에서, 조골세포 유래의 미토콘드리아는 조골세포로부터 유래하고 미토콘드리아의 기질이 미토콘드리아 이중막 (내막 및 외막)으로 둘러싸인 구조물을 총칭한다. 상기 조골세포 유래의 미토콘드리아는 조골세포 내에 존재하거나, 조골세포로부터 분비되어 배양액 (또는 배지)에 존재할 수 있다. 본 명세서에서, '조골세포로부터 유래한다' 함은 조골세포에 존재하거나, 조골세포, 조골세포 배양물, 조골세포 용해물, 및/또는 조골세포 파쇄물로부터 분리 및/또는 분비된 것을 의미할 수 있다. 예컨대, 상기 조골세포 유래의 미토콘드리아는 조골세포, 조골세포 배양물, 조골세포 용해물, 및/또는 조골세포 파쇄물로부터 분리 및/또는 분비된 미토콘드리아, 상기 미토콘드리아 유래 소포체, 상기 미토콘드리아 및/또는 상기 미토콘드리아 유래 소포체를 포함하는 세포 (예컨대, 미토콘드리아 합성이 증가된 조골세포) 또는 상기 세포의 배양물 등으로 이루어진 군에서 선택된 1종 이상을 포함하는 것일 수 있다.
본 명세서에서, 조골세포(osteoblast)는 척추동물에서 골세포를 만드는 세포로서, 골 기질을 합성 및 분비하여 뼈를 만들고, 뼈에 필요한 Ca 이온, Mg이온 등의 무기질을 뼈에 침착시켜 골조직을 석회화하며, 자신이 만든 골조직 속에 묻혀 자신도 일반 골세포가 되기도 하는 세포이다. 조골세포는 뼈를 싸고 있는 골막의 안쪽에 위치한다. 본 명세서에서 사용되는 골모세포는 뼈에서 추출(또는 분리)된 골모세포 또는 상기 골모세포를 골분화용 배지에서 배양한 골모세포 (본 명세서에서 활성화 골모세포라고도 칭해짐)일 수 있다.
본 명세서에서, 미토콘드리아는 인지질 이중층으로 이루어진 내막과 외막의 이중막, 내막 내부의 기질 (matrix), 내막과 외막 사이의 막간 공간 (intermembrane space)를 포함하는 세포내 기관으로, 상기 내막의 일부는 안쪽으로 돌출하여 여러 겹으로 접혀 있는 '크리스테(cristae)' 구조를 이루며, 가장 긴 부분의 평균 길이가 약 10nm 내지 약 50um, 약 10nm 내지 약 30um, 약 10nm 내지 약 10um, 약 50nm 내지 약 50um, 약 50nm 내지 약 30um, 또는 약 50nm 내지 약 10um인 것일 수 있다. 상기 미토콘드리아는 조골세포 내재의 미토콘드리아, 조골세포로부터 분비된 미토콘드리아, 상기 미토콘드리아가 분열하여 생성된 미토콘드리아 (미토콘드리아 기질이 이중막에 싸여있는 형태로 내막의 크리스테 구조를 가지며, 대체적으로 구형이고 상대적으로 크기가 작음), 또는 이들 모두를 포함하는 것일 수 있다.
상기 미토콘드리아 유래 소포체 (mitochondria-derived vesicle; MDV)는 미토콘드리아의 기질 중 일부가 이중막 또는 단일막(예컨대, 상기 이중막의 외막 및 내막 중 어느 하나)에 싸여 떨어져 나온 것으로, 내막의 크리스테 구조가 관찰되지 않고, 평균 길이가 상기 미토콘드리아보다 작은 것일 수 있다.
조골세포 유래의 미토콘드리아의 수득
상기 조골세포 유래의 미토콘드리아 (미토콘드리아 및/또는 미토콘드리아 유래 소포체)는 조골세포, 조골세포 용해물, 및/또는 조골세포 파쇄물로부터 얻어진 것일 수 있다. 일 예에서, 상기 조골세포 배양물은 조골세포를 통상적인 배지, 예컨대, 골형성 및/또는 골분화를 위하여 통상적으로 사용되는 골형성용 배지 또는 골분화용 배지에서 배양한 것일 수 있다.
일 구체예에서, 본 명세서에서 제공되는 약학적 조성물 또는 방법에서 유효성분으로 사용되는 조골세포 유래의 미토콘드리아는 조골세포의 배양물, 조골세포 용해물, 파쇄물, 또는 용해물을 1차 원심분리하여 얻어진 상청액을 2차 원심분리하여 얻어진 펠렛 또는 상기 펠렛을 포함하는 현탁액의 형태로 사용될 수 있다.
다른 예에서, 다음의 단계를 포함하는 조골세포 유래의 미토콘드리아 제조 방법이 제공된다:
조골세포의 배양물, 파쇄물, 또는 용해물을 1차 원심분리하는 단계;
상기 1차 원심분리에 의하여 얻어진 상청액을 2차 원심분리하는 단계; 및
최종적으로 얻어진 펠렛을 분리하는 단계.
본 명세서에서 조골세포 유래의 미토콘드리아 수득에 있어서, 상기 1차 원심분리는 미토콘드리아 (미토콘드리아 및/또는 미토콘드리아 유래 소포체) 이외의 세포 성분 (예컨대, 상기 미토콘드리아보다 크기가 크거나 무거운 세포 성분)을 침전시켜 제거하기 위한 단계이고, 상기 2차 원심분리는 상기 1차 원심분리에서 얻어진 상청액 내의 미토콘드리아(미토콘드리아 및/또는 미토콘드리아 유래 소포체)를 침전시켜 수집하기 위한 단계로서, 상기 1차 원심분리보다 높은 속도 및/또는 장시간 수행할 수 있다. 수집되는 미토콘드리아(미토콘드리아 및/또는 미토콘드리아 유래 소포체)의 양 및/또는 순도를 높이기 위하여, 상기 1차 원심분리 (저속 원심분리) 및/또는 2차 원심분리 (고속 원심분리)를 각각 독립적으로 1회 이상 (예컨대, 1회, 2회, 3회, 4회, 또는 5회) 수행할 수 있다.
일 예에서, 상기 2차 원심분리 단계 이후에, 수집된 미토콘드리아(미토콘드리아 및/또는 미토콘드리아 유래 소포체)를 약학적 조성물로서 사용하기 위한 통상적인 정제 단계를 추가로 포함할 수 있다.
구체적으로, 상기 1차 및 2차 원심분리는, 각각 독립적으로, 0 내지 10℃, 3 내지 10℃, 0 내지 5℃, 또는 3 내지 5℃의 온도에서 수행될 수 있다. 또한, 상기 1차 및 2차 원심분리는, 각각 독립적으로, 1 내지 50분, 1 내지 30분, 1 내지 15분, 5 내지 50분, 5 내지 30분, 또는 5 내지 15분동안 수행될 수 있으나, 이에 제한되는 것은 아니며, 원심분리 횟수 및 샘플의 함량 등에 따라 적절히 조정될 수 있다.
일 예에서, 1차 원심분리에서 2차 원심분리로 갈수록 속도를 높여서 수행할 수 있다. 예를 들어, 상기 1차 원심분리는 100 내지 2,000×g, 100 내지 1,500×g, 100 내지 1,000×g, 100 내지 800×g, 200 내지 2,000×g, 200 내지 1,500×g, 200 내지 1,000×g, 200 내지 800×g, 300 내지 2,000×g, 300 내지 1,500×g, 300 내지 1,000×g, 300 내지 800×g, 400 내지 2,000×g, 400 내지 1,500×g, 400 내지 1,000×g, 400 내지 800×g, 500 내지 2,000×g, 500 내지 1,500×g, 500 내지 1,000×g, 500 내지 800×g, 600 내지 800×g, 200 내지 450×g, 또는 300 내지 450×g의 속도로 수행될 수 있다. 또한, 상기 2차 원심분리는 1차 원심분리보다 빠른 속도로 수행될 수 있으며, 예를 들어, 3,000 내지 20,000×g, 3,000 내지 18,000×g, 3,000 내지 16,000×g, 3,000 내지 14,000×g, 5,000 내지 20,000×g, 5,000 내지 18,000×g, 5,000 내지 16,000×g, 5,000 내지 14,000×g, 7,000 내지 20,000×g, 7,000 내지 18,000×g, 7,000 내지 16,000×g, 7,000 내지 14,000×g, 10,000 내지 20,000×g, 10,000 내지 18,000×g, 10,000 내지 16,000×g, 10,000 내지 14,000×g의 속도로 수행될 수 있다.
일 예에서, 상기 조골세포 유래의 미토콘드리아는 조골세포를 배양한 후 얻어진 배양액 내에서 수득한 것 또는 조골세포 배양액에 포함된 형태일 수 있다. 상기 조골세포 배양액은 조골세포를 통상의 배지, 예컨대, 골세포 분화에 통상적으로 사용되는 배지에서 배양한 배양물일 수 있다. 이러한 배양액에는 세포가 분비한 사이토카인, 케모카인, 엑소좀 및 미세소포체 등과 조골세포 유래 미토콘드리아가 포함될 수 있다. 일 구체예에 있어서, 상기 조골세포 유래 미토콘드리아의 분리는 조골세포를 배양하고, 얻어진 배양액을 1차 원심분리하여 미토콘드리아를 제외한 세포 성분들을 침전시키고, 상청액을 수득하는 단계, 상기 상청액을 제2차 원심분리하여 미토콘드리아 성분을 포함하는 분획(펠렛)을 수득하는 단계로 수행될 수 있다.
의약 용도
상기 조골세포 유래의 미토콘드리아는 골형성 또는 골형성 촉진 및/또는 골질환의 예방 및/또는 치료 용도로 사용될 수 있다.
본 명세서에서, 골형성 또는 골형성 촉진은 서로 동등한 의미로 호환 가능하며, 새로운 뼈가 만들어지거나 만들어진 뼈가 치밀화하는 일체의 과정을 통칭하는 것으로, 조골세포로부터 골세포로의 분화, 골광화 (bone mineralization) 등의 골형성에 수반되는 모든 기작 중에 선택된 하나 이상을 유도 및/또는 촉진하는 작용을 의미할 수 있다.
본 명세서에서, 상기 조골세포 유래의 미토콘드리아가 유효하게 적용될 수 있는 골질환은 조골세포의 활성감소, 파골세포의 활성증가, 외부 충격, 노화 등으로 이루어진 군에서 선택된 하나 이상으로 인한 골생성/골재생 감소 및/또는 골조직의 정상적인 구조의 파괴와 관련된 모든 질병을 의미할 수 있다. 예를 들어, 상기 골질환은 골절, 골파괴증 (예, 2차성 골파괴증, 염증성 골파괴증 등), 골다공증, 골연화증, 골관절염, 류머티즘 관절염, 골형성 장애 (예, 노화로 인한 골재생능 감소 등) 등으로 이루어진 군에서 선택된 하나 이상일 수 있다.
본 명세서에서 특별한 언급이 없는 한, 용어 "유효성분"은 단독으로 활성을 나타내거나 또는 그 자체로는 활성이 없는 보조제(담체)와 함께 활성을 나타내는 성분을 지칭한다. 본 명세서에서, 유효성분으로서 앞서 설명한 조골세포 유래의 미토콘드리아가 사용된다.
본 명세서에서 제공되는 약학적 조성물 및 예방/치료 방법에 있어서, 유효성분인 조골세포 유래의 미토콘드리아는 약학적 유효량으로 함유 또는 사용될 수 있다. 상기 약학적 유효량은 소망하는 효과를 얻을 수 있는 유효성분의 함유량 또는 투여량을 의미한다. 상기 약학적 조성물 내의 유효 성분(조골세포 유래의 미토콘드리아)의 함유량 또는 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 간격, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 예컨대, 상기 유효성분의 1회 투여량은 0.001 내지 1000 mg/kg, 0.01 내지 100 mg/kg, 0.01 내지 50 mg/kg, 0.01 내지 20 mg/kg, 0.01 내지 10mg/kg, 0.01 내지 5mg/kg, 0.1 내지 100 mg/kg, 0.1 내지 50 mg/kg, 0.1 내지 20 mg/kg, 0.1 내지 10mg/kg, 0.1 내지 5mg/kg, 1 내지 100 mg/kg, 1 내지 50 mg/kg, 1 내지 20 mg/kg, 1 내지 10mg/kg, 또는 1 내지 5mg/kg 범위일 수 있으나, 이에 제한되는 것은 아니다. 다른 예에서, 약학적 조성물 내 유효성분의 함량은, 전체 약학적 조성물 중량 기준으로, 0.01중량% 내지 99.9중량%, 0.01중량% 내지 90중량%, 0.01중량% 내지 80중량%, 0.01중량% 내지 70중량%, 0.01중량% 내지 60중량%, 0.01중량% 내지 50중량%, 0.01중량% 내지 40중량%, 0.01중량% 내지 30중량%, 1중량% 내지 99.9중량%, 1중량% 내지 90중량%, 1중량% 내지 80중량%, 1중량% 내지 70중량%, 1중량% 내지 60중량%, 1중량% 내지 50중량%, 1중량% 내지 40중량%, 1중량% 내지 30중량%, 5중량% 내지 99.9중량%, 5중량% 내지 90중량%, 5중량% 내지 80중량%, 5중량% 내지 70중량%, 5중량% 내지 60중량%, 5중량% 내지 50중량%, 5중량% 내지 40중량%, 5중량% 내지 30중량%, 10중량% 내지 99.9중량%, 10중량% 내지 90중량%, 10중량% 내지 80중량%, 10중량% 내지 70중량%, 10중량% 내지 60중량%, 10중량% 내지 50중량%, 10중량% 내지 40중량%, 또는 10중량% 내지 30중량%일 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서 제공되는 약학적 조성물은, 상기 유효성분에 추가하여, 약학적으로 허용 가능한 담체를 추가로 포함할 수 있다. 상기 담체는 단백질, 핵산, 및/또는 세포를 포함하는 약물의 제제화에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물 (예컨대, 주사용수, 정제수 등), 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘, 미네랄 오일 등으로 이루어진 군에서 선택된 1종 이상일 수 있으나, 이에 한정되는 것은 아니다. 또한, 상기 약학적 조성물은 안정화제 또는 용해보조제를 포함할 수 있으며, 예를 들어, 안정화제는 나트륨 피로설파이트(sodium pyrosulfite) 또는 에틸렌 디아민테트라아세트산(ethylenediaminetetraacetic acid)일 수 있고, 용해보조제는 염산, 아세트산, 수산화나트륨, 탄산수소나트륨, 탄산나트륨 또는 수산화칼륨일 수 있다. 상기 약학적 조성물은 또한, 약학적 조성물 제조에 통상적으로 사용되는 희석제, 부형제, 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등으로 이루어진 군에서 선택된 1종 이상을 추가로 포함할 수 있다.
본 명세서에서 제공되는 유효성분 또는 이를 포함하는 약학적 조성물의 투여 대상은 인간, 원숭이 등을 포함하는 영장류, 마우스, 래트 등을 포함하는 설치류 등을 포함하는 포유류, 또는 이들로부터 유래하는 세포, 조직, 세포 배양물 또는 조직 배양물일 수 있다. 보다 구체적으로, 상기 유효성분 또는 약학적 조성물의 투여 대상은 골형성이 필요하거나, 골질환에 걸릴 위험이 있거나 골질환을 앓고 있는 인간 등의 포유동물일 수 있다.
본 명세서에서 제공되는 유효성분 또는 약학적 조성물은 비경구 투여에 의하여 투여되거나, 생체 내의 또는 생체로부터 분리된 세포, 조직, 또는 체액에 접촉시킴으로써 투여되는 것일 수 있다. 구체적으로, 상기 유효성분 또는 약학적 조성물은 비경구 투여, 예컨대, 골형성이 필요한 부위 및/또는 골질환 부위에 직접적으로 투여 (예컨대, 주입)될 수 있다. 이 경우, 상기 유효성분 또는 약학적 조성물은 환부, 즉 골형성이 필요한 부위 및/또는 골질환 부위에 직접적으로 투여 (예컨대, 주입) 가능한 주사제 형태로 제형화된 것일 수 있다. 이 경우, 상기 주사제는 주사제 처방 및 유통에 따른 제품 안정성을 확보하기 위하여, 주사제로 사용 가능한 산수용액 또는 인산염 등의 완충용액을 사용하여 pH를 조절함으로써, 물리적으로나 화학적으로 매우 안정한 주사제로 제조될 수 있다.
구체적으로, 상기 주사제는 주사용수를 포함할 수 있다. 상기 주사용수는 고형주사제의 용해나 수용성 주사제를 희석하기 위하여 만들어진 증류수로서, 글루코스 주사, 자일리톨 주사, D-만니톨 주사, 프룩토스 주사, 생리식염수, 덱스트란 40 주사, 덱스트란 70 주사, 아미노산 주사, 링거액, 락트산-링거액 또는 pH 3.5~7.5 범위의 인산염 완충용액 또는 인산이수소나트륨-구연산 완충용액 등 일 수 있다.
다른 예에서, 본 명세서에서 제공되는 유효성분 또는 약학적 조성물은 다양한 형태(예컨대, 하이드로겔, 패치(patch), 이식용 시트지 등)로 환부, 즉, 골형성이 필요한 부위(조직) 및/또는 골질환 부위(조직)에 직접 투여 (부착, 삽입, 또는 이식)될 수 있다. 일 예에서, 상기 유효성분 또는 약학적 조성물은 콜라겐 시트지에 포함되어 환부에 적용(부착, 삽입, 또는 이식)될 수 있다.
조골세포의 분리
본 명세서에서는 조골세포를 분리하는 방법을 제공한다.
상기 조골세포 분리 방법은 다음의 단계를 포함한다:
(a) Cre 재조합효소가 발현되는 세포 또는 상기 세포 내 미토콘드리아 기질에서만 조건부로 형광 단백질을 발현하도록 조작된 형질전환 동물(제1 형질전환 동물)과 조골세포 특이적으로 Cre 재조합효소를 발현하도록 조작된 형질전환 동물(제2 형질전환 동물)을 교배시켜, 조골세포 또는 조골세포의 미토콘드리아 기질에서만 상기 형광 단백질을 발현하는 형질전환 동물 (제3 형질전환 동물)을 준비하는 단계, 및
(b) 상기 준비된 형질전환 동물 (제3 형질전환 동물)에서 얻어진 골 시료 (예컨대, 두개골 조각 등)로부터 형광 단백질을 발현하는 조골세포를 분리하는 단계.
상기 제1 형질전환 동물과 제2 형질전환 동물은 교배 가능한 동종의 동물로서, 인간을 제외한 포유동물 중에서 선택될 수 있으며, 예컨대, 마우스, 래트, 토끼, 돼지, 개, 또는 소 등일 수 있으나, 이에 제한되는 것은 아니다. 일 예에서, 제1 형질전환 동물 (Cre 재조합효소 발현 조건부로 형광 단백질 발현)은 암컷을 사용하고, 제2 형질전환 동물 (조골세포에서만 형광 단백질 발현)은 수컷을 사용하여 교배할 수 있다.
상기 형광단백질을 발현하는 조골세포를 분리하는 단계 (b)는 상기 제3 형질전환 동물에서 분리한 골 시료에 단백질분해효소 (예컨대, 트립신, 콜라겐분해효소 등)를 처리하여 얻어진 분해물로부터 형광신호를 나타내는 세포를 추출하는 단계를 포함할 수 있고, 상기 형광신호를 나타내는 세포를 추출하는 단계는 FACS (Fluorescence-activated cell sorting) 등과 같은 통상적인 세포 분리기술에 의하여 수행될 수 있다.
상기와 같은 조골세포 분리 방법에 의하여 살아있는 조골세포를 분리할 수 있다.
본 명세서에서 제공되는 조골세포 분리 방법은 조골세포와 결합하는 항체의 사용을 수반하지 않으므로, 기존의 항체를 사용하는 FACS에 의한 조골세포 분리시에 살아있는 조골세포 바깥쪽 세포막에 특이적으로 발현하는 항원 및/또는 이에 결합하는 항체가 없어서 발생하는 문제점을 극복할 수 있다.
본 발명에서 개시되는 조골세포 유래의 미토콘드리아 (미토콘드리아 및/또는 미토콘드리아 유래 소포체)를 유효성분으로 포함하는 약학적 조성물은 조골세포에서의 골분화/골형성을 유도하여 골형성능을 증진시킴으로써, 다양한 골질환에서 우수한 치료 효과를 얻을 수 있을 있다.
도 1은 조골세포 선택적 분리배양을 위해, 조골세포의 미토콘드리아에서만 선택적으로 녹색형광단백질(GFP)가 발현되게 만든 조건부 유전자 조작 마우스(Col1a1-Cre;Igs1CKI-mito-GFP/+)의 제작 과정을 예시적으로 보여주는 모식도이다.
도 2는 형질전환 마우스(Col1a1-Cre;Igs1CKI - mito - GFP /+)의 두개골에서 추출한 조골세포의 골형성 유도 후의 미토콘드리아의 분열(fission)을 관찰한 초고해상도 형광현미경 Lattice SIM(structured illumination microscopy) 이미지이다.
도 3은 형질전환 마우스 (Col1a1-Cre;Igs1CKI - mito - GFP /+)의 두개골에서 추출한 조골세포의 골형성 유도 후 미토콘드리아 유래 소포체가 분비되는 것을 관찰한 초고해상도 형광현미경 Lattice SIM(Elyra 7, Zeiss) 이미지이다.
도 4a내지 도 4c는 형질전환 마우스 (Col1a1-Cre;Igs1CKI - mito - GFP /+)의 두개골에서 추출한 조골세포에서 골형성을 유도 후 조골세포 내부의 세포구조물들을 관찰한 투과 전자 현미경 이미지로서, 도 4a는 조골세포 내부를 각각 25,000배(왼쪽), 15,000배(오른쪽)로 관찰한 이미지이고 (bar scale: 500nm), 도 4b는 조골세포 내부를 10,000배율로 관찰한 이미지이며 (bar scale: 1㎛), 도 4c는 조골세포 외부를 각각 10,000배(왼쪽), 6000배(오른쪽)로 관찰한 이미지이다 (왼쪽 사진: 위쪽 화살표 - collagen fiber, 아래쪽 화살표 - Extracellular mitochondria, bar scale - 1㎛; 오른쪽 사진 (osteoid): 위쪽 화살표 - mineral deposition, 가운데 - collagen fiber, 아래쪽 화살표 - Extracellular mitochondria, bar scale - 2㎛).
도 5은 형질전환 마우스 (Col1a1-Cre;Igs1CKI - mito - GFP /+)의 두개골에서 추출한 조골세포에서 분비된 미토콘드리아 유래 소포체(mitochondria-derived vesicle, MDV) 및 작은 미토콘드리아가 골형성을 유도한다는 가설을 요약하여 보여주는 모식도이다.
도 6a는 형질전환 마우스 (Col1a1-Cre;Igs1CKI - mito - GFP /+)의 두개골에서 추출한 세포로부터 유세포 자동 분리기(Fluorescence-activated cell sorting, FACS)를 이용하여 조골세포를 추출하는 과정을 모식적으로 보여준다.
도 6b 및 6c는 도 6a의 FACS 결과를 정량화한 결과를 보여준다.
도 6d는 도 6a-c의 FACS 결과 얻어진 형광 이미지로서, 녹색형광단백질(GFP)가 미토콘드리아 기질 내에 발현되어 있는 조골세포를 보여준다 (bar scale: 50㎛).
도 7은 활성화된 조골세포에서 분비된 미토콘드리아 및 미토콘드리아 유래 소포체(MDV)를 분리하는 과정을 보여주는 모식도이다.
도 8a는 분리된 미토콘드리아 및 미토콘드리아 유래 소포체(MDV)를 골형성 유도를 위해 적용하는 과정을 보여주는 모식도이다.
도 8b는 조골세포 분화배양액에 추출된 미토콘드리아를 첨가한 후 3일 후에 alkaline phosphatase (ALP) 염색을 한 결과를 보여준다. 대조군에 비해 미토콘드리아가 첨가된 분화배양액에서 자란 조골세포의 골형성 능력이 확연히 촉진되었다.
도 8c는 조골세포 분화배양액에 추출된 미토콘드리아를 첨가한 후 3일 후에 실시간 중합효소 연쇄반응(qRT-PCR)을 통해 조골세포분화와 관련된 대표적인 유전자(Alpl, Runx2, Sp7)의 발현을 확인한 결과를 보여주는 그래프이다.　
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
실시예 1: 두개골 유래 조골세포에서 조골 분화 유도 후 미토콘드리아의 분열 확인
조골세포 유래의 미토콘드리아 및 미토콘드리아 유래 소포체의 분비 및 확인을 위하여, 조골세포의 미토콘드리아 기질에서만 특이적으로 녹색형광단백질(GFP)이 발현되도록 한 형질전환 마우스를 제작하였다. 보다 구체적으로, Cre재조합효소가 발현되는 세포의 미토콘드리아 기질에서만 GFP가 발현되도록 형질전환된 마우스 (Igs1CKI-mitoGFP/+) (Jackson Lab에서 구입; Stock No. 018140)를 조골세포 특이적으로 Cre 재조합효소를 발현하는 Col1a1 - Cre 마우스(한국생명공학연구원에 기탁(동결보존)된 마우스를 기탁자의 동의하에 동물화하였음)와 교배시켜(암컷 Igs1CKI - mitoGFP / CKI -mitoGFP 마우스와 숫컷 Col1a1 - Cre 마우스 간의 교배) 조골세포의 미토콘드리아에서만 조건부로 GFP를 발현하는 형질전환 마우스(Col1a1-Cre;Igs1CKI - mito - GFP /+)를 제작하였다. 상기와 같은 형질전환 마우스에 관한 설명은 도 1에 모식적으로 나타내었다.
상기와 같이 준비된 형질전환 마우스의 두개골을 0.25% trypsin-EDTA (Gibco) 용액으로 10분 동안 처리한 후 용액을 제거하고, 2 mg/mL의 제 2형 콜라겐분해효소(type 2 collagenase; Worthington) 용액으로 30분 동안 처리한 후 용액을 제거하는 방식으로 먼저 골조직에서 불순물을 제거한 후, 다시 제 2형 콜라겐분해효소로 60분 동안 골조직을 처리하면서 골조직에서 분리되어 나온 세포를 1300 rpm 속도로 3분간 원심분리하여 수집하였다. 골조직에서 추출된 모든 세포를 살아있으면서 GFP를 발현하는 조골세포만을 분리하기 위하여, 7-AAD (7-amino-actinomycin D; Bio-Legend)로 약 10분동안 염색(죽은 세포만 염색됨) 후, 초고속 유세포 자동 분리기(Fluorescence-activated cell sorting, FACS)를 이용하여 분리하였다. 이때, 비슷한 모양과 크기를 가지는 세포를 먼저 분리하고, 이 세포들 중에서 살아있는 세포들(7-AAD negative cells)만을 선택하여, GFP를 발현하는 세포(조골세포)와 GFP를 발현하지 않는 세포(비조골세포)로 분리한 후, GFP를 발현하는 조골세포만을 수집하였다. 이렇게 분리 및 추출된 두개골 유래 조골세포를 조골세포 분화용 배지에서 배양하여 분화를 유도하였다. 상기 조골세포 분화용 배지는 50 ㎍/mL의 ascorbic acid (Amreasco), 5mM의 beta-glycerophosphate (Sigma), 10%(w/v) fetal bovine serum (Gibco), 그리고 100 U/mL의 penicillin-streptomycin (Gibco)이 첨가된 alpha MEM(Minimum Essential Medium - Alpha Modification; HyClone)으로 구성되어 있으며, 조골세포 분화 이후, 0.5일 및 7일 경과 후에 초고해상도 형광현미경 Lattice SIM(structured illumination microscopy)으로 관찰한 결과를 도 2에 나타내었다. 도 2에 나타난 바와 같이, 분화 시간이 경과함에 따라 조골 세포 내에서 미토콘드리아가 광범위하게 분열(fission)하는 것을 확인할 수 있다.
실시예 2: 두개골 유래 조골세포에서 조골 분화 유도 후 미토콘드리아에서 소포체 분비 확인
상기 실시예 1에 기재된 바와 같이, 형질전환 마우스(Col1a1-Cre; Igs1CKI -mito-GFP/+)의 두개골에서 추출한 두개골 유래 조골세포를 조골세포 분화용 배지에서 배양하여 7일 동안 골형성유도 후, 약 20분 동안 초고해상도 Lattice SIM(structured illumination microscopy) 형광현미경(Elyra 7, Zeiss)으로 실시간 세포 촬영을 진행하였다.
그 결과 얻어진 형광 이미지를 도 3에 나타내었다. 도 3에 나타난 바와 같이, 미토콘드리아 기질에 녹색형광단백질(GFP)이 발현된 미토콘드리아로부터 작은 미토콘드리아가 또는 미토콘드리아 유래 소포체(mitochondria-derived vesicles, MDVs) (도 3의 화살표)가 활발하게 분비되는 것을 확인할 수 있다.
실시예 3: 조골세포 분화 과정 중 조골세포 내부 및 외부에서의 미토콘드리아 유래 소포체의 확인
실시예 1에 기재된 바와 같이, 형질전환 마우스(Col1a1-Cre; Igs1CKI - mito - GFP /+)의 두개골에서 추출한 조골세포에서 골형성을 유도한 후, 조골세포 내부와 외부의 세포구조물들을 투과전자현미경으로 관찰하여, 그 결과를 도 4a, 4b, 및 4c에 나타내었다. 도 4a에서 나타난 바와 같이, 조골세포 내부에서 미토콘드리아 유래 소포체와 작은 미토콘드리아가 상대적으로 큰 미토콘드리아로부터 분리되어 나오는 것을 확인할 수 있다. 도 4b에서 나타난 바와 같이, 조골세포 내부에 전자밀도가 높아 진하게 보이는 작은 미토콘드리아가 많이 생성되어있는 것을 확인할 수 있다. 도 4c에서 나타난 바와 같이, 조골세포 밖의 골형성이 유도되는 부위에서 미토콘드리아 유래 소포체 및/또는 작은 미토콘드리아들이 콜라겐 섬유 근처에 분비된 것을 확인할 수 있다.
실시예 4: 활성화된 조골세포에서 분비된 미토콘드리아 성분의 골형성 촉진 작용 확인
도 5의 모식도에 나타난 바와 같이 활성화된 조골세포에서 분비된 미토콘드리아 및 미토콘드리아 유래 소포체가 골형성을 유도하는 것을 증명하기 위한 실험을 진행하였다. 도 5는 골형성을 위해 활성화된 조골세포가 분화하는 과정 중에 미토콘드리아가 광범위하게 분열되고, 미토콘드리아 내부에 인산칼슘이 축적된 후, 축적된 인산칼슘을 포함하는 미토콘드리아 유래 소포체 및/또는 작은 미토콘드리아가 미토콘드리아에서 분비되어 세포 외 골기질에서 콜라겐 섬유와 함께 골광화를 촉진하는 과정을 요약한 모식도이다. 이것은 활성화된 조골세포에서 분비된 미토콘드리아, 미토콘드리아 유래 소포체(MDV)와 작은 미토콘드리아가 골형성 유도를 위해 적용될 수 있음을 암시한다.
먼저, 실시예 1에 기재된 바와 형질전환 마우스(Col1a1-Cre; Igs1CKI - mito - GFP /+)의 두개골에서 얻은 세포로부터 초고속 유세포 자동 분리기(Fluorescence-activated cell sorting, FACS)를 이용하여 조골세포를 추출하였다 (도 6a 참조). 구체적으로, 두개골로부터 얻은 세포들 중 살아있으면서, 비슷한 크기와 모양을 가지고 있는 세포들(도 6c의 P1~P4)을 분리하고, 이 중에서 녹색형광단백질이 발현되고 있는 조골세포(GFP positive Osteoblasts; 도 6b 및 6c의 화살표로 표지된 P6)만을 분리하였다. 상기 FACS 과정과 이로부터 얻어진 유세포 분석 결과를 도 6b, 6c, 및 6d에 나타내었다. 도 6b, 6c, 및 6d에 나타난 바와 같이, 분리된 조골세포는 화살표로 표시된 P6 population에 해당하며, 총 세포 중 약 3.1%를 차지하였다.
또한, 활성화된 조골세포(조골세포 분화용 배지에서 분화가 유도된 조골세포)의 배양 배지를 모아 조골세포에서 분비된 미토콘드리아 및 미토콘드리아 유래 소포체를 추출한 후, 조골세포의 분화용 배지에 상기 추출된 미토콘드리아 및 미토콘드리아 유래 소포체를 첨가하여 골형성을 평가하였다. 보다 구체적으로, 조골세포 분화용 배지에서 분화를 유도시킨 활성화된 조골세포의 배양 배지를 수집한 후, 700×g 속도로 10분간 4℃에서 냉장원심분리하여 세포를 침전시키고 (도 7에 세포 펠렛으로 표시됨(핵 포함)), 상청액만 모아 죽은 세포는 버리고, 다시 13,000×g 속도로 10분간 냉장원심분리하여, 미토콘드리아 및 미토콘드리아 유래 소포체를 포함하는 펠렛(도 7에 미토콘드리아 펠렛으로 표시됨; 미토콘드리아 기질 부위가 녹색(GFP)으로 표지됨)을 얻었다.
상기 얻어진 펠렛(57.5 cm2 면적의 배양접시의 10 mL의 분화 배양액으로부터 추출)을 200 ㎕의 조골세포 분화용 배지로　재부유(resuspension)시킨 후, 0.75 cm2 면적의 배양접시에서 배양한 골형성을 새로 유도하는 조골세포에 첨가하였다. 조직에 적용하고자 할 때에는 생콜라겐 시트지를 재부유 용액으로 적신 후에 골형성 유도부위에 위치시킨 후 봉합한다. 상기 조골세포로부터 미토콘드리아 및 미토콘드리아 유래 소포체를 분리하는 과정과 얻어진 결과를 도 7에 나타내었다.
상기 미토콘드리아 및 미토콘드리아 유래 소포체의 골형성(osteogenesis) 활성을 확인하기 위하여, 골형성 마커인 alkaline phosphatase(ALP)를 검출하였다. 구체적으로, 도 8a에서와 같이 조골세포 분화 배양액에 미토콘드리아 펠렛을 처리한 후 3일째에 alkaline phosphatase (ALP) 염색을 수행하였다. ALP 염색은 1 mg의 Naphthol AS-MX phosphate (Sigma)를 100 μL의 N,N-dimethylformamide (Sigma)에 용해시킨 후, 2 mL의 0.1% Fast blue BB salt (Sigma) 용액을 첨가한 후 37℃에서 30분 동안 진행하였다. 비교를 위하여 미토콘드리아 펠렛을 처리하지 않은 조골세포 분화 배양액을 사용하여 동일한 시험을 수행하였다. 상기 얻어진 결과를 도 8b에 나타내었다. 도 8b에서 나타난 바와 같이, 대조군과 비교하여, 미토콘드리아 펠렛이 첨가된 분화배양액에서 자란 조골세포의 골형성 능력이 확연히 증진된 것을 확인할 수 있다.
또한, 조골세포에서 분리된 미토콘드리아 및 미토콘드리아 유래 소포체의 골형성(osteogenesis) 활성을 조골세포 분화와 관련된 대표적인 유전자 마커인 Alpl, Runx2, 및 Sp7의 발현수준으로 측정하였다. 구체적으로, 도 8a에서와 같이, 미토콘드리아 펠렛 처리 후 3일째에 실시간 중합효소 연쇄반응(qRT-PCR)을 수행하여 Alpl, Runx2, 및 Sp7의 발현 수준을 측정하였다. 비교를 위하여 미토콘드리아 펠렛을 처리하지 않은 조골세포 분화 배양액을 사용하여 동일한 시험을 수행하였다. 상기 qRT-PCR에 사용된 프라이머 서열은 다음과 같다: Alpl F_primer: CCAACTCTTTTGTGCCAGAGA, Alpl R_primer: GGCTACATTGGTGTTGAGCTTTT, Runx2 F_primer: TTCTCCAACCCACGAATGCAC, Runx2 R_primer: CAGGTACGTGTGGTAGTGAGT, Sp7 F_primer: CGCATCTGAAAGCCCACTTG, Sp7 R_primer: CAGCTCGTCAGAGCGAGTGAA.
상기 얻어진 결과를 도 8c에 나타내었다. 도 8c에서 나타난 바와 같이, 대조군에 비해, 미토콘드리아 펠렛이 첨가된 분화 배양액에서 자란 조골세포에서 조골세포분화와 관련된 대표적인 유전자(Alpl, Runx2, Sp7)의 발현이 유의미하게 증가한 것을 확인할 수 있다.　
도 8b 및 8c에 나타난 결과는 조골세포 분화배양액에 추출된 미토콘드리아 펠렛을 첨가한 후 단 3일 만에 얻은 것이어서, 조골세포에서 추출된 미토콘드리아 및 미토콘드리아 유래 소포체가 골형성 유도능이 매우 우수함을 증명하며, 골질환 예방 또는 치료에 유용하게 활용될 수 있음을 시사한다.

Claims (27)

  1. 조골세포 유래의 미토콘드리아를 포함하는, 골형성을 위한 약학적 조성물.
  2. 제1항에 있어서, 상기 조골세포 유래의 미토콘드리아는,
    (1) 조골세포로부터 분리 또는 분비된 미토콘드리아,
    (2) 상기 (1)의 미토콘드리아 유래의 소포체, 또는
    (3) 상기 (1) 및 (2)의 조합
    을 포함하는 것인, 약학적 조성물.
  3. 제1항에 있어서, 상기 조골세포 유래의 미토콘드리아는 조골세포의 배양물, 용해물, 또는 파쇄물을 1차 원심분리하여 얻어진 상청액을 2차 원심분리하여 얻어진 펠렛 또는 상기 펠렛을 포함하는 현탁액 형태로 상기 약학적 조성물에 포함되는 것인, 약학적 조성물.
  4. 제5항에 있어서, 상기 1차 원심분리는 0 내지 10℃에서 1 내지 50분 동안 100 내지 2,000×g 속도로 수행되는 것인, 약학적 조성물.
  5. 제3항에 있어서, 상기 2차 원심분리는 0 내지 10℃에서 1 내지 50분 동안 3,000 내지 20,000×g 속도로 수행되는 것인, 약학적 조성물.
  6. 조골세포 유래의 미토콘드리아를 포함하는, 골질환의 예방 또는 치료를 위한 약학적 조성물.
  7. 제6항에 있어서, 상기 조골세포 유래의 미토콘드리아는,
    (1) 조골세포로부터 분리 또는 분비된 미토콘드리아,
    (2) 상기 (1)의 미토콘드리아 유래의 소포체, 또는
    (3) 상기 (1) 및 (2)의 조합
    을 포함하는 것인, 약학적 조성물.
  8. 제6항에 있어서, 상기 조골세포 유래의 미토콘드리아는 조골세포의 배양물, 용해물, 또는 파쇄물을 1차 원심분리하여 얻어진 상청액을 2차 원심분리하여 얻어진 펠렛 또는 상기 펠렛을 포함하는 현탁액 형태로 상기 약학적 조성물에 포함되는 것인, 약학적 조성물.
  9. 제8항에 있어서, 상기 1차 원심분리는 0 내지 10℃에서 1 내지 50분 동안 100 내지 2,000×g 속도로 수행되는 것인, 약학적 조성물.
  10. 제8항에 있어서, 상기 2차 원심분리는 0 내지 10℃에서 1 내지 50분 동안 3,000 내지 20,000×g 속도로 수행되는 것인, 약학적 조성물.
  11. 제6항 내지 제10항 중 어느 한 항에 있어서, 상기 골질환은 골절, 골파괴증, 골다공증, 골연화증, 골관절염, 류머티즘 관절염, 또는 골형성 장애인, 약학적 조성물.
  12. 조골세포 유래의 미토콘드리아를 골형성을 필요로 하는 개체에 투여하는 단계를 포함하는, 골형성 방법.
  13. 제12항에 있어서, 상기 조골세포 유래의 미토콘드리아는,
    (1) 조골세포로부터 분리 또는 분비된 미토콘드리아,
    (2) 상기 (1)의 미토콘드리아 유래의 소포체, 또는
    (3) 상기 (1) 및 (2)의 조합
    을 포함하는 것인, 방법.
  14. 제12항에 있어서, 상기 조골세포 유래의 미토콘드리아는 조골세포의 배양물, 용해물, 또는 파쇄물을 1차 원심분리하여 얻어진 상청액을 2차 원심분리하여 얻어진 펠렛 또는 상기 펠렛을 포함하는 현탁액 형태인, 방법.
  15. 제14항에 있어서, 상기 1차 원심분리는 0 내지 10℃에서 1 내지 50분 동안 100 내지 2,000×g 속도로 수행되는 것인, 방법.
  16. 제14항에 있어서, 상기 2차 원심분리는 0 내지 10℃에서 1 내지 50분 동안 3,000 내지 20,000×g 속도로 수행되는 것인, 방법.
  17. 조골세포 유래의 미토콘드리아를 포함하는, 골질환의 예방 또는 치료 방법.
  18. 제17항에 있어서, 상기 조골세포 유래의 미토콘드리아는,
    (1) 조골세포로부터 분리 또는 분비된 미토콘드리아,
    (2) 상기 (1)의 미토콘드리아 유래의 소포체, 또는
    (3) 상기 (1) 및 (2)의 조합
    을 포함하는 것인, 방법.
  19. 제17항에 있어서, 상기 조골세포 유래의 미토콘드리아는 조골세포의 배양물, 용해물, 또는 파쇄물을 1차 원심분리하여 얻어진 상청액을 2차 원심분리하여 얻어진 펠렛 또는 상기 펠렛을 포함하는 현탁액 형태인, 방법.
  20. 제19항에 있어서, 상기 1차 원심분리는 0 내지 10℃에서 1 내지 50분 동안 100 내지 2,000×g 속도로 수행되는 것인, 방법.
  21. 제19항에 있어서, 상기 2차 원심분리는 0 내지 10℃에서 1 내지 50분 동안 3,000 내지 20,000×g 속도로 수행되는 것인, 방법.
  22. 제17항에 있어서, 상기 골질환은 골절, 골파괴증, 골다공증, 골연화증, 골관절염, 류머티즘 관절염, 또는 골형성 장애인, 방법.
  23. 조골세포의 배양물, 용해물, 또는 파쇄물을 1차 원심분리하는 단계;
    상기 1차 원심분리에 의하여 얻어진 상청액을 2차 원심분리하는 단계; 및
    최종적으로 얻어진 펠렛을 분리하는 단계
    를 포함하는, 조골세포 유래의 미토콘드리아의 제조 방법.
  24. 제23항에 있어서, 상기 1차 원심분리는 0 내지 10℃에서 1 내지 50분 동안 100 내지 2,000×g 속도로 수행되는 것인, 방법.
  25. 제23항에 있어서, 상기 2차 원심분리는 0 내지 10℃에서 1 내지 50분 동안 3,000 내지 20,000×g 속도로 수행되는 것인, 방법.
  26. 제23항에 있어서, 상기 조골세포 유래의 미토콘드리아는 골형성 또는 골질환 치료에 사용하기 위한 것인, 방법
  27. (a) Cre 재조합효소가 발현되는 세포 또는 상기 세포 내 미토콘드리아 기질에서만 조건부로 형광 단백질을 발현하도록 조작된 형질전환 동물과 조골세포 특이적으로 Cre 재조합효소를 발현하도록 조작된 형질전환 동물을 교배시켜, 조골세포 또는 조골세포의 미토콘드리아 기질에서만 상기 형광 단백질을 발현하는 형질전환 동물을 준비하는 단계, 및
    (b) 상기 준비된 형질전환 동물에서 얻어진 골 시료 (예컨대, 두개골 조각 등)로부터 형광 단백질을 발현하는 조골세포를 분리하는 단계
    를 포함하는, 조골세포 분리 방법.
PCT/KR2020/007015 2019-05-30 2020-05-29 조골세포 유래 미토콘드리아를 포함하는 골형성 촉진을 위한 약학적 조성물 WO2020242250A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US17/614,635 US20220226387A1 (en) 2019-05-30 2020-05-29 Pharmaceutical composition for promoting osteogenesis, comprising osteoblast-derived mitochondria
KR1020217039080A KR20220003058A (ko) 2019-05-30 2020-05-29 조골세포 유래 미토콘드리아를 포함하는 골형성 촉진을 위한 약학적 조성물

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0063976 2019-05-30
KR20190063976 2019-05-30

Publications (1)

Publication Number Publication Date
WO2020242250A1 true WO2020242250A1 (ko) 2020-12-03

Family

ID=73552393

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/007015 WO2020242250A1 (ko) 2019-05-30 2020-05-29 조골세포 유래 미토콘드리아를 포함하는 골형성 촉진을 위한 약학적 조성물

Country Status (3)

Country Link
US (1) US20220226387A1 (ko)
KR (1) KR20220003058A (ko)
WO (1) WO2020242250A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024010866A1 (en) * 2022-07-07 2024-01-11 Luca Science Inc. Redox-modulating organelle complexes

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240066506A (ko) 2022-11-01 2024-05-16 가톨릭대학교 산학협력단 비타민 e를 유효성분으로 포함하는 줄기세포 스페로이드의 골분화 촉진용 조성물

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008137035A1 (en) * 2007-05-02 2008-11-13 The Mclean Hospital Corporation Methods and compositions for mitochondrial replacement therapy
KR20150093640A (ko) * 2015-07-31 2015-08-18 (주)아모레퍼시픽 미토콘드리아 활성화를 위한 조성물
KR20180054522A (ko) * 2016-11-14 2018-05-24 주식회사 파이안바이오테크놀로지 외래 미토콘드리아를 세포로 전달하는 방법
KR20180071030A (ko) * 2016-12-19 2018-06-27 차의과학대학교 산학협력단 미토콘드리아를 포함하는 허혈성 질환 예방 또는 치료용 조성물

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3549589A4 (en) * 2016-11-30 2020-07-15 Paean Biotechnology Inc. PHARMACEUTICAL COMPOSITION WITH MITOCHONDRIA

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008137035A1 (en) * 2007-05-02 2008-11-13 The Mclean Hospital Corporation Methods and compositions for mitochondrial replacement therapy
KR20150093640A (ko) * 2015-07-31 2015-08-18 (주)아모레퍼시픽 미토콘드리아 활성화를 위한 조성물
KR20180054522A (ko) * 2016-11-14 2018-05-24 주식회사 파이안바이오테크놀로지 외래 미토콘드리아를 세포로 전달하는 방법
KR20180071030A (ko) * 2016-12-19 2018-06-27 차의과학대학교 산학협력단 미토콘드리아를 포함하는 허혈성 질환 예방 또는 치료용 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KALANI, ANURADHA, KAMAT PRADIP K., VOOR MICHAEL J., TYAGI SURESH C., TYAGI NEETU: "Mitochondrial epigenetics in bone remodeling during hyperhomocysteinemia", MOL. CELL BIOCHEM, vol. 295, 18 June 2014 (2014-06-18), pages 89 - 98, XP055764739, DOI: 10.1007/s11010-014-2114-3 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024010866A1 (en) * 2022-07-07 2024-01-11 Luca Science Inc. Redox-modulating organelle complexes

Also Published As

Publication number Publication date
KR20220003058A (ko) 2022-01-07
US20220226387A1 (en) 2022-07-21

Similar Documents

Publication Publication Date Title
Hu et al. Central migration of neuronal tissue and embryonic stem cells following transplantation along the adult auditory nerve
WO2015088288A1 (ko) 트롬빈을 이용한 줄기세포 유래 엑소좀의 생성 촉진 방법
WO2020242250A1 (ko) 조골세포 유래 미토콘드리아를 포함하는 골형성 촉진을 위한 약학적 조성물
WO2013025042A2 (ko) 줄기세포 유래 미세소포를 포함하는 신경 생성 촉진용 조성물
WO2017179840A1 (ko) 트롬빈 처리 줄기세포에서 유래된 엑소좀을 포함하는 만성폐질환 치료용 조성물
WO2019151840A1 (ko) 분리된 미토콘드리아를 포함하는 류마티스 관절염 예방 또는 치료용 약학 조성물
WO2013133494A1 (ko) 지방유래 줄기세포 배양액, 이의 제조방법, 및 이를 포함하는 발모촉진용 조성물
WO2017131352A1 (ko) 줄기세포로부터 추출된 엑소좀을 함유하는 베이지 지방세포 분화 유도용 조성물
WO2019107939A1 (ko) 줄기세포 유래 엑소좀 생성 촉진용 조성물
WO2021210872A1 (ko) 트롬빈 처리 줄기세포에서 유래된 엑소좀을 포함하는 당뇨병성 피부질환 예방 또는 치료용 조성물
Serrano Martinez et al. Mouse parotid salivary gland organoids for the in vitro study of stem cell radiation response
WO2020111507A1 (ko) 오가노이드의 생체 이식용 조성물
WO2013085303A1 (ko) 개과동물 양막-유래 다분화능 줄기세포
WO2018030630A1 (ko) Sox 유전자가 이입된 비바이러스성 미니써클 벡터 및 이의 제조방법
WO2012008733A2 (ko) 1기 태반조직 유래 줄기세포 및 이를 함유하는 세포치료제
EP1272203B1 (en) Treatment of neurodegenerative gastrointestinal disorders by implanting neural stem cells and/or progeny thereof into gastrointestinal organs
WO2017078439A1 (ko) 췌장소도세포 및 엘라스틴 유사 인공 세포외 기질을 포함하는 당뇨병 치료용 약학적 조성물
WO2020122405A1 (ko) 역분화 줄기세포 유래 중간엽 줄기세포를 포함하는 염증성 질환의 예방 또는 치료용 조성물
WO2014051338A2 (ko) 말초혈액 단핵세포를 유효성분으로 포함하는 예방 또는 치료용 약제학적 조성물
WO2018093233A1 (ko) 지방줄기세포유래 엑소좀을 유효성분으로 포함하는 간 섬유증 예방 또는 치료용 조성물
WO2018124749A1 (ko) 세포 투과능 및 골조직 재생능을 가지고 있는 이중 기능성 신규 펩타이드 및 이의 용도
WO2014042292A1 (ko) 단백질 인산화효소 c 활성화제를 포함하는 줄기세포 부착 촉진용 조성물 및 줄기세포의 부착 촉진 방법
WO2019221477A1 (ko) 전구세포 배양액 및 다층 그래핀 필름을 포함하는 줄기세포 분화 촉진용 조성물 및 이의 용도
US20040115808A1 (en) Enteric nervous system derived stem and progenitor cells and uses thereof
WO2019168364A1 (ko) 줄기세포의 티오레독신 발현을 증진시키는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20814625

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 20217039080

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20814625

Country of ref document: EP

Kind code of ref document: A1