WO2020171595A1 - 가노더마 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법 - Google Patents
가노더마 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법 Download PDFInfo
- Publication number
- WO2020171595A1 WO2020171595A1 PCT/KR2020/002412 KR2020002412W WO2020171595A1 WO 2020171595 A1 WO2020171595 A1 WO 2020171595A1 KR 2020002412 W KR2020002412 W KR 2020002412W WO 2020171595 A1 WO2020171595 A1 WO 2020171595A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ganoderma
- seq
- nucleotide sequence
- gene
- composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Definitions
- the present application relates to a marker, a composition, a kit, a chip, and a method of using the same for diagnosing root rot.
- Root rot disease (basal stem rot) is a disease of plants, mainly showing a condition in which the vitality of the plant decreases due to invasion of young roots. Plants infected with root rot show atrophy, growth is sluggish, fruits are small, yield is reduced, and when the disease progresses severely, leaves degenerate, slowly wither, and die later. Pathogens are known to be microorganisms of the genus Ganoderma, and are known to occur when pathogens invade the roots of plants.
- the present inventors completed the present application by discovering a sequence specifically possessed by microorganisms in the genus Ganoderma, which is the main pathogen of root rot, and developing a novel marker capable of detecting microorganisms in the genus Ganoderma from this.
- One object of the present application is to provide a composition for diagnosing root rot disease.
- Another object of the present application is to provide a kit for diagnosing root rot disease comprising the composition.
- Another object of the present application is to provide a chip for diagnosing root rot including the composition.
- Another object of the present application is to provide a method for diagnosing root rot.
- Another object of the present application is to provide a composition for detecting microorganisms in the genus Ganoderma.
- Another object of the present application is to provide a method for detecting microorganisms in the genus Ganoderma.
- Another object of the present application is to provide a use for diagnosing root rot.
- Another object of the present application is to provide a use for detecting microorganisms in the genus Ganoderma.
- the marker capable of specifically detecting the Ganoderma boninense bacteria of the present application can directly detect microorganisms in the genus Ganoderma in soil. Through this, it can be used to prevent and treat root rot caused by contamination of the microorganisms, and industrial use in oil palm farms can be expected.
- FIG. 1 is a diagram showing the result of detecting Ganoderma boninense bacteria as a marker of the present application in Malaysian soil.
- An aspect of the present application for achieving the above object provides a composition for diagnosing root rot disease.
- the composition comprises a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, or an agent capable of detecting a fragment thereof. It may be a composition for diagnosing root rot disease, but is not limited thereto.
- the gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof is a gene specifically possessed by microorganisms in the genus Ganoderma , or a fragment thereof It may be, and may be mixed with a marker for detecting microorganisms in the genus Ganoderma.
- marker capable of detecting microorganisms in the genus Ganoderma refers to a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, Or a fragment thereof, as a sequence that is specifically present only in microorganisms of the genus Ganoderma, and refers to a sequence capable of determining whether or not a microorganism of genus Ganoderma is present in a sample by determining the presence or absence of the sequence.
- the markers provided in the present application may have a certain level of homology to each other or share a specific core sequence of microorganisms of the genus Ganoderma, but are not limited thereto.
- gene represented by the nucleotide sequence of SEQ ID NO: 1 is one of genes having a sequence specifically found in microorganisms of the genus Ganoderma, and the microorganism of genus Ganoderma is in a sample (soil) according to the presence or absence of the gene. You can check whether it exists or not.
- a gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1 is a gene that has 80% or more homology or identity to the nucleotide sequence of SEQ ID NO: 1, and is represented by the nucleotide sequence of SEQ ID NO: 1 Likewise, it has a sequence that is specifically found in microorganisms of the genus Ganoderma, and it is possible to check whether or not a microorganism of genus Ganoderma is present in a sample (soil) according to the presence or absence of the gene.
- a gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1 may have 80%, 85%, 90%, or 95% or more homology, and more specifically, SEQ ID NO: 2 to It may include the base sequence of any one of 9, but is not limited thereto.
- nucleotide sequence or amino acid sequence represented by a specific sequence number or an abnormality that has the same or corresponding activity as a gene or protein of a nucleotide sequence or amino acid sequence represented by a specific sequence number ( identity) may also be included in the scope of the present application, but is not limited thereto.
- nucleotide sequence or amino acid sequence of a specific sequence number may have homology or identity of at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more with the nucleotide sequence or amino acid sequence of a specific sequence number, and the corresponding It is obvious that sequences in which some sequences are deleted, modified, substituted or added are also included in the scope of the present application, as long as they are exhibiting efficacy or activity and are specifically present in the microorganism of the genus Ganoderma of interest.
- the term'homology' or'identity' means the degree to which two given amino acid sequences or base sequences are related to each other, and may be expressed as a percentage.
- sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and a default gap penalty established by the program used can be used together.
- sequence homologous or identical sequences are generally at least about 50%, 60%, 70%, 80% of the sequence full or full-length in medium or high stringent conditions. Or it can hybridize to 90% or more. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotide.
- the homology, similarity or identity of a polynucleotide or polypeptide can be found in, for example, Smith and Waterman, Adv. Appl. As known in Math (1981) 2:482, for example, Needleman et al. (1970), J Mol Biol. 48: 443 can be determined by comparing sequence information using a GAP computer program.
- the GAP program defines the total number of symbols in the shorter of two sequences, divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
- the default parameters for the GAP program are (1) a monolithic comparison matrix (contains values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); And (3) no penalty for end gaps.
- the term “homology” or “identity” refers to relevance between sequences.
- fragment refers to a partial sequence of a gene having a specific sequence, specifically, a gene represented by the nucleotide sequence of SEQ ID NO: 1, and at least 80% homology with the nucleotide sequence of SEQ ID NO: 1 It refers to a sequence of a partial region that can be used for detecting microorganisms in the genus Ganoderma by including a sequence specific to a microorganism in the genus Ganoderma while being a partial sequence of a gene having The sequence or length is not limited as long as it is a partial sequence of a gene represented by the nucleotide sequence of SEQ ID NO: 1 and a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1 and can detect microorganisms in the genus Ganoderma.
- the fragment may include the nucleotide sequence of any one of SEQ ID NOs: 10 to 12, but is not limited thereto.
- the marker of the present application may include any one of SEQ ID NOs: 1 to 12, and more specifically, the marker of the present application may be composed of any one of SEQ ID NOs: 1 to 12. , Is not limited thereto.
- the "detectable agent” includes any agent generally used to detect a gene in the art, and not only an agent that detects the entire sequence of the marker, but also detects a part of the marker. It means a formulation that can be identified.
- the detectable agent may mean an agent capable of amplifying and detecting the marker of the present application, but is not limited thereto, and specifically, a probe, a primer pair, an antibody, an aptamer, and It may be any one selected from the group consisting of oligonucleotides, but is not limited thereto.
- primer refers to a single-stranded oligonucleotide sequence that is complementary to a nucleic acid strand to be detected, and may serve as a starting point for the synthesis of a primer extension product.
- primers may be prepared to be used for detection of a marker through a PCR reaction, and the specific length and sequence of the primers are used conditions such as temperature and ionic strength as well as the complexity of the required DNA or RNA target. According to the method known in the art can be synthesized.
- the primer pair may be a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 13 and 14, but is not limited thereto.
- the "probe” of the present application is a probe that can be prepared from a specific gene sequence by a known method, for example, as long as it can be hydrated under stringent conditions with a complementary sequence for all or part of the nucleotide sequence. It may be included without limitation in the scope of the application.
- the "stringent condition” means a condition that enables specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., homolog).
- genes with high homology or identity 80% or more, 85% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, Particularly, under the condition that genes with 99% or more homology or identity are hybridized, and genes with lower homology or identity are not hybridized, or at 60°C, which is a washing condition for common southern hybridization , 1 X SSC, 0.1% SDS, specifically 60° C., 0.1 X SSC, 0.1% SDS, more specifically 68° C., 0.1 X SSC, at a salt concentration and temperature corresponding to 0.1% SDS, once, specifically Conditions for washing 2 times to 3 times can be listed as examples.
- Hybridization requires that two nucleic acids have a complementary sequence, although a mismatch between bases is possible depending on the stringency of the hybridization.
- complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.
- the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments that are complementary to the entire sequence.
- polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
- the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose.
- the appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
- diagnosis refers to a process of determining whether root rot has occurred due to contamination by microorganisms in the genus Ganoderma.
- composition of the present invention it is possible to check whether a sequence specific to the microorganism genus Ganoderma is present in the sample.
- the composition for diagnosing root rot disease of the present application is a specific marker of microorganisms in the genus Ganoderma, that is, a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1, or
- the composition may be a composition capable of determining whether a fragment is present in the collected sample and diagnosing whether the sample is contaminated by microorganisms in Ganoderma genus or whether a root rot disease has occurred, but is not limited thereto.
- the root rot disease may be caused by microorganisms in the genus Ganoderma in the oil palm tree, and the plant that causes the root rot disease may be Elaeis guineensis, Elaeis oleifera, Attalea maripa, etc., but is not limited thereto.
- Ganoderma genus microorganism is a microorganism belonging to fungi, and has been traditionally used as a medicine in Asia.
- a marker capable of specifically detecting the microorganisms is provided.
- the microorganisms of the genus Ganoderma are Ganoderma alba, Ganoderma annularis, Ganoderma atrum, Ganoderma aurea, and Ganoderma austral.
- Ganoderma amboinense Ganoderma applanatum, Ganoderma boninense, Ganoderma brownie, Ganoderma colossus, Ganoderma colossus Ganoderma cupreum, Ganoderma curtisii, Ganoderma formosanum, Ganoderma incrassatum, Ganoderma lobatum, Ganoderma lobatum, Ganoderma lucidum Ganoderma lucidum), Ganoderma meredithiae, Ganoderma miniatocinctum, Ganoderma multipileum, Ganoderma nigrolucidum, Ganoderma nigrolucidum, Ganoderma Ganoderma orbiforme), Ganoderma oregonense, Ganoderma purpurea, Ganoderma pfeifferi, Ganoderma philippii, Ganoderma pseudoferreum , Ganoderma resinaceum, Ganoderma rubra, Ganoderma sichuanense, Ganoderma sinense, Ganoderma stey
- Another aspect of the present application provides a kit for diagnosing root rot disease.
- the kit may include an agent capable of detecting a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof,
- the kit for diagnosing root rot disease of the present application may be used to check whether microorganisms in the genus Ganoderma are present in a soil sample collected at the site.
- the kit may be selected from the group consisting of an RT-PCR kit, an immune strip, a DNA chip kit, a protein chip kit, a rapid kit or a MRM (multiple reaction monitoring) kit, and an ELISA diagnosis kit, As long as it can be ascertained whether or not microorganisms in the genus Ganoderma exist, they are not limited to the principle or form of their operation.
- the kit of the present application may include one kind or more other components composition, solution, or device suitable for diagnosing root rot disease, but is not limited thereto.
- the other components include, but are not limited to, a suitable carrier, a labeling substance capable of generating a detectable signal, a chromophores, a solubilizing agent, a detergent, a buffering agent, a stabilizer, and the like.
- the labeling material is an enzyme
- a substrate capable of measuring enzyme activity and a reaction terminator may be included.
- the carrier includes a soluble carrier, an insoluble carrier, and an example of a soluble carrier includes a physiologically acceptable buffer solution known in the art, for example, PBS, and an example of an insoluble carrier includes polystyrene, polyethylene, polypropylene, polyester, poly Polymers such as acrylonitrile, fluororesin, crosslinked dextran, polysaccharide, and magnetic particles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof may be used, but are not limited thereto.
- PBS physiologically acceptable buffer solution
- an insoluble carrier includes polystyrene, polyethylene, polypropylene, polyester, poly Polymers such as acrylonitrile, fluororesin, crosslinked dextran, polysaccharide, and magnetic particles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof may be used, but are not limited thereto.
- the kit of the present application may include a primer pair for detection of a marker, and a reagent for performing a detection reaction, but is not limited thereto.
- the kit of the present application may additionally include reagents required for an amplification reaction performed for marker detection, and the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, and buffers, and further , It may further include reagents necessary for real-time PCR reaction performance and analysis.
- the kit of the present application may further include a user's guide that describes the optimum reaction performance conditions.
- the guide is a handout explaining how to use the kit, e.g., how to prepare the PCR buffer, and the reaction conditions presented.
- the guide contains a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and a description on the surface of the package containing the kit.
- the guide includes information disclosed or provided through electronic media such as the Internet.
- Another aspect of the present application provides a chip for diagnosing root rot.
- the chip may include an agent capable of detecting a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof, and specifically,
- the chip may be a DNA chip or a protein chip.
- the DNA chip may include a substrate to which a marker gene for detecting microorganisms in the genus Ganoderma or cDNA corresponding to a fragment thereof or an oligonucleotide is attached, and reagents, preparations, and enzymes for producing a fluorescently labeled probe And the like may additionally be included.
- the substrate may include a cDNA or oligonucleotide corresponding to a control gene or a fragment thereof, but is not limited thereto.
- the protein chip includes an antibody that specifically recognizes a gene represented by the nucleotide sequence of SEQ ID NO: 1 of the present application, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof. However, it is not limited thereto.
- Another aspect of the present application provides a method for diagnosing root rot.
- a gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof from the collected sample Provides a method for diagnosing root rot.
- the gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1 may include any one nucleotide sequence of SEQ ID NOs: 2 to 9, and the fragment is any one nucleotide sequence of SEQ ID NO: 10 to 12 It may include, but is not limited thereto.
- the sample may be used without limitation as long as it is possible to determine contamination by microorganisms in Ganoderma genus, but may be soil, plants, etc.
- the sample collection depth, collection method, etc. are not limited.
- RT-PCR reverse transcriptase polymerase reaction
- competitive RT-PCR competitive reverse transcriptase polymerase reaction
- real time polymerase reaction real time reverse transcriptase polymerase reaction
- real time real time reverse transcriptase polymerase reaction
- real time real time reverse transcriptase polymerase reaction
- quantitative RT-PCR RNase protection method
- Northern blotting Northern blotting
- gene chip may be performed by a method selected from the group consisting of a combination thereof, but is not limited thereto.
- the diagnostic method of the present application further comprises the step of (d) detecting the marker of the present application in the control sample, or (e) the marker of the present application detected in the control sample and in step (c) It may be to further include a step of comparing the detection result of the marker in the confirmed sample, but is not limited thereto.
- the marker detection method of the present application may be to detect the amplified marker after amplifying the marker, but is not limited to a specific method as long as it is a marker detection method known in the art.
- the detection result may be the amount of the amplified gene or fragment thereof, but is not limited thereto.
- the control sample may be a sample in which microorganisms in Ganoderma do not exist, or a sample in which root rot disease does not occur, but is not limited thereto.
- the diagnostic method of the present application is (f) comparing the amount of the amplified gene or fragment thereof in the control sample and the sample, and when the amount of the gene or fragment thereof specifically possessed by the microorganism genus Ganoderma increases, root rot disease It may further include a step of diagnosing as having a disease, but is not limited thereto.
- a method of separating genomic DNA from a sample or a microorganism contained in a sample may be performed using a method known in the art, for example, the CTAB method or the wizard prep kit (Promega).
- a target sequence can be amplified by performing an amplification reaction using a primer.
- Methods of amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, and There are strand displacement amplification or amplification via Q ⁇ replicase or any other suitable method for amplifying nucleic acid molecules known in the art.
- PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase.
- PCR methods are well known in the art, and commercially available kits may be used.
- Real-time PCR is a method of monitoring the progress of PCR in real time in order to compare each PCR within an exponentially increasing range.
- the real-time PCR method a DNA quantification technique, is a method of quantifying the amount of target DNA present in the first sample by observing the generation process of PCR amplified products in real time using a device in which a thermal cycler and a spectrophotometer are integrated.
- Real-time PCR replaces the existing microbial qualitative and quantitative method, which had no choice but to be based on microbial cultivation, and enables qualitative and quantification of microorganisms without performing separation and cultivation of microorganisms.
- the real-time PCR method is divided into absolute quantification and relative quantification analysis.
- preparation of a standard curve is an essential factor.
- Quantitative real-time PCR is performed simultaneously on the standard and unknown samples to derive a calibration curve from the standard sample, and then the amount of target DNA in the unknown sample is quantified from the calibration curve.
- the calibration curve from the standard sample x-axis: concentration of the standard sample, y-axis: threshold cycle number (CT; threshold cycle)
- CT threshold cycle number
- Quantitative PCR refers to PCR for quantifying the amount of template DNA at the start of the amplification reaction, and means PCR capable of confirming amplification of a molecule to be amplified at any time point during the reaction.
- PCR is combined with a calibration curve that correlates the number of template DNA molecules at the initiation of the reaction and a signal serving as an indicator of the amplification. This calibration curve can be produced using a standard sample with a known number of molecules.
- the calibration curve is based on the calibration curve prepared from the amplification of the standard sample by performing quantitative real-time PCR using a gene or marker of a microorganism in Ganoderma genus to be quantified as a standard sample, and using a primer to specifically amplify it. It may be to confirm the number of threshold cycles (CT) of the target gene or marker.
- CT threshold cycles
- the amplified target sequence may be labeled with a detectable labeling substance.
- the label material may preferably be a fluorescent substance , but is not limited thereto.
- the detection chemistry currently used in real-time PCR is generally divided into a non-specific method using Sybr Green I and a specific method using a hybridization probe. Sybr Green I non-specifically binds to double-stranded DNA to emit fluorescence, and a real-time PCR instrument measures the amount of this fluorescence to confirm the amount of DNA.
- the hybridization probe specifically hybridizes to a complementary nucleotide sequence and emits fluorescence during the PCR reaction.
- a taqman probe (dual labeled fluorogenic probe) has a fluorescent reporter at the 5'-end and a quencher at the 3'-end.
- fluorescence reporter of the Taqman probe is present in close proximity to the quencher, fluorescence is canceled and thus not detected.
- the Taqman probe is hybridized to a specific target sequence and PCR amplification proceeds, the Taqman probe is decomposed by the 5'-3' exonuclease activity of Taq DNA polymerase, and a fluorescent reporter is released freely. As it moves away from the quencher, it emits fluorescence. By measuring this, the amount of generation of the target DNA fragment is monitored in real time.
- the primer pair used in the method of the present application may be a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 13 and 14, and the step of detecting a gene or fragment thereof in the method of the present application may be performed with the nucleotide sequences of SEQ ID NOs: 13 and 14. It may be carried out through PCR (polymerase chain reaction) using the formed primer pair, but is not limited thereto.
- Another aspect of the present application provides a composition for detecting microorganisms in the genus Ganoderma.
- the composition for detecting microorganisms in the genus Ganoderma of the present application may be used to determine whether a sample (eg, soil) is contaminated by microorganisms in the genus Ganoderma, and specifically, may be used to detect the marker of the present application. .
- Another aspect of the present application provides a method for detecting microorganisms in the genus Ganoderma.
- comprising the step of detecting a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof from the collected sample Provides a method for detecting microorganisms in the genus Ganoderma
- the method for detecting microorganisms in Ganoderma genus of the present application may be to detect whether or not a microorganism in genus Ganoderma is present in a sample using the marker or composition of the present application, but is not limited thereto.
- Another aspect of the present application provides a use for diagnosing root rot.
- a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof for diagnosing root rot disease or a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% or more homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof is provided for diagnosis of root rot disease. .
- Another aspect of the present application provides a use for detecting microorganisms in the genus Ganoderma.
- a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof for detecting microorganisms in the genus Ganoderma Or (ii) a gene represented by the nucleotide sequence of SEQ ID NO: 1, a gene having at least 80% homology with the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof, to detect microorganisms in the genus Ganoderma do.
- the present inventors attempted to discover a marker capable of specifically detecting a microorganism of the genus Ganoderma, which is known as the main cause of root rot.
- Ganoderma boninense G3 (GCA_002900995.2) , Ganoderma boninense NJ3 (GCA_001855635.1) , Ganoderma lucidum BCRC (GCA_000338035.1) , Ganoderma Tsugae (GCA_003057275.1) , Ganoderma lucidum Xiangnong5.1) , Ganoderma lucidum G260125 (GCA_000271565.1) , Ganoderma sinense (GCA_002760635.1) microorganisms obtained DNA sequences from a known NCBI site, and Ganoderma boninense directly obtained the DNA sequence of the microorganism, and from the obtained sequence, microorganisms of the genus Ganoderma were obtained. Specific markers for detection were discovered and developed.
- NGS Next Generation Sequencing
- NCBI Next Generation Sequencing
- the DNA sequence of the microorganism of the genus Ganoderma known in the database (as of May 2018, 178,448,606,127bp) and the DNA sequence of the fungi strain other than the genus Ganoderma (2,391 strains, 80,288,864,015bp) information were obtained.
- the gDNA sequence of the soil which was confirmed to be free of microorganisms in the genus Ganoderma, was obtained through NGS (7,724,586,454bp).
- the microorganism-specific marker of the genus Ganoderma represented by the nucleotide sequence of SEQ ID NO: 2 to 9 has at least 83% identity with the marker sequence of SEQ ID NO: 1.
- Example 2 Diagnosis of root rot disease using Ganoderma specific marker
- Example 1 Using the markers obtained in Example 1, it was confirmed whether microorganisms in the genus Ganoderma could be directly detected in the soil.
- primers for detecting the markers of SEQ ID NOs: 1 to 9 of the present application were prepared, and regions within the microorganism-specific sequence of the genus Ganoderma to which the primers bind are shown in Table 2 below.
- Primer information for detecting a partial region of SEQ ID NOs: 10 to 12 is shown in Table 3 below.
- Each lane of FIG. 1 represents as follows.
- Lane 1 is a DNA ladder
- lane 2 is a PCR product using Ganoderma boninense Genomic DNA
- Lane 3 is a PCR product using Genomic DNA of a Vercandera microorganism (Bjerkandera sp.)
- Lane 4 is a PCR product using the Fusarium microorganism (Fusarium sp.) Genomic DNA
- Lane 5 is a PCR product using a Trichoderma microorganism (Trichoderma sp.) genomic DNA
- Lane 6 is a PCR product using soil DNA in which root rot has occurred
- Lane 7 is a PCR product using soil DNA in which root rot has occurred
- Lane 8 shows the PCR product (negative control) proceeded with only water.
- the present inventors not only discovered novel markers specifically possessed by microorganisms in the genus Ganoderma, but also confirmed that it is possible to diagnose whether or not root rot infection is caused by Ganoderma bacteria in soil.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 출원은 Ganoderma 속 미생물을 특이적으로 검출할 수 있는 마커, 조성물, 및 상기 마커 또는 상기 조성물을 이용하여 Ganoderma 속 미생물을 검출하는 방법, 뿌리 썩음병 진단 방법, Ganoderma 속 미생물을 검출하는 용도, 및 뿌리 썩음병 진단 용도에 관한 것이다.
Description
본 출원은 뿌리 썩음병 진단을 위한 마커, 조성물, 키트, 칩 및 이를 이용하는 방법에 관한 것이다.
뿌리 썩음병(basal stem rot)은 주로 어린 뿌리가 침해되어 식물체의 활력이 떨어지는 병증을 나타내는 식물체의 병이다. 뿌리 썩음병에 감염된 식물체는 위축을 나타내고, 생육은 부진하여 과실은 작고, 수량이 감소될 뿐만 아니라, 병이 심하게 진전되면 잎은 퇴록되고, 서서히 시들다가 후에 말라죽는다. 병원균은 Ganoderma 속 미생물인 것으로 알려져 있으며, 병원균이 식물체의 뿌리를 침범함으로써 발생하는 것으로 알려져 있다.
오일팜 산업이 활발한 말레이시아에서는 Ganoderma 속 미생물에 의한 뿌리 썩음병에 의한 경제적 손실이 매우 크며 그 규모가 연간 4,600만 달러에 달하는 것으로 알려져 있다. 이에, 산업 현장에서 이용할 수 있는 뿌리 썩음병 진단이 가능한 마커 개발의 필요성이 대두되고 있다.
이와 관련하여, 종래에 인삼 뿌리 썩음병 진단을 위한 기술은 알려져 있으나(한국 등록특허 10-1570792호), 이는 인삼 뿌리 썩음 병원균인 Cylindrocarpon destructans을 검출하기 위한 방법으로, Ganoderma 속 미생물에 의한 뿌리 썩음병 진단을 위한 마커는 아직 개발되지 않은 실정이다.
본 발명자들은 뿌리 썩음병의 주된 병원균인 Ganoderma 속 미생물이 특이적으로 갖는 서열을 발굴하고, 이로부터 Ganoderma 속 미생물을 검출할 수 있는 신규한 마커를 개발하여 본 출원을 완성하였다.
본 출원의 하나의 목적은 뿌리 썩음병 진단용 조성물을 제공하는 것이다.
본 출원의 다른 하나의 목적은 상기 조성물을 포함하는 뿌리 썩음병 진단용 키트를 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 조성물을 포함하는 뿌리 썩음병 진단용 칩을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 뿌리 썩음병 진단 방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 Ganoderma 속 미생물 검출용 조성물을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 Ganoderma 속 미생물 검출 방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 뿌리 썩음병 진단 용도를 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 Ganoderma 속 미생물 검출 용도를 제공하는 것이다.
본 출원의 Ganoderma boninense 균을 특이적으로 검출할 수 있는 마커는 토양에서 직접 Ganoderma 속 미생물을 검출할 수 있다. 이를 통해 상기 미생물의 오염으로 인한 뿌리 썩음병을 예방 및 치료하는데 이용될 수 있고, 오일팜 농장에서의 산업적 활용을 기대할 수 있다.
도 1은 말레이시아 토양에서 본 출원의 마커로 Ganoderma boninense 균을 검출한 결과를 나타낸 도이다.
이하, 본 출원 내용에 대하여 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시한 일 양태의 설명 및 실시형태는 공통된 사항에 대하여 다른 양태의 설명 및 실시 형태에도 적용될 수 있다. 또한, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 더불어, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
상술한 목적을 달성하기 위한 본 출원의 일 양태는 뿌리 썩음병 진단용 조성물을 제공한다.
하나의 구체예에서, 상기 조성물은 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 검출할 수 있는 제제를 포함하는 뿌리 썩음병 진단용 조성물일 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 상기 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편은 Ganoderma 속 미생물이 특이적으로 갖는 유전자, 또는 그의 단편일 수 있으며, Ganoderma 속 미생물을 검출하기 위한 마커와 혼용될 수 있다.
본 출원에서, "Ganoderma 속 미생물을 검출할 수 있는 마커" 또는 "마커"는 상기 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 의미하는 것으로서, Ganoderma 속 미생물에만 특이적으로 존재하는 서열로서 상기 서열의 존재 여부를 판별함으로써, 시료 내에 Ganoderma 속 미생물이 존재하는지 여부를 판별할 수 있는 서열을 의미한다. 본 출원의 마커를 이용할 경우, 채취된 시료가 Ganoderma 속 미생물에 의해 오염되었는지 여부를 빠르고 정확하게 판별할 수 있다. 본 출원에서 제공하는 마커는 서로 일정 수준 이상의 상동성을 갖거나, Ganoderma 속 미생물이 갖는 특이적 코어 서열을 공유하는 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서, "서열번호 1의 염기서열로 표현되는 유전자"는 Ganoderma 속 미생물에서 특이적으로 발견되는 서열을 갖는 유전자의 하나로서, 상기 유전자의 존재 여부에 따라 Ganoderma 속 미생물이 시료(토양) 내에 존재하는지 여부를 확인할 수 있다. 또한, "서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자"는 서열번호 1의 염기서열과 80% 이상의 상동성 또는 동일성을 갖는 유전자로서, 서열번호 1의 염기서열로 표현되는 유전자와 마찬가지로, Ganoderma 속 미생물에서 특이적으로 발견되는 서열을 갖고, 상기 유전자의 존재 여부에 따라 Ganoderma 속 미생물이 시료(토양) 내에 존재하는지 여부를 확인할 수 있다. 구체적으로, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자는 80%, 85%, 90%, 또는 95% 이상의 상동성을 갖는 것일 수 있고, 보다 구체적으로, 서열번호 2 내지 9 중 어느 하나의 염기서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서, 유전자 또는 단백질이 특정 서열번호의 염기서열 또는 아미노산 서열을 갖는 것으로 기재되어 있다 하더라도, 해당 서열번호의 염기서열 또는 아미노산 서열로 이루어진 유전자 또는 단백질과 동일 혹은 상응하는 활성을 가지는 경우라면, 목적하는 Ganoderma 속 미생물에 특이적으로 존재하는 것인한, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 서열을 갖는 유전자 또는 단백질도 본 출원에서 사용될 수 있음은 자명하다.
또한, 특정 서열번호로 표현되는 염기서열 또는 아미노산 서열의 유전자 또는 단백질과 동일 또는 상응하는 활성을 갖는 이상, 특정 서열번호로 표현되는 염기서열 또는 아미노산 서열과 80% 이상의 상동성(homology) 또는 동일성(identity)을 갖는 서열도 본 출원의 범주에 포함될 수 있으나, 이에 제한되는 것은 아니다. 구체적으로, 특정 서열번호의 염기서열 또는 아미노산 서열과 적어도 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 가질 수 있으며, 상응하는 효능 또는 활성을 나타내는 것으로, 목적하는 Ganoderma 속 미생물에 특이적으로 존재하는 것인한, 일부 서열이 결실, 변형, 치환 또는 부가된 서열 역시 본 출원의 범주에 포함됨은 자명하다.
본 출원에서 용어, '상동성(homology)' 또는 '동일성(identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열과 서로 관련된 정도를 의미하며 백분율로 표시될 수 있다.
용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된 (conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나 (homologous) 또는 동일한 (identical) 서열은 중간 또는 높은 엄격한 조건(stringent conditions)에서 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90% 이상으로 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다. (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol.48: 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 일진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다. 따라서, 본 출원에서 사용된 것으로서, 용어 "상동성" 또는 "동일성"은 서열들간의 관련성(relevance)를 나타낸다.
본 출원에서, "단편"은 특정 서열을 갖는 유전자의 일부 서열을 의미하는 것으로, 구체적으로는, 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자의 일부 서열이면서, Ganoderma 속 미생물 특이적인 서열을 포함함으로써, Ganoderma 속 미생물 검출에 이용될 수 있는 일부 영역의 서열을 의미한다. 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자의 일부 서열이면서 Ganoderma 속 미생물을 검출할 수 있는 한, 서열이나 그 길이는 제한되지 않고, 상기 단편의 양 말단에 무의미한 서열이 부가되거나, 일부 서열이 치환된 서열 역시 본 출원의 범주에 포함됨은 자명하다. 구체적으로, 상기 단편은 서열번호 10 내지 12 중 어느 하나의 염기서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다.
구체적으로, 본 출원의 마커는 서열번호 1 내지 12 중 어느 하나의 서열을 포함하는 것일 수 있고, 보다 구체적으로, 본 출원의 마커는 서열번호 1 내지 12 중 어느 하나의 서열로 구성되는 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서, "검출할 수 있는 제제"는 당업계에서 일반적으로 유전자를 검출하는데 이용하는 임의의 제제를 모두 포함하며, 상기 마커의 서열 전체를 검출하는 제제뿐 아니라, 그 일부를 검출하여 마커의 존재를 확인할 수 있는 제제를 의미한다. 본 출원에서, 상기 검출할 수 있는 제제는, 이에 제한되는 것은 아니나, 본 출원의 마커를 증폭하고 검출할 수 있는 제제를 의미할 수 있고, 구체적으로는 프로브, 프라이머 쌍, 항체, 앱타머, 및 올리고뉴클레오티드로 이루어진 군에서 선택되는 어느 하나인 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서, "프라이머"는 검출하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 본 출원에서 프라이머는 PCR 반응을 통한 마커의 검출에 이용되기 위해 제작될 수 있으며, 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity)뿐만 아니라 온도 및 이온 강도와 같은 이용 조건에 따라 당업계에 알려진 방법으로 합성될 수 있다. 구체적으로, 상기 프라이머 쌍은 서열번호 13 및 14의 염기서열로 이루어진 프라이머 쌍일 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 "프로브"는 공지의 방법으로 특정 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화 될 수 있는 것이라면 본 출원의 범주에 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌 (예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다. 예를 들어, 상동성(homology) 또는 동일성(identity)이 높은 유전자끼리, 80% 이상, 85% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성 또는 동일성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1 X SSC, 0.1% SDS, 구체적으로는 60℃, 0.1 X SSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1 X SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치 (mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).
본 출원에서, "진단"은 Ganoderma 속 미생물에 의해 오염되어 뿌리 썩음병이 발병되었는지 여부를 판단하는 과정을 의미한다. 본 발명의 조성물을 이용하면 시료에 Ganoderma 속 미생물 특이적인 서열이 존재하는지 여부를 확인할 수 있다.
본 출원의 뿌리 썩음병 진단용 조성물은 Ganoderma 속 미생물이 갖는 특이적인 마커, 즉, 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편이 채취된 시료에 존재하는지 여부를 판별하여 시료가 Ganoderma 속 미생물에 의해 오염되었는지 여부, 또는 뿌리 썩음병에 걸렸는지를 진단할 수 있도록 하는 조성물일 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 상기 뿌리 썩음병은 오일팜나무에서 Ganoderma 속 미생물에 의해 발병하는 것일 수 있고, 상기 뿌리 썩음병이 발병하는 식물체는 Elaeis guineensis, Elaeis oleifera, Attalea maripa 등일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서, "Ganoderma 속 미생물"은 진균류(fungi)에 속하는 미생물로서, 아시아에서는 전통적으로 의약품으로 사용되어 왔다. 본 출원에서는 상기 Ganoderma 속 미생물이 뿌리 썩음병의 원인균이라는 점에 착안하여, 상기 미생물을 특이적으로 검출할 수 있는 마커를 제공한다. 구체적으로, 상기 Ganoderma 속 미생물은 가노더마 알바(Ganoderma alba), 가노더마 아눌라리스(Ganoderma annularis), 가노더마 아트룸(Ganoderma atrum), 가노더마 오레아(Ganoderma aurea), 가노더마 오스트랄(Ganoderma austral), 가노더마 암보이넨스(Ganoderma amboinense), 가노더마 아플라나툼(Ganoderma applanatum), 가노더마 보니넨스(Ganoderma boninense), 가노더마 브라우니(Ganoderma brownie), 가노더마 콜로서스(Ganoderma colossus), 가노더마 큐프레움(Ganoderma cupreum), 가노더마 커티시(Ganoderma curtisii), 가노더마 포르모사눔(Ganoderma formosanum), 가노더마 인크라사툼(Ganoderma incrassatum), 가노더마 로바툼(Ganoderma lobatum), 가노더마 루시둠(Ganoderma lucidum), 가노더마 메레디티애(Ganoderma meredithiae), 가노더마 미니아토신툼(Ganoderma miniatocinctum), 가노더마 멀티피레움(Ganoderma multipileum), 가노더마 니그로루시덤(Ganoderma nigrolucidum), 가노더마 오르비포르메 (Ganoderma orbiforme), 가노더마 오레고넨스(Ganoderma oregonense), 가노더마 퍼푸레아(Ganoderma purpurea), 가노더마 페이페리(Ganoderma pfeifferi), 가노더마 필리피(Ganoderma philippii), 가노더마 수도페레움(Ganoderma pseudoferreum), 가노더마 레시나세움(Ganoderma resinaceum), 가노더마 루브라(Ganoderma rubra), 가노더마 시추아넨스(Ganoderma sichuanense), 가노더마 시넨스(Ganoderma sinense), 가노더마 스테야에르타눔(Ganoderma steyaertanum), 가노더마 토르나툼(Ganoderma tornatum), 가노더마 수개(Ganoderma tsugae), 가노더마 비리디스(Ganoderma viridis), 가노더마 베버리아눔(Ganoderma weberianum), 및 가노더마 조나툼(Ganoderma zonatum)으로 이루어진 군에서 선택되는 것일 수 있으나, 이에 제한되지 않는다.
본 출원의 다른 하나의 양태는 뿌리 썩음병 진단용 키트를 제공한다.
하나의 구체예에서, 상기 조성물을 포함하는 뿌리 썩음병 진단용 키트를 제공한다. 구체적으로, 상기 키트는 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 검출 할 수 있는 제제를 포함할 수 있으며, 본 출원의 뿌리 썩음병 진단용 키트는 현장에서 채취한 토양 시료에 Ganoderma 속 미생물이 존재하는지 여부를 확인하는 데 이용될 수 있다.
구체적으로, 상기 키트는 RT-PCR 키트, 면역 스트립, DNA 칩 키트, 단백질 칩 키트, 래피드(rapid) 키트 또는 MRM(Multiple reaction monitoring) 키트, 및 ELISA 진단 키트로 이루어진 군으로부터 선택되는 것일 수 있으나, Ganoderma 속 미생물이 존재하는지 여부를 확인할 수 있다면 그 작동 원리나 형태에 제한되지 않는다.
또한, 본 출원의 키트는 뿌리 썩음병 진단을 위해 적합한 한 종류 또는 그 이상의 다른 구성성분 조성물, 용액 또는 장치를 포함할 수 있으나, 이에 제한되지 않는다. 상기 다른 구성 성분의 일 예로, 적합한 담체, 검출 가능한 신호를 생성할 수 있는 표지 물질, 발색단(chromophores), 용해제, 세정제, 완충제, 안정화제 등이 포함되나 이에 제한되지 않는다. 표지물질이 효소인 경우에는 효소 활성을 측정할 수 있는 기질 및 반응 정지제를 포함할 수 있다. 담체는 가용성 담체, 불용성 담체가 있고, 가용성 담체의 일 예로 당 분야에서 공지된 생리학적으로 허용되는 완충액, 예를 들어 PBS가 있고, 불용성 담체의 일 예로 폴리스틸렌, 폴리에틸렌, 폴리프로필렌, 폴리에스테르, 폴리아크릴로니트릴, 불소 수지, 가교 덱스트란, 폴리사카라이드, 라텍스에 금속을 도금한 자성 미립자와 같은 고분자, 기타 종이, 유리, 금속, 아가로오스 및 이들의 조합일 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 키트는 마커의 검출을 위한 프라이머 쌍, 및 검출 반응을 수행하기 위한 시약을 포함할 수 있으나, 이에 제한되지 않는다. 또한, 본 출원의 키트는 마커 검출을 위해 수행되는 증폭 반응에 필요한 시약을 추가로 포함할 수 있고, 상기 증폭 반응을 수행하기 위한 시약은 DNA 폴리머라제, dNTPs 및 버퍼 등을 포함할 수 있고, 또한, 실시간 PCR 반응 수행 및 분석을 위해 필요한 시약을 추가로 포함할 수 있다.
또한, 본 출원의 키트는 최적의 반응 수행 조건을 기재한 사용자 안내서를 추가로 포함할 수 있다. 안내서는 키트 사용법, 예를 들면, PCR 버퍼 제조 방법, 제시되는 반응 조건 등을 설명하는 인쇄물이다. 안내서는 팜플렛 또는 전단지 형태의 안내 책자, 키트에 부착된 라벨 및 키트를 포함하는 패키지의 표면상에 설명을 포함한다. 또한, 안내서는 인터넷과 같이 전기 매체를 통해 공개되거나 제공되는 정보를 포함한다.
본 출원의 또 다른 하나의 양태는 뿌리 썩음병 진단용 칩을 제공한다.
하나의 구체예에서, 상기 조성물을 포함하는 뿌리 썩음병 진단용 칩을 제공한다. 상기 칩은 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 검출 할 수 있는 제제를 포함할 수 있으며, 구체적으로, 상기 칩은 DNA 칩, 또는 단백질 칩일 수 있다.
상기 DNA 칩은 Ganoderma 속 미생물을 검출하기 위한 마커 유전자 또는 그의 단편에 해당하는 cDNA 또는 올리고뉴클레오티드(oligonucleotide)가 부착되어 있는 기판을 포함하는 것일 수 있고, 형광표식 프로브를 제작하기 위한 시약, 제제, 효소 등을 추가적으로 포함할 수 있다. 또한, 상기 기판은 대조군 유전자 또는 그의 단편에 해당하는 cDNA 또는 올리고뉴클레오티드를 포함할 수 있으나, 이에 제한되지 않는다.
상기 단백질 칩은 본 출원의 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 특이적으로 인식하는 항체를 포함하는 것일 수 있으나, 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 뿌리 썩음병 진단 방법을 제공한다.
하나의 구체예에서, 채취된 시료에서 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 검출하는 단계를 포함하는, 뿌리 썩음병 진단 방법을 제공한다. 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자는 서열번호 2 내지 9 중 어느 하나의 염기서열을 포함하는 것일 수 있고, 상기 단편은 서열번호 10 내지 12 중 어느 하나의 염기서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다.
상기 시료는 Ganoderma 속 미생물에 의한 오염을 판단할 수 있는 한, 제한없이 이용될 수 있으나, 토양, 식물체 등이 될 수 있고, 토양 시료의 경우, 시료의 채취 깊이, 채취 방법 등은 제한되지 않는다.
또한, 상기 검출은 역전사효소 중합효소반응(RT-PCR), 경쟁적 역전사효소 중합효소반응(competitive RT-PCR), 실시간 중합효소반응(real time RT-PCR), 실시간 역전사효소 중합효소반응(real time quantitative RT-PCR), RNase 보호 분석법(RNase protection method), 노던 블랏팅(Northern blotting), 유전자 칩, 및 이들의 조합으로 이루어진 군에서 선택된 방법으로 수행될 수 있으나, 이에 제한되지 않는다.
본 출원의 진단 방법의 한 예로서,
(a) 시료를 채취하는 단계;
(b) 시료에서 게놈 DNA를 분리하는 단계; 및
(c) 상기 분리된 게놈 DNA를 주형으로 하여, 본 출원의 마커를 검출하기 위한 프라이머 세트를 이용하는 실시간 PCR을 수행하여 마커를 검출하는 단계를 포함하는 것일 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 진단 방법은, (d) 대조군 시료에서 본 출원의 마커를 검출하는 단계를 추가로 포함하거나, 또는, (e) 상기 대조군 시료에서 검출된 본 출원의 마커와 (c) 단계에서 확인된 시료 내 마커의 검출 결과와 비교하는 단계를 추가로 포함하는 것일 수 있으나, 이에 제한되지 않는다. 본 출원의 마커 검출 방법은 마커를 증폭한 후 증폭된 마커를 검출하는 것일 수 있으나, 당업계에 알려진 마커 검출 방법이라면 특정 방법에 제한되지 않는다. 상기 검출 결과는 증폭된 유전자 또는 이의 단편의 양일 수 있으나, 이에 제한되지 않는다. 상기 대조군 시료는 Ganoderma 속 미생물이 존재하지 않는 시료, 또는 뿌리 썩음병이 발병하지 않은 시료 등이 될 수 있으나, 이에 제한되지 않는다.
더 나아가, 본 출원의 진단 방법은 (f) 대조군 시료와 시료 내 증폭된 유전자 또는 그의 단편의 양을 비교하여, Ganoderma 속 미생물이 특이적으로 갖는 유전자 또는 그의 단편의 양이 증가할 경우, 뿌리 썩음병에 걸린 것으로 진단하는 단계를 추가로 포함할 수 있으나, 이에 제한되지 않는다.
본 출원에서, 시료 또는 시료 내 포함된 미생물에서 게놈 DNA를 분리하는 방법은 당업계에 공지된 방법을 이용할 수 있으며, 예를 들면, CTAB 방법을 이용할 수도 있고, wizard prep 키트 (Promega)를 이용할 수도 있다. 상기 분리된 게놈 DNA를 주형으로 하고, 프라이머를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭할 수 있다. 표적 핵산을 증폭하는 방법은 중합효소연쇄반응 (PCR), 리가아제 연쇄반응 (ligase chain reaction), 핵산 서열 기재 증폭 (nucleic acid sequence-based amplification), 전사 기재 증폭 시스템 (transcription-based amplification system), 가닥 치환 증폭 (strand displacement amplification) 또는 Qβ 복제효소 (replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 임의의 기타 적당한 방법이 있다. 이 중에서, PCR이란 중합효소를 이용하여 표적 핵산에 특이적으로 결합하는 프라이머 쌍으로부터 표적 핵산을 증폭하는 방법이다. 이러한 PCR 방법은 당업계에 잘 알려져 있으며, 상업적으로 이용가능한 키트를 이용할 수도 있다.
실시간 PCR은 각 PCR을 지수함수적으로 증가하는 범위 내에서 비교하기 위해 매 시기의 PCR 진행 상황을 실시간으로 모니터링하는 방법이다. DNA 정량기법인 실시간 PCR 방법은 열순환기 (thermal cycler)와 분광 형광광도계가 일체화된 장치를 이용하여 실시간으로 PCR 증폭 산물의 생성 과정을 관찰함으로써 최초의 시료에 존재하는 표적 DNA 양을 정량하는 방법이다. 실시간 PCR은 미생물 배양에 기초할 수밖에 없었던 기존의 미생물 정성 및 정량 방법을 대체하여 미생물의 분리 및 배양을 수행하지 않고서도 미생물의 정성 및 정량을 가능하게 한다.
실시간 PCR 방법은 절대 정량 (absolute quantification)과 상대 정량 (relative quantification) 분석으로 구분되는데, 시료 내의 표적 DNA를 정량하기 위해서는 표준시료의 검량선 (표준곡선; standard curve) 작성이 필수적인 요소이다. 표준시료와 미지시료를 대상으로 동시에 정량적 실시간 PCR을 실시하여 표준시료로부터 검량선을 도출한 후, 이 검량선으로부터 미지시료 내 표적 DNA의 양을 정량한다. 이때 표준시료로부터의 검량선 (x축: 표준시료의 농도, y축: 역치 주기 수 (CT; threshold cycle))은 상관지수 (R2)가 1에 가까울수록, 기울기가 -3.33에 가까울수록 이상적이다. "정량적 PCR"이란 증폭반응 개시 시의 주형 DNA 양을 정량하기 위한 PCR로서, 반응 중 임의의 시점에서 증폭대상의 분자에 대해 증폭을 확인할 수 있는 PCR을 의미한다. 정량을 위해서는 일반적으로 그와 같은 PCR과 반응 개시 시의 주형 DNA 분자 수와 그 증폭의 지표가 되는 신호를 관련짓는 검량선이 조합된다. 이 검량선은 분자 수가 알려진 표준시료를 이용하여 제작할 수 있다. 상기 검량선은 정량하고자 하는 Ganoderma 속 미생물의 유전자 또는 마커를 표준시료로 하고, 이를 특이적으로 증폭하기 위한 프라이머를 이용하여 정량적 실시간 PCR을 수행함으로써, 표준시료의 증폭으로부터 작성된 검량선을 기준으로 시료 내 존재하는 표적 유전자 또는 마커의 역치 주기 수 (CT)를 확인하는 것일 수 있다.
또한, 상기 증폭된 표적 서열은 검출가능한 표지 물질로 표지될 수 있다. 상기 표지 물질은 바람직하게는 형광을 발하는 물질일 수 있으나, 이에 제한되지 않는다. 현재 실시간 PCR에 사용되는 검출 방법 (detection chemistry)은 일반적으로 Sybr Green I을 이용하는 비특이적 방법과 혼성화 프로브 (hybridization probe)를 이용하는 특이적 방법으로 나뉜다. Sybr Green I은 이중나선 DNA에 비특이적으로 결합하여 형광을 방출하며 실시간 PCR 기기는 이 형광의 양을 측정하여 DNA의 양을 확인할 수 있다. 혼성화 프로브는 특이적으로 상보적인 염기서열에 혼성화되어 PCR 반응 중에 형광을 방출한다. 예를 들어, 대표적인 혼성화 프로브로서 택맨 프로브 (taqman probe, dual labeled fluorogenic probe)는 5'-말단에는 형광 리포터가, 3'-말단에는 소광제 (quencher)가 결합되어 있다. 택맨 프로브의 형광 리포터는 소광제와 근접하여 존재하는 경우, 형광이 상쇄되어 검출되지 않는다. 택맨 프로브가 특이적 표적 염기서열에 혼성화되어 PCR 증폭이 진행되면 Taq DNA 폴리머라제의 5'-3' 엑소뉴클레아제 (exonuclease) 활성에 의해 택맨 프로브가 분해되면서 형광 리포터가 자유롭게 방출되고, 그로 인해 소광제와 멀어지면서 형광을 발산하게 된다. 이를 측정하여 실시간으로 표적 DNA 조각의 생성량을 모니터링하는 것이다.
구체적으로, 본 출원의 방법에서 이용하는 프라이머 쌍은 서열번호 13 및 14의 염기서열로 이루어진 프라이머 쌍일 수 있고, 본 출원의 방법의 유전자 또는 이의 단편을 검출하는 단계는 서열번호 13 및 14의 염기서열로 이루어진 프라이머 쌍을 이용한 PCR(Polymerase chain reaction)을 통해 수행되는 것일 수 있으나, 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 Ganoderma 속 미생물 검출용 조성물을 제공한다.
하나의 구체예에서, 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 검출할 수 있는 제제를 포함하는, Ganoderma 속 미생물 검출용 조성물을 제공한다.
본 출원의 Ganoderma 속 미생물 검출용 조성물은 시료(예를 들어, 토양)가 Ganoderma 속 미생물에 의해 오염되었는지 여부를 판별하는 데 이용될 수 있으며, 구체적으로는 본 출원의 마커를 검출하는데 이용될 수 있다.
본 출원의 또 다른 하나의 양태는 Ganoderma 속 미생물 검출 방법을 제공한다.
하나의 구체예에서, 채취된 시료에서 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 검출하는 단계를 포함하는, Ganoderma 속 미생물 검출 방법을 제공한다.
본 출원의 Ganoderma 속 미생물 검출 방법은 본 출원의 마커, 또는 조성물을 이용하여 시료 내 Ganoderma 속 미생물이 존재하는지 여부를 검출하는 것일 수 있으나, 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 뿌리 썩음병 진단 용도를 제공한다.
하나의 구체예에서, (i) 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편의 뿌리 썩음병 진단 용도; 또는 (ii) 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 검출할 수 있는 제제의 뿌리 썩음병 진단 용도를 제공한다.
본 출원의 또 다른 하나의 양태는 Ganoderma 속 미생물 검출 용도를 제공한다.
하나의 구체예에서, (i) 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편의 Ganoderma 속 미생물 검출 용도; 또는 (ii) 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 검출할 수 있는 제제의 Ganoderma 속 미생물 검출 용도를 제공한다.
이하, 본 출원을 실시예를 들어 상세히 설명하고자 하나, 이는 본 출원의 이해를 돕기 위한 것일 뿐, 본 출원의 범위가 이에 한정되는 것은 아니다.
실시예 1: Ganoderma 균의 서열 추출 및 특이적 마커 발굴
본 발명자들은 뿌리 썩음병의 주원인으로 알려져 있는 Ganoderma 속 미생물을 특이적으로 검출할 수 있는 마커를 발굴하고자 하였다.
이에, Ganoderma 속 미생물 중, Ganoderma boninense G3(GCA_002900995.2), Ganoderma boninense NJ3(GCA_001855635.1), Ganoderma lucidum BCRC(GCA_000338035.1), Ganoderma Tsugae(GCA_003057275.1), Ganoderma lucidum Xiangnong(GCA_000262775.1), Ganoderma lucidum G260125 (GCA_000271565.1), Ganoderma sinense(GCA_002760635.1) 미생물은 공지된 NCBI 사이트에서 DNA 서열을 확보하였으며, Ganoderma boninense은 직접 미생물의 DNA 서열을 확보하여, 확보된 서열로부터 Ganoderma 속 미생물을 검출하기 위한 특이적 마커를 발굴 및 개발하였다.
구체적으로, NGS (Next Generation Sequencing) 시퀀싱을 통해 본 발명자들이 확보한 Ganoderma boninense 균주의 DNA 서열(2,544contig, 95,911,849bp), NCBI(https://www.ncbi.nlm.nih.gov/)의 nt database (2018년 5월기준, 178,448,606,127bp)에 공지된 Ganoderma 속 미생물의 DNA 서열, 및 Ganoderma 속이 아닌 fungi 균주의 DNA 서열(2,391개 strain, 80,288,864,015bp) 정보를 확보하였다.
이후, 본 발명자들이 확보한 토양 샘플 중, metagenome 분석 결과 Ganoderma 속 미생물이 존재하지 않는 것으로 확인된 토양의 gDNA서열을 NGS를 통해 확보하였다(7,724,586,454bp).
이후, Ganoderma 속 미생물, Ganoderma 속에 속하지 않는 미생물과 말레이시아 토양 DNA에서 확보한 미생물 서열 중 Ganoderma 속 미생물 특이적인 마커를 발굴하였다(표 1).
| 서열번호 | 미생물 | Identity |
| 1 | CJ Ganoderma boninense | - |
| 2 | Ganoderma boninense G3 | 94% |
| 3 | Ganoderma boninense NJ3 | 98% |
| 4 | Ganoderma lucidum BCRC | 83% |
| 5 | Ganoderma Tsugae | 83% |
| 6 | 84% | |
| 7 | Ganoderma lucidum Xiangnong | 83% |
| 8 | Ganoderma lucidum G260125 | 84% |
| 9 | Ganoderma sinense | 89% |
상기 서열번호 2 내지 9의 염기서열로 표현되는 Ganoderma 속 미생물 특이적 마커는 서열번호 1의 마커 서열과 최소 83%의 동일성(identity)을 갖는 것을 확인하였다.
실시예 2: Ganoderma 균 특이적 마커를 이용한 뿌리 썩음병의 진단
상기 실시예 1에서 확보한 마커를 이용하여 토양에서 직접 Ganoderma 속 미생물을 검출할 수 있는지 확인하였다.
이를 위해, 본 출원의 서열번호 1 내지 9의 마커를 검출하기 위한 프라이머를 제작하였으며, 상기 프라이머가 결합하는 Ganoderma 속 미생물 특이적 서열 내 영역은 다음의 표 2와 같다
| 서열번호 | 미생물 |
| 10 | Ganoderma boninense G3 |
| 11 | Ganoderma boninense NJ3 |
| 12 | CJ Ganoderma boninense |
상기 서열번호 10 내지 12의 일부 영역을 검출하기 위한 프라이머 정보는 다음의 표 3과 같다.
| 서열번호 | 서열 | |
| 13 | Forward | GCGCTCCATGACTACGCTAT |
| 14 | Reverse | CCAGTCGATCGAATAGTAGTTGG |
상기 서열번호 13 및 14의 염기서열로 이루어진 프라이머 쌍을 이용하여, 토양에서 Ganoderma 균에 의한 감염 여부를 진단할 수 있는지 확인하였다.
구체적으로, 말레이시아에서 채취한 Ganoderma boninense에 오염된 토양 샘플(도 1의 레인 6 및 7)에서 얻어진 토양 DNA 300~500ng 또는 genomic DNA (G.boninense 또는 Ganoderma 속 미생물이 아닌 다른 fungi) 1~20ng을 AccuPowr® PriFi Taq PCR PreMix 튜브에 넣고, 10 pmol/uL의 서열번호 13 및 14의 프라이머를 1uL 첨가하였다. 이후, 증류수를 넣어 전체 volume이 20uL이 되도록 하고, Blue pellet을 잘 녹인 다음에 spin down하였다. 이후, Thermocycler에 setting한후 다음과 같은 조건에서 PCR을 진행하였다.
95℃에서 5분후 95℃에서 20초, 60℃에서 30초, 68℃에서 1분간 30~50cycle을 돌린다. 이후 68℃에서 5분간 두었다.
| 온도 | 시간 | Cycles |
| 95°C | 5분 | 1cylces |
| 95°C | 20초 | 30~50cylces |
| 60°C | 30초 | |
| 68°C | 1분 | |
| 68°C | 5분 | 1cylces |
PCR 반응이 끝난 후, 4℃에서 유지시키고, 1% agrose gel에 20uL를 모두 로딩하여 전기영동으로 PCR 산물을 분석하였다. 얻어진 PCR 산물로부터 Ganoderma 속 미생물의 존재 여부를 확인하고, PCR 산물의 밴드 강도 (band intensity)로부터 상기 Ganoderma 균에 의한 토양의 오염정도를 확인하였다 (도 1).
도 1의 각 레인이 나타내는 바는 다음과 같다. 레인 1은 DNA ladder를, 레인 2는 Ganoderma boninense Genomic DNA를 이용한 PCR 산물; 레인 3은 베르칸데라 미생물(Bjerkandera sp.) Genomic DNA를 이용한 PCR 산물; 레인 4는 퓨자리움 미생물(Fusarium sp.) Genomic DNA를 이용한 PCR 산물; 레인 5는 트리코더마 미생물(Trichoderma sp.) Genomic DNA를 이용한 PCR 산물; 레인 6은 뿌리썩음병이 발생한 토양 DNA를 이용한 PCR 산물; 레인 7은 뿌리썩음병이 발생한 토양 DNA를 이용한 PCR 산물; 레인 8은 물만 넣고 진행한 PCR 산물(negative control)을 나타낸다.
도 1의 결과로부터, 본 출원의 마커를 이용하여 Ganoderma 균에 의한 뿌리썩음병을 검출할 수 있음을 확인하였다.
상술한 실시예로부터, 본 발명자들은 Ganoderma 속 미생물이 특이적으로 갖는 신규 마커를 발굴하였을 뿐만 아니라, 토양에서 Ganoderma 균에 의한 뿌리 썩음병 감염 여부를 진단할 수 있음을 확인하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Claims (19)
- 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 검출할 수 있는 제제를 포함하는, 뿌리 썩음병 진단용 조성물.
- 제1항에 있어서, 상기 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편은 Ganoderma 속 미생물이 특이적으로 갖는 것인, 조성물.
- 제1항에 있어서, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자는 서열번호 2 내지 9 중 어느 하나의 염기서열을 포함하는 것인, 조성물.
- 제1항에 있어서, 상기 제제는 프로브, 프라이머 쌍, 항체, 앱타머, 및 올리고뉴클레오티드로 이루어진 군에서 선택되는 어느 하나인 것인, 조성물.
- 제1항에 있어서, 상기 단편은 서열번호 10 내지 12 중 어느 하나의 염기서열을 포함하는 것인, 조성물.
- 제4항에 있어서, 상기 프라이머 쌍은 서열번호 13 및 14의 염기서열로 이루어진 프라이머 쌍인 것인, 조성물.
- 제1항에 있어서, 상기 뿌리 썩음병은 Ganoderma 속 미생물에 의해 발병하는 것인, 조성물.
- 제7항에 있어서, 상기 Ganoderma 속 미생물은 Ganoderma alba, Ganoderma annularis, Ganoderma atrum, Ganoderma aurea, Ganoderma austral, Ganoderma amboinense, Ganoderma applanatum, Ganoderma boninense, Ganoderma brownie, Ganoderma colossus, Ganoderma cupreum, Ganoderma curtisii, Ganoderma formosanum, Ganoderma incrassatum, Ganoderma lobatum, Ganoderma lucidum, Ganoderma meredithiae, Ganoderma miniatocinctum, Ganoderma multipileum, Ganoderma nigrolucidum, Ganoderma orbiforme, Ganoderma oregonense, Ganoderma purpurea, Ganoderma pfeifferi, Ganoderma philippii, Ganoderma pseudoferreum, Ganoderma resinaceum, Ganoderma rubra, Ganoderma sichuanense, Ganoderma sinense, Ganoderma steyaertanum, Ganoderma tornatum, Ganoderma tsugae, Ganoderma viridis, Ganoderma weberianum, 및 Ganoderma zonatum으로 이루어진 군에서 선택되는 것인, 조성물.
- 제1항 내지 제8항 중 어느 한 항의 조성물을 포함하는 뿌리 썩음병 진단용 키트.
- 제1항 내지 제8항 중 어느 한 항의 조성물을 포함하는 뿌리 썩음병 진단용 칩.
- 채취된 시료에서 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 검출하는 단계를 포함하는, 뿌리 썩음병 진단 방법.
- 제11항에 있어서, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자는 서열번호 2 내지 9 중 어느 하나의 염기서열을 포함하는 것인, 방법.
- 제11항에 있어서, 상기 단편은 서열번호 10 내지 12 중 어느 하나의 염기서열을 포함하는 것인, 방법.
- 제11항에 있어서, 상기 유전자 또는 이의 단편을 검출하는 단계는 서열번호 13 및 14의 염기서열로 이루어진 프라이머 쌍을 이용한 PCR(Polymerase chain reaction)을 통해 수행되는 것인, 방법.
- 제11항에 있어서, 상기 방법은 대조군 시료와 채취된 시료에서 증폭된 유전자 또는 이의 단편의 양을 비교하는 단계를 추가로 포함하는 것인, 방법.
- 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 검출할 수 있는 제제를 포함하는, Ganoderma 속 미생물 검출용 조성물.
- 채취된 시료에서 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편을 검출하는 단계를 포함하는, Ganoderma 속 미생물 검출 방법.
- 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편의 뿌리 썩음병 진단 용도.
- 서열번호 1의 염기서열로 표현되는 유전자, 상기 서열번호 1의 염기서열과 최소 80% 이상의 상동성을 갖는 유전자, 또는 이의 단편의 Ganoderma 속 미생물 검출 용도.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020190020030A KR102147351B1 (ko) | 2019-02-20 | 2019-02-20 | Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법 |
| KR10-2019-0020030 | 2019-02-20 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020171595A1 true WO2020171595A1 (ko) | 2020-08-27 |
Family
ID=72143892
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2020/002412 Ceased WO2020171595A1 (ko) | 2019-02-20 | 2020-02-19 | 가노더마 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR102147351B1 (ko) |
| WO (1) | WO2020171595A1 (ko) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100255124A1 (en) * | 2009-04-03 | 2010-10-07 | Synthetic Genomics, Inc. | Compositions of volatile organic compounds and methods of use thereof |
-
2019
- 2019-02-20 KR KR1020190020030A patent/KR102147351B1/ko active Active
-
2020
- 2020-02-19 WO PCT/KR2020/002412 patent/WO2020171595A1/ko not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100255124A1 (en) * | 2009-04-03 | 2010-10-07 | Synthetic Genomics, Inc. | Compositions of volatile organic compounds and methods of use thereof |
Non-Patent Citations (4)
| Title |
|---|
| DATABASE Nucleotide 21 December 2016 (2016-12-21), ZHANG, D.H., LI,N., YU,X., ZHAO,P., LI,T. AND XU,J.W.: "Ganoderma lucidum strain CGMCC 5.616 lanosterol synthase gene, complete cds", XP055732423, retrieved from NCBI Database accession no. KX452685.1 * |
| DATABASE Nucleotide 28 October 2016 (2016-10-28), DURAND-GASSELIN,T., LAYBATS,A., CARASCO-LACOMBE,C., TAN,J.S. SHAHRUL RABIAH SYED ALWEE,S.: "Ganoderma boninense strain NJ3 contig8657, whole genome shotgun sequence", XP055732422, retrieved from NCBI Database accession no. LFMK01017874.1 * |
| KARTHIKEYAN , M. , KRISHNAN RADHIKA , RAMANUJAM BHASKARAN , SUBRAMANIAN MATHIYAZHAGAN, RAMASAMY SAMIYAPPAN AND RETHINASAMY VELAZHA: "Rapid Detection of Ganoderma Disease of Coconut and Assessment of Inhibition Effect of Various Control Measures by Immunoassay and PCR", PLANT PROTECT. SCI., vol. 42, no. 2, 2006, pages 49 - 57, XP055732427 * |
| UTOMO, C. ET AL.: "Identification of Ganoderma, the causal agent of basal stem rot disease ir oil palm using a molecular method", MYCOPATHOLOGIA, vol. 159, 2005, pages 159 - 170, XP019259844 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR102147351B1 (ko) | 2020-08-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR20020008190A (ko) | 마이크로어레이에 기준한 삭감식 혼성화 | |
| WO2011025262A2 (ko) | 결핵균군 및 마이코박테리아 속 구분 검출용 조성물 및 이를 이용한 실시간 다중 중합효소 연쇄반응에 의한 결핵균 및 마이코박테리아 속의 동시 분석 방법 | |
| CN114134218B (zh) | 一种基于CRISPR-Cas12a的荧光检测方法 | |
| WO2023085783A1 (ko) | 결핵균 검출 및 약물 내성 확인을 위한 유전자 증폭용 조성물 및 이의 용도 | |
| WO2021075912A1 (ko) | 결핵균 및 비결핵항산균을 동시에 감별하여 검출할 수 있는 고감도 다중 등온증폭반응용 프라이머 세트 | |
| WO2021141178A1 (ko) | 뎅기 바이러스의 4종류 혈청형 동시 전장유전체 염기서열 분석용 프라이머 세트 및 이를 이용한 cDNA 합성 방법 | |
| WO2020171604A1 (ko) | Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법 | |
| WO2020171596A1 (ko) | 가노더마 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법 | |
| WO2020171598A1 (ko) | Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법 | |
| WO2021141179A1 (ko) | 뎅기 바이러스의 4종류 혈청형 동시 검출용 올리고뉴클레오티드 및 플라스미드와 이를 이용한 뎅기 바이러스 혈청형 분석 방법 | |
| WO2020171595A1 (ko) | 가노더마 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법 | |
| WO2020171603A1 (ko) | Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법 | |
| WO2021256706A1 (ko) | Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법 | |
| EP2421969B1 (en) | Selective detection of bordetella species | |
| KR20160126654A (ko) | 플란타인 모틀 바이러스 진단 또는 검출용 프라이머 세트 및 이의 용도 | |
| WO2012002598A1 (ko) | 결핵 진단용 프라이머, 프로브, 이를 포함하는 키트 및 상기 키트를 이용한 결핵 진단 방법 | |
| WO2011142646A2 (ko) | 인유두종바이러스 검출 및 유전형 확인 방법 | |
| WO2011132872A9 (ko) | 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트 | |
| KR101967735B1 (ko) | 제한효소 절편길이 다형성을 이용한 종특이적 김 붉은갯병균 결정방법 | |
| WO2011002237A2 (ko) | 우점종 제거 기술에 기반한 희소 미생물 또는 신규 미생물의 단일 세포 유래 게놈 라이브러리의 제조방법 | |
| WO2024232476A1 (ko) | Crispr-cas 기반의 노로바이러스 gii.4 특이적 검출이 가능한 신규 가이드 rna 및 이의 활용 | |
| WO2026005316A1 (ko) | 원심분리를 이용하지 않는 종이 기반의 핵산 추출(pine-cx) 방법 및 이를 이용하는 시료 내 핵산 검출 방법 | |
| WO2024232477A1 (ko) | Crispr-cas 기반의 노로바이러스 gii.3 특이적 검출이 가능한 신규 가이드 rna 및 이의 활용 | |
| WO2023140596A1 (ko) | 전장유전체 증폭을 위한 치쿤군야 바이러스 범용 프라이머 세트 및 이를 이용한 진단 키트 | |
| Duduk | End-Point PCR for Universal Detection of Phytoplasmas Based on the 16S rRNA Gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20758490 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 20758490 Country of ref document: EP Kind code of ref document: A1 |