WO2020132059A1 - Adeno-associated virus (aav) producer cell line and related methods - Google Patents

Adeno-associated virus (aav) producer cell line and related methods Download PDF

Info

Publication number
WO2020132059A1
WO2020132059A1 PCT/US2019/067156 US2019067156W WO2020132059A1 WO 2020132059 A1 WO2020132059 A1 WO 2020132059A1 US 2019067156 W US2019067156 W US 2019067156W WO 2020132059 A1 WO2020132059 A1 WO 2020132059A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
gene
mammalian cell
derepressible
under control
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/067156
Other languages
English (en)
French (fr)
Inventor
Bingnan GU
Caitlin M. GUENTHER
Anandita SETH
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Lonza Walkersville Inc
Original Assignee
Lonza Walkersville Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Lonza Walkersville Inc filed Critical Lonza Walkersville Inc
Priority to EP19899841.1A priority Critical patent/EP3891290A4/en
Priority to SG11202106217TA priority patent/SG11202106217TA/en
Priority to CN201980090045.3A priority patent/CN113396222A/zh
Priority to JP2021535829A priority patent/JP7650800B2/ja
Priority to KR1020217022728A priority patent/KR20210108423A/ko
Publication of WO2020132059A1 publication Critical patent/WO2020132059A1/en
Priority to IL284219A priority patent/IL284219A/en
Anticipated expiration legal-status Critical
Priority to JP2025039219A priority patent/JP2025102801A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • C12N15/864Parvoviral vectors, e.g. parvovirus, densovirus
    • C12N15/8645Adeno-associated virus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151Methods of production or purification of viral material
    • C12N2750/14152Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/001Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/005Vector systems having a special element relevant for transcription controllable enhancer/promoter combination repressible enhancer/promoter combination, e.g. KRAB
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/001Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/005Vector systems having a special element relevant for transcription controllable enhancer/promoter combination repressible enhancer/promoter combination, e.g. KRAB
    • C12N2830/006Vector systems having a special element relevant for transcription controllable enhancer/promoter combination repressible enhancer/promoter combination, e.g. KRAB tet repressible
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/40Vector systems having a special element relevant for transcription being an insulator
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/42Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/48Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/50Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • the present disclosure relates to mammalian cell lines for producing adeno-associated virus (AAV).
  • the cells suitably include nucleic acids encoding helper genes and AAV genes, under the control of derepressible promoters.
  • the disclosure also relates to isolated nucleic acid molecules that encode such genes, as well as methods of using the mammalian cells for producing A A Vs.
  • AAV adeno-associated virus
  • the wildtype AAV genome is composed of a 4.7 kb single-stranded DNA that includes regulatory genes for replication (Rep) and structural genes for Capsid (Cap), flanked by inverted terminal repeats (ITR) for virus replication and packaging.
  • Rep regulatory genes for replication
  • Cap structural genes for Capsid
  • ITR inverted terminal repeats
  • AAV replication in host cells requires the coinfection of helper viruses, such as Adenovirus (Ad) and Herpes Simplex virus.
  • helper viruses such as Adenovirus (Ad) and Herpes Simplex virus.
  • Ad Adenovirus
  • Herpes Simplex virus Herpes Simplex virus
  • recombinant AAV can be produced in HEK293 cells by the co-transfection of three plasmids: pHelper plasmids expressing E2A, E40rf6 and VA from Adenovirus, pRep-Cap plasmids for Rep and Cap proteins, and AAV transfer plasmids carrying the desired gene of interest (GOI).
  • pHelper plasmids expressing E2A, E40rf6 and VA from Adenovirus
  • pRep-Cap plasmids for Rep and Cap proteins pRep-Cap plasmids for Rep and Cap proteins
  • AAV manufacturing relies on several bridging platforms. Besides the triple trasnfection in HEK293 cells noted above, AAV can be produced by co-infection of two baculoviruses expressing Rep-Cap and the GOI, respectively, into insect cells. However, these baculoviruses are unstable at higher passage and are time-consuming to prepare (see, e.g., Urabe et al,“Insect Cells as a Factory to Produce Adeno-Associated Virus Type 2 Vectors,” Human Gene Therapy 73: 1935-1943 (2002)). HeLa packaging cells with stably integrated Rep-Cap and GOI have also been developed.
  • a mammalian cell for producing an adeno- associated virus comprising a nucleic acid molecule encoding a viral helper gene under control of a first derepressible promoter, a nucleic acid molecule encoding an AAV gene under control of a second derepressible promoter, and a nucleic acid molecule encoding a repressor element of the first and the second derepressible promoters.
  • AAV adeno- associated virus
  • a mammalian cell for producing an adeno-associated virus comprising a nucleic acid molecule encoding an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter, an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, a viral- associated, non-coding RNA under control of a third depressible promoter, two inverted terminal repeat (ITR) sequences, and a repressor element of the first, second and third derepressible promoters.
  • AAV adeno-associated virus
  • an isolated nucleic acid molecule encoding an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter, an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, a viral-associated, non-coding RNA under control of a third depressible promoter, two inverted terminal repeat (ITR) sequences, and a repressor element of the first, second and third derepressible promoters.
  • an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter
  • an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter
  • a viral-associated, non-coding RNA under control of a third depressible promoter
  • two inverted terminal repeat (ITR) sequences two inverted terminal repeat (ITR) sequences
  • AAV adeno- associated virus
  • adeno-associated virus comprising: transfecting the mammalian cell with an isolated nucleic acid molecule encoding an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter, an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, a viral-associated, non-coding RNA under control of a third depressible promoter, two inverted terminal repeat (ITR) sequences, and a repressor element of the first, second and third derepressible promoters, treating the mammalian cell with a binding partner of the repressor element, activating the first, second and third derepressible promoters, producing the AAV, harvesting the AAV and administering the AAV to a mammalian patient.
  • AAV adeno- associated virus
  • an adeno- associated virus comprising: transfecting a mammalian cell stably expressing one or more nucleic acids encoding TetR and/or TetR-KRAB with a first nucleic acid encoding an adenovirus helper gene comprising an E2A gene, a E40rf gene and a viral-associated non-coding RNA under control of a first derepressible promoter, a second nucleic acid encoding an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, and, optionally, a third nucleic acid encoding a gene of interest under control of a third derepressible promoter, treating the mammalian cell with a binding partner of the TetR and/or TetR-KRAB, activating the first, second, and third derepressible promoters, producing the AAV, and harvesting the AAV.
  • AAV adeno- associated virus
  • adeno-associated virus comprising: stably transfecting a mammalian cell with a nucleic acid encoding a TetR and/or TetR-KRAB repressor, chicken hypersensitive site-4 (cHS4) sequences flanking the TetR and/or TetR-KRAB repressor, and a selection gene, transfecting the stably transfected mammalian cell with: a first nucleic acid encoding an adenovirus helper gene comprising an E2A gene, a E40rf gene and a viral-associated non-coding RNA, under control of a first derepressible promoter; a second nucleic acid encoding an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter; and optionally, a third nucleic acid encoding a gene of interest under control of a third derepressible
  • FIG. 1 shows a schematic of the use of derepressible promoters to control the expression of helper and VA genes in accordance with embodiments hereof.
  • FIGS. 2A and 2B show exemplary nucleic acid molecules for production of helper and VA genes in accordance with embodiments hereof.
  • FIG. 3 shows the results of induction of helper and AAV genes in accordance with embodiments hereof.
  • FIGS. 4A-4C shows schematics of derepressible constructs for expression of AAV genes in accordance with embodiments hereof.
  • FIG. 5 shows exemplary derepressible p5 promoters in accordance with embodiments hereof.
  • FIG. 6 shows exemplary derepressible pl9 promoters in accordance with embodiments hereof.
  • FIG. 7A-7B shows exemplary derepressible pl9 promoters, including an artificial intron, in accordance with embodiments hereof.
  • FIGS. 8A-8B show the results of Rep-Cap expression and AAV titers using the Rep- Cap vectors, in accordance with embodiments hereof.
  • FIGS. 9A-9B show additional results of Rep-Cap expression and AAV titers using the Helpers and Rep-Cap vectors, in accordance with embodiments hereof.
  • FIGS. 10A-10D show exemplary nucleic acid constructs encoding helper, AAV and VA genes, in accordance with embodiments hereof.
  • FIGS. 11 A-l IE show exemplary nucleic acid constructs encoding helper, AAV, gene of interest, and Rep-Cap vectors, in accordance with embodiments hereof.
  • FIGS. 12A-12B show exemplary nucleic acid constructs encoding TetR and TetR- KRAB, in accordance with embodiments hereof.
  • the term“about” is used to indicate that a value includes the inherent variation of error for the method/device being employed to determine the value. Typically the term is meant to encompass approximately or less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20% variability depending on the situation.
  • the words“comprising” (and any form of comprising, such as“comprise” and“comprises”),“having” (and any form of having, such as “have” and“has”),“including” (and any form of including, such as“includes” and“include”) or “containing” (and any form of containing, such as“contains” and“contain”) are inclusive or open- ended and do not exclude additional, unrecited, elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method, system, host cells, expression vectors, and/or composition of the invention. Furthermore, compositions, systems, cells, and/or nucleic acids of the invention can be used to achieve any of the methods as described herein.
  • Adeno-associated virus has emerged as the vector of choice for gene therapy in over 120 clinical trials worldwide.
  • the fast-growing demand of recombinant AAV requires highly efficient and robust manufacturing platforms.
  • current methods for AAV production including transient transfection and helper virus systems, are extremely costly and lab-intensive.
  • Described herein is a plasmid/helper virus-free AAV producer cell line, and methods of use thereof, that provides efficient AAV manufacturing for a long-term solution at significantly reduced cost.
  • the AAV producer cell line described herein represents a next generation platform for both clinical and commercial AAV manufacturing.
  • a mammalian cell for producing an adeno- associated virus AAV.
  • the term“mammalian cell” includes cells from any member of the order Mammalia, such as, for example, human cells, mouse cells, rat cells, monkey cells, hamster cells, and the like.
  • the cell is a mouse cell, a human cell, a Chinese hamster ovary (CHO) cell, a CHOK1 cell, a CHO-DXB11 cell, a CHO-DG44 cell, a CHOK1 SV cell including all variants (e.g.
  • HEK human embryonic kidney
  • Mammalian cells include mammalian cell cultures which can be either adherent cultures or suspension cultures.
  • Adherent cultures refer to cells that are grown on a substrate surface, for example a plastic plate, dish or other suitable cell culture growth platform, and may be anchorage dependent.
  • Suspension cultures refer to cells that can be maintained in, for example, culture flasks or large suspension vats, which allows for a large surface area for gas and nutrient exchange. Suspension cell cultures often utilize a stirring or agitation mechanism to provide appropriate mixing. Media and conditions for maintaining cells in suspension are generally known in the art.
  • An exemplary suspension cell culture includes human HEK293 clonal cells.
  • adeno-associated virus refers to a small sized, replicative-defective nonenveloped virus containing a single stranded DNA of the family Parvoviridae and the genus Dependoparvovirus. Over 10 adeno-associated virus serotypes have been identified so far, with serotype AAV2 being the best characterized. Other non-limiting examples of AAV serotypes are ANC80, AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and AAV11. In addition to these serotypes, AAV pseudotypes have been developed.
  • An AAV pseudotype contains the capsid of a first serotype and the genome of a second serotype (e.g. the pseudotype AAV2/5 would correspond to an AAV with the genome of serotype AAV2 and the capsid of AAV5).
  • adenovirus refers to a nonenveloped virus with an icosahedral nucleocapsid containing a double stranded DNA of the family Adenoviridae. Over 50 adenoviral subtypes have been isolated from humans and many additional subtypes have been isolated from other mammals and birds. Birds. See, e.g., Ishibashi et al.,“Adenoviruses of animals,” In The Adenoviruses, Ginsberg, ed., Plenum Press, New York, N.Y., pp.
  • the mammalian cell provided herein suitably includes a nucleic acid molecule encoding a viral helper gene under control of a first derepressible promoter, a nucleic acid molecule encoding an AAV gene under control of a second derepressible promoter, and a nucleic acid molecule encoding a repressor element of the first and the second derepressible promoters.
  • the nucleic acid molecules encoding the various components for producing an AAV are contained within the mammalian cell in separate nucleic acid molecules, for example separate plasmids or vectors. In other embodiments, the nucleic acid molecules encoding the various components for producing an AAV are included on the same plasmid or vector. In further embodiments, certain of the components are contained on the same nucleic acid molecule (e.g., helper genes and AAV gens), while other genes are contained on separate nucleic acid molecules (e.g., gene encoding the repressor element).
  • A“nucleic acid,”“nucleic acid molecule,” or“oligonucleotide” means a polymeric compound comprising covalently linked nucleotides.
  • the term “nucleic acid” includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which may be single- or double-stranded.
  • DNA includes, but is not limited to, complimentary DNA (cDNA), genomic DNA, plasmid or vector DNA, and synthetic DNA.
  • RNA includes, but is not limited to, mRNA, tRNA, rRNA, snRNA, microRNA, miRNA, or MTRNA
  • the nucleic acid molecules are capable of encoding the various genes. That is the nucleic acid molecules, when transcribed, produce mRNA for the genes described herein, which is then translated to the desired or required proteins.
  • the mammalian cells include a nucleic acid molecule encoding a viral helper gene.
  • Viral helper genes include various adenoviral virus genes, herpes virus genes and bocavirus genes (see, e.g., Guido et al .,“Human bocavirus: Current knowledge and future challenges,” World J. Gateroenterol 22:8684-8697, the disclosure of which is incorporated by reference herein in its entirety).
  • the viral helper gene is an adenovirus helper gene.
  • the term“adenovirus helper gene” or“AV helper gene” refers to a gene that is composed of one or more nucleic acid sequences derived from one or more adenovirus subtypes or serotypes that contributes to Adeno-associated virus replication and packaging.
  • the Adenovirus helper gene is El A, E1B, E2A, E4 (including E40rf6), VA, or a combination thereof or any other adenovirus helper gene.
  • the adenovirus helper gene comprises both E2A and E40rf6 genes.
  • an internal ribosome entry site (IRES) element is included between the E2A and E40rf6 genes. The IRES element initiates translation of the E40rf6 gene after the E2A gene in a single expression cassette, providing stability to the construct.
  • the various nucleic acid molecules encoding the various genes described herein are suitably under control of a derepressible promoter.
  • “under control” refers to a gene being regulated by a“promoter,”“promoter sequence,” or“promoter region,” which refers to a DNA regulatory region/sequence capable of binding RNA polymerase and initiating transcription of a downstream coding or non-coding gene sequence.
  • the promoter and the gene are in operable combination or operably linked.
  • the terms“in operable combination”,“in operable order” and“operably linked” refer to the linkage of nucleic acid sequences in such a manner that a promoter capable of directing the transcription of a given gene and/or the synthesis of a desired protein molecule is produced.
  • the term also refers to the linkage of amino acid sequences in such a manner so that a functional protein is produced.
  • the promoter sequence includes the transcription initiation site and extends upstream to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • the promoter sequence includes a transcription initiation site, as well as protein binding domains responsible for the binding of RNA polymerase.
  • Eukaryotic promoters will often, but not always, contain“TATA” boxes and“CAT” boxes.
  • Various promoters, including inducible promoters may be used to drive the gene expression, e.g., in the host cell or vectors of the present disclosure.
  • the promoter is not a leaky promoter, i.e., the promoter is not constitutively expressing any of the gene products as described herein.
  • the promoter is a constitutive promoter, which initiates mRNA synthesis independent of the influence of an external regulation.
  • the promoters used to control the transcription of the various genes for producing the AAVs described herein are derepressible promoters.
  • a “derepressible promoter” refers to a structure that includes a functional promoter and additional elements or sequences capable of binding to a repressor element to cause repression of the functional promoter. “Repression” refers to the decrease or inhibition of the initiation of transcription of a downstream coding or non-coding gene sequence by a promoter.
  • A“repressor element” refers to a protein or polypeptide that is capable of binding to a promoter (or near a promoter) so as to decrease or inhibit the activity of the promoter.
  • a repressor element can interact with a substrate or binding partner of the repressor element, such that the repressor element undergoes a conformation change. This conformation change in the repressor element takes away the ability of the repressor element to decrease or inhibit the promoter, resulting in the “derepression” of the promoter, thereby allowing the promoter to proceed with the initiation of transcription.
  • A“functional promoter” refers to a promoter, that absent the action of the repressor element, would be capable of initiation transcription.
  • promoters that can be used in the practice of the present invention are known in the art, and include for example, PCMV, PHI, P19, P5, P40 and promoters of Adenovirus helper genes (e.g., E1A, E1B, E2A, E40rf6, and VA).
  • Exemplary repressor elements and their corresponding binding partners that can be used as derepressible promoters are known in the art, and include systems such as the cumate gene- switch system (CuO operator, CymR repressor and cumate binding partner) (see, e.g., Mullick el al.,“The cumate gene-switch: a system for regulated expression in mammalian cells,” BMC Biotechnology 6: 43 (1-18) (2006), the disclosure of which is incorporated by reference herein in its entirety, including the disclosure of the derepressible promoter system described therein) and the TetO/TetR system described herein (see, e.g., Yao e a/.,“Tetracycline Repressor, tetR, rather than the tetR-Mammalian Cell Transcription Factor Fusion Derivatives, Regulates Inducible Gene Expression in Mammalian Cells,” Human Gene Therapy 9: 1939-1950 (1998), the disclosure of which
  • the derepressible promoters comprise a functional promoter and two tetracycline operator sequences (TetCk).
  • TetCk tetracycline operator sequences
  • FIG. 1 A schematic showing an exemplary depressible promoter system is provided in FIG. 1.
  • TetCk TetO sequences
  • TetR suitable Doxy cy cline
  • the TetR proteins change conformation, release from the TetCk sequences, and the functional promoters begin their normal transcription processes, as they would naturally.
  • this results in the change of the overall system from an“off’ position (where suitably no transcription is taking place from the PCMV promoter and the PHI promoter), to an“on” position when Dox is added, allowing the PCMV promoter and the PHI promoter to return to their natural state of transcribing the genes under their control.
  • an“off’ position where suitably no transcription is taking place from the PCMV promoter and the PHI promoter
  • the PCMV promoter with TetC sequences (suitably the pcDNA4/TO promotor; INVITROGEN ® ), is in an“off’ position when bound by TetR.
  • the TetR changes conformation, release from the TetCh sequences of the depressible promoter, and the PCMV promotor proceeds to transcribe the adenoviral helper genes (e.g., E2A and E4).
  • the mammalian cell can further comprise a nucleic acid encoding a viral-associated (VA), non-coding RNA under control of a fourth derepressible promoter.
  • this derepressible promoter can include the functional promoter PHI, and the TetCh sequences controlling the expression of the non-coding RNA (see, e.g., Wiederschain et al .,“Single-vector inducible lentiviral RNAi system for oncology target validation, Cell Cycle 5:498-504 (2009), the disclosure of which is incorporated by reference herein in its entirety, including for the disclosure of the promoter system and sequence).
  • FIG. 1 shows that controls the expression of the non-coding RNA.
  • the PHI promoter with TetCh sequences is in an“off’ position when bound by TetR.
  • the TetR changes conformation, release from the TetCh sequences of the depressible promoter, and the PHI promotor proceeds to transcribe the VA 1 non-coding RNA.
  • FIG. 2A shows an exemplary nucleic acid molecule that can be utilized in the various mammalian cells and methods described herein.
  • a CMV promoter is used upstream of both E2A and E40rf6 genes, linked via a IRES element.
  • the CMV promoter includes the CMV enhancer and the tet operator (TetCE), for control, via derepression.
  • TetCE tet operator
  • FIG. 2A shows an exemplary location for the HI promotor, also including TetCh sequences, controlling the expression of the VA non-coding RNA.
  • FIG. 1 and FIG. 2A also illustrate that, in embodiments, the mammalian cells can include the repressor element under control of a constitutive promoter.
  • the repressor element that is encoded is a tetracycline repressor protein (TetR).
  • TetR tetracycline repressor protein
  • a suitable promotor for expression of the repressor element is an hPGK promotor.
  • a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein can be included.
  • this transcriptional repression domain is a Krueppel-associated box (KRAB) sequence, fused in frame to the C-terminus of TetR (see, e.g., Szulc et al.,“A versatile tool for conditional gene expression and knockdown,” Nature Methods 3: 109-1 16 (2006)).
  • KRAB Krueppel-associated box
  • FIG. 2B and FIG. 12A shows an exemplary nucleic acid molecule that lacks the KRAB sequence.
  • a nucleic acid encoding the tetracycline repressor protein can be included or stably expressed within a mammalian cell.
  • this transcriptional repression domain is a Krueppel-associated box (KRAB) sequence, fused in frame to the C-terminus of TetR (see, e.g., Szulc et al.,“A versatile tool for conditional gene expression and knockdown,” Nature Methods 3: 109-116 (2006)).
  • KRAB Krueppel-associated box
  • FIG. 2B and FIG. 12A show an exemplary nucleic acid molecule that lacks the KRAB sequence.
  • the AAV gene that is encoded by the nucleic acid molecule comprises Rep and Cap genes.
  • Other AAV genes that can be encoded by the nucleic acid molecules include any gene from any AAV serotype.
  • the AAV gene is Rep78, Rep68, Rep52, Rep40, VP1, VP2, VP3 , or a combination thereof.
  • the AAV gene is from adeno-associated virus type 2.
  • the AAV gene is from the adeno-associated virus Anc80.
  • the term“Rep” gene refers to the art-recognized region of the AAV genome which encodes the replication proteins of the virus which are collectively required for replicating the viral genome, or functional homologues thereof such as the human herpesvirus 6 (HHV-6) rep gene which is also known to mediate AAV-2 DNA replication.
  • the rep coding region can include the genes encoding for AAV Rep78 and Rep68 (the“long forms of Rep”), and Rep52 and Rep40 (the“short forms of Rep”), or functional homologues thereof.
  • the rep coding region, as used herein, can be derived from any viral serotype, such as the AAV serotypes described herein.
  • the region need not include all wild-type genes but may be altered, (e.g., by insertion, deletion or substitution of nucleotides), so long as the rep genes present provide for sufficient integration functions when expressed in a suitable target cell. See, e.g. Muzyczka, N., Current Topics in Microbiol and Immunol. 158.91-129 (1992); and Kotin, R. M., Human Gene Therapy 5:793-801 (1994).
  • the term“Cap” gene refers to the art-recognized region of the AAV genome which encodes the capsid proteins of the virus.
  • Illustrative (non-limiting) examples of these capsid proteins are the AAV capsid proteins VP1, VP2, and VP3.
  • Cap genes used in this disclosure can come from any AAV serotype or a combination of AAV serotypes.
  • FIG. 4A shows the natural location and promoter drivers of Rep and Cap genes.
  • the ratio of Rep78 and Rep52 genes must be maintained at optimum levels.
  • control of the amount of Rep78 production can interference with DNA replication.
  • Rep78 can be toxic if overly produced in mammalian cells.
  • the mammalian cell can include a nucleic acid encoding a Rep78 gene under control of the second derepressible promoter and a Rep52 gene under control of a third derepressible promoter.
  • a nucleic acid encoding a Rep78 gene under control of the second derepressible promoter and a Rep52 gene under control of a third derepressible promoter.
  • the Rep78 gene can be under the control of a derepressible promoter (p5), that includes the TetC sequences.
  • the natural pl9 promoter within Rep78 is modified or mutated to be silenced.
  • the removed Rep52 gene is also placed under the control of a derepressible promoter (pi 9) that includes TetC sequences.
  • FIG. 5 shows three potential locations for each of the TetO sequences, relative to the TATA box, rep-binding element (RBE) and initiator element (INR), for modification to the p5 promotor of Rep78.
  • the wild-type p5 promotor is also illustrated schematically.
  • FIG. 6 shows three potential locations for each of the TetO sequences, relative to the TATA boxes and the Spl transcription factor, of the pl9 promoter for Rep52.
  • the wild-type pl9 promotor is also illustrated schematically. Additional locations of the TetO sequences are also encompassed herein and can readily be envisioned by those of ordinary skill in the art.
  • the Rep78 gene can be under control of a derepressible promoter, and the Rep52 gene can be under control of a derepressible promoter that is contained within an artificial intron.
  • a derepressible p5 promoter e.g., including Tet02 sequences as described herein
  • a derepressible pl9 promoter e.g., including TetCk sequences contained within an intron (designated In-i-pl9), controls the expression of Rep52.
  • FIG. 7A where the two tet operator sequences are illustrated within a chimeric intron.
  • This chimeric intron can be inserted at various locations relative to the components of the pl9 promoter.
  • the intron sequence is suitably placed downstream of the TATA-2 of the pl9 promoter. Spacing can be, for example, between about 1 and 25 base pairs downstream from the TATA-2 sequence.
  • the Cap gene that is encoded by the nucleic acid molecules is suitably under the control of a native promoter. That is, the Cap gene does not necessarily have to be under the control of a derepressible promoter, though a derepressible promoter can be used if desired. In suitable embodiments, the Cap gene is under the control of a p40 promoter.
  • the nucleic acid molecules include two inverted terminal repeat (ITR) sequences. As known in the art, these ITR sequences (i.e., AAV2 ITR) are single stranded sequence of nucleotides, followed downstream by its reverse compliment.
  • ITR sequences represent the minimal sequence required for replication, rescue, packaging and integration of the AAV genome.
  • these ITR sequences flank a gene of interest.
  • the nucleic acid molecules further encode a gene of interest.
  • This gene of interest can be, for example, a reporter gene, a selection gene, or a gene of therapeutic interest, for example.
  • a gene of interest such as the gene encoding green fluorescent protein (EGFP) is flanked by two ITR sequences.
  • EGFP green fluorescent protein
  • A“gene” refers to an assembly of nucleotides that encode a polypeptide, and includes cDNA and genomic DNA nucleic acid molecules.“Gene” also refers to a nucleic acid fragment that can act as a regulatory sequence preceding (5' non-coding sequences) and following (3' non coding sequences) the coding sequence. In some embodiments, genes are integrated with multiple copies. In some embodiments, genes are integrated at predefined copy numbers.
  • the term“gene of interest” or“GOI” is used to describe a heterologous gene.
  • the term“heterologous gene” or“HG” as it relates to nucleic acid sequences such as a coding sequence or a control sequence denotes a nucleic acid sequence, e.g. a gene, that is not normally joined together, and/or are not normally associated with a particular cell.
  • a heterologous gene is a construct where the coding sequence itself is not found in nature (e.g., synthetic sequences having codons different from the native gene). Allelic variation or naturally occurring mutational events do not give rise to heterologous DNA, as used herein.
  • a“reporter gene” is a gene whose expression confers a phenotype upon a cell that can be easily identified and measured.
  • the reporter gene comprises a fluorescent protein gene.
  • the reporter gene comprises a selection gene.
  • selection gene refers to the use of a gene which encodes an enzymatic activity that confers the ability to grow in medium lacking what would otherwise be an essential nutrient; in addition, a selection gene may confer resistance to an antibiotic or drug upon the cell in which the selection gene is expressed.
  • a selection gene may be used to confer a particular phenotype upon a host cell. When a host cell must express a selection gene to grow in selective medium, the gene is said to be a positive selection gene.
  • a selection gene can also be used to select against host cells containing a particular gene; a selection gene used in this manner is referred to as a negative selection gene.
  • the term“gene of therapeutic interest” refers to any functionally relevant nucleotide sequence.
  • the gene of therapeutic interest of the present disclosure can comprise any desired gene that encodes a protein that is defective or missing from a target cell genome or that encodes a non-native protein having a desired biological or therapeutic effect (e.g., an antiviral function), or the sequence can correspond to a molecule having an antisense or ribozyme function.
  • genes of therapeutic interest include those used for the treatment of inflammatory diseases, autoimmune, chronic and infectious diseases, including such disorders as AIDS, cancer, neurological diseases, cardiovascular disease, hypercholestemia; various blood disorders including various anemias, thalassemias and hemophilia; genetic defects such as cystic fibrosis, Gaucher's Disease, adenosine deaminase (ADA) deficiency, emphysema, etc.
  • inflammatory diseases autoimmune, chronic and infectious diseases, including such disorders as AIDS, cancer, neurological diseases, cardiovascular disease, hypercholestemia; various blood disorders including various anemias, thalassemias and hemophilia; genetic defects such as cystic fibrosis, Gaucher's Disease, adenosine deaminase (ADA) deficiency, emphysema, etc.
  • antisense oligonucleotides e.g., short oligonucleotides complementary to sequences around the translational initiation site (AUG codon) of an mRNA
  • AUG codon translational initiation site
  • the mammalian cells provided herein are substantially free of helper virus.
  • a“helper virus” is any non-AAV virus that is added to enable the replication and packaging of adeno-associated virus.
  • Representative (non-limiting) examples of helper viruses are adenovirus and herpes virus.
  • the term substantially free of helper virus refers to a cell that has fewer than 100, fewer than 10, or fewer than 1 helper virus per cell.
  • the term substantially free of helper virus refers to a cell in which no helper viruses are present or to a population of cells in which no helper viruses are present using detection methods known to those skilled in the art.
  • no wild-type helper virus is in the cell.
  • wild-type virus refers to any complete- non-AAV virus that can replicate in the cell independently of any other virus.
  • the AAV producer cells described herein provide a long-term and cost-efffective solution for large scale AAV manufracturing. As constitutive expression of either helper or Rep proteins can be cytotoxic, the stratagies described herein allow for control of their expression by engineered, derepressible promoters.
  • a mammalian cell for producing an adeno-associated virus comprising, in a single nucleic acid molecule, sequences encoding an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter, an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, a viral-associated, non-coding RNA under control of a third depressible promoter, two inverted terminal repeat (ITR) sequences, and a repressor element of the first, second and third derepressible promoters.
  • this single nucleic acid molecule includes all of the various sequences, along with other required elements, to enable the production of an AAV within the cell.
  • FIG. 10A and 10B show exemplary nucleic acid molecules including these various sequences that can be utilized in mammalian cells to produce AAVs.
  • the mammalian cells are mammalian cell cultures, and in embodiments, can be suspension cultures.
  • the use of suspension cell cultures allows for increased scalability and production of AAV.
  • the single nucleic acid molecule includes an internal ribosome entry site (IRES) element between the E2A and E40rf6 genes.
  • IRS internal ribosome entry site
  • a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a fourth derepressible promoter (e.g., as shown in FIG. 4B, the Rep52 gene is separate from the Rep78 gene).
  • a Rep78 gene can be placed under control of the second derepressible promoter and a Rep52 gene can be placed under control of a fourth derepressible promoter contained within an artificial intron.
  • the Cap gene is under control of a native promoter.
  • the derepressible promoters comprise a functional promoter and two tetracycline operator sequences (TetCh).
  • the functional promoter of the first derepressible promoter i.e., controlling the expression of the adenovirus helper gene comprising E2A and E40rf6 genes
  • CMV cytomegalovirus
  • the repressor element of the derepressible promoter is under control of a constitutive promoter, such that it is produced at all times to limit expression of other genes under the control of the derepressible promoters.
  • the repressor element that is encoded is a tetracycline repressor protein, for binding to TetCh sequences to act as the derepressible promoter. In embodiments, for example as shown in FIG.
  • a nucleic acid encoding a transcriptional repression domain (e.g., a KRAB sequence) is included in frame with the nucleic acid encoding the tetracycline repressor protein.
  • This transcriptional repression domain provides for improved repressive activity of the TetR when binding to TetCh, thereby minimizing the amount of leakage or basal gene expression prior to derepression.
  • Exemplary mammalian cells that can be used in the embodiments and methods described herein are described throughout, and include for example, Chinese hamster ovary (CHO) cells, as well as human cells, including human embryonic kidney (HEK, such as HEK293) cells.
  • CHO Chinese hamster ovary
  • HEK human embryonic kidney
  • the mammalian cells further include a nucleic acid molecule encoding a gene of interest (GOI).
  • GOI a gene of interest
  • the GOI is included between two ITR sequences.
  • an isolated nucleic acid molecule encoding an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter, an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, a viral-associated, non-coding RNA under control of a third depressible promoter, two inverted terminal repeat (ITR) sequences, and a repressor element of the first, second and third derepressible promoters.
  • an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter
  • an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter
  • a viral-associated, non-coding RNA under control of a third depressible promoter
  • two inverted terminal repeat (ITR) sequences two inverted terminal repeat (ITR) sequences
  • an“isolated nucleic acid molecule” includes vectors and plasmids that can contain the isolated nucleic acid molecule, as well as similar structures where the isolated nucleic acid molecule can be manipulated, stored, shipped, and ultimately utilized in various cell transfection systems.
  • the isolated nucleic acid molecules described herein can be used for production of AAVs as described herein, but can also be utilized in various non-AAV producing cell lines (including transient transfection systems).
  • the isolated nucleic acid molecules described herein suitably further include various additional elements and sequences as required to allow for use in the cellular systems, including mammalian cells, described herein.
  • FIGS. 10A-10B two plasmid constructs are shown.
  • an internal ribosome entry site (IRES) element can be included between the E2A and E40rf6 genes.
  • IRS internal ribosome entry site
  • a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a fourth derepressible promoter (i.e., separated from the Rep52 gene).
  • a Rep78 gene is under control of a derepressible promoter (ip5 promoter as shown, and various iterations described in FIG. 5) and a Rep52 gene is under control of a fourth derepressible promoter contained within an artificial intron, illustrated as ipl9, and described with reference to FIGS. 7A-7B.
  • the isolated nucleic acid further suitably includes the Cap gene under control of a native promoter (i.e., p40).
  • various derepressible promoters can be included in the isolated nucleic acid molecules, and suitably include a functional promoter and two tetracycline operator sequences (TetCh). As shown in FIG. 10A and 10B, with regard to the helper genes E2 and E4, suitably this functional promoter is a CMV promoter, which includes the TetCh sequences.
  • the derepressible promoter for use with the viral-associated, non-coding RNA suitably includes an HI promoter, as well as the TetC sequences.
  • the repressor element e.g., a tetracycline repressor protein
  • a constitutive promoter for example, a hPGK promoter.
  • the isolated nucleic acid molecules can further include a nucleic acid encoding a transcriptional repression domain (e.g., a KRAB sequence) in frame with the nucleic acid encoding the tetracycline repressor protein.
  • the isolated nucleic acid molecules can further include a gene of interest (GOI, e.g., a GFP), suitably between the two ITR sequences.
  • GOI gene of interest
  • the repressor element is suitably flanked by an insulator, for example, a chicken hypersensitive site-4 (cHS4) sequence.
  • a chicken hypersensitive site-4 (cHS4) sequence for example, a chicken hypersensitive site-4 (cHS4) sequence.
  • a nucleic acid encoding a transcriptional repression domain (such as KRAB) is included in frame with the nucleic acid encoding the tetracycline repressor protein (e.g., TetR-KRAB).
  • FIGS. 10A-10D and FIGS. 11A-11E Additional genetic and sequence elements for inclusion in the isolated nucleic acid molecules described herein are known in the art and can be found illustrated schematically in FIGS. 10A-10D and FIGS. 11A-11E.
  • sequence identity or“% identity” in the context of nucleic acid sequences described herein refers to the percentage of residues in the compared sequences that are the same when the sequences are aligned over a specified comparison window.
  • a comparison window can be a segment of at least 10 to over 1000 residues in which the sequences can be aligned and compared.
  • Methods of alignment for determination of sequence identity are well-known can be performed using publicly available databases such as BLAST (blast.ncbi.nlm.nih.gov/Blast. CGI.).
  • nucleic acid molecules have at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity with a reference nucleic acid molecule, respectively (or a fragment of the reference polypeptide or nucleic acid molecule).
  • polypeptides or nucleic acid molecules have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% or 100% sequence identity with a reference nucleic acid molecule, respectively (or a fragment of the reference nucleic acid molecule).
  • nucleic acid molecules have about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% sequence identity with a reference nucleic acid molecule, respectively.
  • A“vector” or“expression vector” is a replicon, such as a plasmid, phage, virus, or cosmid, to which a nucleic acid molecule described herein may be attached to bring about the replication and/or expression of the attached nucleic acid molecule in a cell.
  • “Vector” includes episomal ( e.g ., plasmids) and non-episomal vectors.
  • the term“vector” includes both viral and nonviral means for introducing a nucleic acid molecule into a cell in vitro , in vivo , or ex vivo.
  • the term vector may include synthetic vectors. Vectors may be introduced into the desired host cells by well-known methods, including, but not limited to, transfection, transduction, cell fusion, and lipofection. Vectors can comprise various regulatory elements including promoters.
  • adeno-associated virus in a mammalian cell.
  • the methods described herein include transfecting the mammalian cell with an isolated nucleic acid molecule encoding an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter, an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, a viral-associated, non-coding RNA under control of a third depressible promoter, two inverted terminal repeat (ITR) sequences, and a repressor element of the first, second and third derepressible promoters.
  • an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter
  • an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter
  • a viral-associated, non-coding RNA under control of a third depressible promoter
  • Transfection means the introduction of an exogenous nucleic acid molecule, including a vector, into a cell.
  • A“transfected” cell comprises an exogenous nucleic acid molecule inside the cell and a“transformed” cell is one in which the exogenous nucleic acid molecule within the cell induces a phenotypic change in the cell.
  • the transfected nucleic acid molecule can be integrated into the host cell's genomic DNA and/or can be maintained by the cell, temporarily or for a prolonged period of time, extra-chromosomally.
  • Host cells or organisms that express exogenous nucleic acid molecules or fragments are referred to as “recombinant,” “transformed,” or“transgenic” organisms.
  • transfection techniques are generally known in the art. See, e.g., Graham et ah, Virology, 52:456 (1973); Sambrook et ah, Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York (1989); Davis et ah, Basic Methods in Molecular Biology, Elsevier (1986); and Chu et ah, Gene 73: 197 (1981).
  • exogenous DNA moieties such as an AAV vector cassette, AAV helper constructs, and other nucleic acid molecules
  • Various methods of transfecting the mammalian cells with the isolated nucleic acid molecules described herein are known in the art and include various chemical and physical methods, for example, electroporation, cell injection, calcium phosphate exposure, liposome or polymer-based carrier systems, etc.
  • a vectors such as the PIGGYBACTM transposon can be used for the stable integration of these nucleic acid molecules, which allows one-step insertion of large nucleic acid sequences in multiple copies randomly in a cell genome.
  • the system consists of a PIGGYBACTM Vector and the Super PIGGYBACTM Transposase which recognizes transposon-specific inverted terminal repeats (ITRs) and efficiently integrates the ITRs and intervening DNA into the genome at TTAA sites.
  • the Super PIGGYBACTM Transposase is delivered to the cell via the Super PIGGYBACTM Transposase Expression Vector, which is co transfected with one or more PIGGYBACTM Vectors.
  • the methods further include treating the mammalian cell with a binding partner of the repressor element.
  • a repressor element in the presence of a repressor element, the functional promoters of the derepressible promoters controlling the transcription of the various genes encoded by the nucleic acid molecules, are repressed. That is, the genes are not actively being transcribed, and are instead awaiting derepression.
  • the repressor element of the derepressible promoters is suitably under control of constitutive promoter, such that the repressor element is being produced soon after transfection of the nucleic acid molecule into the mammalian cell.
  • the repressor element Upon treatment with the binding partner of the repressor element, the repressor element binds to the binding partner, changes conformation, and no longer represses the derepressible promoter. This results in the activating of the first, second and third (and additional as needed) derepressible promoters (i.e., the functional promoters of the derepressible promoters) within the mammalian cell.
  • the first, second and third (and additional as needed) derepressible promoters i.e., the functional promoters of the derepressible promoters
  • the various elements are transcribed and translated within the mammalian cell, resulting in the production of the AAV.
  • the AAV is then harvested using methods known in the art.
  • the mammalian cell culture is a suspension culture, including a human cell such as an HEK suspension cell culture.
  • nucleic acid molecules can further include an internal ribosome entry site (IRES) element between the E2A and E40rf6 genes.
  • IRS internal ribosome entry site
  • Exemplary constructs related to the Rep78 and Rep 52 genes are described herein, including where a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a fourth derepressible promoter.
  • a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a fourth derepressible promoter contained within an artificial intron.
  • the use of an artificial intron allows for removal of the fourth derepressible promoter following activating the derepressible promoters and prior to the producing the AAV.
  • the derepressible promoter within the intron ensures the repression of Rep52 gene expression before activation, while still allowing for the expression of the Rep78 protein following the removal of the intron during mRNA splicing.
  • the Cap gene is under control of a native promoter, such as p40.
  • the functional promoter of the derepressible promoter controlling the expression of the helper genes is a cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • the repressor element that is encoded in the methods described herein is a tetracycline repressor protein, and suitably the derepressible promoters comprise a functional promoter and two tetracycline operator sequences (Tet02).
  • the repressor element is under control of a constitutive promoter, such as hPGK, for example when the repressor element that is encoded is a tetracycline repressor protein.
  • HEK human embryonic kidney
  • CHO Chinese hamster ovary
  • the AAV comprises a nucleic acid molecule encoding a gene of interest.
  • This GOI can be a reporter gene, a selection gene, or any other gene of interest, including a gene of therapeutic interest.
  • the methods of producing the AAVs can be used in a continuous manufacturing system.
  • the use of a suspension cell culture allows for the production of large volumes of AAV, with high productivity and prolonged culture conditions to allow for multiple harvests of AAV for each batch of starting cells.
  • Production methods can utilize any suitable reactor(s) including but not limited to stirred tank, airlift, fiber, microfiber, hollow fiber, ceramic matrix, fluidized bed, fixed bed, and/or spouted bed bioreactors.
  • “reactor’ can include a fermenter or fermentation unit, or any other reaction vessel and the term“reactor” is used interchangeably with“fermenter”
  • fermenter or fermentation refers to both microbial and mammalian cultures.
  • an example bioreactor unit can perform one or more, or all, of the following: feeding of nutrients and/or carbon sources, injection of suitable gas (e.g., oxygen), inlet and outlet flow of fermentation or cell culture medium, separation of gas and liquid phases, maintenance of temperature, maintenance of oxygen and CO2 levels, maintenance of pH level, agitation (e.g., stirring), and/or cleaning/sterilizing.
  • suitable gas e.g., oxygen
  • Example reactor units such as a fermentation unit, may contain multiple reactors within the unit, for example the unit can have 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100, or more bioreactors in each unit and/or a facility may contain multiple units having a single or multiple reactors within the facility.
  • the bioreactor can be suitable for batch, semi fed-batch, fed-batch, perfusion, and/or a continuous fermentation processes. Any suitable reactor diameter can be used. In embodiments, the bioreactor can have a volume between about 100 mL and about 50,000 L.
  • Non-limiting examples include a volume of 100 mL, 250 mL, 500 mL, 750 mL, 1 liter, 2 liters, 3 liters, 4 liters, 5 liters, 6 liters, 7 liters, 8 liters, 9 liters, 10 liters, 15 liters, 20 liters, 25 liters, 30 liters, 40 liters, 50 liters, 60 liters, 70 liters, 80 liters, 90 liters, 100 liters, 150 liters, 200 liters, 250 liters, 300 liters, 350 liters, 400 liters, 450 liters, 500 liters, 550 liters, 600 liters, 650 liters, 700 liters, 750 liters, 800 liters, 850 liters, 900 liters, 950 liters, 1000 liters, 1500 liters, 2000 liters, 2500 liters, 3000 liters, 3
  • suitable reactors can be multi-use, single-use, disposable, or non-disposable and can be formed of any suitable material including metal alloys such as stainless steel (e.g., 316L or any other suitable stainless steel) and Inconel, plastics, and/or glass.
  • metal alloys such as stainless steel (e.g., 316L or any other suitable stainless steel) and Inconel, plastics, and/or glass.
  • the devices, facilities, and methods described herein can also include any suitable unit operation and/or equipment not otherwise mentioned, such as operations and/or equipment for separation, purification, and isolation of such products.
  • Any suitable facility and environment can be used, such as traditional stick-built facilities, modular, mobile and temporary facilities, or any other suitable construction, facility, and/or layout.
  • modular clean-rooms can be used.
  • the devices, systems, and methods described herein can be housed and/or performed in a single location or facility or alternatively be housed and/or performed at separate or multiple locations and/or facilities.
  • a method of treatment with an adeno- associated virus comprising: transfecting the mammalian cell with an isolated nucleic acid molecule encoding: an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter, an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, a viral-associated, non-coding RNA under control of a third depressible promoter, two inverted terminal repeat (ITR) sequences, and a repressor element of the first, second and third derepressible promoters, treating the mammalian cell with a binding partner of the repressor element, activating the first, second and third derepressible promoters, producing the AAV, harvesting the AAV, and administering the AAV to a mammalian patient.
  • AAV adeno- associated virus
  • the methods are used to treat a human patient with a gene of interest, including a gene of therapeutic interest.
  • Administration to a human patient can include, for example, inhalation, injection, or intravenous administration, as well as other administration methods known in the art.
  • the methods of producing the AAV and the use of various derepressible promoters are described herein.
  • a method of producing an adeno-associated virus includes transfecting a mammalian cell stably expressing one or more nucleic acids encoding TetR and/or TetR-KRAB with: a first nucleic acid encoding an adenovirus helper gene comprising an E2A gene, a E40rf gene and a viral-associated non-coding RNA, under control of a first derepressible promoter, a second nucleic acid encoding an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, optionally, a third nucleic acid encoding a gene of interest under control of a third derepressible promoter; treating the mammalian cell with a binding partner of the TetR; activating the first, second and third derepressible promoters; producing the AAV; and harvesting the AAV.
  • AAV adeno-associated virus
  • the mammalian cell is a mammalian cell culture, including a suspension culture
  • the mammalian cell is a Chinese hamster ovary (CHO) cell or a human cell including a human embryonic kidney (HEK) cell.
  • CHO Chinese hamster ovary
  • HEK human embryonic kidney
  • nucleic acids or transposons to transfect mammalian cells offers advantages over combining the nucleic acids in one plasmid, including the ability to optimize the ratio of separate AAV-producing and packaging components and to exert temporal control over expression of each transposon.
  • the nucleic acid encoding the E2A and E40rf genes further comprises an internal ribosome entry site (IRES) element between the E2A and E40rf genes.
  • IRS internal ribosome entry site
  • the derepressible promoters comprise a functional promoter and two tetracycline operator sequences (TetCk).
  • the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • the mammalian cell used to produce adeno-associated virus (AAV) is stably expressing one or more nucleic acids encoding TetR and/or TetR-KRAB under control of a constitutive promoter.
  • TetR and/or TetR-KRAB stable expression of a TetR and/or TetR-KRAB in a mammalian cell (prior to insertion of nucleic acids carrying the components of the virus, suitably via transposons) maximizes the repression of potentially cytotoxic AAV genes introduced by transfection and confers increased temporal control over the derepressible promoter elements.
  • a KRAB repressor domain is fused in frame with the TetR.
  • fusing a KRAB repressor domain in frame with the TetR ensures that“leaky” expression of the potentially cytotoxic AAV-packaging nucleic acids is less likely to occur.
  • a KRAB repressor domain fused in frame with the TetR repressor domain provides an additional mechanism to accomplish high levels of repression of derepressible promoters.
  • the mammalian cell produces a sufficient amounts of TetR.
  • a“sufficient” of TetR is defined as the level of amount and/or activity of a repressor (e.g., TetR) to stop expression and/or activity of a repressible and/or derepressible element (i.e., prior to addition of doxycycline).
  • TetR As described herein, producing sufficient amounts of TetR is necessary for repression of the derepressible promoters under normal conditions (e.g., before addition of doxycycline). If sufficient amounts of TetR are not produced by the mammalian cell, the cell may prematurely transcribe and translate potentially cytotoxic AAV-packaging nucleic acids.
  • the mammalian cell further comprises stable expression of one or more nucleic acids encoding chicken hypersensitive site-4 (cHS4) flanking the TetR and/or TetR-KRAB repressor sequences.
  • cHS4 sequences flanking the TetR and/or TetR-KRAB repressor sequences prevent the silencing of TetR expression and further improve the stability of integrated repressors in the mammalian cell genome.
  • the treating comprises treating with doxycycline to remove repression of derepressible promoters.
  • each of the first, second and third nucleic acids are flanked by transposon-specific inverted terminal repeats (ITRs).
  • a method for producing an adeno-associated virus comprises stably transfecting a mammalian cell with: a nucleic acid encoding a TetR and/or TetR- KRAB repressor, chicken hypersensitive site-4 (cHS4) sequences flanking the TetR and/or TetR- KRAB repressor, and a selection gene; transfecting the stably transfected mammalian cell with a first nucleic acid encoding an adenovirus helper gene comprising an E2A gene, a E40rf gene and a viral-associated non-coding RNA, under control of a first derepressible promoter, a second nucleic acid encoding an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, and optionally, a third nucleic acid encoding a gene of interest under control of a third derepressible promoter; treating the mammalian cell with: a nucleic acid encoding
  • the mammalian cell further comprises a selection gene, such as a zeocin resistance gene.
  • Additional selection genes include other antibiotic resistance genes, such as kanamycin and geneticin resistance genes. As described herein, expression of a zeocin resistance gene allows for efficient selection of correctly integrated repressors in the mammalian cell genome.
  • Embodiment 1 is a mammalian cell for producing an adeno-associated virus (AAV), comprising a nucleic acid molecule encoding a viral helper gene under control of a first derepressible promoter, a nucleic acid molecule encoding an AAV gene under control of a second derepressible promoter, and a nucleic acid molecule encoding a repressor element of the first and the second derepressible promoters.
  • AAV adeno-associated virus
  • Embodiment 2 includes the mammalian cell of embodiment 1, wherein the mammalian cell is a mammalian cell culture.
  • Embodiment 3 includes the mammalian cell of embodiment 2, wherein the mammalian cell culture is a suspension culture.
  • Embodiment 4 includes the mammalian cell of any one of embodiments 1-3, wherein the viral helper gene is an adenovirus helper gene.
  • Embodiment 5 includes the mammalian cell of embodiment 4, wherein the adenovirus helper gene comprises E2A and E40rf6 genes.
  • Embodiment 6 includes the mammalian cell of embodiment 5, further comprising an internal ribosome entry site (IRES) element between the E2A and E40rf6 genes.
  • IRS internal ribosome entry site
  • Embodiment 7 includes the mammalian cell of any one of embodiments 1-6, wherein the AAV gene comprises Rep and Cap genes.
  • Embodiment 8 includes the mammalian cell of embodiment 7, wherein a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a third derepressible promoter.
  • Embodiment 9 includes the mammalian cell of embodiment 7, wherein a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a third derepressible promoter contained within an artificial intron.
  • Embodiment 10 includes the mammalian cell of any one of embodiments 8 or 9, wherein the Cap gene is under control of a native promoter.
  • Embodiment 11 includes the mammalian cell of any one of embodiments 1-10, wherein each of the derepressible promoters comprise a functional promoter and two tetracycline operator sequences (Tet02).
  • Embodiment 12 includes the mammalian cell of embodiment 11, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • Embodiment 13 includes the mammalian cell of any one of embodiments 1-12, wherein the repressor element is under control of a constitutive promoter.
  • Embodiment 14 includes the mammalian cell of any one of embodiments 1-13, wherein the repressor element is a tetracycline repressor protein.
  • Embodiment 15 includes the mammalian cell of embodiment 14, further comprising a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein.
  • Embodiment 16 includes the mammalian cell of any one of embodiments 1-15, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
  • the mammalian cell is a Chinese hamster ovary (CHO) cell.
  • Embodiment 17 includes the mammalian cell of any one of embodiments 1-15, wherein the mammalian cell is a human cell.
  • Embodiment 18 includes the mammalian cell of embodiment 17, wherein the human cell is a human embryonic kidney (HEK) cell.
  • HEK human embryonic kidney
  • Embodiment 19 includes the mammalian cell of any one of embodiments 1-18, further comprising a nucleic acid molecule including two inverted terminal repeat (ITR) sequences.
  • ITR inverted terminal repeat
  • Embodiment 20 includes the mammalian cell of any one of embodiments 1-19, further comprising a nucleic acid molecule encoding a gene of interest.
  • Embodiment 21 includes the mammalian cell of any one of embodiments 1-20, further comprising a nucleic acid encoding a viral-associated, non-coding RNA under control of a fourth derepressible promoter.
  • Embodiment 22 is a mammalian cell for producing an adeno-associated virus (AAV), comprising a nucleic acid molecule encoding an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter, an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, a viral-associated, non-coding RNA under control of a third depressible promoter, two inverted terminal repeat (ITR) sequences, and a repressor element of the first, second and third derepressible promoters.
  • AAV adeno-associated virus
  • Embodiment 23 includes mammalian cell of embodiment 22, wherein the mammalian cell is a mammalian cell culture.
  • Embodiment 24 includes the mammalian cell of embodiment 23, wherein the mammalian cell culture is a suspension culture.
  • Embodiment 25 includes the mammalian cell of any one of embodiments 22-24, further comprising an internal ribosome entry site (IRES) element between the E2A and E40rf6 genes.
  • IRS internal ribosome entry site
  • Embodiment 26 includes the mammalian cell of any one of embodiments 22-25, wherein a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a fourth derepressible promoter.
  • Embodiment 27 includes the mammalian cell of any one of embodiments 22-25, wherein a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a fourth derepressible promoter contained within an artificial intron.
  • Embodiment 28 includes the mammalian cell of any one of embodiments 26 or 27, wherein the Cap gene is under control of a native promoter.
  • Embodiment 29 includes the mammalian cell of any one of embodiments 22-28, wherein each of the derepressible promoters comprise a functional promoter and two tetracycline operator sequences (Tet02).
  • Embodiment 30 includes the mammalian cell of embodiment 29, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • Embodiment 31 includes the mammalian cell of any one of embodiments 22-30, wherein the repressor element is under control of a constitutive promoter.
  • Embodiment 32 includes the mammalian cell of any one of embodiments 22-31, wherein the repressor element is a tetracycline repressor protein.
  • Embodiment 33 includes the mammalian cell of embodiment 25, further comprising a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein.
  • Embodiment 34 includes the mammalian cell of any one of embodiments 22-33, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
  • Embodiment 35 includes the mammalian cell of any one of embodiments 22-33, wherein the mammalian cell is a human cell.
  • Embodiment 36 includes the mammalian cell embodiment 35, wherein the human cell is a human embryonic kidney (HEK) cell.
  • HEK human embryonic kidney
  • Embodiment 37 includes the mammalian cell of any one of embodiments 22-36, further comprising a nucleic acid molecule encoding a gene of interest.
  • Embodiment 38 is an isolated nucleic acid molecule encoding an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter, an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, a viral- associated, non-coding RNA under control of a third depressible promoter, two inverted terminal repeat (ITR) sequences, and a repressor element of the first, second and third derepressible promoters.
  • adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter, an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, a viral- associated, non-coding RNA under control of a third depressible promoter, two inverted terminal repeat (ITR) sequences, and a repressor element of the first, second and third derepressible promoters.
  • Embodiment 39 includes the isolated nucleic acid of embodiment 38, further comprising an internal ribosome entry site (IRES) element between the E2A and E40rf6 genes.
  • IRS internal ribosome entry site
  • Embodiment 40 includes the isolated nucleic acid of any of embodiments 38-39, wherein a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a fourth derepressible promoter.
  • Embodiment 41 includes the isolated nucleic acid of any of embodiments 38-39 wherein a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a fourth derepressible promoter contained within an artificial intron.
  • Embodiment 42 includes the isolated nucleic acid of any of embodiments 40 or 41, wherein the Cap gene is under control of a native promoter.
  • Embodiment 43 includes the isolated nucleic acid of any of embodiments 38-42, wherein each of the derepressible promoters comprise a functional promoter and two tetracycline operator sequences (Tet02).
  • Embodiment 44 includes the isolated nucleic acid of embodiment 43, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • Embodiment 45 includes the isolated nucleic acid of any of embodiments 38-44, wherein the repressor element is under control of a constitutive promoter.
  • Embodiment 46 includes the isolated nucleic acid of any of embodiments 38-45, wherein the repressor element is a tetracycline repressor protein.
  • Embodiment 47 includes the isolated nucleic acid of embodiment 46, further comprising a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein.
  • Embodiment 48 includes the isolated nucleic acid of any of embodiments 38-47, further comprising a gene of interest.
  • Embodiment 49 is a method of producing an adeno-associated virus (AAV) in a mammalian cell comprising transfecting the mammalian cell with an isolated nucleic acid molecule encoding an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter, an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, a viral-associated, non-coding RNA under control of a third depressible promoter, two inverted terminal repeat (ITR) sequences, and a repressor element of the first, second and third derepressible promoters, treating the mammalian cell with a binding partner of the repressor element, activating the first, second and third derepressible promoters, producing the AAV, and harvesting the AAV.
  • AAV adeno-associated virus
  • Embodiment 50 includes the method of embodiment 49, wherein the mammalian cell is a mammalian cell culture.
  • Embodiment 51 includes the method of embodiment 50, wherein the mammalian cell culture is a suspension culture.
  • Embodiment 52 includes the method of any of embodiments 49-51, further comprising an internal ribosome entry site (IRES) element between the E2A and E40rf6 genes.
  • Embodiment 53 includes the method of any of embodiments 49-52, wherein a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a fourth derepressible promoter.
  • IRS internal ribosome entry site
  • Embodiment 54 includes the method of any of embodiments 49-52, wherein a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a fourth derepressible promoter contained within an artificial intron.
  • Embodiment 55 includes the method of embodiment 54, wherein the fourth derepressible promoter is removed following the activating the derepressible promoters and prior to the producing the AAV.
  • Embodiment 56 includes the method of any of embodiments 53 or 54, wherein the Cap gene is under control of a native promoter.
  • Embodiment 57 includes the method of any of embodiments 49-56, wherein each of the derepressible promoters comprise a functional promoter and two tetracycline operator sequences (Tet02).
  • Embodiment 58 includes the method of embodiment 57, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • Embodiment 59 includes the method of any of embodiments 49-58, wherein the repressor element is under control of a constitutive promoter.
  • Embodiment 60 includes the method of any of embodiments 49-59, wherein the repressor element that is a tetracycline repressor protein.
  • Embodiment 61 includes the method of embodiment 60, wherein the nucleic acid further comprises a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein.
  • Embodiment 62 includes the method of any of embodiments 60 or 61, wherein the treating comprises treating with doxycycline.
  • Embodiment 63 includes the method of any of embodiments 49-62, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
  • Embodiment 64 includes the method of any of embodiments 49-63, wherein the mammalian cell is a human cell.
  • Embodiment 65 includes the method of embodiment 64, wherein the human cell is a human embryonic kidney (HEK) cell.
  • HEK human embryonic kidney
  • Embodiment 66 includes the method of any of embodiments 49-65, wherein the AAV comprises a nucleic acid molecule encoding a gene of interest.
  • Embodiment 67 includes the method of embodiment 66, wherein the AAV comprises a gene of therapeutic interest.
  • Embodiment 68 is a method of treatment with an adeno-associated virus (AAV) comprising transfecting the mammalian cell with an isolated nucleic acid molecule encoding, an adenovirus helper gene comprising E2A and E40rf6 genes under control of a first derepressible promoter, an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, a viral-associated, non-coding RNA under control of a third depressible promoter, two inverted terminal repeat (ITR) sequences; and a repressor element of the first, second and third derepressible promoters; treating the mammalian cell with a binding partner of the repressor element; activating the first, second and third derepressible promoters; producing the AAV; harvesting the AAV; and administering the AAV to a mammalian patient.
  • AAV adeno-associated virus
  • Embodiment 69 includes the method of embodiment 68, wherein the mammalian cell is a mammalian cell culture.
  • Embodiment 70 includes the method of embodiment 69, wherein the mammalian cell culture is a suspension culture.
  • Embodiment 71 includes the method of any of embodiments 68-70, further comprising an internal ribosome entry site (IRES) element between the E2A and E40rf6 genes.
  • Embodiment 72 includes the method of any of embodiments 68-71, wherein a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a fourth derepressible promoter.
  • IRS internal ribosome entry site
  • Embodiment 73 includes the method of any of embodiments 68-72, wherein a Rep78 gene is under control of the second derepressible promoter and a Rep52 gene is under control of a fourth derepressible promoter contained within an artificial intron.
  • Embodiment 74 includes the method of embodiment 73, wherein the fourth derepressible promoter is removed following the activating the derepressible promoters and prior to the producing the AAV.
  • Embodiment 75 includes the method of any of embodiments 73 or 74, wherein the Cap gene is under control of a native promoter.
  • Embodiment 76 includes the method of any of embodiments 68-75, wherein each of the derepressible promoters comprise a functional promoter and two tetracycline operator sequences (TetCh).
  • Embodiment 77 includes the method of embodiment 76, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • Embodiment 78 includes the method of any of embodiments 68-77, wherein the repressor element is under control of a constitutive promoter.
  • Embodiment 79 includes the method of any of embodiments 68-78, wherein the repressor element that is a tetracycline repressor protein.
  • Embodiment 80 includes the method of embodiment 79, wherein the nucleic acid further comprises a nucleic acid encoding a transcriptional repression domain in frame with the nucleic acid encoding the tetracycline repressor protein.
  • Embodiment 81 includes the method of any of embodiments 79 or 80, wherein the treating comprises treating with doxycycline.
  • Embodiment 82 includes the method of any of embodiments 68-81, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
  • Embodiment 83 includes the method of any of embodiments 68-82, wherein the mammalian cell is a human cell.
  • Embodiment 84 includes the method of embodiment 83, wherein the human cell is a human embryonic kidney (HEK) cell.
  • HEK human embryonic kidney
  • Embodiment 85 includes the method of any of embodiments 68-84, wherein the AAV comprises a nucleic acid molecule encoding a gene of interest.
  • Embodiment 86 includes the method of embodiment 87, wherein the AAV comprises a gene of therapeutic interest.
  • Embodiment 87 includes the method of any of embodiments 68-86, wherein the administering comprises inhalation, injection or intravenous administration.
  • Embodiment 88 is a method of producing an adeno-associated (AAV) virus, comprising: transfecting a mammalian cell stably expressing one or more nucleic acids encoding TetR and/or TetR with a first nucleic acid encoding an adenovirus helper gene comprising an E2A gene, a E40rf gene and a viral-associated non-coding RNA under control of a first derepressible promoter, a second nucleic acid encoding an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter, and, optionally, a third nucleic acid encoding a gene of interest under control of a third derepressible promoter; treating the mammalian cell with a binding partner of the TetR and/or TetR-KRAB; activating the first, second and third derepressible promoters; producing the AAV; and harvesting the AAV.
  • AAV adeno-associated
  • Embodiment 89 includes the method of embodiment 88, wherein the mammalian cell is a mammalian cell culture.
  • Embodiment 90 includes the method of any of embodiments 88-89, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
  • Embodiment 91 includes the method of any of embodiments 88-90, wherein the mammalian cell is a human cell.
  • Embodiment 92 includes the method of embodiment 91, wherein the human cell is a human embryonic kidney (HEK) cell.
  • HEK human embryonic kidney
  • Embodiment 93 includes the method of embodiment 89, wherein the mammalian cell culture is a suspension culture.
  • Embodiment 94 includes the method of any of embodiments 88-90, wherein the mammalian cell further comprises an internal ribosome entry site (IRES) element between the E2A and E40rf6 genes.
  • IRS internal ribosome entry site
  • Embodiment 95 includes the method of any of embodiments 88-91, wherein each of the derepressible promoters comprise a functional promoter and two tetracycline operator sequences (TetCh).
  • Embodiment 96 includes the method of embodiment 92, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • Embodiment 97 includes the method of any of embodiments 88-96, wherein the stably expressed TetR and/or TetR-KRAB is under control of a constitutive promoter.
  • Embodiment 98 includes the method of embodiment 97, wherein the nucleic acid encoding the TetR-KRAB comprises KRAB fused in frame with the TetR.
  • Embodiment 99 includes the method of any one of embodiments 88-98, wherein the treating comprises treating with doxycycline.
  • Embodiment 100 includes the method of any one of embodiments 88-99, wherein each of the first, second and third nucleic acids are flanked by transposon-specific inverted terminal repeats (ITRs).
  • ITRs transposon-specific inverted terminal repeats
  • Embodiment 101 includes the method of any of embodiments 88-100, wherein the mammalian cell expresses sufficient amounts of TetR and/or TetR-KRAB.
  • Embodiment 102 includes the method of any of embodiments 88-101, wherein the AAV comprises a gene of therapeutic interest.
  • Embodiment 103 includes the method of any of embodiments 88-102, wherein the mammalian cell further comprises stable expression of one or more nucleic acids encoding chicken hypersensitive site-4 (cHS4) flanking the TetR and/or TetR-KRAB repressor sequences.
  • cHS4 chicken hypersensitive site-4
  • Embodiment 104 includes the method of any of embodiments 88-103, wherein the mammalian cell further comprises a zeocin resistance gene.
  • Embodiment 105 is a method for producing an adeno-associated virus (AAV), comprising: stably transfecting a mammalian cell with: a nucleic acid encoding a TetR and/or TetR-KRAB repressor; chicken hypersensitive site-4 (cHS4) sequences flanking the TetR and/or TetR-KRAB repressor; and a selection gene; transfecting the stably transfected mammalian cell with: a first nucleic acid encoding an adenovirus helper gene comprising an E2A gene, a E40rf gene and a viral-associated non-coding RNA, under control of a first derepressible promoter; a second nucleic acid encoding an AAV gene comprising Rep and Cap genes under control of a second derepressible promoter; and optionally, a third nucleic acid encoding a gene of interest under control of a third derepressible promoter; treating
  • Embodiment 106 includes the method of embodiment 105, wherein the stably transfected mammalian cell produces a sufficient amounts of TetR.
  • Embodiment 107 includes the method of any of embodiments 106 and 107, wherein the KRAB repressor domain is fused in frame with the TetR.
  • a derepressible promoter from the pcDNA4/TO vector was utilized.
  • This promoter includes the complete CMV promoter with an insertion of two Tetracycline operator sequences (TetCh) between the TATA box and transcriptional start site (TSS).
  • TATA box Tetracycline operator sequences
  • TSS transcriptional start site
  • TetR tetracycline repressor protein
  • an Internal Ribosome Entry Site (IRES) element was used to initiate the translation of E40rf6 after E2A in a single expression cassette, driven by a single inducible CMV promoter (FIG. 1).
  • a TetR gene expression cassette is included for the control of the derepressible promoters (see FIG. 1).
  • a constitutive human PGK promoter is used to drive the expression of TetR, followed by an IRES that directs the expression of puromycin N- acetyltransferase used to select the transposon integrated cells (see FIG. 2A).
  • TetR To reduce the potential leaky expression from the derepressible promoters, an enhanced version of TetR was also included (see, e.g., Szulc el al.,“A versatile tool for conditional gene expression and knockdown,” Nature Methods 3: 109-116 (2006)). Briefly, a strong repressive domain of KRAB was fused in-frame to the C-terminal of original TetR, which improves its repressive activity and minimizes basal gene expression before induction. An SV40 Nuclear Localization Signal (NLS) was inserted as well to facilitate the nuclear entry of the larger TetR- KRAB fusion protein (FIG. 2 A, FIGS. 12A-12B).
  • NLS Nuclear Localization Signal
  • AAAAAT AAAC AAAT AGGGGTTCCGCGC AC ATTTCCCCGAAAAGT GCC ACCTGACGT
  • AAAAT GCCGC AAAGGGAAT AAGGGCGAC ACGGAAAT GTT GAAT ACTC AT ACTC
  • pl9-il The sequences for the derepressible promoters including pl9 illustrated schematically in FIG. 6 are provided below: pl9-il
  • an artificial intron was created for the insertion of TetO sites in the Rep78 ORF (FIG. 4C).
  • the chimeric intron between introns from human b-globin and immunoglobulin heavy chain genes was adopted by replacing the non-essential internal sequence with the Tet02 sites (FIG. 7A).
  • the new artificial intron was inserted lbp or 25bp downstream of TATA-2 of pl9 promoter in situ (iRepCap-10 and iRepCapl l) (FIG. 4B and FIG. 7B).
  • the new pl9 promoter with adjacent TetO-containing intron ensured the repression of Rep52 gene expression before induction, while still allowing for the expression of the Rep78 protein after the removal of the intron during mRNA splicing.
  • the efficiency of splicing is evaluated by PCR analysis for the cDNA.
  • HEK293 cells were transfected with one of the vectors plus standard pHelper and pAAV-GFP for AAV production. Three days after transfection, cells were harvested for Rep-Cap protein expression and AAV titer analysis. Western blot analysis revealed various expression levels of Rep and Cap proteins; many maintained similar ratios of Rep78 vs Rep52 as control RepCap vector (FIG. 8 A). qPCR analysis of the AAV titer showed that the designs performed similarly or had higher titers compared to control triple transfection (FIG. 8B).
  • FIGS. 10A-10D show the plasmid constructs used for integration into mammalian cells, suitably HEK293 cells. To facilitate the future addition of specific AAV genes of interest, the AAV-GFP was not included in some of the transfer vectors (FIGS. 10A and 10B).
  • HEK293 cells will be transfected with both the transfer vectors and transposase mRNA and the integrated cell pool will be enriched by puromycin selection.
  • the single cell clones will be isolated and screened for AAV production with and without Dox treatment to activate derepression.
  • GTCCT AAAT GC AC AGCGACGGATTCGCGCT ATTT AGAAAGAGAGAGC AAT ATTT C A
  • ACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATG AGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCAC ATTTCCCCGAAAAGTGCCACCTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCG TTAAATTTTTGTTAAATCAGCTCATTTTAACCAATAGGCCGAAATCGGCAAAATC CCTT AT AAATC AAAAGAAT AGACCGAGAT AGGGTTGAGT GTT GTTCC AGTTTGGAAC AAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTA
  • AAAT GC AC AGCGACGGATTCGCGCT ATTT AGAAAGAGAGAGC AAT ATTTC AAGAAT

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Epidemiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/US2019/067156 2018-12-21 2019-12-18 Adeno-associated virus (aav) producer cell line and related methods Ceased WO2020132059A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP19899841.1A EP3891290A4 (en) 2018-12-21 2019-12-18 ADENO-ASSOCIATED VIRUS (AAV) PRODUCING CELL LINE AND METHODS
SG11202106217TA SG11202106217TA (en) 2018-12-21 2019-12-18 Adeno-associated virus (aav) producer cell line and related methods
CN201980090045.3A CN113396222A (zh) 2018-12-21 2019-12-18 腺相关病毒(aav)生产细胞系和相关方法
JP2021535829A JP7650800B2 (ja) 2018-12-21 2019-12-18 アデノ随伴ウイルス(aav)産生細胞株および関連方法
KR1020217022728A KR20210108423A (ko) 2018-12-21 2019-12-18 아데노 관련 바이러스 (aav) 생산자 세포주 및 관련 방법
IL284219A IL284219A (en) 2018-12-21 2021-06-20 Adeno-associated virus (AAV) cell line generation and related processes
JP2025039219A JP2025102801A (ja) 2018-12-21 2025-03-12 アデノ随伴ウイルス(aav)産生細胞株および関連方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201862783589P 2018-12-21 2018-12-21
US62/783,589 2018-12-21
US201962866092P 2019-06-25 2019-06-25
US62/866,092 2019-06-25

Publications (1)

Publication Number Publication Date
WO2020132059A1 true WO2020132059A1 (en) 2020-06-25

Family

ID=71099162

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/067156 Ceased WO2020132059A1 (en) 2018-12-21 2019-12-18 Adeno-associated virus (aav) producer cell line and related methods

Country Status (8)

Country Link
US (2) US11739347B2 (enExample)
EP (1) EP3891290A4 (enExample)
JP (2) JP7650800B2 (enExample)
KR (1) KR20210108423A (enExample)
CN (1) CN113396222A (enExample)
IL (1) IL284219A (enExample)
SG (1) SG11202106217TA (enExample)
WO (1) WO2020132059A1 (enExample)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112501209A (zh) * 2020-12-07 2021-03-16 和元生物技术(上海)股份有限公司 外源基因可控表达的腺相关病毒包装方法
WO2022026927A1 (en) * 2020-07-30 2022-02-03 Shape Therapeutics Inc. Stable cell lines for inducible production of raav virions
WO2022079083A1 (en) * 2020-10-15 2022-04-21 F. Hoffmann-La Roche Ag Nucleic acid constructs for va rna transcription
JPWO2022172986A1 (enExample) * 2021-02-12 2022-08-18
JPWO2023054671A1 (enExample) * 2021-09-30 2023-04-06
WO2023171698A1 (ja) 2022-03-08 2023-09-14 富士フイルム株式会社 プロデューサー細胞、プロデューサー細胞の製造方法、およびアデノ随伴ウイルスの製造方法
WO2025168663A1 (en) 2024-02-09 2025-08-14 F. Hoffmann-La Roche Ag Method for producing recombinant adeno-associated viral particles
WO2025252480A1 (en) 2024-06-07 2025-12-11 F. Hoffmann-La Roche Ag Method for purifying plasmid dna
WO2026022064A1 (en) 2024-07-22 2026-01-29 F. Hoffmann-La Roche Ag Novel aav rep orfs and rep polypeptides
WO2026037757A1 (en) 2024-08-13 2026-02-19 F. Hoffmann-La Roche Ag Modified aav particles
EP4578943A4 (en) * 2022-08-25 2026-02-25 Fujifilm Corp PROCESS FOR TARGETING VIRUS PRODUCTION AND CULTURE COMPOSITION
EP4473123A4 (en) * 2022-02-01 2026-03-11 Shape Therapeutics Inc STABLE CELL LINES FOR INDUCIBLE VAAR VIRION PRODUCTION

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4322975A4 (en) * 2021-04-14 2025-03-26 Capsida, Inc. PLASMIDS AND PROCESSES FOR PRODUCING ADENO-ASSOCIATED VIRUSES
TW202323529A (zh) * 2021-10-18 2023-06-16 美商再生元醫藥公司 包括腺病毒相關病毒聚核苷酸的真核細胞
WO2024143429A1 (ja) * 2022-12-27 2024-07-04 株式会社シンプロジェン ヘルパー遺伝子制御
US12410436B2 (en) * 2023-10-31 2025-09-09 Lonza Houston, Inc. Adeno-associated virus (AAV) producer cell lines
WO2025122676A1 (en) * 2023-12-05 2025-06-12 Shape Therapeutics Inc. Systems and methods for raav production using a biphasic culture
CN118460545B (zh) * 2024-07-08 2025-02-11 凌意(杭州)生物科技有限公司 一种诱导型表达Rep多肽的表达框
WO2026044087A1 (en) * 2024-08-21 2026-02-26 Shape Therapeutics Inc. Increased cellular stability for aav production

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018192982A2 (en) * 2017-04-18 2018-10-25 Glaxosmithkline Intellectual Property Development Limited Methods for adeno-associated viral vector production

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5622856A (en) 1995-08-03 1997-04-22 Avigen High efficiency helper system for AAV vector production
US6037177A (en) * 1997-08-08 2000-03-14 Cell Genesys, Inc. Method for increasing the efficiency of recombinant AAV production
JP2002153278A (ja) * 2000-11-22 2002-05-28 Hisamitsu Pharmaceut Co Inc ウイルスベクターの製造に用いられる細胞、その製法およびその細胞を用いたウイルスベクターの製造方法
US8067156B2 (en) * 2001-05-31 2011-11-29 The Rockefeller University Method for generating replication defective viral vectors that are helper free
AU2002367943A1 (en) * 2001-12-18 2003-12-22 University Of North Carolina At Chapel Hill Improved reagents and methods for producing parvoviruses
EP1844148A2 (en) 2005-01-31 2007-10-17 University of Iowa Research Foundation Nucleic acid silencing of huntington's disease gene
WO2011126808A2 (en) * 2010-03-29 2011-10-13 The Trustees Of The University Of Pennsylvania Pharmacologically induced transgene ablation system
CN106062185A (zh) 2014-04-24 2016-10-26 美天旎生物技术有限公司 用于自动生成遗传修饰的t细胞的方法
EP3271462A4 (en) * 2015-03-16 2018-08-29 Board of Trustees, Southern Illinois University System for stable gene expression
US20190367876A1 (en) 2017-01-18 2019-12-05 F1 Oncology, Inc. Methods of transducing and expanding immune cells and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018192982A2 (en) * 2017-04-18 2018-10-25 Glaxosmithkline Intellectual Property Development Limited Methods for adeno-associated viral vector production

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HUANG M-M, HEARING P: "Adenovirus early region 4 encodes two gene products with redundant effects in lytic infection", JOURNAL OF VIROLOGY, vol. 63, no. 6, 1 June 1989 (1989-06-01), US , pages 2605 - 2615, XP003011435, ISSN: 0022-538X
J. TORDO, C. O'LEARY, A. S. L. M. ANTUNES, N. PALOMAR, P. ALDRIN-KIRK, M. BASCHE, A. BENNETT, Z. D'SOUZA, H. GLEITZ, A. GODWIN, R.: "A novel adeno-associated virus capsid with enhanced neurotropism corrects a lysosomal transmembrane enzyme deficiency", BRAIN, vol. 141, no. 7, 16 May 2018 (2018-05-16) - July 2018 (2018-07-01), pages 2014 - 2031, XP055478182 *
MITSUHIRO MACHITANI; KAZUFUMI KATAYAMA; FUMINORI SAKURAI; HAYATO MATSUI; TOMOKO YAMAGUCHI; TAKAYUKI SUZUKI; HIROYUKI MIYOSHI; KENJ: "Development of an adenovirus vector lacking the expression of virus-associated RNAs", JOURNAL OF CONTROLLED RELEASE, vol. 154, no. 3, 7 June 2011 (2011-06-07), AMSTERDAM, NL , pages 285 - 289, XP028285879, ISSN: 0168-3659, DOI: 10.1016/j.jconrel.2011.06.020
U. DEUSCHLE , V. K. MEYER, H. J. THIESEN: "Tetracycline-reversible silencing of eukaryotic promoters", MOL CELL BIOL., vol. 15, no. 4, 1995, pages 1907 - 14, XP002912539 *
ZHOU, H. BEAUDET, A.L.: "A New Vector System with Inducible E2a Cell Line for Production of Higher Titer and Safer Adenoviral Vectors", VIROLOGY, vol. 275, no. 2, 30 September 2000 (2000-09-30), AMSTERDAM, NL , pages 348 - 357, XP004435894, ISSN: 0042-6822, DOI: 10.1006/viro.2000.0515

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022026927A1 (en) * 2020-07-30 2022-02-03 Shape Therapeutics Inc. Stable cell lines for inducible production of raav virions
JP2023536148A (ja) * 2020-07-30 2023-08-23 シェイプ セラピューティクス インク. Raavウイルス粒子の誘導産生のための安定な細胞株
JP2023546116A (ja) * 2020-10-15 2023-11-01 エフ. ホフマン-ラ ロシュ アーゲー Va rna転写のための核酸構築物
WO2022079083A1 (en) * 2020-10-15 2022-04-21 F. Hoffmann-La Roche Ag Nucleic acid constructs for va rna transcription
US12312606B2 (en) 2020-10-15 2025-05-27 Hoffmann-La Roche Inc. Nucleic acid constructs for VA RNA transcription
CN112501209A (zh) * 2020-12-07 2021-03-16 和元生物技术(上海)股份有限公司 外源基因可控表达的腺相关病毒包装方法
CN112501209B (zh) * 2020-12-07 2024-02-13 和元生物技术(上海)股份有限公司 外源基因可控表达的腺相关病毒包装方法
WO2022172986A1 (ja) 2021-02-12 2022-08-18 富士フイルム株式会社 アデノ随伴ウイルスを産生するためのキットおよびその利用
JPWO2022172986A1 (enExample) * 2021-02-12 2022-08-18
JPWO2023054671A1 (enExample) * 2021-09-30 2023-04-06
EP4410971A4 (en) * 2021-09-30 2025-06-04 FUJIFILM Corporation METHOD FOR PRODUCING AN ADENO-ASSOCIATED VIRUS, CELLS AND EXPRESSION VECTOR
EP4473123A4 (en) * 2022-02-01 2026-03-11 Shape Therapeutics Inc STABLE CELL LINES FOR INDUCIBLE VAAR VIRION PRODUCTION
WO2023171698A1 (ja) 2022-03-08 2023-09-14 富士フイルム株式会社 プロデューサー細胞、プロデューサー細胞の製造方法、およびアデノ随伴ウイルスの製造方法
EP4578943A4 (en) * 2022-08-25 2026-02-25 Fujifilm Corp PROCESS FOR TARGETING VIRUS PRODUCTION AND CULTURE COMPOSITION
WO2025168663A1 (en) 2024-02-09 2025-08-14 F. Hoffmann-La Roche Ag Method for producing recombinant adeno-associated viral particles
WO2025252480A1 (en) 2024-06-07 2025-12-11 F. Hoffmann-La Roche Ag Method for purifying plasmid dna
WO2026022064A1 (en) 2024-07-22 2026-01-29 F. Hoffmann-La Roche Ag Novel aav rep orfs and rep polypeptides
WO2026037757A1 (en) 2024-08-13 2026-02-19 F. Hoffmann-La Roche Ag Modified aav particles

Also Published As

Publication number Publication date
US12529074B2 (en) 2026-01-20
US20240018545A1 (en) 2024-01-18
JP7650800B2 (ja) 2025-03-25
SG11202106217TA (en) 2021-07-29
US20200199627A1 (en) 2020-06-25
IL284219A (en) 2021-08-31
EP3891290A1 (en) 2021-10-13
CN113396222A (zh) 2021-09-14
EP3891290A4 (en) 2022-11-02
KR20210108423A (ko) 2021-09-02
JP2025102801A (ja) 2025-07-08
US11739347B2 (en) 2023-08-29
JP2022516004A (ja) 2022-02-24

Similar Documents

Publication Publication Date Title
US12529074B2 (en) Adeno-associated virus (AAV) producer cell line and related methods
US20220259572A1 (en) Adeno-associated virus (aav) production
US10858631B2 (en) Methods for adeno-associated viral vector production
US9896665B2 (en) Proviral plasmids and production of recombinant adeno-associated virus
WO1999047691A1 (en) Compositions and methods for helper-free production of recombinant adeno-associated viruses
US20230159953A1 (en) Closed-ended, linear, duplex adenoassociated virus dna, and uses thereof
GB2566572A (en) Methods for adeno-associated viral vector production
EP4229205B1 (en) Nucleic acid constructs for va rna transcription
US12410436B2 (en) Adeno-associated virus (AAV) producer cell lines
JP2024501223A (ja) 低レベルのva-rnaを有する産生細胞
EP4389880A1 (en) Method of obtaining a modified adeno-associated virus capsid
AU2024371130A1 (en) Adeno-associated virus (aav) producer cell lines
US20260022401A1 (en) Novel AAV rep ORFs and Rep polypeptides
WO2026003353A1 (en) Genetic constructs for improved aav titers and potency
EP4671265A1 (en) GENETIC CONSTRUCTIONS FOR ENHANCED AAV TITLES AND ASSOCIATED USEFUL POWER
JP2025516117A (ja) Aavゲノムを決定するための方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19899841

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021535829

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019899841

Country of ref document: EP

Effective date: 20210705

ENP Entry into the national phase

Ref document number: 20217022728

Country of ref document: KR

Kind code of ref document: A