WO2020242147A1 - 마이셀 구조의 나노 전달체 및 이의 용도 - Google Patents

마이셀 구조의 나노 전달체 및 이의 용도 Download PDF

Info

Publication number
WO2020242147A1
WO2020242147A1 PCT/KR2020/006713 KR2020006713W WO2020242147A1 WO 2020242147 A1 WO2020242147 A1 WO 2020242147A1 KR 2020006713 W KR2020006713 W KR 2020006713W WO 2020242147 A1 WO2020242147 A1 WO 2020242147A1
Authority
WO
WIPO (PCT)
Prior art keywords
nanosome
nanosomes
present
lipopeptide
hyparnp
Prior art date
Application number
PCT/KR2020/006713
Other languages
English (en)
French (fr)
Inventor
김용호
서민아
강은성
남지영
이복수
배도현
김한주
이재철
이은아
탁츙탄
Original Assignee
주식회사 아임뉴런바이오사이언스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 아임뉴런바이오사이언스 filed Critical 주식회사 아임뉴런바이오사이언스
Priority claimed from KR1020200061614A external-priority patent/KR20200135224A/ko
Publication of WO2020242147A1 publication Critical patent/WO2020242147A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
    • A61K47/12—Carboxylic acids; Salts or anhydrides thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/42—Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/12—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by a special physical form, e.g. emulsion, microcapsules, liposomes, characterized by a special physical form, e.g. emulsions, dispersions, microcapsules
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/107—Emulsions ; Emulsion preconcentrates; Micelles

Definitions

  • the present invention relates to a micelle-structured nanocarrier and its use, and more specifically, to a single-layered nanosome for delivering macromolecules and its use as a drug carrier, contrast agent, and therapeutic composition.
  • DDS drug delivery system
  • a drug delivery system using a polymer is to deliver a substance to a desired target by enclosing a drug around it with a polymer substance.
  • Polymers used for this are usually synthetic polymers, proteins, micelles, liposomes, and antibodies.
  • the principle is that drugs are covalently bonded to polymers or made into capsules. .
  • polyethylene glycol PEG
  • polyglutamate polyglutamate
  • HA hyaluronic acid
  • polyethylene glycol is a very suitable polymer for the human body, it does not decompose in the body and is mainly excreted through the kidneys, so it has a problem that it can accumulate in our body.
  • the liposome is a carrier containing a lipid bilayer and maintains its functionality through the fat component. Liposomes have the advantage of being capable of targeted delivery to specific cells, tissues, and organs as well as large doses of drugs (Pol. J. Pharmacol. 2003, 55, 1063-1070). However, liposome-mediated drug delivery has disadvantages that absorption is delayed, distribution is limited, metabolic rate is low, and is trapped in cells of the liver or spleen and is quickly removed from the blood.
  • gene editing/correction technology based on gene scissors technology called CRISPR/Cas9 is currently the most spotlighted technology worldwide as an innovative gene therapy and correction technology that can be applied to various diseases.
  • the disease treatment technology using in vivo gene editing technology is a technology that can effectively correct the wrong gene in the living body and directly treat the wrong gene.It is a technology that can treat the root cause of the disease in a disease induced by a gene abnormality that was classified as an incurable disease. It is in the limelight as a way to do it.
  • there is a problem to be solved such as efficient delivery of the gene editing system to the body, and research on various delivery systems to solve this is in progress, but an efficient delivery system has not yet been established.
  • the present invention is the nanosome; And it is another object to provide a nanosome complex comprising a biologically active material enclosed in the nanosome.
  • another object of the present invention is to provide a contrast medium composition comprising the nanosomes.
  • Another object of the present invention is to provide a pharmaceutical composition comprising the nanosome complex as an active ingredient.
  • the nanosomes may include fatty acids: lipopeptide in a molar ratio of 1: 0.01 to 1: 1.
  • the nanosome may have a size of 1 to 2000 nm.
  • the present invention provides a nanosome complex comprising the nanosome and a biologically active material enclosed in the nanosome.
  • the biologically active substance is a chemical compound, protein, glycoprotein, peptide, antibody, enzyme, nuclease, hormone, DNA, RNA, siRNA. (small interfering RNA), miRNA (microRNA), mRNA (messenger RNA), antisense oligonucleotides, aptamers, cytokines, transcription factors, toxins, carbohydrates, lipids, natural products ), a semi-synthetic drug, a drug, a microparticle, a nanoparticle, and a virus.
  • siRNA small interfering RNA
  • miRNA miRNA
  • miRNA miRNA
  • mRNA messenger RNA
  • antisense oligonucleotides aptamers
  • cytokines transcription factors
  • toxins carbohydrates
  • carbohydrates lipids, natural products
  • semi-synthetic drug a drug, a microparticle, a nanoparticle, and a virus.
  • the composition is composed of a radioactive isotope, an organic fluorescent material, a magnetic resonance imaging (MRI) contrast agent, a computed tomography (CT) contrast agent, a positron tomography (PET) contrast agent, an ultrasonic contrast agent, and a fluorescent contrast agent.
  • MRI magnetic resonance imaging
  • CT computed tomography
  • PET positron tomography
  • ultrasonic contrast agent an ultrasonic contrast agent
  • fluorescent contrast agent a fluorescent contrast agent.
  • One or more labeling substances selected from the group may be included.
  • the present invention provides a pharmaceutical composition comprising the nanosome complex as an active ingredient.
  • 3A is a result of measuring the hydrodynamic diameter of each C8dNP2, C10NP2, and C14dNP2 lipopeptide-based nanosome by dynamic light scattering (DLS).
  • DLS dynamic light scattering
  • FIG. 3B shows a transmission electron microscope (TEM) image of each lipopeptide-based nanosome of FIG. 3A.
  • 5A is a result of measuring the diameter of a nanosome encapsulated with HypaRNP composed of various molar ratios (25:1, 50:1, 100:1) of C8dNP2 lipopeptide and HypaRNP by dynamic light scattering method.
  • Figure 5b is a result of observing the nanosomes of the 50:1 ratio of Figure 5a with a transmission electron microscope.
  • 5C is a result of confirming whether Cy3-HypaRNP is stably encapsulated in C8dNP2 lipopeptide-based nanosomes through UV-visible spectrophotometry analysis.
  • 5D is a result of analyzing whether or not the secondary structure of HypaRNP changes according to nanosome encapsulation through circular dichroism measurement.
  • 5E is a result of analyzing the morphology and molecular mass of C8dNP2 lipopeptide-based nanosomes through SAXS measurement.
  • 5F is a result of analyzing the atomic pair distribution function from the SAXS measurement of FIG. 5E.
  • 6A is a result of analyzing cytotoxicity by measuring eGFP intensity and cell viability after treatment with C8dNP2 lipopeptide-based nanosomes at concentrations (0, 10, 25, 50, 75, 100 ⁇ M) in eGFP-reporter HEK cells to be.
  • Figure 8a is a lipopeptide-based nanometer by observing the expression level of eGFP protein under a confocal microscope after processing and culturing HypaRNP (Unencapsulated HypaRNP) or HypaRNP-encapsulated nanosomes (Encapsulated RNP) not encapsulated in eGFP-reporter HEK cells. This is the result of analyzing the gene editing efficiency of HypaRNP delivered through moth.
  • Figure 8b is a picture showing the measurement principle of eGFP-negative cells including insertion/deletion mutations by RNP through flow cytometry, and a result of measuring the frequency of eGFP-negative cells in the control and each experimental group.
  • Figures 8c and 8d are respectively eGFP-reporter HEK cells (Fig. 8c) and eGFP-reporter glioblastoma cells (Fig. 8D) of the insertion / deletion mutations on the eGFP target gene induced by the delivery of the nanosome-mediated HypaRNP according to the present invention. This is the result showing the frequency.
  • the present invention relates to nanosomes that can be usefully used in research fields, diagnosis or treatment fields of various diseases, etc., and more specifically, the present inventors provide excellent mass transfer efficiency of lipopeptide-based nanosomes in which peptides and fatty acids are bound. By confirming, the present invention was completed.
  • the present invention provides a nanosome for mass transfer, characterized in that lipopeptide and fatty acid form a micelle structure.
  • the nanosome of the present invention is characterized in that the lipopeptide in which a peptide and a fatty acid are conjugated by a peptide bond, and a fatty acid in a form that is not bonded to the peptide are arranged to generate a hydrophobic nucleus, and have a spherical monolayer micelle structure. do.
  • the lipopeptide and the fatty acid may be arranged to be suitable for generating a hydrophobic nucleus, and for example, may be arranged regularly or randomly.
  • peptide is a polymer of amino acids, and usually a form in which a few amino acids are linked is called a peptide, and when many amino acids are linked, it is called a protein.
  • Linkages between amino acids in the structure of these peptides and proteins consist of an amide bond or a peptide bond.
  • Peptide bonds are bonds that form -CO-NH- after water (H 2 O) escapes between the carboxyl group (-COOH) and the amino group (-NH 2 ).
  • the type of peptide is not particularly limited, but a cell-penetrating peptide may be preferably used.
  • cell permeability refers to the ability or property of a peptide to penetrate cells (membrane) and penetrate into cells.
  • the cell-penetrating peptide is not particularly limited as long as it has a cell-penetrating ability, and may be appropriately selected by a person of ordinary skill in the art to achieve a desired purpose.
  • Non-limiting examples thereof include, KIKKVKKKGRKKIKKVKKKGRK (SEQ ID NO: 1), RIKRVKKRGRR (SEQ ID NO: 2), RIRRVRRRGRR (SEQ ID NO: 3), RWKRWKKRGRR (SEQ ID NO: 4), KWKKWKKKGRK (SEQ ID NO: 5), KIKKGRK (SEQ ID NO: 5), KIKKV LIKLVKKLGRL (SEQ ID NO: 7), GHEARLKADEESVYKG (SEQ ID NO: 8), GHEAALKADEESVYKG (SEQ ID NO: 9), DHEAALKADEESVYKG (SEQ ID NO: 10), or DPHEAALKADEESVYKGR (SEQ ID NO: 11)
  • the cell-penetrating peptide is 70% or more, preferably 80% or more, more preferably 90% or more, most preferably 91%, 92%, 93, respectively, with the amino acid sequence represented by SEQ ID NO: 1 to 11 %, 94%, 95%, 96%, 97%, 98%, 99% or more may include amino acid sequences having sequence homology.
  • the peptides of the present invention can be produced so that the purity of each peptide is 90% or more through a conventional peptide synthesis method or manufacturing method known to those skilled in the art. For example, it can be synthesized directly or purchased and used after requesting manufacture from a peptide manufacturer. .
  • the peptide is a peptide composed of D-form or L-form, only part of the sequence D-form or L-form through a conventional peptide synthesis method or manufacturing method known to those skilled in the art, or all of them in the form of racemics. I can.
  • other conventional modifications known in the art are possible in order to increase the stability of the peptide.
  • the peptide is preferably synthesized by using a solid phase peptide synthesis method, but the method and conditions for peptide synthesis are not limited thereto as described above.
  • the "fatty acid” refers to a carboxylic acid (R-COOH) in which carbon atoms are connected in a chain shape, and is produced by hydrolysis of fat. Most naturally occurring fatty acids are made up of an even number of carbon molecules, up to 4 to 28, and most fatty acids have 18 carbons, and the simplest form of fatty acid is acetic acid (CH 3 -COOH).
  • the fatty acid includes all of the fatty acids constituting the nanosomes according to the present invention, and specifically, refers to both the fatty acid constituting the lipopeptide and the fatty acid not bound to the peptide.
  • the fatty acid may preferably be a saturated fatty acid.
  • the saturated fatty acid is one having a single bond between all carbons and carbons, and may be one having a carbon number of C1 to C20, preferably C1 to C18, more preferably C6 to C18, such as octanoic acid, It may be capric acid, decanoic acid, myristic acid, or tetradecanoic acid, but is not limited thereto.
  • micelle refers to an aggregate in which surfactants are collected at a certain concentration or higher.
  • a surfactant when dissolved in water, when the concentration is higher than a certain concentration, the hydrophobic part forms a nucleus and the hydrophilic part forms a surface in contact with water. Is done.
  • a fatty acid which is a hydrophobic moiety, is located on the inner side of the micelle structure, and the peptide is located on the surface, and a space in which the fatty acid is located includes a space for encapsulating a material.
  • nanosomes may be mixed with the micelles or nanoparticles, and refer to particles having a size of several to several thousand nanometers (nm, a substance of one billionth of a meter).
  • the nanosome has a particle size of 1 to 2000 nm, 1 to 1000 nm, 1 to 500 nm, 1 to 400 nm, 1 to 200 nm, 1 to 100 nm, 1 to 80 nm, 1 to 70 nm , 1 to 50 nm, 10 to 50 nm, 20 to 50 nm, or 25 to 45 nm, but is not limited thereto.
  • the nanosome of the present invention may be an artificial construct through artificial complexation of the above-described components constituting it, or may be a natural construct generated from and secreted from cells through the composition of a specific condition (environment).
  • C8dNP2 and C10dNP2 were measured to be about 27.2 and 30 nm, respectively, and it was confirmed that nanosomes were formed through TEM images. Furthermore, in order to evaluate the effect of the nanosomes as a mass carrier according to the present invention, a nanosome complex encapsulating the Cas9 RNP complex was prepared.To this end, the C8dNP2 lipopeptide that best formed the nanosomes was selected and the C8dNP2-based nanosomes were used. Was used (see Example 2).
  • HypaCas9-NLS having a structure as shown in FIG. 1 was prepared and a nanosome containing its RNP complex (HypaRNP)
  • HypaRNP nanosome containing its RNP complex
  • the eGFP-reporter HEK cells were treated with nanosomes encapsulated with HypaRNP to confirm excellent cellular uptake and delivery efficiency of nanosome-mediated HypaRNP (see Example 5-2).
  • the present invention is the nanosome; And it provides a nanosome complex comprising a biologically active material enclosed in the nanosome.
  • the nanosome complex is prepared by encapsulating a biologically active material inside the nanosome through ultrasonic treatment, but is not limited thereto, and a method and conditions for specific encapsulation can be appropriately selected and applied by a person skilled in the art. have.
  • the size of the entire nanosome can be controlled by adjusting the length of the alkyl chain of the fatty acid constituting the nanosome.
  • the length of the alkyl chain may be appropriately selected or adjusted by those skilled in the art according to the characteristics and environment of the material to be delivered.
  • the molar ratio of fatty acids constituting the nanosomes and lipopeptides can be adjusted.
  • the fatty acid: lipopeptide can be adjusted in a molar ratio of 1: 0.01 to 1: 1, and the skilled person can adjust it by selecting an appropriate ratio in consideration of conditions such as a substance to be delivered and a target cell.
  • the molar ratio between the lipopeptide and the biologically active substance can be adjusted for effective substance encapsulation of nanosomes and effective transport of substances into cells, which is dependent on characteristics such as size and molecular weight of the substance to be delivered. Accordingly, it can be easily adjusted by those skilled in the art.
  • lipopeptide: Cas9 protein is 20:1 to 500:1, 20:1 to 400:1, 20:1 to 300 :1, 20:1 ⁇ 200:1, 30:1 ⁇ 200:1, 30:1 ⁇ 150:1, 30:1 ⁇ 100:1, 30:1 ⁇ 90:1, 30:1 ⁇ 80:1 , 30:1 to 70:1, 30:1 to 60:1, 40:1 to 60:1, and most preferably, may be included in a molar ratio of 45:1 to 55:1, but is not limited thereto.
  • the nucleases are Cas9 (CRISPR-associated protein 9), Cas3 (CRISPR-associated nuclease/helicase Cas3), CAS12, CAS13, CAS14, CAS variants, Cfp1 (CxxC-finger protein-1), ZFN (Zinc finger nuclease).
  • TALEN Transcription activator-like effector nuclease
  • the drugs are chemical drugs, biodrugs, nucleic acid drugs, peptide drugs, protein drugs, natural product drugs, and hormones.
  • hormone contrast agent
  • contrast agent contrast agent
  • biopharmaceutical refers to various biopharmaceuticals such as (original) biologics and biogenerics, biobetters, and biosuperiors.
  • the biodrug refers to any drug prepared, secreted or semi-synthesized from a biological origin, and includes all of vaccines, blood products, antigens, cell products, gene therapy products, stem cells, and the like, but is not limited thereto.
  • the nanoparticles may be selected from the group consisting of iron oxide, gold, carbon nanotubes, and magnetic beads, but are not limited thereto.
  • the biologically active material encapsulated in the nanosome may be, for example, a Cas9 protein.
  • the Cas9 protein may include or consist of an amino acid sequence represented by SEQ ID NO: 32 (PDB code: 5F9R), but is not limited thereto.
  • the Cas9 protein may include all variants thereof.
  • the peptide may include an amino acid sequence having sequence homology of 70% or more, more preferably 80% or more, and most preferably 90% or more with the amino acid sequence of SEQ ID NO: 32.
  • sequence homology includes a polypeptide having, and refers to a polypeptide that exhibits substantially the same physiological activity as the polypeptide represented by SEQ ID NO: 32.
  • the functional equivalent may be generated as a result of addition, substitution or deletion of some of the amino acid sequences of each of the GRS, LRS and IRS.
  • the variant of the Cas9 protein according to the present invention may be a mutation in the amino acid sequence of K848A / K1003A / R1060A / N497A / R661A / Q695A / Q926A.
  • the Cas9 variant may be a nuclear localization signal peptide is additionally linked for efficient gene editing in the nucleus of the cell.
  • Nuclear Localizing Signal may be used interchangeably with various terms such as a nuclear internationalization signal, a nuclear transfer signal, a nuclear transfer sequence, and a nuclear position sequence.
  • Nuclear transfer signals are peptide strands that help various proteins used in the nucleus to be synthesized in the cytoplasm and then transported into the nucleus. As graphene can enter the nucleus, it is possible to enter the nucleus with high resolution and reliability. Nucleic acid can be detected, and nucleic acid in the nucleus can be detected in a short time, so the results of diagnosis of specific diseases and life science experiments can be quickly known.
  • the nuclear localization signal peptide is PKKKRKV (SEQ ID NO: 33), CGGGPKKKRKVED (SEQ ID NO: 34), KR-PAATKKAGQA-KKKK (SEQ ID NO: 35), AVKRPAATKKAGQAKKKKLD (SEQ ID NO: 36), MSRRRKANPTKLSENAKKLAKEVEN (SEQ ID NO: 37), PAAKRVKLD (SEQ ID NO: PAAKR). 38), KLKIKRPVK (SEQ ID NO: 39), GRKKRRQRRRPQ (SEQ ID NO: 40), KIPIK (SEQ ID NO: 41), and the like.
  • the nuclear localization signal peptide may be sequentially linked so that the nuclear localization signal peptide is operable to the Cas9 protein peptide.
  • the nuclear localization signal peptide may be linked using a linker, for example, may be linked using a GGS linker including one or more GGS repeat units, but is not limited thereto.
  • the present invention provides a pharmaceutical composition comprising the nanosome complex as an active ingredient.
  • the pharmaceutical composition of the present invention is a composition for preventing and treating brain diseases, a composition for preventing and treating bacterial infection, a composition for preventing and treating cancer, a composition for preventing and treating pain, depending on the type of drug encapsulated inside the biocompatible polymer.
  • Composition inflammatory disease prevention and treatment composition, interstitial disease prevention and treatment composition, ulcer prevention and treatment composition, depression prevention and treatment composition, allergic disease prevention and treatment composition, arrhythmia prevention and treatment composition, hypertension It can be used as a composition for prevention and treatment, a composition for preventing and treating diabetes, a composition for preventing and treating genetic diseases, or a composition for preventing and treating heart disease.
  • the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier in addition to the nanosome complex encapsulating the drug.
  • a pharmaceutically acceptable carrier is commonly used in preparation, and includes, but is limited to, saline, sterile water, Ringer's solution, buffered saline, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, and the like. It is not, and other conventional additives such as antioxidants and buffers may be further included if necessary.
  • injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets.
  • suitable pharmaceutically acceptable carriers and formulations it can be preferably formulated according to each component using a method disclosed in Remington's literature.
  • the pharmaceutical composition of the present invention is not particularly limited in its formulation, but may be formulated as an injection, an inhalant, an external preparation for skin, or the like.
  • the pharmaceutical composition of the present invention is administered orally or parenterally according to the desired method (e.g., intravenous, subcutaneous, intramuscular, intraperitoneal, intradermal) , Mucosal (mucosal), inhalation (inhalation) or topically applied), the dosage varies depending on the condition and weight of the patient, the severity of the disease, the drug type, the route and time of administration, but appropriately selected by those skilled in the art. Can be.
  • the desired method e.g., intravenous, subcutaneous, intramuscular, intraperitoneal, intradermal
  • Mucosal micosal
  • inhalation inhalation
  • topically applied the dosage varies depending on the condition and weight of the patient, the severity of the disease, the drug type, the route and time of administration, but appropriately selected by those skilled in the art. Can be.
  • the pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount refers to an amount sufficient to treat or diagnose a disease at a reasonable benefit/risk ratio applicable to medical treatment or diagnosis, and the effective dose level is the type of disease, severity, drug Activity, sensitivity to drugs, time of administration, route of administration and rate of excretion, duration of treatment, factors including drugs used concurrently, and other factors well known in the medical field.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or administered in combination with another therapeutic agent, may be administered sequentially or simultaneously with a conventional therapeutic agent, and may be administered single or multiple. It is important to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all the above factors, and this can be easily determined by a person skilled in the art.
  • the effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, sex, condition, body weight, absorption of the active ingredient in the body, inactivation rate and excretion rate, the type of disease, and the drug used in combination, daily or every other day. It can be administered or divided into 1 to 3 times a day. However, since it may increase or decrease depending on the route of administration, the severity of obesity, sex, weight, age, etc., the dosage amount does not limit the scope of the present invention in any way.
  • the present invention provides the use of the pharmaceutical composition for preventing or treating diseases.
  • “individual” refers to a subject in need of treatment of a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses and cattle. Means mammal.
  • the present baldeo provides a contrast medium composition comprising the nanosomes.
  • the contrast agent composition is composed of a radioactive isotope, an organic fluorescent material, a magnetic resonance imaging (MRI) contrast agent, a computed tomography (CT) contrast agent, a positron tomography (PET) contrast agent, an ultrasonic contrast agent, and a fluorescent contrast agent.
  • MRI magnetic resonance imaging
  • CT computed tomography
  • PET positron tomography
  • ultrasonic contrast agent ultrasonic contrast agent
  • fluorescent contrast agent a fluorescent contrast agent.
  • One or more labeling substances selected from the group may be included.
  • the nanosomes of the present invention may be attached to various labeling substances as described above that can be used for image diagnosis, and may be used as a contrast medium composition by using them.
  • radioactive isotope single photon emission computed tomography nuclides 99mTc, 123I, 111In, 67Ga, 177Lu, 201Tl, 117mSn, 125I and positron emission tomography nuclides 11C, 13N, 15O, 18F, 38K, 62Cu, 64Cu, 68Ga, 82Rb, 124I, 89Zr and therapeutic nuclides 131I, 166Ho, 188Re, 67Cu, 89Sr, 90Y, 225Ac, 213Bi, 211At may be used, but are not limited thereto.
  • Radioactive isotopes have been used for a long time because their chemical properties are almost similar to those of non-radioactive isotopes, so that they can be arbitrarily substituted, and their emission energy is relatively large so that a small amount of detection is possible.
  • Organic fluorescent dyes are widely used alternatives to radioactive isotopes.
  • fluorescent materials When fluorescent materials are activated by a specific wavelength, they emit light having a specific wavelength.
  • radioactive materials also exhibit a limit of detection, which requires a long time to search.
  • thousands of photons per molecule can be emitted under appropriate conditions, so even detection at the level of a single molecule is theoretically possible.
  • the type of organic fluorescent material that can be encapsulated or bound to a nanosome is understood as a concept including all materials used in the art or to be used in the future.
  • quantum dots which are semiconductor nanomaterials, are composed of CdSe, CdS, ZnS, ZnSe, and the like, and each emit light of a different color depending on the size and type. Compared to organic fluorescent materials, it has a wider active wavelength and has a narrower emission wavelength, so there are more gadgets emitting other colors than organic fluorescent materials. Therefore, in recent years, quantum dots are widely used as a method to overcome the disadvantages of organic fluorescent materials.
  • quantum dots that can be encapsulated or bonded to nanosomes are understood as a concept including all materials currently used or used in the future.
  • the magnetic resonance imaging (MRI) contrast agent is specifically, transition metal ions including gadolinium (Gd), manganese (Mn), iron (Fe), copper (Cu) and chromium (Cr); A hydrophobic complex of the transition metal ions including gadopentate dimeglumine (Gd-DTPA) and gadoterate meglumine (Gd-DOTA); Fluorine-containing compounds including perfluorocarbon and perfluoropropan; Iron oxide, manganese, copper and chromium nanoparticles; Examples of compounds in which the surface of the nanosome is modified with a hydrophobic material may be exemplified, but are not limited thereto.
  • radioactive isotopes including 99mTc, 123I, 111In, 67Ga, 177Lu, 201Tl, 117mSn, and 125I, and a hydrophobic complex of the radioactive isotope may be used, but are not limited thereto. .
  • the contrast agent composition of the present invention may further include a lubricant, a wetting agent, an emulsifier, a suspending agent, or a preservative in addition to the above components.
  • the contrast agent composition according to the present invention can be prepared as an aqueous solution for parenteral administration.
  • a buffer solution such as Hans solution, Ringers solution, or physically buffered saline may be used.
  • Aqueous injection suspensions may be added with a substrate capable of increasing the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or dextran.
  • contrast agent composition of the present invention may be in the form of a sterile injectable preparation in an aqueous or oily suspension.
  • a sterile injectable preparation in an aqueous or oily suspension.
  • Such suspensions can be formulated according to techniques known in the art using suitable dispersing or wetting agents (eg Tween 80) and suspending agents.
  • Sterile injectable preparations may also be sterile injectable solutions or suspensions in non-toxic parenterally acceptable diluents or solvents (eg, solutions in 1,3-butanediol). Vehicles and solvents that can be used include mannitol, water, Ringer's solution and isotonic sodium chloride solution.
  • sterile nonvolatile oils are commonly used as solvents or suspending media. For this purpose, any non-volatile oil with less irritation, including synthetic mono or diglycerides, can be used.
  • the contrast agent composition of the present invention is a substance commonly used as a pH adjuster such as citric acid and sodium citrate, and/or other commonly used sweeteners such as aspartame, acesulfame potassium, sweet syrup, saccharin sodium, saccharin calcium, sugar, etc.
  • Substances used and/or substances commonly used as antifoaming agents such as silicon resin, and/or substances commonly used as preservatives such as alcohols, phenols, organic acids and salts thereof, organic mercury compounds, parabens, and/or Pineapple flavor, strawberry flavor, orange flavor, lemon flavor, chocolate flavor, cola flavor, grape flavor, pine flavor, and the like may further contain one or more additives selected from materials commonly used as flavoring agents.
  • Example 1-1 Lipopeptide synthesis, purification and characterization
  • the peptide was synthesized using the Fmoc-solid-phase peptide synthesis method (SPPS) on a Libertyblue automatic microwave synthesized system.
  • SPPS Fmoc-solid-phase peptide synthesis method
  • amino acid:N,N-diisopropylcarbodiimide (DIC):ethyl 2-cyano-2-(hydroxyimino)acetate (oxima):resin was mixed in a molar ratio of 5:4.9:10:1 The mixture was used for each coupling reaction.
  • an aliphatic chain is bonded to the N-terminus of the peptide by binding octanoic acid (8C), decanoic acid (10C) or myristic acid (14C) to the peptide. Bonded to. Thereafter, piperidine: dimethylformamide (DMF) was used in a ratio of 20:80 v/v to perform Fmoc deprotection. The final product was used in the resin for 2 hours using a mixture of trifluoroacetic acid (TFA), triisopropylsilane (TIS) and deionized water (DI water) (95:2.5:2.5 v/v).
  • TFA trifluoroacetic acid
  • TIS triisopropylsilane
  • DI water deionized water
  • DNA oligonucleotides were synthesized and labeled by Cosmo Genetech (CosmoGene, Korea) and Integrated DNA Technologies (IDT, USA), respectively.
  • the sgRNA template containing the T7 promoter and the 20nt target sequence was amplified and purified through polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • sgRNA was transcribed in vitro using a high-yield script T7 kit (NEB, MA, USA) according to the manufacturer's protocol, and each of the transcribed sgRNAs was 15% modified TBE-urea polyacrylamide gel electrophoresis (PAGE) (Biorad, CA, USA) and an RNA-PAGE repair kit (Zymo research, CA, USA).
  • PAGE polyacrylamide gel electrophoresis
  • the sequence of the oligonucleotides synthesized and used in this example is summarized in Table 1 below.
  • Example 1-3 Cloning, mutation, protein expression, and purification (HypaSpCas9-NLS)
  • a gene encoding the SpCas9 WT enzyme protein consisting of the amino acid sequence of SEQ ID NO: 32 was obtained from Addgene (Plasmid # 39312), and the hyper-accurate SpCas9 variant induces site-specific mutations in SpCas9 WT and 7 mutations K848A / K1003A / Prepared using primer sets for R1060A / N497A / R661A / Q695A / Q926A.
  • linker GGS and SV40 nuclear localization signal (SV40 NLS, SEQ ID NO: 33) sequences were inserted into the C-terminus of HypaCas9 where the mutation was induced using a Q5® site-specific mutagenesis kit (NEB, MA, USA).
  • the HypaCas9 variant protein was prepared.
  • the plasmid was isolated and purified using a DNA-Spin TM purification kit (Intronbio, Korea), and DNA ID was confirmed through sequencing.
  • the HypaCas9 variant was overexpressed in Escherichia coli Rosetta2 (DE3) (Novagen, Korea) with an N-terminal His MBP tag followed by a tobacco etch virus (TEV) protease cleavage site. Afterwards, the protein expressed above was purified through Ni-NTA affinity chromatography (Qiagen, MA, USA) with buffer A (20 mM Tris-HCl, pH 8.0, 250 mM NaCl, 0.5 mM TCEP, 5% glycerol). I did. The tag was removed using TEV protein via dialysis against buffer A supplemented with 5 mM EDTA at 4°C.
  • the working molarity was determined by screening at different concentrations.
  • the lipopeptide lyophilized under reduced pressure was dissolved in PBS of pH 7.4 containing 5 mM MgCl 2 , 10% glycerol, and 0.2 ⁇ M saturated fatty acid.
  • sonication was performed at 4° C. for 15 minutes with 20% amplitude and 2 second pulse/2 second pause, and at the same time HypaRNP was added to prepare nanosomes encapsulated with HypaRNP.
  • Example 1-5 Preparation of eGFP-reporter-containing human HEK cells and glioblastoma cells
  • HEK 293A cells were purchased from the American Type Culture Collection (ATCC, USA), and glioblastoma cells were provided from the Korean Institute of Radiation Medicine. HEK cells were prepared in DMEM (Dulbecco's modified Eagle's medium) (Gibco, Korea) medium supplemented with 10% heat inactivated fetal bovine serum (FBS, HyClone, USA) and 1% penicillin/striptomycin (Welgene, Korea). Incubated at °C and 5% CO 2 conditions.
  • DMEM Dynabecco's modified Eagle's medium
  • FBS heat inactivated fetal bovine serum
  • FBS HyClone, USA
  • penicillin/striptomycin Welgene, Korea
  • eGFP-reporter HEK cell line To prepare the eGFP-reporter HEK cell line, incubate the cells until they occupy 70% of the area of the culture vessel, and then use the lipofectamine reagent (Invitrogen, MA, USA) according to the manufacturer's protocol to use peGFP-N1 plasmid ( Clontech, USA) was transfected. After 48 hours, in order to select eGEP-positive cells containing the CMV-eGFP cassette integrated into the genome of the host cell, it was cultured in a medium containing 0.5 mg/mL G418 (Thermo Scientific, MA, USA) for 4 weeks.
  • the lipofectamine reagent Invitrogen, MA, USA
  • peGFP-N1 plasmid Clontech, USA
  • eGFP positive cells were cultured in DMEM medium supplemented with 0.2 mg/mL G418 for further study.
  • glioblastoma cells were cultured in DMEM/F12 medium (Gibco, 1:1 ratio) containing growth factors containing 100 ng/ ⁇ l of B27, EGF and bFGF.
  • eGFP-reporter glioblastoma cells were prepared by transducing a lentiviral vector of IL13Ra2-eGFP (GenTarget Inc, CA, USA) according to the manufacturer's protocol. Subsequently, the transduced cells were selected in a medium supplemented with 1 ⁇ g/ml puromycin.
  • Example 1-6 Human cell transfection and eGFP interference assay
  • Human cells were transfected with RNP-encapsulated nanosomes according to the following procedure. Briefly, 10 5 cells per well were dispensed into a 6-well plate and cultured for one day. When the cells reached about 60-80% of the culture area, HypaRNP-encapsulated nanosomes or non-encapsulated HypaRNP were treated and incubated for 4 hours. Thereafter, the cells were washed with PBS (pH 7.4) and cultured for 3 days, and after the culture, the cells were treated with trypsin for 1 minute. Subsequently, the cell pellet was recovered by centrifugation at 800 g for 3 minutes, and then resuspended in PBS for FACS measurement. Each experiment was performed at least twice with 10,000 cells/sample.
  • the double-stranded DNA substrate was purified by amplification from the PCR product of the eGFP gene, and the Cas9:sgRNA RNP complex was purified using a size exclusion column. After that, the DNA substrate and RNP (1:10 ratio) were mixed and 30 in buffer C (20 mM Hepes-NaOH, pH 7.4, 150 mM NaCl, 5 mM MgCl 2 , 0.1 mM EDTA, 5% glycerol, 5 ⁇ g/mL BSA). The reaction proceeded to 37° C. for minutes. Thereafter, the reaction was stopped by treatment with protease K (1 mg/mL) at room temperature for 20 minutes, and the cleaved product was confirmed using 2% agarose gel electrophoresis.
  • Cy3-labeled SpCas9 a Cy3 maleimide single-reactive dye (GE Healthcare, IL, USA) was used through disulfide bonds to two cysteine residues (C80 and C574) exposed to the solvent of the SpCas9 protein. Combined. Briefly, the dye was dissolved and stored in DMSO, and labeled by mixing Cas9:dye in a molar ratio of 1:20 under buffer C (20 mM Tris-HCl pH 7.5, 250 mM NaCl, 1 mM TCEP and 5% glycerol). The process was carried out. Subsequently, the sample was incubated at 20° C. for 1 hour and then at 4° C. for 6 hours. Thereafter, 10 mM TCEP was added to stop the reaction, and the labeled SPCas9 was separated from the dye through size exclusion chromatography. All reactions were carried out in the light-blocked condition.
  • cytotoxic LDH assay kit-WST (Dojindo, Japan). Briefly, 5 x 10 3 HEK cells were dispensed into each well of a 96-well plate, and the next day, the nanosomes were replaced with a new medium containing various concentrations and cultured at 37° C. for 12 hours. Subsequently, the medium was recovered and the released LDH was analyzed. Meanwhile, cell morphology and eGFP intensity were monitored using a fluorescence microscope and a luminescent microplate reader, respectively.
  • Example 1-10 Dynamic light scattering (DLS) analysis
  • Dynamic light scattering (Zetasizer-Nano, Malvern, UK) analysis was performed in PBS at 20° C. in order to measure the hydrodynamic diameter and zeta potential of nanosomes not encapsulated with substances and nanosomes encapsulated with HypaRNA. Each analysis result was expressed as the average value of the three measurement results.
  • the secondary structure of the HypaRNP complex was measured with a circular dichroism (CD) spectrum over a wavelength range of 190 to 260 nm at 20°C (Chirascan plus, Applied Photophysics, UK).
  • CD circular dichroism
  • the CD spectrum was obtained by subtracting with a buffer (protein alone) or nanosomes (RNP-encapsulated nanosomes). Each result was expressed as the average residual ellipticity over an average of 3 scans.
  • a negative-dyed TEM sample was prepared on a copper grating plate coated with carbon, and an experiment for TEM observation was conducted. Briefly, 10 ⁇ l of a sample (HypaRNP or HypaRNP-encapsulated nanosomes) was dropped on a grid and incubated for 1 minute at ambient temperature, and excess solution was wiped off with filter paper. The sample was stained by adding 10 ⁇ l of 2% uranyl acetate, and the TEM sample was observed using a JEM 2100LF transmission electron microscope with an acceleration voltage of 200 kV and an exposure of 0.2 seconds.
  • HypaRNP Nanosome HypaRNP-nanosome Data collection parameters PAL-SAXS BL4C Capillary Vibration 0.7340.007-0.25 Synchrotron beamline Beam geometry Wavelength ( ⁇ ) q range ( ⁇ -1 ) Exposure time (s) Concentration range (mg/mL) 0.5-2.0 0.9-1.8 0.9-1.8 Sample parameters Sample purity 99 >95 >95 Temperature (K) 277 277 277 Structural parameters I(0) (cm -1 ) [from Guinier] 0.73 6.14 6.7 R g (nm) [from Guinier] 4.6 10.5 16.6 I(0) (cm -1 ) [from P(r)] 0.73 6.13 6.7 R g (nm) [from P(r)] 4.7 10.6 16.6 D max (nm) 11.9 28.7 39.1 Porod volume measurement (10 3 ⁇ 3 ) 347 4,190 4,760 Molecular weight (kDa) 208 152 491
  • the present inventors have tried to prepare a lipopeptide-based nanosome for effective mass transfer and analyze its mass transfer efficiency through this example.
  • the dNP2 peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to the method of Example 1-1 has three kinds of saturated fatty acids, that is, caprylic acid.
  • C8:0 caprylic acid or octanoic acid (C8:0)
  • capric acid capric aid
  • decanoic acid C10:0
  • myristic acid or tetradecanoic acid Each of C14:0 was conjugated through a peptide bond to prepare three types of lipopeptides (C8dNP2, C10dNP2 and C14dNP2) having different alkyl chain lengths.
  • each lipopeptide was successfully synthesized and purified through reverse phase high performance liquid chromatography (HPLC), and MALDI-TOF analysis was performed to determine the purity of each lipopeptide of 95% or more.
  • the molecular mass was measured and shown in FIG. 2.
  • each lipopeptide-based nanosome was measured using dynamic light scattering (DLS).
  • DLS dynamic light scattering
  • the length of the free C8dNP2 lipopeptide was estimated to be about 2.8 nm, so the material to be encapsulated in the following experiment It was determined that it was possible to encapsulate HypaRNP having a size of about 10 nm. Therefore, the present inventors finally selected the C8dNP2 lipopeptide, and conducted experiments to analyze the mass transfer efficiency of the nanosomes.
  • the present inventors tried to analyze the cerebrovascular barrier permeability for dNP2 used as a cell-permeable peptide constituting the lipopeptide.
  • FITC fluorescence was conjugated to the N-terminus of the dNP2 peptide, injected into the brain of a mouse, and then the tissue was excised and observed with a confocal microscope (Iba1: Microclia cell label, D: DAPI, cell nucleus, NeuN: Neuron). .
  • Example 3 in order to analyze the mass transfer efficiency of the lipopeptide-based nanosomes according to the present invention, the HypaRNP-encapsulated nanosomes prepared in Example 1-3 were prepared.
  • HypaRNP complex was purified using a size exclusion column, and then 0.5 ⁇ M of HypaRNP was added to various concentrations of C8dNP2 lipoproteins.
  • C8dNP2: HypaRNP was composed of 25:1, 50:1, and 100:1 molar ratios.
  • the present inventors determined the concentration of C8dNP2 to be 25 ⁇ M in order to minimize the concentration of lipopeptide constituting the nanosome.
  • the present inventors prepared nanosomes encapsulating the RNP according to the determined concentration condition using HypaRNP conjugated with Cy3 fluorescence, and then subjected to UV-visible spectrophotometry analysis to measure and compare the absorbance of Cy3 fluorescence. As a result, as shown in Fig.
  • the pair distribution function (P (r)) representing the bell-shape represents the seeds, so that the maximum interatomic distances are 11.9 nm (HypaRNP), 28.7 nm (Nanosome), and 39.1 It was confirmed that it exhibits a spherical characteristic with nm (HypaRNP-nanosome).
  • P (r) the pair distribution function representing the bell-shape
  • the present inventors analyzed the intracellular delivery efficiency of HypaRNP using the HypaRNP-encapsulated nanosomes prepared above to verify whether lipopeptide-based nanosomes efficiently mediate the transfer of substances into cells.
  • eGFP-reporter HEK cells having an eGFP gene inserted into the genome of a host cell were prepared, and eGFP-reporter HEK cells stably expressing the eGFP protein were recovered through flow cytometry. I did. Thereafter, in order to investigate the cytotoxicity of the lipopeptide-based nanosomes, which is a substance delivery system according to the present invention, the cells were treated with nanosomes at various concentrations and then cell viability was measured. As a result, as shown in Figure 6a, when the C8dNP2-based nanosomes were treated with 50 ⁇ M or less, significant cytotoxicity was not observed.
  • HypaRNP-encapsulated nanosomes to eGFP-reporter HEK cells in DMEM medium and then absorbed Cy3-HypaRNP cells through Cy3 fluorescence. The efficiency was investigated.
  • HypaRNP was absorbed into the cells from 30 minutes after treatment with the nanosomes (Encapsulated HypaRNP), and the absorption efficiency was 70 ⁇ 11% within 4 hours after treatment with the nanosomes. Absorption into cells was almost complete, and Cy3 fluorescence was not observed in the cells at 24 hours. On the other hand, in the case of treatment with free Cy3-HypaRNP (Unencapsulated HypaRNP) not encapsulated with nanosomes, fluorescence was not observed. Further, in order to confirm whether the RNP absorbed into the cell is localized in the nucleus, Z-stacking was performed 4 hours after treatment to construct a 3D image of the cell nucleus.
  • Cy3-HypaRNP is present in most of the nuclei (58 ⁇ 13%), in particular, in cells treated with RNP-encapsulated nanosomes, whereas non-specifically present when unenclosed Cy3-HypaRNP is treated. I did.
  • the present inventors tried to investigate whether or not it effectively mediates genomic modification in human cells through lipopeptide-based nanosome-mediated HypaRNP delivery.
  • the endogenous eGFP gene was targeted in the eGFP-reporter HEK cell system.
  • the delivery of the CRIPSR/Cas9 system to the nucleus induces double-strand breaks (DSB) at the target genomic locus of the eGFP gene, and repair of DSB by the cellular system is performed by insertion/deletion at the DNA cleavage site. deletion; indels) mutation, which prevents the expression of the reporter eGFP.
  • DSB double-strand breaks
  • the frequency of eGFP genetic modification by the lipopeptide-based nanosomes according to the present invention is higher compared to the case where HypaRNP was delivered using Lipofectamine 2000 (9.1 ⁇ 1.5%) or CRISPRMAX (11.4 ⁇ 1.8%) instead of nanosomes. Confirmed.
  • the mutation frequency of insertion/deletion was about 20% as shown in FIG. 8D.
  • the level of mutation frequency by lipopeptide-based nanosome-mediated delivery was determined by poly-arginine-conjugated SpCas9 wild type (about 6%), SpCas9 wild type and plasmid encoding sgRNA (about 7%), gold nanoparticles (about 11%). ) was significantly higher than that of the conventional system.
  • the micelle-type lipopeptide-based nanosome according to the present invention is a drug delivery system with excellent material transfer efficiency, and it was confirmed that even a large protein can be delivered into cells with excellent efficiency. It is expected to be useful in the field of research, diagnosis or treatment of various diseases, and the like by effectively delivering it to the inside.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Dispersion Chemistry (AREA)
  • Inorganic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Optics & Photonics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 마이셀 구조의 나노 전달체 및 이의 용도에 관한 것으로서, 보다 구체적으로는 거대 분자를 전달하기 위한 단층 구조의 나노좀 및 이의 약물 전달체, 조영제, 치료용 조성물로의 용도에 관한 것이다. 본 발명에 따른 나노좀은 우수한 세포 투과성과 더불어 뇌혈관장벽 투과능을 가지며 세포 내로의 우수한 물질 전달 효과를 나타낸다. 또한 상기 지방산의 알킬 사슬의 길이를 조절하여 나노좀의 크기 조절이 용이하며, 나노좀을 구성하는 리포펩타이드와 지방산의 몰농도 비율 또는 리포펩타이드와 봉입되는 물질 간의 몰농도 비율을 조절함으로써 물질 전달 효율의 향상을 위한 최적 조건을 설정할 수 있다. 따라서 본 발명에 따른 나노좀은 종래의 한계점을 극복할 수 있는 약물전달시스템으로 기초연구 및 임상 분야에서 유용하게 활용될 수 있다.

Description

마이셀 구조의 나노 전달체 및 이의 용도
본 발명은 마이셀 구조의 나노 전달체 및 이의 용도에 관한 것으로서, 보다 구체적으로는 거대 분자를 전달하기 위한 단층 구조의 나노좀 및 이의 약물 전달체, 조영제, 치료용 조성물로의 용도에 관한 것이다.
질병의 치료를 위해서는 약물의 투여가 불가피하지만 투여되는 약물이 갖는 부작용이나 복용의 불편함 등에 의해 약물투여 또는 복용에 많은 한계점이 있다. 반면, 인구는 증가하고 생활수준은 향상되며 전 세계적으로는 고령화로 인한 질병의 치료가 한층 더 요구되어지면서 약물의 부작용과 복용의 불편함을 최소화하고 효능 및 효과는 최대화하는 최적의 약물 복용방법으로의 과학적 진보를 위한 노력들이 이루어지고 있다. 이러한 측면에서 종래의 약리학적 활성을 갖는 물질을 원하는 부위에 효율적으로 전달할 수 있도록 제형을 설계하여 약물 치료를 최적화하는 기술인 약물전달시스템(Drug Delivery System, DDS)에 대한 지속적인 연구개발이 이루어지고 있다.
최근의 연구동향을 살펴볼 때 약물전달시스템은 크게 고분자를 이용한 방법과 융합기술을 이용한 방법으로 분류될 수 있다. 고분자를 이용한 약물전달시스템은 약물의 주변을 고분자 물질로 둘러 쌓아 원하는 표적에 물질을 전달하는 것이다. 이에 이용되는 고분자로는 보통 합성 고분자(synthetic polymer), 단백질, 마이셀(micelle), 리포솜(liposome) 그리고 항체(antibody) 등이 있는데 원리는 약물을 고분자와 공유결합을 시키거나 캡슐 형태로 만들어 이용하는 것이다. 예컨대, 폴리에틸렌글리콜(polyethylene glycol; PEG)이나 폴리글루타메이트(polyglutamate), 히알루론산(hyaluronic acid; HA)과 같은 고분자 물질을 사용하는 고분자-약물 결합체(polymer-drug conjugation)의 경우는 전달될 수 있는 약물의 양에 한계가 있다는 단점을 가지고 있긴 하지만 몇몇 항암제-고분자 제품들이 FDA 허가를 받고 상업화에 성공하였다. 그러나 폴리에틸렌글리콜은 인체에 매우 적합한 고분자이지만 체내에서 분해되지 않고 주로 신장을 통해 배출되기 때문에 우리 몸에 축적될 수 있다는 문제점을 안고 있다. 이러한 문제점을 보완하기 위해 최근 생체 내 면역반응이 거의 없어 거부반응을 나타내지 않는 히알루론산이 연구개발되고 있으나, 이 또한 반감기가 빠르다는 단점이 있다. 리포좀(liposome)은 지질이중층을 포함하는 운반체로서 지방 성분을 통해 그 기능성을 유지하게 된다. 리포좀은 약물의 많은 투여량뿐만 아니라 특정한 세포, 조직, 그리고 장기를 표적화한 전달이 가능하다는 장점을 가지고 있다(Pol. J. Pharmacol. 2003, 55, 1063-1070). 하지만 리포좀 매개 약물 전달은 흡수가 지연되고 분포의 제한을 받으며 대사율이 낮아지고 간이나 비장의 세포에 포획되어 혈액으로부터 신속하게 제거되는 단점이 있다.
한편, CRISPR/Cas9으로 불리는 유전자 가위 기술에 기반한 유전자 편집/교정기술은 다양한 질병들에 대해 적용될 수 있는 혁신적 유전자 치료 및 교정 기술로써 현재 전 세계적으로 가장 각광받고 있는 기술이다. 이 중에서 특히, 생체 내 유전자 편집기술을 활용한 질환 치료기술은 생체 내의 잘못된 유전자를 효과적으로 교정하여 잘못된 유전자를 직접적으로 치료 가능한 기술로써 불치병으로 분류되었던 유전자 이상으로 유도된 질환에서 질병의 근본원인을 치료할 수 있는 방법으로 각광받고 있다. 하지만 유전자 편집 시스템의 효율적인 체내 전달 등과 같은 해결해야 하는 문제점을 가지고 있고, 이를 해결하기 위한 다양한 전달체에 대한 연구가 진행되고 있으나, 아직 효율적인 전달체가 확립되지 않은 실정이다.
이처럼 상기와 같은 한계점 때문에, Cas9 단백질과 같은 거대 분자를 포함한 약리활성을 갖는 다양한 생물학적 활성 물질을 생체 내로 효과적으로 전달할 수 있고 세포독성이 없는 새로운 전달시스템의 개발이 필요하다.
상기와 같은 종래의 문제점을 해결하기 위해, 본 발명자들은 Cas9과 같은 거대 분자도 전달이 가능한 전달체를 개발하기 위하여 연구노력한 결과, 펩타이드와 지방산이 결합된 리포펩타이드 및 지방산으로 구성된 마이셀 구조의 나노좀을 제조하고, 상기 나노좀이 거대 단백질도 전달이 가능한 약물전달시스템으로 이용 가능함을 확인하고, 이에 기초하여 본 발명을 완성하였다.
이에, 본 발명은 리포펩타이드(lipopeptide) 및 지방산이 마이셀(micelle) 구조를 형성하는 것을 특징으로 하는, 물질 전달용 나노좀을 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 나노좀; 및 상기 나노좀 내에 봉입된 생물학적 활성 물질을 포함하는, 나노좀 복합체를 제공하는 것을 다른 목적으로 한다.
또한, 본 발명은 상기 나노좀을 포함하는, 조영제 조성물을 제공하는 것을 또 다른 목적으로 한다.
또한, 본 발명은 상기 나노좀 복합체를 유효성분으로 포함하는, 약학적 조성물을 제공하는 것을 또 다른 목적으로 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기와 같은 본 발명의 목적을 달성하기 위하여, 본 발명은 리포펩타이드(lipopeptide) 및 지방산이 마이셀(micelle) 구조를 형성하는 것을 특징으로 하는, 물질 전달용 나노좀을 제공한다.
본 발명의 일구현예로, 상기 리포펩타이드는 세포 투과성 펩타이드를 포함할 수 있다.
본 발명의 다른 구현예로, 상기 지방산은 탄소 수 1 내지 20으로 이루어진 군에서 선택된 포화지방산일 수 있다.
본 발명의 또 다른 구현예로, 상기 나노좀은 지방산 : 리포펩타이드가 1 : 0.01 내지 1 : 1의 몰농도 비율로 포함되는 것일 수 있다.
본 발명의 또 다른 구현예로, 상기 나노좀은 1 내지 2000 nm의 크기를 갖는 것일 수 있다.
또한, 본 발명은 상기 나노좀 및 상기 나노좀 내에 봉입된 생물학적 활성 물질을 포함하는, 나노좀 복합체를 제공한다.
본 발명의 일구현예로, 상기 생물학적 활성 물질은 화합물(chemical compound), 단백질, 당단백질, 펩타이드, 항체(antibody), 효소(enzyme), 핵산분해효소(Nuclease), 호르몬, DNA, RNA, siRNA(small interfering RNA), miRNA(microRNA), mRNA(messenger RNA), 안티센스 올리고뉴클레오티드, 압타머(aptamer), 사이토카인(cytokine), 전사인자(transcription factor), 독소, 탄수화물, 지질, 천연물(natural product), 반합성 물질(semi-synthetic drug), 약물(drug), 마이크로입자, 나노입자 및 바이러스로 이루어진 군에서 선택되는 하나 이상인 것일 수 있다.
본 발명의 다른 구현예로, 상기 핵산분해효소는 Cas9(CRISPR-associated protein 9), Cas3(CRISPR-associated nuclease/helicase Cas3), CAS12, CAS13, CAS14, CAS variants, Cfp1(CxxC-finger protein-1), ZFN(Zinc finger nuclease) 및 TALEN(Transcription activator-like effector nuclease)으로 이루어진 군에서 선택되는 어느 하나인 것일 수 있다.
또한, 본 발명은 상기 나노좀을 포함하는, 조영제 조성물을 제공한다.
본 발명의 일구현예로, 상기 조성물은 방사성 동위원소, 유기 형광물질, 자기공명영상(MRI) 조영제, 컴퓨터단층촬영(CT) 조영제, 양전자단층촬영(PET) 조영제, 초음파 조영제 및 형광 조영제로 이루어진 군에서 선택된 하나 이상의 표지물질이 포함된 것일 수 있다.
또한, 본 발명은 상기 나노좀 복합체를 유효성분으로 포함하는, 약학적 조성물을 제공한다.
본 발명에서는 세포 투과능을 갖는 펩타이드와 지방산이 결합된 리포펩타이드 기반 나노좀을 제조하고, 상기 나노좀에 Cas9 RNP 복합체를 봉입한 복합체를 인간 세포에 처리한 결과 우수한 세포 내 전달 효과 및 이에 따른 유전자 편집 효과를 확인하였다. 또한 본 발명에 따른 상기 나노좀을 구성하는 세포 투과성 펩타이드는 뇌혈관장벽 투과능을 가지는바, 상기 나노좀은 뇌혈관장벽의 투과가 요구되는 뇌질환 치료를 위한 약물전달체로 적용할 수 있다.
더욱이, 상기 지방산의 알킬 사슬의 길이를 조절하여 나노좀의 크기 조절이 용이하며, 나노좀을 구성하는 리포펩타이드와 지방산의 몰농도 비율 또는 리포펩타이드와 봉입되는 물질 간의 몰농도 비율을 조절함으로써 물질 전달 효율의 향상을 위한 최적 조건을 설정할 수 있다. 따라서 본 발명에 따른 나노좀은 종래의 한계점을 극복할 수 있는 약물전달시스템으로 기초연구 및 임상 분야뿐만 아니라 조영제 등의 진단 분야에서도 유용하게 활용될 수 있을 것으로 기대된다.
도 1은 본 발명에 따른 리포펩타이드 기반 나노좀 구조 및 상기 나노좀에 HypaCas9-NLS를 봉입한 나노좀 전달체의 세포 내 전달을 통한 유전자 편집을 도시한 모식도이다.
도 2는 MALDI-TOF 분석을 통해 알킬 사슬 길이가 상이한 각 리포펩타이드(C8dNP2, C10NP2, 및 C14dNP2)의 순도 및 분자적 질량을 측정하여 나타낸 결과이다.
도 3a는 각 C8dNP2, C10NP2, 및 C14dNP2 리포펩타이드 기반 나노좀의 유체역학적 직경을 동적 광산란법(DLS)으로 측정한 결과이다.
도 3b는 상기 도 3a의 각 리포펩타이드 기반 나노좀에 대한 투과전자현미경(TEM) 이미지를 나타낸 것이다.
도 4는 본 발명에 따른 리포펩타이드를 구성하는 세포투과성 펩타이드(dNP2)의 뇌혈관장벽 투과능을 공초점 현미경으로 관찰한 결과이다.
도 5a는 C8dNP2 리포펩타이드와 HypaRNP가 다양한 몰비(25:1, 50:1, 100:1)로 구성된 HypaRNP가 봉입된 나노좀의 직경을 동적 광산란법으로 측정한 결과이다.
도 5b는 상기 도 5a의 50:1 비율로 구성된 나노좀을 투과전자현미경으로 관찰한 결과이다.
도 5c는 UV-visible spectrophotometry 분석을 통해 Cy3-HypaRNP이 C8dNP2 리포펩타이드 기반 나노좀에 안정적으로 봉입되는지 여부를 확인한 결과이다.
도 5d는 원형이색성 측정을 통해 나노좀 봉입에 따른 HypaRNP의 2차 구조 변화 여부를 분석한 결과이다.
도 5e는 SAXS 측정을 통해 C8dNP2 리포펩타이드 기반 나노좀의 형태와 분자적 질량을 분석한 결과이다.
도 5f는 상기 도 5e의 SAXS 측정으로부터 원자짝 분포 함수를 분석한 결과이다.
도 6a는 eGFP-리포터 HEK 세포에 C8dNP2 리포펩타이드 기반 나노좀을 농도별(0, 10, 25, 50, 75, 100 μM)로 처리한 후 eGFP 강도 및 세포 생존율을 측정하여 세포독성을 분석한 결과이다.
도 6b는 eGFP-리포터 HEK 세포에 봉입되지 않은 유리 HypaRNP(Unencapsulated HypaRNP) 또는 HypaRNP가 봉입된 나노좀(Encapsulated HypaRNP)을 처리하고 공초점 현미경으로 세포 형태를 관찰하여 세포독성을 분석한 결과이다.
도 7은 eGFP-리포터 HEK 세포에 HypaRNP가 봉입된 나노좀(Encapsulated HypaRNP) 또는 봉입되지 않은 HypaRNP을 처리하고 시간 경과에 따른 세포 흡수를 공초점 현미경으로 관찰하고 이를 정량한 결과 및 세포 내로 흡수된 HypaRNP의 세포 핵으로의 국소화 정도를 분석한 결과이다.
도 8a는 eGFP-리포터 HEK 세포에 봉입되지 않은 HypaRNP(Unencapsulated HypaRNP) 또는 HypaRNP이 봉입된 나노좀(Encapsulated RNP)을 처리하고 배양한 후 공초점 현미경으로 eGFP 단백질의 발현수준을 관찰하여 리포펩타이드 기반 나노좀을 통해 전달된 HypaRNP의 유전자 편집 효율을 분석한 결과이다.
도 8b는 유세포 분석을 통해 RNP에 의한 삽입/결실 돌연변이를 포함하는 eGFP-음성 세포의 측정 원리를 도시한 그림 및 대조군과 각 실험군에서 eGFP-음성 세포의 빈도를 측정하여 나타낸 결과이다.
도 8c 및 8d는 각각 eGFP-리포터 HEK 세포(도 8c) 및 eGFP-리포터 교모세포종 세포(도 8d)에서 본 발명에 따른 나노좀 매개 HypaRNP의 전달에 의해 유도된 eGFP 표적 유전자 상의 삽입/결실 돌연변이의 빈도를 나타낸 결과이다.
본 발명은 연구 분야, 다양한 질병의 진단 또는 치료 분야 등에서 유용하게 활용될 수 있는 나노좀에 관한 것으로서, 보다 구체적으로, 본 발명자들은 펩타이드와 지방산이 결합된 리포펩타이드 기반 나노좀의 우수한 물질 전달 효율을 확인함으로써 본 발명을 완성하였다.
이하, 본 발명을 자세히 설명한다.
본 발명은 리포펩타이드(lipopeptide) 및 지방산이 마이셀(micelle) 구조를 형성하는 것을 특징으로 하는, 물질 전달용 나노좀을 제공한다.
본 발명의 나노좀은 펩타이드와 지방산이 펩타이드 결합으로 접합된 리포펩타이드 및, 펩타이드와 결합되지 않은 형태의 지방산이 소수성 핵을 생성하도록 배열되어 구형의 단일층인 마이셀(micelle) 구조를 갖는 것을 특징으로 한다. 이때, 리포펩타이드와 지방산은 소수성 핵을 생성하는데 적합하도록 배열될 수 있으며, 예컨대 규칙적 또는 무작위적으로 배열될 수 있다.
본 발명에서, “펩타이드(peptide)”란 아미노산의 중합체로서, 보통 소수의 아미노산이 연결된 형태를 펩타이드라 하며, 많은 아미노산이 연결되면 단백질이라 부른다. 이러한 펩타이드 및 단백질 구조에서 아미노산 간의 연결은 아마이드(amide) 결합 또는 펩타이드 결합으로 이루어져 있다. 펩타이드 결합이란 카르복실기(-COOH)와 아미노기(-NH2) 사이에 물(H2O)이 빠져나가고 -CO-NH- 형태를 이루는 결합이다.
본 발명의 나노좀을 형성하는데 적용될 수 있다면, 펩타이드의 종류는 특별히 제한되지는 않으나, 바람직하게는 세포 투과성 펩타이드를 사용할 수 있다.
본 발명에서 사용되는 용어, “세포 투과성”이란, 펩타이드가 세포(막)를 투과하여 세포 내부로 침투할 수 있는 능력 또는 성질을 의미한다.
본 발명에 있어서, 상기 세포 투과성 펩타이드는 세포 투과능을 가지는 것이라면 특별히 제한되지 않으며, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 원하는 목적을 달성하기 위하여 적절하게 선택할 수 있다. 이의 비제한적인 예시로는, KIKKVKKKGRKKIKKVKKKGRK(서열번호 1), RIKRVKKRGRR(서열번호 2), RIRRVRRRGRR(서열번호 3), RWKRWKKRGRR(서열번호 4), KWKKWKKKGRK(서열번호 5), KIKKVKKKGRK(서열번호 6), LIKLVKKLGRL(서열번호 7), GHEARLKADEESVYKG(서열번호 8), GHEAALKADEESVYKG(서열번호 9), DHEAALKADEESVYKG(서열번호 10), 또는 DPHEAALKADEESVYKGR(서열번호 11) 아미노산 서열을 포함하거나 표시되는 것일 수 있다. 이때, 상기 세포 투과성 펩타이드는 상기 서열번호 1 내지 11로 표시되는 아미노산 서열과 각각 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 가장 바람직하게는 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 이상의 서열 상동성을 가지는 아미노산 서열을 포함할 수도 있다.
본 발명의 펩타이드는 당업자에게 알려진 통상의 펩타이드 합성 방법 혹은 제조 방법을 통하여 각 펩타이드의 순도가 90% 이상이 되도록 제작할 수 있으며, 예컨대 직접 합성하거나 펩타이드 제조회사에 제조를 의뢰한 후 구입하여 사용할 수 있다. 상기 펩타이드는 당업자에게 알려진 통상의 펩타이드 합성 방법 혹은 제조 방법을 통하여 D-form 이나 L-form, 서열 중 일부만 D-form이나 L-form으로 구성된 펩타이드, 또는 이들의 라세미체 형태로 모두 제작하여 사용될 수 있다. 또한, 펩타이드의 안정성을 높이기 위해 그 외의 당업계에 공지된 통상적인 변형이 가능하다. 본 발명에서는 바람직하게 고체상 펩타이드 합성(Solid phase peptide synthesis) 방법을 이용하여 펩타이드를 합성하였으나, 전술한 바와 같이 펩타이드 합성 방법 및 조건이 이에 제한되는 것은 아니다.
본 발명에서, 상기 “지방산(fatty acid)”은 탄소 원자가 사슬 모양으로 연결된 카르복시산(R-COOH)을 통틀어 이르는 것으로, 지방이 가수분해되어 생성된다. 대부분의 자연적으로 발생하는 지방산은 4~28개까지의 짝수의 탄소 분자로 이루어져 있으며, 대부분의 지방산의 탄소 수는 18개 정도로 가장 간단한 형태의 지방산은 아세트산(CH3-COOH)이다.
본 발명에 있어서, 상기 지방산은 본 발명에 따른 나노좀을 구성하는 지방산 모두를 포함하는 것으로, 구체적으로 상기 리포펩타이드를 구성하는 지방산 및 펩타이드와 결합되어 있지 않은 지방산 모두를 의미한다. 상기 지방산은 바람직하게는 포화지방산(saturated fatty acid)일 수 있다. 상기 포화지방산은 모든 탄소와 탄소 사이의 결합이 단일 결합으로 되어 있는 것으로서, C1 내지 C20, 바람직하게는 C1 내지 C18, 더욱 바람직하게는 C6 내지 C18의 탄소 수를 가진 것일 수 있으며, 예컨대 옥타노산, 카프릭산, 데카노산, 미리스틱산 또는 테트라데카노산일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, “마이셀”은 계면활성제가 일정 농도 이상에서 모인 집합체를 말하는데, 대표적으로 계면활성제가 물에 녹는 경우 일정 농도 이상이 되면 소수성 부분이 핵을 형성하고 친수성 부분은 물과 닿은 표면을 형성하게 된다. 본 발명에서는 소수성 부분인 지방산이 마이셀 구조의 내부 쪽에 위치하고 펩타이드가 표면 쪽으로 위치하며, 지방산이 위치하는 내부에는 물질을 봉입할 수 있는 공간을 포함한다.
본 발명에서, 나노좀(nanosome)은 상기 마이셀 또는 나노입자와 혼용될 수 있으며, 크기가 수 내지 수천 나노미터(nm, 10억분의 1미터인 물질)인 입자를 말한다. 본 발명에서 상기 나노좀은 입자의 크기가 1 내지 2000 nm, 1 내지 1000 nm, 1 내지 500 nm, 1 내지 400 nm, 1 내지 200 nm, 1 내지 100 nm, 1 내지 80 nm, 1 내지 70 nm, 1 내지 50 nm, 10 내지 50 nm, 20 내지 50 nm, 또는 25 내지 45 nm일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 나노좀은 이를 구성하는 전술한 구성 요소들의 인위적 복합체화(complexation)를 통한 인공적 작제물이거나, 특정 조건(환경)의 조성을 통하여 세포로부터 발생되고 세포 밖으로 분비되는 자연적 작제물일 수 있다.
본 발명에서는 일실시예에서는, 상기 펩타이드와 지방산이 결합된 리포펩타이드로 이루어진 나노좀을 제조하고 이의 특성을 분석하였다. 구체적으로, 본 발명에서는 상기 펩타이드로써 서열번호 1의 아미노산 서열로 표시되는 dNP2 펩타이드를 이용하였으며, 상기 펩타이드에 알킬 사슬 길이가 상이한 3종류의 포화지방산 즉, 옥탄산(octanoic acid) (C8:0), 데칸산(decanoic acid) (C10:0), 및 미리스트산(myristic acid) (C14:0)을 각각 결합시켜 알킬 사슬 길이가 다른 3종류의 리포펩타이드(C8dNP2, C10dNP2, C14dNP2)를 제조하였다. 이후 상기 리포펩타이드로 구성된 나노좀의 직경을 측정한 결과, C8dNP2 및 C10dNP2이 각각 약 27.2 및 30 nm로 측정되었으며, TEM 이미지를 통해서도 나노좀이 형성된 것을 확인하였다. 나아가 본 발명에 따른 나노좀의 물질 전달체로써의 효과를 평가하기 위해 Cas9 RNP 복합체를 봉입한 나노좀 복합체를 제조하였으며, 이를 위해 나노좀을 가장 잘 형성한 C8dNP2 리포펩타이드를 선정하여 C8dNP2 기반 나노좀을 이용하였다(실시예 2 참조).
본 발명의 다른 실시예에서는, 상기 나노좀을 구성하는 세포투과성 펩타이드로 이용한 dNP2의 뇌혈관장벽 투과능을 검증하였다. 이를 위해, in vivo 모델의 뇌에 FITC 형광이 접합된 dNP2를 주입하고 공초점 현미경으로 관찰한 결과 dNP2 펩타이드가 우수한 뇌혈관장벽 투과능을 갖는다는 것을 알 수 있었다(실시예 3 참조).
본 발명의 또 다른 실시예에서는, 본 발명에 따른 나노좀의 물질 전달 효율을 분석하기 위해 도 1에 도시된 바와 같은 구조를 갖는 HypaCas9-NLS를 제조하고 이의 RNP 복합체(HypaRNP)를 봉입한 나노좀을 제조하였으며, 이때 효율적인 봉입을 위한 리포펩타이드: HypaRNP의 최적의 몰비 조건을 확인하였으며(실시예 4-1 참조), 제조된 상기 나노좀 복합체의 특성을 측정하여 HypaRNP가 상기 나노좀 내에 안정적으로 봉입된 것을 확인하였다(실시예 4-2 참조).
본 발명의 또 다른 실시예에서는, eGFP 유전자가 삽입된 eGFP-리포터 HEK 세포를 제조하고 상기 세포를 이용해 본 발명에 따른 리포펩타이드 기반 나노좀 및 상기 나노좀에 HypaRNP가 봉입된 나노좀 복합체의 세포독성을 측정하여 50 μM 이하의 나노좀 농도에서는 세포독성이 나타나지 않는 것을 확인하였다(실시예 5-1 참조).
본 발명의 또 다른 실시예에서는, 상기 eGFP-리포터 HEK 세포에 HypaRNP가 봉입된 나노좀을 처리하여 나노좀 매개 HypaRNP의 우수한 세포 흡수 및 전달 효율을 확인하였다(실시예 5-2 참조).
본 발명의 또 다른 실시예에서는, eGFP-리포터 HEK 세포 및 eGFP-리포터 교모세포종 세포를 이용해 상기 나노좀을 통해 세포 내로 전달된 HypaRNP의 유전자 편집 효율을 분석한 결과, 아무 처리하지 않은 경우에 비해 유의미한 유전자 편집 효과를 확인하였으며, 이러한 효과는 종래의 리포좀으로 HypaRNP를 봉입시켜 세포 내로 전달한 경우에 비해 편집 효율이 더욱 높은 것을 알 수 있었다.
상기 실시예의 결과들은, 본 발명에 따른 나노좀은 거대 단백질도 효과적으로 봉입하여 세포 내로 효과적으로 전달할 수 있으며, 더욱이 뇌혈관장벽 투과능을 가지는바 뇌질환 표적 물질의 전달체로도 활용 가능함을 입증하는 것이다.
이에, 본 발명의 다른 양태로서, 본 발명은 상기 나노좀; 및 상기 나노좀 내에 봉입된 생물학적 활성 물질을 포함하는, 나노좀 복합체를 제공한다.
본 발명에서, 상기 나노좀 복합체는 생물학적 활성 물질이 초음파처리를 통해 상기 나노좀의 내부에 봉입되어 제조된 것이나 이에 제한되는 것은 아니며, 구체적인 봉입을 위한 방법 및 조건은 당업자가 적절히 선택하여 적용할 수 있다.
본 발명에 따른 복합체에서, 상기 나노좀은 생물학적 활성 물질을 효과적으로 봉입하고 세포 내로 효율적으로 전달하기 위하여, 나노좀을 구성하는 지방산의 알킬 사슬의 길이를 조절하여 나노좀 전체의 크기 조절이 가능하다. 알킬 사슬의 길이는 상기 전달하고자 하는 물질의 특성 및 환경에 따라 당업자에게 적절하게 선택 또는 조절될 수 있다.
본 발명에 따른 복합체에서, 나노좀의 형성 및 세포 내로의 효율적인 물질 전달을 위해, 상기 나노좀을 구성하는 지방산과 리포펩타이드의 몰농도 비율을 조절할 수 있다. 예컨대, 지방산 : 리포펩타이드를 1 : 0.01 내지 1 : 1의 몰비로 조절할 수 있으며, 당업자가 전달하고자 하는 물질, 표적 세포 등의 조건을 고려하여 적절한 비율을 선택하여 조절이 가능하다.
또한, 본 발명에 있어서, 나노좀의 물질 봉입 및 세포 내로의 효과적인 물질 전달을 위해 리포펩타이드와 생물학적 활성 물질과의 몰농도 비율을 조절할 수 있으며, 이는 전달하고자 하는 물질의 크기, 분자량 등의 특성에 따라 당업자에게 용이하게 조절할 수 있다. 예컨대, 본 발명에 따른 나노좀에 Cas9 RNP 복합체를 봉입하여 나노좀 복합체를 제조하는 경우, 리포펩타이드: Cas9 단백질이 20:1~500:1, 20:1~400:1, 20:1~300:1, 20:1~200:1, 30:1~200:1, 30:1~150:1, 30:1~100:1, 30:1~90:1, 30:1~80:1, 30:1~70:1, 30:1~60:1, 40:1~60:1, 가장 바람직하게는 45:1~55:1의 몰비로 포함될 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, 상기 나노좀에 봉입되는 생물학적 활성 물질은 바람직하게는 '생물학적 또는 약제학적 활성을 갖는 물질'을 의미하며, 이는 세포 내 (세포질 또는 핵 내)로 투과되어 생리활성 조절에 관여하거나 약리효과를 발현할 수 있는 것 또는 운반되어 작용해야 하는 세포 내, 조직 내, 세포간질, 혈액 등 다양한 생체 내 부위에서도 생물학적 활성을 갖는 물질을 의미한다. 예컨대, 비제한적으로 화합물(chemical compound), 단백질, 당단백질, 펩타이드, 항체(antibody), 효소(enzyme), 핵산분해효소(Nuclease), 호르몬, DNA, RNA, siRNA(small interfering RNA), miRNA(microRNA), mRNA(messenger RNA), 안티센스 올리고뉴클레오티드, 압타머(aptamer), 사이토카인(cytokine), 전사인자(transcription factor), 독소, 탄수화물, 지질, 천연물(natural product), 반합성 물질 (semi-synthetic drug), 약물(drug), 마이크로입자, 나노입자 및 바이러스로 이루어진 군으로부터 선택되는 하나 이상인 것일 수 있다.
상기 핵산분해효소는 Cas9(CRISPR-associated protein 9), Cas3(CRISPR-associated nuclease/helicase Cas3), CAS12, CAS13, CAS14, CAS variants, Cfp1(CxxC-finger protein-1), ZFN(Zinc finger nuclease) 및 TALEN(Transcription activator-like effector nuclease)으로 이루어진 군에서 선택되는 어느 하나일 수 있으나, 이에 제한되는 것은 아니다.
상기 약물(drug)은 화합물 약물(chemical drug), 바이오 약물(biodrug), 핵산 약물(nucleic acid drug), 펩타이드 약물(peptide drug), 단백질 약물(protein drug), 천연물 약물(natural product drug), 호르몬(hormone), 조영제(contrast agent) 및 항체(antibody)로 이루어진 군으로부터 선택될 수 있으나, 이에 제한되는 것은 아니다.
상기 “바이오 약물”은 (오리지널) 생물학적 치료제(biologics) 및 바이오제네릭(biogenerics), 바이오베터(biobetters), 바이오수페리어(biosuperiors) 등 다양한 바이오 의약품을 의미한다. 상기 바이오 약물은 생물학적 기원으로부터 제조, 분비 또는 반합성된 임의의 약물을 의미하며, 백신, 혈액 제제, 항원, 세포 제제, 유전자 치료제, 줄기세포 등을 모두 포함하며, 이에 제한되지는 않는다.
상기 나노입자는 산화철, 금, 탄소나노튜브, 및 자기 비드로 이루어진 군으로부터 선택되는 것일 수 있으나, 이에 제한되지는 않는다.
본 발명에 있어서, 상기 나노좀에 봉입되는 생물학적 활성 물질은 예를 들어 Cas9 단백질일 수 있다. 상기 Cas9 단백질은 서열번호 32(PDB code: 5F9R)로 표시되는 아미노산 서열을 포함하는 것이거나 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 Cas9 단백질은 이의 변이체를 모두 포함할 수 있다. 구체적으로, 상기 펩타이드는 서열번호 32의 아미노산 서열과 70 % 이상, 더욱 바람직하게는 80% 이상, 가장 바람직하게는 90 % 이상의 서열 상동성을 가지는 아미노산 서열을 포함할 수 있다. 예를 들면, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%의 서열 상동성을 갖는 폴리펩타이드를 포함하는 것으로, 상기 서열번호 32로 표시되는 폴리펩티드와 실질적으로 동질의 생리활성을 나타내는 폴리펩티드를 말한다. 상기 기능적 동등물은 상기 GRS, LRS 및 IRS 각각의 아미노산 서열 중 일부가 부가, 치환 또는 결실의 결과 생성될 것일 수 있다. 바람직하게 본 발명에 따른 Cas9 단백질의 변이체는 K848A / K1003A / R1060A / N497A / R661A / Q695A / Q926A의 아미노산 서열의 변이가 유발된 것일 수 있다. 또한, 상기 Cas9 변이체는 세포의 핵 내에서의 효율적인 유전자 편집을 위해 핵 국소화 신호 펩타이드가 추가적으로 연결된 것일 수 있다.
본 발명에서, “핵 국소화 신호 펩타이드(Nuclear Localizing Signal, NLS)”는 핵국제화신호, 핵이행신호, 핵이동서열, 핵위치서열등 다양한 용어와 혼용될 수 있다. 핵이행신호는 핵에서 이용되는 여러 가지 단백질들이 세포질에서 합성된 후 핵 내부로 수송될 수 있도록 도와주는 펩타이드 가닥으로, 그래핀을 핵 내로 진입시킬 수 있어 조직 또는 세포에서 높은 해상도와 신뢰도로 핵 내 핵산을 검출할 수 있고, 빠른 시간 안에 핵 내 핵산 검출이 가능하여 특정 질환의 진단, 생명과학 실험 등의 결과를 신속하게 알 수 있다. 예컨대, 핵 국소화 신호 펩타이드는 PKKKRKV(서열번호 33), CGGGPKKKRKVED(서열번호 34), KR-PAATKKAGQA-KKKK(서열번호 35), AVKRPAATKKAGQAKKKKLD(서열번호 36), MSRRRKANPTKLSENAKKLAKEVEN(서열번호 37), PAAKRVKLD(서열번호 38), KLKIKRPVK(서열번호 39), GRKKRRQRRRPQ(서열번호 40), KIPIK(서열번호 41) 등일 수 있다. 상기 CGGGPKKKRKVED는 the SV40 Large T-antigen (a monopartite NLS)에서 발견된 핵 국소화 신호 펩타이드고, KR-PAATKKAGQA-KKKK 및 AVKRPAATKKAGQAKKKKLD는 Nucleoplasmin (염색체를 응축하는데 관여하는 단백질)의 핵 국소화 신호 펩타이드이며, MSRRRKANPTKLSENAKKLAKEVEN는 EGL-13의 핵 국소화 신호 펩타이드이고, PAAKRVKLD는 c-Myc의 핵 국소화 신호 펩타이드이다.
본 발명에 있어서, 상기 핵 국소화 신호 펩타이드는 핵 국소화 신호 펩타이드가 Cas9 단백질 펩타이드에 작동 가능하도록 순차적으로 연결될 수 있다. 상기 핵 국소화 신호 펩타이드는 링커를 사용하여 연결된 것일 수 있으며, 예를 들어 하나 이상의 GGS 반복단위를 포함하는 GGS 링커를 사용하여 연결된 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 양태로서, 본 발명은 상기 나노좀 복합체를 유효성분으로 포함하는, 약학적 조성물을 제공한다.
상기 약학적 조성물의 치료 용도는 나노좀에 봉입되는 약물의 종류에 따라 선택적으로 적용이 가능하다. 즉, 본 발명의 약학적 조성물은 생체적합성 고분자의 내부에 봉입되는 약물의 종류에 따라서 뇌질환 예방 및 치료용 조성물, 세균감염 예방 및 치료용 조성물, 암 예방 및 치료용 조성물, 통증 예방 및 치료용 조성물, 염증성 질환 예방 및 치료용 조성물, 간질성 질환 예방 및 치료용 조성물, 궤양 예방 및 치료용 조성물, 우울증 예방 및 치료용 조성물, 알레르기성 질환 예방 및 치료용 조성물, 부정맥 예방 및 치료용 조성물, 고혈압 예방 및 치료용 조성물, 당뇨병 예방 및 치료용 조성물, 유전자 질환 예방 및 치료용 조성물 또는 심장병 예방 및 치료용 조성물 등으로 활용이 가능하다.
본 발명에서, 상기 뇌질환은, 신경교종, 뇌 암, 알츠하이머병, 뇌혈관성 치매증, 야콥-크루츠펠트병(Jacob-Creutzfeldt disease), 두부 손상에 의한 치매, 파킨슨병(Parkinson's disease), 루게릭병, 헌팅턴병(Huntington's disease), 니만-픽병(nieman-pick disease), 뇌졸중, 두부 외상, 간질, 우울증 또는 불안증일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 약학적 조성물은, 약물을 봉입하고 있는 나노좀 복합체 이외에 약학적으로 허용 가능한 담체를 더 포함할 수 있다. 상기 약학적으로 허용 가능한 담체는 제제 시에 통상적으로 이용되는 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 사이클로덱스트린, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 에탄올, 리포좀 등을 포함하지만 이에 한정되지 않으며, 필요에 따라 항산화제, 완충액 등 다른 통상의 첨가제를 더 포함할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제, 윤활제 등을 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다. 적합한 약학적으로 허용되는 담체 및 제제화에 관해서는 레밍턴의 문헌에 개시되어 있는 방법을 이용하여 각 성분에 따라 바람직하게 제제화할 수 있다. 본 발명의 약학적 조성물은 제형에 특별한 제한은 없으나 주사제, 흡입제, 피부 외용제 등으로 제제화할 수 있다.
본 발명의 약학적 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여(예를 들어, 정맥 내(intravenous), 피하(subcutaneous), 근육 내(intramuscular), 복강 내(intraperitoneal), 피내(intradermal), 점막 내(mucosal), 흡입(inhalation) 또는 국소에 적용)할 수 있으며, 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 시간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다.
본 발명의 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서 “약학적으로 유효한 양”은 의학적 치료 또는 진단에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료 또는 진단하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 질환 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명에 다른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
구체적으로 본 발명의 약학적 조성물의 유효량은 환자의 연령, 성별, 상태, 체중, 체내에 활성 성분의 흡수도, 불활성률 및 배설속도, 질병종류, 병용되는 약물에 따라 달라질 수 있으며, 매일 또는 격일 투여하거나, 1일 1 내지 3회로 나누어 투여할 수 있다. 그러나 투여 경로, 비만의 중증도, 성별, 체중, 연령 등에 따라서 증감 될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다.
또한, 본 발명의 또 다른 양태로서, 본 발명은 상기 나노좀 복합체를 유효성분으로 포함하는 약학적 조성물을 개체에 투여하는 단계를 포함하는 질환 예방 또는 치료방법을 제공한다.
또한, 본 발명의 또 다른 양태로서, 본 발명은 상기 약학적 조성물의 질환 예방 또는 치료용도를 제공한다.
본 발명에서 “개체”란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐(mouse), 쥐(rat), 개, 고양이, 말 및 소 등의 포유류를 의미한다.
또한, 본 발명의 다른 양태로서, 본 발며은 상기 나노좀을 포함하는 조영제 조성물을 제공한다.
본 발명의 일 실시예에서, 조영제 조성물은 방사성 동위원소, 유기 형광물질, 자기공명영상(MRI) 조영제, 컴퓨터단층촬영(CT) 조영제, 양전자단층촬영(PET) 조영제, 초음파 조영제 및 형광 조영제로 이루어진 군에서 선택된 하나 이상의 표지물질이 포함된 것일 수 있다.
본 발명의 나노좀에는 영상진단에 사용될 수 있는 상기와 같은 다양한 표지물질이 부착될 수 있고, 이를 이용하여 조영제 조성물로 활용될 수 있다.
방사성 동위원소를 이용한 방법에서 방사성 표지물질(Radioactive isotope)로는 단일광자방출 컴퓨터단층촬영용 핵종인 99mTc, 123I, 111In, 67Ga, 177Lu, 201Tl, 117mSn, 125I 과 양전자단층촬영용 핵종인 11C, 13N, 15O, 18F, 38K, 62Cu, 64Cu, 68Ga, 82Rb, 124I, 89Zr과 치료용 핵종인 131I, 166Ho, 188Re, 67Cu, 89Sr, 90Y, 225Ac, 213Bi, 211At을 사용할 수 있으나, 이에 제한되는 것은 아니다. 방사성 동위원소들은 비방사성의 동위체와 화학적 성질이 거의 비슷하여 임의로 치환이 가능하고, 방출 에너지가 비교적 커서 소량의 검출도 가능하다는 장점이 있기 때문에 오랫동안 사용되어 왔다.
방사성 동위원소에 대한 대안으로 널리 사용되는 것은 유기 형광물질(Organic fluorescent dyes)이다. 형광물질들은 특정 파장에 의해서 활성이 되면 고유의 파장을 갖는 빛을 발광하게 된다. 특히, 검색법이 소형화됨에 따라, 방사성 물질 역시 검출 한계를 나타내어 검색에 오랜 시간이 요구된다. 이에 비해 형광물질의 경우 적절한 조건에서 분자당 수천 개의 광자를 방출할 수 있어 단일분자 수준의 검출까지도 이론적으로 가능하다. 본 발명에서 나노좀에 봉입 또는 결합될 수 있는 유기 형광물질의 종류는 당업계에서 사용되고 있는 또는 향후 사용될 물질을 모두 포함하는 개념으로 이해된다.
또한, 반도체 나노 물질인 양자점(Quantum dot)은 CdSe, CdS, ZnS, ZnSe 등으로 구성되어 있으며 크기 및 종류에 따라서 각각 다른 색의 빛을 발광한다. 유기 형광물질에 비하여 넓은 활성 파장을 가지고 있으며 좁은 발광파장을 나타내기 때문에 다른 색을 발광하는 가짓수가 유기 형광물질보다 많다. 따라서, 최근 들어 유기 형광물질의 단점들을 극복하기 위한 방법으로 양자점이 많이 사용되고 있다. 본 발명에서 나노좀에 봉입 또는 결합될 수 있는 양자점은 당업계에서 현재 사용되고 있는 또는 향후 사용될 물질을 모두 포함하는 개념으로 이해된다.
상기 자기공명영상(MRI) 조영제는 구체적으로, 가돌리늄(Gd), 망간(Mn), 철(Fe), 구리(Cu) 및 크롬(Cr)을 포함하는 전이금속 이온; 가도펜테테이트 디메글루민(Gd-DTPA), 가도테레이트 메글루민(Gd-DOTA)을 포함하는 상기 전이금속 이온의 소수성 착화합물; 퍼플루오로카본(perfluorocarbon), 퍼플루오로프로판(perfluoropropan)을 포함하는 불소함유 화합물; 산화철계, 망간계, 구리계 및 크롬계 나노입자; 상기 나노좀의 표면을 소수성 물질로 수식한 화합물 등을 예로 들 수 있으나, 이에 한정되는 것은 아니다.
상기 컴퓨터단층촬영 조영제로는 구체적으로, 요오드화 양귀비씨 기름 유래의 요오드화 소수성 물질; 비스무스(Bi), 금(Au) 및 은(Ag)을 포함하는 금속 원소로 구성된 나노입자 등이 사용될 수 있으나, 이에 한정되는 것은 아니다.
상기 단일광자방출 컴퓨터단층촬영 조영제로는 99mTc, 123I, 111In, 67Ga, 177Lu, 201Tl, 117mSn, 125I 을 포함하는 방사선 동위원소, 상기 방사선 동위원소의 소수성 착화합물 등이 사용될 수 있으나, 이에 한정되는 것은 아니다.
상기 양전자단층촬영 조영제로는 11C, 13N, 15O, 18F, 38K, 62Cu, 64Cu, 68Ga, 82Rb, 124I, 89Zr을 포함하는 방사선 동위원소, 상기 방사선 동위원소의 소수성 착화합물 등이 사용될 수 있으나, 이에 한정되는 것은 아니다.
치료를 위한 목적으로는 131I, 166Ho, 188Re, 67Cu, 89Sr, 90Y, 225Ac, 213Bi, 211At을 포함하는 방사선 동위원소, 상기 방사선 동위원소의 소수성 착화합물 등이 사용될 수 있으나, 이에 한정되는 것은 아니다.
상기 초음파 조영제는 구체적으로, 퍼플루오로프로판(perfluoropropan), 퍼플루오로헥산(perfluorohexane), 설퍼 헥사플루오라이드(sulfur hexafluoride), 퍼플루오로펜탄(perfluoropentane), 데카플루오로부탄(decafluorobutane) 등이 사용될 수 있으나, 이에 한정되는 것은 아니다.
또한, 상기 형광 조영제는 구체적으로, 플루오로세인(fluorescein), 로다민(rhodamine), 나일 레드(Nile Red), Cy-3 및 Cy-5을 포함하는 저분자량 형광 물질; 상기 저분자량 형광 물질을 공유결합으로 도입한 소수성 물질; 5 nm 내지 20 nm 크기의 CdSe, CdS 및 CdTe로 이루어진 군으로부터 선택되는 무기물 발광 반도체로 이루어져 있으며, ZnS로 된 이종 접합체가 외부를 둘러싸고 있는 양자점(quantum dots); 상기 양자점의 표면을 소수성 물질로 수식한 형태의 물질 등이 사용될 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 따른 조영제 조성물에 사용되는 담체는 의약 분야에서 통상 사용되는 담체 및 비히클을 포함하며, 구체적으로 이온 교환, 알루미나, 알루미늄 스테아레이트, 레시틴, 혈청 단백질(예, 사람 혈청 알부민), 완충 물질(예, 여러 인산염, 글리신, 소르브산, 칼륨 소르베이트, 포화 식물성 지방산의 부분적인 글리세라이드 혼합물), 물, 염 또는 전해질(예, 프로타민설페이트, 인산수소이나트륨, 인산수소캄륨, 염화나트륨 및 아연염), 교질성 실리카, 마그네슘 트리실리케이트, 폴리비닐피롤리돈, 셀룰로즈계 기질, 폴리에틸렌 글리콜, 나트륨 카르복시메틸셀룰로즈, 폴리아릴레이트, 왁스, 폴리에틸렌 글리콜 또는 양모지 등을 포함하나 이에 제한되지 않는다. 본 발명의 조영제 조성물은 또한 상기 성분들 이외에 윤활제, 습윤제, 유화제, 현탁제, 또는 보존제 등을 추가로 포함할 수 있다.
본 발명에 따른 조영제 조성물은 비경구 투여를 위한 수용성 용액으로 제조할 수 있다. 바람직하게는 한스 용액(Hanks solution), 링거 용액(Ringers solution) 또는 물리적으로 완충된 염수와 같은 완충 용액을 사용할 수 있다. 수용성 주입(injection) 현탁액은 소디움 카르복시메틸셀룰로즈, 솔비톨 또는 덱스트란과 같이 현탁액의 점도를 증가시킬 수 있는 기질을 첨가할 수 있다.
본 발명의 조영제 조성물의 다른 바람직한 형태는 수성 또는 유성 현탁액의 멸균 주사용 제제의 형태일 수 있다. 이러한 현탁액은 적합한 분산제 또는 습윤제(예를 들면 트윈 80) 및 현탁화제를 사용하여 본 분야에 공지된 기술에 따라 제형화할 수 있다. 멸균 주사용 제제는 또한 무독성의 비경구적으로 허용되는 희석제 또는 용매 중의 멸균 주사 용액 또는 현탁액(예를 들면 1,3-부탄디올 중의 용액)일 수 있다. 사용될 수 있는 비히클 및 용매로는 만니톨, 물, 링거 용액 및 등장성 염화나트륨 용액이 있다. 또한, 멸균 비휘발성 오일이 통상적으로 용매 또는 현탁화 매질로서 사용된다. 이러한 목적을 위해 합성모노 또는 디글리세라이드를 포함하여 자극성이 적은 비휘발성 오일은 그 어느 것도 사용할 수 있다.
본 발명의 조영제 조성물은 구연산, 구연산나트륨 등의 기타 통상으로 pH 조절제로 사용하는 물질 및/또는 아스파탐, 아세설팜 칼륨, 단미시럽, 삭카린나트륨, 삭카린칼슘, 설탕 등의 기타 통상으로 감미제로 사용하는 물질 및/또는 규소수지 등의 기타 통상으로 소포제로 사용하는 물질 및/또는 알코올류, 페놀류, 유기산 및 그 염류, 유기 수은화합물, 파라벤류 등의 기타 통상으로 보존제로 사용하는 물질 및/또는 파인애플향, 딸기향, 오렌지향, 레몬향, 초콜릿향, 콜라향, 포도향, 소나무향 등의 기타 통상으로 착향제로 사용되는 물질 중에서 선택된 1종 이상의 첨가제를 추가로 함유할 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1: 실험방법
실시예 1-1. 리포펩타이드 합성, 정제 및 특성 분석
먼저, Libertyblue 자동화 마이크로파 합성 시스템(Libertyblue automatic microwave synthesized system) 상에서 Fmoc-고체상 펩타이드 합성법(SPPS)을 이용하여 펩타이드를 합성하였다. 이때, 아미노산:N,N-다이이소프로필카보디이미드(DIC):에틸 2-시아노-2-(하이드록시이미노)아세테이트 (옥시마):레진을 5:4.9:10:1 몰비로 혼합한 혼합물을 각 커플링 반응에 사용하였다.
다음으로, 상기에서 합성한 펩타이드를 이용하여 리포펩타이드를 제조하기 위해, 옥탄산 (8C), 데칸산 (10C) 또는 미리스트산 (14C)을 상기 펩타이드의 N-말단에 결합시킴으로써 지방족 사슬을 펩타이드에 접합시켰다. 이후 피페리딘(piperidine):디메틸포름아마이드(dimethylformamide; DMF)를 20:80 v/v 비율로 사용하여 Fmoc 탈보호반응을 수행하였다. 최종 생성물을 트리플루오로아세트산(trifluoroacetic acid; TFA), 트리이소프로필실란(triisopropylsilane; TIS) 및 탈이온수(DI 물)(95:2.5:2.5 v/v)의 혼합물을 사용하여 수지에서 2시간 동안 실온에서 절단하고, 이어서 차가운 무수 디에틸 에테르를 사용하여 침전시켰다. 생성물은 C4 컬럼(Waters XBridgeTM, Massachusetts, USA)에 로딩하고 역상 HPLC(Waters Quaternary Gradient Module 2545) 및 이동상 A(0.1% TFA 용액) 및 이동상 B(아세토니트릴로 희석된 0.1% TFA의 80% 용액)를 사용하여 정제하였다. 이어서, MALDI-TOF 질량 스펙트럼을 이용하여 분획물의 순도 및 분자적 질량을 확인하였다. 최종산물의 분석 결과 순도 >95%의 리포펩타이드가 정제되었음을 확인하였다.
실시예 1-2. 올리고뉴클레오티드의 합성 및 정제
DNA 올리고뉴클레오티드는 Cosmo Genetech (CosmoGene, Korea)과 Integrated DNA Technologies (IDT, USA)에서 각각 합성하고 표지하였다. T7 프로모터 및 20nt 표적 서열을 포함하는 sgRNA 주형을 중합효소연쇄반응(PCR)을 통해 증폭시키고 정제하였다. sgRNA는 제조사의 프로토콜에 따라 고수율 스크립트 T7 키트(NEB, MA, USA)를 사용하여 in vitro 전사되었으며, 전사된 sgRNA는 각각 15% 변성 TBE-우레아 폴리아크릴아미드 겔 전기영동(PAGE) (Biorad, CA, USA) 및 RNA-PAGE 복구 키트(Zymo research, CA, USA)를 사용하여 분리 및 정제하였다. 본 실시예에서 합성 및 사용된 올리고뉴클레오티드의 서열은 하기 표 1에 정리하여 나타내었다.
이름 시퀀스 (5 →3)
위치지정 돌연변이의 프라이머 구성 (소문자로 표기된 부분이 돌연변이 지점)
N497A-fwd ACGCATGACAgcCTTTGATAAAAATCTTC (서열번호 12)
N497A-rev TCAATAAATGATTGAGCTGAAG (서열번호 13)
R661A-fwd TGGTTGGGGAgcTTTGTCTCGAAAATTGATTAATG (서열번호 14)
R661A-rev GTATAACGGCGACGTTTAAG (서열번호 15)
Q695A-fwd CAATTTTATGgcGCTGATCCATGATGATAG (서열번호 16)
Q695A-rev CGATTGGCAAAACCATCTG (서열번호 17)
Q926A-fwd TGAAACTCGCgcAATCACTAAGCATG (서열번호 18)
Q926A-rev ACCAATTGGCGTTTGATAAAAC (서열번호 19)
K848A-fwd AAGTTTCCTTgcAGACGATTCAATAG (서열번호 20)
K848A-rev TGTGGAACAATGTGATCG (서열번호 21)
K1003A-fwd GAAATATCCAgcACTTGAATCGGAG (서열번호 22)
K1003A-rev TTAATCAAAGCAGTTCCAAC (서열번호 23)
R1060A-fwd GATTCGCAAAgcCCCTCTAATCGAAAC (서열번호 24)
R1060A-rev TCTCCATTTGCAAGTGTAATTTC (서열번호 25)
Insert GGS-NLS-fwd aaagcgcaaggtcTAACTAATAACATTGGAAGTGGATAAC (서열번호 26)
Insert GGS-NLS-rev ttcttcggtgatccgccGTCACCTCCTAGCTGACT (서열번호 27)
eGFP 유전자 증폭의 프라이머 구성
eGFP-fwd ATGGTGAGCAAGGGCGAGGAGC (서열번호 28)
eGFP-rev TTACTTGTACAGCTCGTCCATG (서열번호 29)
SpCas9-sgRNA sequence (밑줄친 시퀀스는 20-nt 가이드 시퀀스 표적 eGFP 유전자) GGUGGUGCAGAUGAACUUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUG (서열번호 30)
sgRNA 전사의 DNA 주형 (이태릭 시퀀스는 T7 프로모터) GAAATTAATACGACTCACTATA GGTGGTGCAGATGAACTTCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTG (서열번호 31)
실시예 1-3. 클로닝, 돌연변이, 단백질 발현, 및 정제 (HypaSpCas9-NLS)
Addgene(Plasmid # 39312)으로부터 서열번호 32의 아미노산 서열로 이루어진 SpCas9 WT 효소 단백질을 암호화하는 유전자를 얻었으며, hyper-accurate SpCas9 변이체는 SpCas9 WT에서 부위 특이적 돌연변이를 유발시키고 7개의 돌연변이 K848A / K1003A / R1060A / N497A / R661A / Q695A / Q926A에 대한 프라이머 세트를 사용하여 제조하였다. 또한, Q5® 부위 특이적 돌연변이 유발 키트(NEB, MA, USA)를 이용하여 링커 GGS 및 SV40 핵 국소화 신호(SV40 NLS, 서열번호 33) 서열을 상기 변이가 유발된 HypaCas9의 C-말단에 삽입하여 HypaCas9 변이체 단백질을 제조하였다. 플라스미드는 DNA-SpinTM 정제 키트(Intronbio, Korea)를 사용하여 분리 및 정제하였고, 서열분석을 통해 DNA ID를 확인하였다.
HypaCas9 변이체는 담배 식각 바이러스(tobacco etch virus; TEV) 프로테아제 절단 부위가 이어진 N-말단 His MBP 태그와 함께 Escherichia coli Rosetta2 (DE3)(Novagen, Korea)에서 과발현시켰다. 이후 완충액 A(20 mM Tris-HCl, pH 8.0, 250 mM NaCl, 0.5 mM TCEP, 5% 글리세롤)와 함께 Ni-NTA 친화성 크로마토그래피(Qiagen, MA, USA)를 통해 상기에서 발현된 단백질을 정제하였다. 4℃에서 5 mM EDTA가 보충된 완충액 A에 대한 투석을 통해 TEV 단백질을 사용하여 태그를 제거하였다. 이어서 정제된 Cas9를 HiTrap S 컬럼(GE HealthCare)에 로딩한 다음, 완충액 B (20 mM HEPES pH 7.6, 250 mM NaCl, 1 mM TCEP)에서 Superdex S200(GE HealthCare)상의 크기 배제 크로마토 그래피를 수행하였다.
실시예 1-4. HypaRNP가 봉입된 나노좀의 제조
리포펩타이드 기반 나노좀 형성을 위해, 농도를 달리한 스크리닝으로 작동 몰농도(working molarity)를 결정하였다. 이어서 HypaRNP가 봉입된 나노좀을 제조하기 위해, 감압 동결건조된 리포펩타이드를 5 mM MgCl2, 10% 글리세롤, 및 0.2 μM 포화지방산이 포함된 pH 7.4의 PBS에 용해시켰다. 이어서 4℃에서 15분 동안 20% 진폭, 2초 진동(pulse)/2초 멈춤(pause)으로 초음파처리하고, 동시에 HypaRNP를 첨가하여 HypaRNP가 봉입된 나노좀을 제조하였다. 이어서 상기 용액을 0.2 μM Whatman 여과 멤브레인(Merck, MA, USA)으로 여과한 다음 즉시 실험에 이용하였다. 봉입 효율은 하기 수학식에 따라 Cy3가 표지된 Cas9의 흡광도 스펙트럼에 근거하여 분석하였다. 상기 스펙트럼은 자외선(UV)-가시관선 분광학(Cary 8454 UV-Vis, Aglient Technologies, CA, USA)을 이용해 측정하였다.
[수학식 1]
efficiency(%) = [(unencapsulated - encapsulated)/unencapsulated Cy3HypaRNP]× 100
실시예 1-5. eGFP-리포터 포함 인간 HEK 세포 및 교모세포종 세포의 제조
HEK 293A 세포는 American Type Culture Collection (ATCC, USA)에서 구입하였고, 교모세포종 세포(glioblastoma cells)는 한국방사선의학연구소로부터 제공받았다. HEK 세포는 10%의 열비활성 소태아혈청(FBS, HyClone, USA)과 1%의 페니실린/스트립토마이신(Welgene, Korea)이 보충된 DMEM(Dulbecco's modified Eagle's medium)(Gibco, Korea) 배지에서 37°C 및 5% CO2 조건으로 배양하였다.
eGFP-리포터 HEK 세포주를 제조하기 위해, 세포가 배양용기 면적의 70%를 차지할 때까지 배양한 다음, 제조사의 프로토콜에 따라 리포펙타민 시약(Invitrogen, MA, USA)을 사용하여 peGFP-N1 플라스미드(Clontech, USA)를 형질감염(transfection)시켰다. 48시간 후 숙주세포의 게놈에 통합된 CMV-eGFP 카세트를 포함하는 eGEP 양성 세포를 선별하기 위해 0.5 mg/mL G418(Thermo Scientific, MA, USA)이 함유된 배지에서 4주 동안 배양하였다. 이후 유세포분석(BD biosciences, NJ, USA)을 통해 eGFP 형광을 기준으로 단일 세포를 여과 및 분류하였고, 응집된 세포, 세포 잔해 및 사멸된 세포는 제외하였다. eGFP 양성 세포는 추가 연구를 위해 0.2 mg/mL G418이 보충된 DMEM 배지에서 배양하였다.
상기 방법과 유사하게, 교모세포종 세포는 100 ng/㎕의 B27, EGF 및 bFGF를 포함하는 성장인자가 함유된 DMEM/F12 배지(Gibco, 1:1 비율)에서 배양하였다. 다음으로, 제조사의 프로토콜에 따라 IL13Ra2-eGFP(GenTarget Inc, CA, USA)의 렌티바이러스 벡터를 형질도입함으로써 eGFP-리포터 교모세포종 세포를 제조하였다. 이후 1 μg/ml의 퓨로마이신이 보충된 배지에서 형질도입된 세포를 선별하였다.
실시예 1-6. 인간 세포의 형질감염 및 eGFP 방해 분석법
하기 과정에 따라 인간 세포에 RNP가 봉입된 나노좀을 형질감염시켰다. 간략하게, 6웰 플레이트에 각 웰 당 105개 세포를 분주하고 하루 동안 배양하였다. 세포가 배양 면적의 약 60~80%에 도달하면 HypaRNP가 봉입된 나노좀 또는 봉입되지 않은 HypaRNP를 처리하고 4시간 동안 배양하였다. 이후 PBS (pH 7.4)로 세포를 세척하고 3일 동안 배양하였으며, 배양 후 세포에 1분 동안 트립신을 처리하였다. 이어서 800 g에서 3분 동안 원심분리하여 세포 펠렛을 회수한 다음, FACS 측정을 위해 PBS로 재현탁시켰다. 각 실험은 10,000개의 세포/샘플로 적어도 2회 수행하였다.
또한 공초점 현미경 관찰을 위해, 104개의 세포를 8웰 챔버(Lab-Tek II, Thermo Scientific, USA)에 분주한 다음, HypaRNP가 봉입된 나노좀 또는 봉입되지 않은 HypaRNP를 처리하고 PBS로 세포를 2회 세척한 후, 3.5% 파라포름알데히드(paraformaldehyde)로 세포를 고정하였다. 핵은 Hoechst 33342(Thermo Scientific, USA) 염색으로 표지하였고, Leica 공초점 현미경(Leica TCS SP8, Germany)으로 세포들을 관찰하였다. 실험은 적어도 2회 실시하였다.
실시예 1-7. 표적 DNA 절단과 T7 핵산내부가수분해효소 I 분석법(T7E1)
이중나선 DNA 기질은 eGFP 유전자의 PCR 산물로부터 증폭시켜 정제하였고, Cas9:sgRNA RNP 복합체는 크기 배제 컬럼을 이용하여 정제하였다. 이후 DNA 기질과 RNP(1:10 비율)를 혼합하고 버퍼 C (20 mM Hepes-NaOH, pH 7.4, 150 mM NaCl, 5 mM MgCl2, 0.1 mM EDTA, 5% glycerol, 5μg/mL BSA)에서 30분 동안 37℃로 반응을 진행하였다. 이후 실온에서 프로테아제 K (1mg/mL)를 20분 동안 처리하여 반응을 중지시켰고, 절단된 산물을 2%의 아가로오스 겔 전기영동을 사용하여 확인하였다.
한편, 삽입/결실 돌연변이 빈도를 분석하기 위해 T7E1 분석을 실시하였다. 인간 세포의 DNA는 유전체 DNA 분리 키트를 사용하여 추출하였다. 이후 Q5 fidelity DNA 중합효소(NEB, USA)와 특이적 프라이머 세트(상기 표 1 참조)를 사용하여 eGFP 유전자를 증폭시켰다. PCR 산물의 변성 및 식힘의 과정을 거친 후, 37℃에서 20분간 T7E1 (Toolgen, Korea)으로 샘플을 분해하였다. 2%의 아가로오스 겔 전기영동과 safe SYBR(Thermo Scientific, USA)으로 염색하여 분해산물을 분리하여 시각화하였다. 그 후, 하기 수학식 2에 따라 ImageLab(Chemidoc, Biorad, USA)을 사용하여 CRISPR/Cas9 시스템이 매개하는 유전자 조작 주파수를 얻기 위해 밴드를 정량화하였다. 실험은 3회 실시하였으며, 증폭에 사용된 프라이머와 가이드 RNA 서열은 상기 표 1에 나타내었다.
[수학식 2]
주파수 (%) = [1 - (절단 부분/총량)] X 100
실시예 1-8. Cy3로 표지된 SpCas9의 제조 및 정제
Cy3로 표지된 SpCas9를 제조하기 위해, SpCas9 단백질의 용매에 노출된 두 개의 시스테인 잔기(C80 및 C574)에 이황화 결합을 통해 Cy3 말레이미드(maleimide) 단일-반응 염료(GE Healthcare, IL, USA)를 결합시켰다. 간략하게, 상기 염료는 DMSO에 용해시키고 저장하였으며, 버퍼 C(20 mM Tris-HCl pH 7.5, 250 mM NaCl, 1 mM TCEP and 5% glycerol) 하에서 Cas9:염료를 1:20의 몰비로 혼합하여 표지 과정을 수행하였다. 이어서 샘플을 20℃에서 1시간 동안 배양한 다음, 4℃에서 6시간 동안 배양하였다. 이후, 10 mM TCEP를 추가하여 반응을 중지시키고, 크기 배제 크로마토그래피를 통해 표지된 SPCas9을 염료와 분리하였다. 모든 반응은 빛이 차단된 조건에서 수행되었다.
실시예 1-9. 세포 생존율 분석
리포펩타이드 기반 나노좀의 세포 독성을 조사하기 위해, 세포 독성 LDH 분석 키트-WST(Dojindo, Japan)를 사용하여 MTT 분석을 실시하였다. 간단하게, 5 x 103 HEK 세포를 96-웰 플레이트의 각 웰에 분주하고, 다음날 상기 나노좀을 다양한 농도로 포함하는 새로운 배지로 교체한 후 37℃에서 12시간 동안 배양하였다. 이어서, 배지를 회수하여 방출된 LDH를 분석하였다. 한편, 세포 형태 및 eGFP 강도는 각각 형광 현미경 및 발광 마이크로 플레이트 리더를 사용하여 모니터링 하였다.
실시예 1-10. 동적 광산란(Dynamic light scattering; DLS) 분석
물질이 봉입되지 않은 나노좀과 HypaRNA가 봉입된 나노좀의 유체역학적 직경과 제타 전위를 측정하기 위해 20℃ PBS에서 동적 광산란(Zetasizer-Nano, Malvern, UK) 분석을 실시하였다. 각 분석 결과는 3회 측정 결과의 평균 값으로 나타내었다.
실시예 1-11. 원형이색성(Circular dichroism) 측정
HypaRNP 복합체의 2차 구조는 20℃에서 190~260 nm의 파장 범위에 걸쳐 원형이색성(CD) 스펙트럼으로 측정하였다(Chirascan plus, Applied Photophysics, UK). CD 스펙트럼은 버퍼(단백질 단독) 또는 나노좀(RNP가 봉입된 나노좀)으로 빼고 얻었다. 각 결과는 평균 3회 스캔에서 평균 잔류 타원율으로 나타냈다.
실시예 1-12. 투과전자현미경(TEM)
음성-염색 TEM 샘플을 탄소가 코팅된 구리 격자판 상에 준비하고 TEM 관찰을 위한 실험을 진행하였다. 간략하게, 10 ㎕의 샘플(HypaRNP 또는 HypaRNP가 봉입된 나노좀)을 격자판 위에 떨어뜨리고 주변 온도에서 1분 동안 배양하였으며, 잉여 용액은 여과지로 닦아냈다. 샘플은 10 ㎕의 2% 우라닐 아세테이트를 첨가하여 염색하였고, TEM 샘플은 200 kV의 가속 전압과 0.2초 노출로 JEM 2100LF 투과 전자 현미경을 사용해 관찰하였다.
실시예 1-13. Solution SAXS 측정
소각 x선 산란(SAXS) 측정은 포항 가속기 연구소, 4C SAXS II 빔라인에서 수행되었다(BL4C, PAL, Korea). 포항 광원 II 저장 고리의 In-vacuum Undulator 20 (IVU20: 1.4 m short, 20 mm period)에서 나온 광원은 0.73 Å의 x선 빔 파장을 나타냈다. 산란백터 q = (4π/λ) sin θ의 규모는 0.070 nm-1 < q < 1.2 nm-1, 여기서 2θ는 산란각이고, λ는 x선 빔 파장이다. 4℃ 및 4.0m의 샘플과 검출기 거리에서 모세관 세포에서 X선 회절 데이터를 수집했다. 방사선 손상을 관찰하기 위해 5s 노출의 6개 연속 프레임에 대해 SAXS 패턴을 수집했다. 최종 산란 데이터는 대조군을 감안하고 모든 농도에서 데이터를 병합하여 생성되었으며, 산란 강도 I(q)의 Fourier inversion을 사용하여 쌍 분포 함수 P(r)를 계산하였다. 표본의 분자 질량은 BSA 산란을 기준으로 측정되었다. 상세한 SAXS 데이터 및 분석 통계는 표 2에 요약하여 나타내었다.
HypaRNP 나노좀 HypaRNP-나노좀
데이터 수집 매개변수 PAL-SAXS BL4C모세관 진동0.7340.007-0.25
싱크로트론 빔라인
빔 기하학
파장 (Å)
q 범위 (Å-1)
노출 시간 (s)
농도 범위 (mg/mL) 0.5-2.0 0.9-1.8 0.9-1.8
샘플 매개변수
샘플의 순도 99 >95 >95
온도 (K) 277 277 277
구조적 매개변수
I(0) (cm-1) [from Guinier] 0.73 6.14 6.7
Rg (nm) [from Guinier] 4.6 10.5 16.6
I(0) (cm-1) [from P(r)] 0.73 6.13 6.7
Rg (nm) [from P(r)] 4.7 10.6 16.6
Dmax (nm) 11.9 28.7 39.1
포로드(Porod) 부피 측정 (103Å3) 347 4,190 4,760
분자량 (kDa) 208 152 491
실시예 1-14. 통계적 분석
모든 데이터는 평균 ±표준 편차 (SD)로 표시된다. GraphPad Prism을 사용하여 일원 분산 분석(ANOVA)과 Tukey's HSD 테스트로 여러 그룹을 비교하였다. P < 0.05 (*로 표시)와 P < 0.01 (**로 표시)는 유의한 결과로 해석하였다.
실시예 2. 알킬 사슬 길이에 따른 리포펩타이드의 특성 분석 및 선정
본 발명자들은 본 실시예를 통해 효과적인 물질 전달을 위한 리포펩타이드 기반 나노좀을 제조하고 이의 물질 전달 효율을 분석하고자 하였다.
이를 위해, 먼저 세포투과성 펩타이드에 포화지방산이 결합된 리포펩타이드를 제조하기 위해 상기 실시예 1-1의 방법에 따라 서열번호 1의 아미노산 서열로 이루어진 dNP2 펩타이드에 3종류의 포화지방산 즉, 카프릴산(caprylic acid) 또는 옥탄산(octanoic acid) (C8:0), 카프르산(capric aid) 또는 데칸산(decanoic acid) (C10:0), 및 미리스트산(myristic acid) 또는 테트라데칸산 (C14:0) 각각을 펩타이드 결합을 통해 접합시켜 알킬 사슬 길이가 상이한 3종류의 리포펩타이드(C8dNP2, C10dNP2 및 C14dNP2)를 제조하였다.
상기 방법으로 제조된 리포펩타이드에 대하여 역상 고성능 액체크로마토그래피 (HPLC)를 통해 각 리포펩타이드가 성공적으로 합성 및 정제된 것을 확인하였으며, MALDI-TOF 분석을 실시하여 95% 이상의 순도를 갖는 각 리포펩타이드의 분자적 질량을 측정하여 도 2에 나타내었다.
나아가 각 리포펩타이드로 구성된 나노좀에 대하여 물질 전달 시스템으로써 적합한지 여부를 검증하기 위해 물리적 특성들을 분석하였다. 구체적으로, 먼저 동적 광산란법(DLS)을 이용하여 상기 각 리포펩타이드 기반 나노좀의 유체역학적 직경을 측정하였다. 그 결과, 도 3a에 나타낸 바와 같이 리포펩타이드 농도가 50 μM인 경우, C8dNP2 및 C10dNP2 나노좀의 직경은 각각 약 27.2 및 30 nm로 측정되었으며 길이가 더 긴 리포펩타이드인 C14dNP2 기반 나노좀의 경우에는 직경이 500 nm를 초과하는 것으로 나타났다. 이러한 결과와 부합하게, TEM으로 상기 각 나노좀을 관찰한 결과 도 3b에서 볼 수 있는 바와 같이 C14dNP2 기반 나노좀의 경우 리포펩타이드가 응집되어 나노좀이 관찰되지 않았으며, C10dNP2에 비해 C8dNP2이 나노좀을 더 잘 형성하는 것을 확인하였다.
이에 더하여, 각각 Phyre 및 PyMol을 사용하여 유리 리포펩타이드의 3D 구조 및 길이를 이론적으로 모델링하여 추론한 결과, 유리 C8dNP2 리포펩타이드의 길이는 약 2.8 nm인 것으로 추정되었으며, 따라서 하기 실험에서 봉입하고자 하는 물질인 약 10 nm 크기의 HypaRNP의 봉입이 가능할 것으로 판단하였다. 따라서 본 발명자들은 최종적으로 C8dNP2 리포펩타이드를 선정하였으며, 이로 이루어진 나노좀의 물질 전달 효율을 분석하기 위한 실험들을 진행하였다.
실시예 3. 펩타이드의 in vivo 뇌혈관장벽 투과능 분석
본 발명자들은 상기 리포펩타이드를 구성하는 세포투과성 펩타이드로 이용한 dNP2에 대하여 뇌혈관장벽 투과능을 분석하고자 하였다. 이를 위해, dNP2 펩타이드의 N-말단에 FITC 형광을 접합시켜 마우스의 뇌에 주입한 후 조직을 적출하여 공초점 현미경으로 관찰하였다(Iba1: Microclia 세포 표지, D: DAPI, 세포 핵, NeuN: Neuron).
그 결과, 도 4에 나타낸 바와 같이, 뇌 조직에서 FITC로 표지된 dNP2 펩타이드의 강한 형광이 관찰되는 것을 확인하였는바, 본 발명에 따른 dNP2 펩타이드가 우수한 뇌혈관장벽 투과능을 갖는 것을 알 수 있었다.
실시예 4. HypaCas9 RNP가 봉입된 나노좀 제조 및 이의 특성 분석
4-1. 리포펩타이드의 최소 농도 선정
본 실시예에서는 본 발명에 따른 리포펩타이드 기반 나노좀의 물질 전달 효율을 분석하기 위해, 상기 실시예 1-3에서 제조한 HypaRNP가 봉입된 나노좀을 제조하였다.
구체적으로, C8dNP2 리포펩타이드를 최소 농도로 사용하면서 HypaRNP를 봉입할 수 있는 나노좀의 조건을 알아보기 위해, 크기 배제 컬럼을 사용하여 HypaRNP 복합체를 정제한 다음, 0.5 μM의 HypaRNP를 다양한 농도의 C8dNP2 리포펩타이드로 구성된 나노좀(12.5, 25, 50 μM)에 봉입시켜 C8dNP2: HypaRNP가 25:1, 50:1, 및 100:1 몰비로 구성되도록 하였다.
상기 각 몰비의 HypaRNP가 봉입된 나노좀의 직경을 동적 광산란법으로 측정한 결과, 도 5a에 나타낸 바와 같이 25:1의 비율에서는 상기 RNP가 나노좀에 안정적으로 봉입되지 않은 것으로 나타나 상기 몰비는 RNP를 봉입하기에 적합한 비율이 아닌 것으로 판단하였다. 이에 반해, C8dNP2/RNP 비율이 50:1과 100:1인 경우 각각의 직경이 약 35.2 및 약 40.5 nm로 측정되었고, 이는 C8dNP2 기반 나노좀으로 HypaRNP를 완전히 봉입하기에 적절한 크기로 판단되었다. 또한, 제타 전위를 측정한 결과, 양으로 하전된 HypaRNP가 봉입된 나노좀의 경우 37.1 ± 7.8 mV로 측정되었으며, 이는 RNP가 봉입되지 않은 유리 나노좀(33.6 ± 6.9 mV) 및 유리 HypaRNP(0.5 ± 5.3 mV)에 비해 높은 값으로 양성의 나노좀 시스템이 HypaRNP의 세포 내 전달을 촉진할 것으로 판단되었다. 더욱이, C8dNP2/RNP 비율이 50:1로 구성된 나노좀을 TEM으로 관찰한 결과, 도 5b에서 볼 수 있는 바와 같이 약 35 nm의 크기를 갖는 RNP가 봉입된 나노좀이 고도의 상동성 형태를 일관되게 나타내는 것을 확인하였다.
상기 결과에 근거하여, 본 발명자들은 나노좀을 구성하는 리포펩타이드의 농도를 최소화하기 위해 C8dNP2의 농도를 25 μM로 결정하였다.
4-2. HypaRNP가 봉입된 나노좀의 특성 분석
본 발명자들은 Cy3 형광이 접합된 HypaRNP를 이용해 상기 결정된 농도 조건에 따라 상기 RNP를 봉입한 나노좀을 제조한 후 UV-visible spectrophotometry 분석을 실시하여 Cy3 형광의 흡광도를 측정하여 비교하였다. 그 결과, 도 5c에 나타낸 바와 같이 RNP가 봉입된 나노좀(Encapsulated Cy3-HypaRNP)에서 Cy3 형광이 64±12%까지 현저히 감소하였으나, 봉입되지 않은 혼합물(Cy3-HypaRNP 및 Unencapsulated Cy3-HypaRNP)에서는 이러한 감소가 나타나지 않았으며, 단백질분해효소 K를 처리하여 나노좀을 용해시킨 경우(Encapsulated Cy3-HypaRNP lysis)에도 봉입되지 않은 경우와 유사하게 Cy3 형광의 강도가 회복되는 것을 통해 HypaRNP가 C8dNP2-기반 나노좀 내에 안정적으로 봉입된 것을 확인하였다.
또한, 원형이색성 측정을 통해 HypaRNP 리보핵단백질 복합체의 2차 구조를 분석한 결과, 도 5d에 나타낸 바와 같이 나노좀으로 봉입되거나 봉입되지 않은 RNP의 2차 구조가 유사한 비율로 나타남을 확인하였는바, C8dNP2 기반 나노좀 시스템이 RNP 구조를 방해하지 않으며, 이러한 결과는 HypaRNP가 Cas9 뉴클레아제 활성의 손실 없이 리포펩타이드 기반 나노좀 시스템에 적절하게 봉입됨을 시사하는 것이다.
나아가 SAXS(small-angle X-ray scattering) 측정을 통해 수성 단계에서 C8dNP2 기반 나노좀 시스템의 형태와 분자적 질량을 분석하였다. 그 결과, 도 5e에 나타낸 바와 같이 산란 벡터 q < 0.1 Å-1의 소각(small-angle) 영역에서, 실험 산란 프로파일은 구형에 대응하는 q-1 전력 법칙을 따랐다. 또한 도 5f에서 볼 수 있는 바와 같이 종형(bell-shape)을 나타내는 쌍 분포 함수(P (r))는 종자 간을 표시하여 최대 원자간 거리가 11.9 nm (HypaRNP), 28.7 nm (Nanosome) 및 39.1 nm (HypaRNP-nanosome)을 갖는 구형의 특성을 나타내는 것을 확인하였다. 또한 RNP, 리포펩타이드 기반 나노좀 단독 또는 RNP가 봉입된 나노좀의 분자 질량을 소 혈청 알부민(BSA) 산란을 표준으로 사용하여 절대적 산란 강도를 통해 계산한 결과, RNP가 봉입된 나노좀은 나노좀 단독에 비해 339kDa의 질량 증가를 보였으며, 이는 각각의 나노좀이 약 2개의 RNP 분자를 포함할 수 있음을 시사하는 것이다.
실시예 5. 리포펩타이드 기반 나노좀의 세포 내 전달 효율 분석
본 발명자들은 리포펩타이드 기반 나노좀이 세포 내로의 물질 전달을 효율적으로 매개하는지 여부를 검증하기 위하여, 상기에서 제조한 HypaRNP가 봉입된 나노좀을 이용해 HypaRNP의 세포 내 전달 효율을 분석하였다.
5-1. 세포독성 분석
구체적으로, 상기 실시예 1-5의 방법에 따라 숙주세포의 게놈 내에 eGFP 유전자가 삽입된 eGFP-리포터 HEK 세포를 제조하고, 유세포 분석을 통해 eGFP 단백질을 안정적으로 발현하는 eGFP-리포터 HEK 세포를 회수하였다. 이후 본 발명에 따른 물질 전달 시스템인 리포펩타이드 기반 나노좀의 세포 독성을 알아보기 위해, 나노좀을 다양한 농도로 상기 세포에 처리한 후 세포 생존율을 측정하였다. 그 결과, 도 6a에 나타낸 바와 같이 C8dNP2 기반 나노좀을 50 μM 이하로 처리한 경우에는 유의미한 세포독성이 나타나지 않았다. 또한, 도 6b에서 볼 수 있는 바와 같이 봉입되지 않은 유리 HypaRNP(Unencapsulated HypaRNP)를 0.5 μM로 처리하거나 상기 HypaRNP가 봉입된 나노좀(Encapsulated HypaRNP)을 25 μM로 처리한 경우 아무 처리도 하지 않은 세포(Untreatment)와 비교하여 세포 형태에 변화가 없는 것을 확인하였다.
5-2. 리포펩타이드 기반 나노좀에 의한 HypaRNP의 전달 효율 분석
본 발명자들은 C8dNP2 리포펩타이드 기반 나노좀에 의한 HypaRNP의 세포 내 전달 효율을 평가하기 위해, DMEM 배지 하에 eGFP-리포터 HEK 세포에 HypaRNP-봉입 나노좀을 처리한 후 Cy3 형광을 통해 Cy3-HypaRNP의 세포 흡수 효율을 조사하였다.
그 결과, 도 7에 나타낸 바와 같이 상기 나노좀(Encapsulated HypaRNP)을 세포에 처리하고 30분 후부터 HypaRNP가 세포에 흡수되는 것이 관찰되었으며, 흡수 효율은 70 ± 11%로 상기 나노좀 처리 후 4시간 내에 세포 내로의 흡수가 거의 완료되었으며 24시간째는 세포에서 Cy3 형광이 관찰되지 않았다. 한편, 나노좀으로 봉입되지 않은 유리 Cy3-HypaRNP(Unencapsulated HypaRNP)를 처리한 경우에는 형광이 관찰되지 않았다. 나아가 세포 내로 흡수된 RNP가 핵에 국소화되는지 여부를 확인하기 위해, 처리 후 4시간째에 Z-stacking을 수행하여 세포 핵의 3D 이미지를 구축하였다. 그 결과, RNP가 봉입된 나노좀이 처리된 세포에서는 Cy3-HypaRNP가 특히 대부분의 핵(58±13%)에 존재하는 반면, 봉입되지 않은 Cy3-HypaRNP가 처리된 경우에는 비특이적으로 존재하는 것을 확인하였다.
실시예 6. HypaRNP의 유전자 편집 효능 비교 (T7 mismatch detection assay)
상기 결과들에 근거하여, 본 발명자들은 리포펩타이드 기반 나노좀 매개 HypaRNP 전달을 통해 인간 세포에서 게놈 변형을 효과적으로 매개하는지 여부를 조사하고자 하였다. 구체적으로, eGFP-리포터 HEK 세포 시스템에서 내인성 eGFP 유전자를 표적으로 하였다. CRIPSR/Cas9 시스템의 핵으로의 전달은 eGFP 유전자의 표적 게놈 유전자좌에서 이중 가닥 절단(double-strand breaks; DSB)을 유도하고, 세포 시스템에 의한 DSB의 수리는 DNA 절단 지점에서 삽입/삭제(insertion/deletion; indels) 변이를 초래하여 리포터 eGFP가 발현되지 못하게 된다.
이에, eGFP-리포터 HEK 세포에 봉입되지 않은 유리 HypaRNP(Unencapsulated HypaRNP) 또는 HypaRNP가 봉입된 나노좀(Encapsulated RNP)을 순차적으로 2회 처리한 다음 3일 동안 배양한 후 공초점 현미경 및 유세포 분석법을 이용하여 eGFP 형광을 분석하였다. 먼저, 공초점 현미경으로 관찰한 결과 도 8a에 나타낸 바와 같이 유리 HypaRNP 및 HypaRNP가 봉입된 나노좀이 처리된 경우 아무것도 처리하지 않은 세포(Untreatment)와 비교하여 eGFP 발현이 각각 7±5% 및 37±18% 감소한 것으로 나타났다. 또한 유세포 분석 결과, 도 8b에 나타낸 바와 같이 세포집단에서 eGFP-음성 세포의 평균 빈도는 아무 처리하지 않은 세포와 비교하여 HypaRNP가 봉입된 나노좀이 처리된 경우 17.2±2.6%로 나타났다. 한편, 유리 HypaRNP가 처리된 경우에는 eGFP-음성 세포의 수가 대조군에 비해 유의미하지는 않은 정도로 약간 증가하였으며, 이러한 결과는 나노좀-매개 HypaRNP 전달의 중요성을 시사한다. 또한 나노좀 대신 리포펙타민 2000(9.1±1.5%) 또는 CRISPRMAX(11.4±1.8%)를 이용해 HypaRNP를 전달한 경우와 비교할 때 본 발명에 따른 리포펩타이드 기반 나노좀에 의한 eGFP 유전자 변형의 빈도가 더욱 높은 것을 확인하였다.
이에 더하여, 표적 유전자의 변형률을 더 알아보기 위해 게놈 DNA를 분리하고 특이적 프라이머 세트를 사용하여 PCR로 eGFP 게놈 유전자좌를 증폭시켰다. 이후 증폭된 PCR 산물에 미스매치-민감성 T7 엔도뉴클레아제 1(T7 endonuclease 1; T7E1)을 처리하였다. T7E1 분석 결과, 도 8c에서 볼 수 있는 바와 같이 삽입/결실 돌연변이의 빈도(indels %)가 SpCas9 야생형(26.1%)과 비교해 27.6%로 약간 더 높은 것을 확인하였다. 또한, eGFP-리포터 인간교모세포종 세포에서도 HypaRNP가 봉입된 나노좀의 유전자 편집 효율을 분석한 결과, 도 8d에 나타낸 바와 같이 삽입/결실의 돌연변이 빈도가 약 20%임을 확인하였다. 더욱이, 리포펩티드 기반 나노좀 매개 전달에 의한 돌연변이 빈도 수준은 폴리-아르기닌이 접합된 SpCas9 야생형(약 6%), SpCas9 야생형 및 sgRNA를 암호화하는 플라스미드(약 7%), 금 나노입자(약 11%)와 같은 종래 시스템에 비해 현저히 높게 나타났다.
종합적으로, 본 발명의 결과를 통해 HypaRNP를 전달하는 리포펩타이드 기반 나노좀이 인간 세포에서 내인성 유전자의 편집을 효율적으로 매개한다는 것을 알 수 있었다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명에 따른 마이셀 형태의 리포펩타이드 기반 나노좀은 우수한 물질 전달 효율을 갖는 약물 전달 시스템으로써 거대 단백질 까지도 우수한 효율로 세포 내로 전달 가능함을 확인하였는바, 다양한 생물학적 활성을 갖는 물질을 세포 및 조직 등 생체 내로 효과적으로 전달함으로써 연구 분야, 다양한 질병의 진단 또는 치료 분야 등에서 유용하게 이용될 수 있을 것으로 기대된다.

Claims (11)

  1. 리포펩타이드(lipopeptide) 및 지방산이 마이셀(micelle) 구조를 형성하는 것을 특징으로 하는, 물질 전달용 나노좀.
  2. 제1항에 있어서,
    상기 리포펩타이드는 세포 투과성 펩타이드를 포함하는 것을 특징으로 하는, 나노좀.
  3. 제1항에 있어서,
    상기 지방산은 탄소 수 1 내지 20으로 이루어진 군에서 선택된 포화지방산인 것을 특징으로 하는, 나노좀.
  4. 제1항에 있어서,
    상기 나노좀은 지방산 : 리포펩타이드가 1 : 0.01 내지 1 : 1의 몰농도 비율로 포함되는 것을 특징으로 하는, 나노좀.
  5. 제1항에 있어서,
    상기 나노좀은 1 내지 2000 nm의 크기를 갖는 것을 특징으로 하는, 나노좀.
  6. 제1항 내지 제5항 중 어느 한 항의 나노좀; 및
    상기 나노좀 내에 봉입된 생물학적 활성 물질을 포함하는, 나노좀 복합체.
  7. 제6항에 있어서,
    상기 생물학적 활성 물질은 화합물(chemical compound), 단백질, 당단백질, 펩타이드, 항체(antibody), 효소(enzyme), 핵산분해효소(Nuclease), 호르몬, DNA, RNA, siRNA(small interfering RNA), miRNA(microRNA), mRNA(messenger RNA), 안티센스 올리고뉴클레오티드, 압타머(aptamer), 사이토카인(cytokine), 전사인자(transcription factor), 독소, 탄수화물, 지질, 천연물(natural product), 반합성 물질 (semi-synthetic drug), 약물(drug), 마이크로입자, 나노입자 및 바이러스로 이루어진 군에서 선택되는 하나 이상인 것을 특징으로 하는, 나노좀 복합체.
  8. 제7항에 있어서,
    상기 핵산분해효소는 Cas9(CRISPR-associated protein 9), Cas3(CRISPR-associated nuclease/helicase Cas3), CAS12, CAS13, CAS14, CAS variants, Cfp1(CxxC-finger protein-1), ZFN(Zinc finger nuclease) 및 TALEN(Transcription activator-like effector nuclease)으로 이루어진 군에서 선택되는 어느 하나인 것을 특징으로 하는, 나노좀 복합체.
  9. 제1항의 나노좀을 포함하는, 조영제 조성물.
  10. 제9항에 있어서,
    상기 조영제 조성물은 방사성 동위원소, 유기 형광물질, 자기공명영상(MRI) 조영제, 컴퓨터단층촬영(CT) 조영제, 양전자단층촬영(PET) 조영제, 초음파 조영제 및 형광 조영제로 이루어진 군에서 선택된 하나 이상의 표지물질이 포함된 것을 특징으로 하는, 조영제 조성물.
  11. 제6항의 나노좀 복합체를 유효성분으로 포함하는, 약학적 조성물.
PCT/KR2020/006713 2019-05-24 2020-05-22 마이셀 구조의 나노 전달체 및 이의 용도 WO2020242147A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2019-0060998 2019-05-24
KR20190060998 2019-05-24
KR10-2020-0061614 2020-05-22
KR1020200061614A KR20200135224A (ko) 2019-05-24 2020-05-22 마이셀 구조의 나노 전달체 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2020242147A1 true WO2020242147A1 (ko) 2020-12-03

Family

ID=73553272

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/006713 WO2020242147A1 (ko) 2019-05-24 2020-05-22 마이셀 구조의 나노 전달체 및 이의 용도

Country Status (1)

Country Link
WO (1) WO2020242147A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050032722A1 (en) * 2001-07-03 2005-02-10 Mahato Ram I. Soluble steroidal peptides for nucleic acid delivery
KR20140046994A (ko) * 2012-10-09 2014-04-21 한양대학교 산학협력단 인간 ＮＬＢＰ 유래의 ＮＰ2 폴리펩티드 또는 ｄＮＰ2 폴리펩티드를 포함하는 세포 투과 펩티드 및 이를 이용한 카고 전달 시스템

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050032722A1 (en) * 2001-07-03 2005-02-10 Mahato Ram I. Soluble steroidal peptides for nucleic acid delivery
KR20140046994A (ko) * 2012-10-09 2014-04-21 한양대학교 산학협력단 인간 ＮＬＢＰ 유래의 ＮＰ2 폴리펩티드 또는 ｄＮＰ2 폴리펩티드를 포함하는 세포 투과 펩티드 및 이를 이용한 카고 전달 시스템

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
LEHTO, T.: "Saturated fatty acid analogues of cell -penetrating peptide PepFectl4: role of fatty acid modification in complexation and delivery of splice-correcting oligonucleotides", BIOCONJUGATE CHEMISTRY, vol. 28, 2017, pages 782 - 792, XP055764380 *
MOUT, R. ET AL.: "Direct cytosolic delivery of CRISPR/Cas9-ribonucleoprotein for efficient gene editing", ACS NANO, November 2017 (2017-11-01), pages 24 52 - 2458, XP055675446 *
TESAURO, D: "Peptide-based drug-delivery systems in biotechnological applications: recent advances and perspectives", MOLECULES, vol. 24, no. 351, 19 January 2019 (2019-01-19), pages 1 - 27, XP055764384 *
THACH, T. T.: "Lipopeptide-Based Nanosome-Mediated Delivery of Hyperaccurate CRISPR/Cas9 Ribonucleoprotein for Gene Editing", SMALL, vol. 15, November 2019 (2019-11-01), XP055764388 *

Similar Documents

Publication Publication Date Title
Wu et al. Albumin-based nanoparticles as methylprednisolone carriers for targeted delivery towards the neonatal Fc receptor in glomerular podocytes
US20220062387A1 (en) Targeting of melanocytes for delivering therapeutic or diagnostic agents using protein nanocages
JP2011511641A (ja) システインに富む新規な細胞膜透過性ペプチドの同定
CN110074997A (zh) 细胞穿透肽、包含该肽的缀合物、及包含该缀合物的组合物
EA022422B1 (ru) Пептидные производные, их получение и применение
EP2167139A2 (de) Aktivierbare diagnostische und therapeutische verbindung
EP3405429B1 (en) Formation of functionalized nanoparticles by supramolecular co-assembly
KR102386477B1 (ko) 신규한 세포 투과성 펩타이드 및 이의 용도
KR102386478B1 (ko) 신규한 세포 투과성 펩타이드 및 이의 용도
US20230144488A1 (en) Cell-penetrating peptide and use thereof
WO2020242147A1 (ko) 마이셀 구조의 나노 전달체 및 이의 용도
WO2023023031A2 (en) Transferrin receptor targeting peptide oligonucleotide complexes and methods of use thereof
Li et al. Self-assembling modified neuropeptide S enhances nose-to-brain penetration and exerts a prolonged anxiolytic-like effect
TW201707727A (zh) 雙重標靶融合蛋白
WO2022139071A1 (ko) 신규한 세포 투과성 펩타이드 및 이의 용도
US20120207681A1 (en) Chemical compositions to detect and treat amyloid in a patients brain and retina
KR20200135224A (ko) 마이셀 구조의 나노 전달체 및 이의 용도
WO2008012102A2 (de) Röntgendichtes konjugat
EP3949995B1 (en) Peptide and use thereof
US20180066031A1 (en) Enzymatically-cleavable peptide amphiphiles
WO2023277628A1 (ko) 신규한 세포 투과성 펩타이드 및 이의 용도
US9782494B2 (en) Methods of using multilayer magnetic micelle compositions
WO2024054062A1 (ko) 세포 내 형질주입을 위한 신규한 폴리펩타이드 조성물
US20230279061A1 (en) Isolated peptide for a peptide coacervate, and methods of use thereof
US11447525B2 (en) Peptide and use therefor

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20814288

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20814288

Country of ref document: EP

Kind code of ref document: A1