WO2020232081A2 - Capture and analysis of target genomic regions - Google Patents
Capture and analysis of target genomic regions Download PDFInfo
- Publication number
- WO2020232081A2 WO2020232081A2 PCT/US2020/032615 US2020032615W WO2020232081A2 WO 2020232081 A2 WO2020232081 A2 WO 2020232081A2 US 2020032615 W US2020032615 W US 2020032615W WO 2020232081 A2 WO2020232081 A2 WO 2020232081A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- target genomic
- genomic region
- target
- endonucleases
- genomic regions
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
Definitions
- sequencing target genomic regions is extremely important in diverse biotechnological fields ranging from agronomy, taxonomy to medicine.
- sequencing target regions in a genome is important in precision and individualized medicine, where understanding the genetic diversity in specific regions of the genome can be linked to phenotypic information about a subject’s health, which in turn can dictate treatment options.
- sequencing target regions of a genome is important in agronomical applications for improving desirable traits in plants, such as seed and food production.
- RNA sequences Several methods exist for the analyzing target genomic DNA or RNA sequences. For example, targeted amplification prior to sequencing is common and multiple methods are available to isolate and/or amplify target regions of the genome. As a common theme, the methods known in the art utilize variations of polymerase chain reaction (PCR), ligation- chain reaction or probe hybridization to isolate and amplify target genomic regions.
- PCR polymerase chain reaction
- Current methods for isothermal detection of genetic material can be performed, for example, using loop-mediated isothermal amplification (LAMP) or strand displacement amplification.
- LAMP loop-mediated isothermal amplification
- these techniques are difficult to optimize for different targets and are not suitable for analyzing long targets.
- LAMP loop-mediated isothermal amplification
- strand displacement amplification strand displacement amplification
- Characterizing particularly, detecting and sequencing longer stretches of DNA sequences, for example, at least about 1-50 kilobase (kb), is of particular interest.
- detection and sequencing are not readily achieved with the conventional methods. Therefore, improved methods for characterizing, such as detecting and sequencing target genomic regions, particularly, detecting and sequencing long stretches of target genomic regions, are desirable.
- Certain embodiments of the invention provide materials and methods for capturing target genomic regions and optionally, further analyzing, such as by detecting and/or sequencing.
- the materials and methods disclosed herein are particularly suitable for analyzing target genomic regions containing at least about 1 kb, preferably, at least about 10 kb, even more preferably, at least about 30 kb, or most preferably, at least about 50 kb.
- target genomic regions can be isolated based on cleavage at two specific recognition sites, each recognition site containing a minimum of between about 10 and about 30 nucleotides.
- the two recognition sites flank the target genomic region.
- the cleaved target genomic region can then be captured using an oligonucleotide, referenced herein as a“bridge oligo”.
- a bridge oligo has sequences at the 3’ and the 5’ ends that hybridize to the sequences at the 3’ and 5’ ends, respectively, of the cleaved target genomic region.
- the captured target genomic regions can then be analyzed, for example, detected and/or sequenced, such as via amplification and sequencing.
- certain embodiments of the invention provide methods for capturing a target genomic region from a genetic material, comprising:
- the captured target genomic region can be further analyzed, for example, detected or sequenced.
- Such analysis can comprise the steps of: d. ligating the free ends of the single stranded target genomic region hybridized to the bridge oligo to produce a single stranded circular target genomic region that is hybridized to the bridge oligo,
- the cleavage of the target genomic region at the recognition sites is performed using a first and a second programmable endonuclease, such as Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) associated protein 9 endonucleases (Cas9 endonuclease), for example, a first Cas9 endonuclease comprising a first guide RNA (gRNA) having a sequence complementary to the first recognition site and a second Cas9 endonuclease comprising a second gRNA having a sequence complementary to the second recognition site.
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- the target genomic region hybridized to the bridge oligo is amplified via an amplification reaction, for example, an isothermal amplification reaction, preferably, via a polymerase chain reaction or rolling circle amplification (RCA) reaction.
- an amplification reaction for example, an isothermal amplification reaction, preferably, via a polymerase chain reaction or rolling circle amplification (RCA) reaction.
- RCA rolling circle amplification
- a single stranded amplification product is produced via RCA, which comprises concatenated copies of the target genomic region in single stranded form.
- One or more primers in addition to the bridge oligo can also be used in an RCA reaction to produce a double stranded amplification product, which comprises concatenated copies of the target genomic region in double stranded form.
- a conventional PCR reaction can also be used to amplify the target molecules using appropriate primers that bind to the target regions or to a common region introduced by the bridge oligo.
- the amplified target genomic region can be detected using techniques known in the art, for example, using a labeled probe complementary to a sequence within the target genomic region.
- the amplified target genomic region can also be sequenced using techniques known in the art, for example, nanopore sequencing (Oxford Nanopore TechnologiesTM), reversible dye-terminator sequencing (IlluminaTM) and Single Molecule Real-Time (SMRT) sequencing (PacBioTM).
- the materials and methods disclosed herein can be modified to capture, and optionally, analyze, multiple target genomic regions, for example, in a multiplex reaction.
- multiple pairs of target recognition sites are designed to cleave multiple target genomic regions and these multiple target genomic regions can be captured via a plurality of bridge oligos, each of the plurality of bridge oligos specifically designed to capture a target genomic region.
- the plurality of bridge oligos can be immobilized on a solid substrate, such as a chip.
- the multiple target genomic regions so captured can be detected or sequenced using techniques known in the art.
- kits for carrying out the methods of the invention comprise one or more endonucleases designed to cleave one or more target genomic regions and specific bridge oligos designed to capture the one or more target genomic regions.
- kits of the invention comprise one or more guide molecules in the form of DNA or RNA designed to cleave one or more target genomic regions and specific bridge oligos designed to capture the one or more target genomic regions.
- Such kits can also comprise one or more Cas9 endonucleases.
- kits can further comprise polymerases, ligase, primers and other reagents for amplifying the captured one or more target genomic regions. Even further, the kits can provide instructions to perform the methods of the invention.
- FIG. 1 Overview of the methods to capture a target genomic region and two examples of analyzing the target genomic region, namely, detection or sequencing.
- FIG. 2 An example of sequencing a captured target genomic region using Single Molecule Real-Time (SMRT) sequencing (PacBioTM).
- SMRT Single Molecule Real-Time
- FIG. 3 An example of the detection of multiple target genomic regions using an array of bridge oligos designed to capture multiple target genomic regions.
- FIG. 4 An example of amplification of circularized target molecule via PCR.
- Primers are illustrated containing adapters required for sequencing using reversible dye- terminator sequencing (IlluminaTM).
- FIG. 5 An example of designing recognition sites and bridge oligos based on two gRNAs that bind to the same strand of a double stranded genome.
- FIG. 6 An example of designing recognition sites and bridge oligos based on two gRNAs that bind to the opposite strands of a double stranded genome.
- FIG. 7 Another example of designing recognition sites and bridge oligos based on two gRNAs that bind to the opposite strands of a double stranded genome.
- FIG. 8 Another example of designing recognition sites and bridge oligos based on two gRNAs that bind to the same strand of a double stranded genome.
- FIG. 9 Examples of different approaches to ligate the ends of the target molecules to form a circular single-stranded structure.
- FIG. 10 An example of an RCA reaction resulting from a bridge oligo with a non complementary 5’ end section.
- FIG. 11 An example of utilizing a single programmable endonuclease and a primer extending from a target to form a circular single-stranded molecule and a bridge oligo.
- SEQ ID NO: 1 Exemplary region to be studied according to the methods of the invention.
- SEQ ID NO: 2 Exemplary first recognition site.
- SEQ ID NO: 3 Exemplary second recognition site.
- SEQ ID NO: 4 Exemplary target genomic region.
- SEQ ID NO: 5 Sequence at the 5’ end of the target genomic region of SEQ ID NO: 4.
- SEQ ID NO: 6 Sequence at the 3’ end of the target genomic region of SEQ ID NO: 4
- SEQ ID NO: 7 Sequence at the 5’ end of the bridge oligo designed to capture target genomic region of SEQ ID NO: 4.
- SEQ ID NO: 8 Sequence at the 3’ end of the bridge oligo designed to capture target genomic region of SEQ ID NO: 4.
- SEQ ID NO: 9 A bridge oligo designed to capture the target genomic region of SEQ
- phrases“consisting essentially of’ or“consists essentially of’ indicate that the described embodiment encompasses embodiments containing the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the described embodiment.
- ranges are stated in shorthand, so as to avoid having to set out at length and describe each and every value within the range. Any appropriate value within the range can be selected, where appropriate, as the upper value, lower value, or the terminus of the range.
- a range of 0.1-1.0 represents the terminal values of 0.1 and 1.0, as well as the intermediate values of 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, and all intermediate ranges encompassed within 0.1-1.0, such as 0.2-0.5, 0.2-0.8, 0.7-1.0, etc.
- a range of 5-10 indicates all the values between 5.0 and 10.0 as well as between 5.00 and 10.00 including the terminal values.
- ranges are used herein, such as for the size of the polynucleotides, the combinations and sub-combinations of the ranges ( e.g ., subranges within the disclosed range) and specific embodiments therein, are explicitly included.
- organism as used herein includes viruses, bacteria, fungi, plants and animals. Additional examples of organisms are known to a person of ordinary skill in the art and such embodiments are within the purview of the invention.
- the assays described herein can be useful in analyzing any genetic material obtained from any organism.
- genomic refers to genetic material from any organism.
- a genetic material can be viral genomic DNA or RNA, nuclear genetic material, such as genomic DNA or genetic material present in cell organelles, such as mitochondrial DNA or chloroplast DNA. It can also represent the genetic material coming from a natural or artificial mixture or several organisms.
- long target genomic regions refers to a target genomic region having at least about 1 kb, preferably, at least about 10 kb, even more preferably, at least about 30 kb, or most preferably, at least about 50 kb.
- the materials and methods disclosed herein for characterizing target genomic regions, particularly, long target genomic regions solve the problems associated with conventional methods for capture and detection of target genomic regions, particularly, long target genomic regions.
- the invention provides methods for capturing a target genomic region from a genetic material.
- the methods comprise the steps of:
- the captured target genomic region can be further analyzed, for example, detected or sequenced.
- Such analysis can comprise the steps of:
- a target genomic region is a region of interest in the genome of an organism. Such region is flanked by a first recognition site and a second recognition site. Each of the first and the second recognition sites comprises a sequence of a minimum of between about 10 to about 30 nucleotides.
- the first and the second recognition sites are selected based on the target genomic region. Typically, unique sequences that flank the target genomic region are selected as the first and the second recognition sites. Uniqueness of these sequences ensures that these sequences are less likely to occur elsewhere in the genome, thus minimizing non-specific cleavage and avoids capture of regions other than the target genomic region. Also, the minimum lengths of the first and the second recognition sites are preferably between about 10 and about 30 nucleotides, which ensure that these sequences occur rarely in a genome, thus also minimizing non-specific cleavage and capture of regions other than the target genomic region. The sequences of the first and the second recognition sites can be identical to each other or different from each other. A person of ordinary skill in the art can determine appropriate sequences for the first and the second recognition sites based on the sequence of the target genomic region and the available genomic sequence for a particular organism, for example, from a genome sequence database.
- the cleavage of a genetic material at the recognition sites is performed using one or more endonucleases that cleave the phosphodiester bond (cut) in the genetic material at the specific recognition sites.
- the endonucleases can be restriction endonucleases.
- Certain restriction endonucleases that cut recognition sites comprising a minimum of between about 10 and about 30 nucleotides, for example, up to about 80 nucleotides include meganucleases, such as homing endonucleases from the LAGLIDADG family, GIY-YIG family, HNH family, His-Cys box family and PD-(D/E)XK family.
- Additional examples of restriction endonucleases that cut recognition sites comprising a minimum of between about 10 and about 30 nucleotides, for example, up to about 80 nucleotides are known in the art and such embodiments are within the purview of the invention.
- cleavage at the recognition sites is performed using one or more programmable endonucleases.
- the term programmable endonuclease is used to describe different classes of enzymes that can be targeted to cleave a specific region of a DNA or RNA molecule.
- a programmable endonuclease is an endonuclease that can be designed or programmed to cleave a nucleotide sequence of interest.
- a programmable endonuclease can comprise of target recognition portion and endonuclease portion, where a common endonuclease portion can be combined with any target recognition portion to cleave a nucleotide sequence of interest.
- the programmable endonucleases are targeted by a guide RNA (gRNA), a guide DNA (gDNA) or by a structure formed between a guide molecule and the target (Varshney and Burgess, 2016).
- gRNA guide RNA
- gDNA guide DNA
- Cas9 are programmable endonucleases, as they cleave double stranded genetic material by making a double stranded break at a specific location at a recognition site (Jinek et ak, 2012).
- a gRNA having a specific sequence complementary to the sequence of the recognition site directs the Cas9 endonucleases to the recognition site.
- gDNA or gRNA molecules can be used to target some types of argonaute proteins (Hegge et ak, 2017; Swarts et ak, 2015).
- Additional examples of programmable endonucleases include Cpfl, C2cl, C2c2, C2c, RNA- or DNA-guided Argonaute proteins, structure-guided endonucleases, among others.
- Novel proteins can also be engineered to cleave DNA based on recognizing specific DNA structures formed between a gDNA and the target sequence, such as a 3’ end mismatch (Xu et ak, 2016).
- two Cas9 endonucleases are used to cleave a target genomic region from a genetic material, namely, a first Cas9 endonuclease that cuts DNA at a first recognition site based on a first gRNA having a sequence complementary to the first recognition site and a second Cas9 endonuclease that cuts DNA at a second recognition site based on a second gRNA having a sequence complementary to the second recognition site.
- RNP ribonucleoprotein
- programmable endonucleases such as Cas9
- Cas9 programmable endonucleases
- the use of common restriction enzymes limits the target genomic regions that can be analyzed because a combination of restriction enzymes might not exist that cut near the target region without cutting within the target region. This is particularly problematic as the number of sites increases. Furthermore, even if such combinations of restriction enzymes exist, they are likely to change every time a new target is envisioned, making the process very difficult to scale.
- PCR instead of endonucleases to extract the sites to be circularized, as done in Fredriksson et ak, (2007), limits the size of the target molecules because PCR tends to work best for fragments under 1 Kb.
- PCR requires laborious optimization and can be very difficult, cost-prohibitive or impossible to be carried out for a large number of target regions in parallel.
- a sequence toward the 5’ end of the gRNA is complementary to the sequence of the recognition site.
- a Cas9-gRNA RNP complex also recognizes a short conserved sequence motif of about two to five nucleotides, typically, three nucleotides, located adjacent on the non-complementary strand of the target DNA and to the 3’ end of the sequence of the gRNA that is complementary to the recognition site, which is called protospacer adjacent motif (PAM).
- PAM is critical in the gRNA binding to the recognition site as well as Cas9 mediated cleavage of the target genetic material, although engineered Cas9 enzymes are envisioned that lack this requirement of a PAM site.
- a recognition site is designed so that the sequence of the recognition site on the genetic material is immediately followed toward the 3’ side of the non-complementary strand by the sequence 5’-NGG-3k
- the Cas9 endonuclease When the gRNA binds to the recognition site, the Cas9 endonuclease creates a double stranded break in the double stranded genetic material at three nucleotides toward the 5’ side of the NGG sequence on the non-complementary strand, i.e., starting from the 5’ end and going towards the 3’ end of the recognition site, Cas9 endonuclease makes a double stranded break between the third and the fourth nucleotide.
- cleaved genetic material is cleaved using appropriate endonucleases
- the resultant mixture of the target genomic regions and the cleaved fragments of the genetic material are denatured to convert it into single stranded form, for example, by subjecting it to denaturation conditions.
- subjecting cleaved genetic material to denaturation conditions comprises subjecting it to an appropriate temperature in the presence of appropriate compounds, such as salt, dimethyl sulfoxide, sodium hydroxide, etc. and at appropriate pH.
- DNA can also be denatured using chemical treatment with NaOH or high salt concentration.
- the cleaved genetic material is denatured by subjecting it to a temperature of: between 75°C to 115°C, preferably, between 80°C to 110°C, more preferably, between 85°C and 105°C and even more preferably, between 90°C and 100°C, and most preferably, about 95°C.
- a person of ordinary skill in the art can determine appropriate denaturation conditions and such embodiments are within the purview of the invention.
- a specifically designed bridge oligo is contacted with the cleaved and denatured genetic material.
- the bridge oligo is a single stranded oligonucleotide.
- the bridge oligo comprises sequences at the 3’ and 5’ ends that hybridize to the sequences at the 3’ and the 5’ ends, respectively, of the single stranded target genomic region.
- a bridge oligo can also be a double stranded oligonucleotide having 3’ and 5’ end overhangs that hybridize to the sequences at the 3’ and the 5’ ends, respectively, of the single stranded target genomic region, which can be used to capture both strands of the target DNA molecule.
- the bridge oligos can be protected against nuclease degradation by the different ways known in the art so that they remain present in the reaction after a treatment with given nucleases, such as adding one or more phosphorothioate bond in its 3’ and/or 5’ ends, and adding inverted dT and inverted ddT at its 3’ and 5’ end, respectively.
- the bridge oligo serves several purposes.
- the bridge oligo circularizes the correct target genomic regions generated by on-target cuts with the endonucleases. Because off-target cutting is expected in a reaction with endonucleases, a bridge oligo provides additional specificity by only allowing the correct molecules to be circularized. Also, the bridge oligo itself can serve as the primer for the subsequent amplification.
- the bridge oligo can be engineered to provide additional functionality, such as preparing the resulting molecules for sequencing.
- a bridge oligo can be immobilized on a solid surface for detection on a chip or it can be biotinylated for recovery with streptavi din-bound beads.
- the 5’ and 3’ end of the bridge oligos can also have additional“tail” sequences that are non-complementary to the target region, creating common sequences that can be used to link to the molecule additional functionalities, such as providing sites for binding of primers for PCR, add biotin molecules or other modifications known in the art (Figure 10).
- a bridge oligo can further contain sequences, such as a restriction site specific for a rare-cutter restriction endonuclease, a primer binding sequence or a target for a programmable endonuclease.
- the rare-cutter restriction site or the target for a programmable endonuclease can be used to cleave individual target genomic regions from the concatenated copies of the target genomic region produced after nucleic acid amplification.
- Non-limiting examples of rare-cutter restriction endonucleases are described in PCT Publication WO 2009/079488, which is herein incorporated by reference in its entirety, particularly, Table 1.
- a rare-cutter restriction endonuclease is an endonuclease whose restriction site occurs rarely in a genetic material.
- a rare- cutter restriction endonuclease is an endonuclease whose restriction site occurs on average every 50-100 kb, preferably, every 100-200 kb, or more preferably, every 200-400 kb, or even more preferably, every 400-600 Kb. Examples of rare-cutter restriction endonucleases for human genome and their restriction sites are given in Table 1 below:
- Table 1 Examples of human rare-cutter endonucleases and their restriction sites.
- rare-cutter endonucleases are described in, e.g., Restriction Endonucleases ((Nucleic Acids and Molecular Biology) by Pingoud (Editor), Springer; 1 ed. (2004)). Many rare-cutter endonucleases are also commercially available, such as roaming class of endonucleases, e.g., from New England BioLabs (Beverly, MA). Even further examples of rare-cutter endonucleases are known in the art and such embodiments are within the purview of the invention.
- a primer binding sequence in a bridge oligo facilitates using an additional primer in a RCA reaction to amplify the target genomic regions and produce concatenated copies of the target genomic region in double stranded form, through hyper-branching of the original molecule.
- the first and the second recognition sites can be present on the same strand of the genetic material or on the opposite strands of the genetic material.
- Figure 5 provides an example of designing recognition sites and bridge oligos based on two gRNAs that bind to the same strand of a double stranded genome.
- the bottom strand of the double stranded genomic DNA is selected for designing the recognition sites.
- the first gRNA binds to the first recognition site and the Cas9 endonuclease cuts the genomic DNA three nucleotides downstream of the 5’ end of the first recognition site.
- the second gRNA binds to the second recognition site and the Cas9 endonuclease cuts the genomic DNA three nucleotides downstream of the 5’ end of the second recognition site.
- the target genomic region is cleaved from the genomic DNA in double stranded form.
- This target genomic region has, at the end towards the first recognition site, all but the first three nucleotides from the first recognition site and has, at the end towards the second recognition site, the first three nucleotides from the second recognition site.
- This double stranded target genomic region can be converted to single stranded form and one or more bridge oligos can be designed to capture either or both of the strands.
- a bridge oligo is designed to have, towards the 3’ end, a sequence complementary to the first three nucleotides of the second recognition site and additional nucleotides that are complementary to the sequence present on the bottom strand beyond and adjacent to the 5’ end of the second recognition site.
- This bridge oligo has, towards the 5’ end, a sequence complementary to the first recognition site except the first three nucleotides and optionally, additional nucleotides that are complementary to the sequence present on the bottom strand beyond and adjacent to the 3’ end of the first recognition site.
- a bridge oligo is designed to have, towards the 3’ end, the sequence of the first recognition site except the first three nucleotides and optionally, a sequence present on the bottom strand beyond and adjacent to the 3’ end of the first recognition site.
- This bridge oligo has, towards the 5’ end, the sequence of the first three nucleotides of the second recognition site and additional nucleotides that are present on the bottom strand beyond and adjacent to the 5’ end of the second recognition site.
- Figure 6 provides an example of designing recognition sites and bridge oligos based on two gRNAs that bind to the opposite strands of a double stranded genome.
- the bottom strand of the double stranded genomic DNA is selected for designing the first recognition site and the top strand of the double stranded genomic DNA is selected for designing the second recognition site.
- the first gRNA binds to the first recognition site on the bottom strand and the Cas9 endonuclease cuts the genomic DNA three nucleotides downstream of the 5’ end of the first recognition site.
- the second gRNA binds to the second recognition site on the top strand and the Cas9 endonuclease cuts the genomic DNA three nucleotides downstream of the 5’ end of the second recognition site.
- the target genomic region is cleaved from the genomic DNA in double stranded form.
- This target genomic region has, at the end towards the first recognition site, the sequence of the first recognition site except the first three nucleotides, and has, at the end towards the second recognition site, the sequence of the second recognition site except the first three nucleotides.
- This double stranded target genomic region can be converted to single stranded form and one or more bridge oligos can be designed to capture either or both of the strands.
- a bridge oligo is designed to have, towards the 3’ end, the sequence of the second recognition site except the first three nucleotides and optionally, a sequence present on the top strand beyond and adjacent to the 3’ end of the second recognition site.
- This bridge oligo has, towards the 5’ end, the sequence complementary to the first recognition site except the first three nucleotides and optionally, a sequence complementary to the sequence present on the bottom strand beyond and adjacent to the 3’ end of the first recognition site.
- a bridge oligo is designed to have, towards the 3’ end, the sequence of the first recognition site except the first three nucleotides and optionally, a sequence present on the bottom strand beyond and adjacent to the 3’ end of the first recognition site.
- This bridge oligo has, towards the 5’ end, a sequence complementary to the second recognition site except the first three nucleotides and optionally, a sequence complementary to the sequence present on the top strand beyond and adjacent to the 3’ end of the second recognition site.
- Figure 7 provides another example of designing recognition sites and bridge oligos based on two gRNAs that bind to the opposite strands of a double stranded genome.
- the top strand of the double stranded genomic DNA is selected for designing the first recognition site and the bottom strand of the double stranded genomic DNA is selected for designing the second recognition site.
- the first gRNA binds to the first recognition site on the top strand and the Cas9 endonuclease cuts the genomic DNA three nucleotides downstream of the 5’ end of the first recognition site.
- the second gRNA binds to the second recognition site on the bottom strand and the Cas9 endonuclease cuts the genomic DNA three nucleotides downstream of the 5’ end of the second recognition site.
- the target genomic region is cleaved from the genomic DNA in double stranded form.
- This target genomic region has, at the end towards the first recognition site, the first three nucleotides of the first recognition site and has, at the end towards the second recognition site, the first three nucleotides of the second recognition site.
- This double stranded target genomic region can be converted to single stranded form and one or more bridge oligos can be designed to capture either or both of the strands.
- a bridge oligo is designed to have, towards the 3’ end, a sequence complementary to the first three nucleotides of the second recognition site and additional nucleotides that are complementary to the sequence present on the bottom strand beyond and adjacent to the 5’ end of the second recognition site.
- This bridge oligo has, towards the 5’ end, the sequence of the first three nucleotides of the first recognition site and additional nucleotides that are present on the top strand beyond and adjacent to the 5’ end of the first recognition site.
- a bridge oligo is designed to have, towards the 3’ end, a sequence complementary to the first three nucleotides of the first recognition site and additional nucleotides that are complementary to the sequence present on the top strand beyond and adjacent to the 5’ end of the first recognition site.
- This bridge oligo has, towards the 5’ end, the sequence of the first three nucleotides of the second recognition site and additional nucleotides that are present on the bottom strand beyond and adjacent to the 5’ end of the second recognition site.
- Figure 8 provides another example of designing recognition sites and bridge oligos based on two gRNAs that bind to the same strand of a double stranded genome.
- the top strand of the double stranded genomic DNA is selected for designing the first recognition site and the second recognition site.
- the first gRNA binds to the first recognition site on the top strand and the Cas9 endonuclease cuts the genomic DNA three nucleotides downstream of the 5’ end of the first recognition site.
- the second gRNA binds to the second recognition site on the top strand and the Cas9 endonuclease cuts the genomic DNA three nucleotides downstream of the 5’ end of the second recognition site.
- the target genomic region is cleaved from the genomic DNA in double stranded form.
- This target genomic region has, at the end towards the first recognition site, the first three nucleotides at the 5’ end of the first recognition site and has, at the end towards the second recognition site, all but the first three nucleotides at the 5’ end of the second recognition site.
- This double stranded target genomic region can be converted to single stranded form and one or more bridge oligos can be designed to capture either or both of the strands.
- a bridge oligo is designed to have, towards the 3’ end, the sequence of the second recognition site except for the first three nucleotides and optionally, the sequence present on the top strand beyond and adjacent to the 3’ end of the second recognition site.
- This bridge oligo has, towards the 5’ end, the sequence of the first three nucleotides of the first recognition site and additional nucleotides that are present on the top strand beyond and adjacent to the 5’ end of the first recognition site.
- a bridge oligo is designed to have, towards the 3’ end, a sequence complementary to the first three nucleotides of the first recognition site and additional nucleotides that are complementary to the sequence present on the top strand beyond and adjacent to the 5’ end of the first recognition site.
- This bridge oligo has, towards the 5’ end, a sequence complementary to the second recognition site except the first three nucleotides and optionally, a sequence complementary to the sequence present on the top strand beyond and adjacent to the 3’ end of the second recognition site.
- hybridizes with indicates that the two sequences are sufficiently complementary to each other to allow hybridization between the two sequences. Sequences that hybridize with teach other can be perfectly complementary but can also have mismatches to a certain extent. Therefore, the sequences at the 5’ and 3’ ends of a bridge oligo may have a few mismatches with the corresponding sequence at the 5’ and 3’ ends of the target genomic region as long as the bridge oligo can hybridize with and capture the target genomic region. Depending upon the stringency of hybridization, a mismatch of about 5% to about 20% between the two complementary sequences would allow for hybridization between the two sequences. Typically, high stringency conditions have higher temperature and lower salt concentration and low stringency conditions have lower temperature and higher salt concentration. High stringency conditions for hybridization are preferred, and therefore, the sequences at the 3’ and 5’ ends of a bridge oligo are preferred to be perfectly complementary to the sequences at the 3’ and 5’ ends, respectively, of the target genomic region.
- the captured target genomic region can be further analyzed, for example, detected or sequenced.
- Such analysis can comprise the steps of:
- ligating the free ends of the single stranded target genomic region hybridized to the bridge oligo to produce a single stranded circular target genomic region that is hybridized to the bridge oligo is performed by using a ligase ( Figure 9A).
- ligating the free ends of the single stranded target genomic region also comprises nucleic acid synthesis to fill the gap between the two ends of the target genomic region using an appropriate DNA polymerase enzyme ( Figure 9B).
- the gap between the ends of the target can also be filled by hybridizing a single-stranded oligo to the bridge oligo in the gap and ligating the resulting molecules together (Figure 9C).
- Ligase enzymes suitable for ligating the free ends of the single stranded target genomic are known in the art and include T4 DNA ligase, Ampligase, T7 DNA ligase and Taq DNA ligase.
- the properly circularized target sequences can be converted into a double-stranded vector. This can be done by supplementing the reaction with a DNA polymerase without strand-displacement capabilities and DNA ligase, which will fill synthesize a second strand complementary to the circularized target ( Figure 4).
- the remaining genetic material for example, uncleaved genomic DNA and off-targets genomic fragments
- the remaining genetic material are removed, for example, degraded.
- This can be done by a combination of exonucleases that degrade the nucleic acids from their exposed 3’ or 5’ terminus, whether single-stranded or double-stranded, DNA or RNA.
- a treatment with appropriate exonucleases leaves only the circularized target molecules and greatly reduces the difficulty of the subsequent steps.
- the properly circularized target sequences separated from the rest of the genetic material via a treatment with an exonuclease and hybridized to the bridge oligo, can be amplified via nucleic acid amplification.
- the amplification can be done via PCR, using the sequences in the bridge oligo to design primers that can amplify the circular molecules and convert them back into linear molecules. This is particularly suitable for short stretches for DNA ( ⁇ 10 Kb), where PCR is most efficient.
- the bridge oligos for multiple targets can contain a common region non-complementary to the target that is used to drive the PCR reaction with a pair of common primers for all fragments in parallel ( Figure 4).
- such amplification is an isothermal amplification, for example, rolling circle amplification (RCA).
- the isothermal amplification facilitates amplification of long stretches of DNA, for example, multiple copies of target genomic regions, each copy containing at least about 10-50 kb can be produced.
- a conventional RCA reaction padlock synthetic probes are used to hybridize a target nucleic acid sequence and create a circle (Nilsson et ah, 1994). The circle is then amplified in an RCA reaction.
- a circularized target sequence captured using a bridge oligo is amplified via an RCA reaction.
- the bridge oligo acts as the primer for the RCA reaction, which linearly amplifies the target sequence creating long, single-stranded, tandem repeats of the target sequence.
- the amplified single stranded target sequences can then be used for subsequent analysis.
- the amplified target sequences can also be converted into double-stranded form, for example by capturing both target strands and allowing their RCA products to reanneal.
- exponential amplification of the target circularized molecules can be obtained through hyper-branched RCA using one or more additional primers (beyond the bridge oligo itself) to generate double-stranded tandem repeats of the target sequence.
- the primers beyond the bridge oligo can be designed based on the sequences of the bridge oligo, based on the sequences present in the target genomic region, or be composed of a combination of random bases to amplify multiple positions of the circle. Additional approaches to convert the single stranded captured target genomic regions into double-stranded form are known in the art and such embodiments are within the purview of the instant invention.
- the target genomic regions of different sizes can be created and amplified by RCA, thereby bypassing limitations of conventional methods that depend on amplifying nucleic acids by PCR and, hence, are not effective for amplifying long target genomic regions.
- An important advantage provided by the methods disclosed herein is the detection and analysis of long target genomic regions, for example, genomic regions containing at least about 1 kb, preferably, at least about 15 kb, even more preferably, at least about 30 kb, or most preferably, at least about 50 kb.
- the product of the RCA reaction can be analyzed to detect or sequence the target genomic region.
- amplification product can be detected based on the turbidity of the reaction, fluorescence detection or labeled molecular beacons.
- label refers to a molecule detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means.
- useful labels include fluorescent dyes (fluorophores), fluorescent quenchers, luminescent agents, electron-dense reagents, biotin, digoxigenin, 32 P and other isotopes or other molecules that can be made detectable, e.g., by incorporating into an oligonucleotide.
- the term includes combinations of labeling agents, e.g., a combination of fluorophores each providing a unique detectable signature, e.g., at a particular wavelength or combination of wavelengths.
- fluorophores include, but are not limited to, Alexa dyes (e.g., Alexa 350, Alexa 430, Alexa 488, etc ), AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, Cy2, Cy3, Cy5, Cy5.5, Cy7, Cy7.5, Dylight dyes (Dylight405, Dylight488, Dylight549, Dylight550, Dylight 649, Dylight680, Dylight750, Dylight800), 6-FAM, fluorescein, FITC, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, ROX, R-Phycoerythrin (R-PE), Starbright Blue Dyes (e.g., Starbright Blue 520, Starbright Blue 700), TAMRA, TET
- Certain embodiments of the invention provide detection in parallel of more than four different targets.
- different bridge oligos can be immobilized onto a substrate, for example, a chip, where the coordinates of each bridge oligo and, therefore, of each target genomic region is known.
- a substrate for example, a chip
- dozens, hundreds or even thousands of target sequences can be detected and analyzed in a multiplex reaction.
- the product of the PCR or RCA reaction is sequenced.
- Various methods of sequencing can be used for sequencing the product of the PCR and RCA, such as using portable Nanopore MinionTM or benchtop machines, Nanopore PromethionTM, PacBio SequelTM or Illumina HiSeqTM.
- the sequencing step can also be used for multiplex detection of several targets and/or polymorphism detection.
- short properly circularized target sequences can be prepared for sequencing after PCR amplification ( Figure 4).
- the PCR primers can be specific to the target regions or, preferably, be universal to all targets by designing them to amplify a common region introduced by the bridge oligo ( Figures 4B-4C).
- adapter molecules can be added to the molecules to make them compatible with the sequencer being used, following the specific manufacture’s recommendations.
- primers with “tails” non-complementary to the bridge oligo can be used to incorporate the necessary adapters during the PCR, making the process more efficient ( Figures 4A and 4C).
- These primers may also contain a short unique sequence (4-16 nucleotides) that is added during PCR to link the sequencing data to the respective sample, commonly known as index or barcode ( Figure 4C).
- concatenated copies can be cleaved to produce individual copies of the target genomic region, for example, using a rare-cutter restriction enzyme to cut the concatenated copies at the restriction site introduced via the bridge oligo. Such cleavage produces multiple copies of the target genomic region, each having sticky ends.
- the sticky ends can be used to conjugate the target genomic regions to an adapter sequence.
- an adapter comprising overhangs complementary to the restriction site specific for the rare-cutter restriction enzyme can be mixed with the copies of the target genomic regions to produce a double stranded DNA comprising the target genomic region flanked by the adapters.
- adapter refers to a known nucleotide sequence of between four to one hundred nucleotides, preferably, between ten to twenty nucleotides, and even more preferably, about fifteen nucleotides, depending on the sequencing technology being used.
- the adapter sequences once incorporated at the ends of the amplified copies of the target genomic regions can facilitate sequencing of the target genomic regions, for example, by providing binding sites for primers.
- target genomic regions flanked by the adapters are sequenced using paired-end sequencing.
- paired-end sequencing used herein refers to the sequencing technology where both ends of a fragment are sequenced using specific primer binding sites present on each of the ends of the double stranded polynucleotides.
- Paired-end sequencing generates high-quality sequencing data which is aligned using a computer software program to generate the sequence of the polynucleotide flanked by the two primer binding sites. Sequencing from both ends of a double stranded molecule allows high quality data from both ends of the double stranded molecule because sequencing from only one end of the molecule may cause the sequencing quality to deteriorate as longer sequencing reads are performed.
- the double stranded polynucleotides produced at the end of the adapter incorporation are sequenced using specific primers that bind to the two ends of the double stranded target genomic regions flanked by the adapters.
- a general description and the principle of paired-end sequencing is provided in Illumina Sequencing Technology, Illumina, Publication No. 770-2007-002, the contents of which are herein incorporated by reference in their entirety.
- Non-limiting examples of the paired-end sequencing technology are provided by Illumina MiSeqTM, Illumina MiSeqDxTM and Illumina MiSeqFGxTM. Additional examples of the paired-end sequencing technology that can be used in the assays of the invention are known in the art and such embodiments are within the purview of the invention.
- the sticky ends of the cleaved copies of target genomic regions can be used to conjugate the target genomic regions with hairpin adapters.
- a hairpin adapter comprising overhangs complementary to the restriction site specific for the rare-cutter restriction enzyme can be mixed with the copies of the target genomic regions to produce a double stranded DNA comprising the target genomic region flanked by the hairpin adapters.
- the phrase“hairpin adapter” refers to a polynucleotide containing a double stranded stem and a single stranded hairpin loop.
- the single stranded hairpin loop region of a hairpin adapter can provide primer binding site for sequencing.
- a hairpin adapter hybridizes with both sticky ends of a target genomic sequence, it produces a double-stranded DNA template containing the target genomic region in the double stranded region capped by hairpin loops at both ends.
- Such template can be used for sequencing the target genomic region via Single Molecule Real-Time (SMRT) sequencing (PacBioTM). Description and the principle of SMRT sequencing is provided in Pacific Biosciences (2016), Publication No.: BR108-100318, the contents of which are herein incorporated by reference in their entirety.
- SMRT Single Molecule Real-Time
- nanopore technology is used to sequence the target genomic regions.
- the copies of target genomic regions are processed to sequence the target genomic regions as described, for example, in Nanopore Technology Brochure, Oxford Nanopore Technologies (2019), and Nanopore Product Brochure, Oxford Nanopore Technologies (2016). The contents of both these brochures are herein incorporated by reference in their entireties.
- multiple target genomic regions are captured and optionally, further analyzed, such as detected or sequenced.
- a pair of gRNAs is designed for each target genomic region.
- the sequences of the gRNAs are selected so that the Cas9 endonuclease for one target genomic region does not disrupt other target genomic regions. Based on the known genomic sequences of the concerned organism, a person of ordinary skill in the art can determine appropriate combinations of recognition sites to specifically cleave and isolate multiple target genomic regions.
- the gRNAs can also be designed and synthesized with degenerate or wobble bases to allow for hybridization to multiple or uncertain locations.
- this can be done to compensate for known polymorphisms in the gRNA target site, to add multiple degenerate bases to randomly hybridize to multiple positions of the genome, as well as to design gRNAs that hybridize to an unknown gene that encodes a known amino acid sequence based on the degeneracy of the genetic code.
- the bridge oligo may also be adapted to contain the degenerate bases, if needed.
- certain embodiments of the invention provide a method for capturing a plurality of target genomic regions from a genetic material.
- the methods comprise the steps of:
- each pair of endonucleases having a first recognition site and a second recognition site, each recognition site comprising a sequence of a minimum of between about 17 and about 24 nucleotides, wherein each pair of recognition sites flanks a target genomic region from the plurality of target genomic regions,
- each bridge oligo comprises sequences at the 3’ and 5’ ends that hybridize to the 3’ and 5’ ends, respectively, of a target genomic region from the plurality of target genomic regions in single stranded form.
- the aspects described above of capturing a target genomic region for example, designing the recognition sites, endonucleases used in cleaving the genetic material and designing the bridge oligos for capturing the cleaved target genomic regions are also applicable to the instant methods of capturing a plurality of target genomic regions.
- a substrate having a plurality of bridge oligos conjugated to the substrate at specific known locations.
- a genetic material cleaved with a plurality of pairs of endonucleases is converted into the single stranded form and the plurality of target genomic regions in single stranded form is contacted with the substrate under appropriate conditions to allow hybridization between the bridge oligos conjugated to the substrate the plurality of target genomic regions.
- target genomic regions are hybridized to the corresponding bridge oligos and circularized, the target genomic regions present at specific locations can be further analyzed.
- the capture target genomic regions are amplified using RCA and further detected, for example, using laser excitation and emission detection methods.
- the plurality of target genomic regions are further analyzed, for example, detected or sequenced.
- Such analysis can comprise the steps of:
- removing non-circularized genetic material from the substrate e. optionally, removing non-circularized genetic material from the substrate, f. optionally, amplifying the plurality of target genomic regions by nucleic acid amplification to produce multiple copies of each target genomic region, and
- the aspects described above of analyzing a target genomic region for example, ligating the free ends of the single stranded target genomic regions, detecting the target genomic regions or sequencing the target genomic regions are also applicable to the instant methods of analyzing a plurality of target genomic regions.
- the non-circularized genetic material can be removed by degrading with exonucleases or by washing it from the substrate.
- kits for carrying out the assay of the invention can contain specific endonucleases necessary to carry out the assay of the invention, specific guide molecules designed to target one or more target genomic regions, a computer software program designed to process the sequencing data obtained from the assay and optionally, materials that provide instructions to perform the assay.
- the kit of the invention comprises:
- the kit can further comprise one or more programmable endonucleases.
- kits can comprise primers for PCR or RCA reaction of circularized target genomic regions, DNA ligase, polymerase and other reagents for PCR or RCA, restriction endonucleases, for example, rare-cutters to cleave concatenated copies of the target genomic regions, and sequencing reagents.
- the kit of the invention can be customized for one or more specific target genomic regions.
- a user may provide the sequences of one or more target genomic regions and a kit can be produced to carry out the assay of the invention for the one or more target sequences.
- This example describes a typical procedure for capturing and analyzing a target genomic region according to the materials and methods disclosed herein. For example, the following sequence is identified for analysis in this example. 5’ACCCACTGTTGAGAGTCAGTGGCAAGAGAAGTCTCGTCTTTTACGTCCCGTATC A A A ATGAGTGTAC A ATAC ATGA/Gl TCTA TGTGCGA GTGA GA I GCA CGGGTCTGGGC CTGGAGAGTGGACCACCTACAATTGGCCATTTCGGTTTGCGGAAGCTGTCAAGTC AACGCGAGTCCTAG[G/A]ATCTCATAGTCTTCGCATTAACCCGTATTAAGTGGACT CGCCTACAGTTTGTCTTATGCTAGCAACCCAGGCAIT/ AGTCTGTACGCGCGHrC GTCCACrGGirAGTGGGGTCCTTCCTGGAGTGTrC/GlGTATGGGCCATCCGGTCTAC CTTACTAACTTAGGCTTTAAGCGCATTTCTATGTGCGTGAGGTGTCGCATTCATAC TTAG
- sequence of SEQ ID NO: 1 provides the sequence of the non-complementary strand, i.e., the gRNA binds to the opposite strand.
- the recognition sites are present on the opposite strand and the regions corresponding to the recognition sites are bolded and italicized, NGG PAM motif is underlined and the sites for cleavage by Cas9 endonuclease are indicated by vertical bars.
- a first gRNA is designed to bind to the first recognition site having the sequence that is reverse complementary to the sequence of TCTATGTGCGAGTGAGAGCA (SEQ ID NO: 2) and the second gRNA is designed to bind to the second recognition site having the sequence that is reverse complementary to the sequence of GCGCGATCGTCCACTGGTAG (SEQ ID NO: 3).
- the two recognition sites flank a genomic sequence having certain single nucleotide polymorphisms (SNPs) indicated by the nucleotides in the solid brackets. Cas9 mediated cleavage of this sequence will produce a sequence of 184 bp. Sequencing this fragment will provide information about the SNPs present within this region.
- Cas9 mediated cleavage of a genetic material containing the sequence of SEQ ID NO: 1 will produce the following fragment, which is the target genomic region.
- GCATAGTCTGTACGCGCGATCGTCCACTGG (SEQ ID NO: 6). Sequences complementary to these sequences are produced for the ends of the bridge oligo to capture the target genomic region of SEQ ID NO: 4.
- SEQ ID NOs: 7 and 8 are connected to create a bridge oligo of the following sequence:
- Padlock probes circularizing oligonucleotides for localized DNA detection. Science 265, 2085-8. Available at: http://www.ncbi.nlm.nih.gov/pubmed/7522346 [Accessed May 1, 2018]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR112022001539A BR112022001539A2 (pt) | 2019-05-13 | 2020-05-13 | Captura e análise de regiões genômicas alvo |
| KR1020217040709A KR20220039653A (ko) | 2019-05-13 | 2020-05-13 | 표적 게놈 영역의 포집 및 분석 |
| AU2020275301A AU2020275301A1 (en) | 2019-05-13 | 2020-05-13 | Capture and analysis of target genomic regions |
| US17/610,724 US20220220542A1 (en) | 2019-05-13 | 2020-05-13 | Capture and analysis of target genomic regions |
| EP20806525.0A EP3969581B1 (en) | 2019-05-13 | 2020-05-13 | Capture and analysis of target genomic regions |
| CA3145806A CA3145806A1 (en) | 2019-05-13 | 2020-05-13 | Capture and analysis of target genomic regions |
| CN202080051127.XA CN114286861B (zh) | 2019-05-13 | 2020-05-13 | 捕获和分析靶基因组区域 |
| JP2022506557A JP7854386B2 (ja) | 2019-05-13 | 2020-05-13 | 標的ゲノム領域の捕捉と分析 |
| ES20806525T ES3051342T3 (en) | 2019-05-13 | 2020-05-13 | Capture and analysis of target genomic regions |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962846988P | 2019-05-13 | 2019-05-13 | |
| US62/846,988 | 2019-05-13 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2020232081A2 true WO2020232081A2 (en) | 2020-11-19 |
| WO2020232081A3 WO2020232081A3 (en) | 2020-12-24 |
Family
ID=73289300
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/032615 Ceased WO2020232081A2 (en) | 2019-05-13 | 2020-05-13 | Capture and analysis of target genomic regions |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20220220542A1 (https=) |
| EP (1) | EP3969581B1 (https=) |
| JP (1) | JP7854386B2 (https=) |
| KR (1) | KR20220039653A (https=) |
| CN (1) | CN114286861B (https=) |
| AU (1) | AU2020275301A1 (https=) |
| BR (1) | BR112022001539A2 (https=) |
| CA (1) | CA3145806A1 (https=) |
| ES (1) | ES3051342T3 (https=) |
| WO (1) | WO2020232081A2 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022232425A3 (en) * | 2021-04-29 | 2022-12-01 | Illumina, Inc. | Amplification techniques for nucleic acid characterization |
| EP4034675A4 (en) * | 2019-09-26 | 2023-10-04 | Jumpcode Genomics, Inc. | Method and system for targeted nucleic acid sequencing |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009079488A1 (en) | 2007-12-17 | 2009-06-25 | Helicos Biosciences Corporation | Surface-capture of target nucleic acids |
Family Cites Families (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2876249A1 (fr) | 2004-10-11 | 2006-04-14 | Barry Callebaut Ag | Utilisation du beurre de cacao dans des preparations culinaires |
| US20090233291A1 (en) * | 2005-06-06 | 2009-09-17 | 454 Life Sciences Corporation | Paired end sequencing |
| CA2615323A1 (en) * | 2005-06-06 | 2007-12-21 | 454 Life Sciences Corporation | Paired end sequencing |
| EP3257949A1 (en) | 2005-06-15 | 2017-12-20 | Complete Genomics Inc. | Nucleic acid analysis by random mixtures of non-overlapping fragments |
| CN101432439B (zh) * | 2006-02-24 | 2013-07-24 | 考利达基因组股份有限公司 | Dna阵列上的高通量基因组测序 |
| US9080211B2 (en) * | 2008-10-24 | 2015-07-14 | Epicentre Technologies Corporation | Transposon end compositions and methods for modifying nucleic acids |
| US9365897B2 (en) * | 2011-02-08 | 2016-06-14 | Illumina, Inc. | Selective enrichment of nucleic acids |
| US9873907B2 (en) * | 2013-05-29 | 2018-01-23 | Agilent Technologies, Inc. | Method for fragmenting genomic DNA using CAS9 |
| EP4170044B1 (en) * | 2014-06-06 | 2026-03-11 | Cornell University | Method for identification and enumeration of nucleic acid sequence, expression, copy, or dna methylation changes, using combined nuclease, ligase, polymerase, and sequencing reactions |
| HRP20200529T1 (hr) * | 2014-06-06 | 2020-09-04 | Regeneron Pharmaceuticals, Inc. | Postupci i pripravci za modificiranje ciljnog lokusa |
| WO2016109255A1 (en) * | 2014-12-30 | 2016-07-07 | University Of South Florida | Methods and compositions for cloning into large vectors |
| GB2565461B (en) * | 2016-03-31 | 2022-04-13 | Harvard College | Methods and compositions for the single tube preparation of sequencing libraries using Cas9 |
| GB201616590D0 (en) * | 2016-09-29 | 2016-11-16 | Oxford Nanopore Technologies Limited | Method |
| KR20220038604A (ko) * | 2019-05-30 | 2022-03-29 | 래피드 제노믹스 엘엘씨 | 표적 게놈 영역의 유연한 및 고처리량 시퀀싱 |
-
2020
- 2020-05-13 US US17/610,724 patent/US20220220542A1/en active Pending
- 2020-05-13 BR BR112022001539A patent/BR112022001539A2/pt unknown
- 2020-05-13 JP JP2022506557A patent/JP7854386B2/ja active Active
- 2020-05-13 WO PCT/US2020/032615 patent/WO2020232081A2/en not_active Ceased
- 2020-05-13 EP EP20806525.0A patent/EP3969581B1/en active Active
- 2020-05-13 AU AU2020275301A patent/AU2020275301A1/en active Pending
- 2020-05-13 CN CN202080051127.XA patent/CN114286861B/zh active Active
- 2020-05-13 CA CA3145806A patent/CA3145806A1/en active Pending
- 2020-05-13 ES ES20806525T patent/ES3051342T3/es active Active
- 2020-05-13 KR KR1020217040709A patent/KR20220039653A/ko active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009079488A1 (en) | 2007-12-17 | 2009-06-25 | Helicos Biosciences Corporation | Surface-capture of target nucleic acids |
Non-Patent Citations (13)
| Title |
|---|
| "Nucleic Acids and Molecular Biology", 2004, SPRINGER, article "Restriction Endonucleases" |
| DAHL, F., STENBERG, J., FREDRIKSSON, S., WELCH, K., ZHANG, M., NILSSON, M.: "Multigene amplification and massively parallel sequencing for cancer mutation discovery", PROC. NATL. ACAD. SCI. U. S. A., vol. 104, 2007, pages 9387 - 92, XP002530544, DOI: 10.1073/PNAS.0702165104 |
| FREDRIKSSON, S.BANER, J.DAHL, F.CHU, A.JI, H.WELCH, K. ET AL.: "Multiplex amplification of all coding sequences within 10 cancer genes by Gene-Collector", NUCLEIC, vol. 35, 2007, pages e47, XP002487873, DOI: 10.1093/nar/gkm078 |
| HEGGE, J. W., SWARTS, D. C., AND VAN DER OOST, J.: "Prokaryotic Argonaute proteins: novel genome-editing tools?", NAT. REV. MICROBIOL., vol. 16, 2017, pages 5 - 11, XP002780880, DOI: 10.1038/nrmicro.2017.73 |
| HU, J. H.MILLER, S. M.GEURTS, M. H.TANG, W.CHEN, L.SUN, N. ET AL.: "Evolved Cas9 variants with broad PAM compatibility and high DNA specificity", NATURE, vol. 556, 2018, pages 57 - 63, XP055490065, DOI: 10.1038/nature26155 |
| ILLUMINA SEQUENCING TECHNOLOGY, ILLUMINA |
| JINEK, M., CHYLINSKI, K., FONFARA, I., HAUER, M., DOUDNA, J. A., AND CHARPENTIER, E.: "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity", SCIENCE, vol. 337, 2012, pages 816 - 21, XP055229606, DOI: 10.1126/science.1225829 |
| NILSSON, M.MALMGREN, H.SAMIOTAKI, M.KWIATKOWSKI, M.CHOWDHARY, B. P.LANDEGREN, U.: "Padlock probes: circularizing oligonucleotides for localized DNA detection", SCIENCE, vol. 265, 1994, pages 2085 - 8, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/pubmed/7522346> |
| PACIFIC BIOSCIENCES, 2018 |
| See also references of EP3969581A4 |
| SWARTS, D. C., HEGGE, J. W., HINOJO, I., SHIIMORI, M., ELLIS, M. A., DUMRONGKULRAKSA, J.: "Argonaute of the archaeon Pyrococcus furiosus is a DNA-guided nuclease that targets cognate DNA", NUCLEIC ACIDS RES., vol. 43, 2015, pages 5120 - 5129, XP055287460, DOI: 10.1093/nar/gkv415 |
| VARSHNEY, G. K.BURGESS, S. M.: "DNA-guided genome editing using structure-guided endonucleases", GENOME BIOL., vol. 17, 2016, pages 187, XP055419357, DOI: 10.1186/s13059-016-1055-4 |
| XU, S.CAO, S.ZOU, B.YUE, Y.GU, C.CHEN, X. ET AL.: "An alternative novel tool for DNA editing without target sequence limitation: the structure-guided nuclease", GENOME BIOL, vol. 17, 2016, pages 186, XP055459333, DOI: 10.1186/s13059-016-1038-5 |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4034675A4 (en) * | 2019-09-26 | 2023-10-04 | Jumpcode Genomics, Inc. | Method and system for targeted nucleic acid sequencing |
| WO2022232425A3 (en) * | 2021-04-29 | 2022-12-01 | Illumina, Inc. | Amplification techniques for nucleic acid characterization |
Also Published As
| Publication number | Publication date |
|---|---|
| BR112022001539A2 (pt) | 2022-03-22 |
| ES3051342T3 (en) | 2025-12-26 |
| CN114286861B (zh) | 2024-12-06 |
| EP3969581B1 (en) | 2025-10-08 |
| JP2022534625A (ja) | 2022-08-02 |
| WO2020232081A3 (en) | 2020-12-24 |
| AU2020275301A1 (en) | 2022-01-20 |
| EP3969581A2 (en) | 2022-03-23 |
| EP3969581A4 (en) | 2023-06-14 |
| US20220220542A1 (en) | 2022-07-14 |
| KR20220039653A (ko) | 2022-03-29 |
| CN114286861A (zh) | 2022-04-05 |
| CA3145806A1 (en) | 2020-11-19 |
| JP7854386B2 (ja) | 2026-05-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2021282536B2 (en) | Polynucleotide enrichment using CRISPR-Cas systems | |
| US10538806B2 (en) | High throughput screening of populations carrying naturally occurring mutations | |
| US20220389408A1 (en) | Methods and compositions for phased sequencing | |
| JP6525473B2 (ja) | 複製物配列決定リードを同定するための組成物および方法 | |
| CN107250381B (zh) | Dna集合的归一化迭代条形码和测序 | |
| EP3969581B1 (en) | Capture and analysis of target genomic regions | |
| JP7788280B2 (ja) | 標的遺伝子領域の柔軟かつハイスループット配列決定 | |
| HK40053631A (en) | Polynucleotide enrichment using crispr-cas systems | |
| HK1236561B (en) | Polynucleotide enrichment using crispr-cas systems | |
| HK1236561A1 (en) | Polynucleotide enrichment using crispr-cas systems |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20806525 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 3145806 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2020806525 Country of ref document: EP Effective date: 20211213 |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20806525 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2020275301 Country of ref document: AU Date of ref document: 20200513 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2022506557 Country of ref document: JP Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112022001539 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112022001539 Country of ref document: BR Kind code of ref document: A2 Effective date: 20220127 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2020806525 Country of ref document: EP |