WO2020163747A1 - Rnai agents for hepatitis b virus infection - Google Patents
Rnai agents for hepatitis b virus infection Download PDFInfo
- Publication number
- WO2020163747A1 WO2020163747A1 PCT/US2020/017264 US2020017264W WO2020163747A1 WO 2020163747 A1 WO2020163747 A1 WO 2020163747A1 US 2020017264 W US2020017264 W US 2020017264W WO 2020163747 A1 WO2020163747 A1 WO 2020163747A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- sequence
- administered
- hbv
- amount
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
- A61K31/52—Purines, e.g. adenine
- A61K31/522—Purines, e.g. adenine having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/66—Phosphorus compounds
- A61K31/675—Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
- A61K9/0021—Intradermal administration, e.g. through microneedle arrays or needleless injectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/312—Phosphonates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/317—Chemical structure of the backbone with an inverted bond, e.g. a cap structure
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/343—Spatial arrangement of the modifications having patterns, e.g. ==--==--==--
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/345—Spatial arrangement of the modifications having at least two different backbone modifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3521—Methyl
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
- C12N2310/3533—Halogen
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/31—Combination therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/35—Special therapeutic applications based on a specific dosage / administration regimen
Definitions
- RNA interference (RNAi) agents for inhibition of Hepatitis B Virus gene expression, compositions that include HBV RNAi agents, and methods of use thereof. Methods of treating and/or preventing symptoms or diseases associated with an infection caused by Hepatitis B Virus in a subject in need thereof are also disclosed.
- the Hepatitis B Virus is a strict hepatotrophic, double-stranded DNA containing virus. Although DNA is the genetic material, the replication cycle involves a reverse transcription step to copy a pregenomic RNA into DNA. Hepatitis B Virus is classified as one member of the Hepadnaviruses and belongs to the family of Hepadnaviridae. The primary infection of adult humans with Hepatitis B Virus causes an acute hepatitis with symptoms of organ inflammation, fever, jaundice and increased liver transaminases in blood. Those patients that are not able to overcome the virus infection suffer a chronic disease progression over many years with increased risk of developing cirrhotic liver or liver cancer. Perinatal transmission from Hepatitis B Virus-infected mothers to newborns also leads to chronic hepatitis.
- cccDNA serves as a template for transcription of five major viral mRNAs, which are 3.5, 3.5, 2,4, 2.1 and 0.7 kb long. All mRNAs are 5 '-capped and polyadenylated at the 3 '-end. There is sequence overlap at the 3'- end between all five mRNAs.
- One 3.5 kb mRNA serves as template for core protein and polymerase production.
- the same transcript serves as a pre-genomic replication intermediate and allows the viral polymerase to initiate the reverse transcription into DNA.
- Core protein is needed for nucleocapsid formation.
- the other 3 5 kb mRNA encodes pre-core, the secretable e-antigen (HBeAg).
- HBeAg secretable e-antigen
- the 2.4 and 2.1 kb mRNAs carry the open reading frames (“ORF”) pre-Sl, pre-S2 and S for expression of viral large, medium and small surface antigen.
- ORF open reading frames
- the s-antigen is associated with infectious, complete particles.
- blood of infected patients also contain non-infectious particles derived from s-antigen alone, free of genomic DNA or polymerase. The function of these particles is not fully understood.
- the complete and lasting depletion of detectable s-antigen in blood is considered as a reliable indicator for Hepatitis B Virus clearance.
- the 0.7 kb mRNA encodes the X protein. This gene product is important for efficient transcription of viral genes and also acts as a transaetivator on host gene expression. The latter activity seems to be important for hepatocyte transformation during development of liver cancer.
- Hepatitis B Virus replication has been shown to suppress Hepatitis B Virus replication, sometimes to undetectable levels, with improvement of liver function and reduction of liver inflammation typically seen as the most important benefits.
- !amivudine, tenofovir, and/or entecavir has been shown to suppress Hepatitis B Virus replication, sometimes to undetectable levels, with improvement of liver function and reduction of liver inflammation typically seen as the most important benefits.
- only few patients achieve complete and lasting remission after the end of treatment.
- the Hepatitis B Vims develops dmg resistance with increasing duration of treatment. This is especially difficult for patients co-infected with Hepatitis B and Human Immunodeficiency Virus (HIV). Both viruses are susceptible to nucleoside analogue drugs and may co-develop resistance.
- a second treatment option is the administration of interferon-alpha.
- patients receive high doses of interferon-alpha over a period of 6 months.
- the Asian genotype B gives very poor response rates.
- Co-infection with Hepatitis D Virus (HDV) or Human Immunodeficiency Virus has been shown to render interferon-alpha therapy completely ineffective. Patients with strong liver damage and heavy fibrotic conditions are not qualified for interferon-alpha therapy.
- RNAi Hepatitis B Virus-specific RNA interference
- dsRNA double- stranded ribonucleic acid
- RNAi agent also herein termed RNAi agent, RNAi trigger, or trigger
- HBV Hepatitis B Vims
- Described herein are methods for treating and/or preventing symptoms or diseases associated with an HBV infection in a subject in need thereof (e.g., a human or animal subject).
- the method comprises administering one or more HBV gene-specific RNAi agents able to selectively and efficiently decrease expression of an HBV gene.
- the symptoms and diseases associated with an HBV infection include but are not limited to chronic liver diseases/disorders, inflammations, fibrotic conditions, proliferative disorders (including cancers, such as hepatocellular carcinoma), Hepatitis D Virus (HDV) infection, and acute HBV infection.
- the symptoms and diseases are associated with chronic HBV infection and/or HDV infection.
- compositions comprising one or more of the disclosed HBV RNAi agents that are able to selectively and efficiently decrease expression of an HBV gene.
- compositions for use in treating and/or preventing symptoms or diseases associated with an HBV infection in a human subject for example by administration of an effective amount of the pharmaceutical composition to the human subject.
- uses of the pharmaceutical compositions in the manufacture of a medicament for use in treating and/or preventing symptoms or diseases associated with an HBV infection in a human subject are also described herein.
- a method for treating or preventing a disease associated with an HBV infection in a subject comprising administering the pharmaceutical composition comprising one or more of the disclosed HBV RNAi agents.
- a pharmaceutical composition for use in treating or preventing a disease associated with an HBV' infection in a subject comprises one or more of the disclosed HBV RNAi agents.
- a method for treating a disease associated with an HBV infection in a subject comprising administering the pharmaceutical composition comprising one or more of the disclosed HBV RNAi agents.
- a pharmaceutical composition for use in treating a disease associated with an HBV infection in a subject comprises one or more of the disclosed HBV RNAi agents.
- a method for preventing a disease associated with an HBV infection in a subject comprising administering the pharmaceutical composition comprising one or more of the disclosed HBV RNAi agents.
- a pharmaceutical composition for use in preventing a disease associated with an HBV infection in a subject comprises one or more of the disclosed HBV RNAi agents.
- the one or more HBV RNAi agents are administered to the subject in an amount of about 25-400 mg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 100 mg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 35 mg, 50 rng, 200 rng, 300 rng or 400 mg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 40 mg per dose administration, about 100 mg per dose administration or about 200 mg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 40 mg per dose administration.
- the one or more HBV RNAi agents are administered in a combined amount of about 100 nig per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 200 mg per dose administration. In some embodiments, the one or more HBV RN Ai agents are administered in a combined amount of about 1-10 mg/kg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 1-5 mg/kg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in about 1-18 weeks intervals. In some embodiments, the one or more HBV RNAi agents are administered in about 1 month intervals (i.e., monthly dosing).
- the one or more HBV RNAi agents are administered in intervals of about once every four weeks. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 40 mg, about 100 mg or about 200 mg per dose administration in intervals of about once every four weeks. In some
- the one or more HBV RNAi agents are administered in about 7-day, 14-day, 21-day or 28-day intervals. In some embodiments, the one or more HBV RN Ai agents are administered in 28-day intervals or about 28-day intervals. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 40 mg, about 100 mg or about 200 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 40 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the one or more HBV RNAi agents are administered in a combined amount of about 100 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 200 mg per dose
- the methods inhibit expression of one or more Hepatitis B Vims genes.
- the methods inhibit expression of one or more HBV transcripts.
- the methods inhibit expression of most or all HBV transcripts.
- the method comprises administering one or more HBV RNAi agents described herein.
- the method comprises administering a pharmaceutical composition comprising one or more of the HBV RNAi agents described herein.
- the method comprises administering two HBV RNAi agents described herein.
- the method comprises administering a pharmaceutical composition comprising two HBV RNAi agents described herein.
- the method comprises contacting a cel!
- the method comprises contacting a cell infected with HBV with two HBV RNAi agents described herein.
- the one or more HBV RNAi agents are administered in a combined amount of about 25-400 mg per dose administration.
- the one or more HBV RNAi agents are administered in a combined amount of about 100 mg per dose administration.
- the one or more HBV RNAi agents are administered in a combined amount of about 35 mg, 50 mg, 200 mg, 300 mg or 400 mg per dose administration.
- the one or more HBV RNAi agents are administered in a combined amount of about 40 mg, about 100 mg or about 200 mg per dose
- the one or more HBV RNAi agents are administered in a combined amount of about 40 mg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 100 mg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 200 mg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 1-10 mg/kg per dose administration. In some embodiments, the one or more HBV RN Ai agents are administered in a combined amount of about 1-5 mg/kg per dose
- the one or more HBV RNAi agents are administered in about 1-18 week intervals. In some embodiments, the one or more HBV RNAi agents are administered in about 1 mouth intervals (i.e., monthly dosing) in some embodiments, the one or more HBV RNAi agents, such as a combined amount of about any one of 40, 100 or 200 mg per dose administration of the one or more HBV RNAi agents, are administered in intervals of about once every four weeks. In some embodiments, the one or more HBV RNAi agents are administered in about 7-day, 14-day, 21 -day or 28-day intervals. In some embodiments, the one or more HBV RNAi agents are administered in 28-day intervals or about 28-day intervals.
- the one or more HBV RNAi agents are administered in a combined amount of about 40 mg per dose administration, about 100 rng per dose administration or about 200 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W). in some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 40 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, the one or more HBV RNAi agents are administered in a combined amount of about 100 mg per dose
- the one or more HBV RNAi agents are administered in a combined amount of about 200 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W).
- Each HBV RNAi agent disclosed herein includes at least a sense strand and an antisense strand.
- the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other.
- the length of the RNAi agent sense and antisense strands described herein each can be 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length.
- the sense and antisense strands are independently 19 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are
- the sense and antisense strands can be either the same length or different lengths.
- the HBV RNAi agents disclosed herein have been designed to include antisense strand sequences that are at least partially complementary to a sequence in the HBV genome that is conserved across the majority of known serotypes of HBV.
- the RNAi agents described herein upon delivery to a cell expressing HBV, inhibit the expression of one or more HBV genes in vivo or in vitro.
- An HBV RNAi agent includes a sense strand (also referred to as a passenger strand) that includes a first sequence, and an antisense strand (also referred to as a guide strand) that includes a second sequence.
- a sense strand of the HBV RNAi agents described herein includes a core stretch having at least about 85% identity to a nucleotide sequence of at least 16 consecutive nucleotides in an HBV mRNA.
- the sense strand core nucleotide stretch having at least about 85% identity to a sequence in an HBV mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
- An antisense strand of an HBV RNAi agent comprises a nucleotide sequence having at least about 85% complementary over a core stretch of at least 16 consecutive nucleotides to a sequence in an HBV mRNA and the corresponding sense strand.
- the antisense strand core nucleotide sequence having at least about 85% complementarity to a sequence in an HBV mRNA or the corresponding sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
- HBV RNAi agent sense strands and antisense strands that can be used in HBV RNAi agents are provided in Tables 3 and 4.
- Examples of HBV RNAi agent duplexes are provided in Table 5.
- Examples of 19-nucleotide core stretch sequences that consist of or are included in the sense strands and antisense strands of HBV RNAi agents disclosed herein, are provided in Table 2.
- one or more HB V RNAi agents are delivered to target cells or tissues using any oligonucleotide deliver ⁇ ' technology known in the art.
- Nucleic acid deliver ' methods include, but are not limited to, by encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors or Dynamic Poly conjugates (DPCs) (see, for example WO 2000/053722, WO 2008/0022309, WO 201 1/104169, and WO 2012/083185, each of which is incorporated herein by reference).
- an HBV RNAi agent is delivered to target cells or tissues by covalently linking the RNAi agent to a targeting group.
- the targeting group can include a cell receptor ligand, such as an asialoglycoprotein receptor (ASGPr) ligand.
- ASGPr asialoglycoprotein receptor
- an ASGPr ligand includes or consists of a galactose derivative cluster.
- a galactose derivative cluster includes an N-aeety!- galactosamine trimer or an N-acetyl-galactosamine tetramer.
- a galactose derivative cluster is an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer.
- a targeting group can be linked to the 3' or 5' end of a sense strand or an antisense strand of an HBV RNAi agent. In some embodiments, a targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, a targeting group is linked to the 5' end of the sense strand. In some embodiments, a targeting group is linked to the RNAi agent via a linker.
- a targeting group, with or without a linker can be linked to the 5' or 3' end of any of the sense and/or antisense strands disclosed in Tables 2, 3, and 4.
- a linker, with or without a targeting group can be attached to the 5' or 3' end of any of the sense and/or antisense strands disclosed in Tables 2, 3, and 4.
- described herein are methods of treating or preventing an HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising administering a composition that comprises one or more HBV RNAi agents having the duplex sequences disclosed in Table 5.
- described herein are methods of treating or preventing an HBV-assoeiated disease in a subject comprising administering a composition that comprises one or more HBV RNAi agents having the duplex sequences disclosed in Table 5.
- described herein are methods of treating an HBV- associated disease in a subject comprising administering a composition that comprises one or more HBV RNAi agents having the duplex sequences disclosed in Table 5. [0028] In some embodiments, described herein are methods of preventing an HBV- associated disease in a subject comprising administering a composition that comprises one or more HBV RNAi agents having the duplex sequences disclosed in Table 5.
- the composition comprises a combination or cocktail of at least two HBV RNAi agents having different nucleotide sequences.
- the two or more different HBV RNAi agents are each separately and independently linked to targeting groups.
- the two or more different HBV RNAi agents are each linked to targeting groups comprised of N-acetyl-galactosamines.
- each of the RNAi agents is linked to the same targeting group.
- each of the RNAi agents is linked to different targeting groups, such as targeting groups having different chemical structures.
- targeting groups are linked to the HBV RNAi agents without the use of an additional linker.
- the targeting group is designed having a linker readily present to facilitate the linkage to an HBV RNAi agent.
- the two or more RNAi agents may be linked to the targeting groups using the same linkers.
- the two or more RNAi agents are linked to the targeting groups using different linkers.
- HBV mRNA is known to be polycistronic, resulting in the translation of multiple polypeptides, and separate mR As overlap in RNA sequence, therefore a single RNAi agent targeting an HBV gene may result in inhibition of most or all HBV transcripts.
- compositions that includes two or more HBV RNAi agents targeting different locations or regions of an HBV gene may provide for additional advantages over a composition that includes only a single HBV RNAi agent, such as (a) ensuring that all HBV viral transcripts are targeted (i.e., 3.5 kb pre-genomic RNA; 3.5 kb pre-core mRNA; 2.4 kb pre-Sl mRNA; 2, 1 kb pre-S2/S mRNA; 0.7 kb X mRNA; as well as any 8-antigen expressing mRN As produced from integrated HB V DNA); (b) serving to expand the genotype coverage to potentially address a larger patient population; and/or (c) potentially decreasing the viral resistance due to mutations in the si
- described herein are methods of treating or preventing an HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising administering a pharmaceutical composition that comprises a combination of at least two HBV RNAi agents having different sequences, wherein each HBV RNAi agent targets a different location or different region of an HBV gene.
- described herein are methods of treating or preventing an HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising administering a pharmaceutical composition that comprises a combination of at least two HBV RNAi agents, wherein each HBV RNAi agent is designed to target a different HBV transcript (for example, a composition that includes two HBV RNAi agents, wherein the first HBV RNAi agent includes an antisense strand that is at least partially
- an RNAi agent that includes an antisense strand at least partially complementary to a nucleotide sequence located in the S ORF targets a portion of the HBV genome of SEQ ID NO: 1 between positions 1-1307 and 3185-3221.
- an RNAi agent that includes an antisense strand at least partially complementary to a nucleotide sequence located in the X ORF targets a portion of the HBV genome of SEQ ID NO: 1 between positions 1308-1930.
- the symptoms and diseases are associated with chronic HBV infection and/or HDV infection.
- the subject has a diagnosis of HBeAg positive or FIBeAg negative chronic FIB V infection for at least 6 months.
- Described herein are methods of treating or preventing an HBV-associated disease in a subject, comprising administering a pharmaceutical composition that comprises a combination of at least two HBV RNAi agents having different sequences, wherein each HBV RNAi agent targets a different location or different region of an HBV gene.
- a pharmaceutical composition that compri ses a combination of at least two HBV RNAi agents, wherein each HBV RN Ai agent is designed to target a different HBV transcript (for example, a composition that includes two HBV RNAi agents, wherein the first HBV RNAi agent includes an antisense strand that s at least partially complementary to a nucleotide sequence located in the S ORF of an HBV gene, while the second HBV RNAi agent includes an antisense strand that is at least partially complementary' to a nucleotide sequence located in the X ORF of an HBV gene).
- Described herein are methods of treating an HBV- associated disease in a subject, comprising administering a pharmaceutical composition that comprises a combination of at. least two HBV RNAi agents having different sequences, wherein each HBV RNAi agent targets a different location or different region of an HBV gene.
- a pharmaceutical composition that comprises a combination of at least two HBV RNAi agents, wherein each HBV RNAi agent is designed to target a different HBV transcript (for example, a composition that includes two HB V RNAi agents, wherein the first HBV RNAi agent includes an antisense strand that is at least partially complementary to a nucleotide sequence located in the S QKF of an HBV gene, while the second HBV RNAi agent includes an antisense strand that is at least partially complementary to a nucleotide sequence located in the X ORF of an HBV gene).
- a pharmaceutical composition that comprises a combination of at least two HBV RNAi agents, wherein each HBV RNAi agent is designed to target a different HBV transcript (for example, a composition that includes two HB V RNAi agents, wherein the first HBV RNAi agent includes an antisense strand that is at least partially complementary to a nucleotide sequence located in the S QKF of an HBV gene, while the second H
- the at least two HBV RNAi agents are administered in a combined amount of about 25-400 nig per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 25-50 mg, 50- 75 mg, 75-100 mg, 100-125 mg, 125-150 mg, 150-175 mg, 175-200 mg, 200-225 mg, 225 250 mg, 250-275 mg, 275-300 mg, 300-325 mg, 325-350 mg, 350-375 mg, 375-400 mg, 25- 75 mg, 50-100 rag, 100-150 mg, 150-200 rag, 200-250 mg, 250-300 rag, 300-350 mg, 350- 400 mg, 25-100 mg, 50-150 mg, 100-200 mg, 150-250 mg, 200-300 mg, 300-400 mg, 25-200 mg, or 200-400 mg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 30-50 mg per dose
- the at least two HB V RNAi agents are administered in a combined amount of about 30-50 mg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 90-1 10 mg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 190-210 mg per dose administration.
- the at least two HBV RNAi agents are administered in a combined amount of about 25 mg, about 50 mg, about 100 mg, about 125 g, about 150 mg, about 175 g, about 200 mg, about 225 mg, about 250 mg, about 275 mg, about 300 mg, about 325 mg, about 350 g, about 375 mg, or about 400 mg per dose administration.
- the at least two HBV RNAi agents are administered in a combined amount of about 50 mg, about 75 mg, about 100 mg, or about 125 g per dose administration.
- the one or more HBV RNAi agents are administered in a combined amount of about 35 mg, 50 g, 100 g, 200 g, 300 mg or 400 mg per dose administration.
- the at least two HBV RNAi agents are administered in a combined amount of about 35 mg, 50 mg, 100 mg, 200 mg, 300 mg or 400 nig per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 40 g, about 100 mg, or about 200 mg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 40 mg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 100 mg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 200 g per dose administration.
- the at least two HB V RNAi agents are administered in about 7-day, about 14-day, about 21 -day or about 28-day intervals. In some embodiments, the at least two HBV RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 40 mg, about. 100 mg or about 200 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the at least two HBV RNAi agents are administered in a combined amount of about 40 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 100 mg per dose administration in 28-day intervals or about 28- day intervals (i .e., Q4W). In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 200 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the at least two HBV RNAi agents are administered in a combined amount of about 1-10 mg/kg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 1-5 mg/kg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about.
- the at least two HBV RNAi agents are administered in about 1-18 week intervals. In some embodiments, the at least two HBV RNAi agents are administered in about 1-week intervals, about 2-week intervals, about 3-week intervals, about 4-week intervals, about 5 -week intervals, about 6-week intervals, about 7- week intervals, about 8-week intervals, about 9-week intervals, about 10-week intervals, about 11-week intervals, about 12-week intervals, about 13-week intervals, about 14-week intervals, about 15-week intervals, about 16-week intervals, about 17-week intervals, or about 18-week intervals.
- the at least two HB V RNAi agents are administered in about 1-6 month intervals. In some embodiments, the at least two HBV RNAi agents are administered in about 1 -month intervals, about 2-month intervals, about 3 -month intervals, about 4-month intervals, about 5-month intervals, or about 6-month intervals. In some embodiments, the at least two HBV RNAi agents are administered in about 4-week intervals or 1 -month intervals. In some embodiments, the one or more HBV RNAi agents are administered in about 7-day, 14-day, 21 -day or 28-day intervals. In some embodiments, the one or more HBV RNAi agents are administered in 28-day intervals or about 28-day intervals.
- the at least two HBV RNAi agents are administered for a duration of about 1-12 months. In some embodiments, the at least two HBV RNAi agents are administered for a duration of at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 1 1 months or at least about 12 months. In some embodiments, the at least two HBV RNAi agents are administered for a duration of about 1-18 weeks. In some
- the at least two HBV RNAi agents are administered for a duration of at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at. least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks, at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about 18 weeks.
- the at least two HBV RNAi agents are administered for a duration of about 12 weeks or 3 months.
- a pharmaceutical composition that comprises a combination of one HBV RNAi agent that targets the S QRF of an HBV RNA (he., having an antisense strand that targets the S transcripts (S, pre-Sl, and pre-82), the pregenomic RNA (core and polymerase), and the pre-core transcripts (HBeAg) of an HBV genome), and one HBV RNAi agent that targets the X ORF of an HBV RNA (he., having an antisense strand that targets the X transcript of an HBV genome, the S transcripts (S, pre-Sl, and pre-S2), the pregenomic RNA (core and polymerase), and the pre-core transcripts (HBeAg) of an HBV genome).
- the pharmaceutical composition described herein comprises at least one HBV RNAi agent that contains a sequence that targets the S ORF of an HBV gene, and a second HBV RNAi agent that contains a sequence that targets the X ORF of an HBV gene.
- a pharmaceutical composition that comprises a combination of one HBV RNAi agent that targets the S ORF of an HBV RNA (i.e., having an antisense strand that targets the S transcripts (S, pre-Sl, and pre-82), the pregenomic RNA (core and polymerase), and the pre-core transcripts (HBeAg) of an HBV genome), and one HBV RNAi agent that targets the X ORF of an HBV RNA (i.e., having an antisense strand that targets the X transcript of an HBV genome, the S transcripts (S, pre-Sl, and pre-S2), the pregenomic RNA (core and polymerase), and the pre-core transcripts (HBeAg) of an HBV genome).
- one HBV RNAi agent that targets the S ORF of an HBV RNA i.e., having an antisense strand that targets the S transcripts (S, pre-Sl, and pre-82
- the pregenomic RNA core and
- the pharmaceutical composition described herein comprises at least one HBV RNAi agent that contains a sequence that targets the 8 ORF of an HBV gene, and a second HBV RNAi agent that contains a sequence that targets the X ORF of an HBV gene.
- the two HBV RNAi agents are administered in a ratio of about 1 : 1 , 2: 1, 3: 1, 4: 1 or 5: 1. In some embodiments, the two HBV RNAi agents are administered in a ratio of about 2: 1.
- the two HBV RNAi agents are administered in a combined amount of about 25-75 mg per dose administration and in the ratio of about. 2: 1 , about 3:1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50-125 mg per dose administration and in the ratio of about 2: 1, about 3:1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 75-150 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- the two HBV RNAi agents are administered in a combined amount of about 100-200 mg per dose administration and in the ratio of about 2:1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- the two HBV R Ai agents are administered in a combined amount of about 150-250 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about. 1 :2,
- the two HBV RNAi agents are administered in a combined amount of about 200-300 mg per dose administration and in the ratio of about 2: 1, about 3 : 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- the two HBV RNAi agents are administered in a combined amount of about 300-400 mg per dose administration and in the ratio of about 2: 1, about 3 : 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50-100 mg per dose administration and in the ratio of about 2: 1, about 3 : 1, about 1 : 1 , about 4: 1, about 5: 1 or about 1 :2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25-400 mg per dose administration and in the ratio of about 2: 1.
- the two HBV RNAi agents are administered in a combined amount of about 25-75 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50-125 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 75-150 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100-200 g per dose administration and in the ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 125-225 mg per dose administration and in the ratio of about 2: 1 . In some embodiments,
- the two HBV RNAi agents are administered in a combined amount of about 150-250 mg per dose adm nistration and in the ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200-300 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 300-400 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about. 35 mg per dose administration and in the ratio of about 2: 1.
- the two HBV RNAi agents are administered in a combined amount of about 40 g per dose administration and in the ratio of about 2: 1. In some embodiments, the tw ? o HBV RNAi agents are administered in a combined amount of about 100 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the tw ? o HBV RNAi agents are administered in a combined amount of about 200 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 300 mg per dose administration and in the ratio of about 2: 1.
- the two HBV RNAi agents are administered in a combined amount of about 400 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the two HBV RNAi agents are administered in about 7-day, about 14- day, about 21 -day or about 28-day intervals. In some embodiments, the two HBV RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, the two HBV RNAi agents are administered in a combined amount of any one of about 40 mg, about 100 mg or about 200 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the two HBV RNAi agents are administered in a combined amount of about 40 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200 mg per dose
- administration in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the first RNAi agent is administered in an amount of about 3-650 mg per dose administration, and the second RNAi agent is administered in an amount of about 2-325 mg per dose administration. In some embodiments, the first RNAi agent is administered in an amount of about 35-265 mg per dose administration. In some
- the first RNAi agent is administered in an amount of about 50-75 mg per dose administration.
- the second RNAi agent is administered in an amount of about 20-125 mg per dose administration. In some embodiments, the second RNAi agent is administered in an amount of about 25-50 mg per dose administration.
- two RNAi agents are administered at a combined dose of 25-400 mg per dose administration.
- two RNAi agents are administered at a combined dose of 25-400 mg, and the first RNAi agent is administered with the second RNAi agent at a ratio of 1 : 1.
- the dose of each of the first and second RNAi agents is in an amount of about 12 mg for a combined dose of about 25 mg.
- the dose of each of the first and second RNAi agents is in an amount of about 17 mg for a combined dose of about 35 mg.
- the dose of each of the first and second RN Ai agents is in an amount of about 20 mg for a combined dose of about 40 mg.
- the dose of each of the first and second RNAi agents is in an amount of about 25 mg for a combined dose of about 50 mg. In an embodiment, the dose of each of the first and second RNAi agents is in an amount of about 50 mg for a combined dose of about 100 mg. In an embodiment, the dose of each of the first and second RNAi agents is in an amount of about 100 mg for a combined dose of about 200 mg. In an embodiment, the dose of each of the first and second RNAi agents is in an amount of about 150 mg for a combined dose of about 300 mg. In an embodiment, the dose of each of the first and second RNAi agents is in an amount of about 200 g for a combined dose of about 400 mg.
- two RNAi agents are administered in about 7-day, about 14-day, about 21-day or about 28-day intervals. In some embodiments, two RNAi agents are administered in 28- day intervals or about 28-day intervals (i.e., Q4W). In an embodiment, the dose of each of the first and second RNAi agents is in an amount of about 20 mg for a combined dose of about 40 mg, or in an amount of about 50 mg for a combined dose of about 100 mg, or in an amount of about 100 mg for a combined dose of about 200 mg, and the two RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of each of the first and second RNAi agents is in an amount of about 20 mg for a combined dose of about 40 mg and the two RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In an embodiment, the dose of each of the first and second RNAi agents is in an amount of about 50 mg for a combined dose of about 100 mg and the two RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of each of the first and second RNAi agents is in an amount of about 100 mg for a combined dose of about 200 rng and the two RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- two RNAi agents are administered at a combined dose of 25- 400 mg per dose, and the first RNAi agent is administered with the second RNAi agent at a ratio of 2: 1.
- the dose of the first RNAi agent is in an amount of about 16 mg
- the dose of the second RN Ai agent is in an amount of about 8 mg for a combined dose of about 25 mg.
- the dose of the first RNAi agent is in an amount of about 24 rng
- the dose of the second RNAi agent is in an amount of about 12 mg for a combined dose of about 35 mg.
- the dose of the first RNAi agent is in an amount of about 27 mg, and the dose of the second RNAi agent is in an amount of about 13 mg for a combined dose of about 40 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 33 mg, and the dose of the second RNAi agent is in an amount of about 17 mg for a combined dose of about 50 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 65 rng, and the dose of the second RNAi agent is in an amount of about 35 mg for a combined dose of about 100 mg.
- the dose of the first RNAi agent is in an amount of about 133 mg, and the dose of the second RNAi agent is in an amount of about 67 mg for a combined dose of about 200 mg.
- the dose of the first RNAi agent is in an amount of about 200 mg, and the dose of the second RNAi agent is in an amount of about 100 mg for a combined dose of about 300 mg.
- the dose of the first RNAi agent is in an amount of about 270 mg, and the dose of the second RNAi agent is in an amount of about 135 g for a combined dose of about 400 mg.
- two RNAi agents are administered in about 7-day, about 14-day, about 21 -day or about 28-day intervals.
- two RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of the first RNAi agent is in an amount of about 27 mg
- the dose of the second RNAi agent is in an amount of about 13 g for a combined dose of about 40 g and the two RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of the first RNAi agent is in an amount of about 65 mg, and the dose of the second RNAi agent is in an amount of about 35 mg for a combined dose of about 100 mg and the two RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4VV).
- the dose of the first RNAi agent is in an amount of about 133 mg, and the dose of the second RNAi agent is in an amount of about 67 mg for a combined dose of about 200 mg and the two RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- two RNAi agents are administered at a combined dose of 25- 400 mg per dose, the first RNAi agent is administered with the second RNAi agent at a ratio of 3: 1.
- the dose of the first RNAi agent is in an amount of about 18 mg, and the dose of the second RNAi agent is in an amount of about 6 mg for a combined dose of about 25 mg.
- the dose of the first RNAi agent is in an amount of about 27 mg, and the dose of the second RN Ai agent is in an amount of about 9 mg for a combined dose of about 35 mg.
- the dose of the first RNAi agent is in an amount of about 30 mg, and the dose of the second RNAi agent is in an amount of about 10 mg for a combined dose of about 40 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 36 mg, and the dose of the second RNAi agent is in an amount of about 12 mg for a combined dose of about 50 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 75 mg, and the dose of the second RNAi agent is in an amount of about 25 mg for a combined dose of about 100 mg.
- the dose of the first RNAi agent is in an amount of about 150 mg, and the dose of the second RNAi agent is in an amount of about 50 mg for a combined dose of about 200 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 225 mg, and the dose of the second RNAi agent is in an amount of about 75 mg for a combined dose of about 300 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 300 mg, and the dose of the second RNAi agent is in an amount of about 100 mg for a combined dose of about 400 mg. In some embodiments, two RNAi agents are administered in about 7-day, about 14-day, about 21-day or about 28-day intervals.
- two RNAi agents are administered in 28- day intervals or about 28-day intervals (i.e., Q4W).
- the dose of the first RNAi agent is in an amount of about 30 mg
- the dose of the second RNAi agent is in an amount of about 10 mg for a combined dose of about 40 mg and the two RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of the first RNAi agent is in an amount of about 75 mg
- the dose of the second RN Ai agent is in an amount of about 25 mg for a combined dose of about 100 mg and the two RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of the first RNAi agent is in an amount of about 150 mg
- the dose of the second RNAi agent is in an amount of about 50 mg for a combined dose of about 200 mg and the two RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the two HBV RNAi agents are administered in a combined amount of about 1-10 mg/kg per dose administration. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 1-5 mg/kg per dose
- the two HBV RNAi agents are administered in a combined amount of about 1-1.5 mg/kg, about 1.5-2.0 mg/kg, about 2.0-2.5 mg/kg, about
- the two HBV RNAi agents are administered in about 7-day, about 14-day, about 21-day or about 28-day intervals. In some embodiments, the two HBV RNAi agents are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the first RNAi agent is administered in an amount of about 0.6-7 mg/kg per dose administration, and the second RNAi agent is administered in an amount of about 0.3-5 mg/kg per dose administration. In some embodiments, the second RNAi agent is administered in an amount of about 0.5-2.5 mg/kg per dose administration. In some embodiments, the second RNAi agent is administered in an amount of about 0.3- 1.5 mg/kg per dose administration. In some embodiments, the first RNAi agent is administered in an amount of about 0.6-5 mg/kg per dose administration. In some embodiments, the first RNAi agent is administered in an amount of about 1-2.5 mg/kg per dose administration.
- the first RNAi agent and the second RNAi agent are administered in about 7-day, about 14-day, about 21-day or about 28-day intervals. In some embodiments, the first RNAi agent and the second RNAi agent are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- HBV RNAi agents having an antisense strand comprising administering one or more HBV RNAi agents having an antisense strand compri sing the sequence of any of the sequences in Table 3.
- HBV RNAi agents having a sense strand comprising the sequence of any of the sequences in Table 4.
- HBV RNAi agents having an antisense strand comprising the sequence of any of the sequences in Table 3, and a sense strand comprising the sequence of any of the sequences in Table 4 that is at least partially complementary to the antisense strand.
- HBV RNAi agents having an antisense strand that consists of the sequence of any of the sequences in Table 3, and a sense strand that consists of the sequence of any of the sequences in Table 4 that is at least partially
- HBV RNAi agents having the duplex structure of Table 5.
- HBV RNAi agents having an antisense strand comprising the sequence of any of the sequences in Table 3.
- Disclosed herein are methods of treating or preventing a disease associated with an infection caused by HBV, comprising administering one or more HBV RNAi agents having an antisense strand comprising the sequence of any of the sequences in Table 3. [0056] Disclosed herein are methods of treating a disease associated with an infection caused by HBV, comprising administering one or more HBV RNAi agents having an antisense strand comprising the sequence of any of the sequences in Table 3.
- HBV RNAi agents having a sense strand comprising the sequence of any of the sequences in Table 4.
- HBV RNAi agents having a sense strand comprising the sequence of any of the sequences in Table 4.
- HBV RNAi agents having a sense strand comprising the sequence of any of the sequences in Table 4.
- HBV RNAi agents having an antisense strand comprising the sequence of any of the sequences in Table 3, and a sense strand comprising the sequence of any of the sequences in Table 4 that is at least partially complementary to the antisense strand.
- HBV RNAi agents having an antisense strand comprising the sequence of any of the sequences in Table 3, and a sense strand comprising the sequence of any of the sequences in Table 4 that is at least partially complementary to the antisense strand.
- HBV RNAi agents having an antisense strand comprising the sequence of any of the sequences in Table 3, and a sense strand comprising the sequence of any of the sequences in Table 4 that is at least partially complementary to the antisense strand.
- HBV RNAi agents having an antisense strand that consists of the sequence of any of the sequences in Table 3, and a sense strand that consists of the sequence of any of the sequences in Table 4 that is at least partially complementary to the antisense strand.
- HBV RNAi agents having an antisense strand that consists of the sequence of any of the sequences in Table 3, and a sense strand that consists of the sequence of any of the sequences in Table 4 that is at least partially complementary to the antisense strand.
- HBV RNAi agents having an antisense strand that consists of the sequence of any of the sequences in Table 3, and a sense strand that consists of the sequence of any of the sequences in Table 4 that is at least partially complementary to the antisense strand.
- HBV RNAi agents having the duplex structure of Table 5.
- HBV RNAi agents having the duplex structure of Table 5.
- HBV RNAi agents having the duplex staicture of Table 5.
- HBV RNAi agent having an antisense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 3
- a second HBV RNAi agent having an antisense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 3.
- a first HBV RNAi agent having an antisense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 3 and a sense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 4 that is at least partially complementary' to the antisense strand of the first HBV RNAi agent
- a second HBV RNAi agent having an antisense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 3 and a sense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 4 that is at least partially complementary' to the antisense strand of the second HBV RNAi agent.
- a first HB V RNAi agent having an antisense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 3 and a sense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 4 that is at least partially
- a second HBV RNAi agent having an antisense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 3 and a sense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 4 that is at least partially complementary' to the antisense strand of the second HBV RNAi agent.
- a disease associated with an infection caused by HBV comprising administering (i) a first HBV RNAi agent having an antisense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 3 and a sense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 4 that is at least partially complementary to the antisense strand of the first HBV RNAi agent, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 3 and a sense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 4 that is at least partially complementary to the antisense strand of the second HBV RNAi agent.
- a disease associated with an infection caused by HBV comprising administering (i) a first HBV RNAi agent having an antisense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 3 and a sense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 4 that is at least partially complementary to the antisense strand of the first HBV RNAi agent, and (ii) a second HBV RNAi agent having an antisense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 3 and a sense strand comprising or consisting of the sequence of any of the sequences in Table 2 or Table 4 that is at least partially complementary to the antisense strand of the second HBV RNAi agent.
- an HBV RNAi agent disclosed herein comprises:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') AUUGAGAGAAGUCCACCAC (SEQ ID NO;
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') UUUGAGAGAAGUCCACCAC (SEQ ID NO:
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') GUGGUGGACUUCUCUCAAA (SEQ ID NO: 35); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a sense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5 ! ⁇ 3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39), or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases fro the sequence (5' >3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40), or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ⁇ >3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a sense strand that comprises the nue!eobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or
- an antisense strand that comprises the nucleobase sequence differing by 0, L 2 or 3 nucleobases from the sequence (5' ⁇ >3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ⁇ 3 ') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') ACCAAUUUAUGCCUACAGC (SEQ ID NO:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'Ob') UCCAAUUUAUGCCUACAGC (SEQ ID NO:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5O"3') GACCAAUUUAUGCCUACAG (SEQ ID NO:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3 ! ) AACCAAUUUAUGCCUAC AG (SEQ ID NO:
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) UACCAAUUUAUGCCUAC AG (SEQ ID NO:
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).
- HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises an HBV RNAi agent.
- kits for treating or preventing a disease associated with an infection caused by HBV comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises an HBV RNAi agent.
- kits for treating a disease associated with an infection caused by HBV comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises an HBV RNAi agent.
- HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5’- 3 ! ) AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ->3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a sense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5 ! - 3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40),
- a second HBV RNAi agent comprises:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) GACCAAUUUAUGCCUAC AG (SEQ ID NO: 27), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ >3 ! ) CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or ii) an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') AACCAAUUUAUGCCUACAG (SEQ ID NO:
- a sense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! - 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- UACCAAUUUAUGCCUACAG (SEQ ID NO:
- a composition that inhibits expression of an HBV gene in a cell comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a sense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a sense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40);
- a second HBV RNAi agent comprises:
- an antisense strand that comprises the nucieobase sequence differing by 0, I, 2 or 3 nucleobases from the sequence (5’ ⁇ 3') GACCAAUUUAUGCCUACAG (SEQ ID NO:
- a sense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3’) CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') AACCAAUUUAUGCCUACAG (SEQ ID NO:
- a sense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or
- an antisense strand that comprises the nucleohase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'->3 ! ) UACCAAUUUAUGCCUACAG (SEQ ID NO: 29), and a sense strand that comprises the nucfeobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).
- a disease associated with an infection caused by HBV comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:
- an antisense strand that comprises the nucleohase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'ri»3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a sense strand that comprises the nuc!eobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ 3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5O"3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40);
- a second HBV RNAi agent comprises:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'ri»3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ri»3') CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ 3‘) AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55), or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3 ! ) UACCAAUUUAUGCCUACAG (SEQ ID NO: 29), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'riN3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).
- RNAi agent comprises:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'riN3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45),
- a second HBV RNAi agent comprises:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) GACCAAUUUAUGCCUAC AG (SEQ ID NO:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'->3 ! ) AACCAAUUUAUGCCUACAG (SEQ ID NO:
- a sense strand that comprises the nucleobase sequence differing by 0, i, 2 or 3 nucleobases from the sequence (5'- 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3‘) UACCAAUUUAUGCCUACAG (SEQ ID NO:
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'riN3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).
- a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:
- an antisense strand that comprises the nue!eobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44), or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'QO') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a sense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'- 3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45),
- a second HBV RNAi agent comprises:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) GACCAAUUUAUGCCUAC AG (SEQ ID NO:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) AACCAAUUUAUGCCUACAG (SEQ ID NO:
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'QO') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3‘) UACCAAUUUAUGCCUACAG (SEQ ID NO:
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises: v) an antisense strand that comprises the nue!eobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a sense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'- 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44), or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence ' ⁇ q') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45);
- a second HBV RNAi agent comprises:
- viilan antisense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'- 3 ! ) GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ 3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases fro the sequence (5' ⁇ >3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') UACCAAUUUAUGCCUACAG (SEQ ID NO: 29), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ⁇ >3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).
- a method of treating or preventing an HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising administering a composition for inhibiting expression of an HBV gene in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a sense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5' ⁇ >3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'- 3’) UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 r ) UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40);
- a second HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary to a portion of the X ORF of an HBV mRNA.
- a composition for inhibiting expression of an HBV gene in a cell comprising administering a composition for inhibiting expression of an HBV gene in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ->3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39), or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3') UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ⁇ 3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40),
- a second HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary to a portion of the X ORF of an HBV mRNA.
- a disease associated with an infection caused by HBV comprising administering a composition for inhibiting expression of an HBV gene in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ 3') AAUUGAGAGAAGUCCACCA (SEQ ID NO: 12), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ 3') UGGUGGACUUCUCUCAAUU (SEQ ID NO: 39); or vi) an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 !
- UAUUGAGAGAAGUCCACCA (SEQ ID NO: 13), and a sense strand that comprises the nucieobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5 ! ⁇ 3') UGGUGGACUUCUCUCAAUA (SEQ ID NO: 40);
- a second HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary to a portion of the X ORE of an HBV mRNA.
- kits for treating or preventing an HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises;
- an antisense strand that comprises the nucieobase sequence differing by 0, I, 2 or 3 nucleobases from the sequence (5' ⁇ >3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a sense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ »3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a sense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45);
- a second HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary ' to a portion of the X ORE of an HBV mRNA.
- a composition that inhibits expression of an HBV gene in a cell comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition compri ses two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! - 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a sense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or iv) an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ⁇ O') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a sense strand that comprises the nucieobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'OG') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45);
- a second HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary to a portion of the X ORE of an HBV mRNA.
- a disease associated with an infection caused by HBV comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises:
- an antisense strand that comprises the nucieobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5 ! - 3') AGAAAAUUGAGAGAAGUCC (SEQ ID NO: 17), and a sense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') GGACUUCUCUCAAUUUUCU (SEQ ID NO: 44); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') UGAAAAUUGAGAGAAGUCC (SEQ ID NO: 18), and a sense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ⁇ 3 ') GGACUUCUCUCAAUUUUCA (SEQ ID NO: 45);
- a second HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary to a portion of the X ORF of an HBV mRNA.
- RNAi agents comprises an antisense strand having a sequence that is at least partially complementary to a portion of the S ORF of an HBV mRNA, and wherein a second HBV RNAi agent comprises:
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a sense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ >3 ! ) CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'->3 ! ) AACCAAUUUAUGCCUACAG (SEQ ID NO:
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3‘) UACCAAUUUAUGCCUACAG (SEQ ID NO:
- a composition that inhibits expression of an HBV gene in a cell comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary to a portion of the S ORE of an HBV mRNA, and wherein a second HBV RNAi agent comprises:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') GACCAAUUUAUGCCUACAG (SEQ ID NO:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3 ! ) AACCAAUUUAUGCCUACAG (SEQ ID NO:
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) UACCAAUUUAUGCCUACAG (SEQ ID NO:
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).
- a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two or more HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand having a sequence that is at least partially complementary to a portion of the S ORF of an HBV mRNA, and wherein a second HBV RNAi agent comprises:
- viijan antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) GACCAAUUUAUGCCUACAG (SEQ ID NO: 27), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) CUGUAGGCAUAAAUUGGUC (SEQ ID NO: 54); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'ri»3') AACCAAUUUAUGCCUACAG (SEQ ID NO: 28), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ⁇ 3') CUGUAGGCAUAAAUUGGUU (SEQ ID NO: 55); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3‘) UACCAAUUUAUGCCUACAG (SEQ ID NO: 29), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5O>3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 56).
- an HBV RNAi agent disclosed herein comprises:
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') UACCAAUUUAUGCCUACAGGCCUUAU (SEQ ID NO: 149); or
- an antisense strand that comprises the nucleobase sequence differing by 0, I, 2 or 3 nucleobases from the sequence (5'- 3') UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO: 150); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 r ) UACCAAUUUAUGCCUACAGGC (SEQ ID NO: 151); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 152); or e. an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') UAUUGAGAGAAGUGCACGACG (SEQ ID NO: 160); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5’- 3 ! ) UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 163); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') UAUUGAGAGAAGUCCACCACGA (SEQ ID NO: 170); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ->3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') UACCAAUUUAUCCCUACAGCUU (SEQ ID NO: 172); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3 ! ) UACCAAIJOUAUGCCUACAGCCU (SEQ ID NO: 173); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5 ! ri»3') UAUUGAGAGAAGUCCACCAUU (SEQ ID NO: 174), or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5O"3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ⁇ 3') AGAAAAUUGAGAGAAGUCCACC (SEQ ID NO: 180); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ->3') UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 181); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ⁇ 3') ACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 182); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1. 2 or 3 nucleobases from the sequence (5'- 3 ! ) ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 183); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 r ) ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO: 184), or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'Q3') UCCAAUUUAUGCCUACAGCUU (SEQ ID NO: 185); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1. 2 or 3 nucleobases from the sequence (5'- 3 ! ) UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 186); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'0 ⁇ 3') UACCAAUUUAUGCCUACAGCU (SEQ ID NO: 187), or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') AACCAAUUUAUGCCUACAGCC (SEQ) ID NO: 189); or aa. an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ⁇ O') ACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 190); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') UCCAAUUUAUGCCUACAGCCU (SEQ ID NO: 191); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5’- 3 ! ) ACCAAUUUAUGCCUACAGCCG (SEQ ID NO: 192); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') UCCAAUUUAUGCCUACAGCCG (SEQ ID NO: 193); or
- an antisense strand that comprises the nucieobase sequence differing by 0, 1. 2 or 3 nucleobases from the sequence (5' ⁇ >3') UACCAAUUUAUGCCUACAGGG (SEQ ID NO: 194);
- HBV RNAi agent further comprises a sense strand at least partially complementary to the respective antisense strand.
- an HBV RNAi agent disclosed herein comprises:
- an antisense strand that consists of the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') UACCAAUUUAUGCCUACAGGCCUUAU (SEQ ID NO: 149); or
- an antisense strand that consists of the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3 ! ) UACCAAUUUAUGCCUACAGGCCU (SEQ ID NO: 150); or
- an antisense strand that consists of the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ 3') UACCAAUUUAUGCCUACAGGC (SEQ ID NO: 151); or
- an antisense strand that consists of the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5O"3') UGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 152); or
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') UACCAAUUUAUGCCUACAGCC (SEQ) ID NO: 162); or
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') UACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 163), or
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') UAUUGAGAGAAGUCCACCACGA (SEQ ID NO: 170); or
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3 ! ) AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171); or
- an anti sense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ->3') UACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 172); or
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3') UACCAAUUUAUGCCUACAGCCU (SEQ ID NO: 173); or
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3 ! ) UAUUGAGAGAAGUCCACCAUU (SEQ ID NO: 174); or
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3 ! ) UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175); or
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ 3') AGAAAAUUGAGAGAAGUCCUU (SEQ ID NO: 178); or
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3 ! ) UGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 181); or
- an anti sense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 r ) ACCAAUUUAUGCCUACAGCUU (SEQ ID NO: 182), or
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3 ! ) ACCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 183); or
- an antisense strand that comprises the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ⁇ 3') ACCAAUUUAUGCCUACAGCCUC (SEQ ID NO: 184); or
- an antisense strand that consists of the nueleobase sequence differing by 0, I, 2 or 3 nucleobases from the sequence (5'->3 r ) UCCAAUUUAUGCCUACAGCUU (SEQ ID NO: 185); or
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3') UCCAAUUUAUGCCUACAGCCUU (SEQ ID NO: 186); or
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ⁇ >3') UACCAAUUUAUGCCUACAGCU (SEQ ID NO: 187); or
- an antisense strand that comprises the nueleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'-» 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), or
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') AACCAAUUUAUGCCUACAGCC (SEQ ID NO: 189); or
- aa an antisense strand that consi sts of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') ACCAAUUUAUGCCUACAGCCU (SEQ ) ID NO: 190); or bb. an antisense strand that consists of the nueleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'QO') UCCAAUUUAUGCCUACAGCCU (SEQ ID NO: 191); or
- cc an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') ACCAAUUUAUGCCUACAGCCG (SEQ ) ID NO: 192); or
- dd an antisense strand that comprises the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5’- 3 ! ) UCCAAUUUAUGCCUACAGCCG (SEQ ID NO: 193), or.
- an antisense strand that consists of the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') UACCAAUUUAUGCCUACAGGG (SEQ ID NO: 194);
- HBV RNAi agent further comprises a sense strand at least partially complementary to the respective antisense strand.
- an HBV RNAi agent disclosed herein comprises:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5' ⁇ >3 ! ) usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfccsusuAu (SEQ ID NO: 61); or
- an antisense strand that comprises the sequence differing by 0, 1 , 2 or 3 nucleotides from the sequence (5 ⁇ 3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfcscsu (SEQ ID NO: 62); or
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5' ⁇ >3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfccsu (SEQ ID NO: 63); or
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'- ⁇ 3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsc (SEQ ID NO: 64); or
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5' ⁇ >3') usAfscscaauUfuAfuGfcCfuacagcsc (SEQ ID NO: 85); or vii. an antisense strand that comprises the sequence differing by 0, 1 , 2 or 3 nucleotides from the sequence (5'- ⁇ 3') usAfsusugagAfgAfaGfuCfcaccacsg (SEQ ID NO: 94); or
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5 ! ⁇ 3') usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgsa (SEQ ID NO: 98); or
- an antisense strand that comprises the sequence differing by 0, I, 2 or 3 nucleotides from the sequence (5' ⁇ >3 ! ) usAfscsCfaAfuuuauGfcCfuAfcAfgcsc (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1 , 2 or 3 nucleotides from the sequence (5'->3 ! ) usAfscsCfaAfuuuauGfcCfuAfcAfgcusu (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'->3') usAfscsCfaAfuuuauGfcCfuAfcAfgccsu (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5 ! ⁇ 3') usAfscsCfaAfuuuauGfcCfuAfcAfgccusu (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5 ⁇ 3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ ID NO: 107); or
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5' ⁇ 3') cPrpus.AfsusUfgAfg.AfgAfaGfuCfcAfcCfaCfsg (SEQ ID NO: 108); or
- XV an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'->3 ! ) usAfsusUfgAfgagaaGfuCfcAfcCfausu (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5 ⁇ 3') usAfsusUfgAfgagaaGfuCfcAfcCfacsg (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5 ! ⁇ >3') usAfsusUfgAfgagaaGfuCfcAfcCfacsusu (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1 , 2 or 3 nucleotides from the sequence (5 ! ⁇ 3') usAfsusUfgAfgagaaGfuCfcAfcCfacsgsa (SEQ ID NO: 1 12); or
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5 ! ⁇ 3') usAfsusUfgAfgagaaGfuCfcAfcCfacusu (SEQ ID NO: 120); or
- an antisense strand that comprises the sequence differing by 0, I, 2 or 3 nucleotides from the sequence (5'- 3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'- ⁇ 3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO:
- xxii an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'->3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacusu (SEQ ID NO: 127); or
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5 '- ⁇ 3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacsc (SEQ ID NO: 128); or
- an antisense strand that comprises the sequence differing by 0, 1 , 2 or 3 nucleotides from the sequence (5 '->3') usGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5 ! ⁇ 3') usGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ) ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5 ! ⁇ 3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1 , 2 or 3 nucleotides from the sequence (5'- asCfsesAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'- 3') asGfscsAfaUfuUfaUfgCfcUfaCfaGfccusc (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1 , 2 or 3 nucleotides from the sequence (5'- ⁇ 3') usCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5' ⁇ 3') usCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5 ! ⁇ 3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 136); or
- an antisense strand that comprises the sequence differing by 0, 1 , 2 or 3 nucleotides from the sequence (5 ! ⁇ 3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 137); or
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5' ⁇ >3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 138); or
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'->3 r ) usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsu (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5' ⁇ >3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5' ⁇ 3') asAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'->3 ! ) usAfscsCfaAfuUfUfAfuGfcCfuAfcAfgusu (SEQ ID NO: 142); or
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5' ⁇ 3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgCfsc (SEQ ID NO: 143); or
- an antisense strand that comprises the sequence differing by 0, 1 , 2 or 3 nucleotides from the sequence (5' ⁇ 3') asCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO: 144); or xl an antisense strand that comprises the sequence differing by 0, 1 , 2 or 3 nucleotides from the sequence (5'-»3') usCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'- 3 ! ) asCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1, 2 or 3 nucleotides from the sequence (5'- 3') usCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO:
- an antisense strand that comprises the sequence differing by 0, 1 , 2 or 3 nucleotides from the sequence (5'- 3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfggsg (SEQ ID NO:
- a, g, c and u are 2 ! -0-methyl (2 ! -OMe) modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides, s is a phosphorothioate intemucleoside linkage and the remaining nucleotide monomers are linked by phosphodiester bonds; and cPrpu is 5'- cyclopropyl phosphonate-2'-0-methyl modified nucleotide; and wherein the HB V RNAi agent further comprises a sense strand at least partially complementary to the respective antisense strand
- an HBV RNAi agent disclosed herein comprises:
- an antisense strand that consists of the sequence (5 '->3') usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfccsusuAu (SEQ ID NO: 61); or ii. an antisense strand that consists of the sequence (5’->3 ! ) usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfcscsu (SEQ ID NO: 62); or
- an antisense strand that consists of the sequence (5 ! ⁇ 3') usAfscsCfaAfoUfuAfuGfcCfuAfcAfgGfccsu (SEQ ID NO: 63); or
- an antisense strand that consists of the sequence (5'->3 ! ) usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsc (SEQ ID NO: 64), or
- an antisense strand that consists of the sequence (5 ! - 3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ ID NO: 68); or
- an antisense strand that consists of the sequence (5'->3') usAfsusugagAfgAfaGfuCfcaccaesg (SEQ ID NO: 94); or viii. an antisense strand that consists of the sequence (5 '->3') usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgsa (SEQ ID NO: 98); or
- an antisense strand that consists of the sequence (5’- ⁇ >3 ! ) usAfscsCfaAfuuuauGfcCfuAfcAfgcsc (SEQ ID NO: 102); or
- an antisense strand that consists of the sequence (5'->3') usAfscsCfaAfuuuauGfcCfuAfcAfgcusu (SEQ ID NO: 103); or
- an antisense strand that consists of the sequence (5 '->3') usAfscsCfaAfuuuauGfcCfuAfcAfgccsu (SEQ ID NO: 104); or
- an antisense strand that consists of the sequence (5' >3’) usAfscsCfaAfuuuauGfcCfuAfcAfgccusu (SEQ ID NO: 105); or
- an antisense strand that consists of the sequence (5 '- ⁇ 3') cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu (SEQ ID NO: 107); or
- an antisense strand that consists of the sequence (5'->3 ! ) cPrpusAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg (SEQ ID NO: 108); or
- an antisense strand that consists of the sequence (5'- ⁇ 3') usAfsusUfgAfgagaaGfuCfcAfeCfausu (SEQ ID NO: 109); or
- an antisense strand that consists of the sequence (5'->3 ! ) usAfsusUfgAfgagaaGfuCfcAfcCfacsg (SEQ ID NO: HO), or
- an antisense strand that consists of the sequence (5 '->3') usAfsusUfgAfgagaaGfuCfcAfeCfacsusu (SEQ ID NO: 111); or
- an antisense strand that consists of the sequence (5 '->3 ! ) usAfsusUfgAfgagaaGfuCfcAfcCfacsgsa (SEQ ID NO: 112); or
- an antisense strand that consists of the sequence (5'->3') usAfsusUfgAfgagaaGfuCfcAfcCfacusu (SEQ ID NO: 120); or
- XX an antisense strand that consists of the sequence (5’- ⁇ >3 ! ) asGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu (SEQ ID NO: 125);
- an antisense strand that consists of the sequence (5 ' >3’) asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 126); or
- an antisense strand that consists of the sequence (5 '->3') asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacusu (SEQ ID NO: 127); or
- an antisense strand that consists of the sequence (5’ >3’) asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacsc (SEQ ID NO: 128), or
- an antisense strand that consists of the sequence (5'- ⁇ 3') usGfsasAfaAfuUfgAfgAfg.AfaGfuCfcusu (SEQ ID NO: 129); or xxv. an antisense strand that consists of the sequence (5 ! ->3’) usGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc (SEQ ID NO: 130); or
- an antisense strand that consists of the sequence (5 ' >3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO: 132); or
- an antisense strand that consists of the sequence (5 '->3') asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusc (SEQ ID NO: 133); or
- an antisense strand that consists of the sequence (5' >3’) usCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu (SEQ ID NO: 134); or
- an antisense strand that consists of the sequence (5'- ⁇ 3') usCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu (SEQ ID NO: 135); or
- an antisense strand that consists of the sequence (5'->3 ! ) cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 136); or
- an antisense strand that consists of the sequence (5 ! ⁇ 3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 137); or
- an antisense strand that consists of the sequence (5' ⁇ >3 ! ) cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc (SEQ ID NO: 138), or
- an antisense strand that consists of the sequence (5 ! - 3') usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsu (SEQ ID NO: 139), or
- an antisense strand that consists of the sequence (5' ⁇ >3 ! ) usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg (SEQ ID NO: 140); or
- an antisense strand that consists of the sequence (5 ! ->3’) asAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc (SEQ ID NO: 141); or
- an antisense strand that consists of the sequence (5'- ⁇ >3 ! ) usAfscsCfaAfuUfUfAfuGfcCfuAfcAfgusu (SEQ ID NO: 142); or
- xxxvii i an antisense strand that consists of the sequence (5 '->3’) usAfscsCfaAfuUfuAfuGfcCfuAfcAfgCfsc (SEQ ID NO: 143); or
- an antisense strand that consists of the sequence (5 '->3') asCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO: 144); or
- an antisense strand that consists of the sequence (5’ >3’) usCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu (SEQ ID NO: 145); or
- xli an antisense strand that consists of the sequence (5 '- ⁇ 3') asCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO: 146); or xlii. an antisense strand that consists of the sequence (5 '->3') usCfscAfaUfuUfaUfgCfcUfaCfaGfccsg (SEQ ID NO: 147); or
- xliii an antisense strand that consists of the sequence (5'- ⁇ >3 ! ) usAfscsCfaAfuUfuAfuGfcCfuAfcAfggsg (SEQ ID NO: 148);
- a, g, c and u are 2'-0-m ethyl (2' ⁇ OMe) modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; s is a phosphorothioate intemucleoside linkage and the remaining nucleotide monomers are linked by phosphodiester bonds; and cPrpu is 5'- cyclopropyl phosphonate-2'-0-methyl modified nucleotide; and wherein the HB V RNAi agent further comprises a sense strand at least partially complementary to the respective antisense strand.
- an HBV RNAi agent disclosed herein comprises:
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') UUGCCUGUAGGCAUAAAUUGGUAUT (SEQ ID NO: 275); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- UAUAUGCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 276); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'->3') CUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 278); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'QO') CGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 285), or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') CGUGGUGGACUUCUCUCAAUA (SEQ ID NO: 289); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'- ⁇ 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294), or h. a sense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5 ⁇ O') UCGUGGUGGACUUCUCUCAAUU (SEQ ID NO: 300); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ⁇ 3') GCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 303), or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) GGCUGUAGGCAUAAAUUGGUAUU (SEQ ID NO: 304); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ >3 ! ) UGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 306); or
- m. a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 r ) GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307), or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') AAUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 308); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') GGACUUCUCUCAAUUUUCU (SEQ ID NO; 318); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 ! ) GGUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 319), or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- GGACUUCUCUCAAUUUUCA (SEQ ID NO: 320); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') GUGGACUUCUCUCAAUUUUCA (SEQ ID NO: 321); or s. a sense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'QO') GCUGUAGGCAUAAAUUGGU (SEQ ID NO: 322); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') GGCUGUAGGCAUAAAIJUGGU (SEQ ID NO: 323); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ⁇ 3') GAGGCUGUAGGCAUAAAIJIJGGU (SEQ ID NO: 324), or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ⁇ O') GCUGUAGGCAUAAAUUGGA (SEQ ID NO: 325); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') GGCUGUAGGCAUAAAIJUGGA (SEQ ID NO: 326); or
- x. a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3 ! ) AGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 327), or
- y a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328); or
- z. a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') GGCUGUAGGCAUAAAUUGGUU (SEQ ID NO: 329); or
- an antisense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'->3 ! ) AGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 330), or
- bb a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5O"3') AGGCUGUAGGCAUAAAUUGGA (SEQ ID NO: 331); or
- cc a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3 ! ) CGGCUGUAGGCAUAAAUUGGU (SEQ ID NO: 332); or dd. a sense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'QG) C GGCU GU AGGC AU A A AUU GGA (SEQ ID NO: 333); or
- a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- CCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 334);
- HBV RNAi agent further comprises an antisense strand at least partially complementary to the respective antisense strand.
- an HBV RNAi agent disclosed herein comprises:
- a sense strand that consists of the nucleobase sequence (5'-»3') U AU AU GC CU GU AGGC AU AAAUU GGU A (SEQ ID NO: 276); or
- a AU GGU GG ACUU CU CU C AAU AUU (SEQ ID NO: 308); or
- a sense strand that comprises the nucleobase sequence (5'->3') GGACUUC UCU C AAUUUU CU (SEQ ID NO: 318); or
- GGACUUCUCUCAAUUUUCA (SEQ ID NO: 320); or
- an antisense strand that comprises the nucleobase sequence (5'- 3') AGGCUGUAGGCAUAA AUUGGU (SEQ ID NO: 330); or
- HBV RNAi agent further comprises an antisense strand at least partially complementary to the respective antisense strand.
- kits for treating or preventing an HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising admini stering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HB RNAi agents, wdierein a first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 !
- a second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).
- a composition that inhibits expression of an HBV gene in a cell comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence ->3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein a second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3')
- UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- >3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a ceil, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that comprises the nudeobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a sense strand that comprises the nudeobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein a second HBV RNAi agent comprises an antisense strand that comprises the nudeobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 !
- UACCAAUUUAUGCCUACAGUU SEQ ID NO: 154
- a sense strand that comprises the nudeobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'Ob 1 ) CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).
- a composition that inhibits expression of an HBV gene in a cell comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RN Ai agent comprises an antisense strand that consists of the nudeobase sequence (5'- 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a sense strand that consists of the nudeobase sequence (5'QO') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein a second HBV RNAi agent comprises an antisense strand that consists of the nudeobase sequence (5' ⁇ »3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a sense strand that consists of the nudeobase sequence (5'Ob 1
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that consists of the nudeobase sequence (5' ⁇ >3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a sense strand that consists of the nudeobase sequence (5'->3 ! )
- a second HBV RNAi agent comprises an antisense strand that consists of the nudeobase sequence (5'->3 ! ) UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a sense strand that consists of the nudeobase sequence (5'->3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292)
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a ceil, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that consists of the nucleobase sequence (5'-»3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a sense strand that consists of the nucleobase sequence (5'QO')
- RNAi agent comprises an antisense strand that consists of the nucleobase sequence (5' ⁇ 3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a sense strand that consists of the nucleobase sequence (5'-»3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 '->3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') U
- a composition that inhibits expression of an HBV gene in a cell comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ »3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases fro the sequence (5’ ⁇ >3') UACCAAUUUAUGCCU
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3')
- a second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).
- compositions for inhibiting expression of an HBV gene in a cell comprising administering a compositions for inhibiting expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that consists of the nucleobase sequence (5 !
- AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that consists of the nucl eobase sequence (5'-»3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV RNAi agent comprises an antisense strand that consists of the nucleobase sequence (SSG) UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a sense strand that consists of the nucleobase sequence (5'- ⁇ >3 ! )
- kits for treating or preventing a disease associated with an infection caused by HBV comprising administering a
- compositions for inhibiting expression of an HBV gene in a cell comprising two HB V RNAi agents, wherein a first HB V RNAi agent comprises an antisense strand that consists of the nucleobase sequence (5' >3') AGAAAAUUG AGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that consists of the nucleobase sequence (5’- 3 ! ) GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV RNAi agent comprises an antisense strand that consists of the nucleobase sequence (5'- ⁇ >3 ! )
- UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a sense strand that consists of the nucleobase sequence (5'-»3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).
- compositions for inhibiting expression of an HBV gene in a cell comprising administering a compositions for inhibiting expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that consists of the nuc!eobase sequence (5' ⁇ >3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that consists of the nucleobase sequence (5' ⁇ >3 ! )
- a second HBV RNAi agent comprises an antisense strand that consists of the nucleobase sequence (5 ! - 3')
- UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a sense strand that consists of the nucleobase sequence (5'-»3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ »3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HB V RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') U
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ »3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence ->3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (SSO') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a ceil, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, l, 2 or 3 nucleobases from the sequence (5' >3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (S'QG)
- a second HB V RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ >3 ! ) UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! ⁇ 3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294).
- kits for treating or preventing an HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising admini stering a composition that inhibits expression of an HBV gene in a cell, the composition comprising two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that consists of the nucleobase sequence (5' >3’)
- AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that consists of the nucleobase sequence (5'-»3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV RNAi agent comprises an antisense strand that consists of the nucleobase sequence (5'->3 ! ) UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that consists of the nucleobase sequence (5' ⁇ >3')
- a disease associated with an infection caused by HBV comprising administering a composition that inhibits expression of an HBV gene in a cell, the composition comprising two HBV RNAi agents, wherein a first HB V RNAi agent comprises an antisense strand that consists of the nucleobase sequence (5'-»3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that consists of the nucleobase sequence (5'- 3 ! )
- a second HBV RNAi agent comprises an antisense strand that consists of the nucleobase sequence (5'->3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that consists of the nucleobase sequence (5'-»3') GGCU GU AGGC AU AAAUU GGU A (SEQ ID NO: 294).
- a disease associated with an infection caused by HBV comprising administering a composition that inhibits expression of an HBV gene in a ceil, the composition comprising two HBV RNAi agents, wherein a first HB V RN Ai agent comprises an antisense strand that consists of the nucleobase sequence (5' ⁇ »3') AG A AAAUU G AG AG A AGU C C AC (SEQ ID NO: 171), and a sense strand that consists of the nucleobase sequence (5' ⁇ 3')
- a second HBV RNAi agent comprises an antisense strand that consists of the nucleobase sequence (5' ⁇ >3 ! )
- UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that consists of the nucleobase sequence (5'-»3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294).
- a composition that inhibits expression of an HB V gene in a cell comprising administering a composition that inhibits expression of an HB V gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5’ ⁇ >3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'OG) GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') UACCAAU
- a composition that inhibits expression of an HBV gene in a cell comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 !
- a second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307).
- a disease associated with an infection caused by HBV comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HB V RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3')
- a second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases fro the sequence (5'-»3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307).
- kits for treating or preventing an HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that consists of the nucleobase sequence (5'->3 !
- AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that consists of the nucleobase sequence (5'-»3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV RNAi agent comprises an antisense strand that consists of the nucleobase sequence (S'QG) UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that consists of the nucleobase sequence (5' >3')
- GUGGUGGACUUCUCUCAAUAUU SEQ ID NO: 307.
- methods of treating or preventing a disease associated with an infection caused by HBV comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HBV RNAi agent comprises an antisense strand that consists of the nucleobase sequence (5'- ⁇ >3 ! )
- AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that consists of the nucleobase sequence (5'-»3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein a second HBV RNAi agent comprises an antisense strand that consists of the nucieobase sequence (5'->3 ! ) UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that consists of the nucieobase sequence (5' ⁇ >3')
- a disease associated with an infection caused by HBV comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein a first HB V RNAi agent comprises an antisense strand that consists of the nucieobase sequence (5'-»3') AGAAAAUU G AG AG AAGU C C AC (SEQ ID NO: 171), and a sense strand that consists of the nucieobase sequence (5' ⁇ >3 ! )
- a second HBV RNAi agent comprises an antisense strand that consists of the nucieobase sequence (5 ! ->3’)
- UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that consists of the nucieobase sequence (5 ⁇ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307).
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3’) UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a sense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ⁇ 3') GUGGUGGACUUCUCUCAAUAUU
- UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a sense strand that comprises the nucieobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).
- compositions that inhibits expression of an HBV gene in a cell
- the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HB V RNAi agent are modified nucleotides, and wherein the first HB V RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 !
- UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and wherein the second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'QG) UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! -»3') C U GU AGGC AU AAAUU GGU A (SEQ ID NO: 292).
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are m odified and/or all or substantially all of the nucleotides in the anti sense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 !
- the second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ! -»3') UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a sense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'-»3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292).
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modi fied and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5' ⁇ 3’) AGAAAAUUGAGAGAAGUCCAC (SEQ It) NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') GUGGACUUCUCUCUC
- UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328).
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5’ ⁇ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1,
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3’) AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'-»3') AG A A A AUU G AG AG A AGU C C AC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') GUGGACUUC
- UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 162), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') GCCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294).
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5’- 3 r ) GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302);
- RNAi agents comprising an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'-»3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') GUGGACUUCUCUCAAU
- UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3')
- GU GGU GGACUU CU CU C A AU AUU (SEQ ID NO: 307).
- the composition comprises two HBV RNAi agents, wherein all or substantially ail of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HB V RNAi agent comprises an antisense strand that comprises the nuc!eobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 !
- AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, l, 2 or 3 nucleobases from the sequence (5'->3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3')
- RNAi agents comprising an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the anti sense strand in the first and/or second HB RNAi agent are modified nucleotides, and wherein the first HBV R Ai agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') AGAAAAUUGAGAGAAGUCCAC (
- RNAi agents comprising administering a composition that inhibits expression of an HB V gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, L 2 or 3 nucleobases from the sequence (5' ⁇ 3’) UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence '->3') GUGGUGGACUUCUCUCAAU
- UACCAAUUUAUGCCUACAGUU (SEQ ID NO: 154), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292), and wherein the sense strand of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand compri sing N-acetyl -galactosamine .
- compositions that inhibits expression of an HBV gene in a cell
- the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides
- the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 !
- the second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') UACCAAUUUAUGCCUAC AGUU (SEQ ID NO: 154), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ »3') CUGUAGGCAUAAAUUGGUA (SEQ ID NO: 292), and wherein the sense strand of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl -gal
- RNAi agents comprising an antisense strand that comprises the nueleobase sequence differing by 0, I, 2 or 3 nucleobases from the sequence (5'->3') UAUUGAGAGAAGUCCACCACUU (SEQ ID NO: 175), and a sense strand that comprises the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307); and where
- HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3’) AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi
- UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a sense strand that comprises the nueleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328), and wherein the sense strand of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand compri sing N-acetyl -galactosamine .
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a ceil, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5’- 3 r ) GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302)
- RNAi agents comprising an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 !
- the second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'Q>3') UACCAAUUUAUGCCUACAGCG (SEQ ID NO: 188), and a sense strand that comprises the nucleobase sequence differing by 0, l, 2 or 3 nucleobases from the sequence (5' >3') CGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 328), and wherein the sense strand of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand compri sing N-acetyl -galactosamine .
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') AGAAA AUU G AG AG AAGU CC AC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ »3') GUGGACUUCUCUCUC
- UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5 ⁇ O') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294), and wherein the sense strand of the first HB V RNAi agent and the second HB V RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosaniine.
- RNAi agents comprising administering a composition that inhibits expression of an HB V gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'ri»3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'- ⁇ 3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 30
- compositions that inhibits expression of an HBV gene in a cell
- the composition comprises two HBV RNAi agents, wherein ail or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides
- the first HB V RNAi agent comprises an antisense strand that comprises the nuc!eobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'->3 !
- AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein the second HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, l 2 or 3 nucleobases from the sequence (5'->3') UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') GGCUGUAGGCAUAAAUUGGUA (SEQ ID NO: 294), and wherein the sense strand of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-ga
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1 , 2 or 3 nucleobases from the sequence (5'-»3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'OG) GUGGACUUCUCUCAAUUUUU
- UACCAAUUUAUGCCUACAGCC (SEQ ID NO: 162), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ >3') GUGGUGGACUUCUCUCAAUAUU (SEQ ID NO: 307), and wherein the sense strand of the first HBV RNAi agent and the second HBV RNAi agent are conjugated to a targeting ligand comprising N-acetyl-galactosamine.
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the anti sense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' ⁇ 3') AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5'-»3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and where
- RNAi agents comprising administering a composition that inhibits expression of an HBV gene in a cell, wherein the composition comprises two HBV RNAi agents, wherein all or substantially all of the nucleotides in the sense strand are modified and/or all or substantially all of the nucleotides in the antisense strand in the first and/or second HBV RNAi agent are modified nucleotides, and wherein the first HBV RNAi agent comprises an antisense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases from the sequence (5' >3’) AGAAAAUUGAGAGAAGUCCAC (SEQ ID NO: 171), and a sense strand that comprises the nucleobase sequence differing by 0, 1, 2 or 3 nucleobases fro the sequence (5'-»3') GUGGACUUCUCUCAAUUUUCU (SEQ ID NO: 302); and wherein
- the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to ADQ5070 administered to a subject in need thereof is about 1 : 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 1 :2.
- the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 1 : 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 1 :2.
- the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 1 : 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD05Q70 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04872 to AD05070 administered to a subject in need thereof is about 1 :2.
- AD04872 and AD05070 are administered in a combined amount of about 25-400 mg per dose administration. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 25-50 mg, 50-75 mg, 75-100 mg, 100-125 mg, 125-150 mg, 150-175 mg, 175-200 mg, 200-225 mg, 225-250 mg, 250-275 mg, 275-300 mg, 300-325 mg, 325-350 mg, 350-375 mg, 375-400 mg, 25-75 mg, 50-100 mg, 100-150 mg, 150-200 mg, 200-250 mg, 250-300 mg, 300-350 mg, 350-400 mg, 25-100 mg, 50-150 mg, 100-200 mg, 150-250 mg, 200-300 mg, 300-400 mg, 25-200 mg, or 200-400 mg per dose administration.
- AD04872 and AD05070 are administered in a combined amount of about 30-50 mg, about 90-110 mg, or about 190-210 mg per dose administration. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 30-50 mg per dose administration. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 90-1 10 rng per dose administration. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 190-210 rng per dose administration.
- AD04872 to AD05070 are administered in a combined amount of about 25 mg, about 50 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 225 rng, about 250 mg, about 275 mg, about 300 mg, about 325 mg, about 350 mg, about 375 mg, or about 400 mg per dose administration.
- AD04872 and AD05070 are administered in a combined amount of about 50 mg, about 75 mg, about 100 mg, or about 125 mg per dose administration.
- AD04872 and AD05070 are administered in a combined amount of about 35 mg, about 50 mg, about 100 mg, or about 125 mg per dose administration.
- AD04872 and AD05070 are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per dose administration. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 40 rng per dose administration. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 100 mg per dose
- AD04872 and AD05070 are administered in a combined amount of about 200 mg per dose administration. In some embodiments,
- AD04872 and AD05070 are administered in about 7-day, about 14-day, about 21 -day or about 28-day intervals. In some embodiments, AD04872 and AD05070 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD05Q70 are administered in a combined amount of about 40 mg, about 100 mg or about 200 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 40 mg per dose administration in 28-day intervals or about 28-day intervals (i.e ,
- AD04872 and AD05070 are administered in a combined amount of about 100 nig per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 200 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 and AD05070 are administered in about 1-18 week intervals. In some embodiments, AD04872 and AD05070 are administered in about 1- week intervals, about 2-week intervals, about 3 -week intervals, about 4-week intervals, about 5 -week intervals, about 6-week intervals, about 7-week intervals, about 8-week intervals, about 9-week intervals, about 10-week intervals, about 11 -week intervals, about 12-week intervals, about 13 -week intervals, about 14-week intervals, about 15-week intervals, about 16-week intervals, about 17-week intervals, or about 18-week intervals. In some embodiments, AD04872 and AD05070 are administered in about 1-18 week intervals. In some embodiments, AD04872 and AD05070 are administered in about 1- week intervals, about 2-week intervals, about 3 -week intervals, about 4-week intervals, about 5 -week intervals, about 6-week intervals, about 7-week intervals, about 8-week interval
- AD04872 and AD05070 are administered in about 1-6 month intervals. In some embodiments, AD04872 and ADG5070 are administered in about 1- month intervals, about 2-month intervals, about 3-month intervals, about 4-month intervals, about 5 -month intervals, or about 6-month intervals. In some embodiments, AD04872 and ADG5070 are administered in about 4-week intervals or 1 -month intervals. In some embodiments,
- AD04872 and AD05070 are administered in about 7-day, 14-day, 21-day or 28-day intervals. In some embodiments, AD04872 and ADQ5070 are administered in about 28-day intervals. [Q154] In some embodiments, AD04872 and AD05070 are administered for a duration of about 1-12 months. In some embodiments, AD04872 and AD05070 are administered for a duration of at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months or at least about 12 months.
- AD04872 and AD05070 are administered for a duration of about 1-18 weeks. In some embodiments, AD04872 and AD05070 are administered for a duration of at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks, at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about 18 weeks. In some embodiments, AD04872 and AD05070 are administered for a duration of about 12 weeks or 3 months.
- AD04872 and AD05070 are administered in a combined amount of about 25-75 mg per dose administration and in the ratio of about 2: 1, about 3:1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 50-125 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 75- 150 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- AD04872 and AD05070 are administered in a combined amount of about 100-200 mg per dose administration and in the ratio of about 2: 1, about 3: 1 , about 1 : 1, about 4: 1, about 5:1 or about 1 :2. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 150-250 mg per dose
- AD04872 and AD05070 are administered in a combined amount of about 200-300 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- AD04872 and AD05070 are admini stered in a combined amount of about 300-400 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- AD04872 and AD05070 are administered in a combined amount of about 50- 100 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4:1, about 5: 1 or about 1 :2. In some embodiments, AD04872 and AJ305Q70 are administered in a combined amount of about 25-400 mg per dose administration and in the ratio of about 2: 1.
- AD04872 and AD05070 are administered in a combined amount of about 25-75 mg per dose administration and in the ratio of about 2: 1 In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 50-125 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 75-150 mg per dose
- AD04872 and AD05070 are administered in a combined amount of about 100-200 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 125-225 mg per dose administration and in the ratio of about 2:1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 150-250 g per dose administration and in the ratio of about 2: 1. In some embodiments, ADQ4872 and AD05070 are administered in a combined amount of about 200- 300 mg per dose administration and in the ratio of about 2: 1. In some embodiments,
- AD04872 and AD05070 are administered in a combined amount of about 300-400 g per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 35 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are
- AD04872 and AD05070 are administered in a combined amount of about 100 mg per dose administration and in the ratio of about 2: 1.
- ADG4872 and AD05070 are administered in a combined amount of about 200 mg per dose administration and in the ratio of about 2: 1.
- AD04872 and AD05070 are administered in a combined amount of about 300 mg per dose
- AD04872 and AD05070 are administered in a combined amount of about 400 g per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD05070 are administered in about 7-day, about 14-day, about 21 -day or about 28-day intervals. In some embodiments,
- AD04872 and AD0507G are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 and AD05070 are administered in a combined amount of about 40 mg, about 100 mg or about 200 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals.
- AD04872 and AD0507G are administered in a combined amount of about 40 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e , Q4W).
- AD04872 and AD0507Q are administered in a combined amount of about 100 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 200 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 is administered in an amount of about 3-650 mg, and AD05070 is administered in an amount of about 2-325 mg per dose administration. In some embodiments, AD04872 is administered in an amount of about 35-265 mg per dose administration. In some embodiments, AD04872 is administered in an amount of about 50- 75 rng per dose administration. In some embodiments, AD05070 is administered in an amount of about 20-125 mg per dose administration. In some embodiments, AD05070 is administered in an amount of about 25-50 mg per dose administration. Q157] In some embodiments, AD04872 and AD05070 are administered in a combined amount of about 1-10 mg/kg per dose administration. In some embodiments, AD04872 and AD05Q70 are administered in a combined amount of about 1-5 mg/kg per dose
- AD04872 and AD05070 are administered in a combined amount of about 1 -1.5 mg/kg, about 1 .5-2.0 mg/kg, about 2.0-2.5 mg/kg, about 2.5-3.0 mg/kg, about 3.0-3.5 mg/kg, about 3.5-4.0 mg/kg, about 4.0-4.5 mg/kg, about 4.5-5.0 mg/kg, about 5 0-5.5 mg/kg, about 5.5-6.0 mg/kg, about 6.0-6.5 mg/kg, about 6.5-7.0 mg/kg, about 7.0-7.5 mg/kg, about 7.5-8.0 mg/kg, about 8.0-8.5 mg/kg, about 8.5-9.0 mg/kg, about 9.0-9.5 mg/kg, about 9.5-10 mg/kg, about 1-2.5 mg/kg, about 2.5-5.0 mg/kg, about 5.0-7.5 mg/kg, about 7.5-10 mg/kg, about 1-5.0 mg/kg, or about 5.0-10 mg/kg per dose
- AD05070 is administered in an amount of about 0.3-5 mg/kg per dose administration, and AD04872 is administered in an amount of about 0.6-7 mg/kg per dose administration. In some embodiments, AD05070 is administered in an amount of about 0.5-2.5 mg/kg per dose administration. In some embodiments, AD05070 is administered in an amount of about 0.3- 1.5 mg/kg per dose administration. In some embodiments, AD04872 is administered in an amount of about 0.6-5 mg/kg per dose administration. In some embodiments, AD04872 is administered in an amount of about 1-2.5 mg/kg per dose administration.
- AD04872 and AD05070 are administered at a combined dose of 25-400 mg per dose administration. In an embodiment, AD04872 and AD05070 are administered at a combined dose of 25-400 mg, and AD04872 is administered with AD05070 at a ratio of 1 : 1. In an embodiment, the dose of AD04872 is administered with ADQ5070 is in an amount of about 12 mg for a combined dose of about 25 mg. In an embodiment, the dose of each of AD04872 and AD05070 is in an amount of about 17 mg for a combined dose of about 35 mg. In an embodiment, the dose of each of AD04872 and AD05070 is in an amount of about 20 mg for a combined dose of about 40 mg.
- the dose of each of AD04872 and AD05070 is in an amount of about 25 mg for a combined dose of about 50 mg. In an embodiment, the dose of each of AD04872 and AD05070 is in an amount of about 50 mg for a combined dose of about 100 mg. In an embodiment, the dose of each of AD04872 and AD05070 is in an amount of about 100 mg for a combined dose of about 200 mg. In an embodiment, the dose of each of AD04872 and ADQ5070 is in an amount of about 150 mg for a combined dose of about 300 mg. In an embodiment, the dose of each of AD04872 and AD0507Q is in an amount of about 200 mg for a combined dose of about 400 mg.
- AD04872 and ADQ5070 are administered in about 7-day, about 14-day, about 21 -day or about 28-day intervals. In some embodiments, AD04872 and AD05Q70 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In an embodiment, the dose of each of ADQ4872 and AD05070 is in an amount of about 20 mg for a combined dose of about 40 mg, or in an amount of about 50 mg for a combined dose of about 100 mg, or in an amount of about 100 mg for a combined dose of about 200 mg, and AD04872 and AD05070 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of each of AD04872 and AD05070 is in an amount of about 20 mg for a combined dose of about 40 mg and AD04872 and AD05070 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In an embodiment, the dose of each of AD04872 and AD05070 is in an amount of about 50 mg for a combined dose of about 100 mg and ADQ4872 and AD05Q70 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of each of AD04872 and AD05070 is in an amount of about 100 mg for a combined dose of about 200 mg and AD04872 and AD05070 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 and AD05070 are administered at a combined dose of 25-400 mg per dose, and AD05070 is administered with AD04872 at a ratio of J :2.
- the dose of AD04872 is in an amount of about 16 mg, and the dose of AD05070 is in an amount of about 8 mg for a combined dose of about 25 mg.
- the dose of AD05070 is in an amount of about 12 mg, and the dose of the AD04872 is in an amount of about 24 mg for a combined dose of about 35 mg.
- the dose of AD05070 is in an amount of about 13 mg, and the dose of the AD04872 is in an amount of about 27 mg for a combined dose of about 40 mg. In an embodiment, the dose of AD04872 is in an amount of about 33 mg, and the dose of AD05070 is in an amount of about 17 mg for a combined dose of about 50 mg. In an embodiment, the dose of AD0507Q is in an amount of about 35 mg, and the dose of AD04872 is in an amount of about 65 mg for a combined dose of about 100 mg. In an embodiment, the dose of AD05070 is in an amount of about 67 mg, and the dose of AD04872 is in an amount of about 133 mg for a combined dose of about 200 mg.
- the dose of the ADG5070 is in an amount of about 100 mg, and the dose of AD04872 is in an amount of about 200 mg for a combined dose of about 300 mg.
- the dose of AD05070 is in an amount of about 135 mg, and the dose of AD04872 is in an amount of about 270 mg for a combined dose of about 400 mg.
- AD04872 and AD05070 are administered in about 7-day, about 14-day, about 21-day or about 28-day intervals.
- AD04872 and AD0507Q are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD05Q70 is in an amount of about 13 mg, and the dose of the AD04872 is in an amount of about 27 mg for a combined dose of about 40 mg, and AD04872 and AD05070 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD05070 is in an amount of about 35 mg, and the dose of AD04872 is in an amount of about 65 mg for a combined dose of about 100 mg, and AD04872 and AD05070 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD05070 is in an amount of about 67 mg, and the dose of AD04872 is in an amount of about 133 mg for a combined dose of about 200 mg, and AD04872 and AD05070 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 and AD05070 are administered at a combined dose of 25-400 mg per dose, AD05070 is administered with AD04872 at a ratio of 1 :3.
- the dose of AD04872 is in an amount of about 18 mg, and the dose of AD05070 is in an amount of about 6 mg for a combined dose of about 25 mg.
- the dose of AD05070 is in an amount of about 9 mg, and the dose of AD04872 is in an amount of about 27 mg for a combined dose of about 35 mg.
- the dose of AD05070 is in an amount of about 10 mg, and the dose of AD04872 is in an amount of about 30 mg for a combined dose of about 40 mg.
- the dose of AD04872 is in an amount of about 36 mg, and the dose of AD05070 is in an amount of about 12 mg for a combined dose of about 50 mg. In an embodiment, the dose of AD05070 is in an amount of about 25 mg, and the dose of AD04872 is in an amount of about 75 mg for a combined dose of about 100 mg. In an embodiment, the dose of AD05070 is in an amount of about 50 mg, and the dose of AD04872 is in an amount of about 150 mg for a combined dose of about 200 mg. In an embodiment, the dose of AD0507Q is in an amount of about 75 g, and the dose of AD04872 is in an amount of about 225 mg for a combined dose of about 300 mg. In an embodiment, the dose of AD05070 is in an amount of about 100 mg, and the dose of AD05070 is in an amount of about 25 mg, and the dose of AD04872 is in an amount of about 75 mg for a combined dose of about 100 mg. In an embodiment, the dose of AD0
- AD04872 is in an amount of about 300 mg for a combined dose of about 400 mg. In some embodiments, AD04872 and AD05070 are administered in about 7-day, about 14-day, about 21 -day or about 28-day intervals. In some embodiments, AD04872 and AD05070 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In an embodiment, the dose of AD05070 is in an amount of about 10 mg, and the dose of ADQ4872 is in an amount of about 30 mg for a combined dose of about 40 mg, and AD04872 and AD05070 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD05070 is in an amount of about 25 mg, and the dose of AD04872 is in an amount of about 75 mg for a combined dose of about 100 mg, and AD04872 and AD05070 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD05070 is in an amount of about 50 mg, and the dose of AD04872 is in an amount of about 150 mg for a combined dose of about 200 mg, and AD04872 and AD05070 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- about 1 mg/kg (mpk) of AD04872 and about 1 mg/kg of AD05070 are administered to a subject in need thereof.
- about 1.5 mg/kg of AD04872 and about 1.5 mg/kg of AD05070 are administered to a subject in need thereof.
- about 2.0 mg/kg of AD04872 and about 1.0 mg/kg of AD05070 are administered to a subject in need thereof.
- about 3.0 mg/kg of AD04872 and about 1.0 mg/kg of AD05070 are administered to a subject in need thereof.
- about 3.2 mg/kg of AD04872 and about 0.8 mg/kg of AD05070 are administered to a subject in need thereof. In some embodiments, about 2.7 mg/kg of AD04872 and about 1.3 mg/kg of AD0507Q are administered to a subject in need thereof. In some embodiments, about 4.0 mg/kg of AD04872 and about 1.0 mg/kg of AD05070 are administered to a subject in need thereof. In some embodiments, about 3.3 mg/kg of AD04872 and about 1.7 mg/kg of AD05070 are administered to a subject in need thereof.
- between about 0.05 and about 5 mg/kg of AD04872 and between about 0.05 and about 5 mg/kg of AD05070 are administered to a subject in need thereof. In some embodiments, about AD04872 and about AD05070 are administered separately (e.g., in separate injections). In some embodiments, the respective dose of
- AD04872 and the respective dose of AD05070 are administered together (e.g., in the same injection).
- the respective dose of AD04872 and the respective dose of AD05Q70 are prepared in a single pharmaceutical composition.
- the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of ADQ4872 to AD04776 administered to a subject in need thereof is about 4:1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 1 : 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 5: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 1 :2.
- the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 1 : 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 5: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 1 :2.
- the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is about 1 : 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 5: 1. In some embodiments, the ratio of AD04872 to AD04776 administered to a subject in need thereof is 1 :2.
- AD04872 and AD04776 are administered in a combined amount of about 25-400 mg per dose administration. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 25-50 mg, 50-75 mg, 75-100 mg, 100-125 mg, 125-150 mg, 150-175 mg, 175-200 mg, 200-225 mg, 225-250 mg, 250-275 mg, 275-300 mg, 300-325 mg, 325-350 mg, 350-375 mg, 375-400 mg, 25-75 mg, 50-100 mg, 100-150 mg, 150-200 mg, 200-250 mg, 250-300 mg, 300-350 mg, 350-400 mg, 25-100 mg, 50-150 mg, 100-200 mg, 150-250 mg, 200-300 mg, 300-400 mg, 25-200 mg, or 200-400 mg per dose administration.
- AD04872 and AD04776 are administered in a combined amount of about 30-50 mg, about 90-110 mg, or about 190-210 mg per dose administration. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 30-50 mg per dose administration. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 90-110 mg per dose administration. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 190-210 mg per dose administration.
- AD04872 and ADQ4776 are administered in a combined amount of about 25 mg, about 50 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 225 mg, about 250 mg, about 275 mg, about 300 mg, about 325 mg, about 350 mg, about 375 mg, or about 400 mg per dose administration.
- AD04872 and AD04776 are administered in a combined amount of about 50 mg, about 75 mg, about 100 mg, or about 125 mg per dose administration.
- AD04872 and AD04776 are administered in a combined amount of about 35 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg or about 400 mg per dose administration.
- a combined amount of about 35 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg or about 400 mg per dose administration are administered in some embodiments,
- AD04872 and AD04776 are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per dose administration. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per dose administration. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per dose administration. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per dose administration. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per dose administration. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per dose administration. In some embodiments, AD04872 and
- AD04776 are administered in a combined amount of about 40 mg per dose administration. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 100 mg per dose administration. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 200 mg per dose administration. In some embodiments, AD04872 and AD04776 are administered in about 7-day, about 14-day, about 21 -day or about 28-day intervals. In some embodiments, AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In some
- AD04872 and AD04776 are administered in a combined amount of about 40 mg, about 100 mg or about 200 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04776 are
- AD04872 and AD04776 are administered in a combined amount of about 100 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 200 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 and AD04776 are administered in about 1-18 week intervals. In some embodiments, AD04872 and AD04776 are administered in about 1- week intervals, about 2-week intervals, about 3 -week intervals, about 4-week intervals, about 5 -week intervals, about 6-week intervals, about 7-week intervals, about 8-week intervals, about 9-week intervals, about 10-week intervals, about 1 1 -week intervals, about 12-week intervals, about 13-week intervals, about 14-week intervals, about 15-week intervals, about 16-week intervals, about 17-week Intervals, or about 18-week intervals. In some embodiments, AD04872 and AD04776 are administered in about 1-18 week intervals. In some embodiments, AD04872 and AD04776 are administered in about 1- week intervals, about 2-week intervals, about 3 -week intervals, about 4-week intervals, about 5 -week intervals, about 6-week intervals, about 7-week intervals, about 8-week
- AD04872 and AD04776 are administered in about 1-6 month intervals. In some embodiments, AD04872 and AD04776 are administered in about 1- month intervals, about 2-month intervals, about 3- month intervals, about 4- month intervals, about 5- month intervals, or about 6- month intervals. In some embodiments, AD04872 and AD04776 are administered in about 4-week intervals or 1 -month intervals. In some embodiments,
- AD04872 and AD04776 are administered in about 7-day, 14-day, 21 -day or 28-day intervals. In some embodiments, AD04872 and ADQ4776 are administered in about 28-day intervals (i.e., Q4W).
- AD04872 and AD04776 are administered for a duration of about 1-12 months. In some embodiments, AD04872 and AD04776 are administered for a duration of at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months or at least about 12 months. In some embodiments, AD04872 and AD04776 are administered for a duration of about 1-18 weeks.
- AD04872 and AD04776 are administered for a duration of at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks, at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about 18 weeks. In some embodiments, AD04872 and AD04776 are administered for a duration of about 12 weeks or 3 months.
- AD04872 and AD04776 are administered in a combined amount of about 25-75 mg per dose administration and in the ratio of about 2: 1, about 3:1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 50-125 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 75- 150 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- AD04872 and AD04776 are administered in a combined amount of about 100-200 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5:1 or about 1 :2. In some embodiments, ADQ4872 and AD04776 are administered in a combined amount of about 150-250 mg per dose
- AD04872 and AD04776 are administered in a combined amount of about 200-300 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 300-400 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- AD04872 and AD04776 are administered in a combined amount of about 50- 100 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4:1, about 5: 1 or about 1 :2. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 25-400 mg per dose administration and in the ratio of about 2: 1.
- AD04872 and AD04776 are administered in a combined amount of about 25-75 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 50-125 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 75-150 mg per dose
- AD04872 and AD04776 are administered in a combined amount of about 100-200 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 125-225 mg per dose administration and in the ratio of about 2:1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 150-250 mg per dose administration and in the ratio of about 2: 1. In some
- AD04872 and AD04776 are administered in a combined amount of about 200- 300 mg per dose administration and in the ratio of about 2:1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 300-400 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 35 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are
- AD04872 and AD04776 are administered in a combined amount of about 100 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 200 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 300 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 400 mg per dose administration and in the ratio of about 2: 1. In some embodiments, ADQ4872 and AD04776 are administered in about 7-day, about 14-day, about 21-day or about 28-day intervals. In some embodiments,
- AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 40 mg, about 100 mg or about 200 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 40 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 and ADQ4776 are administered in a combined amount of about 100 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 200 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 is administered in an amount of about 3-650 mg, and AD04776 is administered in an amount of about 2-325 mg per dose administration. In some embodiments, AD04872 is administered in an amount of about 35-265 mg per dose administration. In some embodiments, AD04872 is administered in an amount of about 50- 75 mg per dose administration. In some embodiments, AD04776 is administered in an amount of about 20-125 mg per dose administration. In some embodiments, AD04776 is administered in an amount of about 25-50 mg per dose administration.
- AD04872 and AD04776 are administered in a combined amount of about 1-10 mg/kg per dose administration. In some embodiments, AD04872 and AD04776 are administered in a combined amount of about 1-5 mg/kg per dose
- AD04872 and AD04776 are administered in a combined amount of about 1-1.5 mg/kg, about 1.5-2.0 mg/kg, about 2.0-2.5 mg/kg, about 2.5-3.0 mg/kg, about 3.0-3.5 mg/kg, about 3.5-4.0 mg/kg, about 4.0-4.5 mg/kg, about 4.5-5.0 mg/kg, about 5.0-5.5 mg/kg, about 5.5-6.0 mg/kg, about 6.0-6.5 mg/kg, about 6.5-7.0 mg/kg, about 7.0-7.5 mg/kg, about 7.5-8.0 mg/kg, about 8 0-8.5 mg/kg, about 8.5-9.0 mg/kg, about 9 0-9.5 nig/kg, about 9.5-10 mg/kg, about 1-2.5 mg/kg, about 2 5-5 0 mg /' kg, about 5.0-7.5 mg/kg, about 7.5-10 mg/kg, about 1-5.0 mg/kg, or about 5.0-10 mg/kg per dose
- AD04776 is administered in an amount of about 0.3-5 mg/kg per dose administration, and AD04872 is administered in an amount of about 0.6-7 mg/kg per dose administration. In some embodiments, AD04776 is administered in an amount of about 0.5-2.5 mg per dose administration. In some embodiments, AD04776 is administered in an amount of about 0 3-1 5 mg per dose administration. In some
- AD04872 is administered in an amount of about 0.6-5 mg per dose
- AD04872 is administered in an amount of about 1-2.5 mg per dose administration.
- AD04872 and AD04776 are administered at a combined dose of 25-400 mg per dose administration. In an embodiment, AD04872 and AD04776 are administered at a combined dose of 25-400 mg, and AD04872 is administered with AD04776 at a ratio of 1 : 1. In an embodiment, the dose of each of AD04872 and AD04776 is in an amount of about 12 mg for a combined dose of about 25 mg. In an embodiment, the dose of each of AD04872 and AD04776 is in an amount of about 17 mg for a combined dose of about 35 mg. In an embodiment, the dose of each of AD04872 and AD04776 is in an amount of about 20 mg for a combined dose of about 40 mg.
- the dose of each of AD04872 and AD04776 is in an amount of about 25 mg for a combined dose of about 50 mg. In an embodiment, the dose of each of AD04872 and AD04776 is in an amount of about 50 mg for a combined dose of about 100 mg. In an embodiment, the dose of each of AD04872 and AD04776 is in an amount of about 100 mg for a combined dose of about 200 mg. In an embodiment, the dose of each of AD04872 and AD04776 is in an amount of about 150 mg for a combined dose of about 300 mg. In an embodiment, the dose of each of AD04872 and AD04776 is in an amount of about 200 mg for a combined dose of about 400 mg.
- AD04872 and AD04776 are administered in about 7-day, about 14-day, about 21 -day or about 28-day intervals. In some embodiments, AD04872 and ADQ4776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In an embodiment, the dose of each of AD04872 and AD04776 is in an amount of about 20 mg for a combined dose of about 40 mg, or in an amount of about 50 mg for a combined dose of about 100 mg, or in an amount of about 100 mg for a combined dose of about 200 mg, and AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of each of AD04872 and AD04776 is in an amount of about 20 mg for a combined dose of about 40 mg and AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In an embodiment, the dose of each of AD04872 and AD04776 is in an amount of about 50 mg for a combined dose of about 100 mg and AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of each of AD04872 and AD04776 is in an amount of about 100 mg for a combined dose of about 200 mg and AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 and AD04776 are administered at a combined dose of 25-400 mg per dose, and AD04776 is administered with ADQ4872 at a ratio of 1 :2.
- the dose of AD04872 is in an amount of about 16 mg, and the dose of AD04776 is in an amount of about 8 mg for a combined dose of about 25 mg.
- the dose of AD04776 is in an amount of about 12 mg, and the dose of the AD04872 is in an amount of about 24 mg for a combined dose of about 35 mg.
- the dose of AD04776 is in an amount of about 13 mg, and the dose of the AD04872 is in an amount of about 27 mg for a combined dose of about 40 mg.
- the dose of AD04872 is in an amount of about 33 mg, and the dose of AD04776 is in an amount of about 17 mg for a combined dose of about 50 mg. In an embodiment, the dose of AD04776 is in an amount of about 35 mg, and the dose of AD04872 is in an amount of about 65 mg for a combined dose of about 100 mg. In an embodiment, the dose of AD04776 is in an amount of about 67 mg, and the dose of AD04872 is in an amount of about 133 mg for a combined dose of about 200 mg. In an embodiment, the dose of the AD04776 is in an amount of about 100 mg, and the dose of AD04872 is in an amount of about 200 mg for a combined dose of about 300 mg.
- the dose of AD04776 is in an amount of about 135 mg, and the dose of AD04872 is in an amount of about 270 mg for a combined dose of about 400 mg.
- AD04872 and AD04776 are administered in about 7-day, about 14-day, about 21-day or about 28-day intervals.
- AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04776 is in an amount of about 13 mg, and the dose of the AD04872 is in an amount of about 27 mg for a combined dose of about 40 mg, and AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04776 is in an amount of about 35 mg, and the dose of AD04872 is in an amount of about 65 mg for a combined dose of about 100 mg, and AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04776 is in an amount of about 67 mg, and the dose of AD04872 is in an amount of about 133 g for a combined dose of about 200 mg, and AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 and AD04776 are administered at a combined dose of 25-400 mg per dose, AD04776 is administered with AD04872 at a ratio of 1 :3.
- the dose of AD04872 is in an amount of about 18 mg, and the dose of AD04776 is in an amount of about 6 mg for a combined dose of about 25 mg.
- the dose of AD04776 is in an amount of about 9 mg, and the dose of AD04872 is in an amount of about 27 mg for a combined dose of about 35 mg. In an embodiment, the dose of AD04776 is in an amount of about 10 mg, and the dose of AD04872 is in an amount of about 30 mg for a combined dose of about 40 mg. In an embodiment, the dose of AD04872 is in an amount of about 36 mg, and the dose of AD04776 is in an amount of about 12 mg for a combined dose of about 50 mg. In an embodiment, the dose of AD04776 is in an amount of about 25 mg, and the dose of AD04872 is in an amount of about 75 mg for a combined dose of about 100 mg.
- the dose of AD04776 is in an amount of about 50 mg, and the dose of AD04872 is in an amount of about 150 mg for a combined dose of about 200 mg. In an embodiment, the dose of AD04776 is in an amount of about 75 mg, and the dose of AD04872 is in an amount of about 225 mg for a combined dose of about 300 mg. In an embodiment, the dose of AD04776 is in an amount of about 100 mg, and the dose of
- AD04872 is in an amount of about 300 mg for a combined dose of about 400 mg. In some embodiments, AD04872 and AD04776 are administered in about 7-day, about 14-day, about 21 -day or about 28-day intervals. In some embodiments, AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In an embodiment, the dose of AD04776 is in an amount of about 10 mg, and the dose of AD04872 is in an amount of about 30 mg for a combined dose of about 40 mg, and AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04776 is in an amount of about 25 mg, and the dose of AD04872 is in an amount of about 75 mg for a combined dose of about 100 mg, and AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04776 is in an amount of about 50 mg, and the dose of AD04872 is in an amount of about 150 mg for a combined dose of about 200 mg, and AD04872 and AD04776 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- about 1 mg/kg (mpk) of AD04872 and about 1 mg/kg of AD04776 are administered to a subject in need thereof. In some embodiments, about 1.5 mg/kg of AD04872 and about 1.5 mg/kg of AD04776 are administered to a subject in need thereof. In some embodiments, about 2.0 mg/kg of AD04872 and about 1.0 mg/kg of AD04776 are administered to a subject in need thereof. In some embodiments, about 3.0 mg/kg of AD04872 and about 1.0 mg/kg of AD04776 are administered to a subject in need thereof.
- about 3.2 mg/kg of AD04872 and about 0.8 mg/kg of AD04776 are administered to a subject in need thereof. In some embodiments, about 2.7 mg/kg of AD04872 and about 1.3 mg/kg of AD04776 are administered to a subject in need thereof. In some embodiments, about 4 0 mg/kg of ADQ4872 and about 1.0 mg/kg of AD04776 are administered to a subject in need thereof. In some embodiments, about 3.3 mg/kg of AD04872 and about 1.7 mg/kg of AD04776 are administered to a subject in need thereof.
- between about 0.05 and about 5 mg/kg of AD04872 and between about 0.05 and about 5 mg/kg of AD04776 are administered to a subject in need thereof.
- the respective doses of AD04872 and AD04776 are administered separately (e.g., in separate injections).
- the respective doses of ADQ4872 and AD04776 are administered together (e.g , in the same injection).
- the respective doses of AD04872 and AD04776 are prepared in a single pharmaceutical composition.
- the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 4:1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 1 : 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04872 to
- AD04982 administered to a subject in need thereof is 1 :2.
- the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 1 : 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is 1 :2.
- the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 1 : 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04872 to AD04982 administered to a subject in need thereof is 1 :2.
- AD04872 and AD04982 are administered in a combined amount of about 25-400 mg per dose administration. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 25-50 mg, 50-75 mg, 75-100 mg, 100-125 mg, 125-150 mg, 150-175 mg, 175-200 mg, 200-225 mg, 225-250 mg, 250-275 mg,
- AD04872 and AD04982 are administered in a combined amount of about 30-50 mg, about 90-110 mg, or about 190-210 mg per dose administration. In some embodiments, ADQ4872 and AD04982 are administered in a combined amount of about 30- 50 mg per dose administration. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 90-110 mg per dose administration. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 190- 210 mg per dose administration.
- AD04872 and AD04982 are administered in a combined amount of about 25 mg, about 50 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 225 mg, about 250 mg, about 275 mg, about 300 mg, about 325 mg, about 350 mg, about 375 mg, or about 400 mg per dose administration.
- AD04872 and L 1)04982 are administered in a combined amount of about 50 mg, about 75 mg, about 100 mg, or about 125 mg per dose administration.
- AD04872 and AD04982 are administered in a combined amount of about 35 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg or about 400 mg per dose administration.
- AD04872 and AD04982 are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per dose administration. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 40 mg per dose administration. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 100 mg per dose
- AD04872 and AD04982 are administered in a combined amount of about 200 mg per dose administration. In some embodiments,
- AD04872 and AD04982 are administered in about 7-day, about 14-day, about 21-day or about 28-day intervals. In some embodiments, AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 40 mg, about 100 mg or about 200 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 40 mg per dose administration in 28-day intervals or about 28-day intervals (i.e.,
- AD04872 and AD04982 are administered in a combined amount of about 100 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 200 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 and AD04982 are administered in about 1-18 week intervals. In some embodiments, AD04872 and AD04982 are administered in about 1- week intervals, about 2-week intervals, about 3-week intervals, about 4-week intervals, about 5 -week intervals, about 6-week intervals, about 7- week intervals, about 8-week intervals, about 9-week intervals, about 10-week intervals, about 11-week intervals, about 12-week intervals, about 13 -week intervals, about 14-week intervals, about 15-week intervals, about 16-week intervals, about 17-week intervals, or about 18-week intervals. In some embodiments, AD04872 and AD04982 are administered in about 1-18 week intervals. In some embodiments, AD04872 and AD04982 are administered in about 1- week intervals, about 2-week intervals, about 3-week intervals, about 4-week intervals, about 5 -week intervals, about 6-week intervals, about 7- week intervals, about 8-week intervals, about 9-
- AD04872 and AD04982 are administered in about 1-6 month intervals. In some embodiments, AD04872 and AD04982 are administered in about 1- month intervals, about 2-month intervals, about 3- month intervals, about 4- month intervals, about 5- month intervals, or about 6- month intervals. In some embodiments, AD04872 and AD04982 are administered in about 4-week intervals or 1 -month intervals. In some embodiments,
- AD04872 and ADQ4982 are administered in about 7-day, 14-day, 21 -day or 28-day intervals. In some embodiments, AD04872 and AD04982 are administered in about 28-day intervals (i.e., Q4W). Q182] In some embodiments, AD04872 and AD04982 are administered for a duration of about 1-12 months. In some embodiments, AD04872 and AD04982 are administered for a duration of at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 1 1 months or at least about 12 months.
- AD04872 and AD04982 are administered for a duration of about 1-18 weeks. In some embodiments, AD04872 and AD04982 are administered for a duration of at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks, at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about 18 weeks. In some embodiments, AD04872 and AD04982 are administered for a duration of about 12 weeks or 3 months.
- AD04872 and AD04982 are administered in a combined amount of about 25-75 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- AD04872 and AD04982 are admini stered in a combined amount of about 50-125 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- AD04872 and AD04982 are administered in a combined amount of about 75- 150 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 100-200 mg per dose administration and in the ratio of about 2:1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 150-250 mg per dose
- AD04872 and AD04982 are administered in a combined amount of about 200-300 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 300-400 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- ADQ4872 and AD04982 are administered in a combined amount of about 50- 100 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 25-400 mg per dose administration and in the ratio of about 2: 1.
- AD04872 and AD04982 are administered in a combined amount of about 25-75 mg per dose administration and in the ratio of about 2: 1 In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 50-125 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 75-150 mg per dose
- AD04872 and AD04982 are administered in a combined amount of about 100-200 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 125-225 mg per dose administration and in the ratio of about 2:1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 150-250 mg per dose administration and in the ratio of about 2: 1. In some
- AD04872 and AD04982 are administered in a combined amount of about 200- 300 mg per dose administration and in the ratio of about 2:1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 300-400 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 35 mg per dose administration and in the ratio of about 2:1. In some embodiments, AD04872 and AD04982 are
- AD04872 and AD04982 are administered in a combined amount of about 100 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 200 mg per dose administration and in the ratio of about 2: 1. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 300 mg per dose
- AD04872 and AD04982 are administered in a combined amount of about 400 mg per dose administration and in the ratio of about 2: 1
- AD04872 and L 1)04982 are administered in about 7-day, about 14-day, about 21-day or about 28-day intervals.
- AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 and AD04982 are administered in a combined amount of about 40 mg, about 100 mg or about 200 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 40 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 100 mg per dose administration, in the ratio of about 2: 1, and in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 200 mg per dose administration, in the ratio of about 2: 1 , and in 28-day intervals or about 28-day intervals (i.e , Q4W).
- AD04872 is administered in an amount of about 3-650 mg, and AD04982 is administered in an amount of about 2-325 mg per dose administration. In some embodiments, AD04872 is administered in an amount of about 35-265 mg per dose administration. In some embodiments, AD04872 is administered in an amount of about 50- 75 mg per dose administration. In some embodiments, AD04982 is administered in an amount of about 20-125 mg per dose administration. In some embodiments, AD04982 is administered in an amount of about 25-50 mg per dose administration.
- AD04872 and AD04982 are administered in a combined amount of about 1-10 mg/kg per dose administration. In some embodiments, AD04872 and AD04982 are administered in a combined amount of about 1-5 mg/kg per dose
- AD04872 and AD04982 are administered in a combined amount of about 1-1.5 mg/kg, about 1.5-2.0 mg/kg, about 2.0-2.5 mg/kg, about 2.5-3.0 mg/kg, about 3.0-3.5 mg/kg, about 3.5-4.0 mg/kg, about 4.0-4.5 mg/kg, about 4.5-5.0 mg/kg, about 5.0-5.5 mg/kg, about 5.5-6.0 mg/kg, about 6.0-6.5 mg.
- AD04982 is administered in an amount of about 0.3-5 mg/kg per dose administration, and AD04872 is administered in an amount of about 0.6-7 mg/kg per dose administration. In some embodiments, AD04982 is administered in an amount of about 0.5-2.5 mg/kg per dose administration. In some embodiments, AD04982 is administered in an amount of about 0.3- 1.5 mg/kg per dose administration. In some embodiments, AD04872 is administered in an amount of about 0.6-5 mg/kg per dose administration. In some embodiments, AD04872 is administered in an amount of about 1-2.5 mg/kg per dose administration
- AD04872 and AD04982 are administered at a combined dose of 25-400 mg per dose administration. In an embodiment, AD04872 and AD04982 are administered at a combined dose of 25-400 mg, and AD04872 is administered with AD04982 at a ratio of 1 : 1 In an embodiment, the dose of each of AD04872 and AD04982 is in an amount of about 12 mg for a combined dose of about 25 mg. In an embodiment, the dose of each of AD04872 and AD04982 is in an amount of about 17 mg for a combined dose of about 35 mg. In an embodiment, the dose of each of AD04872 and AD04982 is in an amount of about 20 mg for a combined dose of about 40 mg.
- the dose of each of AD04872 and ADG4982 is in an amount of about 25 mg for a combined dose of about 50 mg. In an embodiment, the dose of each of AD04872 and AD04982 is in an amount of about 50 mg for a combined dose of about 100 mg. In an embodiment, the dose of each of AD04872 and AD04982 is in an amount of about 100 mg for a combined dose of about 200 mg. In an embodiment, the dose of each of AD04872 and AD04982 is in an amount of about 150 mg for a combined dose of about 300 mg. In an embodiment, the dose of each of AD04872 and AD04982 is in an amount of about 200 mg for a combined dose of about 400 mg.
- AD04872 and AD04982 are administered in about 7-day, about 14-day, about 21-day or about 28-day intervals. In some embodiments, AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In an embodiment, the dose of each of AD04872 and AD04982 is in an amount of about 20 mg for a combined dose of about 40 mg, or in an amount of about 50 mg for a combined dose of about 100 mg, or in an amount of about 100 mg for a combined dose of about 200 mg, and AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of each of AD04872 and AD04982 is in an amount of about 20 mg for a combined dose of about 40 mg and AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of each of AD04872 and ADQ4982 is in an amount of about 50 mg for a combined dose of about 100 mg and AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of each of AD04872 and ADQ4982 is in an amount of about 100 mg for a combined dose of about 200 mg and AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 and AD04982 are administered at a combined dose of 25-400 rng per dose, and AD04982 is administered with AD04872 at a ratio of 1 :2.
- the dose of AD04872 is in an amount of about 16 mg, and the dose of AD04982 is in an amount of about 8 mg for a combined dose of about 25 mg.
- the dose of AD04982 is in an amount of about 12 mg, and the dose of the ADQ4872 is in an amount of about 24 mg for a combined dose of about 35 mg.
- the dose of AD04982 is in an amount of about 13 mg, and the dose of the AD04872 is in an amount of about 27 nig for a combined dose of about 40 nig. In an embodiment, the dose of AD04872 is in an amount of about 33 mg, and the dose of AD04982 is in an amount of about 17 mg for a combined dose of about 50 mg. In an embodiment, the dose of AD04982 is in an amount of about 35 mg, and the dose of AD04872 is in an amount of about 65 mg for a combined dose of about 100 mg. In an embodiment, the dose of AD04982 is in an amount of about 67 mg, and the dose of AD04872 is in an amount of about 133 mg for a combined dose of about 200 mg.
- the dose of the AD04982 is in an amount of about 100 mg, and the dose of AD04872 is in an amount of about 200 mg for a combined dose of about 300 mg. In an embodiment, the dose of AD04982 is in an amount of about 135 mg, and the dose of AD04872 is in an amount of about 270 mg for a combined dose of about 400 mg. In some embodiments, AD04872 and AD04982 are administered in about 7-day, about 14-day, about 21 -day or about 28-day intervals. In some embodiments, AD04872 and ADQ4982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04982 is in an amount of about 13 mg, and the dose of the AD04872 is in an amount of about 27 mg for a combined dose of about 40 mg, and AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04982 is in an amount of about 35 mg, and the dose of AD04872 is in an amount of about 65 mg for a combined dose of about 100 mg, and AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04982 is in an amount of about 67 mg, and the dose of AD04872 is in an amount of about 133 mg for a combined dose of about 200 mg, and AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04872 and AD04982 are administered at a combined dose of 25-400 mg per dose, AD04982 is administered with AD04872 at a ratio of 1 :3.
- the dose of AD04872 is in an amount of about 18 mg, and the dose of AD04982 is in an amount of about 6 mg for a combined dose of about 25 mg.
- the dose of AD04982 is in an amount of about 9 mg, and the dose of AD04872 is in an amount of about 27 mg for a combined dose of about 35 mg.
- the dose of AD04982 is in an amount of about 10 mg, and the dose of AD04872 is in an amount of about 30 mg for a combined dose of about 40 mg.
- the dose of AD04872 is in an amount of about 36 mg, and the dose of AD04982 is in an amount of about 12 mg for a combined dose of about 50 mg. In an embodiment, the dose of AD04982 is in an amount of about 25 mg, and the dose of AD04872 is in an amount of about 75 mg for a combined dose of about 100 nig. In an embodiment, the dose of AD04982 is in an amount of about 50 mg, and the dose of AD04872 is in an amount of about 150 mg for a combined dose of about 200 mg. In an embodiment, the dose of AD04982 is in an amount of about 75 mg, and the dose of AD04872 is in an amount of about 225 rng for a combined dose of about 300 rng.
- the dose of AD04982 is in an amount of about 100 mg, and the dose of AD04872 is in an amount of about 300 mg for a combined dose of about 400 mg.
- AD04872 and AD04982 are administered in about 7-day, about 14-day, about 21 -day or about 28-day intervals.
- AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04982 is in an amount of about 10 mg, and the dose of AD04872 is in an amount of about 30 mg for a combined dose of about 40 mg, and AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04982 is in an amount of about 25 mg, and the dose of AD04872 is in an amount of about 75 mg for a combined dose of about 100 mg, and AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04982 is in an amount of about 50 mg, and the dose of AD04872 is in an amount of about 150 mg for a combined dose of about 200 mg, and AD04872 and AD04982 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- about l mg/kg (mpk) of AD04872 and about l g/kg of AD04982 are administered to a subject in need thereof.
- about 1.5 mg/kg of AD04872 and about 1.5 mg/kg of AD04982 are administered to a subject in need thereof.
- about 2.0 g/kg of AD04872 and about 1.0 mg/kg of AD04982 are administered to a subject in need thereof.
- about 3.0 mg/kg of AD04872 and about 1.0 mg/kg of AD04982 are administered to a subject in need thereof.
- about 3.2 mg/kg of AD04872 and about 0.8 mg/kg of AD04982 are administered to a subject in need thereof.
- about 2 7 mg/kg of AD04872 and about 1.3 mg/kg of ADQ4982 are administered to a subject in need thereof.
- about 4.0 mg/kg of AD04872 and about 1.0 mg/kg of AD04982 are administered to a subject in need thereof.
- about 3.3 mg/kg of AD04872 and about 1.7 mg/kg of AD04982 are administered to a subject in need thereof.
- between about 0.05 and about 5 mg/kg of AD04872 and between about 0.05 and about 5 mg/kg of AD04982 are administered to a subject in need thereof.
- the respective doses of AD04872 and AD04982 are administered separately (e.g., in separate injections).
- the respective doses of ADQ4872 and AD04982 are administered together (e.g , in the same injection).
- the respective doses of ADQ4872 and AD04982 are prepared in a single pharmaceutical composition.
- disclosed herein are methods of treatment of an HBV infection or prevention of disease or symptoms caused by an HBV infection comprising administering to a subject in need thereof an effective amount of AD04580 and an effective amount of AD04585.
- the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 2: 1.
- the ratio of AD04580 to AD04585 administered to a subject in need thereof is about V I .
- the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 4: 1.
- the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 5: 1.
- the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1 : 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1 :2. In some embodiments, about 1 mg/kg (mpk) of AD04580 and about 1 mg/kg of AD04585 are administered to a subject in need thereof. In some embodiments, about 1.5 mg/kg of AD04580 and about 1.5 mg/kg of AD04585 are administered to a subject in need thereof In some embodiments, between about 0.05 and about 5 mg/kg of AD04580 and between about 0.05 and about 5 mg/kg of AD04585 are administered to a subject in need thereof.
- the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 3 : 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 5: 1.
- the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1 : 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1 :2. In some embodiments, about 1 mg/kg (mpk) of
- AD04580 and about 1 mg/kg of AD04585 are administered to a subject in need thereof. In some embodiments, about 1.5 mg/kg of AD04580 and about 1.5 mg/kg of AD04585 are administered to a subject in need thereof. In some embodiments, between about 0 05 and about 5 mg/kg of AD04580 and between about 0.05 and about 5 mg/kg of AD04585 are administered to a subject in need thereof.
- methods of treating a disease associated with an infection caused by HBV comprising administering to a subject in need thereof an effective amount of AD04580 and an effective amount of AD04585.
- the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 2: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 3: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 4: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 5: 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1 : 1. In some embodiments, the ratio of AD04580 to AD04585 administered to a subject in need thereof is about 1 :2. In some embodiments, about 1 mg/kg (mpk) of
- AD04580 and about 1 mg/kg of AD04585 are administered to a subject in need thereof. In some embodiments, about 1.5 mg/kg of AD04580 and about 1.5 mg/kg of AD04585 are administered to a subject in need thereof. In some embodiments, between about 0 05 and about 5 mg/kg of AD04580 and between about 0.05 and about 5 mg/kg of AD04585 are administered to a subject in need thereof.
- AD04580 and AD04585 are administered in a combined amount of about 25-400 mg. In some embodiments, AD04580 and AD04585 are
- AD04580 and AD04585 are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per dose administration. In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 40 mg per dose administration. In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 100 mg per dose
- AD04580 and AD04585 are administered in a combined amount of about 200 mg per dose administration. In some embodiments,
- AD04580 and AD04585 are administered in about 1-18 week intervals. In some
- AD04580 and AD04585 are administered in about 1-6 month intervals.
- L 1)04580 and AD04585 are administered in about 4-week intervals or 1- month intervals.
- AD04580 and AD04585 are administered in about 7-day, 14-day, 21 -day or 28-day intervals.
- AD04580 and AD04585 are administered in 28-day intervals or about 28-day intervals.
- AD04580 and AD04585 are administered in a combined amount of about 40 mg, about 100 mg or about 200 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04580 and AD04585 are administered in a combined amount of about 40 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W). In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 100 mg per dose administration in 28-day intervals or about 28-day intervals (i.e , Q4W). In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 200 mg per dose administration in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04580 and AD04585 are administered for a duration of about 1-12 months. In some embodiments, AD04580 and AD04585 are administered for a duration of about 3 months. In some embodiments, AD04580 and AD04585 are
- AD04580 and AD04585 are administered in a combined amount of about 100 mg per dose administration and in the ratio of about 2: 1.
- AD04580 is administered in an amount of about 3-650 mg per dose administration, and AD04585 is administered in an amount of about 2-325 mg per dose administration. In some embodiments, AD04580 is administered in an amount of about 35-265 mg per dose administration. In some embodiments, AD04580 is administered in an amount of about 50-75 mg per dose administration. In some embodiments, AD04585 is administered in an amount of about 20-125 mg per dose administration. In some
- AD04585 is administered in the amount of about 25-50 mg per dose administration.
- AD04580 and AD04585 are administered in a combined amount of about 1-10 mg/kg per dose administration. In some embodiments, AD04580 and AD04585 are administered in a combined amount of about 1-5 mg/kg per dose
- AD04580 and AD04585 are administered in a combined amount of about 1-1.5 mg/kg, about 1.5-2.0 mg/kg, about 2.0-2.5 mg/kg, about 2.5-3.0 mg/kg, about 3.0-3.5 mg/kg, about 3.5-4.0 mg/kg, about 4.0-4.5 mg/kg, about 4.5-5.0 mg/kg, about 5 0-5.5 mg/kg, about 5.5-6.0 mg/kg, about 6.0-6.5 mg/kg, about 6.5-7.0 mg/kg, about 7.0-7.5 mg/kg, about 7.5-8.0 mg/kg, about 8.0-8.5 mg/kg, about 8.5-9.0 mg/kg, about 9.0-9.5 mg/kg, about 9.5-10 mg/kg, about 1-2.5 mg/kg, about 2.5-5.0 mg/kg, about 5.0-7.5 mg/kg, about 7.5-10 mg/kg, about 1 -5.0 mg/kg, or about 5.0-10 mg/kg per dose
- AD04585 is administered in an amount of about 0.3-5 mg/kg per dose administration, and AD04580 is administered in an amount of about 0.6-7 mg/kg per dose administration. In some embodiments, AD04585 is administered in an amount of about 0.5-2.5 mg/kg per dose administration. In some embodiments, AD04585 is administered in an amount of about 0 3-1 5 mg/kg per dose administration. In some embodiments, AI3G4580 is administered in an amount of about 0.6-5 mg/kg per dose administration. In some embodiments, AD04580 is administered in an amount of about 1-2.5 mg/kg per dose administration.
- AD04580 and AD04585 are administered at a combined dose of 25-400 mg per dose administration. In an embodiment, AD04580 and AD04585 are administered at a combined dose of 25-400 mg, and AD0458Q is administered with AD04585 at a ratio of 1 : 1. In an embodiment, the dose of each of AD04580 and AD04585 is in an amount of about 12 mg for a combined dose of about 25 mg. In an embodiment, the dose of each of AD04580 and AD04585 is in an amount of about 17 mg for a combined dose of about 35 mg. In an embodiment, the dose of each of AD04580 and AD04585 is in an amount of about 20 mg for a combined dose of about 40 mg.
- the dose of each of AD04580 and AD04585 is in an amount of about 25 mg for a combined dose of about 50 mg. In an embodiment, the dose of each of AD04580 and AD04585 is in an amount of about 50 mg for a combined dose of about 100 mg. In an embodiment, the dose of each of AD04580 and AD04585 is in an amount of about 100 mg for a combined dose of about 200 mg. In an embodiment, the dose of each of AD04580 and AD04585 is in an amount of about 150 mg for a combined dose of about 300 mg. In an embodiment, the dose of each of AD04580 and AD04585 is in an amount of about 200 mg for a combined dose of about 400 mg.
- AD04580 and AD04585 are administered in about 7-day, about 14-day, about 21 -day or about 28-day intervals. In some embodiments, AD04580 and ADQ4585 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In an embodiment, the dose of each of AD04580 and AD04585 is in an amount of about 20 mg for a combined dose of about 40 mg, or in an amount of about 50 mg for a combined dose of about 100 mg, or in an amount of about 100 mg for a combined dose of about 200 mg, and AD04580 and AD04585 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of each of AD04580 and AD04585 is in an amount of about 20 mg for a combined dose of about 40 mg and AD04580 and AD04585 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In an embodiment, the dose of each of AD04580 and AD04585 is in an amount of about 50 mg for a combined dose of about 100 mg and AD04580 and AD04585 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of each of AD04580 and AD04585 is in an amount of about 100 mg for a combined dose of about 200 mg and AD04580 and AD04585 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04580 and AD04585 are administered at a combined dose of 25-400 mg per dose, and AD04585 is administered with AD04580 at a ratio of 1 :2.
- the dose of AD04580 is in an amount of about 16 mg, and the dose of AD04585 is in an amount of about 8 mg for a combined dose of about 25 mg.
- the dose of AD04585 is in an amount of about 12 mg, and the dose of the AD04580 is in an amount of about 24 mg for a combined dose of about 35 mg.
- the dose of AD04585 is in an amount of about 13 mg, and the dose of the AD04580 is in an amount of about 27 mg for a combined dose of about 40 mg.
- the dose of AD04580 is in an amount of about 33 mg, and the dose of AD04585 is in an amount of about 17 mg for a combined dose of about 50 mg. In an embodiment, the dose of AD04585 is in an amount of about 35 mg, and the dose of AD04580 is in an amount of about 65 mg for a combined dose of about 100 mg. In an embodiment, the dose of AD04585 is in an amount of about 67 mg, and the dose of AD04580 is in an amount of about 133 mg for a combined dose of about 200 mg. In an embodiment, the dose of the AD04585 is in an amount of about 100 mg, and the dose of AD04580 is in an amount of about 200 mg for a combined dose of about 300 mg.
- the dose of AD04585 is in an amount of about 135 mg, and the dose of AD04580 is in an amount of about 270 mg for a combined dose of about 400 mg.
- AD04580 and AD04585 are administered in about 7-day, about 14-day, about 21-day or about 28-day intervals.
- AD04580 and AD04585 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04585 is in an amount of about 13 mg, and the dose of the AD04580 is in an amount of about 27 mg for a combined dose of about 40 mg, and AD04580 and AD04585 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04585 is in an amount of about 35 mg, and the dose of AD04580 is in an amount of about 65 mg for a combined dose of about 100 mg, and AD04580 and AD04585 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04585 is in an amount of about 67 mg, and the dose of AD04580 is in an amount of about 133 g for a combined dose of about 200 mg, and AD04580 and AD04585 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- AD04580 and AD04585 are administered at a combined dose of 25-400 mg per dose, ADQ4585 is administered with AD0458Q at a ratio of 1 :3.
- the dose of AD04580 is in an amount of about 18 mg, and the dose of AD04585 is in an amount of about 6 mg for a combined dose of about 25 mg.
- the dose of AD04585 is in an amount of about 9 mg, and the dose of AD04580 is in an amount of about 27 mg for a combined dose of about 35 mg. In an embodiment, the dose of AD04585 is in an amount of about 10 mg, and the dose of AD04580 is in an amount of about 30 mg for a combined dose of about 40 mg. In an embodiment, the dose of AD04580 is in an amount of about 36 mg, and the dose of AD04585 is in an amount of about 12 mg for a combined dose of about 50 mg. In an embodiment, the dose of AD04585 is in an amount of about 25 mg, and the dose of ADQ4580 is in an amount of about 75 mg for a combined dose of about 100 mg.
- the dose of AD04585 is in an amount of about 50 rng, and the dose of AD04580 is in an amount of about 150 mg for a combined dose of about 200 mg. In an embodiment, the dose of AD04585 is in an amount of about 75 mg, and the dose of AD04580 is in an amount of about 225 mg for a combined dose of about 300 mg. In an embodiment, the dose of AD04585 is in an amount of about 100 mg, and the dose of
- AD04580 is in an amount of about 300 mg for a combined dose of about 400 mg. In some embodiments, ADQ4580 and AD04585 are administered in about 7-day, about 14-day, about 21-day or about 28-day intervals. In some embodiments, AD04580 and AD04585 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W). In an embodiment, the dose of AD04585 is in an amount of about 10 mg, and the dose of AD04580 is in an amount of about 30 mg for a combined dose of about 40 mg, and AD04580 and AD04585 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04585 is in an amount of about 25 mg, and the dose of AD04580 is in an amount of about 75 mg for a combined dose of about 100 mg, and AD04580 and AD04585 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- the dose of AD04585 is in an amount of about 50 mg, and the dose of AD04580 is in an amount of about 150 mg for a combined dose of about 200 mg, and AD04580 and AD04585 are administered in 28-day intervals or about 28-day intervals (i.e., Q4W).
- a composition comprising:
- RNAi agent comprising: (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO: 100, SEQ ID NO: 111, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO. 171 , SEQ ID NO: 175, SEQ ID NO: 179 and SEQ ID NO: 180, and
- a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:229, SEQ ID NO: 235, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:273, SEQ ID NO: 307, SEQ ID NO.302 and SEQ ID NO:319, and
- RNAi agent comprising:
- an antisense strand compri sing a nucl eotide sequence of any one of the following: SEQ ID NO: 140, SEQ ID NO: 107, SEQ ID NO: 136, SEQ ID NO:
- a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:262, SEQ ID NO:271, SEQ ID NO: 216, SEQ ID NO: 248, SEQ ID NO: 274, SEQ ID NO.328, SEQ ID NO: 292, and SEQ ID NO: 294;
- first and second RNAi agents are administered in a combined amount of about 50-400 mg per month.
- a method for treating a disease, disorder, or condition associated with an infection caused by Hepatitis B Virus in a human subject in need thereof comprising administering to the human subject an effective amount of a pharmaceutical composition comprising:
- RNAi agent comprising:
- an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO: 100, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 171, SEQ ID NO: 179 and SEQ ID NO: 180, and
- a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:229, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO: 273, SEQ ID NO: 302 and SEQ If) NO:319,-and
- RNAi agent comprising:
- an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO: 140, SEQ ID NO: 107, SEQ ID NO: 136, SEQ ID NO:
- RNAi agents are administered in an amount of about 50-400 mg per month.
- the first and the second HBV RNAi agents are
- the first and the second HBV RNAi agents are administered in a ratio of about 2: 1.
- the first and the second HBV RNAi agents are
- the first and the second HBV RNAi agents are administered in a combined amount of about 50-125 mg per dose administration and in the ratio of about 2: 1, about 3:1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2. In some embodiments, the first and the second HBV RNAi agents are administered in a combined amount of about 75-150 mg per dose administration and in the ratio of about 2: l, about 3: l, about 1 : 1, about 4: 1, about 5: I or about 1 :2. In some embodiments, the first and the second HBV RNAi agents are
- the first and the second HBV RNAi agents are administered in a combined amount of about 150-250 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- the first and the second HBV RNAi agents are administered in a combined amount of about 200-300 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- the first and the second HBV RNAi agents are administered in a combined amount of about 200-300 mg per dose administration and in the ratio of about 2: 1, about 3: 1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- the first and the second HBV RNAi agents are
- the first and the second HBV RNAi agents are administered in a combined amount of about 50-100 mg per dose administration and in the ratio of about 2: 1, about 3:1, about 1 : 1, about 4: 1, about 5: 1 or about 1 :2.
- the first and the second HBV RNAi agents are administered in a combined amount of about 25-400 mg per dose administration and in the ratio of about 2: 1.
- the first and the second HBV RNAi agents are administered in a combined amount of about 25-75 mg per dose administration and in the ratio of about 2: 1.
- the first and the second HBV RNAi agents are administered in a combined amount of about 50-125 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the first and the second HBV RNAi agents are administered in a combined amount of about 75-150 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the first and the second HBV RNAi agents are administered in a combined amount of about 100-200 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the first and the second HBV RNAi agents are administered in a combined amount of about 125-225 mg per dose administration and in the ratio of about 2: 1.
- the first and the second HBV RNAi agents are administered in a combined amount of about 150-250 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the first and the second HBV RNAi agents are administered in a combined amount of about 200-300 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the first and the second HB RNAi agents are administered in a combined amount of about 300-400 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the first and the second HBV RNAi agents are administered in a combined amount of about 35 mg per dose administration and in the ratio of about 2: 1.
- the first and the second HBV RNAi agents are administered in a combined amount of about 40 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the first and the second HBV RNAi agents are administered in a combined amount of about 100 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the first and the second HBV RNAi agents are administered in a combined amount of about 200 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the first and the second HBV RNAi agents are administered in a combined amount of about 300 mg per dose administration and in the ratio of about 2: 1. In some embodiments, the first and the second HBV RNAi agents are administered in a combined amount of about 400 mg per dose administration and in the ratio of about 2: 1.
- the first RNAi agent is administered in the amount of about 3-650 mg per dose administration, and the second RNAi agent is administered in the amount of about 2-325 mg per dose administration. In some embodiments, the first RNAi agent is administered in the amount of about 35-265 mg per dose administration. In some
- the first RNAi agent is administered in the amount of about 50-75 mg per dose administration.
- the second RNAi agent is administered in the amount of about 20-125 mg per dose administration. In some embodiments, the second RNAi agent is administered in the amount of about 25-50 mg per dose administration.
- the first and the second HBV RNAi agents are
- the first and the second HBV RNAi agents are administered in a combined amount of about 1-10 mg/kg per dose administration.
- the first and the second HBV RNAi agents are administered in a combined amount of about 1 -5 rng/kg per dose administration.
- the first and the second HBV RNAi agents are administered in a combined amount of about 1-1.5 mg/kg, about 1.5-2.0 mg/kg, about 2.0-2.5 mg/kg, about 2.5-3.0 rng/kg, about 3.0-3.5 mg/kg, about 3.5-4.0 mg/kg, about 4.0-4.5 mg/kg, about 4.5-5.0 mg/kg, about 5.0-5.5 mg/kg, about 5.5-6.0 mg/kg, about 6.0-6.5 mg/kg, about 6.5-7.0 mg/kg, about 7 0-7 5 mg/kg, about 7.5-8.0 mg/kg, about 8.0-8.5 mg/kg, about 8.5-9.0 mg/kg, about 9.0-9.5 mg/kg, about 9.5-10 mg/kg, about 1- 2.5 mg/kg, about 2.5-5.0
- the first RNAi agent is administered in the amount of about 0.6-7 mg/kg per dose administration, and the second RNAi agent is administered in the amount of about 0.3-5 mg/kg per dose administration. In some embodiments, the second RNAi agent is administered in the amount of about 0.5-2,5 mg/kg per dose administration. In some embodiments, the second RNAi agent is administered in the amount of about 0.3-1.5 mg/kg per dose administration. In some embodiments, the first RNAi agent is administered in the amount of about 0.6-5 mg/kg per dose administration. In some embodiments, the first RN Ai agent is administered in the amount of about 1-2.5 mg/kg per dose administration.
- an HBV RNAi agent disclosed herein consists of or comprises AD05070 linked to (NAG37)s shown as a sodium salt having the structure represented by the following;
- an HBV RNAi agent disclosed herein consists of or comprises AD05070 linked to (NAG25)s shown as a sodium salt having the structure represented by the following;
- an HBV RNAi agent disclosed herein consists of or comprises AD05070 linked to (NAG37)s shown as a free acid having the structure represented by the following;
- an HBV RNAi agent disclosed herein consists of or comprises AD04580 linked to (NAG31)s shown as a sodium salt having the structure represented by the following;
- an HBV RNAi agent disclosed herein consists of or comprises AD04585 linked to (N G25)s shown as a sodium salt having the structure represented by the following;
- an HBV RNAi agent disclosed herein consists of or comprises AD04872 linked to (NAG37)s shown as a sodium salt having the structure represented by the following;
- an HBV RNAi agent disclosed herein consists of or comprises AD04872 linked to (NAG25)s shown as a sodium salt having the structure represented by the following;
- an HBV RNAi agent disclosed herein consists of or comprises AD04872 linked to (NAG37)s shown as a free acid having the structure represented by the following;
- the described HBV RNAi agent(s) are optionally combined with one or more additional (i.e., second, third, etc.) therapeutics.
- a second therapeutic can be another HBV RNAi agent (e.g , a HBV RNAi agent which targets a different sequence within an HBV genome).
- An additional therapeutic can also be a small molecule drug, antibody, antibody fragment, and/or vaccine.
- the HBV RNAi agents, with or without the one or more additional therapeutics, can be combined with one or more excipients to form pharmaceutical compositions.
- the described HBV RNAi agent(s) are optionally combined with one or more additional therapeutics, wherein the additional therapeutic is a nucleoside inhibitor or nucleotide inhibitor.
- the described HB RNAi agent(s) are optionally combined with one or more additional therapeutics, wherein the additional therapeutic entecavir, tenofovir, tenofovir alafenamide, tenofovir disoproxil, lamivudine, or another antiviral therapeutic.
- the nucleoside inhibitor is entecavir or tenofovir.
- entecavir is administered in the amount of 0.5-1 mg daily.
- tenofovir is administered in the amount of 300 mg once daily.
- the described HBV RNAi agent(s) are optionally combined with one or more additional therapeutics, wherein the additional therapeutic is an interferon.
- the described HBV RNAi agent(s) are optionally combined with one or more additional therapeutics, wherein the additional therapeutic is interferon-alpha. In some embodiments, the described HBV RNAi agent(s) are optionally combined with one or more HB additional therapeutics, wherein the additional therapeutic is an HBV vaccine.
- the described HBV RNAi agent(s) are optionally combined with one or more additional therapeutics in a single dosage form (i.e., a cocktail included in a single injection).
- the described HBV RNAi agent(s) may be administered separately from one or more optional additional therapeutics.
- the described HBV RNAi agent(s) are administered to a subject in need thereof via subcutaneous injection, and the one or more optional additional therapeutics are administered orally, which together provide for a treatment regimen for diseases and conditions associated with HBV infection.
- the described HBV RNAi agent(s) are administered to a subject in need thereof via subcutaneous injection, and the one or more optional additional therapeutics are administered via a separate subcutaneous injection.
- compositions for delivering an HBV RNAi agent to a liver cell in vivo including an HBV RNAi agent conjugated or linked to a targeting group.
- the targeting group is an asialoglycoprotein receptor ligand.
- compositions for delivering an HBV RNAi agent to a liver cell in vivo are described, the composition including an HBV RNAi agent linked to an N-acetyl-galactosamine targeting ligand.
- one or more of the described HBV RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent.
- the mammal is a human.
- Hepatitis B Virus RNAi agent(s) provides methods for therapeutic and/or prophylactic treatment of diseases/disorders which are associated with HBV infection.
- the described HB V RN Ai agents mediate RNA interference to inhibit the expression of one or more genes necessary for replication and/or pathogenesis of Hepatitis B Virus.
- HBV RNAi agents may inhibit viral polymerase, core protein, surface antigen, e-antigen and/or the X protein, in a cell, tissue or mammal.
- HBV RNAi agents can be used to treat HBV infection
- HBV RNAi agents can also be used to treat or prevent chronic liver diseases/disorders, inflammations, fibrotic conditions and proliferative disorders, like cancers, associated with HBV infection.
- the methods further comprise treatment of Hepatitis D Virus (HDV) in the subject.
- HDV Hepatitis D Virus
- Such methods comprise administration of HBV RNAi agent to a human being or animal infected with HBV. Further, compositions for delivery of HB RNAi agents to liver cells in vivo are described.
- prophylactic treatment of diseases/disorders which are associated with HBV infection or inhibition of expression of one or more HBV genes comprising administering a
- composition comprising one or more HBV RNAi agents can be administered in a number of ways depending upon whether local or systemic treatment is desired.
- Administration can be, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal
- compositions described herein are administered by subcutaneous injection.
- HBV RNAi agents and/or compositions can be used in methods for therapeutic treatment of HB V infection or disease or conditions caused by HBV infection. Such methods include administration of an HBV RNAi agent as described herein to a subject, e.g., a human or animal subject.
- oligonucleotide and“polynucleotide” mean a polymer of linked nucleosides each of which can be independently modified or unmodified.
- an“RNAi agent” or“RNAi trigger” means a composition that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence specific manner.
- mRNA messenger RNA
- RNAi agents may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells), or by any alternative mechanism(s) or pathway(s). While it is believed that RNAi agents, as that term is used herein, operate primarily through the RNA interference mechanism, the disclosed RNAi agents are not bound by or limited to any particular pathway or mechanism of action.
- RNA interference mechanism i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells
- RISC RNA-induced silencing complex
- RNAi agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: short interfering RNAs (siRNAs), double-stranded RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates.
- the antisense strand of the RNAi agents described herein is at least partially complementary to the mRNA being targeted.
- RNAi agents may be comprised of modified nucleotides and/or one or more non-phosphodiester linkages.
- the terms“silence,”“reduce,”“inhibit,”“down-regulate,” or “knockdown” when referring to expression of a given gene mean that the expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, group of cell s, tissue, organ, or subject is treated with oligomeric compounds, such as RNAi agents, described herein as compared to a second cell, group of cells, tissue, organ, or subject that has not or have not been so treated.
- sequence or“nucleotide sequence” mean a succession or order of nucleobases or nucleotides, described with a succession of letters using standard nomenclature.
- a“nucleotide base,” or“nucleobase” is a heterocyclic pyrimidine or purine compound, which is a standard constituent of all nucleic acids, and includes the bases that form the nucleotides adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U).
- a nucleobase may further be modified to include, without limitation, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases.
- the term“complementary,” when used to describe a first nucleotide sequence (e.g., RNAi agent sense strand or targeted mRNA) in relation to a second nucleotide sequence (e.g., RNAi agent antisense strand or a single- stranded antisense oligonucleotide), means the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)) and form a duplex or double helical structure under certain conditions with an oligonucleotide or polynucleotide including the second nucleotide sequence.
- Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification. For example, a and Af are complementary to U (or T) and identical to A for the purposes of determining identity or complementarity.
- “perfectly complementary'” or“fully complementary'” means that all (100%) of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide.
- the contiguous sequence may comprise all or a part of a first or second nucleotide sequence
- “partially complementary” means that in a hybridized pair of nucleobase sequences, at least 70%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide.
- “subject,”“patient,” or“individual” includes a mammal, such as a human or other animal, and typically is human.
- the subject e.g., patient, to whom the therapeutic agents and compositions are administered, is a mammal, typically a primate, such as a human.
- the primate is a monkey or an ape.
- the subject can be male or female and can be any suitable age, including infant, juvenile, adolescent, adult, and geriatric subjects.
- the subject is a non- primate mammal, such as a rodent, a dog, a cat, a farm animal, such as a cow or a horse, etc.
- substantially complementary means that in a hybridized pair of nucleobase sequences, at least about 85%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide.
- nucleic acid sequence comprises a sequence that has at least about 85% sequence identity or more, preferably at least 90%, at least 95%, or at least 99%, compared to a reference sequence.
- Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
- the inventions disclosed herein encompasses nucleotide sequences substantially identical to those disclosed herein, e.g., in Tables 2, 3, and 4.
- sequences disclosed herein are exactly identical, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% percent identical to those disclosed herein, e.g., in Tables 1, 2, 3 and 4.
- the terms“treat,”“treatment,” and the like mean the methods or steps taken to provide relief from or alleviation of the number, severity, and/or frequency of one or more symptoms of a disease or condition in a subject.
- the phrase“introducing into a cell,” when referring to an oligomeric compound, means functionally delivering the oligomeric compound into a cell.
- the phrase“functional delivery ,” means that delivering the oligomeric compound to the cell in a manner that enables the oligomeric compound to have the expected biological activity, e.g., sequence-specific inhibition of gene expression.
- the term“isomers” refers to compounds that have identical molecular formulae, but that differ in the nature or the sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed“stereoisomers.” Stereoisomers that are not mirror images of one another are termed“diastereoi somers,” and stereoisomers that are non-superimposable mirror images are termed“enantiomers,” or sometimes optical isomers.
- each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms.
- the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.
- the phrase“consisting of’ excludes any element, step, or ingredient not specified in the claim.
- the phrase“consisting essentially of’ limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characters st c(s) of the claimed invention.
- the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending upon the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed herein envisage that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of their state of protonation based on the
- FIG. 1 shows the mean log HBsAg change from day 1 for CHB patients from different cohorts (c2b, c3b, c4b, c5b, c8 and c9 of Example 19)
- FIG. 2 shows individual changes in HBV DNA for CHB patients from different cohorts (c2b, c8 and c9 of Example 19). Solid line indicates HBeAg positive patients and dashed line indicates HBeAg negative patients.
- FIG. 3 show's individual changes in HBV DNA for CHB patients from different cohorts (clb, etc, c4b, c5b, cl, c9, clO and cl 1 of Example 19).
- FIG. 4 shows individual changes in Log HBV R A for CHB patients from cohort 10 of Example 19.
- FIG. 5 show's individual changes in Log HBV RNA for CHB patients from cohort 7 of Example 19.
- FIG. 6 shows individual changes in Log HBV RNA for CHB patients from different cohorts (c2b, c3b, c4b, c5b, c8 and c9 of Example 19). Solid line indicates HBeAg positive patients and dashed line indicates HBeAg negative patients
- FIG. 7 show ' s individual changes in HBeAg for CHB patients from different cohorts (c2b, c4b, c5b, c8 and c9 of Example 19).
- FIG. 8 shows individual changes in HBeAg for CHB patients from different cohorts (clb, c3b and clO of Example 19).
- FIG. 9 show's individual changes in HBcrAg for CHB patients from different cohorts (c2b, c3b, c4b, c5b, c8 and c9 of Example 19). Solid line indicates HBeAg positive patients and dashed line indicates HBeAg negative patients.
- FIG. 10 shows individual changes in HBcrAg for CHB patients from cohort 6 of Example 19.
- FIG. 11 show ' s individual changes in HBcrAg for CHB patients from cohort 7 of Example 19.
- FIG. 12 shows individual changes in HBcrAg for CHB patients from cohort 10 of Example 19.
- FIG. 13 shows the NADIR log HBsAg reduction for HBeAg positive patients and HBeAg negative patients.
- FIG. 14 show's the mean log HBsAg change from day 1 for CHB patients from different cohorts (c2b, c3b, c4b, c5b, c8 and c9 of Example 19).
- FIG. 15 shows the mean change for antigen HBsAg from day 1 for CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals (cohorts lb, le, 2b, 3b, 4b, 5b, 8 and 9 of Example 20).
- FIG. 16 shows the mean changes for antigen HBsAg and HBeAg from day 1 for HBsAg-positive CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals (cohorts lb, lc, 2b, 3b, 4b, 5b, 8 and 9 of Example 20).
- FIG. 17 shows the mean HBsAg changes from Day 1 to Day 113 for CHB patients in cohorts lb, lc, 2b, 3b, 4b and 5b of Example 21, respectively.
- the patients were given three subcutaneous doses of the RNAi component in the amount of: 25 mg (cohort lb), 50 mg (cohort lc), 100 mg (cohort 2b), 200 mg (cohort 3b), 300 mg (cohort 4b) or 400 mg (cohort 5b) on Day 1, 29 and 57 All patients were given NA daily.
- FIG. 18 shows the mean and individual HBsAg changes on Day 113 from Day 1 for all patients in cohorts lb, lc, 2b, 3b, 4b and 5b of Example 21. Dots with an arrow ' indicate HBeAg positive patients. Dots without an arrow indicate HBeAg negative patients.
- FIGS. 19A-19D show the individual changes in HBV DNA, HBV RNA, HBeAg and HBerAg from Day 1 to Day 113 for CHB patients in cohorts lb, lc, 2b, 3b, 4b and 5b of Example 21, respectively.
- the patients were given three subcutaneous doses of the RNAi component in the amount of: 25 mg (cohort lb), 50 mg (cohort lc), 100 mg (cohort 2b), 200 mg (cohort 3b), 300 mg (cohort 4b) or 400 mg (cohort 5b) on Day 1, 29 and 57. And all patients were given NA daily. Each line represents one individual CHB patient.
- FIG. 20 shows the mean change for antigen HBsAg from day 1 for CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals (cohorts lb, lc, 2b, 3b, 4b, 5b, 8 and 9 of Example 20; until day 932).
- FIG. 21 shows the mean changes for antigen HBsAg and HBeAg from day 1 for HBsAg-positive CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals (cohorts lb, lc, 2b, 3b, 4b, 5b, 8 and 9 of Example 20; until day 392).
- HBV RNAi agents AD04872 and AD05070
- FIG. 22 shows sustained suppression of HBsAg in a subset of patients ⁇ 9 months after the last RNAi dose (mean 1.74); cf. example 20: 8 CHB patients/cohort (NA
- Described herein are methods of treating and/or preventing symptoms or diseases associated with an infection caused by Hepatitis B Virus (HBV) in a subject in need thereof or inhibiting expression of one or more Hepatitis B Virus genes. Particularly, described herein are methods of treating or preventing an HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising administering KNAi agents that inhibit expression of Hepatitis B Virus (HBV) (referred to herein as HBV RNAi agents or HBV RNAi triggers).
- HBV RNAi agents comprises a sense strand and an antisense strand. The sense strand and the antisense strand each can be 16 to 30 nucleotides in length.
- the sense and antisense strands each can be 17 to 26 nucleotides in length.
- the sense and antisense strands can be either the same length or they can be different lengths in some embodiments, the sense and antisense strands are each independently 17 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 17-21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length.
- the sense strand is about 21 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, both the sense and antisense strands are each 26 nucleotides in length. In some embodiments, the RNAi agent sense and antisense strands are each independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, a double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides.
- This region of perfect or substantial complementarity between the sense strand and the antisense strand is typically 15-25 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides in length and occurs at or near the 5' end of the antisense strand (e.g , this region may be separated from the 5’ end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly or sub stanti ally complementary)
- the sense strand and antisense strand each contain a core stretch sequence that is 16 to 23 nucleobases in length.
- An antisense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (sometimes referred to, e.g , as a target sequence) present in the HBV mRNA target.
- a sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85%
- the sense strand core stretch sequence is perfectly identical or at least about 85% identical to a nucleotide sequence (target sequence) present in the HBV RNA target
- a sense strand core stretch sequence can be the same length as a corresponding antisense core sequence or it can be a different length.
- the antisense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
- the sense strand core stretch sequence is 16, 17, 18, 19, 20, 21 , 22, or 23 nucleotides in length
- RNAi agent duplexes examples include the nucleotide sequences in Tables 3 and 4.
- the HBV RNAi agent sense and antisense strands anneal to form a duplex.
- a sense strand and an antisense strand of an HBV RNAi agent may be partially, substantially, or fully complementary to each other.
- the sense strand core stretch sequence is at least about 85% complementary or 100% complementary to the antisense core stretch sequence.
- the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that is at least about 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, or 21 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense strand and antisense core stretch sequences of an HBV RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that is at least 85% base paired or 100% base paired.).
- the antisense strand of an HBV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3.
- the sense strand of an HBV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 4.
- the length of the HBV RNAi agent sense and antisense strands described herein are independently 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are 19-26 nucleotides in length. In some embodiments, the described RNAi agent sense and antisense strands are independently 17, 18, 19, 20, 21, 22,
- the sense and antisense strands can be either the same length or they can be different lengths.
- a sense strand and an antisense strand are each 26 nucleotides in length.
- a sense strand is 23 nucleotides in length and an antisense strand is 21 nucleotides in length.
- a sense strand is 22 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, a sense strand is 21 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, a sense strand is 19 nucleotides in length and an antisense strand is 21 nucleotides in length.
- the sense strand and/or the antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3' end, the 5' end, or both the 3' and 5' ends of the core sequences.
- the antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in an HBV mRNA.
- the sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in an HBV mRNA.
- the antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sense strand’s additional nucleotides, if present.
- an extension comprises 1 , 2, 3, 4, 5, or 6 nucleotides at the 5’ and/or 3' end of the sense strand core stretch sequence and/or antisense strand core stretch sequence.
- the extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding antisense strand.
- the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding sense strand.
- both the sense strand and the antisense strand of an RNAi agent contain 3' and 5' extensions.
- one or more of the 3 ! extension nucleotides of one strand base pairs with one or more 5' extension nucleotides of the other strand.
- one or more of 3' extension nucleotides of one strand do not base pair with one or more 5' extension nucleotides of the other strand.
- an HBV RNAi agent has an antisense strand having a 3' extension and a sense strand having a 5’ extension.
- an HBV RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an HBV RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides which are complementary to a corresponding HBV mRNA sequence.
- a 3' antisense strand extension includes or consists of, but is not limited to: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CIJU, UGCCUA, CUGCCU, UGCCU, !JGAUU, GCCUAU, T, ⁇ T, U, UU (each listed 5' to 3').
- the 3' end of the antisense strand may include additional abasic nucleosides (Ab). In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand.
- an HBV RNAi agent comprises an antisense strand having a 5' extension of 1 , 2, 3, 4, or 5 nucleotides in length. In other embodiments, an HBV RNAi agent comprises an antisense strand having a 5' extension of 1 or 2 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises uracil or thymidine nucleotides or nucleotides which are complementary to a corresponding HBV mRNA sequence.
- the 5' antisense strand extension includes or consists of, but is no limited to, UA, TU, U, T, UU, TT, CUC (each listed 5' to 3').
- An antisense strand may have any of the 3' extensions described above in combination with any of the 5' antisense strand extensions described, if present.
- an HBV RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length.
- one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides which correspond to nucleotides in the HBV mRNA sequence.
- the 3' sense strand extension includes or consists of, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5' to 3 ! ).
- the 3' end of the sense strand may include additional abasic nucleosides.
- UUAb, UAb, or Ab may be added to the 3' end of the sense strand.
- the one or more abasic nucleosides added to the 3' end of the sense strand may be inverted (invAb).
- one or more inverted abasic nucleosides may be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent.
- the inclusion of one or more inverted abasic nucleosides at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent.
- an HBV RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length.
- one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides which correspond to nucleotides in the HB V mRNA sequence.
- the sense strand 5' extension can be, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, !JA!J, U, UU (each listed 5' to 3').
- a sense strand may have a 3' extension and/or a 5' extension.
- the 5' end of the sense strand may include an additional abasic nucleoside (Ab) or nucleosides (AbAb).
- the one or more abasic nucleosides added to the 5' end of the sense strand may be inverted (invAb).
- one or more inverted abasic nucleosides may be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent.
- the inclusion of one or more inverted abasic nucleosides at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent.
- an HBV RNAi agent antisense strand includes a nucleotide sequence of any of the sequences in Table 3.
- an HBV RNAi agent antisense strand includes the sequence of nucleotides 1-17, 2-15, 2-17, 1 - 18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1- 26, or 2-26 of any of the sequences in Table 3.
- an HBV RNAi agent sense strand includes the nucleotide sequence of any of the sequences in Table 4.
- an HBV RN Ai agent sense strand includes the sequence of nucleotides 1 -18,
- the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5' end and the antisense strand 3' end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RN Ai agent is blunt-ended.
- blunt end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair).
- the sense strand 5' end and the antisense strand 3' end of an RNAi agent form a frayed end.
- the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a frayed end.
- both ends of an RNAi agent form a frayed end.
- neither end of an RNAi agent is a frayed end.
- a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands from a pair (i.e. do not form an overhang) but are not complementary (i.e. form a non complementary pair).
- an overhang is a stretch of one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3' or 5’ overhangs.
- the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5 ! overhang end, a blunt end and a 3' overhang end, a frayed end and a 5' overhang end, a frayed end and a 3' overhang end, two 5' overhang ends, two 3' overhang ends, a 5' overhang end and a 3' overhang end, two frayed ends, or two blunt ends.
- a nucleotide base is a heterocyclic pyrimidine or purine compound which is a constituent of all nucleic acids and includes adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U).
- the term“nucleotide” can include a modified nucleotide (such as, for example, a nucleotide mimic, abasic site (Ab), or a surrogate replacement moiety).
- Modified nucleotides when used in various polynucleotide or oligonucleotide constructs, may preserve activity of the compound in cells while at the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administering of the polynucleotide or oligonucleotide construct.
- an HBV RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, an HBV RNAi agent is prepared as a sodium salt. Such forms are within the scope of the inventions disclosed herein.
- an HBV RNAi agent contains one or more modified nucleotides.
- a“modified nucleotide” is a nucleotide other than a
- ribonucleotide (2'-hydroxyl nucleotide).
- at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides.
- modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2'-modified nucleotides, 3' to 3' linkages (inverted) nucleotides (represented herein as invdN, invN, invn, inv Ab), non-natural base-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seco nucleotide mimics (unlocked nucleobase analogues, represented herein as NUNA or NLINA), locked nucleotides (represented herein as NLNA or NLNA), 3'-0-methoxy (2' intemucleoside linked) nucleotides (represented herein as 3'-OMen), 2'-F-Arabino nucleotides (represented herein as NfANA or NfANA), 5
- 2 '-O-methyl nucleotides represented herein as a lower case letter 'h' in a nucleotide sequence
- 2'-deoxy-2'-fluoro nucleotides represented herein as Nf, also represented herein as 2'-fiuoro nucleotide
- 2'-deoxy nucleotides represented herein as dN
- 2'-methoxy ethyl (2'-0-2-methoxylethyl) nucleotides
- 2'-amino nucleotides represented herein as NM or 2'-MOE
- HB V RNAi agent sense strands and antisense strands may be synthesized and/or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.
- Modified nucleobases include synthetic and natural nucleobases, such as 5- substituted pyrimidines, 6-azapyrimi dines and N-2, N-6 and 0-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-rne- C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6- rnethyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytos
- all or substantially all of the nucleotides of an RNAi agent are modified nucl eotides.
- an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides.
- a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being ribonucleotides.
- an antisense sense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being ribonucleotides.
- one or more nucleotides of an RNAi agent is a ribonucleotide.
- one or more nucleotides of an HBV RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones).
- a modified internucleoside linkage is a non-phosphate- containing covalent intemucleoside linkage.
- Modified intemucleoside linkages or backbones include, but are not limited to, 5’ -phosphor othioate groups (represented herein as a lower case“s”), chiral phosphorothi oates, thiophosphates, phosphorodithi oates, phosphotriesters, aminoalkyl-phosphotri esters, alkyl phosphonates (e.g., methyl phosphonat.es or 3'-alky!ene phosphonates), chiral phosphonates, phosphinates, phosphorami dates (e.g., 3 '-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl- phosphonates, thionoalkylphosphotriesters, morphoiino linkages, boranophosphates having normal 3 '-5' linkages, 2'-5' linked anal ogs of boranophosphates, or
- a modified intemucleoside linkage or backbone lacks a phosphorus atom.
- Modified intemucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages.
- modified intemucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioform acetyl backbones, alkene-containing backbones, sulfamate backbones,
- methyieneimino and methylenehydrazino backbones methyieneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, Q, S, and CH2 components.
- a sense strand of an HBV RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothi oate linkages
- an antisense strand of an HBV RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages
- both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages.
- a sense strand of an HBV RNAi agent can contain 1 , 2, 3, or 4
- an antisense strand of an HBV RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages.
- an HBV RNAi agent sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, the at least two
- phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 3 ! end of the sense strand. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6- 8 from the 5' end of the sense strand. In some embodiments, an HBV RNAi agent antisense strand contains four phosphorothioate intemucleoside linkages.
- an HBV RNAi agent contains at least two phosphorothioate intemucleoside linkages in the sense strand and three or four phosphorothioate intemucleoside linkages in the antisense strand
- an HBV RNAi agent contains one or more modified nucleotides and one or more modified intemucleoside linkages. In some embodiments, a 2'-modified nucleoside is combined with modified intemucleoside linkage.
- the HBV RNAi agents disclosed herein target an HBV gene at or near the positions of the HBV genome shown in the following Table 1.
- the antisense strand of an HBV RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target HBV 19-mer sequence disclosed in Table 1.
- Hepatitis B virus (subtype ADW2), genotype A, complete genome GenBank AM282986.1 (SEQ ID NO: 1)).
- an HBV RNAi agent includes an antisense strand wherein position 19 of the antisense strand (5 '->3') is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an HBV RNAi agent includes an antisense strand wherein position 1 of the antisense strand (5' 3') is capable of forming a base pair with position 19 of the 19-mer target sequence disclosed in Table 1.
- an HBV RNAi agent includes an antisense strand wherein position 2 of the antisense strand (5' > 3') is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in Table 1.
- an HBV RNAi agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5 - ⁇ 3') are capable of forming base pairs with each of the respective complementary bases located at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1.
- the HBV RNAi agents include core 19-mer nucleotide sequences shown in the following Table 2.
- HBV RNAi agent sense strands and antisense strands that comprise or consist of the nucleotide sequences in Table 2 can be modified nucleotides or unmodified
- the HBV RNAi agents having the sense and antisense strand sequences that comprise or consist of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.
- the antisense strand of an HBV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an HBV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.
- Modified HBV RNAi agent antisense strand sequences are provided in Table 3.
- Modified HB V RNAi agent sense strands are provided in Table 4
- each of the nucleotides in each of the unmodified sequences listed in Tables 3 and 4 may be a modified nucleotide.
- A : adenosine-3 '-phosphate
- G guanosine-3 '-phosphate
- n any 2'-OMe modified nucleotide
- Nf any 2'-fiuoro modified nucleotide
- Tfs 2'-fluoro-5 '-methyluridine-3 '-phosphorothioate
- dN any 2'-deoxyribonucleotide
- NUNA 2', 3 '-seco nucleotide mimics (unlocked nucleobase analogs)
- NLNA locked nucleotide
- AMs 2'-methoxyethyladenosine-3 '-phosphorothioate
- TMs 2'-methoxyethylthymi dine-3 '-phosphorothioate
- vpdN vinyl phosphonate deoxyribonucieotide
- the terminal nucleotide at the 3' end of a given oligonucleotide sequence would typically have a hydroxyl (-OH) group at the respective 3' position of the given monomer instead of a phosphate moiety ex vivo.
- the“g” modified nucleotide on the terminal 3 ' end of the antisense strand of AM06606-AS has a hydroxyl group positioned at its 3' position.
- Targeting groups and linking groups include the following, for which their chemical structures are provided below in Table 6: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG3 l)s, (NAG32), (NAG32)s, (NAG 33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.
- PAZ PAZ
- PAZ
- the HBV RNAi agents described herein are formed by annealing an antisense strand with a sense strand.
- a sense strand containing a sequence listed in Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 3, provided the two sequences have a region of at least about 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
- the antisense strand of an HBV RNAi agent disclosed herein differs by 0, 1 , 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of an HBV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4.
- an HBV RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 3.
- an HBV RNAi agent antisense strand comprises the sequence of nucleotides (from 5’ end 3’ end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences in Table 3.
- an HBV RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 4. In some embodiments, an HBV RNAi agent sense strand comprises the sequence of nucleotides (from 5’ end -> 3’ end) 1-17, 2-17, 3-17,
- the nucleotide at position 1 of the antisense strand can be perfectly complementary 7 to an HBV gene, or can he non-complementary to an HBV gene.
- the nucleotide at position 1 of the antisense strand is a U, A, or dT.
- the nucleotide at position 1 of the antisense strand (from 5’ end 3’ end) forms an A:U or U:A base pair with the sense strand.
- an HBV RNAi agent antisense strand comprises the sequence of nucleotides (from 5’ end -> 3’ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 3.
- an HBV RNAi sense strand comprises the sequence of nucleotides (from 5’ end -> 3’ end ) 1-17 or 1-18 of any of the sense strand sequences in Table 4
- an HBV RNAi agent includes (i) an antisense strand comprising the sequence of nucleotides (from 5’ end - 3’ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5’ end 3’ end) 1-17 or 1-18 of any of the sense strand sequences in Table 4.
- a sense strand containing a sequence listed in Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 3 provided the two sequences have a region of at least about 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
- Representative sequence pairings are exemplified by the Duplex ID Nos. shown in Table 5.
- an HBV RNAi agent comprises of any of the Duplex ID Nos. presented herein.
- an HB V RNAi agent consists of any of the Duplex ID Nos. presented herein.
- an HBV RNAi agent comprises the sense strand and/or the antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein.
- an HBV RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group and/or linking group wherein the targeting group and/or linking group is covalently linked (i.e.
- an HB V RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein.
- an HBV RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group and/or linking group wherein the targeting group and/or linking group is covalently linked to the sense strand or the antisense strand.
- an HBV RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.
- an HBV RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand and/or sense strand nucleotide sequences of any of the duplexes of Table 5, and further comprises a targeting group selected from the group consisting of (PAZ), (NAG13), (NAG13)s,
- NAG 18 (NAG! 8)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s,
- NAG-27 (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31 )s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAGS 5), (NAG35)s, (NAG36), (NAG36)s, (NAGS 7), (NAG37)s.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Virology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Dermatology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Gastroenterology & Hepatology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
Priority Applications (16)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PH1/2021/551866A PH12021551866A1 (en) | 2019-02-07 | 2020-02-07 | RNAi AGENTS FOR HEPATITIS B VIRUS INFECTION |
| BR112021015361-6A BR112021015361A2 (pt) | 2019-02-07 | 2020-02-07 | Agentes de rnai para a infecção pelo vírus da hepatite b |
| AU2020219355A AU2020219355A1 (en) | 2019-02-07 | 2020-02-07 | RNAi agents for Hepatitis B virus infection |
| EA202192191A EA202192191A1 (ru) | 2019-11-07 | 2020-02-07 | АГЕНТЫ РНКи ПРОТИВ ИНФЕКЦИИ, ВЫЗВАННОЙ ВИРУСОМ ГЕПАТИТА В |
| KR1020217028342A KR20210130736A (ko) | 2019-02-07 | 2020-02-07 | B형 간염 바이러스 감염에 대한 RNAi 작용제 |
| MX2021009495A MX2021009495A (es) | 2019-02-07 | 2020-02-07 | Agentes de iarn para infeccion por el virus de la hepatitis b. |
| CA3129261A CA3129261A1 (en) | 2019-02-07 | 2020-02-07 | Rnai agents for hepatitis b virus infection |
| JP2021546213A JP7585214B2 (ja) | 2019-02-07 | 2020-02-07 | B型肝炎ウイルス感染のためのRNAi薬 |
| EP20709945.8A EP3920884B1 (en) | 2019-02-07 | 2020-02-07 | Rnai agents for hepatitis b virus infection |
| EP26151608.2A EP4707394A3 (en) | 2019-02-07 | 2020-02-07 | Rnai agents for hepatitis b virus infection |
| SG11202108395SA SG11202108395SA (en) | 2019-02-07 | 2020-02-07 | Rnai agents for hepatitis b virus infection |
| CN202080013136.XA CN113507920A (zh) | 2019-02-07 | 2020-02-07 | 用于乙型肝炎病毒感染的RNAi剂 |
| IL285257A IL285257A (en) | 2019-02-07 | 2021-08-01 | Rnai agents for hepatitis b virus infection |
| JOP/2021/0208A JOP20210208A1 (ar) | 2019-02-07 | 2021-08-03 | عوامل RNAi لعدوى فيروس الالتهاب الكبدي الوبائي ب |
| US17/396,378 US20210395745A1 (en) | 2019-02-07 | 2021-08-06 | Rnai agents for hepatitis b virus infection |
| JP2024122919A JP7763907B2 (ja) | 2019-02-07 | 2024-07-30 | B型肝炎ウイルス感染のためのRNAi薬 |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962802614P | 2019-02-07 | 2019-02-07 | |
| US62/802,614 | 2019-02-07 | ||
| US201962853659P | 2019-05-28 | 2019-05-28 | |
| US62/853,659 | 2019-05-28 | ||
| US201962932315P | 2019-11-07 | 2019-11-07 | |
| US62/932,315 | 2019-11-07 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/396,378 Continuation US20210395745A1 (en) | 2019-02-07 | 2021-08-06 | Rnai agents for hepatitis b virus infection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020163747A1 true WO2020163747A1 (en) | 2020-08-13 |
Family
ID=69771180
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/017264 Ceased WO2020163747A1 (en) | 2019-02-07 | 2020-02-07 | Rnai agents for hepatitis b virus infection |
Country Status (15)
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021263271A1 (en) * | 2020-06-22 | 2021-12-30 | Janssen Pharmaceuticals, Inc. | Compositions and methods for treatment of hepatitis d virus infection |
| WO2022078479A1 (en) * | 2020-10-16 | 2022-04-21 | Janssen Pharmaceuticals, Inc. | Combination therapy for treating hepatitis b virus infection |
| WO2022133230A1 (en) * | 2020-12-18 | 2022-06-23 | Janssen Pharmaceuticals, Inc. | Combination therapy for treating hepatitis b virus infection |
| WO2022152869A1 (en) * | 2021-01-15 | 2022-07-21 | Janssen Sciences Ireland Unlimited Company | Use of oligonucleotides for individuals with hepatic impairment |
| US11517584B2 (en) | 2016-08-04 | 2022-12-06 | Arrowhead Pharmaceuticals, Inc. | RNAi agents for Hepatitis B virus infection |
| US11534453B2 (en) | 2015-08-07 | 2022-12-27 | Arrowhead Pharmaceuticals, Inc. | RNAi therapy for hepatitis B virus infection |
| WO2023281434A1 (en) * | 2021-07-09 | 2023-01-12 | Janssen Pharmaceuticals, Inc. | Use of oligonucleotides for individuals with renal impairment |
| US11725194B2 (en) | 2017-12-19 | 2023-08-15 | Janssen Sciences Ireland Unlimited Company | Hepatitis B virus (HBV) vaccines and uses thereof |
| EP4265724A4 (en) * | 2020-12-18 | 2025-11-19 | Olix Pharmaceuticals Inc | ARNI AGENT TO INHIBIT THE EXPRESSION AND USE OF HBV |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020163747A1 (en) * | 2019-02-07 | 2020-08-13 | Arrowhead Pharmaceuticals, Inc. | Rnai agents for hepatitis b virus infection |
| CA3235672A1 (en) * | 2021-11-29 | 2023-06-01 | Shanghai Argo Biopharmaceutical Co., Ltd. | Compositions and methods for inhibiting expression of hepatitis b virus (hbv) protein |
| WO2025199466A1 (en) | 2024-03-22 | 2025-09-25 | Purdue Research Foundation | Liver-specific asialoglycoprotein receptor targeting ligands, conjugates comprising same, and related compositions and methods of use |
| KR20260008676A (ko) * | 2024-07-08 | 2026-01-16 | 항저우 티엔롱 파마슈티칼 컴퍼니 리미티드 | HBV 유전자 발현을 표적하고 조절하기 위한 이중 가닥 RNAi 제제 및 그 응용 |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4522811A (en) | 1982-07-08 | 1985-06-11 | Syntex (U.S.A.) Inc. | Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides |
| US5885968A (en) | 1992-08-11 | 1999-03-23 | Rijksuniversiteit Te Leiden | Triantennary cluster glycosides, their preparation and use |
| WO2000053722A2 (en) | 1999-03-10 | 2000-09-14 | Phogen Limited | Delivery of nucleic acids and proteins to cells |
| WO2008022309A2 (en) | 2006-08-18 | 2008-02-21 | F. Hoffmann-La Roche Ag | Polyconjugates for in vivo delivery of polynucleotides |
| WO2011104169A1 (en) | 2010-02-24 | 2011-09-01 | F. Hoffmann-La Roche Ag | Compositions for targeted delivery of sirna |
| WO2012083185A2 (en) | 2010-12-17 | 2012-06-21 | Arrowhead Research Corporations | Peptide-based in vivo sirna delivery system |
| US20130005793A1 (en) | 2011-06-30 | 2013-01-03 | Arrowhead Research Corporation | Compositions and Methods for Inhibiting Gene Expression of Hepatitis B Virus |
| WO2013032829A1 (en) | 2011-08-26 | 2013-03-07 | Arrowhead Research Corporation | Poly(vinyl ester) polymers for in vivo nucleic acid delivery |
| WO2013158141A1 (en) | 2012-04-18 | 2013-10-24 | Arrowhead Research Corporation | Poly(acrylate) polymers for in vivo nucleic acid delivery |
| WO2018027106A2 (en) * | 2016-08-04 | 2018-02-08 | Arrowhead Pharmaceuticals, Inc. | RNAi AGENTS FOR HEPATITIS B VIRUS INFECTION |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2016306275A1 (en) * | 2015-08-07 | 2018-02-08 | Arrowhead Pharmaceuticals, Inc. | RNAi therapy for Hepatitis B virus infection |
| WO2020163747A1 (en) | 2019-02-07 | 2020-08-13 | Arrowhead Pharmaceuticals, Inc. | Rnai agents for hepatitis b virus infection |
-
2020
- 2020-02-07 WO PCT/US2020/017264 patent/WO2020163747A1/en not_active Ceased
- 2020-02-07 TW TW109103911A patent/TWI872048B/zh active
- 2020-02-07 JP JP2021546213A patent/JP7585214B2/ja active Active
- 2020-02-07 MX MX2021009495A patent/MX2021009495A/es unknown
- 2020-02-07 EP EP20709945.8A patent/EP3920884B1/en active Active
- 2020-02-07 EP EP26151608.2A patent/EP4707394A3/en active Pending
- 2020-02-07 BR BR112021015361-6A patent/BR112021015361A2/pt unknown
- 2020-02-07 CN CN202080013136.XA patent/CN113507920A/zh active Pending
- 2020-02-07 CA CA3129261A patent/CA3129261A1/en active Pending
- 2020-02-07 AU AU2020219355A patent/AU2020219355A1/en not_active Abandoned
- 2020-02-07 PH PH1/2021/551866A patent/PH12021551866A1/en unknown
- 2020-02-07 KR KR1020217028342A patent/KR20210130736A/ko active Pending
- 2020-02-07 SG SG11202108395SA patent/SG11202108395SA/en unknown
-
2021
- 2021-08-01 IL IL285257A patent/IL285257A/en unknown
- 2021-08-03 JO JOP/2021/0208A patent/JOP20210208A1/ar unknown
- 2021-08-06 US US17/396,378 patent/US20210395745A1/en active Pending
-
2024
- 2024-07-30 JP JP2024122919A patent/JP7763907B2/ja active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4522811A (en) | 1982-07-08 | 1985-06-11 | Syntex (U.S.A.) Inc. | Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides |
| US5885968A (en) | 1992-08-11 | 1999-03-23 | Rijksuniversiteit Te Leiden | Triantennary cluster glycosides, their preparation and use |
| WO2000053722A2 (en) | 1999-03-10 | 2000-09-14 | Phogen Limited | Delivery of nucleic acids and proteins to cells |
| WO2008022309A2 (en) | 2006-08-18 | 2008-02-21 | F. Hoffmann-La Roche Ag | Polyconjugates for in vivo delivery of polynucleotides |
| WO2011104169A1 (en) | 2010-02-24 | 2011-09-01 | F. Hoffmann-La Roche Ag | Compositions for targeted delivery of sirna |
| WO2012083185A2 (en) | 2010-12-17 | 2012-06-21 | Arrowhead Research Corporations | Peptide-based in vivo sirna delivery system |
| US20130005793A1 (en) | 2011-06-30 | 2013-01-03 | Arrowhead Research Corporation | Compositions and Methods for Inhibiting Gene Expression of Hepatitis B Virus |
| WO2013032829A1 (en) | 2011-08-26 | 2013-03-07 | Arrowhead Research Corporation | Poly(vinyl ester) polymers for in vivo nucleic acid delivery |
| WO2013158141A1 (en) | 2012-04-18 | 2013-10-24 | Arrowhead Research Corporation | Poly(acrylate) polymers for in vivo nucleic acid delivery |
| WO2018027106A2 (en) * | 2016-08-04 | 2018-02-08 | Arrowhead Pharmaceuticals, Inc. | RNAi AGENTS FOR HEPATITIS B VIRUS INFECTION |
Non-Patent Citations (12)
| Title |
|---|
| ANONYMOUS: "To (Hep)B or not to (Hep)B? - Oligonucleotide Therapeutics Society", OLIGONUCLEOTIDE THERAPEUTICS SOCIETY, 23 May 2018 (2018-05-23), XP055691740, Retrieved from the Internet <URL:https://www.oligotherapeutics.org/to-hepb-or-not-to-hepb/> [retrieved on 20200505] * |
| BAENZIGERFIETE, CELL, vol. 22, 1980, pages 611 - 620 |
| BIESSEN ET AL., J. MED. CHEM., vol. 39, 1995, pages 1538 - 1546 |
| CONNOLLY ET AL., J. BIOL. CHEM., vol. 257, 1982, pages 939 - 945 |
| E. GANE: "First results with RNA interference (RNAi) in chronic hepatitis B (CHB) using ARO-HBV", CONFERENCE REPORTS FOR NATAP, THE LIVER MEETING, SAN FRANCISCO NOV 2018, 13 November 2018 (2018-11-13), XP055691686, Retrieved from the Internet <URL:http://www.natap.org/2018/AASLD/AASLD_249.htm> [retrieved on 20200505] * |
| GUIDOTTI LG ET AL.: "High-level hepatitis B virus replication in transgenic mice", J VIROL, vol. 69, 1995, pages 6158 - 6169, XP001007552 |
| LOBST, S.T.DRICKAMER, K., J.B.C., vol. 27 1, 1996, pages 6686 |
| UNKNOWN ET AL: "Arrowhead presents Clinical Data on JNJ-3989 (ARO-HBV) at The International Liver Congress(TM)", 12 April 2019 (2019-04-12), XP055691678, Retrieved from the Internet <URL:http://ir.arrowheadpharma.com/node/14511/pdf> [retrieved on 20200505] * |
| UNKNOWN ET AL: "New ARO-HBV Clinical Data Demonstrating HBsAg Reductions at World Gastroenterologists Summit", 6 September 2018 (2018-09-06), XP055691677, Retrieved from the Internet <URL:http://ir.arrowheadpharma.com/node/13846/pdf> [retrieved on 20200505] * |
| WOODDELL CI ET AL.: "Long-term RNA interference from optimized siRNA expression constructs in adult mice", BIOCHEM BJOPHYS RES COMMUN, vol. 334, 2005, pages 117 - 127, XP027230095, DOI: 10.1016/j.bbrc.2005.06.066 |
| YANG PL ET AL.: "Hydrodynamic injection of viral DNA: a mouse model of acute hepatitis B virus infection", PNAS USA, vol. 99, 2002, pages 13825 - 13830, XP055268407, DOI: 10.1073/pnas.202398599 |
| ZHANG G ET AL.: "High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA", HUMAN GENE THERAPY, vol. 10, 1999, pages 173 5 - 173 7 |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11534453B2 (en) | 2015-08-07 | 2022-12-27 | Arrowhead Pharmaceuticals, Inc. | RNAi therapy for hepatitis B virus infection |
| US11517584B2 (en) | 2016-08-04 | 2022-12-06 | Arrowhead Pharmaceuticals, Inc. | RNAi agents for Hepatitis B virus infection |
| US11590156B2 (en) | 2016-08-04 | 2023-02-28 | Arrowhead Pharmaceuticals, Inc. | RNAi agents for hepatitis B virus infection |
| US11725194B2 (en) | 2017-12-19 | 2023-08-15 | Janssen Sciences Ireland Unlimited Company | Hepatitis B virus (HBV) vaccines and uses thereof |
| WO2021263271A1 (en) * | 2020-06-22 | 2021-12-30 | Janssen Pharmaceuticals, Inc. | Compositions and methods for treatment of hepatitis d virus infection |
| JP2023531682A (ja) * | 2020-06-22 | 2023-07-25 | ヤンセン ファーマシューティカルズ,インコーポレーテッド | D型肝炎ウイルス感染の処置のための組成物および方法 |
| WO2022078479A1 (en) * | 2020-10-16 | 2022-04-21 | Janssen Pharmaceuticals, Inc. | Combination therapy for treating hepatitis b virus infection |
| WO2022133230A1 (en) * | 2020-12-18 | 2022-06-23 | Janssen Pharmaceuticals, Inc. | Combination therapy for treating hepatitis b virus infection |
| EP4265724A4 (en) * | 2020-12-18 | 2025-11-19 | Olix Pharmaceuticals Inc | ARNI AGENT TO INHIBIT THE EXPRESSION AND USE OF HBV |
| WO2022152869A1 (en) * | 2021-01-15 | 2022-07-21 | Janssen Sciences Ireland Unlimited Company | Use of oligonucleotides for individuals with hepatic impairment |
| WO2023281434A1 (en) * | 2021-07-09 | 2023-01-12 | Janssen Pharmaceuticals, Inc. | Use of oligonucleotides for individuals with renal impairment |
Also Published As
| Publication number | Publication date |
|---|---|
| IL285257A (en) | 2021-09-30 |
| JP2022521155A (ja) | 2022-04-06 |
| EP3920884B1 (en) | 2026-04-01 |
| TW202045723A (zh) | 2020-12-16 |
| US20210395745A1 (en) | 2021-12-23 |
| MX2021009495A (es) | 2021-09-08 |
| SG11202108395SA (en) | 2021-08-30 |
| EP3920884A1 (en) | 2021-12-15 |
| CN113507920A (zh) | 2021-10-15 |
| EP4707394A3 (en) | 2026-04-29 |
| JP7763907B2 (ja) | 2025-11-04 |
| TWI872048B (zh) | 2025-02-11 |
| BR112021015361A2 (pt) | 2021-10-05 |
| CA3129261A1 (en) | 2020-08-13 |
| AU2020219355A9 (en) | 2021-10-14 |
| KR20210130736A (ko) | 2021-11-01 |
| EP4707394A2 (en) | 2026-03-11 |
| JOP20210208A1 (ar) | 2023-01-30 |
| JP7585214B2 (ja) | 2024-11-18 |
| AU2020219355A1 (en) | 2021-09-30 |
| JP2024153797A (ja) | 2024-10-29 |
| PH12021551866A1 (en) | 2022-05-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11517584B2 (en) | RNAi agents for Hepatitis B virus infection | |
| JP7763907B2 (ja) | B型肝炎ウイルス感染のためのRNAi薬 | |
| HK40062579A (en) | Rnai agents for hepatitis b virus infection | |
| HK40106715A (en) | Rnai agents for hepatitis b virus infection | |
| HK40009627A (en) | Rnai agents for hepatitis b virus infection | |
| HK40009558A (en) | Rnai agents for hepatitis b virus infection | |
| HK40009558B (en) | Rnai agents for hepatitis b virus infection | |
| HK40009627B (en) | Rnai agents for hepatitis b virus infection | |
| EA053067B1 (ru) | АГЕНТЫ РНКи ПРОТИВ ИНФЕКЦИИ, ВЫЗВАННОЙ ВИРУСОМ ГЕПАТИТА В | |
| EA044937B1 (ru) | АГЕНТЫ РНКи ПРОТИВ ИНФЕКЦИИ, ВЫЗВАННОЙ ВИРУСОМ ГЕПАТИТА В | |
| OA19828A (en) | RNAi agents for hepatitis B virus infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20709945 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: P6001323/2021 Country of ref document: AE |
|
| ENP | Entry into the national phase |
Ref document number: 3129261 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021546213 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112021015361 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: DZP2021000518 Country of ref document: DZ |
|
| ENP | Entry into the national phase |
Ref document number: 20217028342 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2020709945 Country of ref document: EP Effective date: 20210907 |
|
| ENP | Entry into the national phase |
Ref document number: 2020219355 Country of ref document: AU Date of ref document: 20200207 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 112021015361 Country of ref document: BR Kind code of ref document: A2 Effective date: 20210804 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 779702 Country of ref document: NZ |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 285257 Country of ref document: IL |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2020709945 Country of ref document: EP |