WO2020230976A1 - Method for selecting gene-edited cells from undifferentiated pluripotent stem cells - Google Patents

Abstract

The present invention relates to a method for selecting gene-edited cells from undifferentiated pluripotent stem cells, wherein gene-edited cells can be enriched and selected from the undifferentiated pluripotent stem cells by using YM155 resistance induced through the transient knockdown of SLC35F2 by siRNA, and thus the method can be effectively used for selecting gene-edited cells.

Description

Selection method for gene-edited cells from undifferentiated pluripotent stem cells

The present invention relates to a method for selecting gene-edited cells from undifferentiated pluripotent stem cells, and more particularly, a method for enriching and selecting gene-edited cells using YM155 resistance induced by transient knockdown of SLC35F2 by siRNA. It is about.

The present invention was made by the project number 2017M3A9B3061843 under the support of the Ministry of Science, Technology and Communication of the Republic of Korea. Cell Screening Technology Development and Characteristic Research", the host institution is Seoul National University, and the research period is 2017.06.30 ~ 2022.06.29.

This patent application claims priority to Korean Patent Application No. 10-2019-0056334 filed with the Korean Intellectual Property Office on May 14, 2019, and the disclosures of the patent application are incorporated herein by reference.

With recent advances in human pluripotent stem cells (hPSCs), the genetic technology of hPSCs has shown great potential for genetic modification in the context of regenerative medicine. The use of hPSCs derived from patients with genetic diseases enables a continuous supply of certain types of cells that mimic pathology (i.e. disease modeling), which can make a valuable contribution to both drug screening and basic research.

However, patient-derived induced pluripotent stem cells (iPSCs) require a large number of case and control iPSCs to minimize the effect of variability between unrelated hPSC lines.

In contrast, gene edited hPSCs provide an equal pair of control and disease model cells, allowing rigorous comparisons. Despite the potential of the genetic technology of hPSCs, the time required for clonal selection is consuming, and the laborious process and extremely low efficiency of this process result in pooled sgRNA from mouse embryonic stem cells (ESC). It remains a significant hurdle for a wide range of applications, such as performing screening.

Another factor contributing to the technical barrier is the low Cas9 activity in hPSCs; Also, by the effect of Cas9, cells undergo a large amount of p53-dependent cell death in response to DNA damage.

Several strategies have been developed to address the low efficiency of gene editing in hPSCs (as well as other somatic models): the inducible Cas9 system, puromycin selection, and self-replicating episomal vectors. Alternatively, enrichment selection of some of the target-edited clones is a'co-targeting' approach that allows the target-edited clones to survive through acquisition resistance induced by knockout of the gene responsible for drug sensitivity. Was tried by

However, in order to minimize additionally produced unwanted side effects, it is desirable to create a permanent'scar' or achieve'scar-free enrichment' of target-edited clones without foreign genes (e.g., genetic manipulations involved in drug resistance induction). .

Teratoma formation due to unintentional transplantation of undifferentiated hPSCs is a serious risk for hPSC-based cell therapy. To address this risk, several approaches have been developed to selectively remove residual hPSCs. For example, it has been reported that YM155, a survivin inhibitor developed as an anticancer drug, selectively has cytotoxicity to undifferentiated hPSCs and inhibits teratoma formation, and this finding has been reproduced in several independent studies. . However, at that time the molecular mechanisms underlying the high susceptibility of hPSCs to YM155 were not fully elucidated.

In parallel with the transient short interfering RNA (siRNA) mediated knockdown of SLC35F2, the present inventors introduced YM155 induced by the introduction of a gene-editing single guide RNA (sgRNA) targeting the gene of interest. Enrichment selection of gene-edited hPSCs through resistance was efficiently achieved. It was confirmed that this scar-free approach to highly efficient enrichment selection did not require cumbersome clone selection, so that a single clone could be obtained within at least 3 weeks.

Accordingly, an object of the present invention is to provide a method for selecting gene-edited cells.

It is another object of the present invention upon the differentiation in YM155 treated cells derived from undifferentiated pluripotent stem cells, an increase in the amount of expression of SLC35F2 service, YM155 cytotoxic check method comprising the steps of predicting that the generated cytotoxic for YM155 Is to do.

Another object of the present invention is to provide the use of YM155 for selectively inducing apoptosis in undifferentiated pluripotent stem cells in which the expression of the SLC35F2 gene has been suppressed.

The present invention relates to a method for selecting gene-edited cells from undifferentiated pluripotent stem cells, and more particularly, YM155 (CAS 781661-94-7) resistance induced by transient knockdown of SLC35F2 by siRNA. It relates to a method for enriching and selecting the gene-edited cells by using.

Hereinafter, the present invention will be described in more detail.

One aspect of the present invention relates to a method for selecting genetically edited cells comprising the following steps:

Gene editing step of targeting the SLC35F2 gene in undifferentiated pluripotent stem cells to proceed with gene editing, wherein the gene editing is to suppress the expression of the SLC35F2 gene, the gene editing step; And

YM155 (CAS 781661-94-7) treatment to selectively kill the cells in which the expression of the SLC35F2 gene is not suppressed.

In the present specification, "YM155" refers to a survivin inhibitor and refers to a compound represented by the following formula (1) (CAS No. 781661-94-7).

[Formula 1]

According to the present invention, unlike other chemical-based screening approaches, SLC35F2 is a drug-specific membrane transporter for YM155 , and inhibiting the expression of the SLC35F2 gene can block the cellular uptake of YM155, thereby causing cells to Resistance to YM155 can be induced.

The cells selected by the method for selecting gene-edited cells of the present invention may be gene-edited by targeting at least one gene of interest (GOI) in addition to the SLC35F2 gene.

In the present specification, the term "gene editing" refers to a nucleic acid molecule (one or more, such as 1-100,000bp, 1-10,000bp, 1-1000bp, 1-100bp), by cleavage at the target site of the target gene, unless otherwise specified. , 1-70bp, 1-50bp, 1-30bp, 1-20bp, or 1-10bp) by deletion, insertion, substitution, etc., can be used to mean loss, alteration, and/or recovery (modification) of gene function. have.

In the present specification, the term "CRISPR/Cas9" or "CRISPR/Cas9 system" is a genome editing method called CRISPR gene scissors, and RNA that specifically binds to a specific nucleotide sequence ( gRNA) and the Cas9 protein, which acts as a scissors that cuts a specific sequence.

The term "Cas9 (CRISPR associated protein 9) protein" as used herein refers to a protein element essential in the CRISPR/Cas9 system, and two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) When forming a complex with, it forms an active endonuclease or nickase.

Hereinafter, the method for selecting the gene-edited cells of the present invention will be described in detail.

Gene editing steps

This step is a process of performing gene editing on the SLC35F2 gene in undifferentiated pluripotent stem cells.

According to an embodiment, suppression of the expression of the SLC35F2 gene according to knock-out may be achieved by this process.

Specifically, the gene editing is 1 selected from the group consisting of an antisense nucleotide that specifically binds to the SLC35F2 gene, a small interfering RNA (siRNA), and a short hairpin RNA (shRNA). By introducing more than one species into cells, suppression of the expression of the SLC35F2 gene may be achieved, for example, may be achieved by introducing siRNA, but is not limited thereto.

The siRNA may be a nucleic acid having the sequence of SEQ ID NO: 6.

In addition, this step is performed in undifferentiated pluripotent stem cells. In addition to the SLC35F2 gene, it may include a process of performing gene editing on one or more additional genes of interest.

According to one embodiment, a sequence variation due to knock-out may occur in a gene of interest by this process.

Specifically, the gene editing may be performed by introducing a single guide RNA (sgRNA) that specifically binds to the gene of interest to achieve sequence variation of the gene of interest, but is not limited thereto.

Accordingly, this step may be to operably link the reporter gene expressed when a sequence mutation occurs in the gene of interest to the downstream of the gene of interest, and the sequence mutation may be a frame shift mutation. , But is not limited thereto.

The reporter gene may be inserted into a nucleic acid sequence forming a transcription termination structure upstream.

When a frame shift mutation occurs in the gene of interest, a reporter gene operably linked downstream thereof is expressed. The reporter gene is configured not to be expressed because a nucleic acid sequence forming a transcription termination structure is inserted upstream, but when a frame shift mutation occurs, the reporter gene is expressed because it cannot form a transcription termination structure. When the reporter gene encodes a fluorescent protein, since fluorescence is observed due to a frame shift mutation occurring in the gene of interest, transformed cells can be easily identified.

The reporter gene is a fluorescent protein, beta-galactosidase, beta-lactamase, TEV-protease, dihydrofolate reductase, lucifer. Protein selected from the group consisting of luciferase, Renilla luciferase, Gaussia luciferase, selection marker, surface marker gene, and antibiotic resistance protein May be coding, for example, may be coding a fluorescent protein, but is not limited thereto.

According to another embodiment, sequence variation may occur due to knock-in in the gene of interest by this process.

Specifically, the gene editing may be achieved by introducing a single stranded oligodeoxynucleotide (ssODN) specifically binding to the gene of interest into the cell to achieve sequence variation of the gene of interest, but is not limited thereto. .

The ssODN is composed of a single strand of DNA, and is used as a donor of a gene of interest in order to replace a specific base with another base.

The ssODN may be a nucleic acid having any one sequence selected from the group consisting of SEQ ID NO: 9 to SEQ ID NO: 11.

The ssODN binds complementarily to a target site, thereby inducing a sequence mutation of a gene of interest by homologous recombination.

The target site may be a specific locus on the gene of interest, and the sequence mutation may be a substitution mutation, but is not limited thereto.

The undifferentiated pluripotent stem cells may be selected from the group consisting of embryonic stem cells (Embryonic Stem Cells; hereinafter ESC), induced pluripotent stem cells (iPSCs), embryonic germ cells, embryonic tumor cells, and adult stem cells. It may be, for example, ESC, but is not limited thereto.

Steps to induce apoptosis

The concentration of YM155 is 5 to 2000 nM, 5 to 1000 nM, 5 to 500 nM, 5 to 200 nM, 5 to 100 nM, 5 to 50 nM, 5 to 20 nM, 10 to 2000 nM, 10 to 1000 nM, It may be 10 to 500 nM, 10 to 200 nM, 10 to 100 nM, or 10 to 50 nM, for example, 10 to 20 nM, but is not limited thereto.

Another aspect of the present invention relates to a gene-edited cell selected by a method for selecting a gene-edited cell comprising the following steps:

Gene editing step of targeting the SLC35F2 gene in undifferentiated pluripotent stem cells to proceed with gene editing, wherein the gene editing is to suppress the expression of the SLC35F2 gene, the gene editing step; And

YM155 (CAS 781661-94-7) treatment to selectively kill the cells in which the expression of the SLC35F2 gene is not suppressed.

Another aspect of the invention is a method for the identification of YM155 cytotoxicity, comprising the step of predicting that the generation cytotoxic for YM155 if more differentiated cells YM155 treatment when, expression of SLC35F2 the derived from the undifferentiated pluripotent stem cells.

The present invention relates to a method for selecting gene-edited cells from undifferentiated pluripotent stem cells, wherein the gene-edited cells can be concentrated and selected using YM155 resistance induced by transient knockdown of SLC35F2 by siRNA in the undifferentiated pluripotent stem cells. Therefore, it can be effectively used for selection of gene-edited cells.

1A is a result of calculating the score of human pluripotent stem cells (hPSCs) for 666 human cancer cells by performing enrichment analysis.

1B is a result of confirming YM155 as the most effective drug in cells with high hPSC scores by correlating the sensitivity of each cell line to 543 compounds.

1C is a graph comparing the expression level of SLC35F2 in human embryonic stem cells (hESCs) with cancer cell lines.

1D is a graph showing the mRNA expression of SLC35F2 and POU5F1 in human dermal fibroblasts (hDF), hESC-MSCs (Mesenchymal stem cells), and hESCs.

1e is a graph showing the mRNA expression of SLC35F2 and POU5F1 in hESC-MSCs, hCHA3, H9 and induced pluripotent stem cells (iPSCs: SES8).

1F is a photograph showing a fluorescence image of H9 stained with γH2AX after YM155 treatment.

Figure 1g is a result of performing immunoblotting analysis between hESC-MSC and hESC in order to detect the level of pH2AX (Ser 139) and cleaved caspase (c-Casp 3) after YM155 treatment.

1H is a result of quantifying the amount of YM155 absorbed in cells between hDF and hESC by performing LC-MS/MS analysis.

2A is a schematic diagram showing that exon 7 is selected as a target for SLC35F2 knockout.

2B is a cytometry result and a micrograph showing the cell death of SLC35F2 knocked out SLC35F2 KO hESC according to YM155 treatment.

2C is a T7E1 analysis result showing the frequency of insertion/deletion (indel) for clones that survive in the presence of YM155 after the introduction of sgRNA to Cas9 and SLC35F2 .

Figure 2d is a graph showing the percentage of indels through the next-generation sequencing (NGS) analysis for the clones that survive in the presence of YM155 after the introduction of sgRNA to SLC35F2 and Cas9.

2E is sequence information showing that a single clone of YM155R is a homozygous bi-allelic SLC35F2 KO compared to wild-type hESC (NC).

Figure 2f is a result showing the degree of cell death in SLC35F2 KO #1 hESC after YM155 treatment through flow cytometry.

Figure 2g is a result showing the expression level of SLC35F2 in SLC35F2 KO #1 hESC after YM155 treatment.

2H is a photograph showing DNA damage in SLC35F2 KO #1 hESC after YM155 treatment.

Figure 3a is a graph confirming the expression levels of the pluripotency markers NANOG, SOX2 and POU5F1 in SLC35F2 KO #1 hESC.

3B is a photograph of immunoblocking analysis confirming the level of proteins such as SOX2 and OCT4 , which are pluripotent markers, in SLC35F2 KO #1 hESC.

Figure 3c is a photograph showing the result of alkaline phosphatase (phosphathase) analysis of the control (NC) and SLC35F2 KO #1 hESC.

3D is a graph showing the cell growth rate of the control (NC) and SLC35F2 KO #1 hESC.

3E is a result of confirming the degree of cell growth competition through co-culture with wild-type hESCs (EGFP-hESCs) expressing green fluorescent protein by flow cytometry.

3F is a graph showing the mRNA expression of endoderm, mesoderm and ectoderm-specific genes (endoderm: SOX17, GATA6, mesoderm: MSX1 and ectoderm: NESTIN) after somatic differentiation from SLC35F2 KO #1 hESC in relative levels.

3G is a photograph of teratoma formed using SLC35F2 KO hESCs.

3H is transcript data showing a total gene scattering plot of pluripotency marker genes (POU5F1, SOX2, NANOG, Lin28A) in SLC35F2 KO #1 hESC.

4A is a schematic diagram showing a YM155 mediated enrichment selection approach in HEK293T cells (GOI: gene of interest).

Figure 4b is a photograph showing the results of T7E1 analysis of the band (asterisk) cut after enzyme treatment in SLC35F2 KO HEK293T cells.

Figure 4c is a diagram showing the NGS data of the wild-type control and various SLC35F2 KO HEK293T cells.

4D is a schematic diagram of a green fluorescent protein expression system for targeting CCR5 .

Figure 4e is a picture confirming the CRISPR/Cas9 targeting efficiency through co-targeting SLC35F2 and CCR5 and checking the ratio of GFP-positive cells.

Figure 4f is a graph confirming the CRISPR/Cas9 targeting efficiency through co-targeting SLC35F2 and CCR5 and checking the ratio of GFP-positive cells.

4G is a T7E1 analysis result confirming the CRISPR/Cas9 targeting efficiency by co-targeting SLC35F2 and CCR5 and checking the ratio of GFP-positive cells.

Figure 5a is a photograph showing the T7E1 analysis of the CCR5 and SLC35F2 from each clone is applied to by a CCR5 (C) and SLC35F2 (S) to the target combination of the sgRNA by two different percentage of the CCR5 and SLC35F2 target.

5B is a result of next-generation sequencing (NGS) analysis after selection of a control group (WT) and a clone corresponding to #1 (C:S = 1:1).

5C is an RNA-seq sample using t-distributed stochastic neighbor embedding (t-SNE) based on the expression of whole genes, hPSC signature genes and cell transition metal ion homeostasis (GO: 0046916) genes. This is a graph of the clustering results.

Figure 6a is a schematic diagram showing a YES- approach by introduction of siRNA by the CCR5 target sgRNA and SLC35F2 target.

6B is a graph showing relative levels of mRNA expression of SLC35F2 according to the indicated days after siRNA transduction in hESCs.

Figure 6c shows the results of annexin V/7-AAD (Annexin-V/7-AAD) staining and flow cytometry confirming cell death by comparing the 2nd and 5th days after transduction of the siRNA targeting SLC35F2 .

6D is a graph showing the average of the indel ratio as the target efficiency of CCR5 after performing the YES-approach with different YM155 treatment doses.

6E is a graph showing the results of sequencing analysis of CCR5 KO clones after performing the YES-approach at different YM155 treatment doses.

6F is a result of NGS analysis for CCR5 target sequence, sgRNA target and PAM sequence.

Figure 6g shows the results of flow cytometry by varying the treatment dose of YM155 in WT or CCR5 KO hESC and staining with Annexin V/7-AAD.

7A is a result of T7E1 analysis according to the presence or absence of the YES-approach targeting CCR5 , HEK2 and HEK3 loci (*, predicted DNA bands cleaved by T7E1 endonuclease).

Figure 7b is a graph showing the insertion frequency of CCR5 , HEK2 and HEK3 by the control (Cont) or the YES-approach (YES) determined by deep sequencing (*, p<0.05; **, p<0.01).

Figure 7c is a representative phase difference (top) and EGFP (bottom) images of Cas9-EGFP #1 hESC clone (scale bar = 100 μm), and relative mRNA of Cas9 and EGFP of Cas9-EGFP #1 against wild-type hESCs (control). It is a result showing the degree of expression.

7D is a graphical diagram for determining the target efficiency by the GFP reporter hESC expressing the Cas9 (Cas9-EGFP #1) system.

7E is a flow cytometric analysis result of EGFP positive and negative populations under labeling conditions (black arrows indicate EGFP target populations).

7F is a graph showing the EGFP positive (EGFP+) and EGFP negative (EGFP-) populations determined by flow cytometry.

8A is a graphic diagram showing knock-in (KI) targets at the EYA4 , TMEM67, and SLC6A5 loci. In ssODN, an HDR marker sequence (capital red) capable of recognizing each KI was inserted.

Figure 8b is a result showing the indel (KO: Open bar, KI: Red bar) efficiency of the indicator gene according to the presence or absence of the scar-free YES-approach.

Figures 8c to 8e show the HDR frequency of the indel ratio based on deep sequencing analysis for three different objects ( EYA4 , TMEM67 and SLC6A5 genes), respectively, 8c is EYA4 , 8d is TMEM67 , and 8e is SLC6A5 . Is the result.

Hereinafter, the present invention will be described in more detail by the following examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited by these examples.

Throughout this specification, "%" used to indicate the concentration of a specific substance is (weight/weight)% for solids/solids, (weight/volume)% for solids/liquids, and Liquid/liquid is (vol/vol)%.

Example 1: Preparation of cells

Human embryonic stem cells (WA09, WiCell Research Institute; hereinafter hESC) were supplied with mTeSRTM-E8TM culture medium (STEMCELL technologies) and StemMACSTM medium (Miltenyi-Biotec) supplemented with 50 ug/ml gentamicin (Life Technologies). It was incubated on a Rigel (BD Biosciences) coated plate. Cells were cultured every 5 to 6 days and the medium was changed daily.

hESC was washed with DPBS (Dulbecco's Phosphate-Buffered Saline) and exposed to Dispase (Gibco) to exfoliate. The separated cells were washed with DMEM/F-12 (Gibco) medium and plated on a Matrigel coated plate. If necessary, 10 uM of Y27632 (Gibco) was added for cell adhesion.

HEK293T (Human embryonic kidney 293 cells) cells were cultured in a culture dish (Falcon) supplied with DMEM (Gibco) supplemented with 10% FBS (Gibco) and 50 ug/ml gentamicin. Upon transfer, HEK293T cells were washed with DPBS and enzymatically separated with 0.25% trypsin. Trypsin was inactivated by adding DMEM containing 10% FBS, and an appropriate amount of cells was sprayed on the dish.

Example 2: due to intracellular uptake of YM155 in hPSCs SLC35F2 High expression of

The selective induction of apoptosis in human pluripotent stem cells (hPSCs) by YM155 is associated with a DNA damage response. The cytotoxicity of YM155 cannot be completely prevented by inhibition of BIRC5 (encoding survivin). Therefore, it was attempted to investigate the mechanism of selective cell death of hPSCs. To this end, solid cancer cell line gene expression data and drug response data from the Cancer Cell Line Encyclopedia (CCLE) and Cancer Therapeutics Response Portal (CTRP) were used, respectively.

Data from the gene expression omnibus (GEO) were used to identify the hPSC signature, i.e., a set of genes that were expressed differently in hPSCs compared to their differentiated counterparts.

Cell line mRNA expression data at the baseline level of the Pharmacogenomics data set were obtained from the Data Portal (Cancer Cell Line Encyclopedia; CCLE, https://portals.broadinstitute.org/ccle/data). Raw Affymetrix CEL files were transformed to normalize the actual expression values for each set of gene probes using the Robust Multi-Array Average (RMA) method.

When the probe was disrupted into a gene, the maximum value of the expression values of multiple probes per gene was taken as a representative expression value of the gene. Out of a total of 886 cell lines, 666 cancer cell lines with drug sensitivity data were used in this analysis, excluding blood lineage, non-human and ambiguous tissue types. Cell line drug response data was downloaded from the Cancer Therapeutics Response Portal (https://ocg.cancer.gov/programs/ctd2/data-portal).

Using the hPSC signature as shown in Figure 1a, the concentration analysis of a single sample through the Kolmogorov-Smirnov test (Kolmogorov-Smirnov; hereinafter KS) was performed to calculate the hPSC score for 666 human cancer cells.

Specifically, the hPSC score, the area under the fitted curve (AUC) for each of the 543 compounds and the cell line hPSC score for each compound were correlated with the sensitivity of each cell line.

Cell viability values were adjusted in the range of 0-100% and were adjusted by 4-parameter logistic regression analysis. In order to calculate the AUC (area under the fit curve), a specific concentration range was selected for each compound that tested the most cells. AUC was normalized to a range of 0 to 1 by the maximum AUC assumed to be 0% growth inhibition in a given concentration range.

Quantitative data are expressed as mean value ± standard error (SEM). To analyze the statistical significance of each response variable, a student's paired t-test or one-way ANOVA was performed. Pre-specified comparisons between groups were performed (where appropriate) via Tukey's post hoctest using the SPSS program (Social Science Statistics Package, Version 17). P values less than 0.05 were considered statistically significant.

As can be seen from the left side of FIG. 1B, cells with a high hPSC score (hPSC-like cells) of 543 compounds comparing the AUC and hPSC scores (z-scored Pearson correlation coefficient) were YM155 Has been shown to be selectively sensitive to.

The expression value of each gene was compared with the AUC of YM155 to show the strength of the correlation of 18,858 genes.

As can be seen from the right of FIG. 1B, ATP1B1 and SLC35F2 were highly expressed in YM155 resistant and sensitive cells, respectively, indicating that cells with high hPSC scores were selectively sensitive to YM155.

Based on the correlation of drug and gene expression signatures in FIG. 1A, genes with high correlation with susceptibility to YM155 were identified as previously described. The membrane transporter, SLC35F2, was the transcript most associated with YM155 sensitivity (Fig. 1b, left panel), suggesting that the intracellular introduction of YM155 by SLC35F2 causes highly selective cytotoxicity of the drug in hPSCs. This is consistent with previous reports of cancer models.

The gene expression profile database (http://nextbio.com) was used to compare the relative SLC35F2 expression between 24 human embryonic stem cells (hESCs) and various cancer cell lines. A human prostate cancer cell line, PC-3 (prostate cancer cell), was used as a positive control (PC) with high expression of SLC35F2 .

As can be seen in Fig. 1c, all hESCs (including H9 mainly used in this study) consistent with previous studies that identified hESC surface marker proteins expressed higher levels of SLC35F2 than other cancer cell lines.

On the other hand, as can be seen in Figures 1d and 1e, mesenchymal stem cells (hESC-MSCs) and human dermal fibroblasts (hereinafter hDFs) derived from hESCs with strong resistance to YM155 treatment , Two independent hESC lines (H9 and hCHA3) and pluripotent stem cells (iPSCs: SES8) expressed lower levels of SLC35F2 . POU5F1 was identified as a pluripotency marker. From this, it was confirmed that the expression level of SLC35F2 in hESCs was significantly higher than that of other cells.

SLC35F2 is a membrane transporter responsible for the uptake of YM155 into cells, causing DNA damage. As can be seen in Figures 1f and 1g, after YM155 treatment, distinct DNA damage was found in hESC, but not detected in hESC-MSC, so this can be confirmed (nuclear control staining with DAPI, scale bar = 10 um, α-tubulin is internal Used for control).

To perform LC-MS/MS analysis, HEK293T and H9 cells were exposed to 1 uM YM155 for 1 hour, and cells were counted as 1×10 ⁶ . The harvested cells were lysed with 80% methanol and incubated for an additional hour on ice. After spin down at 13,000 rpm for 20 minutes, the supernatant was collected and evaporated with N2 gas until no more solvent remained. The sample residue was resuspended with 100 uL of 50% methanol and filtered through 10 seconds sonication, 5 seconds vortex, spin-down and 0.2 um membrane filter. A total of 5 uL of solvent was injected into UHPLC/Q-TOF MS (Waters, Milford, MA, USA) using a column (ACQUITY UPLC BEH C18, 50 x 2.1 mm, 1.7 mm, 30°C). Samples were read at 0.2 mL/min flow rate, and the estimated peak for YM155 was 4.32 to 4.90 minutes.

As can be seen in FIG. 1h, the intracellular level of YM155 was higher in hESCs than in hDF. This clearly indicates that high SLC35F2 expression in hPSCs leads to this drug selective cytotoxicity in hPSCs.

Therefore, it was demonstrated that the selective induction of apoptosis of hPSCs by YM155 was due to the selective cellular uptake of the drug due to the high expression of SLC35F2 .

Example 3: In hPSCs induced by YM155 SLC35F2 Of selective cell death mediated by

hPSCs (EC _50: 10 nM) in order to confirm the link between YM155 selective cytotoxicity and high expression of SLC35F2 in these cells, using the CRISPR / Cas9 to target the exon 7 was knockout the SLC35F2 from hESCs in ( 2a).

Specifically, after introducing a single guide RNA (sgRNA) for SLC35F2 together with Cas9 into hESCs, the cells were treated with YM155 to remove unedited wild-type hESCs. One of the surviving colonies (YM155R) was selected and maintained.

Sequence number	designation	order
One	Nucleic acid sequence of SLC35F2 exon 7 to which sgRNA specifically binds	AGTGCCACTTCCGTCAACCT
2	Nucleic acid sequence of sgRNA targeting SLC35F2 exon 7	TGACATCAATTATTATACATCGG

Then, using flow cytometry of Annexin V and microscopic images of hESCs (red arrow indicates YM155 resistant clone: YM155R, scale bar = 500 nm), before and after YM155 treatment (YM155R) were compared.

Specifically, cells were separated with Accutase ^TM (561527, BD Biosciences) and washed 3 times with DPBS, and then with FITC Annexin-V (556419, BD Biosciences) and 7-AAD (559925, BD Biosciences) for cell death detection. Dyed. Diluted 1X Annexin V binding buffer (556454, BD Biosciences) was used as a staining solvent. FACS calibur from BD Biosciences and Cell Quest software was used for FACS analysis.

As can be seen from the left side of FIG. 2B (red arrow), a small number of colonies survived after YM155 treatment, while most of the cells experienced apoptosis.

In addition, as can be seen from the right side of Figure 2b, the resistant clone YM155R was very resistant to additional YM155 treatment.

Next, after the introduction of sgRNA of SLC35F2 and Cas9 transfected hESCs, YM155R was treated with different doses of YM155 at 0, 25, 50 and 100 uM, and T7E1 analysis and Indel percentage for surviving clones Next-generation nucleotide sequence analysis (NGS) analysis was performed to confirm.

Specifically, for T7E1 analysis, PCR was performed according to the supplier's instructions with a total volume of 10 ul per sample using SolgTM Taq DNA polymerase (STD16-R500, SolGent). The first PCR was performed with primer F1 and primer R for each gene. The first PCR product was diluted with 190 ul of DW. The second PCR was performed with 1 ul of the first PCR product diluted using primers F2 and R for each gene. The second PCR product was mixed with an equal volume of 2X NEBuffer2 (B7002S, New England BioLabs) and hybridized. Three units of T7E1 endonuclease (M0302S, New England BioLabs) were treated with 10 ul of the hybridized second PCR product. Enzymatic reaction was performed in a water bath at 37° C. for 40 minutes.

As can be seen in Fig. 2c, after the introduction of Cas9 and sgRNA to SLC35F2 , the frequency of insertion/deletion (indel) increased in a concentration-dependent manner, so that gene editing was confirmed.

As can be seen in Figure 2d, the clones surviving in the presence of 100 nM YM155 were almost 100% gene-edited hESC (100% indel ), which was positive as the SLC35F2 knockout (SLC35F2 KO) hESC population was enriched in a dose-dependent manner. This suggests that it effectively eliminates false positives (i.e., hESC left by wild-type SLC35F2).

As shown in Figure 2e, the sequence information from the YM155R clone (KO #1), the sgRNA target sequence, and the PAM sequence are shown in green and orange, respectively, and the single clone of YM155R maintained under the YM155 treatment is homozygous biallele (homozygous bi -allelic) turned out to be SLC35F2 KO.

Next, after treatment with 0, 5 and 25 uM of YM155, cell death assays in wild-type (NC) and SLC35F2 KO #1 hESCs were performed through flow cytometry.

As can be seen in Figure 2f, the resistant clone ( SLC35F2 KO hESCs: KO #1) was found to be very strong against YM155-induced cell death.

The resistance obtained from SLC35F2 KO hESCs could be confirmed through the expression level of SLC35F2 and the degree of DNA damage, which was exhibited by YM155 treatment.

As can be seen in Fig. 2g, the expression of SLC35F2 by YM155 treatment (1 and 2 uM) increased dose-dependently in wild-type hESCs (NC), whereas it was hardly expressed in SLC35F2 KO hESCs.

As can be seen in Figure 2h, as a result of staining with γH2AX and analyzing with a fluorescence microscope image, DNA damage by YM155 treatment (20 nM) was confirmed only in wild-type hESCs, and almost not in SLC35F2 KO hESCs (nuclear control staining with DAPI, scale bar = 10 μm).

Therefore, in SLC35F2 KO hESCs, SLC35F2- mediated cell death by YM155 treatment was hardly observed .

Example 4: SLC35F2 Confirmation of maintenance of cellular function of KO hESCs

Based on the results of Example 3, to characterize SLC35F2 KO hESCs, human skin fibroblasts; the typical, such as (human dermal fibroblasts or less hDF), wild-type hESCs (NC) and SLC35F2 KO from hESCs NANOG, SOX2 and POU5F1 The level of expression of potency markers was monitored.

For SLC35F2 KO hESCs, as can be seen by confirming the relative mRNA expression levels of typical pluripotent markers in FIG. 3A and protein levels such as SOX2 and OCT4 through immunoblocking analysis in FIG. 3B (β-actin is a loading control Used as), it was confirmed that the gene deletion of SLC35F2 had no effect on the self-renewal process of embryonic stem cells. In addition, the same results were derived from alkaline phosphatase activity (Fig. 3c) when representative colonies were enlarged in SLC35F2 KO hESCs, and the measured degree of cell growth rate of SLC35F2 KO #1 hESC (Fig. 3d). I did.

Next, after co-culture of SLC35F2 KO #1 hESC and normal hESCs (EGFP-hESCs) expressing green fluorescent protein, the ratio over time was confirmed by flow cytometry.

As can be seen in Figure 3e, as the ratio of the two cells did not change significantly during the co-culture process, it was found that the gene deletion of SLC35F2 did not significantly affect the growth of hESCs.

Then, a typical system of a specific gene in the KO SLC35F2 # 1 hESC are shown as relative levels of mRNA expression of the (endoderm: NESTIN SOX17, GATA6, mesoderm:: MSX1 and ectoderm). The measurement results were expressed in units of days after somatic cell differentiation, measured in units of 2 days.

Specifically, after somatic differentiation from SLC35F2 KO #1 hESC, spontaneous differentiation of endoderm, mesoderm, and ectoderm-specific genes was induced in vitro , and the specific mRNA expression level of each germ was compared with the control (NC). confirmed that the province endoderm cell differentiation in vitro is reduced to (you can see in the MSX1 gene expression) differentiation and mesenchymal cells Castle (which can be identified by GATA6 gene expression) in the spontaneous differentiation.

As can be seen in Figure 3f, as a result of spontaneous differentiation in vitro , it was confirmed that the deletion of the SLC35F2 gene inhibits endoderm and mesoderm differentiation.

Next, in order to investigate the in vivo multipotency of each cell, a mouse (Balb/C Nude, male 4 weeks old) was anesthetized, and then NC, SLC35F2 KO hESCs were directly injected into the testis.

Specifically, 5×10 ⁶ cells of each NC (n = 3) and SLC35F2 KO (n = 3) hESC were inoculated subcutaneously and skin into 4 week old mice. Mice were euthanized 2 months after each WT and SLC35F2 KO hESC inoculation. This animal experiment was conducted under the permission of the Animal Protection and Use Committee of Seoul National University (license number: SNU-180810-1).

As can be seen in Figure 3g, as a result of staining with H&E, Masson's trichrome, and Alcian Blue, it was possible to confirm the typical three-layered image of teratoma (scale bar is 50 mm). When spontaneous differentiation in vivo was confirmed through teratoma formation, it was found that ectodermal tissue (Nerual rosette), mesodermal tissue (cartilage), and endodermal tissue (Gut-like tissue) were found, indicating that the SLC35F2 gene defect was in vivo spontaneous triodenality. It was found that there was no significant effect on differentiation.

Finally, a total gene scattering plot of pluripotency marker genes ( POU5F1 , SOX2 , NANOG and Lin28A ) in SLC35F2 KO #1 hESC was shown, and each gene was indicated by a red circle.

As can be seen in Figure 3h, it was found that the expression level of pluripotency marker genes ( POU5F1 , SOX2 , NANOG, and Lin28A ) in SLC35F2 KO #1 hESC was not changed compared to wild-type hESC.

Thus, it was found that the high cytotoxicity caused by YM155 was completely eliminated by knockout of SLC35F2 .

Example 5: YM155 mediated cell enrichment selection through co-target selection

SLC35F2 KO concentrated selection of hESC (see Fig. 4a) is from a point that can be achieved by YM155 treatment, SLC35F2 the gene of interest; the two-induced resistance to the If YM155 targeting with (gene of interest GOI) gene editing hPSC It can be predicted that it may be useful for screening.

To prove the hypothesis, HEK293T cells showing a relatively high level of SLC35F2 were utilized to induce dose-dependent cell death after YM155 treatment (EC ₅₀ 10 times higher than hESC). Specifically, through simple introduction of sgRNA targeting SLC35F2 with Cas9 followed by YM155 treatment, gene editing populations were created with an efficiency of 88.4% (see FIGS. 4B and 4C).

Next, co-targeting of SLC35F2 was attempted with CCR5 (CC motif Chemokine Receptor). Utilizing the CCR5 reporter substitute (surrogate reporter) system was monitoring the effectiveness of the CCR5 target. In this system, monomeric red fluorescent protein (mRFP) is expressed by default, whereas expression of green fluorescent protein (GFP) is initiated only after CCR5 is targeted by Cas9 expression (Fig. Reference). Therefore, by co-targeting SLC35F2 and CCR5 and confirming the proportion of GFP-positive cells, real-time monitoring of CRISPR/Cas9 targeting efficiency was possible.

Sequence number	designation		order
3	Nucleic acid sequence of CCR5 targeting site to which sgRNA specifically binds	TGACATCAATTATTATACAT
4	Nucleic acid sequence of sgRNA targeting CCR5	TGACATCAATTATTATACATCGG

Specifically, fluorescence microscopic images of HEK293T cells expressing a surrogate reporter after sgRNA transformation of CCR5 alone or CCR5 / SLC35F2 with or without YM155 treatment were shown as a GFP ratio compared to the mRFP-positive group. In the labeling conditions for CCR5 and SLC35F2 (TS: surrogate reporter only, C: sgRNA for CCR5 , S: sgRNA for SLC35F2, CCR5+SLC35F2: sgRNA for both CCR5 and SLC35F2), the average GFP ratio compared to the mRFP positive group is plotted. Represented by

As can be seen in Figure 4e, it was possible to observe a significant increase in the GFP positive group by treatment with YM155.

In addition, as can be seen in Figure 4f and Table 3, considering that the substitute reporter system is only one-third of the gene editing group, the GFP-positive result group of 25% or less according to the YM155 selection has a high probability of 80%. Suggested that the gene was edited.

	TS	C	S	Cont	YM155
GFP expressing cells (%)	0.465	6.885	0.615	6.665	23.750

Next, in order to confirm the simultaneous targeting of CCR5 and SLC35F2 and enrichment of CCR5 KO by YM155 treatment, a T7E1 analysis for CCR5 was performed.

As can be seen in FIG. 4G, as a result of measuring and comparing the relative density of the bands, the KO efficiency was clearly increased.

As a result, the induction of tolerance by the knockout of YM155 SLC35F2 was useful for the selective enrichment of a gene clone editing.

Example 6: Confirmation of homeostasis of gene-edited hESCs by YM155 treatment

Based on the results of Example 5, after testing this approach (YM155-based enriched selection of CRISPR co-targeting (YM155-based Enriched Selection of CRISPR Co-15 target), hereinafter'YES approach') in HEK293T cells , This was applied to human pluripotent stem cells (hPSCs) more sensitive to YM155. In order to prove the concept of the YES-approach, the production of CCR5 -target hESCs was attempted.

The present inventors selected this gene for the following reasons.

(i) destruction of CCR5 (a genomic safe harbor) has little effect on the pluripotency of hPSCs; And

(ii) The cells may have potential for future applications in HIV-1 studies, for example the production of CCR5 depleted CD4 ⁺ T cells.

In this experiment, two different sgRNA ratios targeting CCR5 and SLC35F2 were used to minimize the selection of false positive clones (e.g., CCR5WT/SLC35F2KO) that could still survive under YM155 treatment. Seven (C:S = 1:1 ratio) or 4 (C:S = 2:1) colonies survive and isolate through the YES-approach using sgRNA targeting CCR5 (C) and SLC35F2 (S). Became.

As can be seen in Figure 5a and Table 4, according to the different dosage rates of the sgRNA targeting CCR5 and SLC35F2 , three clones and one clone were each shown as a CCR5 target hESC (25% or more efficiency), The number of each KO clone was summarized and indicated.

C:S	1:1	2:1
CCR5 KO	3/7	1/4
SLC35F2 EN	5/7	4/4
CCR5 KO (%)	42.9	25

Next, next-generation sequencing (NGS) was performed by selecting a control (WT) and a clone corresponding to #1 (C:S = 1:1) (see FIG. 5B).

Specifically, total RNA was extracted from the cells using Easy-BLUE TM RNA isolation kit (iNtRON Biotechnology) and quality control was performed. The verified samples are used to build the library. Sequencing libraries are prepared by random fragmentation of DNA or cDNA samples and 5'and 3'adapter ligation. The read quality of the raw RNA-seq file (FASTQ) was confirmed using FastQC (v0.11.7), and the adapter sequence of the read was removed using cutadapt (v1.8.1). Align the trimmed FASTQ file to the GRCh38 genome using STAR aligner (v2.6.0a), then HTseq (v0.11.0 with Gencode v22 annotation GTF (https://www.gencodegenes.org/human/release_22.html)) ) Was used to obtain a read count for the gene.

As a result, the single clone was 85.5% indel, indicating that the surviving clone was successfully gene edited in the desired manner. The sgRNA target sequence is indicated in green, and the PAM sequence is indicated in red.

Compared to wild-type hESCs, SLC35F2 KO hESCs did not change total gene expression and pluripotent gene expression, but the permanent KO effect of SLC35F2 in hESCs could not be excluded. Therefore, in order to closely examine genes whose expression is changed in SLC35F2 KO cells, clustering of RNA-seq samples using t-distributed stochastic neighbor embedding (t-SNE) was performed.

As can be seen in Figure 5c, although only minor differences were found between wild-type (NC #1 and NC #2) and KO cells (KO #1 and KO #2) in both total transcription and hPSC signals, the original SLC35F2 The'cytoplasmic transition metal ion homeostasis', which is related to the function of, has changed significantly.

Therefore, taking into account the undesirable bias that may occur due to permanent knockout of the SLC35F2 . By transient knockdown of SLC35F2 it was temporarily confirmed that only need to be YM155 induced immunity.

Example 7: CCR5 A scar-free YES approach for the establishment of target hESCs

YES- approach is the presence of permanent KO of SLC35F2 to was effective in establishing a gene of interest (GOI) target hESC, an induced resistance is YM155 SLC35F2 impact on the inorganic ion homeostasis, or can be a problem in terms of the same disease model The point could not be ruled out.

To solve this problem, GOI (in this case, CCR5) the according to sgRNA and introduction of siRNA by the SLC35F2 target to target, is temporarily YM155 resistance induced mediated by depletion of SLC35F2 was achieved (Fig. 6a Reference).

Sequence number	designation		order
5	Nucleic acid sequence of SLC35F2 targeting site to which siRNA is specifically bound	cagatgttgtccttgtgta
6	SLC35F2 targeting siRNA nucleic acid sequence	cagauguuguccuugugua

As can be seen in Figure 6b, as expected, the depletion of SLC35F2 completely recovered 5 days after siRNA transduction.

In addition, as a result of confirming by annexin V/7-AAD staining, after transduction of siRNA targeting SLC35F2 , concentration selection was possible on the second day as shown in the left panel of FIG. 6C, but on the 5th day as shown in the right panel of FIG. 6C The induced YM155 resistance disappeared.

These observations suggested that YM155 resistance induced by siRNA targeting SLC35F2 only occurred transiently without permanent scarring.

As shown in Fig. 6D, the CCR5 targeting efficiency was improved in a YM155 dose dependent manner.

As can be seen in Figure 6e, the mutation pattern of the gene editing group was simplified by 20 nM YM155 treatment, there were few colonies that survived after 20 nM treatment.

As can be seen in Fig. 6f, one of the clones obtained from the YES-approach accurately targeted CCR5 .

As can be seen in Fig. 6g, with the recovery of SLC35F2 expression, the cytotoxicity of YM155 was completely recovered, suggesting functional recovery of SLC35F2 .

Example 8: Expanding the application of the scar-free YES approach for gene knockout in hESCs

To validate and generalize the high efficiency of the scar-free YES approach for genome editing in hESCs , the known HEK2 and HEK3 genes (GOI) were further targeted. At this time, the HEK2 and HEK3 targeting siRNA nucleic acid sequences are the same as those used in Example 7, and the nucleic acid sequence of the CCR5 targeting site to which sgRNA specifically binds and the nucleic acid sequence of sgRNA targeting CCR5 were used in Example 5 above. Same as sequence.

Sequence number	designation		order
7	Nucleic acid sequence of HEK2 targeting site to which siRNA is specifically bound	GAACACAAAGCATAGACTGCGGG
8	Nucleic acid sequence of HEK3 targeting site to which siRNA is specifically bound	GGCCCAGACTGAGCACGTGATGG

As can be seen in Figures 7a and 7b, the indel frequencies of CCR5 , HEK2 and HEK3 were consistently greatly improved by the YES-approach.

In addition, in order to easily quantify the genome editing efficiency, a green fluorescent protein (EGFP) reporter hESC stably expressing Cas9 (Cas9-EGFP #1) was further established (see Fig. 7c). After introducing sgRNA into EGFP, the EGFP target efficiency was simply determined by measuring the EGFP negative population (see FIG. 7D).

Specifically, the Cas9-2A-EGFP gene (plasmid vector) was optionally introduced into H9 cells (hESCs) using the PiggyBac system, and cells expressing EGFP were collected through flow cytometry (FACS). Then, the nucleotide sequence of each colony derived from a single cell was analyzed to establish a clone that actually expresses Cas9 and EGFP.

As can be seen in Figures 7e and 7f, the EGFP negative population was significantly increased by the scar-free YES-approach. Compared to the specific, targeting efficiency (red histogram of Fig. 7e) in the case where only process sgRNA, YES- approach (after siRNA treatment of SLC35F2 YM155 screening) targeting efficiency of the cells (orange histogram of Fig. 7e) screened with the It increased significantly.

Example 9: Application to gene knock-in using ssODN

On the other hand, gene knock-in (KI) in hESCs remains an important technical obstacle, despite the high demand for genetic modification of patient iPSCs as well as for modeling allogeneic diseases.

Therefore, it was investigated whether the scar-free YES-approach can be applied to gene knockdown (KI). Target the intron site (prevents loss of gene function due to sgRNA targeting) of three different genes (EYA4, TMEM67 or SLC6A5 ) held in house with sgRNA, and then simultaneously, electroporation By delivering single-stranded oligodeoxynucleotides (ssODN) targeting each to the EYA4 , TMEM67 or SLC6A5 loci, homology-directed repair (HDR) with or without a scar-free YES-approach. -It was confirmed the possibility of applying the mediated KI (Fig. 8a). At this time, the nucleic acid sequence of the SLC35F2 targeting site to which siRNA specifically binds is the same as the sequence used in Example 7.

Sequence number	designation		order
9	Nucleic acid sequence of ssODN targeting EYA4		cttgtcctgcttcagttccttttcccaactacttagctagttcCAGCTGcaggctatccaaactctcaccGGGcaatgatttcatcaataataacttatg
10	Nucleic acid sequence of ssODN targeting TMEM67		ctattactataaagctgaggactctcaaaggcccttcagagCAGCTGtattgacaagaacgtgaactctgGGGtcaggctgcctgagttccaattccagt
11	Nucleic acid sequence of ssODN targeting SLC6A5	gtggagtctgctgtaatttagcttgcaaagaatgccttcaccCAGCTGtgggtgctttagggaggcagctgaaatggaagcagactgaatattttgaaat

Sequence number	designation	Sequence (except PAM sequence)
12	Nucleic acid sequence of sgRNA targeting EYA4 (nucleic acid sequence of EYA4 targeting site to which sgRNA specifically binds)	agagtttggatagcctgtat
13	Nucleic acid sequence of sgRNA targeting TMEM67 (nucleic acid sequence of TMEM67 targeting site to which sgRNA specifically binds)	gttcacgttcttgtcaatag
14	Nucleic acid sequence of sgRNA targeting SLC6A5 (nucleic acid sequence of SLC6A5 targeting site to which sgRNA specifically binds)	ttgcaaagaatgccttcacc

Specifically, human embryonic stem cells (hESCs) were separated into single cells and then 1×10 ⁶ cells were counted. Then, 2ug of Cas9 vector, 2ug of sgRNA, 5ug of ssODN, and 2ug of siRNA were transferred into the cell by electroporation. Two days after vector transfection, 20 nM of YM155 was treated for 6 hours and then washed-off to YES-select. After 4-5 days, gDNA was extracted from the selected cells to perform next-generation nucleotide sequence (NGS) analysis.

As can be seen in Figures 8a and 8b, the gene editing efficiency of KO as well as KI was significantly increased up to 12.5% by the YES-approach.

The present invention relates to a method for selecting gene-edited cells from undifferentiated pluripotent stem cells, and more particularly, a method for enriching and selecting gene-edited cells using YM155 resistance induced by transient knockdown of SLC35F2 by siRNA. It is about.

Claims (12)

1. A method for selecting genetically edited cells comprising the following steps:

   Gene editing step of targeting the SLC35F2 gene in undifferentiated pluripotent stem cells to proceed with gene editing, wherein the gene editing is to suppress the expression of the SLC35F2 gene, the gene editing step; And

   YM155 (CAS 781661-94-7) treatment to selectively kill the cells in which the expression of the SLC35F2 gene is not suppressed.
2. The method of claim 1,

   The cell selected by the method is one or more genes of interest (GOI) targeting to include gene-edited cells, gene-edited cell selection method.
3. The method according to claim 1 or 2,

   The gene editing is from the group consisting of antisense nucleotides, small interfering RNA (siRNA), short hairpin RNA (shRNA), and single stranded oligodeoxynucleotides (ssODN). A method for selecting a gene-edited cell that is performed by introducing at least one selected type into a cell.
4. The method of claim 3,

   The siRNA is a nucleic acid having the sequence of SEQ ID NO: 6, a method for selecting a gene-edited cell.
5. The method of claim 3,

   The ssODN is a nucleic acid having a sequence selected from the group consisting of SEQ ID NO: 9 to SEQ ID NO: 11, a method for selecting a gene-edited cell.
6. The method of claim 2,

   In the gene of interest, a reporter gene expressed when a sequence mutation occurs in the gene of interest is operably linked to the downstream of the gene of interest.
7. The method of claim 6,

   The sequence mutation is a frame shift mutation, a method for selecting a gene-edited cell.
8. The method of claim 6,

   The reporter gene is a method for selecting a gene-edited cell in which a nucleic acid sequence forming a transcription termination structure is inserted upstream.
9. The method of claim 6,

   The reporter gene is a fluorescent protein, beta-galactosidase, beta-lactamase, TEV-protease, dihydrofolate reductase, lucifer. Protein selected from the group consisting of luciferase, Renilla luciferase, Gaussia luciferase, selection marker, surface marker gene, and antibiotic resistance protein The method of selecting a gene-edited cell that encodes.
10. The method of claim 1,

    The undifferentiated pluripotent stem cells are selected from the group consisting of embryonic stem cells (Embryonic Stem Cells; hereinafter ESC), induced pluripotent stem cells (iPSCs), embryonic germ cells, embryonic tumor cells, and adult stem cells. Phosphorus, a method for selecting genetically edited cells.
11. The method of claim 1,

    The concentration of the YM155 is 10 to 2000 nM, the method for selecting a gene-edited cell.
12. YM155 comprising the step of predicting that cytotoxicity to YM155 occurs when the expression level of SLC35F2 increases when treated with YM155 (CAS 781661-94-7) to differentiated cells derived from undifferentiated pluripotent stem cells. How to determine the cytotoxicity of.

Images