WO2020230976A1 - Procédé de sélection de cellules génétiquement modifiées à partir de cellules souches pluripotentes indifférenciées - Google Patents

Procédé de sélection de cellules génétiquement modifiées à partir de cellules souches pluripotentes indifférenciées Download PDF

Info

Publication number
WO2020230976A1
WO2020230976A1 PCT/KR2020/000078 KR2020000078W WO2020230976A1 WO 2020230976 A1 WO2020230976 A1 WO 2020230976A1 KR 2020000078 W KR2020000078 W KR 2020000078W WO 2020230976 A1 WO2020230976 A1 WO 2020230976A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
slc35f2
cells
edited
stem cells
Prior art date
Application number
PCT/KR2020/000078
Other languages
English (en)
Korean (ko)
Inventor
차혁진
김근태
박주찬
Original Assignee
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교 산학협력단 filed Critical 서울대학교 산학협력단
Publication of WO2020230976A1 publication Critical patent/WO2020230976A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the present invention relates to a method for selecting gene-edited cells from undifferentiated pluripotent stem cells, and more particularly, a method for enriching and selecting gene-edited cells using YM155 resistance induced by transient knockdown of SLC35F2 by siRNA. It is about.
  • the present invention was made by the project number 2017M3A9B3061843 under the support of the Ministry of Science, Technology and Communication of the Republic of Korea. Cell Screening Technology Development and Characteristic Research", the host institution is Seoul National University, and the research period is 2017.06.30 ⁇ 2022.06.29.
  • hPSCs human pluripotent stem cells
  • iPSCs patient-derived induced pluripotent stem cells
  • hPSCs provide an equal pair of control and disease model cells, allowing rigorous comparisons.
  • the time required for clonal selection is consuming, and the laborious process and extremely low efficiency of this process result in pooled sgRNA from mouse embryonic stem cells (ESC). It remains a significant hurdle for a wide range of applications, such as performing screening.
  • Another factor contributing to the technical barrier is the low Cas9 activity in hPSCs; Also, by the effect of Cas9, cells undergo a large amount of p53-dependent cell death in response to DNA damage.
  • hPSC-based cell therapy Teratoma formation due to unintentional transplantation of undifferentiated hPSCs is a serious risk for hPSC-based cell therapy.
  • several approaches have been developed to selectively remove residual hPSCs.
  • YM155 a survivin inhibitor developed as an anticancer drug, selectively has cytotoxicity to undifferentiated hPSCs and inhibits teratoma formation, and this finding has been reproduced in several independent studies. .
  • the molecular mechanisms underlying the high susceptibility of hPSCs to YM155 were not fully elucidated.
  • the present inventors introduced YM155 induced by the introduction of a gene-editing single guide RNA (sgRNA) targeting the gene of interest. Enrichment selection of gene-edited hPSCs through resistance was efficiently achieved. It was confirmed that this scar-free approach to highly efficient enrichment selection did not require cumbersome clone selection, so that a single clone could be obtained within at least 3 weeks.
  • siRNA transient short interfering RNA
  • an object of the present invention is to provide a method for selecting gene-edited cells.
  • Another object of the present invention is to provide the use of YM155 for selectively inducing apoptosis in undifferentiated pluripotent stem cells in which the expression of the SLC35F2 gene has been suppressed.
  • the present invention relates to a method for selecting gene-edited cells from undifferentiated pluripotent stem cells, and more particularly, YM155 (CAS 781661-94-7) resistance induced by transient knockdown of SLC35F2 by siRNA. It relates to a method for enriching and selecting the gene-edited cells by using.
  • One aspect of the present invention relates to a method for selecting genetically edited cells comprising the following steps:
  • YM155 (CAS 781661-94-7) treatment to selectively kill the cells in which the expression of the SLC35F2 gene is not suppressed.
  • YM155 refers to a survivin inhibitor and refers to a compound represented by the following formula (1) (CAS No. 781661-94-7).
  • SLC35F2 is a drug-specific membrane transporter for YM155 , and inhibiting the expression of the SLC35F2 gene can block the cellular uptake of YM155, thereby causing cells to Resistance to YM155 can be induced.
  • the cells selected by the method for selecting gene-edited cells of the present invention may be gene-edited by targeting at least one gene of interest (GOI) in addition to the SLC35F2 gene.
  • GOI gene of interest
  • the term "gene editing” refers to a nucleic acid molecule (one or more, such as 1-100,000bp, 1-10,000bp, 1-1000bp, 1-100bp), by cleavage at the target site of the target gene, unless otherwise specified. , 1-70bp, 1-50bp, 1-30bp, 1-20bp, or 1-10bp) by deletion, insertion, substitution, etc., can be used to mean loss, alteration, and/or recovery (modification) of gene function. have.
  • CRISPR/Cas9 or “CRISPR/Cas9 system” is a genome editing method called CRISPR gene scissors, and RNA that specifically binds to a specific nucleotide sequence (gRNA) and the Cas9 protein, which acts as a scissors that cuts a specific sequence.
  • gRNA nucleotide sequence
  • CRISPR associated protein 9 protein refers to a protein element essential in the CRISPR/Cas9 system, and two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) When forming a complex with, it forms an active endonuclease or nickase.
  • This step is a process of performing gene editing on the SLC35F2 gene in undifferentiated pluripotent stem cells.
  • suppression of the expression of the SLC35F2 gene according to knock-out may be achieved by this process.
  • the gene editing is 1 selected from the group consisting of an antisense nucleotide that specifically binds to the SLC35F2 gene, a small interfering RNA (siRNA), and a short hairpin RNA (shRNA).
  • siRNA small interfering RNA
  • shRNA short hairpin RNA
  • the siRNA may be a nucleic acid having the sequence of SEQ ID NO: 6.
  • this step is performed in undifferentiated pluripotent stem cells.
  • SLC35F2 gene it may include a process of performing gene editing on one or more additional genes of interest.
  • a sequence variation due to knock-out may occur in a gene of interest by this process.
  • the gene editing may be performed by introducing a single guide RNA (sgRNA) that specifically binds to the gene of interest to achieve sequence variation of the gene of interest, but is not limited thereto.
  • sgRNA single guide RNA
  • this step may be to operably link the reporter gene expressed when a sequence mutation occurs in the gene of interest to the downstream of the gene of interest, and the sequence mutation may be a frame shift mutation. , But is not limited thereto.
  • the reporter gene may be inserted into a nucleic acid sequence forming a transcription termination structure upstream.
  • a reporter gene operably linked downstream thereof is expressed.
  • the reporter gene is configured not to be expressed because a nucleic acid sequence forming a transcription termination structure is inserted upstream, but when a frame shift mutation occurs, the reporter gene is expressed because it cannot form a transcription termination structure.
  • the reporter gene encodes a fluorescent protein, since fluorescence is observed due to a frame shift mutation occurring in the gene of interest, transformed cells can be easily identified.
  • the reporter gene is a fluorescent protein, beta-galactosidase, beta-lactamase, TEV-protease, dihydrofolate reductase, lucifer.
  • Protein selected from the group consisting of luciferase, Renilla luciferase, Gaussia luciferase, selection marker, surface marker gene, and antibiotic resistance protein May be coding, for example, may be coding a fluorescent protein, but is not limited thereto.
  • sequence variation may occur due to knock-in in the gene of interest by this process.
  • the gene editing may be achieved by introducing a single stranded oligodeoxynucleotide (ssODN) specifically binding to the gene of interest into the cell to achieve sequence variation of the gene of interest, but is not limited thereto. .
  • ssODN single stranded oligodeoxynucleotide
  • the ssODN is composed of a single strand of DNA, and is used as a donor of a gene of interest in order to replace a specific base with another base.
  • the ssODN may be a nucleic acid having any one sequence selected from the group consisting of SEQ ID NO: 9 to SEQ ID NO: 11.
  • the ssODN binds complementarily to a target site, thereby inducing a sequence mutation of a gene of interest by homologous recombination.
  • the target site may be a specific locus on the gene of interest, and the sequence mutation may be a substitution mutation, but is not limited thereto.
  • the undifferentiated pluripotent stem cells may be selected from the group consisting of embryonic stem cells (Embryonic Stem Cells; hereinafter ESC), induced pluripotent stem cells (iPSCs), embryonic germ cells, embryonic tumor cells, and adult stem cells. It may be, for example, ESC, but is not limited thereto.
  • the concentration of YM155 is 5 to 2000 nM, 5 to 1000 nM, 5 to 500 nM, 5 to 200 nM, 5 to 100 nM, 5 to 50 nM, 5 to 20 nM, 10 to 2000 nM, 10 to 1000 nM, It may be 10 to 500 nM, 10 to 200 nM, 10 to 100 nM, or 10 to 50 nM, for example, 10 to 20 nM, but is not limited thereto.
  • Another aspect of the present invention relates to a gene-edited cell selected by a method for selecting a gene-edited cell comprising the following steps:
  • YM155 (CAS 781661-94-7) treatment to selectively kill the cells in which the expression of the SLC35F2 gene is not suppressed.
  • Another aspect of the invention is a method for the identification of YM155 cytotoxicity, comprising the step of predicting that the generation cytotoxic for YM155 if more differentiated cells YM155 treatment when, expression of SLC35F2 the derived from the undifferentiated pluripotent stem cells.
  • the present invention relates to a method for selecting gene-edited cells from undifferentiated pluripotent stem cells, wherein the gene-edited cells can be concentrated and selected using YM155 resistance induced by transient knockdown of SLC35F2 by siRNA in the undifferentiated pluripotent stem cells. Therefore, it can be effectively used for selection of gene-edited cells.
  • 1A is a result of calculating the score of human pluripotent stem cells (hPSCs) for 666 human cancer cells by performing enrichment analysis.
  • hPSCs human pluripotent stem cells
  • 1B is a result of confirming YM155 as the most effective drug in cells with high hPSC scores by correlating the sensitivity of each cell line to 543 compounds.
  • 1C is a graph comparing the expression level of SLC35F2 in human embryonic stem cells (hESCs) with cancer cell lines.
  • 1D is a graph showing the mRNA expression of SLC35F2 and POU5F1 in human dermal fibroblasts (hDF), hESC-MSCs (Mesenchymal stem cells), and hESCs.
  • 1e is a graph showing the mRNA expression of SLC35F2 and POU5F1 in hESC-MSCs, hCHA3, H9 and induced pluripotent stem cells (iPSCs: SES8).
  • 1F is a photograph showing a fluorescence image of H9 stained with ⁇ H2AX after YM155 treatment.
  • Figure 1g is a result of performing immunoblotting analysis between hESC-MSC and hESC in order to detect the level of pH2AX (Ser 139) and cleaved caspase (c-Casp 3) after YM155 treatment.
  • 1H is a result of quantifying the amount of YM155 absorbed in cells between hDF and hESC by performing LC-MS/MS analysis.
  • 2A is a schematic diagram showing that exon 7 is selected as a target for SLC35F2 knockout.
  • 2B is a cytometry result and a micrograph showing the cell death of SLC35F2 knocked out SLC35F2 KO hESC according to YM155 treatment.
  • 2C is a T7E1 analysis result showing the frequency of insertion/deletion (indel) for clones that survive in the presence of YM155 after the introduction of sgRNA to Cas9 and SLC35F2 .
  • Figure 2d is a graph showing the percentage of indels through the next-generation sequencing (NGS) analysis for the clones that survive in the presence of YM155 after the introduction of sgRNA to SLC35F2 and Cas9.
  • NGS next-generation sequencing
  • 2E is sequence information showing that a single clone of YM155R is a homozygous bi-allelic SLC35F2 KO compared to wild-type hESC (NC).
  • Figure 2f is a result showing the degree of cell death in SLC35F2 KO #1 hESC after YM155 treatment through flow cytometry.
  • Figure 2g is a result showing the expression level of SLC35F2 in SLC35F2 KO #1 hESC after YM155 treatment.
  • 2H is a photograph showing DNA damage in SLC35F2 KO #1 hESC after YM155 treatment.
  • Figure 3a is a graph confirming the expression levels of the pluripotency markers NANOG, SOX2 and POU5F1 in SLC35F2 KO #1 hESC.
  • 3B is a photograph of immunoblocking analysis confirming the level of proteins such as SOX2 and OCT4 , which are pluripotent markers, in SLC35F2 KO #1 hESC.
  • Figure 3c is a photograph showing the result of alkaline phosphatase (phosphathase) analysis of the control (NC) and SLC35F2 KO #1 hESC.
  • 3D is a graph showing the cell growth rate of the control (NC) and SLC35F2 KO #1 hESC.
  • 3E is a result of confirming the degree of cell growth competition through co-culture with wild-type hESCs (EGFP-hESCs) expressing green fluorescent protein by flow cytometry.
  • 3F is a graph showing the mRNA expression of endoderm, mesoderm and ectoderm-specific genes (endoderm: SOX17, GATA6, mesoderm: MSX1 and ectoderm: NESTIN) after somatic differentiation from SLC35F2 KO #1 hESC in relative levels.
  • 3G is a photograph of teratoma formed using SLC35F2 KO hESCs.
  • 3H is transcript data showing a total gene scattering plot of pluripotency marker genes (POU5F1, SOX2, NANOG, Lin28A) in SLC35F2 KO #1 hESC.
  • FIG. 4A is a schematic diagram showing a YM155 mediated enrichment selection approach in HEK293T cells (GOI: gene of interest).
  • Figure 4b is a photograph showing the results of T7E1 analysis of the band (asterisk) cut after enzyme treatment in SLC35F2 KO HEK293T cells.
  • Figure 4c is a diagram showing the NGS data of the wild-type control and various SLC35F2 KO HEK293T cells.
  • 4D is a schematic diagram of a green fluorescent protein expression system for targeting CCR5 .
  • Figure 4e is a picture confirming the CRISPR/Cas9 targeting efficiency through co-targeting SLC35F2 and CCR5 and checking the ratio of GFP-positive cells.
  • Figure 4f is a graph confirming the CRISPR/Cas9 targeting efficiency through co-targeting SLC35F2 and CCR5 and checking the ratio of GFP-positive cells.
  • 4G is a T7E1 analysis result confirming the CRISPR/Cas9 targeting efficiency by co-targeting SLC35F2 and CCR5 and checking the ratio of GFP-positive cells.
  • Figure 5a is a photograph showing the T7E1 analysis of the CCR5 and SLC35F2 from each clone is applied to by a CCR5 (C) and SLC35F2 (S) to the target combination of the sgRNA by two different percentage of the CCR5 and SLC35F2 target.
  • NGS next-generation sequencing
  • 5C is an RNA-seq sample using t-distributed stochastic neighbor embedding (t-SNE) based on the expression of whole genes, hPSC signature genes and cell transition metal ion homeostasis (GO: 0046916) genes. This is a graph of the clustering results.
  • t-SNE stochastic neighbor embedding
  • Figure 6a is a schematic diagram showing a YES- approach by introduction of siRNA by the CCR5 target sgRNA and SLC35F2 target.
  • 6B is a graph showing relative levels of mRNA expression of SLC35F2 according to the indicated days after siRNA transduction in hESCs.
  • Figure 6c shows the results of annexin V/7-AAD (Annexin-V/7-AAD) staining and flow cytometry confirming cell death by comparing the 2nd and 5th days after transduction of the siRNA targeting SLC35F2 .
  • 6D is a graph showing the average of the indel ratio as the target efficiency of CCR5 after performing the YES-approach with different YM155 treatment doses.
  • 6E is a graph showing the results of sequencing analysis of CCR5 KO clones after performing the YES-approach at different YM155 treatment doses.
  • 6F is a result of NGS analysis for CCR5 target sequence, sgRNA target and PAM sequence.
  • Figure 6g shows the results of flow cytometry by varying the treatment dose of YM155 in WT or CCR5 KO hESC and staining with Annexin V/7-AAD.
  • 7A is a result of T7E1 analysis according to the presence or absence of the YES-approach targeting CCR5 , HEK2 and HEK3 loci (*, predicted DNA bands cleaved by T7E1 endonuclease).
  • Figure 7b is a graph showing the insertion frequency of CCR5 , HEK2 and HEK3 by the control (Cont) or the YES-approach (YES) determined by deep sequencing (*, p ⁇ 0.05; **, p ⁇ 0.01).
  • FIG. 7D is a graphical diagram for determining the target efficiency by the GFP reporter hESC expressing the Cas9 (Cas9-EGFP #1) system.
  • 7E is a flow cytometric analysis result of EGFP positive and negative populations under labeling conditions (black arrows indicate EGFP target populations).
  • 7F is a graph showing the EGFP positive (EGFP+) and EGFP negative (EGFP-) populations determined by flow cytometry.
  • 8A is a graphic diagram showing knock-in (KI) targets at the EYA4 , TMEM67, and SLC6A5 loci.
  • KI knock-in
  • ssODN an HDR marker sequence (capital red) capable of recognizing each KI was inserted.
  • Figure 8b is a result showing the indel (KO: Open bar, KI: Red bar) efficiency of the indicator gene according to the presence or absence of the scar-free YES-approach.
  • Figures 8c to 8e show the HDR frequency of the indel ratio based on deep sequencing analysis for three different objects ( EYA4 , TMEM67 and SLC6A5 genes), respectively, 8c is EYA4 , 8d is TMEM67 , and 8e is SLC6A5 . Is the result.
  • % used to indicate the concentration of a specific substance is (weight/weight)% for solids/solids, (weight/volume)% for solids/liquids, and Liquid/liquid is (vol/vol)%.
  • hESC Human embryonic stem cells (WA09, WiCell Research Institute; hereinafter hESC) were supplied with mTeSRTM-E8TM culture medium (STEMCELL technologies) and StemMACSTM medium (Miltenyi-Biotec) supplemented with 50 ug/ml gentamicin (Life Technologies). It was incubated on a Rigel (BD Biosciences) coated plate. Cells were cultured every 5 to 6 days and the medium was changed daily.
  • mTeSRTM-E8TM culture medium STMCELL technologies
  • StemMACSTM medium Miltenyi-Biotec
  • hESC was washed with DPBS (Dulbecco's Phosphate-Buffered Saline) and exposed to Dispase (Gibco) to exfoliate.
  • the separated cells were washed with DMEM/F-12 (Gibco) medium and plated on a Matrigel coated plate. If necessary, 10 uM of Y27632 (Gibco) was added for cell adhesion.
  • HEK293T Human embryonic kidney 293 cells
  • a culture dish Falcon
  • DMEM Gibco
  • FBS FBS
  • HEK293T cells were washed with DPBS and enzymatically separated with 0.25% trypsin. Trypsin was inactivated by adding DMEM containing 10% FBS, and an appropriate amount of cells was sprayed on the dish.
  • hPSCs human pluripotent stem cells
  • BIRC5 encoding survivin
  • GEO gene expression omnibus
  • KS Kolmogorov-Smirnov
  • the hPSC score, the area under the fitted curve (AUC) for each of the 543 compounds and the cell line hPSC score for each compound were correlated with the sensitivity of each cell line.
  • Cell viability values were adjusted in the range of 0-100% and were adjusted by 4-parameter logistic regression analysis. In order to calculate the AUC (area under the fit curve), a specific concentration range was selected for each compound that tested the most cells. AUC was normalized to a range of 0 to 1 by the maximum AUC assumed to be 0% growth inhibition in a given concentration range.
  • Quantitative data are expressed as mean value ⁇ standard error (SEM). To analyze the statistical significance of each response variable, a student's paired t-test or one-way ANOVA was performed. Pre-specified comparisons between groups were performed (where appropriate) via Tukey's post hoctest using the SPSS program (Social Science Statistics Package, Version 17). P values less than 0.05 were considered statistically significant.
  • the expression value of each gene was compared with the AUC of YM155 to show the strength of the correlation of 18,858 genes.
  • ATP1B1 and SLC35F2 were highly expressed in YM155 resistant and sensitive cells, respectively, indicating that cells with high hPSC scores were selectively sensitive to YM155.
  • the gene expression profile database (http://nextbio.com) was used to compare the relative SLC35F2 expression between 24 human embryonic stem cells (hESCs) and various cancer cell lines.
  • hESCs human embryonic stem cells
  • PC-3 prostate cancer cell
  • PC positive control
  • hESC-MSCs mesenchymal stem cells
  • hDFs human dermal fibroblasts
  • iPSCs pluripotent stem cells
  • SLC35F2 is a membrane transporter responsible for the uptake of YM155 into cells, causing DNA damage.
  • SLC35F2 is a membrane transporter responsible for the uptake of YM155 into cells, causing DNA damage.
  • HEK293T and H9 cells were exposed to 1 uM YM155 for 1 hour, and cells were counted as 1 ⁇ 10 6 .
  • the harvested cells were lysed with 80% methanol and incubated for an additional hour on ice. After spin down at 13,000 rpm for 20 minutes, the supernatant was collected and evaporated with N2 gas until no more solvent remained.
  • the sample residue was resuspended with 100 uL of 50% methanol and filtered through 10 seconds sonication, 5 seconds vortex, spin-down and 0.2 um membrane filter.
  • Example 3 In hPSCs induced by YM155 SLC35F2 Of selective cell death mediated by
  • hPSCs (EC 50: 10 nM) in order to confirm the link between YM155 selective cytotoxicity and high expression of SLC35F2 in these cells, using the CRISPR / Cas9 to target the exon 7 was knockout the SLC35F2 from hESCs in ( 2a).
  • sgRNA single guide RNA
  • cells were separated with Accutase TM (561527, BD Biosciences) and washed 3 times with DPBS, and then with FITC Annexin-V (556419, BD Biosciences) and 7-AAD (559925, BD Biosciences) for cell death detection. Dyed. Diluted 1X Annexin V binding buffer (556454, BD Biosciences) was used as a staining solvent. FACS calibur from BD Biosciences and Cell Quest software was used for FACS analysis.
  • the resistant clone YM155R was very resistant to additional YM155 treatment.
  • NGS Next-generation nucleotide sequence analysis
  • PCR was performed according to the supplier's instructions with a total volume of 10 ul per sample using SolgTM Taq DNA polymerase (STD16-R500, SolGent).
  • the first PCR was performed with primer F1 and primer R for each gene.
  • the first PCR product was diluted with 190 ul of DW.
  • the second PCR was performed with 1 ul of the first PCR product diluted using primers F2 and R for each gene.
  • the second PCR product was mixed with an equal volume of 2X NEBuffer2 (B7002S, New England BioLabs) and hybridized.
  • Three units of T7E1 endonuclease (M0302S, New England BioLabs) were treated with 10 ul of the hybridized second PCR product.
  • Enzymatic reaction was performed in a water bath at 37° C. for 40 minutes.
  • the sequence information from the YM155R clone (KO #1), the sgRNA target sequence, and the PAM sequence are shown in green and orange, respectively, and the single clone of YM155R maintained under the YM155 treatment is homozygous biallele (homozygous bi -allelic) turned out to be SLC35F2 KO.
  • the resistant clone SLC35F2 KO hESCs: KO #1 was found to be very strong against YM155-induced cell death.
  • the resistance obtained from SLC35F2 KO hESCs could be confirmed through the expression level of SLC35F2 and the degree of DNA damage, which was exhibited by YM155 treatment.
  • Example 3 Based on the results of Example 3, to characterize SLC35F2 KO hESCs, human skin fibroblasts; the typical, such as (human dermal fibroblasts or less hDF), wild-type hESCs (NC) and SLC35F2 KO from hESCs NANOG, SOX2 and POU5F1 The level of expression of potency markers was monitored.
  • a typical system of a specific gene in the KO SLC35F2 # 1 hESC are shown as relative levels of mRNA expression of the (endoderm: NESTIN SOX17, GATA6, mesoderm:: MSX1 and ectoderm).
  • the measurement results were expressed in units of days after somatic cell differentiation, measured in units of 2 days.
  • Example 5 YM155 mediated cell enrichment selection through co-target selection
  • SLC35F2 KO concentrated selection of hESC is from a point that can be achieved by YM155 treatment, SLC35F2 the gene of interest; the two-induced resistance to the If YM155 targeting with (gene of interest GOI) gene editing hPSC It can be predicted that it may be useful for screening.
  • HEK293T cells showing a relatively high level of SLC35F2 were utilized to induce dose-dependent cell death after YM155 treatment (EC 50 10 times higher than hESC).
  • YM155 treatment EC 50 10 times higher than hESC.
  • gene editing populations were created with an efficiency of 88.4% (see FIGS. 4B and 4C).
  • CCR5 CC motif Chemokine Receptor
  • CCR5 reporter substitute surrogate reporter
  • mRFP monomeric red fluorescent protein
  • GFP green fluorescent protein
  • Sequence number designation order 3 Nucleic acid sequence of CCR5 targeting site to which sgRNA specifically binds TGACATCAATTATTATACAT 4 Nucleic acid sequence of sgRNA targeting CCR5 TGACATCAATTATTATACATCGG
  • the GFP-positive result group of 25% or less according to the YM155 selection has a high probability of 80%. Suggested that the gene was edited.
  • Example 5 Based on the results of Example 5, after testing this approach (YM155-based enriched selection of CRISPR co-targeting (YM155-based Enriched Selection of CRISPR Co-15 target), hereinafter'YES approach') in HEK293T cells , This was applied to human pluripotent stem cells (hPSCs) more sensitive to YM155. In order to prove the concept of the YES-approach, the production of CCR5 -target hESCs was attempted.
  • hPSCs human pluripotent stem cells
  • the present inventors selected this gene for the following reasons.
  • the cells may have potential for future applications in HIV-1 studies, for example the production of CCR5 depleted CD4 + T cells.
  • the single clone was 85.5% indel, indicating that the surviving clone was successfully gene edited in the desired manner.
  • the sgRNA target sequence is indicated in green, and the PAM sequence is indicated in red.
  • Example 7 CCR5 A scar-free YES approach for the establishment of target hESCs
  • YES- approach is the presence of permanent KO of SLC35F2 to was effective in establishing a gene of interest (GOI) target hESC, an induced resistance is YM155 SLC35F2 impact on the inorganic ion homeostasis, or can be a problem in terms of the same disease model The point could not be ruled out.
  • GOI gene of interest
  • GOI in this case, CCR5
  • siRNA introduction of siRNA by the SLC35F2 target to target
  • Sequence number designation order 5 Nucleic acid sequence of SLC35F2 targeting site to which siRNA is specifically bound cagatgttgtccttgtgta 6 SLC35F2 targeting siRNA nucleic acid sequence cagauguuguccuugugua
  • Example 8 Expanding the application of the scar-free YES approach for gene knockout in hESCs
  • the known HEK2 and HEK3 genes were further targeted.
  • the HEK2 and HEK3 targeting siRNA nucleic acid sequences are the same as those used in Example 7, and the nucleic acid sequence of the CCR5 targeting site to which sgRNA specifically binds and the nucleic acid sequence of sgRNA targeting CCR5 were used in Example 5 above. Same as sequence.
  • Sequence number designation order 7 Nucleic acid sequence of HEK2 targeting site to which siRNA is specifically bound GAACACAAAGCATAGACTGCGGG 8
  • EGFP green fluorescent protein
  • the Cas9-2A-EGFP gene (plasmid vector) was optionally introduced into H9 cells (hESCs) using the PiggyBac system, and cells expressing EGFP were collected through flow cytometry (FACS). Then, the nucleotide sequence of each colony derived from a single cell was analyzed to establish a clone that actually expresses Cas9 and EGFP.
  • gene knock-in (KI) in hESCs remains an important technical obstacle, despite the high demand for genetic modification of patient iPSCs as well as for modeling allogeneic diseases.
  • Sequence number designation Sequence (except PAM sequence) 12 Nucleic acid sequence of sgRNA targeting EYA4 (nucleic acid sequence of EYA4 targeting site to which sgRNA specifically binds) agagtttggatagcctgtat 13 Nucleic acid sequence of sgRNA targeting TMEM67 (nucleic acid sequence of TMEM67 targeting site to which sgRNA specifically binds) gttcacgttcttgtcaatag 14 Nucleic acid sequence of sgRNA targeting SLC6A5 (nucleic acid sequence of SLC6A5 targeting site to which sgRNA specifically binds) ttgcaaagaatgccttcacc
  • hESCs human embryonic stem cells
  • 2ug of Cas9 vector, 2ug of sgRNA, 5ug of ssODN, and 2ug of siRNA were transferred into the cell by electroporation.
  • 20 nM of YM155 was treated for 6 hours and then washed-off to YES-select.
  • gDNA was extracted from the selected cells to perform next-generation nucleotide sequence (NGS) analysis.
  • NGS next-generation nucleotide sequence
  • the present invention relates to a method for selecting gene-edited cells from undifferentiated pluripotent stem cells, and more particularly, a method for enriching and selecting gene-edited cells using YM155 resistance induced by transient knockdown of SLC35F2 by siRNA. It is about.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Procédé de sélection de cellules génétiquement modifiées à partir de cellules souches pluripotentes indifférenciées, les cellules génétiquement modifiées pouvant être enrichies et sélectionnées à partir des cellules souches pluripotentes non différenciées à l'aide de la résistance à YM155 induite par l'inactivation transitoire de SLC35F2 par ARNsi, et, par conséquent, le procédé peut être utilisé efficacement pour sélectionner des cellules génétiquement modifiées.
PCT/KR2020/000078 2019-05-14 2020-01-03 Procédé de sélection de cellules génétiquement modifiées à partir de cellules souches pluripotentes indifférenciées WO2020230976A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0056334 2019-05-14
KR20190056334 2019-05-14

Publications (1)

Publication Number Publication Date
WO2020230976A1 true WO2020230976A1 (fr) 2020-11-19

Family

ID=73290216

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/000078 WO2020230976A1 (fr) 2019-05-14 2020-01-03 Procédé de sélection de cellules génétiquement modifiées à partir de cellules souches pluripotentes indifférenciées

Country Status (2)

Country Link
KR (1) KR102404828B1 (fr)
WO (1) WO2020230976A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160139124A1 (en) * 2014-11-04 2016-05-19 Bloodcenter Research Foundaton Method to bioengineer designer platelets using gene editing and stem cell methodologies
WO2018039783A1 (fr) * 2016-08-30 2018-03-08 UNIVERSITé LAVAL Systèmes et procédés de sélection pour l'édition génomique

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100383816B1 (ko) 2000-06-26 2003-05-16 한국전력공사 적응적 영역분할기를 이용한 3차원 표면 형상 측정 방법및 장치

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160139124A1 (en) * 2014-11-04 2016-05-19 Bloodcenter Research Foundaton Method to bioengineer designer platelets using gene editing and stem cell methodologies
WO2018039783A1 (fr) * 2016-08-30 2018-03-08 UNIVERSITé LAVAL Systèmes et procédés de sélection pour l'édition génomique

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
GEORG E WINTER, RADIC BRANKA, MAYOR-RUIZ CRISTINA, BLOMEN VINCENT A, TREFZER CLAUDIA, KANDASAMY RICHARD K, HUBER KILIAN V M, GRIDL: "The solute carrier SLC35F2 enables YM155-mediated DNA damage toxicity", NATURE CHEMICAL BIOLOGY, vol. 10, 1 September 2014 (2014-09-01), pages 768 - 773, XP055761040, ISSN: 1552-4450, DOI: 10.1038/nchembio.1590 *
KEUN-TAE KIM, JU-CHAN PARK, HAESEUNG LEE, HYEON-KI JANG, YAN JIN, WANKYU KIM, JEONGMI LEE, HYONGBUM HENRY KIM, SANG-SU BAE, HYUK-J: "Scarless enriched selection of genome edited human pluripotent stem cells using induced drug resistance", BIORXIV, 18 January 2019 (2019-01-18), pages 1 - 33, XP055761048 *
YOUNG-HYUN GO, LIM CHANGJIN, JEONG HO-CHANG, KWON OK-SEON, CHUNG SUNGKYUN, LEE HAESEUNG, KIM WANKYU, SUH YOUNG-GER, SON WOO SUNG, : "Structure-activity relationship analysis of YM155 for inducing selective cell death of human pluripotent stem cell s", FRONTIERS IN CHEMISTRY, vol. 7, 16 May 2019 (2019-05-16), pages 1 - 16, XP055761050, DOI: 10.3389/fchem.2019.00298 *
YVONNE VOGES; MARTIN MICHAELIS; FLORIAN ROTHWEILER; TORSTEN SCHALLER; CONSTANZE SCHNEIDER; KATHARINA POLITT; MARCO MERNBERGER; AND: "Effects of YM155 on survivin levels and viability in neuroblastoma cells with acquired drug resistance", CELL DEATH AND DISEASE, vol. 7, no. 10, e2410, 1 October 2016 (2016-10-01), pages 1 - 11, XP055686799, DOI: 10.1038/cddis.2016.257 *

Also Published As

Publication number Publication date
KR20200131724A (ko) 2020-11-24
KR102404828B1 (ko) 2022-06-07

Similar Documents

Publication Publication Date Title
WO2016111546A2 (fr) Endonucléase de ciblage du gène du facteur viii de coagulation sanguine et composition pour le traitement de l'hémophilie comprenant celle-ci
WO2016021972A1 (fr) Cellules immuno-compatibles créées par édition de gènes codant pour le hla médiée par une nucléase
Buecker et al. A murine ESC-like state facilitates transgenesis and homologous recombination in human pluripotent stem cells
Serafimidis et al. Novel effectors of directed and Ngn3-mediated differentiation of mouse embryonic stem cells into endocrine pancreas progenitors
Meek et al. Tuning of β-catenin activity is required to stabilize self-renewal of rat embryonic stem cells
WO2019050071A1 (fr) Composition destinée à la prévention ou au traitement de la fibrose hépatique, contenant un exosome ou un acide ribonucléique dérivé d'exosome
US20210230539A1 (en) Haploid human embryonic stem cell lines and somatic cell lines and methods of making the same
US11085020B2 (en) Mammalian haploid embryonic stem cells
WO2012115454A2 (fr) Procédé pour concentrer des cellules qui sont génétiquement modifiées par des nucléases
Zhang et al. Inhibition of apoptosis reduces diploidization of haploid mouse embryonic stem cells during differentiation
MacDougall et al. Intracellular Ca2+ homeostasis and nuclear export mediate exit from naive pluripotency
WO2020230976A1 (fr) Procédé de sélection de cellules génétiquement modifiées à partir de cellules souches pluripotentes indifférenciées
US20150344910A1 (en) Methods for controlling stem cell differentiation
WO2016080608A1 (fr) Compositions comprenant un inhibiteur de mitofusine pour favoriser la reprogrammation cellulaire et une utilisation correspondante
WO2020055187A1 (fr) Composition destinée à induire la mort de cellules ayant un gène muté, et procédé destiné à induire la mort de cellules ayant un gène modifié à l'aide de la composition
Zhang et al. Epigenetic integrity of paternal imprints enhances the developmental potential of androgenetic haploid embryonic stem cells
WO2021256668A1 (fr) Lignée de cellules souches pluripotentes induites humaines transformée avec un cytochrome p450 marqué par une protéine fluorescente et procédé de criblage d'un modulateur d'ahr l'utilisant
WO2016093668A2 (fr) Procédé intégratif de génération de cellules souches pluripotentes induites pour la thérapie génique
WO2022211604A1 (fr) Cellules souches modifiées avec un gène mutant de fe-fviii, cellules endothéliales différenciées à partir de celles-ci, et composition pharmaceutique les contenant pour la prévention ou le traitement de l'hémophilie
US11261433B2 (en) Autosomal-identical pluripotent stem cell populations having non-identical sex chromosomal composition and uses thereof
Guo et al. Generation of an Abcc8 heterozygous mutation human embryonic stem cell line using CRISPR/Cas9
WO2022035287A1 (fr) Cellule ayant un gène corrigé ex vivo et utilisation associée
WO2022255825A1 (fr) Nouvelles cellules pluripotentes
WO2023043278A1 (fr) Méthode d'évaluation de l'efficacité d'un agent anticancéreux ou de criblage d'un agent anticancéreux
WO2021145700A1 (fr) Cellules ayant une adaptabilité élevée dans des conditions hypoxiques, et leur utilisation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20805913

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20805913

Country of ref document: EP

Kind code of ref document: A1